Motlin-like polypeptide and use thereof

Abstract

A pharmaceutical composition for stimulating peristaltic contraction in the intestinal canal which contains a pharmaceutically acceptable carrier or excipient and an effective amount of a polypeptide, or a salt thereof, having a pharmacological activity similar to motilin. The polypeptide has the formula B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X'-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y, with Z.sub.1,Z.sub.2 and Z.sub.3 each being an amino acid residue having a hydrophobic side-chain, A.sub.1 and A.sub.2 each being an amino acid residue such as Pro, Gly, Asn and Ser, B.sub.1, B.sub.2 and B.sub.3 are each an amino acid residue having a side-chain with an aromatic ring, C is Gln, Glu or Asp, D is Asn, Glu or Asp, X' is an amino acid residue other than Met, E is Gln, Lys or Arg, and Y is homoserine, homoserine-lactone or a peptide chain having amino acid residues not exceeding 10 and containing homoserine or homoserine-lactone at the C-terminal where the first amino acid of said peptide chain is other than Lys, Arg or Pro.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a motilin-like polypeptide, namely a polypeptide having a pharmacological activity similar to motilin, a salt thereof, a process for the preparation of the polypeptide, a recombinant DNA thereof, and a plasmid for expressing the polypeptide as well as a use of the polypeptide for curing gastroenteropathies.

2. Related Arts Motilin is one of peptide hormones, first isolated from mucous membrane of porcine upper small intestine, and its amino acid sequence determined by Brown J. C. et al ["Gastroenterology", Vol. 62, pages 401-404 (1972) and "Can. J. Biochem.", Vol. 52, pages 7-10 (1974)]. The porcine motilin consists of 22 amino acids and has a molecular weight of about 2700.

While, some of the present inventors have succeeded in isolation of cloned cDNA encoding human motilin precursor, the nucleotide sequence therein including a part designating the amino acid sequence same with that for the porcine motilin, so that it has been made apparent that the human motilin has the amino acid sequence same with that for the porcine motilin [Jap. Pat. No. Sho 63-276489(A) which corresponds to U.S. patent application Ser. No. 07/190,849 and European Pat. Appln. No. 88107108.81].

As physiological activities of the motilin, a hypermotility action of digestive tract and contracting action of gastroduodinal and colonic smooth muscle therein have been well known. As the hypermotility action, it has been reported that the rate of gastric emptying is shortened ["Gastroenterology", Vol. 80, pages 456-460 (1981)] and as the contracting action of smooth muscle in the digestive tract, it has been known that the motilin shows a strong contracting action to a rabbit and human gastrointestinal tract, independing from a neuro system. Moreover, no report has been issued on any specific side-effect. Therefore, it has been considered that the motilin is useful for curing gastroenteropathies at the period of post-operation and for diagnosis thereof. In connection with this, please note that prostagrandin has widely been employed for curing the gastroenteropathies, although the drug shows a relatively strong side-effect.

It has also been reported that chemically synthesized motilin analogue-methionine residue at 13-position of motilin being substituted with leucine or norleucine residue- shows biological activity similar to pure native porcine motilin ["Scand. J. Gastroenterology", Vol. 11, pages 119-203 (1976) and others]. Therefore, it has been considered that methionine residue at 13-position has almost no influence on useful activity of the motilin.

The motilin according to widely accepted technical art has been obtained through an extraction from porcine organ tissue and thus it was quite difficult to obtain the same in large amount. Since the motilin is a polypeptide consisting of 22 amino acids, a large scale production is difficult and a cost thereof becomes higher, even if a chemical synthesis shall be applied therefor. Namely, the motilin has not actually been employed for clinical use, due to its poor productivity, in spite of that an effectiveness thereof as the drug for curing gastroenteropathies has been expected.

Therefore, various studies have been made for preparing polypeptides having motilin-like biological activity, with a reasonable cost, by utilizing the so-called "Biotechnology" [Jap. Pat. Nos. Sho 63-71195(A) and 63-208006(A)].

Further, such studies have also been made to develop motilin analogues showing biological activities higher than those of the motilin per se [Jap. Pat. No. Sho 61-26559(B)].

All of said processes utilizing the Biotechnology comprise a step for cleaving a polypeptide chain with use of cyanogen bromide, and a step for removing an excess peptide chain containing homoserine at C-terminal, with use of an enzyme. However, the enzymatic treatment reduces yield of a desired motilin analogue to increase a cost thereof, which makes difficult a large scale production of the motilin analogue.

SUMMARY OF THE INVENTION

A principal object of the invention is to provide a novel motilin-like polypeptide having a biological activity equal to or higher than that of native motilin, and a salt of the polypeptide.

First additional object of the invention is to provide a pharmaceutical agent, namely the agent for curing gastroenteropathies which contains as an effective ingredient the motilin-like polypeptide or salt thereof.

Second additional object of the invention is to provide a process for the preparation of the motilin-like polypeptide or a salt thereof, which is more easy than any process developed prior to this invention, so that the polypeptide and a salt thereof can be supplied to the market with a reasonable price and in large amount.

Third additional object of the invention is to provide a novel recombinant DNA to be employed for carrying out said process.

Fourth additional object of the invention is to provide a plasmid, in which the recombinant DNA is inserted to express the motilin-like polypeptide.

It has been estimated that a pharmacologically active part of the motilin lies in the region of from N-terminal to 15 -position in its amino acid sequence ["Peptide Chemistry 1977", pages 171-176 (1978)]. Characteristic of the region lies in that 7 residues of hydrophobic amino acids of phenylalanine (Phe, appearing in double), valine (Val), proline (Pro), isoleucine (Ile), glycine (Gly) and leucine (Leu) appear in the positions of 1-10. Under an assumption of that a hydrophobicity in the region has a certain relation to a generation of pharmacological activity in the motilin, namely to a binding with a motilin receptor on cell membrane of colonic smooth muscle of rabbit ["Regulatory Peptides", Vol. 15, pages 146-153 (1986)], the present inventors have chemically synthesized various motilin analogues and investigated the same by taking mainly amino acids in the region of 1-10 positions into consideration and finally found that the pharmacological activity thereof can be increased by substituting the amino acid residues in the region for the native motilin with suitable amino acid residues.

Further, the present inventors have also unexpectedly found that the polypeptide per se obtained through the cleaving step using cyanogen bromide and not yet treated with an enzyme has a pharmacological activity equal to or higher than that of the native motilin. This means that the enzymatic removal treatment of residues of amino acids including homoserine (including homoserine-lactone and referred to hereinafter as "Hse") is not required.

According to one aspect of the invention, therefore, the principal object can be attained by a polypeptide of the formula

B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X'-Gln-Glu- Lys-Glu-Arg-D-Lys-Gly-E-Y (I') wherein Z.sub.1, Z.sub.2 and Z.sub.3 are a residue of amino acid having a hydrophobic side-chain, A.sub.1 and A.sub.2 are a residue of amino acid which can take a turn structure in the polypeptide chain, B.sub.1, B.sub.2 and B.sub.3 are a residue of amino acid having a side-chain with an aromatic ring, C is Gln, Glu or Asp, D is Asn, Glu or Asp, X' is a residue of amino acid other than Met, E is Gln, Lye or Arg, and Y is OH, homoserine, homoserine-lactone or a peptide chain having amino acid residues not exceeding 10 and containing homoserine or homoserine-lactone at C-terminal, and a salt thereof.

As the amino acid having the hydrophobic side-chain, valine (Val), isoleucine (Ile), leucine (Leu) or the like can be listed. As the amino acid which can take the turn structure in the polypeptide chain, proline (Pro), glycine (Gly), asparagine (Asn), serine (Ser) or the like can be listed.

The reason why the symbol X' for 13-position amino acid residue is stated as the residue of amino acid other than methionine (Met) lies in that if X' is Met residue, the desired polypeptide having the motilin-like activity can not be obtained, since a cleavage will also occur at Met in 3-position, when a fused protein is treated with the cyanogen bromide. However, the amino acid residue at 13-position may be made as Met, in case where the Met residue shall be protected with a protecting group with use of a suitable chemical procedure to prevent any cleavage at that position due to the cyanogen bromide treatment, the resulting polypeptide with the protected Met residue at 13-position is treated with cyanogen bromide to form homoserine or homoserine-lactone residue at C-terminal, and then the protection radical for the Met is removed.

Therefore, the polypeptide according to the invention is characterized substantially by that shown by the formula of

B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y (I) wherein Z.sub.1, Z.sub.2, Z.sub.3, A.sub.1, A.sub.2, B.sub.1, B.sub.2, B.sub.3, C, D, E and Y have the meanings as referred to, and X is an optional amino acid residue, and a salt thereof which have motilin-like biological activities.

The first additional object can be attained by a pharmaceutical composition for curing a gastoroenteropathy, which comprises, an effective amount of at least one of the polypeptides shown by said formula (1) and salts thereof, in association with a pharmaceutically acceptable carrier or excipient.

Among the polypeptides shown by said formula (I), those shown by the formula of

Phe-Val-A'-Ile-Phe-Thr-Tyr-B'-Glu-Leu-C-Arg-X'-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y' (II) wherein C, X', D and E have the meanings as referred to, A' is Pro, Gly, Asn or Ser, B' is Gly, Asn or Ser, and Y' is homoserine, homoserine-lactone or a peptide chain having amino acid residues not exceeding 10 and containing homoserine or homoserine-lactone at C-terminal, can be prepared through steps of synthesizing a single-stranded DNA which encodes a peptide having at least 6 residues of none-charged polar amino acids and methionine at its terminal, a single-stranded DNA encoding the amino acid sequence shown by said formula (II) and methionine at C-terminal, and a single-stranded complementary DNA; preparing a double-stranded DNA with use of said single-stranded DNA having a specific restriction enzyme recognition site, respectively; ligating a specific restriction site of an expression vector with use of the restriction enzymes same with said specific ones; reconstructing a plasmid having multiple joined genes; introducing the reconstructed plasmid into a microorganism to cause a transformation of the microorganism; cultivating the resulting transformant to produce therein a polypeptide having the amino acid sequence of the formula (II) with the exception of having methionine at C-terminal, as a part of fused protein; breaking the microorganism and treating the same with cyanogen bromide to separate the polypeptide of the formula (II) from the fused protein; and fractionating the resulting mixture to isolate the desired polypeptide of the formula (II), so that the second additional object can be attained.

The ground of that the symbol Y' at C-terminal in the formula (11) is stated as the residue of homoserine, homoserine-lactone or a

peptide chain having the amino acid residues not exceeding 10 and containing homoserine or homoserine-lactone at C-terminal lies in making able to obtain the desired polypeptide having the motilin-like activity, by only the step of treating the fused protein with use of the cyanogen bromide. As the none-charged polar amino acid, asparagine (Asn), glutamine (Gln), threoenine (Thr) and serine (Ser) are suitable for increasing an expression rate of the desired polypeptide.

For producing in the microorganism and in large amount, as a part of the fused protein, the polypeptide having the amino acid sequence of the formula (II) with the exception of having methionine (Met) at C-terminal (Note: Met will be removed by the treatment with cyanogen bromide, so that Hse will appear at C-terminal), it is important to ligate a plural number of the polypeptide having Met at C-terminal in tandem arrangement so as to express the motilin-like polypeptide as a polymerized protein. This can be done by using techniques given in the specification for Jap. Pat. Appln. No. Sho 63-208006 (corresponding to U.S. patent application Ser. No. 07/390,149 and European Pat. Appln.

No. 89115199.5). It is sufficient that each of the motilin-like polypeptides to be tandemly arranged has methionine at C-terminal, since the treatment with use of the cyanogen bromide will cause a cleavage of the polymerized protein at each part of methionine, whereby the polymer protein is separated into its constitutional monomer proteins.

As apparent from the descriptions given above, the third additional object can be attained by the recombinant DNA which encodes the leader sequence polypeptide having at least 6 residues of the none-charged polar amino acids, and subsequently encoding the motilin-like polypeptide having the amino acid sequence of the formula (II), but with the exception of having methionine (Met) at C-terminal. In this case, it is preferable that a plurality of the motilin-like polypeptide are connected in tandem arrangement, each of which polypeptide has Met at its C-terminal.

The last of fourth additional object can be attained by the expression plasmid, wherein such a recombinant DNA is inserted.

BRIEF DESCRIPTION OF THE DRAWING

FIG. 1 is an illustration showing steps for inserting one motilin-like gene into a plasmid;

FIG. 2 is an illustration showing steps for inserting two tandemly arranged motilin-like genes into a plasmid;

FIG. 3 is a graph showing results of that an intestinal contraction activity was measured by Magnus method and compared, on motilin-like polypeptides according to the invention, as test samples and a conventional pure [Leu.sup.13 ]-motilin, as control sample, when an contraction activity of 10.sup.-6 M acetylcholine is assumed as 100%;

FIG. 4A is a chart showing a motional change of intestinal measured by Balloon method using an unconscious living dog, when [Leu.sup.13 ]-motilin-homoserine according to the invention was administered;

FIG. 4B is a chart similar to that of FIG. 4A, but shows the case of that the as control, conventional pure [Leu.sup.13 ]-motilin, was administered; and

FIG. 5 is a graph showing results of that an intestinal canal contraction activity was measured by Balloon method and compared, on the conventional [Leu.sup.13 ]-motilin, as control sample and [Leu.sup.13 ]-motilin-homoserine and a salt thereof, as test samples, in various concentration, when a contraction activity of the conventional drug of 30 .mu.g/kg/hr prostagandin F.sub.2.alpha. is assumed as 100%.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The invention will now be further explained with reference to Examples, Test Examples on pharmacological activity, and Medicine Preparation Examples.

In the following, the explanation will be given on motilin analogues, in which methionine residue at 13-position of native motilin is modified into leucine residue, but please note that other and various motilin analogues having an amino acid residue other than methionine residue at 13-position, can be prepared in a similar manner by using a fermentation method, and that motilin analogues having methionine residue at 13-position may also be prepared by protecting the methionine residue with use of a chemical synthetic method to prevent a cleavage at that position, then treating with cyanogen bromide to form homoserine or homoserine-lactone at C-terminal and thereafter removing the protecting group for the methionine residue.

EXAMPLE 1

In the first place, polypeptides, each having following amino acid sequence were synthesized with use of a peptide synthesizer (Type 430A marketed by Applied Biosystems Co.). ##STR1## wherein R.sub.1 is a) Met-Gly-Ser,

b) Asp-Gly-Ile-Phe-Met-Gly-Ser, or c) Arg-Ile-Phe-Met-Gly-Ser.

A purification of each synthesized polypeptide was carried out by subjecting to HPLC under following conditions, with use of a .mu. Bondasphere C-18 column (19 mm.times.15 cm) marketed by Waters Co.

Eluate: Linear gradient of 30% to 60% acetonitrile in 0.1% trifluoroacetic acid (30 minutes) Flow rate: 7.0 ml/min.

Each of the purified samples (10 mg) was taken and dissolved in 70% formic acid solution (30 ml). After added 50 mg of cyanogen bromide, the solution was reacted for 16-24 hours under 37.degree. C. Then, distilled water (200 ml) was added and lyophilized to remove the formic acid and cyanogen bromide. The resulting material was subjected again to HPLC under conditions same with the former, with use of a .mu. Bondasphere C-18 column marketed by Waters Co.

Fractions in a main peak part on the HPLC were recovered and lyophilized. A part of the dried powder was taken and a nuoleotide sequence thereof was checked with use of a peptide sequencer marketed by Applied Biosystems Co. to confirm that each of the samples was correctly cleaved at the position of methionine (Met) and a polypeptide, wherein said R.sub.1 at C-terminal is modified, as follows.

A) Hse,

B) Asp-Gly-Ile-Phe-Hse, or

C) Arg-Ile-Phe-Hse.

This Example explains the process for the preparation of motilin-like polypeptides, wherein the methionine (Met) in 13-position of motilin is changed to leucine (Leu), but other motilin-like polypeptide having another amino acid residue other than methionine residue in 13-position can be produced by a conventional fermentation method. Further, please note that still other motilin-like polypeptides, wherein a part of the amino acid residues is changed, can also be obtained by synthesizing in a manner similar to the aforesaid, with use of a peptide synthesizer, cleaving the same with use of cyanogen bromide, and purifying by HPLC.

EXAMPLE 2

(1) Synthesis of DNA Encoding a Polypeptide Having Motilin-Like Biological Activity

Motilin-like polypeptide, wherein Met in 13-position is replaced with Leu and Hse is added in 23-position, has the following amino acid sequence. ##STR2##

It has been known on the polypeptide that Hse residue in 23-position is formed by modification of Met residue, when a fused protein produced by a microorganism is treated with cyanogen bromide.

Therefore, following double-stranded DNA fragment shown by following Formula (1) was synthesized, which includes a nucleotide sequence encoding an amino acid sequence having Met residue in 23-position of said amino acid sequence, has at N-terminal a nucleotide sequence encoding a leader polypeptide with a number of non-charged polar amino acid residues through Met (Met-Thr-Met-Ile-Thr-Asn-Ser-Gln-Gln-Gln-Gln-Gln-Gln-Ile-Phe-Met), and has at C-terminal a nucleotide sequence encoding a polypeptide which has an amino acid sequence of Gly-Ile-Leu.

Formula (1)

5'-AATTCATGACCATGATTACGAACTCACAACAACAACAACAACAGATCTTCATG

3'-GTACTGGTACTAATGCTTGAGTGTTGTTGTTGTTGTTGTCTAGAAGTAC

TTCGTTCCGATCTTCACCTACGGCGAACTGCAGCGTCTGCAAGAAAAAGAGCG AAGCAAGGCTAGAAGTGGATGCCGCTTGACGTCGCAGACGTTCTTTTTCTCGC CAACAAAGGCCAGATGGGGATCCTGTGATA GTTGTTTCCGGTCTACCCCTAGGACACTATTCGA

The double-stranded DNA shown by Formula (1) was synthesized in a following manner.

In the first place, the following 6 single-stranded DNAs, each having following amino acid sequence, were synthesized with use of a DNA synthesizer (Gene Assembler, marketed by Pharmacia AB, Sweden). Among them, please note that each pair of DNAs of Formulae (2) and (7), (3) and (6) as well as (4) and (5) are complementary DNAs, excepting a part thereof.

Formula (2)

AATTCATGACCATGATTACGAACTCACAACAACAACAACA

Formula (3)

GATCTTCATGTTCGTTCCGATCTTCACCTACGGCGAACTGCAG

Formula (4)

CGTCTGCAAGAAAAAGAGCGCAACAAAGGCCAGATGGGGATCCTGTGATA

Formula (5)

AGCTTATCACAGGATCCCCATCTGGCCTTTGTTGCGCTCTTTTTCTTG

Formula (6)

CAGACGCTGCAGTTCGCCGTAGGTGAAGATCGGAACGAACATGAA

Formula (7)

GATCTGTTGTTGTTGTTGTTGTGAGTTCGTAATCATGGTCATG

Each of the single-stranded DNAs shown by Formula (2)-(7) was treated with a polynucleotidekinase to phosphorylate at 5'-terminal, and each complementary DNA pair shown by Formula (2) and (2), (3) and (6) as well as (4) and (5) was annealed to prepare three double-stranded DNAs which were tandemly ligated with use of a DNA ligase to obtain the DNA fragment shown by Formula (1).

(2) Insertion of DNA Fragment into Expression Vector

Operations for inserting the synthesized DNA fragment obtained in said Item 1 into an expression vector (plasmid) shall be explained with reference to FIG. 1.

A commercially available plasmid (pTM1) with Trp promoter for expressing in Escherichia coli was treated with restriction enzymes of HindIII and EcoRI to cut the plasmid. To the resulting cleavage sites, the synthesized DNA fragment obtained in Item (1) was ligated with use of DNA ligase to reconstruct a recombinant plasmid. This recombinant plasmid was named as "pTMH1". The plasmid has been designed to commence a protein synthesis at the position with distance of 10 residues from SD sequence in downstream of the Trp promoter. When the expression plasmid is inserted in Escherichia coil or the like, therefore, a protein shall be produced with use of indoleacrylic acid (IAA) or the like.

Further, the recombinant vector has been designed to have recognition sites for restriction enzymes of BgIII and BamHI.

(3) Construction of Recombinant Plasmid with Two or More Motilin-Like Genes

This shall be explained with reference to FIG. 2.

In the first place, the recombinant plasmid (pTMH1) obtained in said Item 3 was treated with restriction enzymes of EcoRI and BamHI to cut the same at an upper-stream position of the motilin-like gene part and at a potion in the vector part, so that a fragment was recovered. Another recombinant plasmid (pTMH1) was treated with restriction enzymes of EcoRI and BgIII to out the same at the same position in the vector part and at a position for making a cleavage site common to that of the upper-stream cleavage position in a downstream region of the motilin-like gene part. To the cleavage sites, the previously recovered fragment was ligated with use of DNA ligase to obtain an expression plasmid with two motilin-like genes which are mutually connected through a peptide of Gly-Ile-Phe-Met. The resulting recombinant plasmid was named as "pTMH2".

In the above case, the cleavage sites by the restriction enzymes of BamHI and BgIII were ligated with the DNA ligase, but each of the restriction enzymes can now not recognize the resulting ligated part, and thus a recombinant plasmid, wherein the motilin-like genes are tandemly arranged freely in number, has the leader peptide sequence through methionine in upper-stream of the motilin-like gene part, by repeating the operations as referred to above.

(4) Production of Fused Protein Containing Motilin-Like Polypeptide

A recombinant plasmid with four tandemly arranged motilin-like genes (pTMH4, prepared by the manner as described in said Item 3) was inserted in Escherichia coli (HB101 strain) to cause a transformation thereof (The transformant was named as "E. coli MH4" and has been internationally deposited with Fermentation Research Institute, Agency of Industrial Science and Technology of Japan under the deposition number of --FERM BP-2555--). The transformants were cultivated at 30.degree. C. in a medium containing 50 .mu.g/ml of ampicillin (for instance, the medium prepared by adding 0.5% casamino acid in M9-medium), under aeration. At the time when A.sub.550 became 0.6-0.8, indoleacrylic acid (IAA) was added, final concentration thereof being made to 15 .mu.g/ml.

Then the cultivation was continued for 16 hours and the resulting medium was centrifuged (8000 rpm, 4.degree. C., 5 minutes) to recover cells. A part of the cells was taken and analyzed by 15% polyamide-gel electrophoresis to find out that desired fused protein reached about 30% of total protein. This brings such estimations of that the leader peptide sequence part of the synthetic DNA inserted in the plasmid accelerates efficient formation of the granulocytes and almost no decomposition by protease shall occur.

(5) Isolation and Purification of Motilin-Like Polypeptide

A suspension of the paste-like cells obtained in said Item 4 (about 30 ml) and in 200 ml of cold acetone was filtered with use of a glass filter, and the resulting residue was suspended in 300 ml of saline and then subjected to a high pressure homogenizer or ultra-sonic treatment to break-down the cells. The resulting cell residue was centrifuged at 10000 rpm for 15 minutes to obtain a pellet. The pellet contains the fused protein consisting of the leader sequence peptide and a tetramer of motilin-like polypeptide.

To a solution of the pellet (amount of protein; about 500 mg) in 30 ml of 70% formic acid, cyanogen bromide (500 mg) was added and reacted at 30.degree. C. for overnight. To the reaction mixture, NaOH (40 g) and distilled water (200 ml) were added to set pH of the solution to a level not lower than 3. The solution was centrifuged (1000 rpm for 20 minutes) to recover aqueous phase. The solution was desalted with Sephadex G-15 column to remove the formic acid and cyanogen bromide, and motilin-like polypeptide fractions were treated by cation exchange chromatography and then purified by HPLC under following conditions and with use of .mu. Bondasphere C-18 column (19 mm.times.15 cm).

Eluate: Linear gradient of 30% to 60% acetonitrile in 0.1% trifluoroacetate, 30 minutes; Flow rate: 7.0 ml/min.

Fractions in a main peak part on the HPLC were collected and lyophilized. A part of the dried powder was taken and checked with use of a peptide sequencer marketed by Applied Biosystems Co. to confirm that the sample has the desired motilin-like polypeptide having Hse at C-terminal and having the correct amino acid sequence.

By carrying out operations as above, 400-500 mg of the desired motilin-like polypeptide were obtained from one liter of the medium, in which the recombinant Escherichia coil (said E. coli MH4) was cultivated.

Biological Activity Test Example 1

An intestinal contraction activity was measured by Magnus method using upper small intestine of rabbit ["J. Pharm. Pharmac.", Vol. 28, pages 650-651 (1976)], on each motilin-like polypeptides (Example 1, wherein R.sub.1 is Hse, Asp-Gly-Ile-Phe-Hse, or Arg-Ile-Phe-Hse) according to the invention, as test samples and a conventional pure [Leu.sup.13 ]-motilin, as control sample. The activities of the test samples and control sample were compared, under assumption of that an contraction activity caused by 10.sup.-6 M acetylcholine is 100%.

Results are shown in FIG. 3. As apparently seen from the Figure, it has been confirmed that each of the polypeptides according to the invent ion has the intestinal contraction activity at the level same with or higher than that of the Leu.sup.13 -motilin.

Biological Activity Test Example 2

An intestinal contraction activity of various motilin analogues prepared in the manner similar to Example 1 was measured by Magnus method as in Biological Test Example 1 to determine ED.sub.50 thereof and compared with that of native motilin, under assumption of that the contraction activity of the native motilin is 100%.

Results are shown in following Table 1. Please note that all of the motilin analogues given in the Table are designated as "Hse" at C-terminal, but the motilin analogues, wherein Hse is homoserine, homoserine-lactone or sodium salt thereof, showed substantially the same contraction activity level.

Further, motilin analogues, wherein Hse residue was changed to a radical of --OH, also showed the contraction activity at same level with those having Hse residue at C-terminal.

TABLE 1__________________________________________________________________________Amino Acid Sequence Activity in vitro__________________________________________________________________________ (%)15101520Phe-Val-Pro-Ile-Phe-Thr-Tyr-Gly-Glu-Leu-Gln-Arg-Met-Gln-Glu-Lys-Glu-Arg-Asn-Lys-Gly-Gln 100(13)(23)-Leu--Hse 100(3)-Gly--Leu--Hse 170-Ser--Leu--Hse 90-100-Asn--Leu--Hse 90-100-Ile--Leu--Hse 2(8)-Ser--Leu--Hse 90-100-Asn--Leu--Hse 90-100-Ile--Leu--Hse 2(11)-Glu--Leu--Hse 110- Asp--Leu--Hse 100(2)-Leu--Leu--Hse 100-Ile--Leu--Hse 100(4)-Leu--Leu--Hse 120-Val--Leu--Hse 100(10)-Ile--Leu--Hse 110-Val--Leu--Hse 100(1)Tyr- 100Ile- 10(5)-Tyr--Leu--Hse 100-Ile--Leu--Hse 10(7)-Phe--Leu--Hse 100-Ile--Leu--Hse 10(19)-Leu--Glu--Hse 90-100- Leu--Asp--Hse 90-100(22)-Leu--Arg-Hse 90-100-Leu--Lys-Hse 90-100__________________________________________________________________________

It can be found from the results shown in Table 1 that an activity can be increased by exchanging one or more amino acid residues, although it has been said that the pharmacological active part of the human motilin depends on amino acid sequence near N-terminal, the following may be said on the relation between the amino acid sequence near N-terminal and a degree of the activity.

a) The motilin analogues, wherein Pro in 3-position and Gly in 8-position of the native motilin are exchanged to Gly, Ser or Asn residue which can take a turn structure in the polypeptide chain, show the activity in the level same with or higher than that of the native motilin, but the activity remarkably reduces, when the amino acid residues in said positions were exchanged to Ile which is difficult to take the meander structure.

In the above case, the motilin analogues, wherein Pro in 3-position of the native motilin was exchanged to Gly, show quite high activity, namely about twice of the native motilin.

b) Although Val in 2-position, Ile in 4-position and Leu in 10-position of the native motilin are amino acids having a hydrophobic side-chain, motilin analogues having a structure of that these amino acids were mutually exchanged show the activity in the level same with or higher than that of the native motilin.

c) Although Phe in 1,5-position and Tyr in 7-position of the native motilin are amino acids having a side-chain with an aromatic ring, motilin analogues having a structure of that these amino acids were mutually exchanged show the activity in the same level with that of the native motilin, but if the amino acid in said positions was exchanged to another amino acid, for instance to Ile, remarkable reduction will occur in activity.

d) it has been considered that C-terminal part of the native motilin is constituted with amino acid residues with charge or polarity and is important for retaining the activity, particularly in vivo, although it is not main active part. Therefore, motilin analogues having an amino acid structure for increasing positive or negative charge at C-terminal and checked a biological activity thereof, but almost no change in activity was found. This brings an estimation of that the amino acid exchange in some extent, at the part near C-terminal does not give so high influence on the activity, if a charge-balance therein is kept throughout.

Biological Activity Test Example 3

Intestinal contraction activity (upper small intestine, jejunum and ileum) was measured by Balloon method using an unconscious dog, on the test sample of [Leu.sup.13 ]-motilin-homoserine (Example 1, R.sub.1 :Hse) and the control sample of [Leu.sup.13 ]-motilin which was chemically synthesized, when the sample was administered in an amount of 2.0/ .mu.g/kg/hr.

Results are shown FIGS. 4A and 4B. As apparently seen from the Figures, it was confirmed that the polypeptide according to the invention [Leu.sup.13 ]-motilin-homoserine) has a noticeable higher contraction activity than the control of [Leu.sup.13 ]-motilin, and that the contraction activity of the polypeptide according to the invention appears in a natural manner.

Further, the polypeptides according to the invention and having homoserine-lactone residue in 23-position has the biological activity same with or similar to those having homoserine residue in 23-position.

Moreover, the polypeptides according to the invention and having various amino acid residues not exceeding 10 and containing Hse residue at C-terminal show the biological activity same with or similar to those having homoserine residue in 23-position.

Biological Activity Test Example 4

Contraction activity of upper small intestine was measured by Balloon method using an unconscious dog as in Biological Test Example 3, on the test sample of [Leu.sup.13 ]-motilin-homoserine (Example 1, R.sub.1 :Hse, Test Sample 1) and its sodium salt (Test Sample 2) as well as the control sample of [Leu.sup.13 ]-motilin, when the sample was administered in an amount of 2.0 .mu.g/kg/hr, to calculate ED.sub.50, and then compared under assumption of that the activity of the control sample is 100%.

Results are shown in following Table 2. As apparently seen from the Table, the test samples show the activity higher than the control sample, by 10-20%.

TABLE 2______________________________________Sample Activity (%)______________________________________Control Sample 100Test Sample1 110-1202 110-120______________________________________

Biological Activity Test Example 5

Contraction activity of upper small intestine was measured by Balloon method using an unconscious dog as in Biological Test Example 3, on the test sample of [Leu.sup.13 ]-motilin-homoserine (Example 1, R.sub.1 :Hse) and its sodium salt as well as the control samples of the conventional [Leu.sup.13 ]-motilin and prostagrandin F.sub.2.alpha. which has been clinically employed for curing gastroenteropathies, for instance "ileus", to calculate ED.sub.50, and then compared under assumption of that the activity of the prostagrandin is 100%.

Results are shown in FIG. 5. As apparently seen from the Figure, the polypeptide and its salt according to the invention show the activity in far low concentration, when compared with the now widely accepted drug of prostagrandin, so that an amount for administration can be remarkably reduced, when the same effect shall be expected.

From FIGS. 4A and 4B, the polypeptides according to the invention and more particularly, [Leu.sup.13 ]-motilin-homoserine show the natural contracting action on intestin into consideration, it can be said that the invention provides a drug far excellent than the conventional drug of prostagrandin, in its safety and mild action.

Medicine Preparation Example

A solution of polypeptide according to the invention ([Leu.sup.13 ]-motilin-homoserine, Example 1, R.sub.1 :Hse) in refined water was aseptically charged into vials, so that each vial contains the polypeptide by 1 mg. After lyophilized, the vial was sealed to obtain a dry powdery medicine. The powdery medicine is dissolved in saline or the like for injection purpose, when it shall be used.

Claims

1. A polypeptide of the formula: B.sub.1 -Z.sub.1 -A.sub.1 - Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X'-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y wherein Z.sub.1, Z.sub.2 and Z.sub.3 are a residue of an amino acid selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Asn and Ser residues; B.sub.1, B.sub.2 and B.sub.3 are a residue of an amino acid selected from the group consisting of Phe and Tyr; C is a residue of Gln, Glu or Asp; D is a residue of Asn, Glu or Asp; X' is a residue of Leu; E is a residue of Gln, Lys or Arg; and Y is selected from the group consisting of homoserine, homoserine-lactone, Asp-Gly-Ile-Phe-Hse, and Asp-Gly-Ile-Phe-Hse-lactone and a salt thereof.

2. The polypeptide according to claim 1, wherein Y is selected from the group consisting of Asp-Gly-Ile-Phe-Hse, and Asp-Gly-Ile-Phe-Hse-lactone.

3. A pharmaceutical composition for inducing a contraction of the intestinal canal, which comprises an effective amount of a polypeptide of the formula: B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X'-Gln,Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y

wherein Z.sub.1, Z.sub.2 and Z.sub.3 are a residue of an amino acid selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Asn and Ser residues; B.sub.1, B.sub.2 and B.sub.3 are a residue of an amino acid selected from the group consisting of Phe or Tyr; C is a residue of Gln, Glu or Asp; D is a residue of Asn, Glu or Asp; X' is a residue of Leu; E is a residue of Gln, Lys or Arg; and Y is selected from the group consisting of homoserine, homoserine-lactone, Asp-Gly-Ile-Phe-Hse, and Asp-Gly-Ile-Phe-Hse-lactone or a salt thereof, in association with a nontoxic pharmaceutical carrier or excipient.

4. A method for inducing contraction of the intestinal canal, comprising administering to a patient in need of such treatment an effective amount of a pharmaceutical composition for inducing contraction of the intestinal canal, comprising a polypeptide of the formula: B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-X'-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y

wherein Z.sub.1, Z.sub.2 and Z.sub.3 are a residue of an amino acid selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Asn and Ser residues; B.sub.1, B.sub.2 and B.sub.3 are a residue of an amino acid selected from the group consisting of Phe or Tyr; C is a residue of Gln, Glu or Asp; D is a residue of Asn, Glu or Asp; X' is a residue of Leu; E is a residue of Gln, Lys or Arg; and Y is selected from the group consisting of homoserine, homoserine-lactone, Asp-Gly-Ile-Phe-Hse, and Asp-Gly-Ile-Phe-Hse-lactone or a salt thereof, in association with a nontoxic pharmaceutical carrier or excipient.

5. A motilin analogue of the formula B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-Leu-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y

wherein B.sub.1, B.sub.2 and B.sub.3 are selected from the group consisting of Phe and Tyr; Z.sub.1, Z.sub.2 and Z.sub.3 are selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Ser and Asn; C is selected from the group consisting of Gln, Glu and Asp; D is selected from the group consisting of Asn, Glu and Asp; E is selected from the group consisting of Gln, Arg and Lys; and Y is selected from the group consisting of homoserine, homoserine-lactone, and a salt thereof.

6. A motilin analogue according to claim 5, wherein said motilin analog is of the formula: Phe-Val-Pro-Ile-Phe-Thr-Tyr-Gly-Glu-Leu-Gln-Arg-Leu-Gln-Glu-Lys-Glu-Arg-Asn-Lys-Gly-Gln-Y

wherein Y is selected from the group consisting of homoserine and homoserine-lactone.

7. A pharmaceutical composition for inducing contraction of the intestinal canal, comprising an effective amount of a motilin analogue of the formula B.sub.1 -Z.sub.1 -A-Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-Leu-Gln-Glu-Lys-Glu-Arg-D-Lys-Gly-E-Y

wherein B.sub.1, B.sub.2 and B.sub.3 are selected from the group consisting of Phe and Tyr; Z.sub.1, Z.sub.2 and Z.sub.3 are selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Ser and Asn; C is selected from the group consisting of Gln, Glu and Asp; D is selected from the group consisting of Asn, Glu and Asp; E is selected from the group consisting of Gln, Arg and Lys; and Y is selected from the group consisting of homoserine, homoserine-lactone, and a salt thereof,

in combination with a nontoxic pharmaceutical carrier or excipient.

8. The pharmaceutical composition according to claim 7, wherein said motilin analogue is a compound of the formula Phe-Val-Pro-Ile-Phe-Thr-Tyr-Gly-Glu-Leu-Gln-Arg-Leu-Gln-Glu-Lys-Glu-Arg-Asn-Lys-Gly-Gln-Y

wherein Y is selected from the group consisting of homoserine and homoserine-lactone.

9. A method for inducing contraction of the intestinal canal, comprising administering to a patient in need of such treatment an effective amount of a motilin analogue of the formula: B.sub.1 -Z.sub.1 -A.sub.1 -Z.sub.2 -B.sub.2 -Thr-B.sub.3 -A.sub.2 -Glu-Z.sub.3 -C-Arg-Leu-Gln-Glu- Lys-Glu-Arg-D-Lys-Gly-E-Y

wherein B.sub.1, B.sub.2 and B.sub.3 are selected from the group consisting of Phe and Tyr; Z.sub.1, Z.sub.2 and Z.sub.3 are selected from the group consisting of Val, Leu and Ile; A.sub.1 and A.sub.2 are selected from the group consisting of Pro, Gly, Ser and Asn; C is selected from the group consisting of Gln, Glu and Asp; D is selected from the group consisting of Asn, Glu and Asp; E is selected from the group consisting of Gln, Arg and Lys; and Y is selected from the group consisting of homoserine, homoserine-lactone, or a salt thereof,

in association with a nontoxic pharmaceutical carrier or excipient.

10. The method according to claim 9, wherein said motilin analogue is a compound of the formula Phe-Val-Pro-Ile-Phe-Thr-Tyr-Gly-Glu-Leu-Gln-Arg-Leu-Gln-Glu-Lys-Glu-Arg-Asn-Lys-Gly-Gln-Y

wherein Y is selected from the group consisting of homoserine and homoserine-lactone.