Molecular differences between species of the M. tuberculosis complex

Abstract

Specific genetic deletions are identified in mycobacteria isolates, including variations in the M. tuberculosis genome sequence between isolates, and numerous deletion present in BCG as compared to M. tb. These deletions are used as markers to distinguish between pathogenic and avirulent strains, and as a marker for particular M. tb isolates. Deletions specific to vaccine strains of BCG are useful in determining whether a positive tuberculin skin test is indicative of actual tuberculosis infection. The deleted sequences may be re-introduced into BCG to improve the efficacy of vaccination. Alternatively, the genetic sequence that corresponds to the deletion(s) are deleted from M. bovis or M. tuberculosis to attenuate the pathogenic bacteria.

Description

Tuberculosis is an ancient human scourge that continues to be an important public health problem worldwide. It is an ongoing epidemic of staggering proportions. Approximately one in every three people in the world is infected with Mycobacterium tuberculosis, and has a 10% lifetime risk of progressing from infection to clinical disease. Although tuberculosis can be treated, an estimated 2.9 million people died from the disease last year.

There are significant problems with a reliance on drug treatment to control active M. tuberculosis infections. Most of the regions having high infection rates are less developed countries, which suffer from a lack of easily accessible health services, diagnostic facilities and suitable antibiotics against M. tuberculosis . Even where these are available, patient compliance is often poor because of the lengthy regimen required for complete treatment, and multidrug-resistant strains are increasingly common.

Prevention of infection would circumvent the problems of treatment, and so vaccination against tuberculosis is widely performed in endemic regions. Around 100 million people a year are vaccinated with live bacillus Calmette-Guerin (BCG) vaccine. BCG has the great advantage of being inexpensive and easily administered under less than optimal circumstances, with few adverse reactions. Unfortunately, the vaccine is widely variable in its efficacy, providing anywhere from 0 to 80% protection against infection with M. tuberculosis .

BCG has an interesting history. It is an attenuated strain of M. bovis , a very close relative of M. tuberculosis . The M. bovis strain that became BCG was isolated from a cow in the late 1800's by a bacteriologist named Nocard, hence it was called Nocard's bacillus. The attenuation of Nocard's bacillus took place from 1908 to 1921, over the course of 230 in vitro passages. Thereafter, it was widely grown throughout the world, resulting in additional hundreds and sometime thousands of in vitro passages. Throughout its many years in the laboratory, there has been selection for cross-reaction with the tuberculin skin test, and for decreased side effects. The net result has been a substantially weakened pathogen, which may be ineffective in raising an adequate immune response.

New antituberculosis vaccines are urgently needed for the general population in endemic regions, for HIV-infected individuals, as well as health care professionals likely to be exposed to tubercle bacilli. Recombinant DNA vaccines bearing protective genes from virulent M. tuberculosis are being developed using shuttle plasmids to transfer genetic material from one mycobacterial species to another, for example see U.S. Pat. No. 5,776,465. Tuberculosis vaccine development should be given a high priority in current medical research goals.

Relevant literature

Mahairas et al. (1996) J Bacteriol 178(5):1274-1282 provides a molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis . Subtractive genomic hybridization was used to identify genetic differences between virulent M. bovis and M. tuberculosis and avirulent BCG. U.S. Pat. No. 5,700,683 is directed to these genetic differences.

Cole et al. (1998) Nature 393:537-544 have described the complete genome of M. tuberculosis . To obtain the contiguous genome sequence, a combined approach was used that involved the systematic sequence analysis of selected large-insert clones as well as random small-insert clones from a whole-genome shotgun library. This culminated in a composite sequence of 4,411,529 base pairs, with a G+C content of 65.6%. 3,924 open reading frames were identified in the genome, accounting for ˜91% of the potential coding capacity.

Mycobacterium tuberculosis (M.tb.) genomic sequence is available at several internet sites.

SUMMARY OF THE INVENTION

Genetic markers are provided that distinguish between strains of the Mycobacterium tuberculosis complex, particularly between avirulent and virulent strains. Strains of interest include M. bovis, M. bovis BCG strains, M. tuberculosis ( M. tb. ) isolates, and bacteriophages that infect mycobacteria. The genetic markers are used for assays, e.g. immunoassays, that distinguish between strains, such as to differentiate between BCG immunization and M. tb. infection. The protein products may be produced and used as an immunogen, in drug screening, etc. The markers are useful in constructing genetically modified M. tb or M. bovis cells having improved vaccine characteristics.

DETAILED DESCRIPTION OF THE EMBODIMENTS

Specific genetic deletions are identified that serve as markers to distinguish between avirulent and virulent mycobacteria strains, including M. bovis, M. bovis BCG strains, M. tuberculosis ( M. tb. ) isolates, and bacteriophages that infect mycobacteria. These deletions are used as genetic markers to distinguish between the different mycobacteria. The deletions may be introduced into M. tb. or M. bovis by recombinant methods in order to render a pathogenic strain avirulent. Alternatively, the deleted genes are identified in the M. tb. genome sequence, and are then reintroduced by recombinant methods into BCG or other vaccine strains, in order to improve the efficacy of vaccination.

The deletions of the invention are identified by comparative DNA hybridizations from genomic sequence of mycobacterium to a DNA microarray comprising representative sequences of the M. tb. coding sequences. The deletions are then mapped to the known M. tb. genome sequence in order to specifically identify the deleted gene(s), and to characterize nucleotide sequence of the deleted region.

Nucleic acids comprising the provided deletions and junctions are used in a variety of applications. Hybridization probes may be obtained from the known M. tb. sequence which correspond to the deleted sequences. Such probes are useful in distinguishing between mycobacteria. For example, there is a 10% probability that an M. tb. infected person will progress to clinical disease, but that probability may vary depending of the particular infecting strain. Analysis for the presence or absence of the deletions provided below as “M. tb variable ” is used to distinguish between different M. tb strains. The deletions are also useful in identifying whether a patient that is positive for a tuberculin skin test has been infected with M. tb or with BCG.

In another embodiment of the invention, mycobacteria are genetically altered to delete sequences identified herein as absent in attenuated strains, but present in pathogenic strains, e.g. deletions found in BCG but present in M. tb H37Rv. Such genetically engineered strains may provide superior vaccines to the present BCG isolates in use. Alternatively, BCG strains may be “reconstructed ” to more closely resemble wild-type M. tb by inserting certain of the deleted sequences back into the genome. Since the protein products of the deleted sequences are expressed in virulent mycobacterial species, the encoded proteins are useful as immunogens for vaccination.

The attenuation (loss of virulence) in BCG is attributed to the loss of genetic material at a number of places throughout the genome. The selection over time for fewer side-effects resulting from BCG immunization, while retaining cross-reactivity with the tuberculin skin test, has provided an excellent screen for those sequences that engender side effects. The identification of deletions that vary between BCG isolates identifies such sequences, which may be used in drug screening and biological analysis for the role of the deleted genes in causing untoward side effects and pathogenicity.

Identification of M. Tuberculosis Complex Deletion Markers

The present invention provides nucleic acid sequences that are markers for specific mycobacteria, including M. tb., M. bovis , BCG and bacteriophage. The deletions are listed in Table 1. The absence or presence of these marker sequences is characteristic of the indicated isolate, or strain. As such, they provide a unique characteristic for the identification of the indicated mycobacteria. The deletions are identified by their M. tb . open reading frame (“Rv ” nomenclature), which corresponds to a known genetic sequence, and may be accessed as previously cited. The junctions of the deletions are provided by the designation of position in the publicly available M. tb. sequence.

TABLE 1
SEQ ID	rd	rv_num	orf_id	breakpoint
SEQ ID	RD01	Rv3871	MTV027.06	“H37Rv, segment
NO: 1				160: 7534, 16989”
SEQ ID	RD01	Rv3872	MTV027.07	“H37Rv, segment
NO: 2				160: 7534, 16989”
SEQ ID	RD01	Rv3873	MTV027.08	“H37Rv, segment
NO: 3				160: 7534, 16989”
SEQ ID	RD01	Rv3874	MTV027.09	“H37Rv, segment
NO: 4				160: 7534, 16989”
SEQ ID	RD01	Rv3875	MTV027.10	“H37Rv, segment
NO: 5				160: 7534, 16989”
SEQ ID	RD01	Rv3876	MTV027.11	“H37Rv, segment
NO: 6				160: 7534, 16989”
SEQ ID	RD01	Rv3877	MTV027.12	“H37Rv, segment
NO: 7				160: 7534, 16989”
SEQ ID	RD01	Rv3878	MTV027.13	“H37Rv, segment
NO: 8				160: 7534, 16989”
SEQ ID	RD01	Rv3879c	MTV027.14c	“H37Rv, segment
NO: 9				160: 7534, 16989”
SEQ ID	RD02	Rv1988	MTCY39.31c	“H37Rv segment
NO: 10				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1987	MTCY39.32c	“H37Rv segment
NO: 11				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1986	MTCY39.33c	“H37Rv segment
NO: 12				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1985c	MTCY39.34	“H37Rv segment
NO: 13				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1984c	MTCY39.35	“H37Rv segment
NO: 14				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1983	MTCY39.36c	“H37Rv segment
NO: 15				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1982c	MTCY39.37	“H37Rv segment
NO: 16				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1981c	MTCY39.38	“H37Rv segment
NO: 17				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1980c	MTCY39.39	“H37Rv segment
NO: 18				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1979c	MTCY39.40	“H37Rv segment
NO: 19				88: 14211, segment
				89: 8598”
SEQ ID	RD02	Rv1978	MTV051.16	“H37Rv segment
NO: 20				88: 14211, segment
				89: 8598”
SEQ ID	RD03	Rv1586c	MTCY336.18	“H37Rv, segment
NO: 21				70: 7677, 16923”
SEQ ID	RD03	Rv1585c	MTCY336.19	“H37Rv, segment
NO: 22				70: 7677, 16923”
SEQ ID	RD03	Rv1584c	MTCY336.20	“H37Rv, segment
NO: 23				70: 7677, 16923”
SEQ ID	RD03	Rv1583c	MTCY336.21	“H37Rv, segment
NO: 24				70: 7677, 16923”
SEQ ID	RD03	Rv1582c	MTCY336.22	“H37Rv, segment
NO: 25				70: 7677, 16923”
SEQ ID	RD03	Rv1581c	MTCY336.23	“H37Rv, segment
NO: 26				70: 7677, 16923”
SEQ ID	RD03	Rv1580c	MTCY336.24	“H37Rv, segment
NO: 27				70: 7677, 16923”
SEQ ID	RD03	Rv1579c	MTCY336.25	“H37Rv, segment
NO: 28				70: 7677, 16923”
SEQ ID	RD03	Rv1578c	MTCY336.26	“H37Rv, segment
NO: 29				70: 7677, 16923”
SEQ ID	RD03	Rv1577c	MTCY336.27	“H37Rv, segment
NO: 30				70: 7677, 16923”
SEQ ID	RD03	Rv1576c	MTCY336.28	“H37Rv, segment
NO: 31				70: 7677, 16923”
SEQ ID	RD03	Rv1575	MTCY336.29c	“H37Rv, segment
NO: 32				70: 7677, 16923”
SEQ ID	RD03	Rv1574	MTCY336.30c	“H37Rv, segment
NO: 33				70: 7677, 16923”
SEQ ID	RD03	Rv1573	MTCY336.31c	“H37Rv, segment
NO: 34				70: 7677, 16923”
SEQ ID	RD04	Rv0221	MTCY08D5.16	“H37Rv, segment
NO: 35				12: 17432, 19335”
SEQ ID	RD04	Rv0222	MTCY08D5.17	“H37Rv, segment
NO: 36				12: 17432, 19335”
SEQ ID	RD04	Rv0223c	MTCY08D5.18	“H37Rv, segment
NO: 37				12: 17432, 19335”
SEQ ID	RD05	Rv3117	MTCY164.27	“H37Rv, segment
NO: 38				135: 27437, 30212”
SEQ ID	RD05	Rv3118	MTCY164.28	“H37Rv, segment
NO: 39				135: 27437, 30212”
SEQ ID	RD05	Rv3119	MTCY164.29	“H37Rv, segment
NO: 40				135: 27437, 30212”
SEQ ID	RD05	Rv3120	MTCY164.30	“H37Rv, segment
NO: 41				135: 27437, 30212”
SEQ ID	RD05	Rv3121	MTCY164.31	“H37Rv, segment
NO: 42				135: 27437, 30212”
SEQ ID	RD06	Rv1506c	MTCY277.28c	“H37Rv, segment
NO: 43				65: 23614, 36347”
SEQ ID	RD06	Rv1507c	MTCY277.29c	“H37Rv, segment
NO: 44				65: 23614, 36347”
SEQ ID	RD06	Rv1508c	MTCY277.30c	“H37Rv, segment
NO: 45				65: 23614, 36347”
SEQ ID	RD06	Rv1509	MTCY277.31	“H37Rv, segment
NO: 46				65: 23614, 36347”
SEQ ID	RD06	Rv1510	MTCY277.32	“H37Rv, segment
NO: 47				65: 23614, 36347”
SEQ ID	RD06	Rv1511	MTCY277.33	“H37Rv, segment
NO: 48				65: 23614, 36347”
SEQ ID	RD06	Rv1512	MTCY277.34	“H37Rv, segment
NO: 49				65: 23614, 36347”
SEQ ID	RD06	Rv1513	MTCY277.35	“H37Rv, segment
NO: 50				65: 23614, 36347”
SEQ ID	RD06	Rv1514c	MTCY277.36c	“H37Rv, segment
NO: 51				65: 23614, 36347”
SEQ ID	RD06	Rv1515c	MTCY277.37c	“H37Rv, segment
NO: 52				65: 23614, 36347”
SEQ ID	RD06	Rv1516c	MTCY277.38c	“H37Rv, segment
NO: 53				65: 23614, 36347”
SEQ ID	RD07	Rv2346c	MTCY98.15c	“H37Rv, segment
NO: 54				103: 17622, 26584”
SEQ ID	RD07	Rv2347c	MTCY98.16c	“H37Rv, segment
NO: 55				103: 17622, 26584”
SEQ ID	RD07	Rv2348c	MTCY98.17c	“H37Rv, segment
NO: 56				103: 17622, 26584”
SEQ ID	RD07	Rv2349c	MTCY98.18c	“H37Rv, segment
NO: 57				103: 17622, 26584”
SEQ ID	RD07	Rv2350c	MTCY98.19c	“H37Rv, segment
NO: 58				103: 17622, 26584”
SEQ ID	RD07	Rv2351c	MTCY98.20c	“H37Rv, segment
NO: 59				103: 17622, 26584”
SEQ ID	RD07	Rv2352c	MTCY98.21c	“H37Rv, segment
NO: 60				103: 17622, 26584”
SEQ ID	RD07	Rv2353c	MTCY98.22c	“H37Rv, segment
NO: 61				103: 17622, 26584”
SEQ ID	RD08	Rv0309	MTCY63.14	“H37Rv, segment
NO: 62				16: 17018, 20446”
SEQ ID	RD08	Rv0310c	MTCY63.15c	“H37Rv, segment
NO: 63				16: 17018, 20446”
SEQ ID	RD08	Rv0311	MTCY63.16	“H37Rv, segment
NO: 64				16: 17018, 20446”
SEQ ID	RD08	Rv0312	MTCY63.17	“H37Rv, segment
NO: 65				16: 17018, 20446”
SEQ ID	RD09	Rv3623	MTCY15C10.29c	“H37Rv, segment
NO: 66				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3622c	MTCY15C10.30	“H37Rv, segment
NO: 67				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3621c	MTCY15C10.31	“H37Rv, segment
NO: 68				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3620c	MTCY15C10.32	“H37Rv, segment
NO: 69				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3619c	MTCY15C10.33	“H37Rv, segment
NO: 70				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3618	MTCY15C10.34c	“H37Rv, segment
NO: 71				153: 21131,
				segment 154: 2832”
SEQ ID	RD09	Rv3617	MTCY15C10.35c	“H37Rv, segment
NO: 72				153: 21131,
				segment 154: 2832”
SEQ ID	RD10	Rv1257c	MTCY50.25	“H37Rv, segment
NO: 73				55: 3689, 6696”
SEQ ID	RD10	Rv1256c	MTCY50.26	“H37Rv, segment
NO: 74				55: 3689, 6696”
SEQ ID	RD10	Rv1255c	MTCY50.27	“H37Rv, segment
NO: 75				55: 3689, 6696”
SEQ ID	RD11	Rv3429	MTCY77.01	“H37Rv, segment
NO: 76				145: 30303 to
				segment 146: 1475”
SEQ ID	RD11	Rv3428c	MTCY78.01	“H37Rv, segment
NO: 77				145: 30303 to
				segment 146: 1475”
SEQ ID	RD11	Rv3427c	MTCY78.02	“H37Rv, segment
NO: 78				145: 30303 to
				segment 146: 1475”
SEQ ID	RD11	Rv3426	MTCY78.03c	“H37Rv, segment
NO: 79				145: 30303 to
				segment 146: 1475”
SEQ ID	RD11	Rv3425	MTCY78.04c	“H37Rv, segment
NO: 80				145: 30303 to
				segment 146: 1475”
SEQ ID	RD12	Rv2072c	MTCY49.11c	“H37Rv segment
NO: 81				93: 9301, 11331”
SEQ ID	RD12	Rv2073c	MTCY49.12c	“H37Rv segment
NO: 82				93: 9301, 11331”
SEQ ID	RD12	Rv2074	MTCY49.13	“H37Rv segment
NO: 83				93: 9301, 11331”
SEQ ID	RD12	Rv2075c	MTCY49.14c	“H37Rv segment
NO: 84				93: 9301, 11331”
SEQ ID	RD13bis	Rv2645	MTCY441.15	“H37Rv segment
NO: 85				118: 12475, 23455”
SEQ ID	RD13bis	Rv2646	MTCY441.16	“H37Rv segment
NO: 86				118: 12475, 23455”
SEQ ID	RD13bis	Rv2647	MTCY441.17	“H37Rv segment
NO: 87				118: 12475, 23455”
SEQ ID	RD13bis	Rv2648	MTCY441.17A	“H37Rv segment
NO: 88				118: 12475, 23455”
SEQ ID	RD13bis	Rv2649	MTCY441.18	“H37Rv segment
NO: 89				118: 12475, 23455”
SEQ ID	RD13bis	Rv2650c	MTCY441.19	“H37Rv segment
NO: 90				118: 12475, 23455”
SEQ ID	RD13bis	Rv2651c	MTCY441.20c	“H37Rv segment
NO: 91				118: 12475, 23455”
SEQ ID	RD13bis	Rv2652c	MTCY441.21c	“H37Rv segment
NO: 92				118: 12475, 23455”
SEQ ID	RD13bis	Rv2653c	MTCY441.22c	“H37Rv segment
NO: 93				118: 12475, 23455”
SEQ ID	RD13bis	Rv2654c	MTCY441.23c	“H37Rv segment
NO: 94				118: 12475, 23455”
SEQ ID	RD13bis	Rv2655c	MTCY441.24c	“H37Rv segment
NO: 95				118: 12475, 23455”
SEQ ID	RD13bis	Rv2656c	MTCY441.25c	“H37Rv segment
NO: 96				118: 12475, 23455”
SEQ ID	RD13bis	Rv2657c	MTCY441.26c	“H37Rv segment
NO: 97				118: 12475, 23455”
SEQ ID	RD13bis	Rv2658c	MTCY441.27c	“H37Rv segment
NO: 98				118: 12475, 23455”
SEQ ID	RD13bis	Rv2659c	MTCY441.28c	“H37Rv segment
NO: 99				118: 12475, 23455”
SEQ	RD13bis	Rv2660c	MTCY441.29c	“H37Rv segment
ID NO:				118: 12475, 23455”
100
SEQ	RD14	Rv1766	MTCY28.32	“H37Rv, segment
ID NO:				79: 30573, 39642”
101
SEQ	RD14	Rv1767	MTCY28.33	“H37Rv, segment
ID NO:				79: 30573, 39642”
102
SEQ	RD14	Rv1768	MTCY28.34	“H37Rv, segment
ID NO:				79: 30573, 39642”
103
SEQ	RD14	Rv1769	MTCY28.35	“H37Rv, segment
ID NO:				79: 30573, 39642”
104
SEQ	RD14	Rv1770	MTCY28.36	“H37Rv, segment
ID NO:				79: 30573, 39642”
105
SEQ	RD14	Rv1771	MTCY28.37	“H37Rv, segment
ID NO:				79: 30573, 39642”
106
SEQ	RD14	Rv1772	MTCY28.38	“H37Rv, segment
ID NO:				79: 30573, 39642”
107
SEQ	RD14	Rv1773c	MTCY28.39	“H37Rv, segment
ID NO:				79: 30573, 39642”
108
SEQ	RD15	Rv1763c	MTV051.01c	“H37Rv, segment
ID NO:				88: 1153, 13873”
109
SEQ	RD15	Rv1764	MTV051.02	“H37Rv, segment
ID NO:				88: 1153, 13873”
110
SEQ	RD15	Rv1765	MTV051.03	“H37Rv, segment
ID NO:				88: 1153, 13873”
111
SEQ	RD15	Rv1766	MTV051.04	“H37Rv, segment
ID NO:				88: 1153, 13873”
112
SEQ	RD15	Rv1767	MTV051.05	“H37Rv, segment
ID NO:				88: 1153, 13873”
113
SEQ	RD15	Rv1768	MTV051.06	“H37Rv, segment
ID NO:				88: 1153, 13873”
114
SEQ	RD15	Rv1769	MTV051.07	“H37Rv, segment
ID NO:				88: 1153, 13873”
115
SEQ	RD15	Rv1770	MTV051.08	“H37Rv, segment
ID NO:				88: 1153, 13873”
116
SEQ	RD15	Rv1771	MTV051.09	“H37Rv, segment
ID NO:				88: 1153, 13873”
117
SEQ	RD15	Rv1772	MTV051.10	“H37Rv, segment
ID NO:				88: 1153, 13873”
118
SEQ	RD15	Rv1773	MTV051.11	“H37Rv, segment
ID NO:				88: 1153, 13873”
119
SEQ	RD15	Rv1774	MTV051.12	“H37Rv, segment
ID NO:				88: 1153, 13873”
120
SEQ	RD15	Rv1775	MTV051.13	“H37Rv, segment
ID NO:				88: 1153, 13873”
121
SEQ	RD15	Rv1776c	MTV051.14	“H37Rv, segment
ID NO:				88: 1153, 13873”
122
SEQ	RD15	Rv1777	MTV051.15	“H37Rv, segment
ID NO:				88: 1153, 13873”
123
SEQ	RD16	Rv3405c	MTCY78.23	“H37Rv, segment
ID NO:				145: 5012, 12621”
124
SEQ	RD16	Rv3404c	MTCY78.24	“H37Rv, segment
ID NO:				145: 5012, 12621”
125
SEQ	RD16	Rv3403c	MTCY78.25	“H37Rv, segment
ID NO:				145: 5012, 12621”
126
SEQ	RD16	Rv3402c	MTCY78.26	“H37Rv, segment
ID NO:				145: 5012, 12621”
127
SEQ	RD16	Rv3401	MTCY78.27c	“H37Rv, segment
ID NO:				145: 5012, 12621”
128
SEQ	RD16	Rv3400	MTCY78.28c	“H37Rv, segment
ID NO:				145: 5012, 12621”
129

The “Rv ” column indicates public M. tb sequence, open reading frame. The BCG

TABLE 2
Strains employed in study of BCG phylogeny
Name of strain	Synonym	Source	Descriptors
BCG-Russia	Moscow	ATCC	# 35740
BCG-Moreau	Brazil	ATCC	# 35736
BCG-Moreau	Brazil	IAF	dated 1958
BCG-Moreau	Brazil	IAF	dated 1961
BCG-Japan	Tokyo	ATCC	# 35737
BCG-Japan	Tokyo	IAF	dated 1961
BCG-Japan	Tokyo	JATA	vaccine strain
BCG-Japan	Tokyo	JATA	bladder cancer strain
BCG-Japan	Tokyo	JATA	clinical isolate-adenitis
BCG-Sweden	Gothenburg	ATCC	# 35732
BCG-Sweden	Gothenburg	IAF	dated 1958
BCG-Sweden	Gothenburg	SSI	production lot, Copenhagen
BCG-Phipps	Philadelphia	ATCC	# 35744
BCG-Denmark	Danish 1331	ATCC	# 35733
BCG-Copenhagen		ATCC	# 27290
BCG-Copenhagen		IAF	dated 1961
BCG-Tice	Chicago	vaccine	dated 1973
BCG-Tice	Chicago	ATCC	# 35743
BCG-Frappier	Montreal	IAF	primary lot, 1973
BCG-Frappier,	Montreal-R	IAF	primary lot, 1973
INH-resistant
BCG-Frappier	Montreal	IAF	passage 946
BCG-Connaught	Toronto	CL	bladder cancer treatment
BCG-Birkhaug		ATCC	# 35731
BCG-Prague	Czech	SSI	lyophilized 1968
BCG-Glaxo		vaccine	dated 1973
BCG-Glaxo		ATCC	# 35741
BCG-Pasteur		IAF	passage 888
BCG-Pasteur		IAF	dated 1961
BCG-Pasteur		IP	1173P2-B
BCG-Pasteur		IP	1173P2-C
BCG-Pasteur		IP	clinical isolate # 1
BCG-Pasteur		IP	clinical isolate # 2
BCG-Pasteur		ATCC	# 35734
Abbreviations:
IP = Institut Pasteur, Paris, France;
IAF = Institut Armand Frappier, Laval, Canada;
AT = American Type Culture Collection, Rockville, Md, USA;
SSI = Statens Serum Institute, Copenhagen, Denmark;
CL = Connaught Laboratories, Willowdale, Canada,
JATA = Japanese Anti-Tuberculosis Association;
INH = isoniazid.
Canadian: BCG's refers to BCG-Montreal and BCG-Toronto, the latter being derived from the former.

In performing the initial screening method, genomic DNA is isolated from two mycobacteria microbial cell cultures. The two DNA preparations are labeled, where a different label is used for the first and second microbial cultures, typically using nucleotides conjugated to a fluorochrome that emits at a wavelength substantially different from that of the fluorochrome tagged nucleotides used to label the selected probe. The strains used were the reference strain of Mycobacterium tuberculosis (H37Rv), other M. tb. laboratory strains, such as H37Ra, the O strain, M. tb. clinical isolates, the reference strain of Mycobacterium bovis, and different strains of Mycobacterium bovis BCG.

The two DNA preparations are mixed, and competitive hybridization is carried out to a microarray representing all of the open reading frames in the genome of the test microbe, usually H37Rv. Hybridization of the labeled sequences is accomplished according to methods well known in the art. In a preferred embodiment, the two probes are combined to provide for a competitive hybridization to a single microarray. Hybridization can be carried out under conditions varying in stringency, preferably under conditions of high stringency (e.g., 4×SSC, 10% SDS, 65° C.) to allow for hybridization of complementary sequences having extensive homology (e.g., having at least 85% sequence identity, preferably at least 90% sequence identity, more preferably having at least 95% sequence identity). Where the target sequences are native sequences the hybridization is preferably carried out under conditions that allow hybridization of only highly homologous sequences (e.g., at least 95% to 100% sequence identity).

Two color fluorescent hybridization is utilized to assay the representation of the unselected library in relation to the selected library (i.e., to detect hybridization of the unselected probe relative to the selected probe). From the ratio of one color to the other, for any particular array element, the relative abundance of that sequence in the unselected and selected libraries can be determined. In addition, comparison of the hybridization of the selected and unselected probes provides an internal control for the assay. An absence of signal from the reference strain, as compared to H37Rv, is indicative that the open reading frame is deleted in the test strain. The deletion may be further mapped by Southern blot analysis, and by sequencing the regions flanking the deletion.

Microarrays can be scanned to detect hybridization of the selected and the unselected sequences using a custom built scanning laser microscope as described in Shalon et al., Genome Res. 6:639 (1996). A separate scan, using the appropriate excitation line, is performed for each of the two fluorophores used. The digital images generated from the scan are then combined for subsequent analysis. For any particular array element, the ratio of the fluorescent signal from the amplified selected cell population DNA is compared to the fluorescent signal from the unselected cell population DNA, and the relative abundance of that sequence in the selected and unselected libraries determined.

Nucleic Acid Compositions

As used herein, the term “deletion marker”, or “marker” is used to refer to those sequences of M. tuberculosis complex genomes that are deleted in one or more of the strains or species, as indicated in Table 1. The bacteria of the M. tuberculosis complex include M. tuberculosis, M. bovis , and BCG, inclusive of varied isolates and strains within each species. Nucleic acids of interest include all or a portion of the deleted region, particularly complete open reading frames, hybridization primers, promoter regions, etc.

The term “junction ” or “deletion junction ” is used to refer to nucleic acids that comprise the regions on both the 3′ and the 5′ sequence immediately flanking the deletion. Such junction sequences are preferably used as short primers, e.g. from about 15 nt to about 30 nt, that specifically hybridize to the junction, but not to a nucleic acid comprising the undeleted genomic sequence. For example, the deletion found in M. bovis , at Rv0221, corresponds to the nucleotide sequence of the M. tuberculosis H37Rv genome, segment 12: 17432,19335. The junction comprises the regions upstream of position 17342, and downstream of 19335, e.g. a nucleic acid of 20 nucleotides comprising the sequence from H37Rv 17332-17342 joined to 19335-19345.

Typically, such nucleic acids comprising a junction will include at least about 7 nucleotides from each flanking region, i.e. from the 3′ and from the 5′ sequence adjacent to the deletion, and may be about 10 nucleotides from each flanking region, up to about 15 nucleotides, or more. Amplification primers that hybridize to the junction sequence, to the deleted sequence, and to the flanking non-deleted regions have a variety of uses, as detailed below.

The nucleic acid compositions of the subject invention encode all or a part of the deletion markers. Fragments may be obtained of the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. For the most part, DNA fragments will be at least about 25 nt in length, usually at least about 30 nt, more usually at least about 50 nt. For use in amplification reactions, such as PCR, a pair of primers will be used. The exact composition of the primer sequences is not critical to the invention, but for most applications the primers will hybridize to the is subject sequence under stringent conditions, as known in the art. It is preferable to chose a pair of primers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt. Algorithms for the selection of primer sequences are generally known, and are available in commercial software packages. Amplification primers hybridize to complementary strands of DNA, and will prime towards each other.

Usually, the DNA will be obtained substantially free of other nucleic acid sequences that do not include a deletion marker sequence or fragment thereof, generally being at least about 50%, usually at least about 90% pure and are typically “recombinant”, i.e. flanked by one or more nucleotides with which it is not normally associated on a naturally occurring chromosome.

For screening purposes, hybridization probes of one or more of the deletion sequences may be used in separate reactions or spatially separated on a solid phase matrix, or labeled such that they can be distinguished from each other. Assays may utilize nucleic acids that hybridize to one or more of the described deletions.

An array may include all or a subset of the deletion markers listed in Table 1. Usually such an array will include at least 2 different deletion marker sequences, ie. deletions located at unique positions within the locus, and may include all of the provided deletion markers. Arrays of interest may further comprise other genetic sequences, particularly other sequences of interest for tuberculosis screening. The oligonucleotide sequence on the array will usually be at least about 12 nt in length, may be the length of the provided deletion marker sequences, or may extend into the flanking regions to generate fragments of 100 to 200 nt in length. For examples of arrays, see Ramsay (1998) Nat. Biotech. 16:40-44; Hacia et al. (1996) Nature Genetics 14:441-447; Lockhart et al. (1996) Nature Biotechnol. 14:1675-1680; and De Risi et al. (1996) Nature Genetics 14:457-460.

Nucleic acids may be naturally occurring, e.g. DNA or RNA, or may be synthetic analogs, as known in the art. Such analogs may be preferred for use as probes because of superior stability under assay conditions. Modifications in the native structure, including alterations in the backbone, sugars or heterocyclic bases, have been shown to increase intracellular stability and binding affinity. Among useful changes in the backbone chemistry are phosphorothioates; phosphorodithioates, where both of the non-bridging oxygens are substituted with sulfur; phosphoroamidites; alkyl phosphotriesters and boranophosphates. Achiral phosphate derivatives include 3′-O′-5′S-phosphorothioate, 3′-S-5′-O-phosphorothioate, 3′-CH 2 -5′-O-phosphonate and 3′-NH-5′-O-phosphoroamidate Peptide nucleic acids replace the entire ribose phosphodiester backbone with a peptide linkage.

Sugar modifications are also used to enhance stability and affinity. The α-anomer of deoxyribose may be used, where the base is inverted with respect to the natural b-anomer. The 2′-OH of the ribose sugar may be altered to form 2′-O-methyl or 2′-O-allyl sugars, which provide resistance to degradation without comprising affinity.

Modification of the heterocyclic bases must maintain proper base pairing. Some useful substitutions include deoxyuridine for deoxythymidine; 5-methyl-2′-deoxycytidine and 5-bromo-2′-deoxycytidine for deoxycytidine. 5- propynyl-2′-deoxyuridine and 5-propynyl-2′-deoxycytidine have been shown to increase affinity and biological activity when substituted for deoxythymidine and deoxycytidine, respectively.

Polypeptide Compositions

The specific deletion markers in Table 1 correspond to open reading frames of the M. tb genome, and therefore encode a polypeptide. The subject markers may be employed for synthesis of a complete protein, or polypeptide fragments thereof, particularly fragments corresponding to functional domains; binding sites; etc.; and including fusions of the subject polypeptides to other proteins or parts thereof. For expression, an expression cassette may be employed, providing for a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. Various transcriptional initiation regions may be employed that are functional in the expression host.

The polypeptides may be expressed in prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression. For large scale production of the protein, a unicellular organism, such as E. coli, B. subtilis, S. cerevisiae, or cells of a higher organism such as vertebrates, particularly mammals, e.g. COS 7 cells, may be used as the expression host cells. Small peptides can also be synthesized in the laboratory.

With the availability of the polypeptides in large amounts, by employing an expression host, the polypeptides may be isolated and purified in accordance with conventional ways. A lysate may be prepared of the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification technique. The purified polypeptide will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure. Pure is intended to mean free of other proteins, as well as cellular debris.

The polypeptide is used for the production of antibodies, where short fragments provide for antibodies specific for the particular polypeptide, and larger fragments or the entire protein allow for the production of antibodies over the surface of the polypeptide. Antibodies may be raised to isolated peptides corresponding to particular domains, or to the native protein.

Antibodies are prepared in accordance with conventional ways, where the expressed polypeptide or protein is used as an immunogen, by itself or conjugated to known immunogenic carriers, e.g. KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like. Various adjuvants may be employed, with a series of injections, as appropriate. For monoclonal antibodies, after one or more booster injections, the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody binding. The immortalized cells, i.e. hybridomas, producing the desired antibodies may then be expanded. For further description, see Monoclonal Antibodies: A Laboratory Manual, Harlow and Lane eds., Cold Spring Harbor Laboratories, Cold Spring Harbor, N.Y. 1988. If desired, the mRNA encoding the heavy and light chains may be isolated and mutagenized by cloning in E. coli, and the heavy and light chains mixed to further enhance the affinity of the antibody. Alternatives to in vivo immunization as a method of raising antibodies include binding to phage “display ” libraries, usually in conjunction with in vitro affinity maturation.

The antibody may be produced as a single chain, instead of the normal multimeric structure. Single chain antibodies are described in Jost et al. (1994) J.B.C. 269:26267-73, and others. DNA sequences encoding the variable region of the heavy chain and the variable region of the light chain are ligated to a spacer encoding at least about 4 amino acids of small neutral amino acids, including glycine and/or serine. The protein encoded by this fusion allows assembly of a functional variable region that retains the specificity and affinity of the original antibody.

Use of Deletion Markers in Identification of Mycobacteria

The deletions provided in Table 1 are useful for the identification of a mycobacterium as (a) variants of M. tb. (b) isolates of BCG (c) M. bovis strains or (d) carrying the identified mycobacterial bacteriophage, depending on the specific marker that is chosen. Such screening is particularly useful in determining whether a particular infection or isolate is pathogenic. The term mycobacteria may refer to any member of the family Mycobacteriacaeae, including M. tuberculosis, M. avium complex, M. kansasii, M. scrofulaceum, M. bovis and M. leprae.

Means of detecting deletions are known in the art. Deletions may be identified through the absence or presence of the sequences in mRNA or genomic DNA, through analysis of junctional regions that flank the deletion, or detection of the gene product, or, particularly relating to the tuberculin skin test, by identification of antibodies that react with the encoded gene product.

While deletions can be easily determined by the absence of hybridization, in many cases it is desirable to have a positive signal, in order to minimize artifactual negative readings. In such cases the deletions may be detected by designing a primer that flanks the junction formed by the deletion. Where the deletion is present, a novel sequence is formed between the flanking regions, which can be detected by hybridization. Preferably such a primer will be sufficiently short that it will only hybridize to the junction, and will fail to form stable hybrids with either of the separate parts of the junction.

Diagnosis is performed by protein, DNA or RNA sequence and/or hybridization analysis of any convenient sample, e.g. cultured mycobacteria, biopsy material, blood sample, etc. Screening may also be based on the functional or antigenic characteristics of the protein. Immunoassays designed to detect the encoded proteins from deleted sequences may be used in screening.

A number of methods are available for analyzing nucleic acids for the presence of a specific sequence. Where large amounts of DNA are available, genomic DNA is used directly. Alternatively, the region of interest is cloned into a suitable vector and grown in sufficient quantity for analysis. The nucleic acid may be amplified by conventional techniques, such as the polymerase chain reaction (PCR), to provide sufficient amounts for analysis. The use of the polymerase chain reaction is described in Saiki, et al. (1985) Science 239:487, and a review of current techniques may be found in Sambrook, et al. Molecular Cloning: A Laboratory Manual, CSH Press 1989, pp.14.2-14.33. Amplification may also be used to determine whether a polymorphism is present, by using a primer that is specific for the polymorphism. Alternatively, various methods are known in the art that utilize oligonucleotide ligation, for examples see Riley et al. (1990) N.A.R. 18:2887-2890; and Delahunty et al. (1996) Am. J. Hum. Genet. 58:1239-1246.

A detectable label may be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2′,7′-dimethoxy-4′,5′-dichloro-6-carboxyfluorescein (JOE), 6-carboxy-X-rhodamine (ROX), 6-carboxy-2′,4′,7!,4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N′,N′-tetramethyl-6-carboxyrhodamine (TAMRA), radioactive labels, e.g. 32 P, 35 S, 3 H; etc. The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g. avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label may be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product.

The sample nucleic acid, e.g. amplified or cloned fragment, is analyzed by one of a number of methods known in the art. The nucleic acid may be sequenced by dideoxy or other methods, and the sequence of bases compared to the deleted sequence. Hybridization with the variant sequence may also be used to determine its presence, by Southern blots, dot blots, etc. The hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. No. 5,445,934, or in WO95/35505, may also be used as a means of detecting the presence of variable sequences. Single strand conformational polymorphism (SSCP) analysis, denaturing gradient gel electrophoresis (DGGE), mismatch cleavage detection, and heteroduplex analysis in gel matrices are used to detect conformational changes created by DNA sequence variation as alterations in electrophoretic mobility. Alternatively, where a polymorphism creates or destroys a recognition site for a restriction endonuclease (restriction fragment length polymorphism, RFLP), the sample is digested with that endonuclease, and the products size fractionated to determine whether the fragment was digested. Fractionation is performed by gel or capillary electrophoresis, particularly acrylamide or agarose gels.

The hybridization pattern of a control and variant sequence to an array of oligonucleotide probes immobilized on a solid support, as described in U.S. Pat. No. 5,445,934, or in WO95/35505, may be used as a means of detecting the presence or absence of deleted sequences. In one embodiment of the invention, an array of oligonucleotides is provided, where discrete positions on the array are complementary to at least a portion of M. tb. genomic DNA, usually comprising at least a portion from the identified open reading frames. Such an array may comprise a series of oligonucleotides, each of which can specifically hybridize to a nucleic acid, e.g. mRNA, cDNA, genomic DNA, etc.

Deletions may also be detected by amplification. In an embodiment of the invention, sequences are amplified that include a deletion junction, i.e. where the amplification primers hybridize to a junction sequence. In a nucleic acid sample where the marker sequence is deleted, a junction will be formed, and the primer will hybridize, thereby allowing amplification of a detectable sequence. In a nucleic acid sample where the marker sequence is present, the primer will not hybridize, and no amplification will take place. Alternatively, amplification primers may be chosen such that amplification of the target sequence will only take place where the marker sequence is present. The amplification products may be separated by size using any convenient method, as known in the art, including gel electrophoresis, chromatography, capillary electrophoresis, density gradient fractionation, etc.

In addition to the detection of deletions by the detection of junctions sequences, or detection of the marker sequences themselves, one may determine the presence or absence of the encoded protein product. The specific deletions in Table 1 correspond to open reading frames of the M. tb genome, and therefore encode a polypeptides. Polypeptides are detected by means known in the art, including determining the presence of the specific polypeptide in a sample through biochemical, functional or immunological characterization. The detection of antibodies in patient serum that react with a polypeptide is of particular interest.

Immunization with BCG typically leads to a positive response against tuberculin antigens in a skin test. In people who have been immunized, which includes a significant proportion of the world population, it is therefore difficult to determine whether a positive test is the result of an immune reaction to the BCG vaccine, or to an ongoing M. tb. infection. The subject invention has provided a number of open reading frame sequences that are present in M. tb isolates, but are absent in BCG. As a primary or a secondary screening method, one may test for immunoreactivity of the patient with the polypeptides encoded by such deletion markers. Diagnosis may be performed by a number of methods. The different methods all determine the presence of an immune response to the polypeptide in a patient, where a positive response is indicative of an M. tb infection. The immune response may be determined by determination of antibody binding, or by the presence of a response to intradermal challenge with the polypeptide.

In one method, a dose of the deletion marker polypeptide, formulated as a cocktail of proteins or as individual protein species, in a suitable medium is injected subcutaneously into the patient. The dose will usually be at least about 0.05 μg of protein, and usually not more than about 5 μg of protein. A control comprising medium alone, or an unrelated protein will be injected nearby at the same time. The site of injection is examined after a period of time for the presence of a wheal. The wheal at the site of polypeptide injection is compared to that at the site of the control injection, usually by measuring the size of the wheal. The skin test readings may be assessed by a variety of objective grading systems. A positive result for the presence of an allergic condition will show an increased diameter at the site of polypeptide injection as compared to the control, usually at least about 50% increase in size, more usually at least 100% increase in size.

An alternative method for diagnosis depends on the in vitro detection of binding between antibodies in a patient sample and the subject polypeptides, either as a cocktail or as individual protein species, where the presence of specific binding is indicative of an infection. Measuring the concentration of polypeptide specific antibodies in a sample or fraction thereof may be accomplished by a variety of specific assays. In general, the assay will measure the reactivity between a patient sample, usually blood derived, generally in the form of plasma or serum. The patient sample may be used directly, or diluted as appropriate, usually about 1:10 and usually not more than about 1:10,000. Immunoassays may be performed in any physiological buffer, e.g. PBS, normal saline, HBSS, dPBS, etc.

In a preferred embodiment, a conventional sandwich type assay is used. A sandwich assay is performed by first attaching the polypeptide to an insoluble surface or support. The polypeptide may be bound to the surface by any convenient means, depending upon the nature of the surface, either directly or through specific antibodies. The particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non-covalently, preferably non-covalently. Samples, fractions or aliquots thereof are then added to separately assayable supports (for example, separate wells of a microtiter plate) containing support-bound polypeptide. Preferably, a series of standards, containing known concentrations of antibodies is assayed in parallel with the samples or aliquots thereof to serve as controls.

Immune specific receptors may be labeled to facilitate direct, or indirect quantification of binding. Examples of labels which permit direct measurement of second receptor binding include radiolabels, such as 3 H or 125 I, fluorescers, dyes, beads, chemilumninescers, colloidal particles, and the like. Examples of labels which permit indirect measurement of binding include enzymes where the substrate may provide for a colored or fluorescent product. In a preferred embodiment, the second receptors are antibodies labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate. Examples of suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art.

In some cases, a competitive assay will be used. In addition to the patient sample, a competitor to the antibody is added to the reaction mix. The competitor and the antibody compete for binding to the polypeptide. Usually, the competitor molecule will be labeled and detected as previously described, where the amount of competitor binding will be proportional to the amount of Immune present. The concentration of competitor molecule will be from about 10 times the maximum anticipated Immune concentration to about equal concentration in order to make the most sensitive and linear range of detection.

Alternatively, antibodies may be used for direct determination of the presence of the deletion marker polypeptide. Antibodies specific for the subject deletion markers as previously described may be used in screening immunoassays. Samples, as used herein, include microbial cultures, biological fluids such as tracheal lavage, blood, etc. Also included in the term are derivatives and fractions of such fluids. Diagnosis may be performed by a number of methods. The different methods all determine the absence or presence of polypeptides encoded by the subject deletion markers. For example, detection may utilize staining of mycobacterial cells or histological sections, performed in accordance with conventional methods. The antibodies of interest are added to the cell sample, and incubated for a period of time sufficient to allow binding to the epitope, usually at least about 10 minutes. The antibody may be labeled with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct detection. Alternatively, a second stage antibody or reagent is used to amplify the signal. Such reagents are well known in the art. For example, the primary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent. Final detection uses a substrate that undergoes a color change in the presence of the peroxidase. The absence or presence of antibody binding may be determined by various methods, including microscopy, radiography, scintillation counting, etc.

An alternative method for diagnosis depends on the in vitro detection of binding between antibodies and the subject polypeptides in solution, e.g. a cell lysate. Measuring the concentration of binding in a sample or fraction thereof may be accomplished by a variety of specific assays. A conventional sandwich type assay may be used. For example, a sandwich assay may first attach specific antibodies to an insoluble surface or support. The particular manner of binding is not crucial so long as it is compatible with the reagents and overall methods of the invention. They may be bound to the plates covalently or non-covalently, preferably non-covalently. The insoluble supports may be any compositions to which polypeptides can be bound, which is readily separated from soluble material, and which is otherwise compatible with the overall method. The surface of such supports may be solid or porous and of any convenient shape. Examples of suitable insoluble supports to which the receptor is bound include beads, e.g. magnetic beads, membranes and microtiter plates. These are typically made of glass, plastic (e.g. polystyrene), polysaccharides, nylon or nitrocellulose. Microtiter plates are especially convenient because a large number of assays can be carried out simultaneously, using small amounts of reagents and samples.

Samples are then added to separately assayable supports (for example, separate wells of a microtiter plate) containing antibodies. Preferably, a series of standards, containing known concentrations of the polypeptides is assayed in parallel with the samples or aliquots thereof to serve as controls. Preferably, each sample and standard will be added to multiple wells so that mean values can be obtained for each. The incubation time should be sufficient for binding, generally, from about 0.1 to 3 hr is sufficient. After incubation, the insoluble support is generally washed of non-bound components. Generally, a dilute non-ionic detergent medium at an appropriate pH, generally 7-8, is used as a wash medium. From one to six washes may be employed, with sufficient volume to thoroughly wash non-specifically bound proteins present in the sample.

After washing, a solution containing a second antibody is applied. The antibody will bind with sufficient specificity such that it can be distinguished from other components present. The second antibodies may be labeled to facilitate direct, or indirect quantification of binding. Examples of labels that permit direct measurement of second receptor binding include radiolabels, such as 3 H or 125 I, fluorescers, dyes, beads, chemilumninescers, colloidal particles, and the like. Examples of labels which permit indirect measurement of binding include enzymes where the substrate may provide for a colored or fluorescent product. In a preferred embodiment, the antibodies are labeled with a covalently bound enzyme capable of providing a detectable product signal after addition of suitable substrate. Examples of suitable enzymes for use in conjugates include horseradish peroxidase, alkaline phosphatase, malate dehydrogenase and the like. Where not commercially available, such antibody-enzyme conjugates are readily produced by techniques known to those skilled in the art. The incubation time should be sufficient for the labeled ligand to bind available molecules. Generally, from about 0.1 to 3 hr is sufficient, usually 1 hr sufficing.

After the second binding step, the insoluble support is again washed free of non-specifically bound material. The signal produced by the bound conjugate is detected by conventional means. Where an enzyme conjugate is used, an appropriate enzyme substrate is provided so a detectable product is formed.

Other immunoassays are known in the art and may find use as diagnostics. Ouchterlony plates provide a simple determination of antibody binding. Western blots may be performed on protein gels or protein spots on filters, using a detection system specific for the polypeptide, conveniently using a labeling method as described for the sandwich assay.

Recombinant Mycobacterium

Mycobacterium, particularly those of the M. tuberculosis complex, are genetically engineered to contain specific deletions or insertions corresponding to the identified genetic markers. In particular, attenuated BCG strains are modified to introduce deleted genes encoding sequences important in the establishment of effective immunity. Alternatively, M. bovis or M. tuberculosis are modified by homologous recombination to create specific deletions in sequences that determine virulence, i.e. the bacteria are attenuated through recombinant techniques.

In order to stably introduce sequences into BCG, the M. tb open reading frame corresponding to one of the deletions in Table 1 is inserted into a vector that is maintained in M. bovis strains. Preferably, the native 5′ and 3′ flanking sequences are included, in order to provide for suitable regulation of transcription and translation. However, in special circumstances, exogenous promoters and other regulatory regions may be included. Vectors and methods of transfection for BCG are known in the art. For example, U.S. Pat. No. 5,776,465, herein incorporated by reference, describes the introduction of exogenous genes into BCG.

In one embodiment of the invention, the complete deleted region is replaced in BCG. The junctions of the deletion are determined as compared to a wild type M. tb. or M. bovis sequence, for example as set forth in the experimental section. The deleted region is cloned by any convenient method, as known in the art, e.g. PCR amplification of the region, restriction endonuclease digestion, chemical synthesis, etc. Preferably the cloned region will further comprise flanking sequences of a length sufficient to induce homologous recombination, usually at least about 25 nt, more usually at least about 100 nt, or greater. Suitable vectors and methods are known in the art, for an example, see Norman et al. (1995) Mol. Microbiol. 16:755-760.

In an alternative embodiment, one or more of the deletions provided in Table 1 are introduced into a strain of M. tuberculosis or M. bovis . Preferably such a strain is reduced in virulence, e.g. H37Ra, etc. Methods of homologous recombination in order to effect deletions in mycobacteria are known in the art, for example see Norman et al., supra.; Ganjam et al. (1991) P.N.A.S. 88:5433-5437; and Aldovini et al. (1993) J. Bacteriol. 175:7282-7289. Deletions may comprise an open reading frame identified in Table 1, or may extend to the full deletion, i.e. extending into flanking regions, and may include multiple open reading frames.

The ability of the genetically altered mycobacterium to cause disease may be tested in one or more experimental models. For example, M. tb. is known to infect a variety of animals, and cells in culture. In one assay, mammalian macrophages, preferably human macrophages, are infected. In a comparison of virulent, avirulent and attenuated strains of the M. tuberculosis complex, alveolar or peripheral blood monocytes are infected at a 1:1 ratio (Silver et al. (1998) Infect Immun 66(3):1190-1199; Paul et al. (1996) J Infect Dis 174(1):105-112). The percentages of cells infected by the strains and the initial numbers of intracellular organisms are equivalent, as were levels of monocyte viability up to 7 days following infection. However, intracellular growth reflects virulence, over a period of one or more weeks. Mycobacterial growth may be evaluated by acid-fast staining, electron microscopy, and colony-forming units (cfu) assays. Monocyte production of tumor necrosis factor alpha may also be monitored as a marker for virulence.

Other assays for virulence utilize animal models. The M. tb. complex bacteria are able to infect a wide variety of animal hosts. One model of particular interest is cavitary tuberculosis produced in rabbits by aerosolized virulent tubercle bacilli (Converse et al. (1996) Infect Immun 64(11):4776-4787). In liquefied caseum, the tubercle bacilli grow extracellularly for the first time since the onset of the disease and can reach such large numbers that mutants with antimicrobial resistance may develop. From a cavity, the bacilli enter the bronchial tree and spread to other parts of the lung and also to other people. Of the commonly used laboratory animals, the rabbit is the only one in which cavitary tuberculosis can be readily produced.

Vaccines may be formulated according to methods known in the art. Vaccines of the modified bacteria are administered to a host which may be exposed to virulent tuberculosis. In many countries where tuberculosis is endemic, vaccination may be performed at birth, with additional vaccinations as necessary. The compounds of the present invention are administered at a dosage that provides effective immunity while minimizing any side-effects. It is contemplated that the composition will be obtained and used under the guidance of a physician.

Conventional vaccine strains of BCG may be formulated in a combination vaccine with polypeptides identified in the present invention and produced as previously described, in order to improve the efficacy of the vaccine.

Various methods for administration may be employed. The formulation may be injected intramuscularly, intravascularly, subcutaneously, etc. The dosage will be conventional. The bacteria can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in semi-solid or liquid forms, such as solutions, injections, etc. The following methods and excipients are merely exemplary and are in no way limiting.

The modified bacteria can be formulated into preparations for injections by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. Unit dosage forms for injection or intravenous administration may comprise the bacteria of the present invention in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.

The term “unit dosage form, ” as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of vaccine, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular bacteria employed and the effect to be achieved, and the pharmacodynamics associated with each complex in the host.

The pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the subject invention, and are not intended to limit the scope of what is regarded as the invention. Efforts have been made to ensure accuracy with respect to the numbers used (e.g. amounts, temperature, concentrations, etc.) but some experimental errors and deviations should be allowed for. Unless otherwise indicated, parts are parts by weight, molecular weight is average molecular weight, temperature is in degrees centigrade; and pressure is at or near atmospheric.

EXPERIMENTAL

Methods:

The technical methods used begin with extraction of whole genomic DNA from bacteria grown in culture.

Day 1

Inoculate culture medium of choice (LJ/7H9) and incubate at 35° C. until abundant growth. Dispense 500 μl 1× TE into each tube. (If DNA is in liquid medium, no TE needed.) Transfer loopful (sediment) of cells into microcentrifuge tube containing 500 μl of 1*TE. If taking DNA from liquid medium, let cells collect in bottom of flask. Pipette cells (about 1 ml) into tube. Heat 20 min at 80° C. to kill cells, centrifuge, resuspend in 500 μl of 1*TE. Add 50 μl of 10 mg/ml lysozyme, vortex, incubate overnight at 37° C.

Day 2

Add 70 μl of 10% SDS and 10 μl proteinase K, vortex and incubate 20 min. at 65° C. Add 100 μl of 5M NaCl. Add 100 μl of CTAB/NaCl solution, prewarmed at 65° C. Vortex until liquid content white (“milky”). Incubate 10 min at 65° C. Outside of hood, prepare new microcentrifuge tubes labeled with culture # on top, and culture #, tube #, date on side. Add 550 μl isopropanol to each and cap. Back in the hood, add 750 μl of chloroform/isoamyl alcohol, vortex for 10 sec. Centrifuge at room temp for 5 min. at 12,000 g. Transfer aqueous supernatant in 180 μl amounts to new tube using pipetter, being careful to leave behind solids and non-aqueous liquid. Place 30 min at −20 C. Spin 15 min at room temp in a microcentrifuge at 12,000 g. Discard supernatant; leave about 20 μl above pellet. Add 1 ml cold 70% ethanol and turn tube a few times upside down. Spin 5 min at room temp in a microcentrifuge. Discard supernatant; leave about 20 μl above the pellet. Spin 1 min in a microcentrifuge and discard cautiously the last 20 μl supernatant just above the pellet using a pipetter (P-20). Be sure that all traces of ethanol are removed. Allow pellet to dry at room temp for 10 min or speed vac 2-3 min. (Place open tubes in speed vac, close lid, start rotor, turn on vacuum. After 3 min. push red button, turn off vacuum, turn off rotor. Check if pellets are dry by flicking tube to see if pellet comes away from side of tube.) Redissolve the pellet in 20-50 μl of ddH2O. Small pellets get 20, regular sized get 30 and very large get 50. DNA can be stored at 4° C. for further use.

DNA array: was made by spotting DNA fragments onto glass microscope slides which were pretreated with poly-L-lysine. Spotting onto the array was accomplished by a robotic arrayer. The DNA was cross-linked to the glass by ultraviolet irradiation, and the free poly-L-lysine groups were blocked by treatment with 0.05% succinic anhydride, 50% 1-methyl-2-pyrrolidinone and 50% borate buffer.

The majority of spots on the array were PCR-derived products, produced by selecting over 9000 primer pairs designed to amplify the predicted open reading frames of the sequences strain H37Rv (ftp.sanger.ac.uk/pub/TB.seq). Some internal standards and negative control spots including plasmid vectors and non- M.tb. DNA were also on the array.

Therefore, with the preparation for an array that contained the whole genome of Mycobacterium tuberculosis, we compared BCG-Connaught to Mycobacterium tuberculosis, using the array for competitive hybridization. The protocol follows:

DNA labeling protocol. Add 4 μg DNA in 20 μl H 2 O, 2 ml dN10N6 and 36 μl H 2 O. 2 ml DNA spike for each DNA sample, for total of 60 μl. Boil 3 minutes to denature DNA, then snap cool on ice water bath. Add 1 μl dNTP (5mM ACG), 10 μl 10 buffer, 4 μl Klenow, 22 μl H 2 O to each tube. Add 3 μl of Cy3 or Cy5 dUTP, for total of 100 μl. Incubate 3 hours at 37° C. Add 11 μl 3M NaAc, 250 μl 100% EtOH to precipitate, store O/N at −20° C. Centrifuge genomic samples 30 minutes at 13K to pellet precipitate. Discard supernatant, add 70% EtOH, spin 15 minutes, discard sup and speed-vac to dry. This provides DNA for two experiments.

DNA hybridization to microarray. protocol. Resuspend the labeled DNA in 11 μl H 2 O (for 2 arrays). Run out 1 μl DNA on a 1.5% agarose gel to document sample to be hybridized. Of the remaining 10 μl of solution, half will be used for this hyb, and half will be left for later date. Take 5 μl of solution Cy3 and add to same amount of Cy5 solution, for total volume 10 μl mixed labeled DNA. Add 1 μl tRNA, 2.75 μl 20×SSC, 0.4 μl SDS, for total volume 14.1 μl. Place on slide at array site, cover with 22 mm coverslip, put slide glass over and squeeze onto rubber devices, then hybridize 4 hours at 65° C. After 4 hours, remove array slides from devices, leave coverslip on, and dip in slide tray into wash buffer consisting of 1×SSC with 0.05% SDS for about 2 minutes. Cover slip should fall off into bath. After 2 minutes in wash buffer, dip once into a bath with 0.06×SSC, then rinse again in 0.06×SSC in separate bath. Dry slides in centrifuge about 600 rpm. They are now ready for scanning.

Fluorescence scanning and data acquisition. Fluorescence scanning was set for 20 microns/pixel and two readings were taken per pixel. Data for channel 1 was set to collect fluorescence from Cy3 with excitation at 520 nm and emission at 550-600 nm. Channel 2 collected signals excited at 647 nm and emitted at 660-705 nm, appropriate for Cy5. No neutral density filters were applied to the signal from either channel, and the photomultiplier tube gain was set to 5. Fine adjustments were then made to the photomultiplier gain so that signals collected from the two spots containing genomic DNA were equivalent.

To analyze the signal from each spot on the array, a 14×14 grid of boxes was applied to the data collected from the array such that signals from within each box were integrated and a value was assigned to the corresponding spot. A background value was obtained for each spot by integrating the signals measured 2 pixels outside the perimeter of the corresponding box. The signal and background values for each spot were imported into a spreadsheet program for further analysis. The background values were subtracted from the signals and a factor of 1.025 was applied to each value in channel 2 to normalize the data with respect to the signals from the genomic DNA spots.

Because the two samples are labeled with different fluorescent dyes, it is possible to determine that a spot of DNA on the array has hybridized to Mycobacterium tuberculosis (green dye) and not to BCG (red dye), thus demonstrating a likely deletion from the BCG genome.

However, because the array now contains spots representing 4000 spots, one may expect up to 100 spots with hybridization two standard deviations above or below the mean. Consequently, we have devised a screening protocol, where we look for mismatched hybridization in two consecutive genes on the genome. Therefore, we are essentially looking only for deletions of multiple genes at this point.

To confirm that a gene or group of genes is deleted, we perform Southern hybridization, employing a separate probe from the DNA on the array. Digestions of different mycobacterium DNAs are run on an agarose gel, and transferred to membranes. The membranes can be repeatedly used for probing for different DNA sequences. For the purposes of this project, we include DNA from the reference strain of Mycobacterium tuberculosis (H37Rv), from other laboratory strains, such as H37Ra, the O strain, from clinical isolates, from the reference strain of Mycobacterium bovis, and from different strains of Mycobacterium bovis BCG.

Once a deletion is confirmed by Southern hybridization, we then set out to characterize the exact genomic location. This is done by using polymerase chain reaction, with primers designed to be close to the edges of the deletion, see Talbot (1997) J Clin Micro. 35: 566-9

Primers have been chosen to amplify across the deleted region. Only in the absence of this region does one obtain an amplicon. PCR products were examined by electrophoresis (1.5% agarose) and ethidium bromide staining.

Once a short amplicon is obtained, this amplicon is then sequenced. A search of the genome database is performed to determine whether the sequence is exactly identical to one part of the Mycobacterium tuberculosis genome, and that the next part of the amplicon is exactly identical to another part of the Mycobacterium tuberculosis genome. This permits precise identification of the site of deletion.

Below follows an example of the kind of report obtained: rd6 bridging PCR, blast search of sequence

emb |Z79701 |MTCY277 Mycobacterium tuberculosis cosmid Y277
Length = 38,908
Plus Strand HSPs:
Score = 643 (177.7 bits), Expect =  1.6e-54, Sum P(2) =  1.6e-54
Identities =  129/131 (98%), Positives =  129/131 (98%), Strand =  Plus/Plus
Query SEQ ID NO:130:	12	ANTAGTAATGTGCGAGCTGAGCGATGTCGCCGCTCCCAAAAATTACCAATGGTTNGGTCA 71
		|  |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct SEQ ID NO:131:	24784	AGTAGTAATGTGCGAGCTGAGCGATGTCGCCGCTCCCAAAAATTACCAATGGTTTGGTCA
Query SEQ ID NO:132:	72	TGACGCCTTCCTAACCAGAATTGTGAATTCATACAAGCCGTAGTCGTGCAGAAGCGCAAC
		||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct SEQ ID NO:133:	24844	TGACGCCTTCCTAACCAGAATTGTGAATTCATACAAGCCGTAGTCGTGCAGAAGCGCAAC
Query SEQ ID NO:134:	132	ACTCTTGGAGT 142
		|||||||||||
Sbjct SEQ ID NO:135:	24904	ACTCTTGGAGT 24914
Score =  224 (61.9 bits), Expect =  1.6e-54, Sum P(2) =  1.6e-54
Identities =  46/49 (93%), Positives =  46/49 (93%), Strand =  Plus/Plus
Query SEQ ID NO:136:	141	GTGGCCTACAACGGNGCTCTCCGNGGCGCGGGCGTACCGGATATCTTAG 189
		| ||||||||||| ||||||| |||||||||||||||||||||||||||
Sbjct SEQ ID NO:137:	37645	GCGGCCTACAACGGCGCTCTCCGCGGCGCGGGCGTACCGGATATCTTAG 37693

This process is repeated with each suggested deletion, beginning with the three previously described deletions to serve as controls. Sixteen deletions have been identified by these methods, and are listed in Table 1.

It is to be understood that this invention is not limited to the particular methodology, protocols, formulations and reagents described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

It must be noted that as used herein and in the appended claims, the singular forms “a”, “and”, and “the ” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a complex ” includes a plurality of such complexes and reference to “the formulation ” includes reference to one or more formulations and equivalents thereof known to those skilled in the art, and so forth.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although any methods, devices and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, the preferred methods, devices and materials are now described.

All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing, for example, the cell lines, constructs, and methodologies that are described in the publications which might be used in connection with the presently described invention. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention.

137 1 1773 DNA Mycobacteria tuberculosis CDS (0)...(0) 1atgactgctg aaccggaagt acggacgctg cgcgaggttg tgctggacca gctcggcact 60gctgaatcgc gtgcgtacaa gatgtggctg ccgccgttga ccaatccggt cccgctcaac 120gagctcatcg cccgtgatcg gcgacaaccc ctgcgatttg ccctggggat catggatgaa 180ccgcgccgcc atctacagga tgtgtggggc gtagacgttt ccggggccgg cggcaacatc 240ggtattgggg gcgcacctca aaccgggaag tcgacgctac tgcagacgat ggtgatgtcg 300gccgccgcca cacactcacc gcgcaacgtt cagttctatt gcatcgacct aggtggcggc 360gggctgatct atctcgaaaa ccttccacac gtcggtgggg tagccaatcg gtccgagccc 420gacaaggtca accgggtggt cgcagagatg caagccgtca tgcggcaacg ggaaaccacc 480ttcaaggaac accgagtggg ctcgatcggg atgtaccggc agctgcgtga cgatccaagt 540caacccgttg cgtccgatcc atacggcgac gtctttctga tcatcgacgg atggcccggt 600tttgtcggcg agttccccga ccttgagggg caggttcaag atctggccgc ccaggggctg 660gcgttcggcg tccacgtcat catctccacg ccacgctgga cagagctgaa gtcgcgtgtt 720cgcgactacc tcggcaccaa gatcgagttc cggcttggtg acgtcaatga aacccagatc 780gaccggatta cccgcgagat cccggcgaat cgtccgggtc gggcagtgtc gatggaaaag 840caccatctga tgatcggcgt gcccaggttc gacggcgtgc acagcgccga taacctggtg 900gaggcgatca ccgcgggggt gacgcagatc gcttcccagc acaccgaaca ggcacctccg 960gtgcgggtcc tgccggagcg tatccacctg cacgaactcg acccgaaccc gccgggacca 1020gagtccgact accgcactcg ctgggagatt ccgatcggct tgcgcgagac ggacctgacg 1080ccggctcact gccacatgca cacgaacccg cacctactga tcttcggtgc ggccaaatcg 1140ggcaagacga ccattgccca cgcgatcgcg cgcgccattt gtgcccgaaa cagtccccag 1200caggtgcggt tcatgctcgc ggactaccgc tcgggcctgc tggacgcggt gccggacacc 1260catctgctgg gcgccggcgc gatcaaccgc aacagcgcgt cgctagacga ggccgttcaa 1320gcactggcgg tcaacctgaa gaagcggttg ccgccgaccg acctgacgac ggcgcagcta 1380cgctcgcgtt cgtggtggag cggatttgac gtcgtgcttc tggtcgacga ttggcacatg 1440atcgtgggtg ccgccggggg gatgccgccg atggcaccgc tggccccgtt attgccggcg 1500gcggcagata tcgggttgca catcattgtc acctgtcaga tgagccaggc ttacaaggca 1560accatggaca agttcgtcgg cgccgcattc gggtcgggcg ctccgacaat gttcctttcg 1620ggcgagaagc aggaattccc atccagtgag ttcaaggtca agcggcgccc ccctggccag 1680gcatttctcg tctcgccaga cggcaaagag gtcatccagg ccccctacat cgagcctcca 1740gaagaagtgt tcgcagcacc cccaagcgcc ggt 1773 2 297 DNA Mycobacteria tuberculosis 2atggaaaaaa tgtcacatga tccgatcgct gccgacattg gcacgcaagt gagcgacaac 60gctctgcacg gcgtgacggc cggctcgacg gcgctgacgt cggtgaccgg gctggttccc 120gcgggggccg atgaggtctc cgcccaagcg gcgacggcgt tcacatcgga gggcatccaa 180ttgctggctt ccaatgcatc ggcccaagac cagctccacc gtgcgggcga agcggtccag 240gacgtcgccc gcacctattc gcaaatcgac gacggcgccg ccggcgtctt cgccgaa 297 3 1104 DNA Mycobacteria tuberculosis 3atgctgtggc acgcaatgcc accggagcta aataccgcac ggctgatggc cggcgcgggt 60ccggctccaa tgcttgcggc ggccgcggga tggcagacgc tttcggcggc tctggacgct 120caggccgtcg agttgaccgc gcgcctgaac tctctgggag aagcctggac tggaggtggc 180agcgacaagg cgcttgcggc tgcaacgccg atggtggtct ggctacaaac cgcgtcaaca 240caggccaaga cccgtgcgat gcaggcgacg gcgcaagccg cggcatacac ccaggccatg 300gccacgacgc cgtcgctgcc ggagatcgcc gccaaccaca tcacccaggc cgtccttacg 360gccaccaact tcttcggtat caacacgatc ccgatcgcgt tgaccgagat ggattatttc 420atccgtatgt ggaaccaggc agccctggca atggaggtct accaggccga gaccgcggtt 480aacacgcttt tcgagaagct cgagccgatg gcgtcgatcc ttgatcccgg cgcgagccag 540agcacgacga acccgatctt cggaatgccc tcccctggca gctcaacacc ggttggccag 600ttgccgccgg cggctaccca gaccctcggc caactgggtg agatgagcgg cccgatgcag 660cagctgaccc agccgctgca gcaggtgacg tcgttgttca gccaggtggg cggcaccggc 720ggcggcaacc cagccgacga ggaagccgcg cagatgggcc tgctcggcac cagtccgctg 780tcgaaccatc cgctggctgg tggatcaggc cccagcgcgg gcgcgggcct gctgcgcgcg 840gagtcgctac ctggcgcagg tgggtcgttg acccgcacgc cgctgatgtc tcagctgatc 900gaaaagccgg ttgccccctc ggtgatgccg gcggctgctg ccggatcgtc ggcgacgggt 960ggcgccgctc cggtgggtgc gggagcgatg ggccagggtg cgcaatccgg cggctccacc 1020aggccgggtc tggtcgcgcc ggcaccgctc gcgcaggagc gtgaagaaga cgacgaggac 1080gactgggacg aagaggacga ctgg 1104 4 300 DNA Mycobacteria tuberculosis 4atggcagaga tgaagaccga tgccgctacc ctcgcgcagg aggcaggtaa tttcgagcgg 60atctccggcg acctgaaaac ccagatcgac caggtggagt cgacggcagg ttcgttgcag 120ggccagtggc gcggcgcggc ggggacggcc gcccaggccg cggtggtgcg cttccaagaa 180gcagccaata agcagaagca ggaactcgac gagatctcga cgaatattcg tcaggccggc 240gtccaatact cgagggccga cgaggagcag cagcaggcgc tgtcctcgca aatgggcttc 300 5 285 DNA M. tuberculosis 5atgacagagc agcagtggaa tttcgcgggt atcgaggccg cggcaagcgc aatccaggga 60aatgtcacgt ccattcattc cctccttgac gaggggaagc agtccctgac caagctcgca 120gcggcctggg gcggtagcgg ttcggaggcg taccagggtg tccagcaaaa atgggacgcc 180acggctaccg agctgaacaa cgcgctgcag aacctggcgc ggacgatcag cgaagccggt 240caggcaatgg cttcgaccga aggcaacgtc actgggatgt tcgca 285 6 1998 DNA Mycobacteria tuberculosis 6atggcggccg actacgacaa gctcttccgg ccgcacgaag gtatggaagc tccggacgat 60atggcagcgc agccgttctt cgaccccagt gcttcgtttc cgccggcgcc cgcatcggca 120aacctaccga agcccaacgg ccagactccg cccccgacgt ccgacgacct gtcggagcgg 180ttcgtgtcgg ccccgccgcc gccaccccca cccccacctc cgcctccgcc aactccgatg 240ccgatcgccg caggagagcc gccctcgccg gaaccggccg catctaaacc acccacaccc 300cccatgccca tcgccggacc cgaaccggcc ccacccaaac cacccacacc ccccatgccc 360atcgccggac ccgaaccggc cccacccaaa ccacccacac ctccgatgcc catcgccgga 420cctgcaccca ccccaaccga atcccagttg gcgcccccca gaccaccgac accacaaacg 480ccaaccggag cgccgcagca accggaatca ccggcgcccc acgtaccctc gcacgggcca 540catcaacccc ggcgcaccgc accagcaccg ccctgggcaa agatgccaat cggcgaaccc 600ccgcccgctc cgtccagacc gtctgcgtcc ccggccgaac caccgacccg gcctgccccc 660caacactccc gacgtgcgcg ccggggtcac cgctatcgca cagacaccga acgaaacgtc 720gggaaggtag caactggtcc atccatccag gcgcggctgc gggcagagga agcatccggc 780gcgcagctcg cccccggaac ggagccctcg ccagcgccgt tgggccaacc gagatcgtat 840ctggctccgc ccacccgccc cgcgccgaca gaacctcccc ccagcccctc gccgcagcgc 900aactccggtc ggcgtgccga gcgacgcgtc caccccgatt tagccgccca acatgccgcg 960gcgcaacctg attcaattac ggccgcaacc actggcggtc gtcgccgcaa gcgtgcagcg 1020ccggatctcg acgcgacaca gaaatcctta aggccggcgg ccaaggggcc gaaggtgaag 1080aaggtgaagc cccagaaacc gaaggccacg aagccgccca aagtggtgtc gcagcgcggc 1140tggcgacatt gggtgcatgc gttgacgcga atcaacctgg gcctgtcacc cgacgagaag 1200tacgagctgg acctgcacgc tcgagtccgc cgcaatcccc gcgggtcgta tcagatcgcc 1260gtcgtcggtc tcaaaggtgg ggctggcaaa accacgctga cagcagcgtt ggggtcgacg 1320ttggctcagg tgcgggccga ccggatcctg gctctagacg cggatccagg cgccggaaac 1380ctcgccgatc gggtagggcg acaatcgggc gcgaccatcg ctgatgtgct tgcagaaaaa 1440gagctgtcgc actacaacga catccgcgca cacactagcg tcaatgcggt caatctggaa 1500gtgctgccgg caccggaata cagctcggcg cagcgcgcgc tcagcgacgc cgactggcat 1560ttcatcgccg atcctgcgtc gaggttttac aacctcgtct tggctgattg tggggccggc 1620ttcttcgacc cgctgacccg cggcgtgctg tccacggtgt ccggtgtcgt ggtcgtggca 1680agtgtctcaa tcgacggcgc acaacaggcg tcggtcgcgt tggactggtt gcgcaacaac 1740ggttaccaag atttggcgag ccgcgcatgc gtggtcatca atcacatcat gccgggagaa 1800cccaatgtcg cagttaaaga cctggtgcgg catttcgaac agcaagttca acccggccgg 1860gtcgtggtca tgccgtggga caggcacatt gcggccggaa ccgagatttc actcgacttg 1920ctcgacccta tctacaagcg caaggtcctc gaattggccg cagcgctatc cgacgatttc 1980gagagggctg gacgtcgt 1998 7 1533 DNA Mycobacteria tuberculosis 7ttgagcgcac ctgctgttgc tgctggtcct accgccgcgg gggcaaccgc tgcgcggcct 60gccaccaccc gggtgacgat cctgaccggc agacggatga ccgatttggt actgccagcg 120gcggtgccga tggaaactta tattgacgac accgtcgcgg tgctttccga ggtgttggaa 180gacacgccgg ctgatgtact cggcggcttc gactttaccg cgcaaggcgt gtgggcgttc 240gctcgtcccg gatcgccgcc gctgaagctc gaccagtcac tcgatgacgc cggggtggtc 300gacgggtcac tgctgactct ggtgtcagtc agtcgcaccg agcgctaccg accgttggtc 360gaggatgtca tcgacgcgat cgccgtgctt gacgagtcac ctgagttcga ccgcacggca 420ttgaatcgct ttgtgggggc ggcgatcccg cttttgaccg cgcccgtcat cgggatggcg 480atgcgggcgt ggtgggaaac tgggcgtagc ttgtggtggc cgttggcgat tggcatcctg 540gggatcgctg tgctggtagg cagcttcgtc gcgaacaggt tctaccagag cggccacctg 600gccgagtgcc tactggtcac gacgtatctg ctgatcgcaa ccgccgcagc gctggccgtg 660ccgttgccgc gcggggtcaa ctcgttgggg gcgccacaag ttgccggcgc cgctacggcc 720gtgctgtttt tgaccttgat gacgcggggc ggccctcgga agcgtcatga gttggcgtcg 780tttgccgtga tcaccgctat cgcggtcatc gcggccgccg ctgccttcgg ctatggatac 840caggactggg tccccgcggg ggggatcgca ttcgggctgt tcattgtgac gaatgcggcc 900aagctgaccg tcgcggtcgc gcggatcgcg ctgccgccga ttccggtacc cggcgaaacc 960gtggacaacg aggagttgct cgatcccgtc gcgaccccgg aggctaccag cgaagaaacc 1020ccgacctggc aggccatcat cgcgtcggtg cccgcgtccg cggtccggct caccgagcgc 1080agcaaactgg ccaagcaact tctgatcgga tacgtcacgt cgggcaccct gattctggct 1140gccggtgcca tcgcggtcgt ggtgcgcggg cacttctttg tacacagcct ggtggtcgcg 1200ggtttgatca cgaccgtctg cggatttcgc tcgcggcttt acgccgagcg ctggtgtgcg 1260tgggcgttgc tggcggcgac ggtcgcgatt ccgacgggtc tgacggccaa actcatcatc 1320tggtacccgc actatgcctg gctgttgttg agcgtctacc tcacggtagc cctggttgcg 1380ctcgtggtgg tcgggtcgat ggctcacgtc cggcgcgttt caccggtcgt aaaacgaact 1440ctggaattga tcgacggcgc catgatcgct gccatcattc ccatgctgct gtggatcacc 1500ggggtgtacg acacggtccg caatatccgg ttc 1533 8 840 DNA Mycobacteria tuberculosis 8atggctgaac cgttggccgt cgatcccacc ggcttgagcg cagcggccgc gaaattggcc 60ggcctcgttt ttccgcagcc tccggcgccg atcgcggtca gcggaacgga ttcggtggta 120gcagcaatca acgagaccat gccaagcatc gaatcgctgg tcagtgacgg gctgcccggc 180gtgaaagccg ccctgactcg aacagcatcc aacatgaacg cggcggcgga cgtctatgcg 240aagaccgatc agtcactggg aaccagtttg agccagtatg cattcggctc gtcgggcgaa 300ggcctggctg gcgtcgcctc ggtcggtggt cagccaagtc aggctaccca gctgctgagc 360acacccgtgt cacaggtcac gacccagctc ggcgagacgg ccgctgagct ggcaccccgt 420gttgttgcga cggtgccgca actcgttcag ctggctccgc acgccgttca gatgtcgcaa 480aacgcatccc ccatcgctca gacgatcagt caaaccgccc aacaggccgc ccagagcgcg 540cagggcggca gcggcccaat gcccgcacag cttgccagcg ctgaaaaacc ggccaccgag 600caagcggagc cggtccacga agtgacaaac gacgatcagg gcgaccaggg cgacgtgcag 660ccggccgagg tcgttgccgc ggcacgtgac gaaggcgccg gcgcatcacc gggccagcag 720cccggcgggg gcgttcccgc gcaagccatg gataccggag ccggtgcccg cccagcggcg 780agtccgctgg cggcccccgt cgatccgtcg actccggcac cctcaacaac cacaacgttg 840 9 2187 DNA Mycobacteria tuberculosis 9atgagtatta ccaggccgac gggcagctat gccagacaga tgctggatcc gggcggctgg 60gtggaagccg atgaagacac tttctatgac cgggcccagg aatatagcca ggttttgcaa 120agggtcaccg atgtattgga cacctgccgc cagcagaaag gccacgtctt cgaaggcggc 180ctatggtccg gcggcgccgc caatgctgcc aacggcgccc tgggtgcaaa catcaatcaa 240ttgatgacgc tgcaggatta tctcgccacg gtgattacct ggcacaggca tattgccggg 300ttgattgagc aagctaaatc cgatatcggc aataatgtgg atggcgctca acgggagatc 360gatatcctgg agaatgaccc tagcctggat gctgatgagc gccataccgc catcaattca 420ttggtcacgg cgacgcatgg ggccaatgtc agtctggtcg ccgagaccgc tgagcgggtg 480ctggaatcca agaattggaa acctccgaag aacgcactcg aggatttgct tcagcagaag 540tcgccgccac ccccagacgt gcctaccctg gtcgtgccat ccccgggcac accgggcaca 600ccgggaaccc cgatcacccc gggaaccccg atcaccccgg gaaccccaat cacacccatc 660ccgggagcgc cggtaactcc gatcacacca acgcccggca ctcccgtcac gccggtgacc 720ccgggcaagc cggtcacccc ggtgaccccg gtcaaaccgg gcacaccagg cgagccaacc 780ccgatcacgc cggtcacccc cccggtcgcc ccggccacac cggcaacccc ggccacgccc 840gttaccccag ctcccgctcc acacccgcag ccggctccgg caccggcgcc atcgcctggg 900ccccagccgg ttacaccggc cactcccggt ccgtctggtc cagcaacacc gggcacccca 960gggggcgagc cggcgccgca cgtcaaaccc gcggcgttgg cggagcaacc tggtgtgccg 1020ggccagcatg cgggcggggg gacgcagtcg gggcctgccc atgcggacga atccgccgcg 1080tcggtgacgc cggctgcggc gtccggtgtc ccgggcgcac gggcggcggc cgccgcgccg 1140agcggtaccg ccgtgggagc gggcgcgcgt tcgagcgtgg gtacggccgc ggcctcgggc 1200gcggggtcgc atgctgccac tgggcgggcg ccggtggcta cctcggacaa ggcggcggca 1260ccgagcacgc gggcggcctc ggcgcggacg gcacctcctg cccgcccgcc gtcgaccgat 1320cacatcgaca aacccgatcg cagcgagtct gcagatgacg gtacgccggt gtcgatgatc 1380ccggtgtcgg cggctcgggc ggcacgcgac gccgccactg cagctgccag cgcccgccag 1440cgtggccgcg gtgatgcgct gcggttggcg cgacgcatcg cggcggcgct caacgcgtcc 1500gacaacaacg cgggcgacta cgggttcttc tggatcaccg cggtgaccac cgacggttcc 1560atcgtcgtgg ccaacagcta tgggctggcc tacatacccg acgggatgga attgccgaat 1620aaggtgtact tggccagcgc ggatcacgca atcccggttg acgaaattgc acgctgtgcc 1680acctacccgg ttttggccgt gcaagcctgg gcggctttcc acgacatgac gctgcgggcg 1740gtgatcggta ccgcggagca gttggccagt tcggatcccg gtgtggccaa gattgtgctg 1800gagccagatg acattccgga gagcggcaaa atgacgggcc ggtcgcggct ggaggtcgtc 1860gacccctcgg cggcggctca gctggccgac actaccgatc agcgtttgct cgacttgttg 1920ccgccggcgc cggtggatgt caatccaccg ggcgatgagc ggcacatgct gtggttcgag 1980ctgatgaagc ccatgaccag caccgctacc ggccgcgagg ccgctcatct gcgggcgttc 2040cgggcctacg ctgcccactc acaggagatt gccctgcacc aagcgcacac tgcgactgac 2100gcggccgtcc agcgtgtggc cgtcgcggac tggctgtact ggcaatacgt caccgggttg 2160ctcgaccggg ccctggccgc cgcatgc 2187 10 426 DNA Mycobacteria tuberculosis 10atggccggac tgaacattta cgtgaggcgc tggcggacag cgcttcacgc aaccgtgtcg 60gcattgatag ttgccatcct cggactcgcc atcaccccgg tcgctagtgc ggcgacggcc 120agggcgacgt tgtcggtgac atcgacgtgg cagaccggtt tcatcgcccg cttcaccatc 180acaaactcga gcacggcgcc gctaaccgat tggaagcttg aattcgactt gccggcagga 240gaatccgtct tgcacacatg gaatagcacc gttgcacgat ctggcacgca ctacgttctc 300agcccagcga attggaatcg catcattgcc cccggtggtt cagccacggg cggcctaaga 360ggcgggctga ccggttctta ctcgccgccg tcgagttgtc tgctcaacgg gcaatatcct 420tgcacc 426 11 597 DNA Mycobacteria tuberculosis 11gtgaactcac cactggtcgt cggcttcctg gcctgcttca cgctgatcgc cgcgattggc 60gcgcagaacg cattcgtgct gcggcaggga atccagcgtg agcacgtgct gccggtggtg 120gcgctgtgca cggtgtccga catcgtgctg atcgccgccg gtatcgcggg gttcggcgca 180ttgatcggcg cacatccgcg tgcgctcaat gtcgtcaagt ttggcggcgc cgccttccta 240atcggctacg ggctacttgc ggcccggcgg gcgtggcgac ctgttgcgct gatcccatct 300ggcgccacgc cggttcgctt agccgaggtc ctggtgacct gtgcggcatt cacgttcctc 360aacccacacg tctacctcga caccgtcgtg ttgctaggcg cgctggccaa cgagcacagc 420gaccagcgct ggctgttcgg cctcggcgcg gtcacagcca gtgcggtatg gttcgccacc 480ctcgggttcg gagccggccg gttgcgcggg ctgttcacca accccggctc gtggagaatc 540ctcgacggcc tgatcgcggt catgatggtt gcgctgggaa tctcgctgac cgtgacc 597 12 909 DNA Mycobacteria tuberculosis 12atggtggatc cgcagcttga cggtccacag ctggccgcat tggctgccgt ggtcgaactg 60ggcagcttcg atgcggccgc ggagcgccta catgtcaccc cgtcggctgt cagtcagcgc 120atcaagtcgt tggagcagca ggtcggccag gtgctggtgg tcagggaaaa gccatgtcgg 180gcgacgaccg caggtatccc gctgttgcgg ttggccgcgc aaacagcgtt gctcgagtcc 240gaggcgctcg ctgaaatggg tggcaacgcg tcgctgaaac gcacgcggat caccattgcg 300gtaaacgccg attccatggc gacatggttt tcggccgtgt tcgacggtct cggcgacgtc 360ctgctcgacg ttcggatcga ggaccaggac cattccgcgc ggctgctacg ggagggtgtg 420gcgatgggcg cggtgaccac cgagcggaac ccggtgccgg gctgccgggt gcacccgctg 480ggtgaaatgc gctacctacc agtggccagc aggccattcg tccagcgcca tctatccgac 540gggttcactg ccgccgcggc ggctaaagct ccgtcactgg cgtggaatcg tgacgatggg 600ctgcaggaca tgttggtgcg taaggccttt cgtcgcgcca tcaccagacc gacgcacttt 660gtcccgacca cagagggctt caccgccgca gcgcgcgccg ggctgggatg gggcatgttc 720cccgagaagc tggcagcatc tccgcttgcc gatggatcgt tcgtacgggt ctgcgacata 780cacctcgacg tccctctcta ttggcaatgc tggaaactgg acagtccgat catcgcgcga 840attaccgaca cggtgagggc ggcggcaagc ggtctgtacc ggggccagca acgccgccgc 900cgaccgggt 909 13 651 DNA Mycobacteria tuberculosis 13atgactccac gcagccttgt tcgcatcgtt ggtgtcgtgg ttgcgacgac cttggcgctg 60gtgagcgcac ccgccggcgg tcgtgccgcg catgcggatc cgtgttcgga catcgcggtc 120gttttcgctc gcggcacgca tcaggcttct ggtcttggcg acgtcggtga ggcgttcgtc 180gactcgctta cctcgcaagt tggcgggcgg tcgattgggg tctacgcggt gaactaccca 240gcaagcgacg actaccgcgc gagcgcgtca aacggttccg atgatgcgag cgcccacatc 300cagcgcaccg tcgccagctg cccgaacacc aggattgtgc ttggtggcta ttcgcagggt 360gcgacggtca tcgatttgtc cacctcggcg atgccgcccg cggtggcaga tcatgtcgcc 420gctgtcgccc ttttcggcga gccatccagt ggtttctcca gcatgttgtg gggcggcggg 480tcgttgccga caatcggtcc gctgtatagc tctaagacca taaacttgtg tgctcccgac 540gatccaatat gcaccggagg cggcaatatt atggcgcatg tttcgtatgt tcagtcgggg 600atgacaagcc aggcggcgac attcgcggcg aacaggctcg atcacgccgg a 651 14 1674 DNA Mycobacteria tuberculosis 14gtgtcatttc tggtcgtggt tcccgagttc ttgacgtccg cggcagcgga tgtggagaac 60ataggttcca cactgcgcgc ggcgaatgcc gcggctgccg cctcgaccac cgcgcttgcg 120gccgctggcg ctgatgaggt atcggcggcg gtggcagcgc tgtttgccag gttcggtcag 180gaatatcaag cggtcagcgc gcaggcgagc gctttccatc aacagttcgt gcagacgctg 240aactcggcgt caggatcgta tgcggccgcg gaggccacca tcgcgtcaca gttgcagacc 300gcgcagcacg atctgctggg cgcggtcaat gcaccaaccg aaacgttgtt ggggcgtccg 360ctaatcggcg acggagcacc cgggacggca acgagtccga atggcggggc gggtgggctg 420ctgtacggca acggcggcaa cggttattcc gcgacggcgt cgggggtcgg cggcggggcc 480ggcggttccg cggggttgat cggcaatggc ggcgccgggg gagccggcgg acccaacgcc 540cccgggggag ccggcggcaa cggtggctgg ctgctcggca acggcgggat cggcgggccc 600gggggcgcgt cgagcatccc cggcatgagt ggtggagccg gcggaaccgg cggtgccgca 660ggacttttgg gctggggagc gaacggcgga gccggcggcc tcggtgatgg agtcggtgtc 720gatcgtggca cgggcggcgc cggaggccgc ggcggcctgt tgtatggcgg atacggcgtc 780agtgggccag gcggcgacgg cagaaccgtc ccgctggaga taattcatgt cacagagccg 840acggtacatg ccaacgtcaa cggcggaccg acgtcaacca ttctggtcga caccggatcc 900gctggtcttg ttgtctcgcc tgaggatgtc gggggaatcc tgggagtgct tcacatgggc 960ctcccaaccg gattgagcat cagcggttac agcggggggc tgtactacat cttcgccacg 1020tataccacga cggtggactt cgggaatggc atcgtcaccg cgccgaccgc cgttaatgtc 1080gtcctcttgt ccatcccaac gtcccccttc gccatttcga cctacttcag cgccttgctg 1140gccgatccga caacaactcc gttcgaagcc tatttcggtg ccgtcggcgt ggacggcgtt 1200ctgggagttg ggcccaatgc ggtgggacca ggccccagca ttccgacgat ggcgttaccg 1260ggtgacctca accagggagt gctcatcgac gcacccgcag gtgagctcgt gttcggtccc 1320aacccgctac ctgcgcccaa cgtcgaggtc gtcggatcgc cgatcaccac cctgtacgta 1380aagatcgatg gtgggactcc catacccgtc ccctcgatca tcgattccgg tggggtaacg 1440ggaaccatcc cgtcatatgt catcggatcc ggaaccctgc cggcgaacac aaacattgag 1500gtctacacca gccccggcgg tgatcggctc tacgcgttca acacaaacga ttaccgcccg 1560accgtcattt catccggcct gatgaatacc gggttcttgc ccttcagatt ccagccggtg 1620tacatcgact acagccccag cggtataggg acaacagtct ttgatcatcc ggcg 1674 15 1674 DNA M. tuberculosis 15gtgtcatttc tggtcgtggt tcccgagttc ttgacgtccg cggcagcgga tgtggagaac 60ataggttcca cactgcgcgc ggcgaatgcc gcggctgccg cctcgaccac cgcgcttgcg 120gccgctggcg ctgatgaggt atcggcggcg gtggcagcgc tgtttgccag gttcggtcag 180gaatatcaag cggtcagcgc gcaggcgagc gctttccatc aacagttcgt gcagacgctg 240aactcggcgt caggatcgta tgcggccgcg gaggccacca tcgcgtcaca gttgcagacc 300gcgcagcacg atctgctggg cgcggtcaat gcaccaaccg aaacgttgtt ggggcgtccg 360ctaatcggcg acggagcacc cgggacggca acgagtccga atggcggggc gggtgggctg 420ctgtacggca acggcggcaa cggttattcc gcgacggcgt cgggggtcgg cggcggggcc 480ggcggttccg cggggttgat cggcaatggc ggcgccgggg gagccggcgg acccaacgcc 540cccgggggag ccggcggcaa cggtggctgg ctgctcggca acggcgggat cggcgggccc 600gggggcgcgt cgagcatccc cggcatgagt ggtggagccg gcggaaccgg cggtgccgca 660ggacttttgg gctggggagc gaacggcgga gccggcggcc tcggtgatgg agtcggtgtc 720gatcgtggca cgggcggcgc cggaggccgc ggcggcctgt tgtatggcgg atacggcgtc 780agtgggccag gcggcgacgg cagaaccgtc ccgctggaga taattcatgt cacagagccg 840acggtacatg ccaacgtcaa cggcggaccg acgtcaacca ttctggtcga caccggatcc 900gctggtcttg ttgtctcgcc tgaggatgtc gggggaatcc tgggagtgct tcacatgggc 960ctcccaaccg gattgagcat cagcggttac agcggggggc tgtactacat cttcgccacg 1020tataccacga cggtggactt cgggaatggc atcgtcaccg cgccgaccgc cgttaatgtc 1080gtcctcttgt ccatcccaac gtcccccttc gccatttcga cctacttcag cgccttgctg 1140gccgatccga caacaactcc gttcgaagcc tatttcggtg ccgtcggcgt ggacggcgtt 1200ctgggagttg ggcccaatgc ggtgggacca ggccccagca ttccgacgat ggcgttaccg 1260ggtgacctca accagggagt gctcatcgac gcacccgcag gtgagctcgt gttcggtccc 1320aacccgctac ctgcgcccaa cgtcgaggtc gtcggatcgc cgatcaccac cctgtacgta 1380aagatcgatg gtgggactcc catacccgtc ccctcgatca tcgattccgg tggggtaacg 1440ggaaccatcc cgtcatatgt catcggatcc ggaaccctgc cggcgaacac aaacattgag 1500gtctacacca gccccggcgg tgatcggctc tacgcgttca acacaaacga ttaccgcccg 1560accgtcattt catccggcct gatgaatacc gggttcttgc ccttcagatt ccagccggtg 1620tacatcgact acagccccag cggtataggg acaacagtct ttgatcatcc ggcg 1674 16 417 DNA Mycobacteria tuberculosis 16atgatcgtgg acacaagcgc cgtggtggcc ctggttcaag gcgagcggcc gcacgccacc 60ctggtcgcgg ccgccctggc cggcgcccat agccccgtca tgtctgcacc caccgtcgcc 120gaatgcctga ttgtcttgac cgcccgtcac ggccccgttg cgcgcacgat cttcgaacga 180cttcgcagcg aaatcggctt gagcgtgtca tctttcaccg ccgagcatgc cgctgccacg 240caacgagcct ttctgcgata cggcaagggg cgccaccgcg cggctctcaa cttcggagac 300tgtatgacgt acgcgaccgc ccagctgggc caccaaccac tgctggccgt cggcaacgac 360ttcccgcaaa ccgaccttga gttccgcggc gtcgtcggct actggccagg cgtcgcg 417 17 684 DNA M. tuberculosis 17gtgcgcatca agatcttcat gctggtcacg gctgtcgttt tgctctgttg ttcgggtgtg 60gccacggccg cgcccaagac ctactgcgag gagttgaaag gcaccgatac cggccaggcg 120tgccagattc aaatgtccga cccggcctac aacatcaaca tcagcctgcc cagttactac 180cccgaccaga agtcgctgga aaattacatc gcccagacgc gcgacaagtt cctcagcgcg 240gccacatcgt ccactccacg cgaagccccc tacgaattga atatcacctc ggccacatac 300cagtccgcga taccgccgcg tggtacgcag gccgtggtgc tcaaggtcta ccagaacgcc 360ggcggcacgc acccaacgac cacgtacaag gccttcgatt gggaccaggc ctatcgcaag 420ccaatcacct atgacacgct gtggcaggct gacaccgatc cgctgccagt cgtcttcccc 480attgtgcaag gtgaactgag caagcagacc ggacaacagg tatcgatagc gccgaatgcc 540ggcttggacc cggtgaatta tcagaacttc gcagtcacga acgacggggt gattttcttc 600ttcaacccgg gggagttgct gcccgaagca gccggcccaa cccaggtatt ggtcccacgt 660tccgcgatcg actcgatgct ggcc 684 18 684 DNA M. tuberculosis 18gtgcgcatca agatcttcat gctggtcacg gctgtcgttt tgctctgttg ttcgggtgtg 60gccacggccg cgcccaagac ctactgcgag gagttgaaag gcaccgatac cggccaggcg 120tgccagattc aaatgtccga cccggcctac aacatcaaca tcagcctgcc cagttactac 180cccgaccaga agtcgctgga aaattacatc gcccagacgc gcgacaagtt cctcagcgcg 240gccacatcgt ccactccacg cgaagccccc tacgaattga atatcacctc ggccacatac 300cagtccgcga taccgccgcg tggtacgcag gccgtggtgc tcaaggtcta ccagaacgcc 360ggcggcacgc acccaacgac cacgtacaag gccttcgatt gggaccaggc ctatcgcaag 420ccaatcacct atgacacgct gtggcaggct gacaccgatc cgctgccagt cgtcttcccc 480attgtgcaag gtgaactgag caagcagacc ggacaacagg tatcgatagc gccgaatgcc 540ggcttggacc cggtgaatta tcagaacttc gcagtcacga acgacggggt gattttcttc 600ttcaacccgg gggagttgct gcccgaagca gccggcccaa cccaggtatt ggtcccacgt 660tccgcgatcg actcgatgct ggcc 684 19 1443 DNA Mycobacteria tuberculosis 19gtggtcggcc cgcggacgag aggatatgcg atccacaagc tgggtttctg cagcgtcgtc 60atgctcggga tcaactcgat aatcggcgcc ggtatcttcc taactccagg tgaggtgatc 120gggctcgcag gacccttcgc gccgatggcc tatgttttag ctggcatttt cgcgggtgtc 180gtggcgatcg tcttcgcgac ggcggcaagg tacgtcagaa caaacggtgc ctcctacgcc 240tacacaacgg ccgcatttgg gcgccggatc ggcatctatg tcggtgtcac ccacgccatt 300accgcgtcca tcgcttgggg ggtgttggct tcttttttcg tctcgacgct gttgcgagtg 360gccttccccg acaaggcctg ggccgacgcc gagcaactgt tcagtgtgaa gacgctgacg 420tttctcggct ttatcggcgt gctgttggcc atcaacctct tcggcaaccg ggcgatcaag 480tgggccaacg gaacgtcaac ggtaggcaag gcattcgcgc tctcggcatt cattgtcggc 540gggctgtgga tcatcaccac ccagcacgtg aacaactacg caacggcgtg gtcggcatac 600agcgcgaccc cgtactcgtt gcttggcgtc gccgaaattg gcaagggcac gttctcgagt 660atggcgctgg ccacgattgt cgcgttgtac gcattcaccg gtttcgaatc gatcgcgaac 720gccgccgaag aaatggacgc gccggaccgg aacctgccga gagctatacc gatcgcgatc 780ttctcggttg gcgcgatcta cttgctcacc ctaacggtag cgatgctgct cggatcgaac 840aagatcgccg cgtcggacga caccgtgaaa ctggccgcgg ccatcggaaa cgctaccttc 900cgaacgatca tcgtcgtcgg agccctgata tcgatgttcg gcatcaatgt cgcggcctcg 960ttcggtgcac cgcggctttg gaccgcgtta gcggacagcg gggttctgcc gacacgcttg 1020tcacgcaaga accaatacga cgtgccgatg gtctccttcg caattacggc gtcgttggcg 1080ctcgcattcc cgttggcgct gcggttcgac aacctgcacc tgaccggcct ggcggtgatc 1140gcccgattcg tccagttcat catcgtgccg atcgctctca tcgcattggc gaggtctcag 1200gcagtagaac atgctgctgt gcggcgaaat gcgttcaccg acaaggtgtt accgcttgtt 1260gcgatcgtgg tctcggttgg gctggcagtg tcctacgact accgctgcat ctttctagtg 1320cggggtggtc cgaactactt ctcgattgct ttgatcgtga tcacgttcgt cgtggtaccg 1380gcgatggctt atctgcacta ctaccgaatc attcgccggg ttggcgatcg gccgagcact 1440cgc 1443 20 846 DNA Mycobacteria tuberculosis 20atgggtgagg cgaacatccg cgagcaggcg atcgccacga tgccacgggg tggccccgac 60gcgtcttggc tggatcgtcg attccagacc gacgcactgg agtacctcga ccgcgacgat 120gtgcccgatg aggtcaaaca gaagatcatc ggggtgctcg accgggtggg caccctgacc 180aacctgcacg agaagtacgc ccggatagcc ctgaaacttg tttctgacat tcccaacccg 240cgaatcctgg aacttggtgc gggccatggc aagctctcag cgaaaatcct cgagctacac 300ccgacagcga cggtgacgat cagcgatcta gatcccacct cggtggccaa catcgccgcg 360ggagagctgg gaacacatcc gcgagcacgc acccaagtga tcgacgccac cgcaatcgac 420ggccacgacc acagctatga cctggcggtc ttcgcgctgg catttcacca cctgccgcct 480acggtcgcct gcaaagcgat cgccgaggcc acccgggtgg ggaagcgctt tctgatcatc 540gacctcaaac ggcagaaacc gctgtcgttc acgctctctt cggtgctgct actgccgctc 600cacctactgc tgctgccatg gtcgtcgatg cgctcgagca tgcacgacgg ctttatcagc 660gcactacgtg cctacagtcc ctcggcgttg cagacgcttg cccgcgccgc cgatccggga 720atgcaggttg aaatcttgcc cgcaccgacc aggctattcc cgccatcgct cgccgttgtg 780ttctcccgtt cgagctcagc gccaacggaa tctagcgagt gctcggccga tcgccaaccc 840ggcgaa 846 21 1407 DNA Mycobacteria tuberculosis 21gtgagataca ctacacctgt gcgtgctgct gtctacctcc gaatctcaga agaccgctcc 60ggcgaacagc tcggcgtggc ccgccaacgc gaggactgcc taaagctgtg cgggcagcga 120aaatgggtgc ccgtcgagta cctcgacaac gacgtcagcg catcaaccgg caagcgccgc 180cccgcctacg agcagatgtt ggccgacatc accgccggca agatcgccgc cgtggtggcc 240tgggacctgg accggctcca tcgccgtccc atcgagctgg aagccttcat gtcattagcc 300gacgagaagc ggctggccct ggccaccgtc gccggcgacg ttgacctggc gacaccccag 360ggccggctag tcgcccgcct gaaggggtcg gtggccgctc acgaaaccga gcacaagaag 420gcacgacagc gccgcgccgc ccgccagaaa gctgaacgcg gccaccccaa ctggtcgaaa 480gccttcggct acctgcccgg ccccaacggt cccgaacccg acccccggac agcgccgctg 540gtcaaacagg cctacgccga catcctcgcc ggggcgtccc tgggcgacgt gtgccgccag 600tggaacgacg ccggggcgtt caccatcacc ggccgcccgt ggacgactac aacgctgtcg 660aaattcttgc gcaaaccccg caacgccgga ctacgcgcat ataagggtgc ccgctacggc 720ccggtggacc gcgacgcgat tgtcggcaag gcccagtggt cgccgctggt ggacgaggcg 780acgttctggg ccgcccaggc cgtgctggac gcccccggcc gcgcccccgg ccgcaaaagc 840gtgcgccgcc acctgctgac cgggctggca ggctgcggca aatgcggcaa ccacctggcc 900ggcagctacc gcaccgacgg ccaggtcgtc tacgtgtgca aggcgtgcca cggggtggcc 960atcctggccg acaacatcga accgatcctg tatcacatcg tggccgagcg gctggccatg 1020cccgacgccg ttgacttgtt gcgccgggag attcacgacg ccgccgaagc cgaaaccatc 1080cgcctggaac tggaaaccct ctacggggag ctggacaggc tcgccgtcga acgcgccgaa 1140gggctactga ccgcgcgcca ggtgaagatc agcaccgaca tcgtcaacgc caagataacg 1200aaacttcagg cccgccaaca ggatcaggaa cggctccgag tgttcgacgg gataccgttg 1260ggaacaccgc aagtcgccgg gatgatagcc gagctgtcgc cggaccggtt ccgcgccgtc 1320ctcgacgtcc tcgctgaagt cgttgtccag ccggtcggca agagcggcag gatattcaat 1380cccgaacggg tgcaggtgaa ttggcga 1407 22 513 DNA M. tuberculosis 22atgagccggc accacaacat cgtgatcgtc tgtgaccacg gccgcaaagg cgatggccgc 60atcgaacacg agcgctgcga tcttgtcgcg ccgatcattt gggtcgacga gacccagggc 120tggttaccgc aggcgccagc ggtggcaaca ttactcgacg acgacaacca gccgcgagcc 180gttattggct tgccgcccaa cgagtctcgc ctacgacctg aaatgcgccg cgacgggtgg 240gtgcggctgc actgggaatt cgcctgcctg aggtacggcg ccgccggcgt gcgcacgtgc 300gagcagcggc ccgtgcgggt tcgcaacggc gacctgcaaa cactgtgcga gaacgttccg 360cggctactga ccggactggc cggcaacccc gactacgcac cgggttttgc ggtgcagtcg 420gacgcggtgg tcgtcgccat gtggctgtgg cgcacgctct gcgaaagcga cacgccgaac 480aaactacgcg ccaccccaac gcgtggtagc tgc 513 23 219 DNA M. tuberculosis 23gtgtcgacca tctaccatca tcgcggccgc gtagccgcac tgtctcgttc ccgcgcatcc 60gacgatcccg agttcatcgc cgcgaaaacc gatctcgttg ccgcgaacat cgcggactac 120ctcatccgca ccctcgccgc agcgccgccc ctgactgacg agcagcgcac ccggctggcc 180gagctgctgc gccccgtgcg gcggtcaggc ggtgcccga 219 24 396 DNA Mycobacteria tuberculosis 24atgaccgccg gcgccggcgg gtcgccgccg acgcgacgat gcccggccac ggaggaccgg 60gcacccgcga cagtcgccac accgtctagc gccgatccta ccgcgtcacg cgccgtgtcg 120tggtggtcgg tgcacgagca tgtcgcgccg gtcctggatg ctgccgggtc gtggccgatg 180gccggcacac cggcctggcg tcagctcgac gacgccgatc ctcgcaaatg ggccgcgatc 240tgcgacgcag cccggcactg ggctctgagg gtagagacgt gccaggaggc gatggcgcag 300gcgtcacgtg acgtatctgc ggccgccgac tggcccggca tcgcccgcga gatcgtccga 360cggcgcggcg tgtacatccc gcgggcgggg gtggcg 396 25 1413 DNA Mycobacteria tuberculosis 25atggccgaca tcccctacgg caccgactat cccgacgccc cctggatcga ccgggacggg 60cacgtgctca tcgacgacgg tggcaaaccg acgcaagttc atcgcggcca agcccgaatc 120gcctaccggc tagccgaacg ttaccaggac aagctgctgc acgtggccgg gatcggctgg 180cactcctggg acggcagacg ctgggcagcc gacgaccgcg gcgaagccaa acgtgcagtg 240ctggcagagc tgcgccaagc gctctcagac agcctcaacg acaaggaatt acgcgccgac 300gtccgaaaat gcgaatcggc gtccggcgtg gccggcgtgc tcgacctggc cgccgcactg 360gtaccattcg ccgcgacggt agccgacctc gacagcgacc cgcacttgct caacgtcgcg 420aatgggacgc tggacctgca cacgctcaaa ttgcggcccc acgcgcccgc tgaccgcatc 480acaaagatat gccgcggtgc ctaccagtcc gacaccgaat cgcctctctg gcaagcgttc 540ttgacccgcg ttctgcccga tgaaggtgtg cgcgggttcg tgcaacgcct ggccggcgtc 600ggcctactag gcaccgtccg cgaacatgtc ctggcgattc ttatcggtgt aggtgccaac 660ggaaaatctg tgttcgacaa ggcgattcgc tatgcccttg gcgattatgc ctgcaccgct 720gagcctgacc ttttcatgca ccgggaaaac gctcacccaa caggcgaaat ggacctccgc 780ggcgtgcgat gggtagcggt atccgagagc gaaaaagatc gccggctggc cgaatcaacg 840ataaaacggc tgactggcgg cgacaccatc cgcgcccgaa agatgcggca agacttcgtg 900gaattcacgc cgtcacatac cccactgctc atcaccaacc acctaccgag agtgcccggc 960gatgatacgg ccatctggcg gcgaattcga gtggtgccgt ttgaagtagt gattcctgcc 1020gacgagcagg accgggaact ggacgcacgg ttgcagttgg aggccgacag catcctgtcc 1080tgggcggtgg ccggatggag cgactatcag cgaatcggac tatcccagcc ggacgcggtg 1140ctcgcggcaa cgtcgaatta ccgcgaggac tccgacacga taaagaggtt catcgacgac 1200gaatgcgtca ccagctcgcc ggtgctgaaa gccactacta cgcatctgtt cgaggcgtgg 1260caaaggtggc gggtgcaaga aggcgtaccc gaaatctcgc gcaaagcgtt cggccagtcg 1320ctcgacaccc acggataccc ggtcactgac aaggcccgtg atggtcgttg gcgggccgga 1380atagcggtga gaggggccga tgatttcgat gat 1413 26 393 DNA Mycobacteria tuberculosis 26atgaccgctg tcgcgatcac cccggcatcc ggcggtcggc acagcgtccg attcgcctac 60gactctgcga tcgtgtcgtt gatcaagtcc acgatccccg cctatgcccg ctcctggtcc 120gcgcacaccc gctgctggtt catcgacgct gactggaccc cactgctggc cgccgagctg 180cgctaccacg gccacaccgt caccggaccc gccgacccgg cgcaacagca gtgcaccgac 240tgggccaaag cgttgttccg ggcggtcgga ccccagcgga cacccgccgt gtacagggct 300ttatccaaag tgctgcaccc cgacgcccca accggatgcc cgatactgca acagcagctc 360aatgccgcca gaaccgcact taccaaccct gct 393 27 270 DNA Mycobacteria tuberculosis 27atggctgaaa cccccgacca cgccgaactg cggcgacgaa tcgccgacat ggctttcaac 60gccgatgtcg gtatggcgac ctgcaaacgc tgtggtgacg ccgtgccgta catcatcctg 120ccgaacctgc agaccggcga acccgtcatg ggtgtcgccg acaacaaatg gaagcgcgcg 180aactgtcccg tcgacgtcgg taagccgtgc ccgttcctaa tcgccgaggg tgtcgccgac 240agcaccgacg acaccataga ggtcgaccag 270 28 312 DNA Mycobacteria tuberculosis 28gtgaccccga tcaaccggcc cctgaccaac gacgaacgac aactgatgca cgagctggca 60gtccaggttg tctgctcgca gacgggttgc tcacccgatg cggcggtcga agcactcgaa 120tccttcgcga aagacggaac acttatcctc cgcggcgaca ccgagaacgc ctacctcgaa 180gccggaggca atgttcttgt ccatgccgat cgtgactggc ttgccttcca cgcgtcgtat 240cccggcaacg acccgctgcg agacgcccga cctatcgagc aggacgacga ccagggggcg 300gggtcgccat cg 312 29 468 DNA Mycobacteria tuberculosis 29atgccaagac caccgaaacc ggcccggctc aaactggttg agggccgctc ccccggccgc 60gattccggcg gccggaaagt ccccgagtcg ccgaagttta tccgtcaggc accggatgcc 120ccggactggc tcgacgccga ggcgctggcc gaatggcggc gcgtcgcacc gactttggag 180cggcttgacc tgctcaaacc tgaggatcgg gcgctcctgt ccgcgtactg cgagacctgg 240tccgtctacg tcgcggcggt tcagcgggtc cgcgccgaag gcctcacaat tacctcaccg 300aaatccggtg tcgtgcaccg gaacccggcg gtgacggttg cggagacggc gcgcatgcat 360ctgctgcgct tggcctccga gtttggcctg accccggccg ccgagcagcg actggcggtg 420gcgccgggcg acgacggcga cgggctcaac ccgtttgccc cggaccgg 468 30 510 DNA Mycobacteria tuberculosis 30atggccgagc tgcggtctgg cgaaggccga accgtgcacg gcaccatcgt gccctacaac 60gaggcgacca ccgtccgcga cttcgacggc gagttccagg aaatgttcgc tcctggcgct 120tttcggcgct ccatcgccga gcgcggccac aaattgaagc tgctggtctc tcacgacgct 180cgaacccgct acccggtggg ccgggccgtt gagttgcggg aggagcctca cggcttgttc 240ggggcgttcg agattgcgga caccccggac ggcgacgagg ctttggcgaa cgtaaaagct 300ggtgtcgtcg actcgttttc ggtgggtttc cgaccgatcc gggaccgtcg cgaaggggat 360gtgctggtgc gcgtcgaagc ggcgctgtta gaggtttccc taaccggcgt tccggcctat 420tcgggggcac aaatcgccgg ggtgcgcgcg gaatcgctta cagtcgtttc ccgttcgaca 480gccgaagcct ggctgtccct actcgattgg 510 31 1419 DNA Mycobacteria tuberculosis 31atgaccgaat tcgacgacat caaaaacctc tctttacctg aaacccgtga cgcggcgaag 60cagctcctcg acagtgtcgc cggcgacctg accggtgagg cggcgcagcg ttttcaggcg 120ctgacgcgcc acgccgagga actgcgggcg gagcagcgcc gccgcggccg cgaagccgag 180gaggcgctgc gccgctaccg ggccggtgag ctgagggtgg tgcccggcgc tcccaccggc 240ggcgacgacg gcgacgcgcc gccgggcaac tcgttgcggg acaccgcgtt tcgcacactg 300gattcttgtg tgcgagacgg cctgatgtcg tcgcgggcgg cggagaccgc ggaaaccttg 360tgccgcaccg ggccgccgca gtccacctcg tgggcgcagc gctggctggc ggccaccggc 420agccgcgact atttgggcgc gttcgtcaag cgggtttcca atcctgttgc ggggcacacg 480gtttggaccg accgggaagc ggccgcgtgg cgtgaggctg ccgcggtggc cgccgagcag 540cgagcgatgg gcctggtgga cacccaaggc gggtttctga tcccggcggc gctggacccg 600gcgatcctgc tgtcgggtga tgggtcgacg aacccgattc ggcaggtggc gagggtggtg 660caaacgacct ccgagatttg gcggggcgtg acttccgaag gcgccgaagc tcgttggtac 720tccgaagccc aggaggtgtc cgacgattcg ccagcgttgg cccagccggc ggtgccgaac 780taccgtggaa gctgctggat tccgttctcc atcgagctgg agggtgacgc ggcgagcttc 840gttggcgaga tcggcaagat tctcgcggac agcgttgagc aactgcaggc cgcggcgttc 900gtcaacggct ccggcaacgg cgagcccacc gggttcgtca gcgcgctaac cggcacctcc 960gatcaggtgg tcgtcggcgc ggggtcagaa gcgattgtgg cggcggatgt ttacgcgttg 1020cagtcggcgc tgccgccaag gttccaggcc agcgccgcgt tcgcggcgaa cttgtccacc 1080atcaacacgt tgcggcaggc ggaaacttcg aatggcgcgc tgaaattccc atcgctgcac 1140gacagtccgc cgatgctagc cgggaagtct gtcctggaag tctcccacat ggacaccgtt 1200gattcggcgg tgacagcgac gaatcatcca ctggtgcttg gcgactggaa gcaattcctc 1260atcggcgaca gagttgggtc catggtggag ttggtgcctc acctgttcgg gccgaatcgc 1320cggccgaccg ggcagcgcgg attcttcgcc tggttcaggg tcggatcaga tgtgctggtg 1380cgcaacgcgt ttcgagttct gaaggtggag actaccgcg 1419 32 351 DNA Mycobacteria tuberculosis 32atggcgccgc tggccgccgg atcgccgagc tggaacggcc gaaagccaag cagcggcaac 60aggaaggcgg cgaccatggc cgccaggctc gatattctgg cttggggccc atgggcccca 120agccagaatc ggagcgtcgt tcgacgaaaa cagacactgc tatcggcgca gccctcggca 180tctccgccgg cacctaccgg cggctcaaac gaatcgacaa cgcaacccgc agcgagttgg 240cgcgtgggcg gcccggcacc cctaagcaga ggccgcccac gcctggccct atcctaccta 300cgcggtagtc tccaccttca gaactcgaaa cgcgttgcgc accagcacat c 351 33 309 DNA Mycobacteria tuburculosis 33atgggctaca aaccagaatc agagcgtcat tcgacgaaaa cagacactgc tatcggcgca 60gccctcggca tctccgccgg cacctaccgg cggctcaaac gaatcgacaa cgcaacccac 120agcgacgaca aagaaatccg ccggttcgcg gagaaacaaa tggcgccgct ggtcgccgga 180tcgccgagct ggaacgcccg aaagccaagg agcgccaacg cgagggtggt cgcctcggtg 240catcgatcac caatgccggc tttggtccca tggaaccaaa gccgtctcag cgccacactg 300acaaggagg 309 34 408 DNA Mycobacteria tuburculosis 34atgaccacca caccagcacg tttcaaccac ttggtgacgg taaccgacct ggaaacgggt 60gaccgcgccg tctgcgaccg cgaccaggtg gccgagacga tccgggcgtg gttcccggac 120gcgcccttgg aggtgaggga agcgctcgtt cggctgcagg ccgcgttgaa tcggcacgag 180cacaccggcg agctcgaagc gttcctgcgg atcagcgtcg agcacgccga cgccgccggc 240ggcgacgagt gcggcccggc gatcctggcc ggccgctccg ggccggaaca agccgccatc 300aaccggcaac tcggactcgc cggcgacgac gagcccgacg gcgacgacac cccgccgtgg 360agccggatga tcgggcttgg cggcggaagc ccagcggaag acgagcgc 408 35 1407 DNA Mycobacteria tuburculosis 35gtgaaacggc tcagcggctg ggacgcggta ctgctttaca gcgagacccc gaatgtgcac 60atgcacacac tcaaggtcgc cgtgatcgaa ttggattcgg acagacagga attcggtgtc 120gacgcgtttc gcgaggtgat cgctggccgg ctgcataagc ttgagccatt gggctatcag 180ctggttgatg tcccgttgaa gttccatcac ccgatgtggc gggagcactg ccaggtcgat 240ctcaactacc acatccggcc gtggcggttg cgcgccccgg ggggtcggcg cgaactcgac 300gaggcggtcg gagaaatcgc cagcaccccg ctgaaccgcg accacccgct gtgggagatg 360tacttcgttg aggggcttgc caaccaccgg atcgcggtgg ttgccaaaat tcaccatgcg 420ttggctgacg gtgttgcctc ggcaaacatg atggcacggg ggatggatct gctgccggga 480ccggaggtcg gccgctatgt gcctgacccc gctcctacca agcggcagtt gctgtccgcg 540gcgttcatcg accacttgcg ccacctcggc cggattcctg caaccatccg gtacaccacg 600cagggtctag gccgggtgcg acgtagctcg cgcaagctct cacccgcact gaccatgcca 660tttaccccgc caccgacgtt catgaatcac cggctcaccc cggagcgcag gttcgccacc 720gccaccctgg cgctgattga cgtgaaggcg acggccaagt tgctgggggc gacgatcaac 780gacatggtgc tggccatgtc gaccggcgct ctgcgtaccc tgctattgcg ctatgacggc 840aaggccgaac cgctgctggc gtcggtcccg gtgagttacg acttctcacc ggagcggatc 900tccggtaacc gcttcaccgg aatgctggtg gcgctgcctg ccgactccga cgacccgttg 960cagcgggtgc gcgtctgtca cgaaaacgcg gtctccgcca aggagagcca ccagcttttg 1020ggaccggagt tgatcagccg ctgggcggct tactggccac ctgccggtgc ggaagccttg 1080ttccggtggt tgtctgagcg cgacgggcag aacaaggtac tcaacttgaa tatctcgaat 1140gttcccggtc cgcgcgaacg cggccgcgtg ggggccgcgc tggtcaccga gatctattcg 1200gtgggcccgt tgaccgccgg tagcggattg aatatcacgg tgtggagtta tgtcgatcag 1260ctcaatatct cggtgttaac cgatggttcc accgtgcagg acccgcatga agtaaccgcg 1320ggaatgatcg cggacttcat cgaaatacgc cgcgccgctg gtctttccgt ggagttgaca 1380gtcgtcgagt ccgcgatggc gcaggca 1407 36 786 DNA Mycobacteria tuburculosis 36atgagcagcg aaagcgacgc agccaacacc gaacctgagg ttctggtaga acagcgggat 60cggattttga tcatcacgat caaccgcccg aaagccaaga acgcggtcaa cgccgcagtc 120agccggggct tggccgatgc gatggatcag cttgacggcg atgccggcct gtcggtggca 180atcctgaccg gtgggggcgg ttcgttctgc gcgggcatgg acctcaaggc gttcgcccgg 240ggcgagaatg tcgtcgtcga aggtcgcggc cttggcttta ccgaacgtcc gccgaccaag 300ccgctcattg ctgcggtgga aggctacgcg ttggcgggtg gcaccgagct ggcgcttgct 360gccgacctga tcgtggcggc cagggattcg gcgttcggga ttcctgaagt caagcggggt 420ctggttgccg gcggcggggg attgctgcgg ttgccggagc gcatcccgta tgcgatagcc 480atggagttgg cgctgaccgg tgacaaccta ccggccgaac gcgcgcacga gctggggctc 540gtcaacgttt tggccgagcc ggggaccgcc ctcgatgctg cgatcgcgtt ggcggagaag 600atcaccgcca atgggccgct ggcggtggtg gccaccaagc ggattatcac cgagtcgcgt 660gggtggagtc ccgacactat gttcgctgag cagatgaaga tcctggtgcc ggtgttcacc 720tccaacgacg cgaaggaagg tgcgatcgcg ttcgccgaga ggcgccggcc ccgttggacg 780ggcacc 786 37 1461 DNA M. tuberculosis 37atgtctgaca gtgccacgga atacgacaag cttttcatcg gcggcaagtg gaccaaaccg 60tcgacctccg atgttatcga ggtacgctgc ccagccactg gggaatatgt cggcaaggtg 120ccgatggcgg ccgccgccga cgtcgacgcc gcggtcgccg cagcacgtgc ggcgttcgac 180aacggcccct ggccctcgac cccgccgcac gagcgtgcgg cggtgatcgc tgcggcggtc 240aagatgctgg ctgagcgcaa ggacctgttc accaagctgc tcgcagccga aaccggccag 300ccgccgacca tcatcgagac gatgcactgg atgggttcga tgggggcgat gaactacttt 360gccggtgcag cggacaaggt cacctggacc gaaacccgca ccggctccta tggacagagc 420attgtcagcc gtgagccggt cggtgtggtg ggcgcgatcg tggcctggaa cgtcccgctg 480tttctggccg tcaacaagat tgcgccggcg ctgctggccg gctgcaccat cgtgctcaag 540cccgccgccg aaacaccgct gaccgcaaac gctttggcgg aggtgttcgc cgaggtgggc 600ctgcccgagg gggtgttgtc ggtagtgccg ggagggattg agaccggtca ggcgctgacg 660tctaacccgg acatcgacat gtttaccttc accggcagct cggccgtcgg ccgagaggtc 720ggcaggcgtg ccgctgagat gctcaagccg tgcaccttag aactcggcgg caagtcggcg 780gccatcattc tcgaggacgt cgacctggcc gcagctattc cgatgatggt gttctccggc 840gtcatgaacg ccggacaggg ctgcgtcaac cagacccgca ttctggctcc gcgctcccgg 900tacgacgaaa tcgtggctgc ggtaactaat ttcgtaacgg ctctcccggt gggcccgccg 960tcggacccgg cagctcagat cgggccgctg atctcggaga agcagcggac tcgcgttgaa 1020ggctacatcg ccaagggcat cgaggagggc gctcggttgg tgtgcggcgg cggccgtccc 1080gagggcttgg acaacggctt ctttatccaa cccaccgtat tcgccgatgt cgacaacaag 1140atgaccatcg cacaggagga gatcttcggg ccggtgctgg ccatcattcc ttatgacacc 1200gaggaggacg cgatcgcgat cgccaacgat tcagtgtatg ggctggcggg cagcgtgtgg 1260accaccgacg tgcccaaagg catcaagatc tcgcagcaga tccgcaccgg gacatacgga 1320atcaactggt acgccttcga tcccggctca cccttcggcg gctacaagaa ctccggaatc 1380ggccgcgaga acgggcccga gggtgtcgaa cacttcaccc agcaaaagag tgtcctgctg 1440ccgatgggct acaccgtcgc g 1461 38 831 DNA M. tuberculosis 38atggcacgct gcgatgtcct ggtctccgcc gactgggctg agagcaatct gcacgcgccg 60aaggtcgttt tcgtcgaagt ggacgaggac accagtgcat atgaccgtga ccatattgcc 120ggcgcgatca agttggactg gcgcaccgac ctgcaggatc cggtcaaacg tgacttcgtc 180gacgcccagc aattctccaa gctgctgtcc gagcgtggca tcgccaacga ggacacggtg 240atcctgtacg gcggcaacaa caattggttc gccgcctacg cgtactggta tttcaagctc 300tacggccatg agaaggtcaa gttgctcgac ggcggccgca agaagtggga gctcgacgga 360cgcccgctgt ccagcgaccc ggtcagccgg ccggtgacct cctacaccgc ctccccgccg 420gataacacga ttcgggcatt ccgcgacgag gtcctggcgg ccatcaacgt caagaacctc 480atcgacgtgc gctctcccga cgagttctcc ggcaagatcc tggcccccgc gcacctgccg 540caggaacaaa gccagcggcc cggacacatt cctggtgcca tcaacgtgcc gtggagcagg 600gccgccaacg aggacggcac cttcaagtcc gatgaggagt tggccaagct ttacgccgac 660gccggcctag acaacagcaa ggaaacgatt gcctactgcc gaatcgggga acggtcctcg 720cacacctggt tcgtgttgcg ggaattactc ggacaccaaa acgtcaagaa ctacgacggc 780agttggacag aatacggctc cctggtgggc gccccgatcg agttgggaag c 831 39 300 DNA M. tuberculosis 39atgtgctctg gacccaagca aggactgaca ttgccggcca gcgtcgacct ggaaaaagaa 60acggtgatca ccggccgcgt agtggacggt gacggccagg ccgtgggcgg cgcgttcgtg 120cggctgctgg actcctccga cgagttcacc gcggaggtcg tcgcgtcggc caccggcgat 180ttccggttct tcgccgcgcc cggatcctgg acgctgcgcg cgctgtcggc ggccggcaac 240ggcgacgcgg tggtgcagcc ctcgggcgcg ggcatccacg aggtagacgt caagatcacc 300 40 441 DNA M. tuberculosis 40atggccaatg tggtagctga aggtgcctac ccttactgtc ggctcactga tcagccgctg 60agtgtggacg aagtgctagc cgccgtctcg ggccccgaac aaggcggcat tgtcatattt 120gtgggaaacg tgcgtgacca caatgccggg catgatgtca cgcggttgtt ctacgaggcg 180tatccgccga tggtgattcg gacattgatg tcgatcatcg gacggtgtga agacaaggcc 240gagggtgtcc gcgttgctgt cgcgcaccgg accggtgaat tgcaaatcgg tgatgccgcg 300gtcgttattg gcgcgtcagc tccccaccgt gcggaggcat ttgacgccgc gcgtatgtgt 360atcgagttgc ttaagcagga agtgccgatt tggaagaagg aattcagctc gaccggtgct 420gaatgggtcg gcgatagacc a 441 41 600 DNA M. tuberculosis 41atgagtccgt ctccatcggc cctgctcgcc gaccacccgg accgcattcg ttggaacgcg 60aaatacgagt gcgctgaccc cacggaggcg gtatttgcgc ccatatcctg gctcggcgac 120gtgctgcagt tcggggtgcc agaagggccg gttctggaac tggcgtgcgg tcggtccggc 180accgcgctgg ggctagccgc ggcgggccgc tgcgtgactg cgatcgacgt ttccgatacc 240gcgttggttc agctcgagct cgaagcgacc cgacgggaat tggccgatcg cctcacactg 300gtgcacgccg atctctgctc ctggcagtcg ggggatggac gctttgctct ggtactttgc 360cgactattct ggcatccgcc cacttttcgc caggcttgcg aggctgtggc gccgggcggt 420gtagtggcgt gggaggcatg gcggcggccc atcgatgtcg ctcgggatac ccgtcgagcc 480gaatggtgct tgaagccagg ccagcccgag tctgaacttc ccgccggctt cacggtgatt 540cgggtggtcg acaccgatgg ttcagagccg tcgcggcgca tcatcgccca acggtcactg 600 42 1200 DNA Mycobacteria tuburculosis 42atgacaagca cctcgattcc gacgttcccg ttcgaccggc cggtcccgac ggagccgtcc 60ccaatgctgt cggaactgag aaacagctgt ccggtagccc cgatagagtt gccctcgggg 120cacacagcat ggctcgtcac tcgctttgac gatgtaaagg gagtgctgtc cgacaagcgt 180ttcagctgca gggcggcagc gcacccgtcg tcgcccccgt tcgtgccgtt cgtgcagctt 240tgccccagct tgttgagcat cgatgggccc caacacaccg cggcccgccg tctgctcgcg 300cagggcctaa atcccggctt catcgcacgc atgcggcccg ttgtccaaca gatcgtcgac 360aatgcgctcg acgatctggc agccgcggaa ccaccggtgg acttccagga aatagtaagt 420gtccctatcg gagaacagct catggccaag ctactcgggg tcgagcccaa aaccgtgcac 480gagctcgcgg cgcacgtgga tgcggcgatg tccgtgtgtg agatcggcga cgaggaggtg 540agccggcggt ggtcagcact gtgcacgatg gtcatcgaca tactgcaccg caagctcgcc 600gaaccgggtg atgacctact tagcacgatc gcccaggcga accggcaaca gtccaccatg 660accgacgagc aggttgtcgg catgctcctc accgtcgtga tcggaggagt cgacacaccg 720atcgccgtga tcacaaacgg gctggcgagc ctgctgcacc accgcgatca atatgaacgg 780ctcgttgaag acccaggccg tgtcgctcgt gcggttgaag aaatagtccg gtttaatccg 840gcaactgaaa ttgagcactt gcgagttgtc accgaggatg tcgtcattgc cggaaccgcg 900ctatcggcgg ggagcccagc atttacctct atcacttcgg ctaaccgcga ctccgaccaa 960ttcctggacc ccgatgagtt tgatgtcgaa cgtaatccga acgaacacat agcatttgga 1020tatggtccac atgcttgccc ggcctcagcg tattcacgca tgtgcttgac gacgttcttc 1080acctcgctta cccagcgatt tccgcaactt caactcgcaa gaccgtttga ggatttggaa 1140cgacggggta agggcctaca ttcggtgggg atcaaggaac tccttgttac ctggccgacg 1200 43 498 DNA Mycobacteria tuburculosis 43gtgcgcattg tcaatgcggc ggacccattt tcgatcaacg atctaggctg tggctatggg 60gctctactgg actacctaga tgcgcgtggc ttcaaaactg attacaccgg catcgacgtc 120tcccccgaaa tggtgcgcgc ggccgcacta cgtttcgaag gtcgggcgaa cgcagacttc 180atctgcgcgg cgcgcataga tcgggaggcg gactatagcg tcgcgagtgg aatattcaat 240gttcgtctga aatcgttgga cacggaatgg tgcgctcaca tcgaagcgac gctcgacatg 300ctgaatgccg cgagtcgccg tggcttctct tttaattgcc tgacatctta ttccgatgca 360tcaaagatgc gcgacgacct gtactatgct gacccatgcg ccctatttga tctctgcaag 420cgcaggtact ccaagagtgt tgcgcttctg cacgactacg gcttgtatga attcacaatt 480ctggttagga aggcgtca 498 44 693 DNA Mycobacteria tuburculosis 44ttgaagaaag tcgcgattgt tcaatcaaat tacatacctt ggcgaggata ttttgacctg 60attgcattcg tcgatgaatt catcatctat gatgacatgc aatataccaa gcgtgattgg 120cgaaacagaa atcggatcaa aacgagccag gggttacagt ggataactgt tcccgtccag 180gtgaagggac gtttccatca aaagatacgt gagacgctga tcgacggcac cgattgggcg 240aaagcgcact ggcgggcact agaattcaac tacagcgcgg ccgctcattt tgcggagatc 300gctgactggc tcgcgccgat ttacctcgaa gaacagcaca cgaatctttc cttactcaac 360aggcgtctat tgaatgcgat ttgcagttat ctcggtatca gcacgcgact ggcaaattcg 420tgggactacg aattagccga cggcaagacc gagagactgg ccaacctctg ccaacaggcc 480gcagcgaccg aatatgtctc tggcccctca gcccgttcgt atgtcgatga gcgcgtgttc 540gacgaactta gcatccgggt aacttggttc gattatgacg gctaccgcga ttataagcaa 600ttgtggggag ggttcgagcc cgccgtgtcg attctggatc tgctctttaa cgtcggagcc 660gaggctccgg actatttgag gtactgtcgc cag 693 45 395 DNA Mycobacteria tuburculosis misc_feature (1)...(395) n = A,T,C or G 45vvmsartgva rhgtsgrgcg dvgargndvs vatrkrsrgd rvgnhgarar rmkrvrgavt 60asrrwagssr tmgtasvsaa tayaswyavd vstvvgdcwd wgmngrhcsd yamvaaagna 120dysadytava awaaryagsh wgargcyvat mavsawaarg argrvvvtga aaawgvdrgn 180stgvvaayva srrwgattva vvkvvgvvaa rwrwaggtgv vvsnaawrgg tashgknssg 240grdrnvsgka dsknysgkgt grtgavvvvv avagrrvmvg vatatsadva yyvvaavard 300nggagdaahg drrravgvcv savasvnvav gyvyggakgv vgttvttvtw awvtcvvvsy 360arkarhdshn gtrsddtaas ttscnvssrg gcnyt 395 46 879 DNA Mycobacteria tuburculosis 46gtgtttgcgt tgagtaataa tctgaaccgt gtgaacgcat gcatggatgg attccttgcc 60cgtatccgct cacatgttga tgcgcacgcg ccagaattgc gttcactgtt cgatacgatg 120gcggccgagg cccgatttgc acgcgactgg ctgtccgagg acctcgcgcg gttgcctgtc 180ggtgcagcat tgctggaagt gggcgggggg gtacttctgc tcagctgtca actggcggcg 240gagggatttg acatcaccgc catcgagccg acgggtgaag gttttggcaa gttcagacag 300cttggcgaca tcgtgctgga attggctgca gcacgaccca ccatcgcgcc atgcaaggcg 360gaagacttta tttccgagaa gcggttcgac ttcgccttct cgctgaatgt gatggagcac 420atcgaccttc cggatgaggc agtcaggcgg gtatcggaag tgctgaaacc gggggccagt 480taccacttcc tgtgcccgaa ttacgtattc ccgtacgaac cgcatttcaa tatcccaaca 540ttcttcacca aagagctgac atgccgggtg atgcgacatc gcatcgaggg caatacgggc 600atggatgacc cgaagggagt ctggcgttcg ctcaactgga ttacggttcc caaggtgaaa 660cgctttgcgg cgaaggatgc gacgctgacc ttgcgcttcc accgtgcaat gttggtatgg 720atgctggaac gcgcgctgac ggataaggaa ttcgctggtc gccgggcaca atggatggtc 780gctgctattc gctcggcggt gaaattgcgt gtgcatcatc tggcaggcta tgttcccgct 840acgctgcagc ccatcatgga tgtgcggcta acgaagagg 879 47 1296 DNA Mycobacteria tuburculosis 47atgtacgaga gacggcatga gcgcggaatg tgcgaccgtg ccgtcgagat gaccgacgtc 60ggcgctacgg cagcccccac cggacctatc gcgcggggca gcgtcgctcg ggtcggcgcg 120gcgaccgcgt tggccgttgc ctgcgtctac acggtcatct atctggcggc ccgcgaccta 180cccccggctt gtttttcgat attcgcggtg ttttgggggg cgctcggcat tgccaccggc 240gccacccacg gcctcctgca agaaacgacc cgcgaggtcc gctgggtgcg ctccacccaa 300atagttgcgg gccatcgtac ccatccgctg cgggtggccg ggatgattgg caccgtcgcg 360gccgtcgtaa ttgcgggtag ctcaccgctg tggagccgac agctattcgt cgaggggcgc 420tggctgtccg tggggctact cagcgttggg gtggccgggt tctgcgcgca ggcgaccctg 480ctgggcgcgc tggccggcgt cgaccggtgg acacagtacg ggtcactgat ggtgaccgac 540gcggtcatcc ggttggcggt cgccgcggca gcggttgtga tcggatgggg tctggccggg 600tacttgtggg ccgccaccgc gggagcggtg gcgtggctgc tcatgctgat ggcctcgccc 660accgcgcgca gcgcggccag cctgctgacg cccgggggaa tcgccacgtt cgtgcgcggt 720gccgctcatt cgataaccgc cgcgggtgcc agcgcgattc tggtaatggg tttcccagtg 780ttgctcaaag tgacctccga ccagttaggg gcaaagggcg gagcggtcat cctggctgtg 840accttgacgc gtgcgccgct tctggtccca ctgagcgcga tgcaaggcaa cctgatcgcg 900catttcgtcg accggcgcac ccaacggctt cgggcgctga tcgcaccggc gctggtcgtc 960ggcggcatcg gtgcggtcgg gatgttggcc gcagggctta ccggtccctg gttgctgcgt 1020gttggattcg gccccgacta ccaaactggc ggggcgttgc tggcctggtt gacggcagcg 1080gcggtagcta tcgccatgct gacgctgacc ggcgccgccg cggtcgcggc cgcactgcac 1140cgggcgtatt tgctgggctg ggtcagcgcg acggtggcgt cgacgctgtt gctgctgctg 1200ccgatgccgc tggagacgcg caccgtgatc gcgctgttgt tcggtccaac ggtgggaatc 1260gccatccatg tggccgcgtt ggcgcggcga cccgac 1296 48 1020 DNA M. tuberculosis 48gtgaagcgag cgctcatcac cggaatcacc ggccaggacg gctcgtatct cgccgaactg 60ctgctggcca aggggtatga ggttcacggg ctcatccggc gcgcttcgac gttcaacacc 120tcgcggatcg atcacctcta cgtcgacccg caccaaccgg gcgcgcggct gtttctgcac 180tatggtgacc tgatcgacgg aacccggttg gtgaccctgc tgagcaccat cgaacccgac 240gaggtgtaca acctggcggc gcagtcacac gtgcgggtga gcttcgacga acccgtgcac 300accggtgaca ccaccggcat gggatccatg cgactgctgg aagccgttcg gctctctcgg 360gtgcactgcc gcttctatca ggcgtcctcg tcggagatgt tcggcgcctc gccgccaccg 420cagaacgagc tgacgccgtt ctacccgcgg tcaccgtatg gcgccgccaa ggtctattcg 480tactgggcga cccgcaatta tcgcgaagcg tacggattgt tcgccgttaa cggcatcttg 540ttcaatcacg aatcaccgcg gcgcggtgag acgttcgtga cccgaaagat caccagggcc 600gtggcacgca tcaaggccgg tatccagtcc gaggtctata tgggcaatct ggatgcggtc 660cgcgactggg ggtacgcgcc cgaatacgtc gaaggcatgt ggcggatgct gcagaccgac 720gagcccgacg acttcgtttt ggcgaccggg cgcggtttca ccgtgcgtga gttcgcgcgg 780gccgcgttcg agcatgccgg tttggactgg cagcagtacg tgaaattcga ccaacgctat 840ctgcggccca ccgaggtgga ttcgctgatc ggcgacgcga ccaaggctgc cgaattgctg 900ggctggaggg cttcggtgca cactgacgag ttggctcgga tcatggtcga cgcggacatg 960gcggcgctgg agtgcgaagg caagccgtgg atcgacaagc cgatgatcgc cggccggaca 1020 49 966 DNA M. tuberculosis 49atgaacgcgc acacctcggt cggcccgctt gaccgcgcgg cccgggtcta catcgccggg 60catcgcggcc tggtcgggtc cgcgctgcta cgcacgtttg cgggcgcggg gttcaccaac 120ctgctggtgc ggtcacgcgc cgagcttgat ctgacggatc gggccgcgac gttcgacttc 180gttctcgagt cgaggccgca ggtcgtcatc gacgcggcgg cccgggtcgg cggcatcctg 240gccaacgaca cctacccggc cgatttcctg tcggaaaacc tccagatcca ggtcaacctg 300ctggatgccg ccgtggcggc gcgggtgccg cggctgctgt tcctgggctc gtcgtgcatc 360tacccgaaac tcgccccgca gccgatcccg gagagcgcgc tgctcaccgg tccgttggag 420ccgaccaacg acgcgtacgc gatcgccaaa atcgccggca tccttgcggt ccaggcggtg 480cgccgccaac atggcctgcc gtggatctcg gcgatgccca ccaacctgta cgggccaggc 540gacaactttt cgccgtccgg ctcgcatctg ctgccggcac tcatccgccg ctatgacgag 600gccaaagcca gtggcgcgcc caacgtgacc aactggggca ccggcacgcc ccgacgggag 660ttgctgcacg tcgacgacct ggcgagcgca tgcctgtatc tgctggaaca tttcgacggg 720ccgacccatg tcaacgtggg aaccggcatc gaccacacca tcggcgagat cgccgagatg 780gtcgcctcgg cggtaggcta tagcggcgaa acccgctggg atccaagcaa accggacgga 840acaccacgca aactgctgga tgtttcggtg ctacgggagg cgggatggcg gccttcgatc 900gcgctgcgcg acggcatcga ggcgacggtg gcgtggtatc gcgagcacgc gggaacggtt 960cggcaa 966 50 729 DNA Mycobacteria tuberculosis 50atgaggctgg cccgtcgcgc tcggaacatc ttgcgtcgca acggcatcga ggtgtcgcgc 60tactttgccg aactggactg ggaacgcaat ttcttgcgcc aactgcaatc gcatcgggtc 120agtgccgtgc tcgatgtcgg ggccaattcg gggcagtacg ccaggggtct gcgcggcgcg 180ggcttcgcgg gccgcatcgt ctcgttcgag ccgctgcccg ggccctttgc cgtcttgcag 240cgcagcgcct ccacggaccc gttgtgggaa tgccggcgct gtgcgctggg cgatgtcgat 300ggaaccatct cgatcaacgt cgccggcaac gagggcgcca gcagttccgt cttgccgatg 360ttgaaacgac atcaggacgc ctttccacca gccaactacg tgggcgccca acgggtgccg 420atacatcgac tcgattccgt ggctgcagac gttctgcggc ccaacgatat tgcgttcttg 480aagatcgacg ttcaaggatt cgagaagcag gtgatcgcgg gtggcgattc aacggtgcac 540gaccgatgcg tcggcatgca gctcgagctg tctttccagc cgttgtacga gggtggcatg 600ctcatccgcg aggcgctcga tctcgtggat tcgttgggct ttacgctctc gggattgcaa 660cccggtttca ccgacccccg caacggtcga atgctgcagg ccgatggcat cttcttccgg 720ggcagcgat 729 51 786 DNA Mycobacteria tuburculosis 51gtgacgtctg ctccgaccgt ctcggtgata acgatctcgt tcaacgacct cgacgggttg 60cagcgcacgg tgaaaagtgt gcgggcgcaa cgctaccggg gacgcatcga gcacatcgta 120atcgacggtg gcagcggcga cgacgtggtg gcatacctgt ccgggtgtga accaggcttc 180gcgtattggc agtccgagcc cgacggcggg cggtacgacg cgatgaacca gggcatcgcg 240cacgcatcgg gtgatctgtt gtggttcttg cactccgccg atcgtttttc cgggcccgac 300gtggtagccc aggccgtgga ggcgctatcc ggcaagggac cggtgtccga attgtggggc 360ttcgggatgg atcgtctcgt cgggctcgat cgggtgcgcg gcccgatacc tttcagcctg 420cgcaaattcc tggccggcaa gcaggttgtt ccgcatcaag catcgttctt cggatcatcg 480ctggtggcca agatcggtgg ctacgacctt gatttcggga tcgccgccga ccaggaattc 540atattgcggg ccgcgctggt atgcgagccg gtcacgattc ggtgtgtgct gtgcgagttc 600gacaccacgg gcgtcggctc gcaccgggaa ccaagcgcgg tcttcggtga tctgcgccgc 660atgggcgacc ttcatcgccg ctacccgttc gggggaaggc gaatatcaca tgcctaccta 720cgcggccggg agttctacgc ctacaacagt cgattctggg aaaacgtctt cacgcgaatg 780tcgaaa 786 52 894 DNA Mycobacteria tuburculosis 52atgtcgacaa acccaggacc agccgaaggg gctaaccaag tgatggcaca ggaacattcg 60gccggcgcgg tacaattcac cgcccacaac gttcgcctcg acgacggaac cttgacgata 120ccggagtcct cgcgcacgtt agacgaatcg tcctggttca tctcggcgcg cgggattctg 180gaaaccgtct ttcccgggga caagagccac ctacgcctgg ccgatgtcgg ctgcttggaa 240ggcgggtacg cggtcgggtt cgcgcgcatg ggatttcagg tcctcgggat cgaggttcgc 300gagctgaaca tggcggcctg caactacatc aaatcgaaga ccaacctgcc gaatctccgg 360ttcgtccacg acaacgccct caacatcgcc aaccacgggc tcttcgatac cgtcttctgc 420tgcggcctct tctaccacct ggagaatccg aagcaatacc tggaaaccct ctcgtcggta 480acgaacaagc tgctgattct ccagacgcac ttctcgatca tcaaccggag cgataaatgg 540ctccggttgc ccacgacggc acgacaattg accgatcggt tgctgcggcg gccggcgccg 600gtgaagttca tgctctcggc gcccaccgaa catgagggac ttcccggtag gtggtttacc 660gagttttccg acgaccgctc gtttggccag cgcgacaccg caaaatgggc gtcctgggac 720aatcgccggt cattctggat tcaacgcgag cacctacttc aggccatcaa agacgtcggc 780gtcgacctgg tgatggagga gtacgacaac ttggaaccaa gcatcgccga gtcgttgctc 840ggaggttcct atgcggcgaa tcttcgaggc accttcatcg gtatcaagac ccgg 894 53 1119 DNA Mycobacteria tuburculosis 53gtgccgtacg tccgccgacc accaggccac gacggccgac ggccggcggg cacaggcgat 60tcacgttcgc catcgcaata cccttgcggc cgcgcaggaa aagggccgac ggtgagtccc 120cagctttgcc ccaaggtgag catcgtctcg accactcaca accaggcggg ctacgcccgt 180caggccttcg acagctttct cgaccagcaa accgacttcc cggtggagat catcgtcgcc 240gacgacgcgt cgaccgatgc caccccggcg atcatccgtg agtacgccga gcggtacccg 300cacgtgttcc ggccgatctt caggaccgaa aacctcggcc tcaatgggaa cctgaccggc 360gccctgtcgg ccgctcgcgg cgagtacgtc gcgttgtgcg aggcggacga ctactggatc 420gatccgctga agctaagcaa acaggtcgca ttcctcgacc ggcaccccaa gacgacggtg 480tgcttccatc ccgtccgagt gatatgggag gacggccatg ccaaggactc gaagttcccc 540ccggttcggg tgcggggcaa cttgagcctg gatgcgttga tcttgatgaa cttcatccag 600accaactcgg ccgtgtaccg tcgcctcgag cgctacgacg acattcctgc cgacgtcatg 660cccctggact ggtatctgca cgtccggcac gcggtgcatg gcgacatcgc catgttgccc 720gacaccatgg ccgtgtatcg ccgccacgcc caaggcatgt ggcacaacca ggtggtggac 780ccgccaaagt tctggttgac gcagggtccg gggcatgcgg cgacgtttga cgcgatgctc 840gacctgttcc cgggagaccc cgcgcgcgag gagctcatcg ccgtcatggc cgactggatc 900cttcgccaga tcgccaacgt tccaggcccg gaggggcgcg ccgcgctgca ggaaaccatc 960gcgcgccatc cccggatcgc catgctggcg ctgcagcacc gcggggcgac acccgcgcgg 1020cggctcaaga cccagtggcg caagctcgcc gccgcgacgc cgagccgcag ggggctcgtg 1080gatgtgtggc cctcccggct ccgacgcggc tgtcgagcc 1119 54 282 DNA Mycobacteria tuburculosis 54atgaccatca actatcagtt cggtgatgtc gacgctcatg gcgccatgat ccgcgctcag 60gccgggttgc tggaggcgga gcatcaggcc atcgttcgtg atgtgttggc cgcgggtgac 120ttttggggcg gcgccggttc ggtggcttgc caggagttca tcacccagct gggccgtaac 180ttccaggtga tctacgagca ggccaacgcc cacgggcaga aggtgcaggc tgccggcaac 240aacatggcac aaaccgacag cgccgtcggc tccagctggg cc 282 55 294 DNA Mycobacteria tuburculosis 55atggcaacac gttttatgac ggatccgcac gcgatgcggg acatggcggg ccgttttgag 60gtgcacgccc agacggtgga ggacgaggct cgccggatgt gggcgtccgc gcaaaacatc 120tcgggcgcgg gctggagtgg catggccgag gcgacctcgc tagacaccat ggcccagatg 180aatcaggcgt ttcgcaacat cgtgaacatg ctgcacgggg tgcgtgacgg gctggttcgc 240gacgccaaca actacgagca gcaagagcag gcctcccagc agatcctcag cagc 294 56 324 DNA Mycobacteria tuburculosis 56gtgcttttgc ctcttggtcc gcctttgccg cccgacgcgg tggtggcgaa acgggctgag 60tcgggaatgc tcggcgggtt gtcggttccg ctcagctggg gagtggctgt gccacccgat 120gattatgacc actgggcgcc tgcgccggag gacggcgccg atgtcgatgt ccaggcggcc 180gaaggggcgg acgcagaggc cgcggccatg gacgagtggg atgagtggca ggcgtggaac 240gagtgggtgg cggagaacgc tgaaccccgc tttgaggtgc cacggagtag cagcagcgtg 300attccgcatt ctccggcggc cggc 324 57 1524 DNA M. tuberculosis 57atgtcacgcc gagcattcct ggctaaggcg gctggagccg gggcagcggc ggttttgacg 60gactgggccg caccggtgat cgaaaaggcc tatggtgccg gtccctgctc gggtcatttg 120accgatatcg agcacatcgt gctgtgccta caggagaaca ggtcgttcga tcactatttc 180ggcacgcttt ctgccgtcga cgggttcgac actccgacgc cgctgtttca acaaaagggc 240tggaacccgg agacgcaggc gctggacccc accggcatta cgctgcccta ccgcatcaat 300accaccgggg gtcccaacgg ggttggcgag tgcgtcaacg acccagacca ccagtggatt 360gccgcgcact tgtcatggaa cggcggcgcc aatgacggct ggctgccggc gcaggcgcgg 420acccggtcgg tggccaacac gcccgtggtg atgggctatt acgcacgtcc tgacataccg 480atccactact tgttggccga taccttcacg atctgcgacc agtacttctc gtcgcttctt 540ggcgggacga tgcctaaccg gctctattgg atcagcgcca ccgtcaatcc cgacggggat 600caaggtgggc cgcagatcgt cgaacccgcc atccagccga agttgacctt cacctggcgc 660atcatgccgc agaacctcag tgacgccggc atcagttgga aggtgtacaa cagcaagctg 720ctcggcgggc tcaacgacac ttccttgagc cgtaacgggt atgtgggcag tttcaaacag 780gccgcagatc cgaggtcgga cctggcccgt tatggcatcg ccccggccta cccgtgggat 840ttcatccgcg acgtcatcaa caacacgctg ccccaggtgt cctgggtcgt tccgttgacc 900gtcgagtccg aacatccgtc attcccggtg gcagtcggtg cggtgacgat cgtgaacttg 960ataagggtgt tgctgcgcaa tccggcggtg tgggagaaaa ccgcgttgat catcgcctat 1020gacgaacatg gcggcttctt cgaccacgtc acaccgctca ccgcgccgga gggcacaccc 1080ggcgaatgga ttcccaacag tgttgacatc gacaaggtcg acggctccgg cggaatacgt 1140ggacccatcg gcttgggctt tcgcgtgccc tgcttcgtca tttcgcctta cagtcgcggc 1200gggctgatgg tccatgatcg gttcgaccac acatcgcagc tgcaattgat cggcaagcgt 1260ttcggggtgc cggttcccaa cttgacaccc tggcgtgcca gtgtcaccgg cgatatgacg 1320tcggcattca atttcgcggc cccgccggac ccgtcgccac ccaatctgga ccacccggtc 1380cgtcaattgc cgaaggtcgc caagtgcgtg cccaatgtgg tgctgggttt cttgaacgaa 1440ggcctgccgt atcgggtgcc ctacccccaa acaacgccag tccaggaatc cggtcccgcg 1500cggccgattc ccagcggcat ctgc 1524 58 1536 DNA M. tuberculosis 58atgtcacgtc gagagttttt gacaaagctc actggcgcag gcgcagcggc attcctgatg 60gactgggctg caccggtgat tgaaaaggcc tacggcgccg ggccttgtcc cggacatttg 120accgacatcg agcatatcgt gttgctgatg caggagaacc ggtcattcga ccactatttc 180ggaacgcttt ccagcaccaa tgggttcaac gccgcgtcgc cggcattcca acaaatgggt 240tggaacccca tgacgcaggc gttggacccc gccggggtca ccattccgtt ccgcttggac 300accacccgag gccccttcct ggacggcgag tgcgtcaacg accccgagca ccagtgggtg 360gggatgcacc tggcctggaa cggtggtgcc aacgacaact ggctgccggc gcaggcgacc 420acccgcgcag gaccatatgt ccctttgacc atgggttact acacgcgcca agacatcccg 480atccactatc tgctggccga cacgttcacc atctgcgacg gctaccattg ctcgctgctg 540acgggcaccc tgcccaaccg gctctactgg ttgagcgcca acatcgaccc cgccggcacc 600gacgggggac cccaattggt agagccgggc ttcctgccgc tgcagcaatt cagttggcgc 660atcatgccgg aaaacctcga agatgccggg gtcagctgga aggtgtacca gaacaagggc 720ctcgggcgat tcatcaacac gcccatcagc aataacgggc tggtgcaggc cttccgccag 780gcagctgatc cgaggtcgaa cttggcccgc tacggtatcg ccccgaccta ccctggggac 840ttcgctgccg acgtcagggc caaccggcta cccaaggtct cctggttagt tcccaacatc 900ctgcagtccg aacaccccgc cctgccggta gcgcttggcg cggtgtccat ggtgaccgcg 960ctgcggatct tgctgtccaa tcccgcggtg tgggaaaaga ccgcacttat cgtcagctat 1020gacgagaacg gcggcttctt cgaccacgtc acgcccccca cggcaccgcc cgggacaccc 1080ggcgaattcg tcacggtgcc caacatcgac gcagtacccg ggtccggtgg cattcgtggt 1140ccgctcggtc tgggttttcg cgttccctgc attgtcattt cgccgtacag ccgcggcccg 1200ctgatggtct ccgacacgtt cgaccacacc tcgcaattga agttgattcg cgcccggttc 1260ggcgtgccgg ttcccaacat gaccgcctgg cgcgacggcg tggttggcga catgacctca 1320gcgttcaact ttgcgactcc accgaattcg accagaccca acttgagcca cccgttgctg 1380ggagcgctgc cgaagctgcc gcagtgcatc cctaacgtgg tgttgggaac caccgacggc 1440gcgttgccga gcattcccta tcgggtgccc tatccgcagg tgatgccaac tcaggaaacc 1500acacccgtcc gcgggactcc cagcgggctg tgcagc 1536 59 1536 DNA M. tuberculosis 59atgtcacgtc gagagttttt gacaaagctc actggcgcag gcgcagcggc attcctgatg 60gactgggctg caccggtgat tgaaaaggcc tacggcgccg ggccttgtcc cggacatttg 120accgacatcg agcatatcgt gttgctgatg caggagaacc ggtcattcga ccactatttc 180ggaacgcttt ccagcaccaa tgggttcaac gccgcgtcgc cggcattcca acaaatgggt 240tggaacccca tgacgcaggc gttggacccc gccggggtca ccattccgtt ccgcttggac 300accacccgag gccccttcct ggacggcgag tgcgtcaacg accccgagca ccagtgggtg 360gggatgcacc tggcctggaa cggtggtgcc aacgacaact ggctgccggc gcaggcgacc 420acccgcgcag gaccatatgt ccctttgacc atgggttact acacgcgcca agacatcccg 480atccactatc tgctggccga cacgttcacc atctgcgacg gctaccattg ctcgctgctg 540acgggcaccc tgcccaaccg gctctactgg ttgagcgcca acatcgaccc cgccggcacc 600gacgggggac cccaattggt agagccgggc ttcctgccgc tgcagcaatt cagttggcgc 660atcatgccgg aaaacctcga agatgccggg gtcagctgga aggtgtacca gaacaagggc 720ctcgggcgat tcatcaacac gcccatcagc aataacgggc tggtgcaggc cttccgccag 780gcagctgatc cgaggtcgaa cttggcccgc tacggtatcg ccccgaccta ccctggggac 840ttcgctgccg acgtcagggc caaccggcta cccaaggtct cctggttagt tcccaacatc 900ctgcagtccg aacaccccgc cctgccggta gcgcttggcg cggtgtccat ggtgaccgcg 960ctgcggatct tgctgtccaa tcccgcggtg tgggaaaaga ccgcacttat cgtcagctat 1020gacgagaacg gcggcttctt cgaccacgtc acgcccccca cggcaccgcc cgggacaccc 1080ggcgaattcg tcacggtgcc caacatcgac gcagtacccg ggtccggtgg cattcgtggt 1140ccgctcggtc tgggttttcg cgttccctgc attgtcattt cgccgtacag ccgcggcccg 1200ctgatggtct ccgacacgtt cgaccacacc tcgcaattga agttgattcg cgcccggttc 1260ggcgtgccgg ttcccaacat gaccgcctgg cgcgacggcg tggttggcga catgacctca 1320gcgttcaact ttgcgactcc accgaattcg accagaccca acttgagcca cccgttgctg 1380ggagcgctgc cgaagctgcc gcagtgcatc cctaacgtgg tgttgggaac caccgacggc 1440gcgttgccga gcattcccta tcgggtgccc tatccgcagg tgatgccaac tcaggaaacc 1500acacccgtcc gcgggactcc cagcgggctg tgcagc 1536 60 1173 DNA Mycobacteria tuburculosis 60atgattttgg atttttcgtg gttgccgccg gagatcaact cggcgcggat ctatgccggt 60gcggggtcgg ggccgttgtt tatggcggcg gcggcgtggg aggggttggc tgcggatttg 120cgggcctcgg cgtcctcgtt tgatgcggtg atcgccgggt tggcggctgg gccgtggtcg 180ggtccggcgt cggtggcgat ggcgggggcg gcggcgccgt atgtggggtg gttgagtgcg 240gcggccgggc aggcggagtt gtcggctggt caggctaccg cggcggcgac ggcgtttgag 300gcggcgttgg cggccacggt gcatccggcg gcggtgacgg cgaatcgggt gttgttgggg 360gcgttggtgg cgacgaacat tttgggtcag aacacgccgg cgattgcggc cactgagttc 420gattatgtgg agatgtgggc tcaggacgtg ggtgcgatgg tggggtatca cgcgggggcg 480gcggcggtgg ctgagacgtt gacgccgttt agtgtgccgc cgctggattt ggcggggttg 540gcttcccagg ccggtgcgca gttgaccggg atggcgacgt cggtttcggc tgcgttgtct 600ccgatcgcgg agggtgcggt ggagggggtg ccggctgtgg tggctgcggc gcagtcggtg 660gcggcggggt tgccggtgga tgcggcgctg caggtggggc aggccgcggc gtatccggcc 720agtatgttga ttgggccgat gatgcagttg gcgcagatgg ggactacggc caacacggct 780gggttggccg gtgcggaggc tgcggggttg gctgcggcgg atgtgccgac gtttgccggt 840gatatcgctt cggggacggg cctaggtggt gccggtggtc tgggtgcggg gatgtcggcg 900gagttgggta aggcgcggtt ggtgggggcg atgtcggtgc ctccgacctg ggaggggtcg 960gttcctgcgc ggatggccag ttcggcgatg gcgggtttgg gggctatgcc tgctgaggtg 1020ccggcggcag gcgggcccat ggggatgatg ccgatgccga tgggtatggg gggtgctggg 1080gcgggtatgc cggccgggat gatgggccgc ggtggcgcaa atccgcatgt ggtgcaggct 1140cggcccagtg tggtgccgcg ggtcgggatc gga 1173 61 1062 DNA Mycobacteria tuburculosis 61atgccggggc ggttcagaaa cttcggtagc caaaacctgg gtagcggcaa catcggcagc 60accaacgtgg gcagcggcaa catcggcagc accaacgtgg gcagcggcaa catcggcgac 120acgaacttcg gtaacggaaa caacggcaac ttcaactttg gtagcggcaa taccggcagt 180aacaacatcg gcttcggaaa caccggcagc gggaatttcg gtttcggaaa cacgggcaac 240aacaacatcg gtatcgggct caccggcgat ggtcagatcg gcatcggcgg actgaactcg 300ggcagcggaa acatcggttt cgggaactcc ggcaccggaa acgtcggttt gttcaactcc 360ggcaccggca acgtaggctt cgggaactcc ggtactgcga acactggatt cgggaacgcg 420ggcaacgtca acaccggatt ttggaacggc ggcagcacaa acactggcct cgctaacgcc 480ggcgccggca acacaggctt tttcgacgct ggcaactaca acttcggcag tcttaacgcc 540ggaaacataa actcgagttt tgggaattcg ggtgacggca acagtggttt cctcaatgct 600ggcgacgtca actccggtgt gggcaatgcg ggtgatgtca acactggctt agggaactcg 660ggcaacatca atactggtgg gtttaatccg ggcacgctca acacgggctt cttcagcgcg 720atgacccaag ctggtccgaa ttcgggcttc ttcaacgccg gtaccggtaa ctctggtttc 780gggcacaacg acccggctgg cagtggcaac tcgggcattc agaactcggg cttcggcaac 840tcgggctatg tcaataccag caccacaagc atgttcggcg gtaactcagg ggtgctcaac 900acgggctacg gcaactcagg tttctataac gcggccgtca acaacaccgg gatttttgtg 960accggcgtga tgagttcggg atttttcaat tttgggacgg gcaactcggg cctgctggtc 1020agcggcaatg ggctttcggg tttcttcaag aacttgttcg ga 1062 62 654 DNA Mycobacteria tuburculosis 62atgagccgac tcctagcttt gctgtgcgct gcggtatgca cgggctgcgt tgctgtggtt 60ctcgcgccag tgagcctggc cgtcgtcaac ccgtggttcg cgaactcggt cggcaatgcc 120actcaggtgg tttcggtggt gggaaccggc ggttcgacgg ccaagatgga tgtctaccaa 180cgcaccgccg ccggctggca gccgctcaag accggtatca ccacccatat cggttcggcg 240ggcatggcgc cggaagccaa gagcggatat ccggccactc cgatgggggt ttacagcctg 300gactccgctt ttggcaccgc gccgaatccc ggtggcgggt tgccgtatac ccaagtcgga 360cccaatcact ggtggagtgg cgacgacaat agccccacct ttaactccat gcaggtctgt 420cagaagtccc agtgcccgtt cagcacggcc gacagcgaga acctgcaaat cccgcagtac 480aagcattcgg tcgtgatggg cgtcaacaag gccaaggtcc caggcaaagg ctccgcgttc 540ttctttcaca ccaccgacgg cgggcccacc gcgggttgtg tggcgatcga cgatgccacg 600ctggtgcaga tcatccgttg gctgcggcct ggtgcggtga tcgcgatcgc caag 654 63 489 DNA Mycobacteria tuburculosis 63gtgtgctgca atggcgtggt gactccgggt gatccagccg acattgcagc gatcaaacag 60ctcaaatacc ggtatctgcg ggcattggac accaagcatt gggacgactt caccgacacc 120ctggccgagg atgtcaccgg cgattacggg tcatcggtcg gtacggagct gcacttcacc 180aaccgcgccg acctggtcga ctacctgcgc caggcactcg gcccgggtgt catcaccgaa 240caccgggtca cccatccgga aatcaccgtg accggcgata ccgcaaccgg catctggtac 300ctgcaagacc gggtcatcgt cgccgagttc aatttcatgc tcatcggcgc cgcgttctac 360cacgaccagt accgacgaac caccgacggc tggcggatca gcgccaccgg ctacgaccga 420acctacgagg cgaccatgtc gttggcgggc cttaacttca acatcaggcc gggccgcgcg 480ctggccgat 489 64 1227 DNA Mycobacteria tuburculosis 64atgagccaat cccggtacgc ggggttgtcc cgcagcgagc tggcagttct gttacccgag 60ctgttgttga tcggccagct gatcgaccga tcgggcatgg cctggtgtat acaggcattc 120ggccgccagg agatgctgca gatcgccatc gaggagtggg cgggcgccag cccgatctac 180accaagcgca tgcaaaaggc gctgaacttc gagggcgacg acgtgcccac catcttcaag 240gggctacagc tcgacatcgg cgcgccgccg caattcatgg acttccgttt caccctgcac 300gaccgctggc acggcgagtt tcacctcgac cactgcggtg cgctgctcga cgtggagccg 360atgggcgacg actacgtcgt cggcatgtgc cacaccatcg aagatccgac gttcgacgcc 420accgcgatcg cgaccaaccc gcgcgcgcag gtgcgcccca tccaccggcc gccccgcaag 480ccggccgacc ggcatccgca ctgtgcgtgg accgtcatca tcgacgagtc ctatcccgag 540gctgagggta ttccggcgct ggacgcggtc cgtgaaacca aagctgccac ctgggaatta 600gacaacgtcg atgcgtctga cgacgggctg gtggactatt cgggtccgct ggtgtccgac 660ctggacttcg gggcgttctc gcattccgca ctggtgcgga tggccgatga ggtctgcctg 720caaatgcacc tgctgaatct gtcgttcgcc attgccgtgc ggaaacgggc caaagccgat 780gctcaactgg ccatttcggt gaacacccgc cagttgatcg gagtggccgg gctgggcgca 840gaacgcattc accgtgcgat ggctttaccc ggcggaatcg aaggcgcgtt aggtgtgctg 900gagctacacc cgctgctcaa cccggccggt tacgtgctgg ccgaaacgtc gccggaccgt 960ctggtggtgc acaactcgcc agcccacgcc gacggcgcct ggatttcgtt gtgcacaccg 1020gcatccgtgc agccgttgca ggccatcgcc accgctgtag acccgcatct gaaggttcgg 1080atcagcggga cggacaccga ctggaccgcg gaactcatcg aggccgatgc cccagcgagc 1140gaactgccgg aggtgttggt agccaaggtc agtcgcggat cggtcttcca gttcgagccg 1200aggcgctcac tgccgttgac cgtgaaa 1227 65 1860 DNA Mycobacteria tuburculosis 65atgtacgacc cgctggggtt gtcgatcggg accacaaacc tggtcgcggc gggtaacgga 60ggtccgccgg ttactcgtcg cgccgtgctg accctgtacc cgcattgcgc accgaaaatc 120ggtgtgccta gccagaaccc gaacttgatc gagccgggcg ccctaatgag cggctttgtt 180gagcgcattg gagatgcggt ggcgctggtg tctcccgacg gatccgtgca cgatccagac 240ctcttgctgg tcgaggcgct ggatgcgatg gtgctgaccg ccggtgcgga cgcgagttcc 300tcggagatcg ccattgccgt tcccgcgcat tggaagcccg gagctgtaca cgcactgcgt 360aacggtttgc ggacgcacgt cggcttcgtc cgcagcggca tggcgccgcg cctggtttcc 420gatgcgatcg cggcgttgac cgcggtgaac tcggaattgg gcctgcccca cggcagtgtg 480gtggggttgc ttgatttcgg tggctccgcg acttacgtca ccttggtgga gaccaagtcg 540gattccagga cgtcggattt ccagcccgtt agtgccacgg cacggtacca ggacttttcc 600ggtagtcaga tcgaccaggc tttgctgctt cgggtcatcg accaattcgg gtacggcgat 660gacgtcgatc cggccagtac cgccgcggtc gggcaactcg gccaactcag ggagcagtgc 720cgtgcggcaa aggaacgact gtccaccgac gttgccacgg aattgttcgc tgagcttgcc 780gggtgcagct cgagcatcga gatgactcgg gaacagctcg aagacctgat ccaggatcca 840ttgaccggct tcatctacgc gttcgacgac atgctggcgc gccacaacgc gagctgggcg 900gatctcgcgg cggtggtcac cgtcggcggt ggtgccaata ttccccttgt gactcaacgt 960ctttcgttcc acactcgtcg acctgtgctg accgcgtcgc aacccgggtg cgcggcggcg 1020atgggtgcgt tgctgctcgc caaccgtggg ggagagcgcg attcgcgaac gcggacgtcc 1080atcggcctcg ccacggccgc agccgccggc accagtgtca tcgagctgcc ggccggcgac 1140gtcatggtca tcgaccatga ggccttgacc gatcgcgagt tggcctggtc gcagaccgac 1200ttcccaagcg aagctccggc gcgtttcgag ggcgactcgt ataacgaagg cggcccctgc 1260tggtcgatgc gtctgaacgc ggtcgagccc cccaaaggac cagcgtggcg gcgaatccgg 1320gtgtcgcagt tgctcatcgg ggtgtcggcg gtagtggcca tgaccgcgat cgggggcgtg 1380gcattgacgt tgacagccat cgagagacgc ccaagcccgc taccaacccc aattgtgccc 1440ggcctggccc cgatgccgcc cggatccgtc gtgcctagct cgcgcgcacc gaccccgccg 1500ccaccgccgt cgaccgttgc gccgcttccc agtgcggcac cggccccgac gacggtcgcg 1560ccggcaccgc cgccgcccac acaggtggtg acgaccacga cagcgccacc cgtcaccacg 1620acgccgaggc cgtcgccgac caccacaacg accaccgcgc caccgtcgac aacgacgaca 1680accgagccgc cggtgacgac cacttcgacg attccaacga ttccgacgac tacgacgacg 1740gtgaagatga ccacggagtg gttgcacgtc ccgtttttgc ccgttccgat cccggtcccg 1800attccgcaaa atccgggtgc cggcgaaccg cagaacccgt tcggaagcct tggctctggg 1860 66 720 DNA M. tuberculosis 66atgatccgat tggtccgtca ttcgatcgcc ctggtggccg ccggccttgc cgccgcattg 60tcggggtgcg attcccacaa ctcgggatcg ctcggtgccg atccgcggca ggtgaccgtg 120ttcggatccg ggcaagtgca gggtgtgccg gacacgttga tcgctgacgt cggcattcag 180gtcaccgcgg ccgacgtcac cagcgcgatg aaccagacca atgatcgcca gcaagcggtg 240atcgatgcac tggtgggtgc cggcctggac cgcaaggaca tccgcaccac cagggtcacc 300gtggcaccgc agtacagcaa tccggagccg gccggaaccg ccaccatcac cgggtatcgg 360gcagacaacg acatcgaggt gaagatccac ccgaccgacg ccgcgtcgcg gctgctggcc 420ctcgtcgtca gcaccggcgg tgacgccacc cggatcagct cggtcagcta ctcgattggc 480gacgactcgc agctggtgaa ggatgcccgg gcgcgcgcct tccaagacgc caagaaccgt 540gcggaccagt acgcacaact gtcggggctg cggctaggca aggtgatctc gatctccgag 600gcatctggcg ccgcgcccac gcacgaggcg ccggcgccgc cgcgcggcct atccgcggtg 660ccgctggaac ccggccagca gacggtgggc ttctcggtca cggtggtctg ggaactgacc 720 67 297 DNA Mycobacteria tuburculosis 67atgtcgatca tgcacgccga gccagagatg ctggctgcga ccgcggggga actgcagtcg 60atcaacgccg ttgcgcgggc cggaaatgca gcggtggcgg gcccgacgac gggtgtggtt 120ccggccgccg ctgatttggt gtccctgcta accgcctccc agtttgccgc gcatgcacag 180ctgtaccagg cgattagtgc cgaggcgatg gcggtccagg agcagttggc gaccacgctg 240ggcatcagcg ccggttcata tgcggccacc gaggctgcca acgccgccac gatcgct 297 68 1239 DNA Mycobacteria tuburculosis 68atgctggact ttgctcagtt accgccggag gtcaactccg cgctgatgta cgccggaccc 60ggttcgggac cgatgctggc tgccgcggcg gcctgggagg cgctggccgc cgagttgcaa 120accacggcgt ccacctacga cgctctgatc actggcctgg ccgacgggcc atggcagggg 180tcctccgcgg cgtccatggt ggctgccgcc acgccccagg tggcgtggtt gaggagcacc 240gccgggcagg ccgagcaagc cggcagccaa gcggtggcag cggcgagtgc ttatgaggcg 300gcgtttttcg cgaccgtgcc gcccccggag atcgcggcca acagggcgtt gttgatggcg 360ttgctggcga cgaacttcct tggccagaac acggcggcga tcgcggccac cgaggcgcaa 420tacgccgaga tgtgggccca ggatgcggcc gcgatgtacg gctatgctgg cgcgtcggcg 480gcggcgacgc agttgtcgcc attcaatccg gcggcgcaga ccatcaaccc ggccgggctg 540gccagccagg ccgcatctgt cggacaagct gtcagcgggg ccgcaaatgc gcaagcactc 600accgacattc ctaaagcgtt gtttgggctt agcggaatct tcaccaatga accgccttgg 660ctcaccgacc ttggcaaggc gctcggtttg accgggcaca cctggtcctc ggacggtagc 720gggctcatcg tgggcggagt gcttggcgac tttgtgcagg gtgtgaccgg gtcggccgaa 780cttgatgcca gcgtggccat ggacacgttc ggcaaatggg tctcgcccgc tcggctcatg 840gtcacccaat tcaaggacta ctttggcctg gcgcacgacc tgccgaagtg ggcgagtgaa 900ggcgccaaag ccgccggtga ggccgccaag gcgttgccgg ccgccgttcc ggccattccg 960agtgctggcc tgagcggcgt tgcgggcgcc gtcggtcagg cggcgtcggt cgggggattg 1020aaggttccgg ccgtttggac cgccacgacc ccggcggcga gccccgcggt gctggcggcg 1080tccaacggcc tcggagccgc ggccgccgct gaaggttcga cacacgcgtt tggcgggatg 1140ccgctcatgg gtagcggtgc cggacgtgcg tttaacaact tcgctgcccc tcgatacgga 1200ttcaagccga ccgtgatcgc ccaaccgccg gctggcgga 1239 69 294 DNA Mycobacteria tuburculosis 69atgacctcgc gttttatgac ggatccgcac gcgatgcggg acatggcggg ccgttttgag 60gtgcacgccc agacggtgga ggacgaggct cgccggatgt gggcgtccgc gcaaaacatt 120tccggcgcgg gctggagtgg catggccgag gcgacctcgc tagacaccat gacccagatg 180aatcaggcgt ttcgcaacat cgtgaacatg ctgcacgggg tgcgtgacgg gctggttcgc 240gacgccaaca actacgaaca gcaagagcag gcctcccagc agatcctcag cagc 294 70 282 DNA Mycobacteria tuburculosis 70atgaccatca actatcaatt cggggacgtc gacgctcacg gcgccatgat ccgcgctcag 60gccgggtcgc tggaggccga gcatcaggcc atcatttctg atgtgttgac cgcgagtgac 120ttttggggcg gcgccggttc ggcggcctgc caggggttca ttacccagct gggccgtaac 180ttccaggtga tctacgagca ggccaacgcc cacgggcaga aggtgcaggc tgccggcaac 240aacatggcac aaaccgacag cgccgtcggc tccagctggg cc 282 71 1185 DNA Mycobacteria tuburculosis 71atgaaggcac cgttgcgttt tggcgttttc atcacgccat tccatccgac cggtcaatcc 60ccgaccgtgg cgttgcaata cgacatggag cgcgtcgttg cgctggaccg gctcggctac 120gacgaggcgt ggtttggcga acaccactcc ggtggctacg agctgatcgc ttgcccggag 180gtgtttatcg cggccgcagc ggaacggacc acccacatcc ggctaggtac cggagtggtt 240tcgctgccct accatcatcc gctaatggtg gccgaccgtt gggtgctgct ggatcacctg 300acccgtgggc gggtcatgtt cggcaccggc cccggcgcgc tgccgtcgga cgcctacatg 360atgggcatcg atccggtcga gcagcgacga atgatgcagg agtccctcga ggcgattctc 420gcgctgttcc gtgccgcacc tgacgagcga atcgaccgcc actccgactg gttcaccctg 480cgtgaagcgc aattgcacat ccgcccctac acctggccgt accccgaaat cgctaccgca 540gccatgattt cgccatcggg tccgcgactg gccggtgcgc tgggcacgtc gctgttatca 600ctgtcgatgt cagtgcccgg cggctacgct gcgctggaaa cagcgtgggg cgtggtgcgg 660gagcaggccg ccaaagctgg gcggggcgag ccggatcgcg ccgattggcg ggtgttgagc 720atcatgcact tgtcggacag ccgcgaccag gcgatcgacg actgcactta cgggttaccc 780gacttctcga ggtacttcgg cgcggcaggg tttgtcccgt tggcgaacac cgtggaaggc 840acccagtcgt ctcgggaatt cgtcgagcaa tacgcggcca agggaaattg ctgcatcggc 900acgcccgatg acgcgatcgc ccacattgaa gacttgctgc accggtcggg tggcttcgga 960acgttgctac tgctcggcca cgactgggcc ccgccaccgg caacctttca ctcctatgag 1020ctgttcgccc gtgctgtgat tccttatttc aagggacaac tcgcggcgcc gcgggcgtcg 1080cacgaatggg ctagaggcaa gcgcgaccaa ttgattggcc gcgccggcga agcggtcgtc 1140aaagccatca ccgagcacgt cgccgaacaa ggggaagcgg gcagc 1185 72 966 DNA M. tuberculosis 72atgggcgcac ctaccgaacg gttagttgat accaacggcg tgcgactgcg agtggtcgag 60gccggtgagc ccggcgcacc cgtggtgata ctggcccacg gctttcccga actggcctat 120tcatggagac accagattcc tgcgcttgcc gacgccggct accacgtgtt ggctcccgat 180cagcgcggtt acggcggatc gtctcgccca gaggcgatcg aggcctacga cattcaccgg 240ttgaccgctg acctagtggg cctactagat gatgtcggtg ccgagcgggc ggtctgggtt 300ggtcatgact ggggtgccgt ggtggtgtgg aacgcgccac tgctgcacgc tgaccgagtc 360gccgccgttg ccgcgttgag cgtccccgcg ctgccccggg cacaggtgcc gccgacgcaa 420gcgttccgca gcaggtttgg ggagaacttc ttctacatcc tttatttcca ggagcccggc 480atcgccgacg ccgaactcaa tggcgacccg gcccgcacga tgcgccgaat gatcggcggt 540ctgcgccctc cgggcgatca gagcgcggca atgcgtatgc tggcgcccgg ccccgacggc 600tttatcgatc ggcttccgga gccggccggg ttgccggcct ggattagtca ggaggaactc 660gaccactaca tcggcgagtt cacccgcacc ggtttcaccg gcggcctgaa ctggtaccgc 720aacttcgacc gcaactggga gaccacggcc gacctcgccg gcaagacgat ctccgtgccc 780tcgttgttca ttgcgggcac agccgatccc gtcttgacgt tcacccgcac cgaccgcgct 840gcggaggtga tctccggccc gtatcgcgag gtgctgatcg acggggccgg tcactggctg 900cagcaggaac gtcccggtga ggtgaccgcg gccctgctgg agttcctgac ggggttggag 960ttgcga 966 73 1365 DNA Mycobacteria tuburculosis 73gtgaataccg atgtgctggc tggcctgatg gccgagctgc ccgaggggat ggtggtcacc 60gaccccgccg tcaccgacgg ctaccggcaa gaccgggcct ttgacccttc ggccggcaaa 120ccgctggcaa tcatccggcc acggcgcacc gaagaggtgc agacggtgct gcgttgggcc 180agtgcgaacc aggtgcccgt ggtgacccga ggagccggta gcggcctttc gggcggggcg 240accgccctgg atggcgggat cgtgctgtcc accgaaaaga tgcgcgacat caccgtcgac 300ccggtcaccc gcaccgcagt gtgccagccc ggcctgtaca acgccgaggt gaaggaggcc 360gccgccgaac acggcctgtg gtatcccccg gatccgtcgt cgttcgagat ctgcagcatc 420ggcggcaaca tcgccaccaa cgccggcggg ctgtgctgcg tgaagtacgg cgtcacaggc 480gactacgtac tgggcatgca ggttgtgctg gccaacggca ccgcggtccg gctgggcggc 540ccacggctca aggacgtcgc cgggctttcc ctgaccaaac tgttcgtcgg cagcgaaggc 600acgctgggcg tcatcacgga ggtgacgttg cgactgctgc ccgcacagaa tgcatcgagc 660atcgtggtgg ccagcttcgg ctcggtgcag gcggcggtcg atgcggtgct cggggttacc 720ggccgacttc gccccgcgat gctggagttc atggattcgg tggcgatcaa cgccgtcgag 780gacaccttgc ggatggacct ggaccgcgat gcggcggcca tgctggtggc tggttctgat 840gaacgtggcc gcgcggccac cgaagacgcc gccgtgatgg ccgccgtgtt cgccgaaaac 900ggtgcgatag acgtgttttc gaccgacgac ccggatgagg gcgaggcgtt cattgcggcc 960cggcggttcg ccattccggc ggtcgagagc aagggggcgt tgctgctcga ggacgtcggg 1020gtaccgctgc ccgcactggg cgaactggtc accgggattg cgcgcatcgc cgaggagcgg 1080aatctgatga tctcggtgat cgcccacgcc ggggacggca atacccaccc gttgctggtg 1140tacgaccccg cagatgccgc gatgctagag cgcgcccacc tcgcgtacgg cgaaatcatg 1200gacctggccg tcggcctggg cggcacgatc accggcgaac acggcgtggg ccggttgaaa 1260cggccgtggt tggccggcta tctcgggccc gacgtcctgg ccctcaacca gcgcatcaag 1320caagcgctgg acccccaggg catcctcaat cccggctcgg cgatc 1365 74 1215 DNA Mycobacteria tuburculosis 74atgacatcag taatgtctca cgaattccag ctcgccaccg ccgaaacctg gccgaatccg 60tggccgatgt accgcgcgtt gcgcgaccac gacccggtgc accacgtcgt cccgccgcag 120cgtcccgagt acgactacta cgtgctgtcc cggcacgccg acgtctggtc ggcagcgcgg 180gaccatcaga cgttctcgtc ggcgcaaggc ttgaccgtta actacggcga gctggaaatg 240attggactgc acgacacccc gcccatggtg atgcaggatc cgccggtcca caccgagttt 300cgcaagctgg tgtcgcgcgg cttcacgcca cgacaggtcg aaaccgtcga gcccacggtg 360cgcaagttcg tcgttgagcg gctcgaaaag ctgcgcgcca acggtggcgg cgacattgtc 420accgaactat tcaaaccgct cccgtcgatg gtggtggcgc actatctcgg tgttcccgaa 480gaggattgga cgcaattcga cgggtggacc caggccatcg tggcggcgaa cgcggttgac 540ggcgccacca ccggcgcact ggacgcggtc ggctcgatga tggcctactt caccgggctg 600atcgagcgac gccgcaccga gcccgccgac gacgccatct cccacctggt agccgccggg 660gtcggcgccg acggcgacac cgccggcaca ctgtccatac tggcgttcac gttcaccatg 720gtcaccggcg gcaacgacac cgtcaccggc atgctaggcg gttcgatgcc gttgctgcac 780cggcggcccg accagcgccg gctgctgctg gatgacccag agggcatccc cgacgcggtc 840gaggagctgc tgcggctcac ctcgccggtg caggggctgg cgcgcacaac cacgcgcgac 900gtcacgatcg gtgacaccac catcccggcc ggtcgccggg tgctgctgct gtacggctcg 960gccaaccgtg acgaacgcca atacggcccg gacgcagccg aactcgatgt cactcggtgc 1020ccgcgcaaca tcttgacctt cagccacggc gcccaccact gcctgggtgc ggccgcggcc 1080cggatgcaat gccgggtggc gctgaccgaa ctgctggccc ggtgcccgga cttcgaggtg 1140gccgagtcac gcatcgtgtg gtccggcggc agttatgtcc ggcgtccgct gtcggtgccg 1200ttccgagtga catcc 1215 75 606 DNA Mycobacteria tuburculosis 75atggcgggta ccgactggct gtccgcgcgt cggaccgagt tagccgcaga tcggatactc 60gacgccgccg agcgactctt tacgcagcgt gacccggcgt cgatcggcat gaacgagatc 120gccaaggccg caggctgttc gcgcgcaaca ctgtatcggt acttcgacag ccgcgaggcg 180ctgcgaaccg cgtacgtgca ccgcgagacc cgccggctcg gccgcgagat catggtgaag 240atcgccgatg tcgtcgaacc tgccgaacgg ctgctggtga gcatcaccac gacgttgcgg 300atggtccgcg acaaccccgc gttggccgcg tggtttacca ccacccgccc accgatcggc 360ggcgagatgg ccggacggtc cgaggtgatc gcggccctgg ccgcggcatt cctcaactca 420ctaggtcccg acgatccgac caccgtcgaa cgccgcgccc gctgggtggt ccggatgctc 480acatcgctgc tgatgttccc cggccgtgac gaagccgacg aacgagcgat gatcgcggag 540ttcgtcgtcc cgatcgtgac acctgcttct gccgccgcta ggaaggccgg tcaccctgga 600cccgag 606 76 534 DNA Mycobacteria tuburculosis 76atgcatccaa tgataccagc ggagtatatc tccaacataa tatatgaagg tccgggtgct 60gactcattgt ctgccgccgc cgagcaattg cgactaatgt ataactcagc taacatgacg 120gctaagtcgc tcaccgacag gctcggcgag ctgcaggaga actggaaagg tagttcgtcg 180gacttgatgg ccgacgcggc tgggcggtat ctcgactggc tgactaaaca ctctcgtcaa 240attctggaaa ccgcctacgt gatcgacttc ctcgcatacg tctatgagga gacacgtcac 300aaggtggtac ccccggcgac tatcgccaac aaccgcgagg aggtgcacag gctgatcgcg 360agcaacgtgg ccggggtaaa cactccagca atcgcaggac tcgatgcaca atatcagcag 420taccgggccc aaaatatcgc tgtcatgaac gactatcaaa gtaccgcccg gtttatccta 480gcgtatctgc cccgatggca ggagccgccg cagatctacg ggggcggggg cggg 534 77 1230 DNA Mycobacteria tuburculosis 77gtggccacga tagcccaacg gctgcgtgac gaccacgggg tggcggcgtc ggagtcgtcg 60gtgaggcgtt ggatcgcaac gcatttcgcc gaggaggtgg cccgcgagag agtcacggtg 120ccgcgcggac cggtcgatgc gggtagtgag gcgcagatcg attacgggcg gctgggcatg 180tggttcgacc cggccaccgc gcgccgggtc gcggtgtggg cgttcgtgat ggtgctggcg 240ttctcccgac acctgttcgt gcgtccggtc atccggatgg accaaaccgc ttggtgtgct 300tgccatgtcg ccgcattcga attcttcgac ggggtgccgg cgcggctagt gtgtgacaac 360ctcaggaccg gggtggacaa gcccgacctg tacgacccgc agatcaaccg ctcctacgcc 420gagctggcca gccactacgc cacgctggtc gacccggccc gcgccagaaa acccaaagat 480aaaccccgcg tggagcggcc gatgacctat gtgcgggact cgttttggaa aggccgcgag 540ttcgattcgc tggcccagat gcagcaggcg gcggtcacct ggagcaccga agtggccggg 600cttcggtact tacgtgcctt ggagggcgcc caacccctgc ggatgttcga agctgtggag 660caacaagcgt tgatcgcatt gccgcccagg gcatttgaac tcaccagctg gtcgatcggc 720accgtcgggg tggacacgca cctcaaagtt ggcaaggcac tctattccgt gccgtggcgg 780ctgatcgggc aacgcctgca cgcgcgcacc gccggtgatg tggtgcagat cttcgccggc 840aacgatgtgg tggccaccca tgtgcgccga cccagcgggc gctccaccga cttctcccac 900tacccaccgg agaagatcgc cttccacatg cgcaccccga cctggtgtcg acacaccgcc 960gaactggtcg gcccagccag ccagcaagtg atcgccgaat tcatgcgcga caacgccatc 1020caccacctac ggtcggccca aggcgtgctc gggctacgcg acaaacacgg ctgcgaccgg 1080ctggaggccg cctgcgcccg cgccatcgag gtcggcgacc cgagctatcg caccatcaag 1140ggcatccttg ttgccggcac cgaacacgcc gccaacgagc cgaccaccag tagtccggca 1200agcaccgctg ggggcgttcc tgcgcggccc 1230 78 753 DNA Mycobacteria tuberulosis 78atgtctatct gtgatccggc gctgcgtaat gcgctacgta ccctgaaact gtccggcatg 60ctcgacaccc tcgacgcccg cctggcccaa acccgcaacg gcgacctggg gcatctggaa 120ttcctgcaag cgttgcgtga agacgagatc gcccgccgcg agtccgccgc cctgacacga 180cgattacgcc gcgccaagtt cgaagcccaa gccaccttcg aagacttcga cttcactgcc 240aacccgaaac tgcccggtgc gatgttgcgc gatctggccg cgctgcgctg gctggatgcc 300ggcgaatcgg tcatcctcca cggcccggtc ggcgtcggaa aaacccatgt agcacaagca 360cttgtccacg ccgtggcccg ccgcggcggc gacgtgcgct tcgccaaaac ctcccgcatg 420ctctccgacc tcgccggcgg gcacgccgac cgatcctggg gccaacgcat ccgcgaatac 480accaagccgc tcgtgctcat tctggacgac ttcgcgatgc gtgagcacac cgccatgcac 540gctgatgacc tctacgagct catcagcgac cgcgccatca ctggcaaacc gctgatcttg 600accagcaacc gcgcaccgaa taactggtac ggcctgttcc ccaaccccgt cgtcgccgaa 660tcactcctgg atcggctcat caacaccagc caccaaatcc tcatggacgg acccagctac 720cgaccccgca agagacccgg ccgcaccacc agc 753 79 696 DNA Mycobacteria tuberulosis 79atgcatctaa tgatacccgc ggagtatatc tccaacgtaa tatatgaagg tccgcgtgct 60gactcattgt atgccgccga ccagcgattg cgacaattag ctgactcagt tagaacgact 120gccgagtcgc tcaacaccac gctcgacgag ctgcacgaga actggaaagg tagttcatcg 180gaatggatgg ccgacgcggc tttgcggtat ctcgactggc tgtctaaaca ctcccgtcag 240attttgcgaa ccgcccgcgt gatcgaatcc ctcgtaatgg cctatgagga gacacttctg 300agggtggtac ccccggcgac tatcgccaac aaccgcgagg aggtgcgcag gctgatcgcg 360agcaacgtgg ccgggggtaa acactccagc aatcgcagac ctcgaggcac aatacgagca 420gtaccgggcc gaaaatatcc aagcaatgga ccgctatcta agttggaccc gatttgcgct 480atcgaagctg ccccgatggc gggagccgcc gcagatccac aggagcgggt aggtccaaga 540ggccggcgcg gtcttgcagg ccagcaacaa tgccgcggtc gaccaggccc atcgcttcgc 600tgctcgcacg acacaccgcg gtttcagatg aatcaggcgt ttcacaccat ggtgaacatg 660ttgctgacgt gttttgcatg tcaggagaaa ccgaga 696 80 528 DNA Mycobacteria tuberulosis 80atgcatccaa tgataccagc ggagtatatc tccaacataa tatatgaagg cccgggcgct 60gactcattgt ttttcgcctc cgggcaattg cgagaattgg cttactcagt tgaaacgacg 120gctgagtcgc tcgaggacga gctcgacgag ctggatgaga actggaaagg tagttcgtcg 180gacttgttgg ccgacgcggt tgagcggtat ctccaatggc tgtctaaaca ctccagtcag 240cttaagcatg ccgcctgggt gatcaacggc ctcgcgaacg cctataacga cacacgtcgg 300aaggtggtac ccccggagga gatcgccgcc aaccgcgagg agaggcgcag gctgatcgcg 360agcaacgtgg ccggggtaaa cactccagca atcgcagacc tcgatgcaca atacgaccag 420taccgggccc gcaatgtcgc tgtaatgaac gcctatgtaa gttggacccg atctgcgcta 480tcggatctgc cccggtggcg ggaaccgccg cagatctaca ggggcggg 528 81 1170 DNA M. tuberculosis 81atgatcatcg ttgtcgggat cggcgccgac ggcatgaccg gtctctccga gcattctcgc 60tccgaattgc gcagggccac agtaatttac ggctcgaaac ggcaacttgc cctgctcgac 120gataccgtca ccgccgagcg ctgggagtgg ccgacgccga tgctgcccgc ggtgcaaggc 180ctgtcaccgg atggggctga cctacacgtg gttgccagcg gcgacccgtt gttgcatggt 240atcggctcca ccctgatccg gctgttcggc cacgacaacg tgaccgtgtt gccgcacgtg 300tccgcggtga cgttggcgtg cgcccggatg ggctggaacg tgtatgacac cgaggtgatc 360agcctggtca ccgcgcaacc acacaccgcg gtgcgccgcg gcggccgggc catcgtgctg 420tccggcgatc ggtccacccc gcaggcgctg gcggtgctgc tgaccgagca cggtcgcggt 480gactccaagt tcagcgtgct cgaacagctt ggcggcccgg ccgaacgccg ccgcgacggt 540acggcccggg catgggcctg cgacccaccc ctcgatgtcg atgagctcaa cgtgatcgcc 600gtgcgctacc tgctcgacga gcgcacgtcg tgggcacccg acgaggcatt cgcgcacgac 660gggcagatca ccaaacaccc gatccgcgtg ctgaccctgg ctgcgctggc gccaaggccc 720gggcagcggt tatgggacgt cggcgcgggc tcaggcgcca tcgcggtcca gtggtgtcgg 780agctggccgg gctgcaccgc ggtggcgttc gagcgcgacg aacggcgccg ccgcaacatt 840gggttcaatg ccgcggcctt cggggtgagc gtcgacgtgc gcggcgacgc gcccgatgcg 900ttcgacgacg ccgcacggcc gtcggtgatt tttcttggcg gtggtgtaac ccagccaggc 960ctgcttgagg cctgcctgga cagcctgccc gcaggcggga acttggtcgc caacgctgtc 1020accgtcgaat cggaagccgc tctggcgcat gcatattcgc gcctcggtgg cgagctacga 1080cgattccagc actatctcgg cgaaccgctg ggcggcttca ccggttggcg cccacagctg 1140ccggtcaccc agtggtcggt gaccaagcga 1170 82 747 DNA Mycobacteria tuberulosis 82gtggacgaca cgggcgctgc tccggtagta attttcggcg gccgcagcca gatcggcggc 60gaactcgcgc gacgcctggc tgccggggcg acgatggtgc tggccgcgcg gaacgccgat 120caactcgccg accaggccgc cgcactccgc gcagctggcg ctatagcggt gcacacccgg 180gagttcgacg ccgacgacct ggccgcacac ggcccgttgg tcgcttcgct cgttgccgag 240cacggcccca tcggcaccgc ggtgctggcc ttcgggatac tcggcgacca ggcccgcgcc 300gagacagacg cggcgcacgc ggtggccatc gtgcacaccg actacgtcgc ccaggtcagc 360ctgctgactc atctggcagc ggcgatgcgc accgccggac ggggatcgct ggtggtgttc 420tcctcggtcg ccgggattcg ggtgcgccgc gccaactatg tctacggatc ggccaaagcc 480ggcctggacg gcttcgccag cggcctggcc gatgcgttgc acggcaccgg ggtgcggtta 540ctgatcgcgc ggccgggatt cgtcatcggg cgcatgaccg agggcatgac gcccgcaccc 600ctgtcggtca ccccggagcg ggtggccgcc gcgaccgcgc gtgcgctggt caacggtaag 660cgcgtggtgt ggattccgtg ggcgctgcgg ccaatgtttg ttgcgctgcg gttgcttccc 720cggttcgtct ggcgcaggat gccgcga 747 83 411 DNA Mycobacteria tuberulosis 83gtggcgatgg tcaacaccac tacgcggctt agtgacgacg cgctggcgtt tctttccgaa 60cgccatctgg ccatgctgac cacgctgcgg gcggacaact cgccgcacgt ggtggcggta 120ggtttcacct tcgaccccaa gactcacatc gcgcgggtca tcaccaccgg cggctcccaa 180aaggccgtca atgccgaccg cagtgggctt gccgtgctca gccaggtcga cggcgcgcgc 240tggctctcac tggagggtag ggcggcggtg aacagcgaca tcgacgccgt gcgcgacgcc 300gagctgcgct acgcgcagcg ctatcgcacc ccgcgtccca atccacgccg agtggtcatc 360gaggtccaga ttgagcgcgt gctgggatcc gcggatctgc tcgaccgggc c 411 84 1461 DNA Mycobacteria tuberulosis 84atgccccgcg cccgatggct gcagagcgcg gccctcatgg gcgccttggc cgtggtgttg 60ataaccgcgg caccggtggc cgccgatgcc taccaggtgc ccgctccgcc ctcgcccacc 120gcatcctgtg acgtaataag cccggttgcg atcccctgcg tggcgctcgg caagttcgcc 180gacgcggtcg ctgcggagtg tcgccgcgtc ggtgtgcccg atgcgcggtg cgtgcttccg 240ctcgcgcacc gggtgaccca ggccgcgcgt gatgcctacc tacagtcttg ggtgcatcgc 300accgcgcggt tccaggatgc gttgcaagac ccggtgccgc tgcgggaaac tcagtggctc 360ggcacgcaca actcgttcaa cagcctcagc gattcgttca cggtctcgca cgcagactca 420aaccagcagc tgtcgttggc ccaacagctc gacatcgacg tccgcgcgct cgagctagac 480ctgcactact tgccccgcct cgagggccac ggcgcccccg gcgtcaccgt gtgtcacggg 540ctgggaccga agaacgcgaa cctaggctgc accgtcgaac ctctgctggc cacagtgctg 600ccgcagatcg ccaactggtt gaacgcaccc gggcataccg aggaggtcat cctgctctac 660ctggaggacc agctgaagaa cgcgtcggcg tatgagtcgg tggtggctac cctcgaccaa 720gtgttgcggc gtgcggacgg aacaagcctt atctaccgtc ccaacccggc ccggcgtgcc 780accaacggct gtgtcccgct tccactcgac gtgtcgcggg aggaaatccg cgcatccggc 840gcacgagccg tgctcgtcgg gtcttgtgcg ccaggttggt cggccgccgt cttcgactgg 900agcggcgttg agctggaaag cggctcgaac tccggctacc ggccataccc ggcctgcgat 960gccacctatg gccgcggtgt ctacgcttgg cgactggtcc gctattacga ggactccacg 1020ctggccacgg cgttggccaa cccgacccgt ccaccggcca atccgcaggc gcttaccccg 1080ccgaaggtgc cggcgatgac cgattgcggg gtcaatctgt tcggcttcga tcagctgctc 1140cccgaagacg gccgcattca ggcgtcgttg tggagctggg caccggacga accgcgtgcc 1200ggtgccggag catgcgccct gcagggcgcg gatggccgct gggtcgccgc atcgtgcggt 1260gacccacacc ctgcggcctg tcgggacgcg gcaggcaggt ggaccgtgac gccggcaccc 1320gtggtcttcg ccggggctgc cctagcctgc acagccatcg gcgcggactt taccctgccc 1380cgaacgggca atcagaacgc ccgtctgcac gccgtggccg ggcccgccgg tggcgcctgg 1440gtgcattacc tactgccgcc a 1461 85 429 DNA Mycobacteria tuberulosis 85atgaccacca cgccccgaca acccctgttc tgcgcccacg ccgacaccaa cggcgacccg 60ggccgctgcg cctgcggcca gcagctcgcc gacgtcggcc cggccacccc gccaccgccc 120tggtgcgaac cgggcaccga acccatctgg gagcagctca ccgaacgata cggcggcgtc 180acaatctgcc agtggacacg atattttccg gccggcgacc cggtggctgc cgacgtgtgg 240atcgccgccg acgatcgtgt cgttgacggc cgggtgctgc gcacccaacc ggcgattcac 300tacacggaac cgcccgtgtt ggggatcggc ccggcggcgg cccgccggct ggccgctgag 360ctgctcaacg ccgccgacac cctcgacgac ggccgccggc agctagacga cctcggcgaa 420caccggcgg 429 86 996 DNA Mycobacteria tuberulosis 86gtgaacaccg cgacccgggt ccggctggcc cgcaaacgcg ccgaccggct caatctgaaa 60ctaatcaaga acggccacca cttcaggttg cgtgacgccg acgagatcac gctggcggtc 120gggcacctag gggtggtgga agccttcctg gcggcggcca agtcgcaaaa caagccgccc 180ggtccgccgc cgagcctcca cgccccgcca tcctggcggc gcgacatcga cgactacctg 240ctcaacctga acgccgccgg tcaacgccca gcgacgatcc ggctacgcaa gacggtgctg 300tgcgcagccg cccacggcct cggccgccca cccgccgacg tcaccgccga acacctcctg 360gactggctag gcaaacagca gcacctctcc ccagagggcc gcaaaaccta tcgcagcacg 420ttgcggggct tcttcgtgtg ggcctacgaa atggaccggg tgcgcgacta tgtcgcagac 480tccctgccta aggtgcgctg cccgaaacag ccgccccgcc cggccggcga cgacgtctgg 540caagcggcgc tggccaaggc cgaccgtcga atcgagctga tgatccgcct agccggtgag 600gccgggctgc gacgcgccga agccgcccag gcgcacaccg gcgacttgat ggacggcggg 660cttctcctcg ttcacggcaa aggtggtaaa cgccgtattg tgccgatcag cgactacttg 720gccgcgctca tccgcgacac cccgcacggc tacctgttcc ccaacggcac cggcggccac 780ctcaccgccg aacacgtggg aaaactcgtc tcccgggcat tacccggtga cgcgaccatg 840cacaccctgc ggcaccgata cgccacccgc gcctaccgcg gctcccacaa cttgcgagct 900gtacaacaac ttctcggtca cgcctcgatc gtgacaacag aacgctacac agcgctgtgc 960gacgacgagg tgcgcgccgc agcagcagcc gcatgg 996 87 366 DNA Mycobacteria tuberulosis 87gtgcacgtgt gccacacgat cgccgacgtg gtcgaccggg ccaaagccga acgctccgaa 60aacacgcttc gcaaggattt caccccctcg gagctgctcg ccgctggtcg ccggatcgcc 120gagctggaac ggccgaaagc caaacagcgg caacgcgaag gcggcgacca tggccgccag 180gctcgatatt ctggcttagg ctccatggag cctaagccag aatcagagcg cgatgcccac 240aaagccgaca ctgccatcag cgaagccctc ggcatctccc gcggccacta ccagcggctc 300aaacgaatcg acaacgcaac ccgcagcgaa gctggctacc gggatggttt aaacggttgg 360agcggc 366 88 324 DNA Mycobacteria tuberulosis 88atgtcaggtg gttcatcgag gaggtacccg ccggagctgc gtgagcgggc ggtgcggatg 60gtcgcagaga tccgcggtca gcacgattcg gagtgggcag cgatcagtga ggtcgcccgt 120ctacttggtg ttggctgcgc ggagacggtg cgtaagtggg tgcgccaggc gcaggtcgat 180gccggcgcac ggcccgggac cacgaccgaa gaatccgctg agctgaagcg cttgcggcgg 240gacaacgccg aattgcgaag ggcgaacgcg attttaaaga ccgcgtcggc tttcttcgcg 300gccgagctcg accggccagc acgc 324 89 984 DNA Mycobacteria tuberulosis 89aaagaccgcg tcggctttct tcgcggccga gctcgaccgg ccagcacgct aattacccgg 60ttcatcgccg atcatcaggg ccaccgcgag ggccccgatg gtttgcggtg gggtgtcgag 120tcgatctgca cacagctgac cgagctgggt gtgccgatcg ccccatcgac ctactacgac 180cacatcaacc gggagcccag ccgccgcgag ctgcgcgatg gcgaactcaa ggagcacatc 240agccgcgtcc acgccgccaa ctacggtgtt tacggtgccc gcaaagtgtg gctaaccctg 300aaccgtgagg gcatcgaggt ggccagatgc accgtcgaac ggctgatgac caaactcggc 360ctgtccggga ccacccgcgg caaagcccgc aggaccacga tcgctgatcc ggccacagcc 420cgtcccgccg atctcgtcca gcgccgcttc ggaccaccag cacctaaccg gctgtgggta 480gcagacctca cctatgtgtc gacctgggca gggttcgcct acgtggcctt tgtcaccgac 540gcctacgctc gcaggatcct gggctggcgg gtcgcttcca cgatggccac ctccatggtc 600ctcgacgcga tcgagcaagc catctggacc cgccaacaag aaggcgtact cgacctgaaa 660gacgttatcc accatacgga taggggatct cagtacacat cgatccggtt cagcgagcgg 720ctcgccgagg caggcatcca accgtcggtc ggagcggtcg gaagctccta tgacaatgca 780ctagccgaga cgatcaacgg cctatacaag accgagctga tcaaacccgg caagccctgg 840cggtccatcg aggatgtcga gttggccacc gcgcgctggg tcgactggtt caaccatcgc 900cgcctctacc agtactgcgg cgacgtcccg ccggtcgaac tcgaggctgc ctactacgct 960caacgccaga gaccagccgc cggc 984 90 1437 DNA Mycobacteria tuberulosis 90atgactaatg aacaacattt cgctgacgat ggcgacatca aacagctcag cctcgacgaa 60acccgttccg cggcaaaaca gctcctcgac tccgtcgagg gcgacctgac cggtgatgtg 120gcgcaacgtt ttcaggcgct gacacgccac gccgaggaac tgcgggcgga gcagcgccgc 180cgcggccgcg aagccgagga ggcgctgcgc cgctgccggg ccggtgagct gagggtggtg 240cccggtgctc ccaccggcgg cgacgacggc gacgcgccgc cgggcaactc gttgcgcgac 300atcgcgtttc gcacactgga cgtttgtgtg cgcgatggcc tgatgtcgtc gcgggcggcg 360gaagccgcgg aaaccttgtg ccgcaccggg ccgccgcagt cgacgtcgtg ggcgcagcgc 420tggctggcgg ccaccggcaa ccgcgactac ctgggggcgt tcgtcaagag ggtttcgaac 480cctgttgcgg ggcacacgac ctggaccgac cgggaagcgg ccgcgtggcg tgaggcggcc 540gcggtggccg ccgagcagcg agcaatgggc ttggtggaca ccgccggcgg gtttttgatc 600ccggcggcgc tggatccggc gattctgctg tcgggtgatg gttcaacgaa tccgatccgg 660caggtggcga gggtggtgca aacgacctcc gaggtttggc ggggcgtgac ctccgaaggc 720gccgaggctc attggtactc cgaagcccag gaggtgtccg acgattcgcc aacgctggcc 780cagccggcgg tgccgagcta ccgtggctcc tgctggattc cgttcagtct cgagattgag 840ggtgacgccg ccggattcgt cgcagaggtg ggccgcgtcc tagcggattc ggttgagcag 900ctgcaggcgg cggcgttcgt cagcggctcc ggcaacggcg agcccaccgg attcgtctcc 960gcactgaccg gcaccgcgga ctacaccgtc accggcgcgg ggacggaagc cgttgtagcc 1020gccgacgttt acgcgctgca gtcggcgttg ccgccgcgct ttcaatccaa cagcgcgttc 1080gcggcgaact tgtccaccat caacgtgctg cgccaggcgg aaaccgcgaa tggggcgctg 1140aaattcccat cgctgcacgc cagcccgccg atgctggccg ggaaacacat ctgggaggtg 1200tcgaacatgg acaccgtgga cgcggcggtg accgccacca attacccgct ggtgcttggc 1260gactggaagc agttcatcat caccgaccgg gtcgggtcga cggtggagct ggtgccgcac 1320gtgttcggcg gcaaccgccg accgaccgga cagcgcggat tcttctgctg gttccgagtc 1380ggttctgatg tgctggtgga caatgcgttc cgcgtgctga aggtgcagac caccgcg 1437 91 531 DNA Mycobacteria tuberulosis 91ttgagtagca tccttttccg cacggccgag ctgcggcctg gtgagggccg caccgtgtac 60ggcgtcatcg tgccttatgg cgaggtgacc accgtccgcg acctcgacgg cgagttccgg 120gaaatgttcg ctcctggcgc ttttcggcgc tccatcgctg agcgcggcca caaggtgaag 180ctgctggtct cccacgacgc tcgaacccgc tacccggttg gccgggccgt cgagctgcgt 240gaggagcctc acggcttgtt cggggcgttc gagcttgcga acaccccgga cggcgacgag 300gccctggcga atgtgaaagc tggtgtggtg gacgcgtttt cggtgggttt ccggccgatc 360cgggaccgcc gggaagggga tgtgatcgtg cgggtcgagg cggcgctgtt ggaggtctcc 420ttgaccggcg ttccggccta tctgggcgcg cagatcgccg gtgtgcgcgc ggaatcgctt 480gcagtcgttt cccgttcgct agccgaagcc aggttagccc tgatggattg g 531 92 624 DNA Mycobacteria tuberculosis 92ttgccatcgc cagcaaccgc ccgaccggac accgccacgg tgggagagcg tgtgcgcgct 60caagttttat ggggcgtttt ttggcatcat ggcattcgcg acccgaaacc cggaaagagg 120agggtggtgt tgaaaatggg taggcgtggt cccgcgccgg cgccggcgca gttgaaactc 180ctcggcggcc gctcgccggg ccgtgattct ggcggccggc gggttacacc accggcggcg 240ttcgagcgtg ttgcgccgga atgcccggat tggttgccgc caggcgctaa agacatgtgg 300gggcgcgtcg ttcccgagct tgcggcatta aacctgctga aggagtccga ccttggggtg 360ctgacctcct tctgcgtcgc ctgggatcag ctcatgcagg ctgtaacagc ctaccgtgaa 420cagggtttca tcgcgacgaa cgcccgcagc cgacgggtga cggtgcatcc tgccgtggcc 480gcggcccggg ccgcgacgag ggacgttttg gtgctcgcgc gcgaattggg gtgcacgcca 540agcgctgagg cgaatttggc tgctgtgctg gcggcggcgg gggaccccga cgacgacgag 600ttcaacccgt tcgccccaga ccgg 624 93 321 DNA Mycobacteria tuberculosis 93ttgacccaca agcgcactaa acgccagcca gccatcgccg cagggctcaa cgccccgcgt 60cggaatcgcg ttgggcggca acatggttgg ccggccgacg ttccgtccgc cgagcagcgc 120cgcgcccaac ggcagcgcga cctcgaggct atccgccgag cgtacgccga gatggtggcg 180acatcacacg aaatcgacga cgacacagcc gaactggcgc tgttgtcgat gcatctcgac 240gatgagcagc gccggcttga ggcggggatg aagctcggct ggcatccgta tcacttcccc 300gacgaacccg acagcaaaca g 321 94 243 DNA Mycobacteria tuberculosis 94atgagcggcc acgcgttggc tgctcggacg ttgctggccg ccgcggacga gcttgtcggc 60ggcccgccag tcgaggcttc ggccgccgcg ctggccggcg acgccgcggg cgcatggcgg 120accgcggccg tcgagcttgc gcgagcgttg gtccgcgctg tggcggagtc gcacggcgtc 180gcggccgttt tgttcgccgc gacggccgcc gcggcggcgg ccgtcgaccg gggtgatccg 240ccg 243 95 1425 DNA Mycobacteria tuberculosis 95atggctgaca tcccctacgg ccgtgactat cccgacccga tctggtgtga cgaggacggc 60cagccgatgc cgccggtcgg cgccgaattg ctcgacgaca ttagggcatt cttgcggcgg 120ttcgtagtct atccaagcga ccatgaactg atcgcgcaca ccctctggat tgcgcattgc 180tggtttatgg aggcgtggga ctcaacgccc cgaatcgctt ttttgtcacc ggaacccggc 240tctggcaaga gccgcgcact cgaagtcacg gaaccgctag tgccccggcc ggtgcatgcc 300atcaactgca caccggccta cctgttccgt cgggtggccg atccggtcgg gcggccgacc 360gtcctgtacg acgagtgtga caccctgttt ggcccgaaag ctaaagaaca cgaggaaatt 420cgcggcgtga tcaacgccgg ccaccgcaag ggagccgtcg cgggccgctg cgtcatccgc 480ggcaagatcg ttgagaccga ggaactgcca gcgtactgtg cggtcgcctt ggccggcctc 540gacgacctgc ccgacaccat catgtctcgg tcgatcgtgg tgaggatgcg caggagggca 600ccaaccgaac ccgtggagcc gtggcgcccc cgcgtcaacg gccccgaggc cgagaagctg 660cacgaccggt tggcgaactg ggcggccgcc attaacccgc tggaaagcgg ttggccggcg 720atgccggacg gggtgaccga ccggcgcgcc gacgtctggg agtccctggt tgcggttgct 780gacaccgcgg gcgggcactg gcccaaaacc gcccgtgcaa ccgcagaaac ggatgcaacc 840gcaaatcgag gagccaagcc cagcataggc gtgctgctgc tgcgggatat ccgtcgagtc 900ttcagcgacc gggaccggat gcgcaccagc gacatcctga ccggactgaa ccggatggag 960gagggaccgt ggggctccat ccgccgcggc gacccgctcg acgcgcgcgg cctcgcgacc 1020cggctcggca gatacggcat cgggccgaag ttccagcaca gtggtggcga accaccctac 1080aaagggtatt cgcggaccca gttcgaggat gcgtggtccc ggtatctctc tgccgacgac 1140gaaacccccg aggaacgaga tttatcggtt tccgcggttt ccgcggtttc accgccggtt 1200ggcgatcccg gtgatgcaac cggcgcaacc gatgcaaccg atctcccgga ggcgggcgac 1260ttgccgtacg agccgccggc gcccaacggg caccccaacg gcgacgcgcc gctgtgctcc 1320gggccgggat gccccaacaa gctcctcagt actgaggcca aggccgccgg caaatgccgg 1380ccctgccgag gtcgagcggc ggctagcgct cgggacggcg cccga 1425 96 390 DNA Mycobacteria tuberculosis 96atgaccgccg tcggcgggtc gccgccgacg cgacgatgcc cggccacaga ggaccgggca 60cccgcgacag tcgccacacc gtctagcacc gatcctaccg cgtcccgcgc cgtgtcgtgg 120tggtcggtgc acgagtatgt cgcaccgacc ctggccgccg ccgtggaatg gccgatggcc 180ggcaccccgg cgtggtgcga cctcgacgac accgacccgg tcaaatgggc cgcgatctgc 240gacgctgctc ggcattgggc actccgggtg gagacgtgcc aggccgcgtc ggccgaggca 300tcacgtgacg tatccgccgc cgccgactgg ccggcggtct ctcgggagat ccagcgtcgg 360cgtgacgcct acattcggcg ggtggtggtc 390 97 258 DNA Mycobacteria tuberculosis 97atgtgcgcgt tcccgtcgcc gagtctcggg tggacggtct ctcacgagac cgaaaggccc 60ggcatggcag acgctccccc gttgtcacgg cggtacatca cgatcagtga ggccgccgaa 120tatctagcgg tcaccgaccg cacggtccgc cagatgatcg ccgacggccg cctacgcgga 180taccgctccg gcacccgcct cgtccgtctg cgccgcgatg aggtcgacgg cgccatgcac 240ccgttcggtg gtgccgca 258 98 360 DNA Mycobacteria tuberculosis 98atggccgatg cggttaagta cgtagttatg tgcaactgcg acgacgaacc gggagcgctc 60atcatcgcct ggatcgacga cgaacgaccc gccggcgggc acatacagat gcggtcgaac 120acccgcttca ccgaaacaca gtggggccgc catatcgagt ggaaactcga atgccgggca 180tgccgaaagt atgcgccgat atccgagatg accgccgcgg cgatcctcga cggtttcggg 240gcgaagcttc acgagctgag aacgtcgacc atccccgacg ctgacgatcc atcaatagca 300gaggcgcgac acgtaattcc gttcagcgca ttatgcttgc gcttgagcca gctaggcggg 360 99 1125 DNA Mycobacteria tuberculosis 99gtgacgcaaa ccggcaagcg tcagagacgc aaattcggtc gcatccgaca gttcaactcc 60ggccgctggc aagccagcta caccggcccc gacggccgcg tgtacatcgc ccccaaaacc 120ttcaacgcca agatcgacgc cgaagcatgg ctcaccgacc gccgccgcga aatcgaccga 180caactatggt ccccggcatc gggtcaggaa gaccgccccg gagccccatt cggtgagtac 240gccgaaggat ggctgaagca gcgtggaatc aaggaccgca cccgcgccca ctatcgcaaa 300ctgctggaca accacatcct ggccaccttc gctgacaccg acctacgcga catcaccccg 360gccgccgtgc gccgctggta cgccaccacc gccgtgggca caccgaccat gcgggcacac 420tcctacagct tgctgcgcgc aatcatgcag accgccttgg ccgacgacct gatcgactcc 480aacccctgcc gcatctcagg cgcgtccacc gcccgccgcg tccacaagat caggcccgcc 540accctcgacg agctggaaac catcaccaaa gccatgcccg acccctacca ggcgttcgtg 600ctgatggcgg catggctggc catgcgctac ggcgagctga ccgaattacg ccgcaaagac 660atcgacctgc acggcgaggt tgcgcgggtg cggcgggctg tcgttcgggt gggcgaaggc 720ttcaaggtga cgacaccgaa aagcgatgcg ggagtgcgcg acataagtat cccgccacat 780ctgatacccg ccatcgaaga ccaccttcac aaacacgtca accccggccg ggagtccctg 840ctgttcccat cggtcaacga ccccaaccgt cacctagcac cctcggcgct gtaccgcatg 900ttctacaagg cccgaaaagc cgccggccga ccagacttac gggtgcacga ccttcgacac 960tccggcgccg tgttggctgc atccaccggc gccacactgg ccgaactgat gcagcggcta 1020ggacacagca cagccggcgc cgcactccgc taccagcacg ccgccaaggg ccgggaccgc 1080gaaatcgccg cactgttaag caaactggcc gagaaccagg agatg 1125 100 225 DNA Mycobacteria tuberculosis 100gtgatagcgg gcgtcgacca ggcgcttgca gcaacaggcc aggctagcca gcgggcggca 60ggcgcatctg gtggggtcac cgtcggtgtc ggcgtgggca cggaacagag gaacctttcg 120gtggttgcac cgagtcagtt cacatttagt tcacgcagcc cagattttgt ggatgaaacc 180gcaggtcaat cgtggtgcgc gatactggga ttgaaccagt ttcac 225 101 186 DNA Mycobacteria tuberculosis 101atgatcgagc agggccgcga ctgccgggac gtggtcaccc agctcgccgc ggtatcgcgc 60gcactcgacc gcgccggatt caagatcgtt gcggcagggt tgaaggaatg cgtgtccggg 120gccacggcca gcggcgcggc accgctgagt gcagctgagc tagaaaagct gttcctggcg 180ctcgct 186 102 357 DNA Mycobacteria tuberculosis 102atgtcggacc agccacgtca tcaccaggtc ctcgacgacc tgctgcccca acaccgcgct 60ctacgtcacc agattcccca ggtgtaccag cgatttgtag ccctgggcga cgccgcgctt 120accgacggcg ctctcagccg caaggtcaag gagcttgtgg cgctggcgat cgcggttgtg 180caggggtgcg atggctgcgt cgcatcacac gcccaagccg cggtacgggc cggcgctaca 240gcgcaagaag ccgctgaggc catcggggtc accatcttga tgcacggtgg accggccacc 300atccacggtg ctcgtgccta cgcggcattt tgcgaattcg ctgacacaac gccgtcc 357 103 1854 DNA Mycobacteria tuberculosis 103atgtcctatc tcgtcgtggt gccggagttg gtcgcagcgg cggcaacaga tttggcgaac 60atcggttcgt cgattagtgc agccaacgcg gccgcggcgg caccgaccac ggcactggtc 120gcagccggcg gcgacgaggt atcggcggcc atagccgcgt tgttcggagc gcatgctcgg 180gcatatcaag cgttgagtgc ccaggcggcg atgtttcatg aacagtttgt ccgggccctc 240gccgccggcg gtaactccta cgccgtcgct gaggcggcaa ccgcgcaatc ggttcagcaa 300gatctgctca acctgatcaa tgcgcccacc caggcgctgt tggggcgtcc gctgatcggc 360aacggcgcca acgggctgcc gggtacgggc cagaacggcg gcgacggcgg gattctgtac 420ggcaacggcg gcaacggtgg gtccggcggg gtcaaccagg ccggtggcaa tggcgggaat 480gctgggctgt ggggcaatgg cggatccggc ggagccggcg ggaacgccac cactgccggc 540cgcaacggct tcaacggggg cgccggggga agcggcggtt tgctgtgggg caatggcggt 600gccggcgggg ccggtgggaa cggcggtccg gctccgctcg tgggcggggt gggcaccacc 660ggtggcgccg gcgggaacgg cggcggcgcc gggttgttct acggtttcgg cggcgccggt 720gggaacggcg ggatgggcgg ggtggcaccg agcaccggcc cctcgatggg catcctcccg 780gccggcggtg tcggcgggcc tggtggctcc ggcggggcga gcgcgcttgc cttcggctcc 840ggcggcgtcg gcggtgccgg tggcttgggc gggccgaccg atggcaccgt ccagggggtg 900ggcggcttcg gcggtcaggg cggcaacggc gggcagagcg gcttgttgtt tggcaacgcg 960ggagccggcg gggcaggcgc tgccggcgga gccggcaccg gcgacaccga gagcttcggc 1020ggccacggcg gggccggcgg tgatggcggc gctgttggct tgatcggtaa cggcggggcc 1080ggcggcaccg gatctcccgg cgctgtggtg ggtggtaacg gcggcgtcgg tggtctgggt 1140ggcgccggca gtcccggggg tctgttgtac ggcaccgggg gggccggcgg caatggcgga 1200ccgggtggtg acggtggtac tggcgcgacg gtgggctttg ccggctccgg cggtttcggc 1260ggtgcggggg gcatcgccca gctgtttggc acgggtggca tgggtggtag cggcggtggt 1320ataggcgctg gcaccacgac cgtggtgccg cccgacgtcg ccccggtggg tggcacaggc 1380ggcaatggcg gtcgcgccgg gctgctgttg ggtgtgggtg gcatgggcgg taatggcggt 1440gccaccagcg tcggcgggac gctctacgcc gccggtggaa acggcggcga cggcgggttg 1500gtgtggggca acggtggcac cggcgggagc ggtggcgccg gcggggcggg cagcgtcggc 1560aacggcggtg cgggtggcaa cgcggcactg ctgttcggca acggcggggc gggcggggcc 1620ggcggcgccg gcggcatcgg tgccggcgga gccggcggct tcggcgcggt tctgtttggc 1680aacggcgggg ctggcgggag cggtgccccc ggtggcatcg gcgccggtgg caatggcgga 1740aacgcgctgc tggtcggcaa cggcggcaac ggtggggcag gtaccggtgg ggctgctggc 1800ggtgccggtg gctcgggcgg gttgctattc ggccaaaatg ggatgcccgg gccg 1854 104 1242 DNA Mycobacteria tuberculosis 104gtgcatgagg tggctgctcg tgagcaacgt tcggacgggc cgatgaggct ggatgcgcag 60ggccgactgc agcgttacga ggaggcgttc gctgactacg atgcaccgtt tgcgttcgta 120gatctcgacg cgatgtgggg caatgccgat caactgcttg cgcgcgccgg cgacaagccg 180atccgggtgg cgtcgaagtc gctgcgttgc cgaccactgc aacgcgaaat ccttgatgcc 240agtgagcgat tcgacgggct attgacgttc acgcttaccg agacgctgtg gcttgccggc 300caaggtttct cgaacctgtt gttggcctac ccgccgaccg accgggcggc attgcgtgcg 360cttggcgagc tgacggccaa ggacccggac ggggcgccga tcgtgatggt ggacagcgtg 420gagcaccttg acctgatcga gcgcacgacc gacaagccgg tacggctgtg tctggatttc 480gatgccggct attggcgcgc cggcgggcgg ataaaaattg gttccaagcg ctcgccgctg 540cacaccccgg agcaggctcg cgcactcgcg gtggagatcg cgcggcggcc ggcgctaacg 600ttggcggcgt tgatgtgcta cgaggcccac attgcgggcc tcggtgacaa cgtcgccggc 660aagcgggtcc acaacgcgat catccgtcgg atgcagcgca tgtcgttcga agagctgcgc 720gagcgtcgtg cccgggccgt cgagctggtg cgcgaggtcg ccgacatcaa gatcgtcaac 780gccggtggca ccggcgactt gcagctggtt gcgcaggagc cgttgattac cgaagcgacc 840gccggctcgg gtttttacgc gccgacactg ttcgactcgt attcgacgtt cacgctgcag 900cccgcggcga tgttcgcgct gccggtatgc cgtcgtcccg gtgcaaagac cgtgaccgcg 960ctcgggggtg gctatttagc cagcggggtc ggggcgaagg accgcatgcc gactccctac 1020ctgccggtcg ggctgaagct caatgcgctg gagggaacgg gcgaagttca gacaccgcta 1080tccggtgatg cagcccgacg gctgaagctt ggcgacaagg tctacttccg ccacaccaag 1140gccggtgagc tgtgtgagcg gttcgaccat ctgcatctgg tccgtggcgc tgaagtagtc 1200gacaccgtcc ccacctaccg gggtgaaggg cgcaccttcc tc 1242 105 1284 DNA Mycobacteria tuberculosis 105atggacgagg cccacccggc tcacccggca gatgcggggc ggcccggtgg cccaattcaa 60ggcgcgcgaa gaggagctgc catgacaccg atcaccgccc tgccgaccga gttggcggcc 120atgcgcgagg tagtcgagac gctcgcaccc attgagcgtg ccgcgggcga gccgggtgag 180cacaaggcgg ccgagtggat cgtcgagcgc ctgcgcacgg cgggcgcgca ggacgcgcgc 240atcgaggagg agcagtacct cgacggctac ccgaggctgc acctcaagct gtcggtgatc 300ggggtggcgg ccggcgtcgc gggcctgctc agcagacgtt tgcgcatccc cgccgcgctg 360gccggggtgg gtgcggggct ggcaatcgcc gacgattgcg ccaacgggcc gcgcattgtg 420cgcaaacgaa cggagacgcc ccggacgaca tggaacgcgg tagccgaggc cggtgatcct 480gctggtcagc taacagttgt tgtgtgcgct caccacgacg ccgcgcacag cggcaagttt 540ttcgaggctc atattgagga ggtaatggtc gagctgtttc ccgggattgt ggagcgcatc 600gacacgcagc tgccgaactg gtgggggccg atcctcgcgc ccgcactcgc cggtgtcggc 660gccctgcgcg gcagccggcc gatgatgatc gccggaacgg tgggtagcgc cctggccgcc 720gctttgttcg ccgacatcgc gcgcagtccg gtcgtccccg gtgccaacga caatctctcc 780gcggttgcgc tgctggtcgc gctggccgag cggctgcgcg agcggccggt gaagggcgtg 840cgagtgttgc tcgtgtccct gggggccgag gaaacgttgc agggcgggat ctacgggttc 900ctggcgcgac acaaacccga gctggaccgc gaccgcacat acttcctgaa cttcgacacc 960atcggctcac ccgagctcat catgctcgag ggcgagggcc cgacggtcat ggaggactac 1020ttctatcggc cattccggga tctggtcatc cgggcggccg agcgcgccga cgcgccgctg 1080cggcgcggca tccggtcgcg caacagtacc gacgcggtgt tgatgagccg cgccggctac 1140ccgaccgcgt gctttgtgtc gatcaaccgg cacaagtcgg tggccaatta ccacctgatg 1200tccgatacac ctgagaatct ctgctatgag acggtgtccc acgccgtcac cgtcgccgaa 1260tccgtgatca gggagctggc ccga 1284 106 1284 DNA Mycobacteria tuberculosis 106atgagcccga tatggagtaa ttggcctggt gagcaagtct gcgcgccgtc ggcgatcgta 60cggccgacct cggaggctga gctggccgac gtgatcgcgc aggcggcgaa aagaggcgag 120cgggtacgcg cggttggcag cgggcattcg tttaccgaca tcgcctgcac ggacggggtc 180atgatcgaca tgaccggcct gcagcgggtc ctcgacgtgg accagccgac tggcctggtg 240acggtcgagg ggggcgcaaa gctacgtgcg ctgggacccc aattggcgca acgacggctc 300ggcctggaga accagggtga cgtggatccc caatccatca ccggcgcgac cgcgaccgcg 360acgcacggaa ccggggtgcg tttccagaat ctgtcggcgc ggatcgtttc gctgcggctg 420gtcaccgcgg gcggggaagt gctcagtctg tccgaaggtg acgattacct ggcggcacgg 480gtttccctcg gcgcgctagg agtgatctca caggtcaccc tgcagacggt tccgctattc 540acgttgcatc gccatgatca gcgacgctcg ctggcgcaga cgctggagcg cctcgacgag 600ttcgtggacg gtaatgacca tttcgagttt ttcgtattcc cttacgcaga taaggcgttg 660acgcgcacca tgcatcgcag tgacgagcag cccaaaccca cgcccgggtg gcagcgcatg 720gtcggcgaga acttcgagaa cgggggattg agcctgatct gccagaccgg ccgtcgtttt 780cctagtgtgg cgccgcgact gaaccgcctg atgacgaaca tgatgtcgtc ctccaccgtg 840caagaccgcg cctacaaggt ctttgcgacc caacgcaagg tcaggttcac cgagatggag 900tacgcgatcc cgcgtgaaaa cgggcgcgag gcgctccagc gtgtcatcga ccttgtgcgc 960cgtcgcagct tgccgatcat gtttccgatt gaggtgcgat tctccgcccc cgacgattcc 1020ttcctgtcga ccgcatatgg gcgcgacact tgctacatcg cggttcatca atacgccggt 1080atggagttcg aaagctactt ccgcgccgtc gaggagatca tggacgacta cgccggtcgg 1140ccacactggg gtaaacgtca ctatcagacc gccgccacgc ttcgtgagcg ctatccgcag 1200tgggatcggt tcgccgcggt tcgcgatcgc ctcgatccgg accgggtgtt tctcaacgac 1260tacacccggc gcgttctcgg tccc 1284 107 309 DNA Mycobacteria tuberculosis 107ttgggttcaa caggaggtag ccaacccatg acggcgaatc gagggcccgc tgcaatctcg 60agcggctcga actctggccg cgttctcgac accgcccggg gtatcctcat cgctcttcgg 120cggtgccccg cagagaccgc gttcgacgag ttgcacaacg ccgctcaacg gcacagattg 180ccggtcttcg aaatagcttg ggcactagtg catttggcgg tcgagggaag cacgccatgc 240cggagcttcg tcgatgccca gtcggcggct cggcgggagt ggggtcagct ttttgcgcat 300gcggcggcg 309 108 744 DNA Mycobacteria tuberculosis 108gtgccgccta cggaaggaaa gtcgacaacg aatcgcgacg aaggcatcca ggtgctccgt 60cgcgccgtcg ccgcgctgga cgaaatagct gccgaaccgg gacacctgcg cctagtcgat 120ctctgcgagc ggctggggct ggccaaatcg acgactcgac gcttgctggt cggcctggtc 180gaggtggggc tggttagtgt cgattcgcac ggccgcttcg cactgggcga gcgtttgctg 240ggattcggaa gtgtcaccgg agcccacata gccgcggcgt tccggccgac cgtcgagcga 300gttgcccgcg cgaccgacgg cgaaacggtc gacctgtcgg tactgcgcgg ccagcgaatg 360tggtttgtcg accagatcga atcgtcttac cggctgcgtg cggtctcagc cgtcgggctc 420cgcttcccgt tgaacggaac cgcgaatgga aaagcggcgc tggctgctct cgacgacgcc 480gacgccgagg ccgcgctctg ccgtctggat cccatggtgg ccgaaggtct acggcgcgag 540atcgtcgaga tccggcgcac cggtatcgct ttcgaccgca acgagcacac cccagggata 600tccgcggctg cgatcgcacg acgcgccctg ggcgacaacg tgatcgcgat ctcggtgccg 660gcgcccaccg cacgatttct ggaaaaagag cagcgcataa tcgccgcgtt gcgcgccgcc 720gcggactcgc cggactggac tcgc 744 109 1218 DNA Mycobacteria tuberculosis 109atggcatccg tcgcccaacc cgttaggcgc cgcccaaagg accggaagaa gcagattttg 60gatcaggccg ttggactgtt catcgaacgt ggcttccatt cggtcaaatt ggaggacatt 120gccgaggcgg ccggggtgac cgcgcgcgcg ttgtatcgcc actacgacaa caagcaggcg 180ttgctcgccg aagcgatccg aaccggccag gatcagtacc agagcgcgcg tcgtctcacc 240gagggcgaga cggagccgac gccgcggccg ttgaacgccg atctggaaga cctgatcgcc 300gcggcggtcg cctctcgggc gttgacggtg ctgtggcagc gcgaggcccg ctacctcaac 360gaggacgacc gcacggcggt ccggcgccgc atcaacgcga tcgtcgccgg catgcgtgac 420agcgtgctgc tggaggtgcc cgatctgagt ccacagcatt cggagttgcg ggcgtgggcg 480gtgtccagca ctttgaccag cctgggccgg cacagcctaa gcctgccggg cgaggaactg 540aaaaagcttc tctaccaggc gtgtatggcc gcggcaagga cgcctcccgt ctgcgaattg 600ccgccactgc cggccggtga tgccgcacgc gacgaggccg acgtgctgtt ctcccgctac 660gagaccctgc tggccgcggg cgcgcggctg ttccgtgcgc agggctatcc ggccgtcaac 720accagcgaaa tcggcaaggg agccggcatc gcgggcccgg ggctgtaccg ttcgttttct 780tccaaacagg ccatcctgga cgcgctcatc cgccgcctcg acgagtggcg ctgcctggag 840tgcatccgag cgctacgagc gaatcagcaa gcggcacaac ggttgcgcgg ccttgtccaa 900gggcacgttc ggatcagctt ggacgctccg gatctggtgg cagtgtcggt caccgaactg 960tcgcacgcct ctgtcgaagt acgcgacggc tacctgcgaa atcagggcga ccgcgaggcc 1020gtgtggatcg acctcatcgg caagctggta cccgcgacca gtgtcgccca ggggcgactg 1080ctggtcgcgg cggcgattag cttcatcgaa gacgtcgctc gcacctggca tctcacgcgc 1140tacgccggag tcgccgacga gatcagtggc ctggcgctgg cgatcctgac cagcggggca 1200ggtaacctct tgcgcgca 1218 110 795 DNA Mycobacteria tuberculosis 110atggtaatcg tggccgacaa ggcggccggt cgggtcgctg atccggtctt gcggccggtg 60ggcgcgctgg gcgatttctt cgcgatgacg ctcgacacgt ccgtgtgcat gttcaagccg 120cctttcgcgt ggcgtgaata cctacttcag tgctggttcg tggcgcgggt gtcgacgctg 180cctggggtgt tgatgacgat cccatgggcg gtgatctcgg ggtttctctt caacgtcttg 240ctgaccgaca tcggtgccgc ggacttttcc ggcaccggct gtgcgatctt caccgtgaac 300caaagcgccc cgatcgtcac ggtcttggtg gtcgcgggcg cgggcgccac cgccatgtgc 360gccgatctgg gtgcgcgcac catccgtgag gaactcgacg cactgcgggt gatgggcatc 420aacccgatcc aagcgctagc ggctccgcgc gtgctggcgg ccaccacggt gtcgttggcg 480ctgaattcgg tggtgaccgc gacggggctg atcggcgcgt tcttttgctc ggtgtttctc 540atgcacgtct cggcgggggc atgggtgacc gggcttacca cgctgaccca caccgtggac 600gtcgtcattt cgatgatcaa ggcgacgttg ttcgggctga tggccggact gatcgcctgc 660tataagggca tgtcggtcgg tggcggcccg gccggagtcg gccgggcggt gaacgaaacc 720gtggtgtttg ccttcatcgt cttgttcgtg atcaacatcg tcgtcaccgc ggtcggcatc 780ccattcatgg tgtcc 795 111 813 DNA Mycobacteria tuberculosis 111atgacggcag cgaaagccct tgtaagcgaa tggaatcgga tgggatcgca gatgcggttc 60ttcgtcggca cgctggccgg gattcccgac gccctcatgc actaccgcgg cgagctgctg 120cgggtgatcg cgcaaatggg gttggggacc ggggttcttg cggtgatcgg tggaacggtc 180gcgatcgtcg ggttcttggc gatgaccacc ggcgcgatcg tggccgtgca gggctacaac 240cagttcgctt cggtgggtgt ggaggcgctg accggcttcg cgtcggcctt cttcaacacc 300cgcgagattc agcccggaac cgtgatggtc gcgctagcgg ccaccgtcgg tgccggtacc 360accgctgcgc tgggggcgat gcggataaac gaggagatcg acgcgctcga ggtgatcggc 420atccgcagca tcagctacct ggcgagcacc cgggtgctgg ccggagtggt cgtggccgtc 480cctctgttct gtgtgggact gatgacggcc tacctggccg cgcgcgtcgg caccaccgcc 540atctatggcc aggggtcggg cgtgtacgac cactacttca acacgttcct gcgcccgacc 600gacgtgctct ggtcgtcggt tgaagtcgtc gtggtcgctc tgatgatcat gctggtgtgc 660acctattacg gctacgccgc acatggcggg ccggccgggg ttggcgaggc ggtcggccgg 720gccgtgcgtg cctcgatggt cgtcgcgtcg atcgcaatcc ttgtcatgac gctggccatc 780tacggccagt cgcccaactt tcacctggcg acc 813 112 1275 DNA M. tuberculosis 112atgagacgcg ggccgggtcg acaccgtttg cacgacgcgt ggtggacgct gatcctgttc 60gcggtgatcg gggtggctgt cctggtgacg gcggtgtcct tcacgggcag cttgcggtcg 120actgtgccgg tgacgctggc ggccgaccgc tccgggctgg tgatggactc cggcgccaag 180gtcatgatgc gcggtgtgca ggtcggccgg gtcgcccaga tcggtcggat cgagtgggcc 240cagaacgggg cgagcctcag actggagatc gaccccgacc agatccggta catcccggcc 300aatgtcgagg cacagatcag cgccaccacc gcattcggtg ccaagttcgt cgacctggtg 360atgccgcaaa acccaagtcg tgcacggctg tccgctgggg cggtactgca ttcgaagaac 420gtcagcacgg aaatcaacac cgtcttcgaa aacgtcgtcg acctgctcaa catgatcgac 480ccgctgaaac tgaacgccgt gctgaccgcg gtcgccgacg ccgttcgcgg gcaaggtgaa 540cggataggcc aggccaccac cgacctcaac gaggtgctgg aggcactcaa cgcacgcggc 600gacaccatcg gcggcaactg gcgatcgctc aagaacttca ccgacaccta tgacgcggcc 660gcccaagaca tcctgacgat cctgaacgcc gccagcacca ccagtgcgac cgtcgtgaat 720cattcgacgc agctggatgc cttgctactc aacgccatcg gactatccaa cgctggcacc 780aacctgcttg gcagcagccg agacaatctc gtcggcgcgg ccgacatcct ggcgccgacc 840acgagcctgc tgttcaagta caaccccgaa tacacctgct tcctgcaggg cgccaagtgg 900tatctcgaca acggcggcta tgcggcctgg ggcggggccg acgggcgcac gctacaactc 960gatgtggcgc tactgttcgg caacgacccc tatgtctatc cggacaacct gccggttgtc 1020gcggccaagg ggggtcccgg cggaaggccg ggatgcgggc cattgccgga tgccacccac 1080aacttcccgg tgcgccagct ggtcaccaac accggatggg gaaccgggct ggacatccgg 1140cccaaccccg gcatcgggca tccctgctgg gccaactact tcccggtgac ccgcgcggtg 1200cccgagccgc cgtcgatccg tcagtgcatc cccgggccgg cgatcgggcc caaccccgcg 1260gcgggggagc agcca 1275 113 1026 DNA Mycobacteria tuberculosis 113atgagggaga acctgggggg cgtcgtggtg cgcctcggcg tcttcctggc ggtatgcctg 60ctgacggcgt tcctgctgat tgccgtcttc ggggaggtgc gcttcggcga cggcaagacc 120tactacgccg agttcgccaa cgtgtccaat ctgcgaacgg gcaagctggt gcgcatcgcc 180ggcgtcgagg tcggcaaggt caccaggatc tccatcaacc ccgacgcgac ggtgcgggtg 240cagttcaccg ccgacaactc ggtcaccctc acgcggggca cccgggcggt gatccgctac 300gacaacctgt tcggtgaccg ctatttggcg ctggaggaag gggccggcgg actcgccgtt 360cttcgtcccg gtcacacgat tccgttggcg cgcacccaac cggcgttgga tctggatgcc 420ctgatcggtg gattcaagcc gctgtttcgt gcgctgaacc ccgagcaggt caacgcgctg 480agcgaacagt tgctgcacgc gtttgccgga caggggccca cgatcgggtc attgctggcc 540cagtccgcgg ccgtgaccaa caccctggcc gaccgtgatc ggctgatcgg gcaggtgatc 600accaacctca acgtggtgct gggctcgctg ggcgctcaca ccgatcggtt ggaccaggcg 660gtgacgtcgc tatcagcgtt gattcaccgg ctcgcgcaac gcaagaccga catctccaac 720gccgtggcct acaccaacgc cgccgccggc tcggtcgccg atctgctgtc gcaggctcgc 780gcgccgttgg cgaaggtggt tcgcgagacc gatcgggtgg ccggcatcgc ggccgccgac 840cacgactacc tcgacaatct gctcaacacg ctgccggaca aataccaggc gctggtccgc 900cagggtatgt acggcgactt cttcgccttc tacctgtgcg acgtcgtgct caaggtcaac 960ggcaagggcg gccagccggt gtacatcaag ctggccggtc aggacagcgg gcggtgcgcg 1020ccgaaa 1026 114 1230 DNA Mycobacteria tuberculosis 114atgaaatcct tcgccgaacg caaccgtctg gccatcggca cagtcggcat cgtcgtcgtc 60gccgccgttg cgctggccgc gctgcaatac cagcggctgc cgtttttcaa ccagggcacc 120agggtctccg cctatttcgc cgacgccggc gggctgcgca ccggcaacac cgtcgaggtc 180tccggctatc cggtgggaaa agtgtccagc atctcgctcg acggaccggg cgtgctggtg 240gagttcaagg tcgacaccga cgtccgactc ggaaaccgca ccgaagtggc aatcaaaacc 300aagggcttgt tgggcagcaa gttcctcgac gtcacccccc gcggggacgg ccgactcgat 360tctccgatcc cgatcgagcg gaccacgtcg ccctaccaac tgcccgacgc ccttggcgat 420ttggccgcca cgatcagcgg gttgcacacc gagcggctgt ccgaatcgct ggccaccctg 480gcgcagacct ttgccgatac gccggcgcac ttccgcaacg ccatacacgg ggtggcccgg 540ctcgcccaaa ccctcgatga gcgcgacaac caactgcgca gcctgctggc caacgcggcc 600aaagccaccg gggtgctggc caaccgcacc gaccagatcg tcggcctggt gcgcgacacg 660aatgtggtct tggcgcagct gcgcacccaa agcgccgccc tggaccggat ctgggcgaac 720atctcggcgg tggccgaaca actgcggggc ttcatcgctg agaaccgcca gcagctgcgc 780ccggcgctgg acaagctcaa cggggtgctg gctatcgtcg aaaaccgcaa agagcgtgtg 840cggcaggcca tcccgctgat caacacctat gtcatgtcgc tgggtgagtc gctgtcgtcg 900ggcccgttct tcaaggcata cgtggtgaac ctgctgccgg gtcagttcgt gcaaccgttc 960atcagcgccg cgttctccga cctggggctc gacccggcca cgttgctgcc gtcgcagctg 1020accgacccac cgaccggtca acccggaacc ccgccgttgc cgatgcccta cccgcgcacg 1080ggccagggcg gtgagccgcg gctgacgctg cccgacgcga tcaccggcaa tcccggcgat 1140ccgcgctatc cgtaccggcc ggagccgccc gcgccgccgc ccggcgggcc gccgcccggc 1200ccgcccgcgc agcagccggg agaccaaccg 1230 115 1269 DNA Mycobacteria tuberculosis 115gtgacaacga aactcagacg tgcccgctcg gtgttggcga ccgccctggt gctggtcgcg 60ggcgtgatcc tggccatgcg caccgccgac gccgccgccc gcacgaccgt ggtcgcctac 120ttcgacaaca gcaacggtgt gttcgccggt gacgacgtgc tcattcgggg cgtgccggtg 180ggcaagatcg tcaagatcga accgcaaccg ctgcgcgcca agatttcgtt ctggttcgac 240cgcaaatacc gagtccccgc cgatgccgcc gcggcgatcc tgtcgccgca actggtgacc 300ggccgggcca tccagctgac accgccgtat gccggcgggc cgaccatggc cgacggcaca 360gtaatcccgc aagagcgcac cgtggtgccg gtggagtggg acgacttgcg ggcgcaactt 420cagcggctga ccgcattgct gcagcccacc cggccgggcg gcgtcagcac gctgggtgcg 480ctcatcaata ctgccgccga caacctgcgc gggcaaggcg ccaccatccg cgacaccatc 540atcaaactgt cacaagcgat ttcggctctc ggtgaccaca gcaaagacat cttctccacc 600gtgacgaacc tgtcgacgct ggtcacggcg ctgcatgaca gcgctgacct gctcgaacgg 660ctcaaccaca acctggccgc ggtgacctcg ctgctggccg atggcccgga caagatcggt 720caggcagccg aggacctcaa cgcggtcgta gccgacgtcg gcagcttcgc cgccgagcac 780cgcgaggcga tcggcaccgc atcagacaag ctcgcgtcaa tcaccaccgc gctggtcgac 840agcctcgacg acatcaagca gacgctgcat atcagcccga cggtgttgca gaacttcaac 900aacatcttcg aaccggccaa cggcgcgctg accggcgcgc tggcgggcaa caacatggcc 960aacccaatcg ccttcctgtg cggcgcgatc caggctgcct cccggctggg cggcgagcaa 1020gcggccaaat tgtgcgtgca atacctggcg ccgatcgtga agaaccgcca gtacaactac 1080ccgccgctgg gggcgaacct gttcgtcggg gcgcaggcca ggcctaacga ggtcacctac 1140agcgaggact ggctgcggcc cgattacgtt gcaccagttg cggacacgcc gccagatccg 1200gccgcggccg tgaccgtcga tcccgcgacc ggcctgcgcg gcatgatgat gccgccgggg 1260ggtggctcg 1269 116 1131 DNA M. tuberculosis 116gtgaggatcg gcctgaccct ggtgatgatc gcggccgtgg tagcgagctg cggctggcgc 60gggctgaatt cgctgccgct gcccggcacg cagggcaacg gcccggggtc cttcgcggtc 120caggcgcagc tgccggatgt caacaacatc cagccgaact cgcgggtgcg ggttgccgac 180gtgacggtcg gccacgtcac gaaaatcgag cgccaaggct ggcacgcgtt ggtgaccatg 240cggctggatg gcgacgtcga tttgcccgcc aacgcaacgg ccaagatcgg caccaccagc 300ctgctgggtt cctaccacat cgagctggcg ccaccgaaag gcgaagcgcg gcaaggcaag 360ctgcgcgacg gttcactcat tgcgctgtca cacggtagcg cctacccaag caccgagcag 420acgctggcag cgctgtcgct ggtgctcaac ggcggcggac tgggccaggt tcaagacatc 480accgaggcgt tgagcaccgc gtttgccggc cgtgagcacg atctgcgcgg gctgattggg 540cagctggaca ccttcaccgc atacctcaac aaccagtccg gtgacatcat cgcggccacc 600gacagcctca accgcctcgt cggcaagttc gccgaccagc aacccgtctt cgatcgggcc 660ctggccacca tccccgacgc gctcgcggtg ctggccgatg agcgggacac gctcgtcgag 720gctgccgagc agctgagcaa gttcagcgcc ctgaccgtcg actcggtcaa caagaccacc 780gcgaacctgg tcaccgaact gcggcaactc ggaccggtgt tggagtcgct ggccaattcc 840ggtccggcgc tgacccgatc gctgtccctg ctggccacgt tcccgttccc gaacgagacg 900ttccaaaatt tccagcgcgg cgaatacgcc aacctgaccg cgatcgtcga cctcacgctc 960agccgcatcg accagggcct gttgaccggc acccgctggg agtgtcatct gacccagctc 1020gagctgcagt ggggtcgcac cattgggcag ttccccagcc cgtgtaccgc gggctatcgg 1080ggtaccccgg gcaatccgct gacgatcgcc taccgctggg atcaggggcc c 1131 117 1311 DNA Mycobacteria tuberculosis 117atgctgcatc taccgcgccg agtgatcgtt cagctggccg tctttaccgt gatcgcggtg 60ggcgtgctgg ccatcacgtt cctgcatttc gtgaggctgc cggcgatgct tttcggcgtc 120ggccgctaca cggtgacgat ggagctggtc gaagccggtg ggctgtatcg caccggcaat 180gtcacctacc gcggctttga ggtgggccgg gtggcagcgg tgcggctcac cgacaccggg 240gtgcaagcgg tgctggccct gaaatcgggc atcgatatcc cgtcggacct caaggccgag 300gtgcacagcc acaccgcgat cggcgaaacc tacgtcgagt tgttgccgcg caacgccgcc 360tcgccgccac tgaagaacgg cgatgtcatt gcgctggccg acacctcggt gccgcccgac 420atcaacgacc tgctcagcgc ggccaacacc gcattggagg caatacctca cgagaacctg 480cagaccgtca tcgacgagtc gtacaccgcg gtggccgggt tagggctcga actttcccgg 540ctgatcaagg gctcggcgga actggcgatc gatgctcgcg cgaatctcga tccgctggtg 600gcgctgatcg accgggcagg accggtgctg gattcgcaga cccacacctc ggatgcgatc 660gcggcctggg cggcacagct ggccgcagtc accggccaat tgcagacaca cgactcggcg 720gtcggcgatc tcatcgaccg gggcggtccg gcgttggggg agacgcgcca actgctcgag 780cggctacaac ccaccgtgcc catcctgctg gccaacctgg tcagcgtcgg ccaggtcgca 840ctcacctatc acaacgacat cgaacagctg ctggtggtgt tccccatggc catcgccgcc 900gaacaggccg gcatcctggc caacctcaac accaagcagg cctaccgggg ccagtatctg 960agcttcaacc tcaacctgaa cctgccgccg ccgtgcacca ccggctttct gccggcccag 1020cagcggcgca ttcccacgtt cgaggactac ccggatcgcc cggccggtga tctgtactgc 1080cgggtgcccc aggattcgcc gtttaacgtg cgcggcgccc gcaacatccc ctgtgaaacc 1140gtgccgggca agcgcgcacc caccgtgaag ttatgcgaga gcgacgcgcc atacctgccg 1200ctgaacgacg gctacaactg gaagggcgac cccaacgcca cggtgccggg tttggggtcc 1260ggccaggaca tcccgcagac atggcaaacg atgctgctgc cgccgggcag c 1311 118 573 DNA Mycobacteria tuberculosis 118atgtcggtag cagtggattc cgacgccgag gatgacgccg tatcggagat cgctgaggca 60gccggcgtgt cgccggcccc agccaaacca tccatgtcgg cgccgcggcg catgctgctg 120ttcggcctgg tcgtcgtcgt cgctttggcg gtgctgttgt gttgctgggg atttcgcgtc 180cagcgggcac gccatgcgca ggaccagcgt ggtcacttcc tgcaagcggc ccggcagtgc 240gcgctgaacc taacgaccat cgactggcgc aacgccgagg cggatgtgcg ccgcattctg 300gacggcgcca caggcgagtt ttacaacgac ttcgcccagc ggtcccagcc cttcgtcgaa 360gtactgaggc acgcaaaggc cagcacggtc ggcacgatca ccgaggccgg gctgcagacg 420cagaccgccg acacggccca ggcgctggtg gcggtgtccg tgcaaacgtc gaatgccggc 480gaagccgacc cggttccacg agcgtggcga atgcgcatca ccgtgcagcg ggtcggcgac 540cgggtcaagg tgtccgacgt cgggttcgtg ccg 573 119 480 DNA Mycobacteria tuberculosis 119gtgagctggt cgcgggtgat cgcctacggg ctgctgcccg ggctggcgtt ggcgctgacg 60tgtggcgcgg gcttgctgaa atggcaggac ggcgccgtcc gcgacgccgc ggttgcccgt 120gcggaatccg tgcgggccgc gaccgacggc accaccgcgc tgctgtctta ccggcccgac 180accgtgcagc atgacctcga gagcgcgcga agcaggctca cgggcacgtt cctcgacgcc 240tacacacagc tgacccacga cgtggtgatc cccggcgcac agcagaagca gatctcggcc 300gtggccaccg tcgcggccgc ggcgtcggtg tcgacttccg ccgaccgcgc cgtcgtcctg 360ctgttcgtaa accagaccat caccgtcggc aaggacgcgc cgaccaccgc cgcttccagc 420gttcgggtga ccctcgacaa catcaacggg cgttggctga tctcgcaatt cgaaccgatc 480 120 375 DNA Mycobacteria tuberculosis 120gtgcagcgcc aatcattgat gccccagcag acccttgccg ccggcgtttt cgtgggtgcg 60ctgctatgcg gtgtcgtgac ggcggcggtg ccaccacacg cacgcgccga cgtggtcgcc 120tatctggtca acgtgacggt acgcccgggc tacaacttcg ccaacgccga cgccgcgttg 180agttacggac atggcctctg cgagaaggtg tctcggggcc gcccttacgc acagatcatc 240gccgacgtca aggctgattt cgacacccgc gaccaatacc aggcctcgta tctgctcagc 300caggctgtca acgaactctg ccccgcgctg atctggcagt tgcgaaactc cgcagtcgac 360aatcggcgct cgggc 375 121 663 DNA Mycobacteria tuberculosis 121atgtcgcgtc gagcatcggc cacgtgtgcc ttgtccgcga ccaccgccgt cgccataatg 60gctgctcccg ccgcacgggc cgacgacaag cggctcaacg acggcgtggt cgccaacgtc 120tacaccgttc aacgtcaggc cggctgcacc aacgacgtca cgatcaaccc gcaactacaa 180ttggccgccc aatggcacac cctcgatctg ctgaacaacc ggcacctcaa cgacgacacc 240ggttctgacg gatccacacc gcaagaccgc gcgcatgccg ccggcttccg cgggaaagtc 300gctgaaaccg tggcgatcaa tcccgccgta gcgatcagcg gcatcgagtt gataaaccag 360tggtactaca accccgcgtt tttcgcgatc atgtccgact gcgccaacac ccagatcggg 420gtgtggtcag aaaacagccc ggatcgcacc gtcgtggtgg ccgtttacgg acagcccgat 480cgaccttccg cgatgccgcc caggggagcg gtaaccggac cgccgtcccc ggtggccgcg 540caagagaacg ttcctatcga ccccagcccc gactacgacg ccagcgacga gatcgaatac 600ggcatcaact ggctgccatg gatcctgcgc ggcgtgtacc cgccgcccgc aatgccgccg 660cag 663 122 405 DNA Mycobacteria tuberculosis 122gtgcggtgga ttgtcgacgg tatgaacgtg atcggaagtc gtccggatgg ttggtggcgc 60gaccgccatc gcgcgatggt gatgctggtg gaaaggctcg aggggtgggc catcaccaag 120gctcggggcg acgacgtgac ggtggtgttc gagcggccgc cgtcgaccgc catcccgtca 180tcggtggtcg aagtggcgca tgcgcccaag gcggccgcca actcggccga cgacgagatc 240gtccggctgg tccgatccgg cgcccagcca caagagattc gtgtggtgac atcggacaaa 300gcgttgaccg accgggtccg agacttgggt gcggcagtct acccggcaga acggttccgt 360gaccttatcg acccgcgcgg gtcgaacgcg gcccgccgca cgcag 405 123 1044 DNA Mycobacteria tuberculosis 123atgtctcaga cacccgctac aacccgcaaa acgtttcccg agatcagctc aagagcgtgg 60gagcaccccg ccgaccggac cgccctttcc gcgctgcgcc ggctcaaagg cttcgaccag 120atcttgaagc tgatgtcggg gatgttgcgg gaacggcagc accggctgct gtacctggcc 180agcgcggcac gggtcgggcc gcggcagttc gccgacctcg acgcgctgct ggacgaatgc 240gtggatgtgc tggacgcgtc ggcgaaaccc gaactctacg tgatgcagtc accaatcgcg 300gatgccttca ccatcggcat gggcaagcca ttcaccgtga tcacctcggg gctgtacgac 360ctggtgacac acgacgagat gcggttcgtg atgggccacg agctcggcca cgcactgtcc 420ggccacgcgg tgtaccgcac gatgatgatg catctgctgc ggttggcccg gtcattcggc 480gtcttgccgg ttggcggctg ggcgctgcgc gcaatcgtgg ctgcgctgct ggaatggcag 540cgcaaatcgg agctgtccgg cgatcgcgct gggttgctgt gcgcgcagga tttggacacc 600gcgctcaggg tggagatgaa gctcgctggc ggctgccggc tggacaagct ggactcggag 660gccttcttgg ctcaggcccg ggaatacgag acatccggcg atatgcgcga cggggtgctc 720aagctgctca acctggagct gcagacccat ccgttctctg tgctgcgggc tgccgccttg 780actcactggg tggacaccgg cggctatgcc aaggtgatag ccggcgagta cccgcgtcgg 840gccgacgacg gcaacgccaa atttgcagac gaccttggcg cggccgcccg gtactaccgg 900gacggcttcg accagtccaa cgacccgctg atcaaaggta tccgcgacgg attcggtggc 960atcgtcgagg gcgtgggacg ggcagcctcg aacgcggccg attcattggg ccgcaagatc 1020accgagtggc ggcagccctc gaag 1044 124 564 DNA Mycobacteria tuberculosis 124atgactacgc gtccggcaac cgaccgccgc aagatgccca ctgggcggga agaggtagcg 60gccgcaatcc tgcaggccgc caccgacctg ttcgccgagc gtgggccagc cgcgacgtcg 120attcgcgaca tcgccgctcg atccaaggtc aaccacgggc tggtgtttcg tcacttcggc 180accaaggacc aactggttgg ggccgtgctc gatcacctgg gcacgaagct gaccagactg 240ttgcactccg aggcgcccgc tgacatcatc gaacgggctc tcgaccgaca tgggcgggtc 300ttagcccggg cactgctgga cggatatccc gtgggccagc tgcaacagcg atttcccaat 360gttgcggagc tgctcgacgc ggtacggcct cgctacgaca gcgacttggg cgcgcggctg 420gcggtcgcgc acgcccttgc gctgcaattc ggttggcggc tctttgcgcc catgctgcgc 480tcggcgacgg gtatcgacga gctgaccggt gacgaactac ggctgtccgt gaacgatgcg 540gtagcccgga tcctggaacc gcac 564 125 702 DNA Mycobacteria tuberculosis 125gtgacgatat tgatcctgac cgacaacgtc cacgcccatg ctctggcggt cgatctgcag 60gccaggcatg gcgatatgga cgtctatcag tcccccatcg gccagctgcc gggtgtcccg 120cgatgtgatg tcgcagagcg cgtcgcggaa atcgtggagc ggtatgacct cgtcctttcc 180ttccactgta aacagaggtt tcccgccgct ttgatcgatg gggtcaggtg tgtgaatgtt 240catccgggtt tcaaccccta caaccgcggc tggtttcccc aggtcttctc gatcatcgac 300gggcaaaaag tcggcgtgac gatccacgag atcgacgatc agttggacca tggtccgatc 360atcgcccagc gggaatgcgc gatcgagtcg tgggattcct cgggaagtgt ctacgcccgg 420ctgatggaca tcgagcgtga gttggtgctg gaacatttcg acgccatccg ggacggcagc 480tacacggcta aatcgccggc caccgagggc aacctcaacc tgaaaaagga tttcgaacaa 540ctccggcggc tagacctgaa cgagcgcgga acgtttgggc atttcctgaa tcgcctgcgc 600gcgttgaccc atgatgattt ccgcaacgct tggttcgtcg atgcgtcagg ccgcaaggtg 660tttgtccgcg tcgtgctcga accggagaag cccgcggaag cc 702 126 1599 DNA Mycobacteria tuberculosis 126atgttagcct tcccttattt gatgactatg atcactccac ctaccttcga cgttgcgttc 60atcggcagcg gggccgcgtg ctctatgact ctgctggaaa tggccgatgc cctgctgagc 120agcccctcgg catcgcccaa gttgcgcatc gcggtggtgg agcgagacga gcagttctgg 180tgcggaatcc cctatggcca acgctccagc atcggatcgc tggccattca gaagctcgac 240gatttcgccg acgagccgga aaaggccgcc taccggatct ggctggagca gaacaagcag 300cgctggctgg cgttcttcca ggcagagggc ggtgcggccg cggcccgctg gatctgcgac 360aaccgcgacg cattggacgg caaccagtgg ggggagctct acctgccgcg gtttctcttc 420ggtgtatttc tgtcggagca gatgattgcc gccatcgccg cgctcggcga gcgtgacctg 480gccgaaatcg tcaccatccg cgctgaggcc atgagcgccc actccgcaga cggccactac 540cgaatcggcc tccgcccgtc tggaaacggt ccaacggcaa ttgctgcagg caaagtggtt 600gtggccattg gcagcccccc gaccaaagcc atccttgcga gcgattccga acccgcattc 660acctatatca acgatttcta ctcccccggc ggggagagca acgttgcgcg actgcgcgat 720tcgctcgacc gcgtcgagtc gtgggagaag cgcaacgtac tggtcgtggg ttccaacgcc 780acctcgctgg aagcgctcta cctaatgcgt cacgacgcgc gcatccgcgc acgcgtccgg 840tccatcaccg tcatctcgcg ctccggcgtg ctgccctaca tgatctgcaa tcagccgccg 900gagtttgact tcccgcggct gcgcacgctg ctctgtacgg aagcgatcgc cgcggcggat 960ctcatgtccg cgatccgcga cgatctcgcg acggccgaag aacgctcgtt gaacctggcc 1020gatttgtacg acgccgttgc cgccctgttt gggcaggcgc tgcacaagat ggatctcgtg 1080cagcaggaag agttcttctg cgtgcacggc atgaacttca ccaagttggt gcggcgtgcg 1140ggacgcgatt gccgccaggc atccgaggag ctagccgcgg acggcacgct gagcctgctc 1200gccggcgaag tactgcgcgt ggatgcctgc gcgtccggcc agccgttcgc caccatgacc 1260taccgagccg cgggagccga gcatacccac cccgtcccct tcgctgcggt ggtgaattgt 1320ggcggtttcg aggagctgga cacgtgttcc tcgccgttcc tggtcagcgc gatgcagaac 1380gggctgtgcc gcccgaaccg caccaaccgt ggccttctgg ttaacgacga cttcgaggcc 1440agcccaggtt tttgcgtcat cgggccccta gtcggcggca atttcactcc caagatccgt 1500ttttggcacg tcgagagcgc accgcgcgtc cggtcgctgg cgaaatcgct ggcggccagc 1560ctgcttgctt cgctccagcc cgtcgcactg gccccatgc 1599 127 1236 DNA Mycobacteria tuberculosis 127atgaagatcc gaacgttatc cggctcggtg ctggagccgc cgtccgcagt acgcgcgacc 60ccaggcacgt ccatgttaaa actcgagccg ggtggctcga cgatccccaa gatccccttc 120atccgcccga gctttcccgg gccagccgag ctcgccgagg acttcgtaca gatcgcccag 180gctaactggt acacgaactt cggtccgaac gagcggcggt ttgcccgcgc cctgcgcgac 240tatctgggac ctcatctgca cgttgctacc ctcgccaacg gcaccctggc actcctcgcg 300gcgctccacg tcagtttcgg cgccggtacg cgggaccgct acctgctgat gccgtcgttc 360acgttcgtcg gcgtggctca ggctgcgcta tggactgggt accgtccctg gttcatcgac 420atcgacgcca acacatggca gccatgcgtc cactccgccc gcgccgtcat cgaacgcttc 480cgcgaccgga tcgccggcat cctgctggcc aatgtgttcg gcgtcggcaa tccccagatc 540agcgtctggg aggagctcgc cgccgaatgg gagctaccga ttgtgctcga ctcggcggcc 600ggcttcggct ccacgtacgc cgacggcgag cgcctcggtg gacgcggtgc atgcgagatc 660ttctccttcc atgcgaccaa gccgttcgcg gttggtgagg gcggcgctct ggtttctcgc 720gatccacggc tcgtcgagca cgcatacaag ttccagaact tcggcttggt gcaaacacgc 780gagtccatcc agctcggaat gaacggcaag ctgtcggaga tcagcgccgc tattggccta 840cgccaactag tcgggcttga tcgccgcctg gcaagtcgcc gcaaggtcct cgagtgctat 900cgcaccggta tggccgacgc gggtgtgcgt ttccaggaca acgccaatgt tgcgtcgctc 960tgtttcgcga gcgcttgctg cacgtccgcc gaccacaagg ccgcggttct gggtagcctg 1020cgtaggcacg cgatcgaggc gcgcgactac tacaacccac cgcagcaccg acatccgtac 1080tttgtgacga atgccgagtt agtcgagtcg accgatctag ccgtcacggc ggacatttgc 1140tcgcgaatcg tgtcgctgcc agtccacgac cacatggccc cggatgacgt tgcccgggtc 1200gtcgccgccg tgcaggaagc ggaggtgcgc ggtgaa 1236 128 2358 DNA Mycobacteria tuberculosis 128atgatcaccg aggacgcctt ccccgtcgaa ccgtggcagg tccgcgagac caagctcaac 60ctgaacctgc tggcccagtc cgaatcccta ttcgccttgt ccaacgggca cattggatta 120cgcggcaacc tcgacgaggg cgaacccttc ggactgccgg gcacctacct gaactctttc 180tacgaaatcc ggccgctgcc gtacgccgag gccggttatg gatatccgga ggccggccag 240accgttgtcg acgtcaccaa cggcaagatc tttcgcctgt tggtcggcga cgagccgttc 300gacgtccggt atggcgaatt gatctcccac gaacggatcc tcgacctgcg cgccgggacg 360ctgacccgcc gcgcgcactg gcgctcaccg gcgggcaagc aagtcaaagt gacgtccacc 420cggctggtgt cgctggccca ccgcagcgtc gcggcgatcg agtacgtcgt cgaggcaatc 480gaggaattcg ttcgcgtgac cgtgcagtcc gaactcgtca ccaacgagga cgtaccggag 540acctcggccg acccgcgggt gtcggccatc ctggacaggc cgctacaggc cgtcgagcac 600gaacgcaccg agcggggtgc acttctcatg caccgcaccc gagccagcgc gctgatgatg 660gccgcaggga tggaacacga ggtcgaggtt cccgggcggg tcgagatcac caccgacgcc 720cgcccggacc tggcccgaac caccgtgatc tgcgggctgc gcccgggaca gaagctgcgc 780atcgtcaaat acctggccta tggctggtcc agcctgcgct cccgcccggc gctgcgcgac 840caggccgccg gcgcgctgca cggtgcccgc tacagcggct ggcaggggct gctggacgcg 900caacgcgcct acctcgacga cttctgggac agcgcggacg tggaggtcga gggcgacccg 960gaatgtcagc aagcggtgcg tttcgggtta tttcacctgt tgcaggccag cgcgcgcgcc 1020gaacgccgcg cgatccccag caaggggctc accggaaccg ggtatgacgg ccacgccttt 1080tgggacaccg aaggtttcgt gctaccggtg ctcacctaca ccgcaccgca tgcggtcgcc 1140gacgcgctgc ggtggcgggc gtcgacgttg gacctggcca aggagcgggc ggccgagctc 1200ggcctggaag gtgccgcctt tccctggcgg accatccgcg gacaggagtc ctcggcctac 1260tggccggccg gcacggcggc ctggcacatc aacgccgaca tcgcgatggc gttcgagcgg 1320taccgcatcg tcaccggcga cggttcgctg gaggaggaat gcggccttgc ggtgctgatc 1380gagaccgccc ggctgtggct ctcgctcggg caccacgacc gccacggcgt ctggcacctc 1440gacggggtca ccggtcccga cgagtacacg gcggtcgtcc gcgacaacgt gttcacgaat 1500ctgatggcgg cgcacaatct gcacaccgcc gccgatgctt gcttgcgcca ccccgaggcg 1560gcggaggcca tgggtgtcac caccgaggag atggccgcct ggcgcgacgc ggccgacgcc 1620gccaacattc cctacgacga ggaactcggt gtccaccagc agtgtgaagg gttcaccacc 1680cttgcggagt gggatttcga agccaacacc acttatccgt tgctactgca cgaggcctac 1740gtgcgcttgt atcccgcaca ggtgatcaag caggccgacc tggtgctggc gatgcagtgg 1800cagagtcacg cgttcacgcc cgagcagaag gcgcgcaacg tcgactacta cgaacggcgc 1860atggtgcgcg actcgtcgtt gtcggcctgc actcaggcgg tgatgtgcgc cgaggtcggc 1920catctcgagt tggcccacga ctatgcctac gaagccgccc tgatcgacct gcgcgacctg 1980caccgcaaca cccgtgacgg cctacacatg gcttcgctgg ccggagcctg gacggcgctg 2040gtcgtaggct tcggcggcct acgcgacgac gagggcatcc tgtccatcga tccgcagctg 2100cccgacggca tctcgcggct gcggttccgg ctgcgatggc gcggcttccg gctgatcgtc 2160gacgccaacc acaccgacgt caccttcatc cttggcgacg gtcccggcac ccagctgacc 2220atgcgccacg ccggccaaga tctgacgctg cacacggaca caccgtccac catcgccgtg 2280cgcacccgta agccgctgct gccgccacca ccgcagccgc caggccgcga gccagtgcac 2340cgccgggctt tagcccgg 2358 129 786 DNA Mycobacteria tuberculosis 129atggcgaact ggtatcgccc gaactatccg gaagtgaggt cccgcgtgct gggtctgccc 60gagaaggtgc gtgcttgcct gttcgacctc gacggtgtgc tcaccgatac cgcgagcctg 120cataccaagg cgtggaaggc catgtttgac gcctacctag ccgagcgagc cgagcgcacc 180ggcgaaaaat tcgttccctt cgaccctgcc gcggactatc acacgtatgt ggacggcaag 240aaacgcgaag acggcgttcg atcgtttctg agcagccgcg ccatcgaaat acccgacggt 300tccccggatg acccgggcgc cgccgagacg gtgtatggcc tgggcaaccg caagaacgac 360atgttgcaca agctgctgcg cgacgatggg gcccaggtgt tcgacgggtc gcggcgctac 420ctggaggcgg tcacggccgc gggtctcggt gtggccgtgg tgtcttcgag cgccaacacc 480cgcgacgtgc tcgcgaccac cggtctggac cggttcgtcc agcagcgggt ggacggcgtg 540acgttgcgcg aagagcacat cgccggcaag ccggcccccg actccttcct gcgcgcggca 600gaactgttgg gggttacccc cgacgcggcg gcggtgttcg aggacgccct gtccggggtg 660gcggccggcc gcgccggcaa cttcgccgta gtggtgggca tcaaccgaac gggccgggcg 720gctcaggccg cccagttgcg ccgccatggc gccgacgtgg tggtaaccga tctcgccgag 780ctgctg 786 130 60 DNA M. tuberculosis misc_feature (1)...(60) n = A,T,C or G 130antagtaatg tgcgagctga gcgatgtcgc cgctcccaaa aattaccaat ggttnggtca 60 131 60 DNA M. tuberculosis 131agtagtaatg tgcgagctga gcgatgtcgc cgctcccaaa aattaccaat ggtttggtca 60 132 60 DNA M. tuberbulosis 132tgacgccttc ctaaccagaa ttgtgaattc atacaagccg tagtcgtgca gaagcgcaac 60 133 60 DNA M. tuberculosis 133tgacgccttc ctaaccagaa ttgtgaattc atacaagccg tagtcgtgca gaagcgcaac 60 134 11 DNA M. tuberculosis 134actcttggag t 11 135 11 DNA M. tuberculosis 135actcttggag t 11 136 49 DNA M. tuberculosis misc_feature (1)...(49) n = A,T,C or G 136gtggcctaca acggngctct ccgnggcgcg ggcgtaccgg atatcttag 49 137 49 DNA M. tuberculosis 137gcggcctaca acggcgctct ccgcggcgcg ggcgtaccgg atatcttag 49

Claims

1. A method of distinguishing whether a patient has been exposed to a virulent strain of the M. tuberculosis complex, the method comprising:contacting said patient or a sample obtained therefrom with a polypeptide encoded by the open reading frame Rv2073c (SEQ ID NO: 82); and determining the presence of an immune reaction to said polypeptide, wherein a positive response is indicative of exposure to a virulent strain of the M. tuberculosis complex.

2. The method of claim 1, wherein the contacting step comprises sub-cutaneous injection of said polypeptide.

3. The method of claim 1, wherein the contacting step is performed in vitro and said sample comprises a blood sample or derivative thereof.

4. The method according to claim 2, wherein said polypeptide is injected at a dose of from 0.05 μg to 5 μg.

5. The method according to claim 2, wherein the site of injection is examined for the presence of a wheat, indicative of said positive response.