Muscle-specific expression vectors

Information

  • Patent Application
  • 20030100526
  • Publication Number
    20030100526
  • Date Filed
    May 24, 2002
    24 years ago
  • Date Published
    May 29, 2003
    23 years ago
Abstract
The invention is directed to novel combinations of muscle-specific enhancer and promoter elements useful for achieving persistent expression in the muscle or myocytes. The muscle-specific promoter elements are derived from a muscle creatine kinase promoter, a troponin I promoter, a skeletal alpha-actin promoter, or a desmin promoter. The muscle-specific enhancer elements are derived from either troponin I internal regulatory elements, muscle creatine kinase enhancers, or desmin enhancers.
Description


DESCRIPTION OF THE INVENTION

[0002] 1. Field of the Invention


[0003] This invention relates to gene therapy methods utilizing tissue-specific expression vectors. The invention further relates to expression vectors used for delivery of a transgene into the muscle. More specifically, the invention relates to transcriptional regulatory elements that provide for enhanced and sustained expression of a transgene in the muscle.


[0004] 2. Background of the Invention


[0005] Gene therapy is the intracellular delivery of exogenous genetic material that corrects an existing defect or provides a new beneficial function to the cells. The muscle is an important target tissue for gene therapy because of its ready accessibility for direct injection, a relatively easy and minimally invasive method. Additionally, the muscle permits greater expression persistence compared to tissues with a higher cellular turnover rate. Skeletal muscle, for example, is being explored as a target tissue for gene therapy in a variety of therapeutic applications. There are a large number of known diseases caused by defects in gene products that could benefit from production of a protein secreted by the muscle. Familial hypercholesterolemia, hemophilia, Gaucher's and Fabry diseases, and type 11 diabetes are just a few examples. Many such diseases may be amenable to gene therapy (Siatskas et al., J. Inherit. Metab. Dis. 2001, 24(Suppl. 2): 25-41; Barranger et al., Expert Opin. Biol. Ther. 2001, 1(5): 857-867; Barranger et al., Neurochem. Res. 1999, 24(5): 601-615).


[0006] Various expression vectors have been developed to deliver exogenous genetic material into various tissues and organs, and muscle tissue, in particular. For a review, see Gene Expression Systems, Eds. J. M. Fernandez and J. P. Hoeffler, Academic Press, San Diego, Calif., 1999. Generally, each expression system possesses certain disadvantages and obtaining desired levels of expression in vivo in a sustainable manner can be a challenge.


[0007] For example, the nucleic acid of retroviral vectors is capable of integrating into the host genome, which results in sustained expression of the transgene carried by the vector. However, the infectivity of retroviral vectors depends on on-going cell proliferation. As a consequence, in vivo delivery of these vectors can be poor. On the other hand, when adenoviral gene transfer vectors are delivered by systemic injection, high levels of transgene expression are observed (Rosefeld et al., Science 1991, 252: 431-434), but such expression can be transient and may require repeated injections. A neutralizing host immune response can further limit the effectiveness of viral vectors (Yang et al., Proc. Natl. Acad. Sci. U.S. A. 1994, 91: 4407-4411; Kozarsky et al., J. Biol. Chem. 1994, 269: 13695-13702). Non-viral gene transfer methods, such as injection of naked plasmid DNA, have also been described but the levels of gene transfer are generally too low to be sufficient for clinical applications (Malone et al., J. Biol. Chem. 1994, 269: 29903-29907; Hickman et al., Hum. Gene Ther. 1994, 5:1477-1483).


[0008] Although the muscle is highly vascularized, secretion of transgene products into the circulation can be somewhat poor. In addition to low secretion, the potentially low levels of transgene expression from muscle-specific vectors can limit the scope of gene therapy applications to those requiring low levels of circulating therapeutic proteins. Another challenge for gene therapy can be delivering the agent to a selected tissue in highly targeted manner. Effective transfection of a large and distributed tissue such as muscle usually necessitates systemic delivery. However, most known expression vectors, viral and non-viral, have potentially adverse side effects associated with ectopic expression following systemic administration. Tissue-specific expression can overcome this problem. Tissue-specific expression can be achieved through the use of transcriptional regulatory elements such as promoters and enhancers that are active only in the target tissue.


[0009] Accordingly, a primary object of the invention is to provide expression vectors optimized for sustained expression of a transgene in muscle tissue. Another object of this invention is to provide enhancer/promoter combinations that can direct sustained and appropriate expression levels in various expression systems.


[0010] These objects are achieved by combining minimal sequences from muscle-specific promoters and muscle-specific enhancers to create chimeric regulatory elements that drive transcription of a transgene in a sustained fashion. The resulting chimeric regulatory elements are useful for gene therapy directed at transgene expression in the muscle as well as other applications requiring long-term expression of exogenous proteins in transfected muscle cells such as myocytes. The various muscle-specific enhancer/promoter combinations of the invention may be useful in the context of adenoviral, adeno-associated viral (MV), retroviral, and plasmid-based vectors for gene expression in cultured cells or in vivo.



SUMMARY OF THE INVENTION

[0011] Chimeric regulatory elements useful for targeting transgene expression to the muscle are provided by the invention. The chimeric regulatory elements of the invention comprise combinations of muscle-specific promoters and muscle-specific enhancers that are able to direct sustained transgene expression preferentially in the muscle.


[0012] The present invention is also directed to recombinant transgenes which comprise one or more operably linked tissue-specific regulatory elements of the invention. The tissue-specific regulatory elements, including muscle-specific promoter and enhancers, operably linked to a transgene drive its expression in myocytes and, in particular, in cardiomyocytes. The transgenes may be inserted in recombinant viral vectors for targeting expression of the associated coding DNA sequences in muscle. Muscle-specific promoters useful in the invention include mammalian muscle creatine kinase (MCK) promoter or mammalian desmin (DES) promoter. Alternatively, the promoter element is selected from the group consisting of mammalian MCK promoter, mammalian troponin I (TNNI2) promoter or mammalian skeletal alpha-actin (ASKA) promoter. In one particular embodiment, the promoter is a human promoter. In another embodiment, the promoter is a murine promoter. In certain embodiments, the promoter is truncated.


[0013] Tissue-specific enhancers useful in the present invention are selected from the group consisting of mammalian MCK enhancer, mammalian DES enhancer, and vertebrate troponin I IRE (TNI IRE, hereinafter referred to as FIRE) enhancer. In one embodiment, the enhancer is mammalian MCK enhancer or mammalian desmin (DE, hereinafter referred to as DES) enhancer. In another embodiment, the enhancer is mammalian DES enhancer or vertebrate FIRE enhancer. One or more of these muscle-specific enhancer elements may be used in combination with a muscle-specific promoter of the invention to provide a tissue-specific regulatory element. In one embodiment, the enhancers are derived from human or mouse. In another embodiment, the FIRE enhancer is an avian enhancer. In one embodiment, the FIRE promoter is a quail promoter. In certain embodiments, the enhancer/enhancer or enhancer/promoter combinations are heterologous, i.e., derived from more than one species. In other embodiments, the enhancers and promoters are derived from the same species. In certain embodiments, enhancer elements are truncated.


[0014] In a particular embodiment, a regulatory element of the invention comprises at least one MCK enhancer operably linked with a DES promoter. In a related embodiment, the regulatory element additionally comprises at least one FIRE enhancer, and optionally, at least one DES enhancer. In another embodiment, a regulatory element of the invention comprises at least two MCK enhancers linked to a MCK promoter or a DES promoter. In yet another embodiment, a regulatory element comprises at least two DES enhancers linked to a DES promoter.


[0015] The invention includes vectors comprising a regulatory element of the invention. In some embodiments, the regulatory element is incorporated in non-viral plasmid-based vectors. In other exemplary embodiments, a regulatory element of the invention is incorporated into a viral vector such as one derived from adenoviruses, adeno-associated viruses (AAV), or retroviruses, including lentiviruses such as the human immunodeficiency (HIV) virus. The invention also encompasses methods of transfecting muscle tissue where such methods utilize the vectors of the invention.


[0016] The invention further includes cells transfected with the nucleic acid containing an enhancer/promoter combination of the invention.


[0017] Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.


[0018] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.







BRIEF DESCRIPTION OF THE FIGURES

[0019]
FIG. 1 is a diagram representing levels of secreted alkaline phosphatase (SEAP) in the serum after intramuscular injection with test plasmids, comprising various enhancer/promoter combinations. Five mice per test plasmid were used. The amounts of serum SEAP measured at 3 days post-injection are represented as a percentage of the control group injected with a plasmid containing human cytomegalovirus (CMV) promoter and enhancer elements. Test plasmids are denoted as per Table 1.


[0020]
FIG. 2 depicts a graph illustrating the expression levels of serum SEAP for up to 3 weeks following systemic administration of plasmids comprising various enhancer/promoter combinations. Serum SEAP levels were measured at 3, 7, and 21 days post administration. Five rats per test plasmid were used. Test plasmids are denoted as per Table 1.







DETAILED DESCRIPTION OF THE INVENTION

[0021] The term “muscle-specific” is used, where appropriate, interchangeably with “tissue-specific” or “tissue-preferential” and refers to the capability of regulatory elements, such as promoters and enhancers, to drive expression of transgenes exclusively or preferentially in muscle tissue or muscle cells regardless of their source.


[0022] The term “myocyte,” as used herein, refers a cell that has been differentiated from a progenitor myoblast such that it is capable of expressing muscle-specific phenotype under appropriate conditions. Terminally differentiated myocytes fuse with one another to form myotubes, a major constituent of muscle fibers. The term “myocyte” also refers to myocytes that are de-differentiated. The term includes cells in vivo and cells cultured ex vivo regardless of whether such cells are primary or passaged.


[0023] The term “stringent conditions” in the context of nucleic acid hybridization is intended to describe conditions of incubation and washes under which oligonucleotides that have significantly identical or homologous sequences can hybridize, i.e., complementarily bind. The conditions are selected such that sequences that are at least 20 nucleotides long and at least about 70% identical can be hybridized. Stringent conditions are well known in the art and their examples can be found in Current Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons, Inc. 1995, and in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Press 1989. Percent identity between two sequences is determined using Basic Local Alignment Tool (BLAST) as described in Altshul et al., J. Mol. Biol. 1990, 215: 403-410.


[0024] The term “transgene” is used interchangeably with “inserted gene,” or “expressed gene” and, where appropriate, “gene.” “Transgene” refers to a polynucleotide that, when introduced into a cell, is capable of being transcribed under appropriate conditions so as to confer a beneficial property to the cell such as, for example, expression of a therapeutically useful protein. Where appropriate, the term “transgene” should be understood to include a combination of a coding sequence and optional non-coding regulatory sequences, such as a polyadenylation signal, a promoter, an enhancer, a repressor, etc.


[0025] The term “transfection” is used interchangeably with the terms “gene transfer,” “transformation,” and “transduction,” and means the intracellular introduction of a polynucleotide. “Transfection efficiency” refers to the relative amount of the transgene taken up by the cells subjected to transfection. In practice, transfection efficiency is estimated by the amount of the reporter gene product expressed following the transfection procedure.


[0026] The term “transfection agent,” as used herein, describes substances that may facilitate the transfer of the polynucleotide across the cell wall.


[0027] The term “vector” is used interchangeably with “transgene delivery vector,” “expression vector,” “expression module,” “expression cassette,” “expression construct,” and, where appropriate, “nucleic acid of the invention.” “Vector” refers to viral or non-viral, prokaryotic or eukaryotic, DNA or RNA sequences that are capable of being transfected into a cell, referred to as “host cell,” so that all or a part of the sequences is transcribed. It is not necessary for the transcript to be expressed. It is also not necessary for a vector to comprise a transgene having a coding sequence. Vectors are frequently assembled as composites of elements derived from different viral, bacterial, or mammalian genes. Vectors contain various coding and non-coding sequences, such as sequences coding for selectable markers, sequences that facilitate their propagation in bacteria, or one or more transcription units that are expressed only in certain cell types. For example, mammalian expression, vectors often contain both prokaryotic sequences that facilitate the propagation of the vector in bacteria and one or more eukaryotic transcription units that are expressed only in eukaryotic cells. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc.


[0028] The term “promoter” is used interchangeably with “promoter element” and “promoter sequence.” Likewise, the term “enhancer” is used interchangeably with “enhancer element” and “enhancer sequence.” “Promoter” refers to a minimal sequence of a transgene that is sufficient to initiate transcription of a coding sequence of the transgene. Promoters may be constitutive or inducible. A constitutive promoter is considered to be a strong promoter if it drives expression of a transgene at a level comparable to that of the cytomegalovirus promoter (CMV) (Boshart et al., Cell 1985, 41: 521). Promoters may be coupled with other regulatory sequences/elements which, when bound to appropriate intracellular regulatory factors, enhance (“enhancers”) or repress (“repressors”) promoter-dependent transcription. A promoter, enhancer, or repressor, is said to be “operably linked” to a transgene when such element(s) control(s) or affect(s) transgene transcription rate or efficiency. For example, a promoter sequence located proximally to the 5′ end of a transgene coding sequence is usually operably linked with the transgene. As used herein, term “regulatory elements” is used interchangeably with “regulatory sequences” and refers to promoters, enhancers, and other expression control elements, or any combination of such elements.


[0029] Promoters are positioned 5′ (upstream) to the genes that they control. Many eukaryotic promoters contain two types of recognition sequences: TATA box and the upstream promoter elements. The TATA box, located 25-30 bp upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase II to begin RNA synthesis as the correct site. In contrast, the upstream promoter elements determine the rate at which transcription is initiated. These elements can act regardless of their orientation, but they must be located within 100 to 200 bp upstream of the TATA box.


[0030] Enhancer elements can stimulate transcription up to 1000-fold from linked homologous or heterologous promoters. Enhancer elements often remain active even if their orientation is reversed (Li et al., J. Bio. Chem. 1990, 266: 6562-6570). Furthermore, unlike promoter elements, enhancers can be active when placed downstream from the transcription initiation site, e.g., within an intron, or even at a considerable distance from the promoter (Yutzey et al., Mol. and Cell. Bio. 1989, 9:1397-1405).


[0031] As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the positioning of regulatory elements with respect to the transgene may vary significantly without loss of function. Multiple copies of regulatory elements can act in concert. Typically, an expression vector comprises one or more enhancer sequences followed by, in the 5′ to 3′ direction, a promoter sequence, all operably linked to a transgene followed by a polyadenylation sequence.


[0032] Many enhancers of cellular genes work exclusively in a particular tissue or cell type. In addition, some enhancers become active only under specific conditions that are generated by the presence of an inducer such as a hormone or metal ion. Because of these differences in the specificities of cellular enhancers, the choice of promoter and enhancer elements to be incorporated into an eukaryotic expression vector is determined by the cell type(s) in which the recombinant gene is to be expressed.


[0033] Enhancer elements derived from viruses generally have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is promiscuously active in many cell types derived from a variety of mammalian species, and vectors incorporating this enhancer have constitutively been widely used (Dijkema et al., EMBO J. 1985, 4: 761). Two other enhancer/promoter combinations that are active in a broad range of cells are derived from long terminal repeat (LTR) of the Rous sarcoma virus genome (Gorman et al. Proc. Natl. Sci. U.S. A. 1982, 79: 6777) and from CMV (Boshart et al., Cell 1985, 41: 521)


[0034] The regulatory elements may be heterologous with regard to each other or to a transgene, that is, they may be from different species. Furthermore, they may be from species other than the host. They also may be derived from the same species but from different genes. Alternatively, they may be derived from a single gene.


[0035] Desmin Regulatory Elements


[0036] Desmin is a muscle-specific cytoskeletal protein that belongs to the family of intermediate filaments that occur at the periphery of the Z disk and may act to keep adjacent myofibrils in lateral alignment. The expression of various intermediate filaments is regulated developmentally and shows tissue specificity. Vimentin, for example, is expressed in all mesenchymal derivatives as well as in the progenitors of muscle and neural tissue; keratin, in epithelial cells; glial fibrillary acidic protein, in glial cells; and neurofilament, in neural cells. Desmin, on the other hand, is expressed exclusively in smooth skeletal muscle.


[0037] Comparison of transient expression of chloramphenicol acetyltransferase (CAT) under the control of desmin upstream regulatory sequences (between nucleotides (nt) −2255 and +75 relative to the transcriptional start site) in differentiated and undifferentiated myogenic and non-myogenic cells, reveals that the human desmin promoter region, between nt −228 and +1, is sufficient for low level expression in myotubes and myoblasts, but not fibroblasts or HeLa cells (Li et al., J. Bio. Chem. 1990, 266: 6562-6570). The same transcription start region is used in different, desmin positive organs, implying that the same promoter is active in skeletal muscle, in heart and in smooth muscle cells of different origins (van Groningen et al., Biochim. Biophys. Acta 1994,1217: 107-109). Thus, this promoter is muscle-specific. The promoter sequence of mouse, human, hamster, and rat desmin is greatly conserved, therefore, it is expected that homologues derived from various mammalian species will have similar activity.


[0038] A human desmin (DES) promoter was obtained by cloning of the 5′ flanking region from nt −2194 to +1 into pCR-Blunt II-TOPO (Invitrogen, Carlsbad, Calif.) using the following primers:
1(SEQ ID NO:1)5′primer:GTTGAATTCA CATATTGACC TCTCTTTCTTCCTACTCCCC(SEQ ID NO:2)3′primer:GGTAGATCTA AGCCGGTCCT TGTTCGGCACTATTTGTATC CCCTCCTGAC AT


[0039] Subsequently, the desmin promoter was truncated at the Pst I site (−228). The sequence of the truncated DES promoter is provided in SEQ ID NO:19.


[0040] A 280-bp enhancer located between nt −973 and −693 of the human sequence contains several sequences homologous to other muscle-specific enhancers. Unlike other muscle-specific enhancers, the desmin (DES) enhancer can function in myoblasts as well as myotubes. The DES enhancer contains two different regions, one is active in differentiated myotubes, between nt −973 and −848, the other is active in undifferentiated myoblasts, between nt −847 and −693. Deletion of the region between nt −1738 and −693 results in a more than 20-fold decrease in expression of a linked CAT gene in differentiated muscle cells and 8-fold decrease in undifferentiated myoblasts. This 280-bp enhancer is independent of orientation, position, and distance, and can activate either the desmin promoter or heterologous promoters, such as HSV tk and human vimentin, at about 14- to 50-fold in C2.7 myotubes, and 9- to 16-fold in C2.7 myoblasts (Li et al., J. Bio. Chem. 1990, 266: 6562-6570).


[0041] The sequence of human muscle-specific 243 bp DES enhancer (-973 to −731) is provided in SEQ ID NO:21. The enhancer was amplified using the following primers:
2(SEQ ID NO:3)5′primer:GGTACTAGTC CTGCCCCCAC AGCTCCTCTC(SEQ ID NO:4)3′primer:GGTCGTACGA ATTGCTAGCA CAGACTTTGTGTGGCTCCTG CCC


[0042] Muscle Creatine Kinase Regulatory Elements


[0043] The muscle creatine kinase (MCK) gene is highly active in all striated muscles. Creatine kinase plays an important role in the regeneration of ATP within contractile and ion transport systems. It allows for muscle contraction when neither glycolysis nor respiration is present by transferring a phosphate group from phosphocreatine to ADP to form ATP. There are four known isoforms of creatine kinase: brain creatine kinase (CKB), muscle creatine kinase (MCK), and two mitochondrial forms (CKMi). MCK is the most abundant non-mitochondrial mRNA that is expressed in all skeletal muscle fiber types and is also highly active in cardiac muscle. The MCK gene is not expressed in myoblasts, but becomes transcriptionally activate when myoblasts commit to terminal differentiation into myocytes. MCK gene regulatory regions display striated muscle-specific activity and have been extensively characterized in vivo and in vitro. The major known regulatory regions in the MCK gene include a muscle-specific enhancer located approximately 1.1 kb 5′ of the transcriptional start site in mouse and a 358-bp proximal promoter. Additional sequences that modulate MCK expression are distributed over 3.3 kb region 5′ of the transcriptional start site and in the 3.3-kb first intron. Mammalian MCK regulatory elements, including human and mouse promoter and enhancer elements are described in Hauser et al., Mol. Therapy 2000, 2:16-25.


[0044] The mouse MCK promoter (−496 to +37) proved difficult to amplify and, as a result, the promoter was generated in three steps. In the first step, primer pairs MCK S7-MCK S11 were used to amplify a 485 bp product. In the second step, primer pairs MCK S9-MCK S12 were used to amplify a 189 bp product. In the third step, the two products were joined with MCK S11-MCK S12 primers to amplify the 533 bp promoter.
3S7:ACCCTGAACC CAGGCATGC(SEQ ID NO:5)S9:GCATGCCTGG GTTCAGGT(SEQ ID NO:6)S11:CCCTGAGTTT GAATCTC(SEQ ID NO:7)S12:AAGGGGGGCT GTCTGTA(SEQ ID NO:8)


[0045] The sequence of the MCK promoter is provided in SEQ ID NO:18.


[0046] The muscle-specific 206 bp mouse MCK enhancer (−1256 to −1051) was amplified using the following primers:
4(SEQ ID NO:9)5′primer:GGGACTAGTC CACTACGGTC TAGGCTGCCC ATG(SEQ ID NO:10)3′primer:GGGCGTACGA TTGGTGCTAG CATCCACCAGGGACAGGGT TATTTTTAGA G


[0047] The sequence of the MCK enhancer is provided in SEQ ID NO:20.


[0048] Troponin I Regulatory Elements


[0049] The heterodimeric troponin complex is located on the thin filament of striated muscle and acts as a calcium-sensitive molecular switch regulating contraction. It is composed of three subunits. Troponin I (TnI) is the inhibitory subunit of a protein complex involved in calcium mediated regulation of acto-myosin ATPase during skeletal muscle contraction. There are three known isoforms: slow skeletal muscle troponin I (TNNI1), fast skeletal muscle troponin I (TNNI2), and cardiac muscle troponin I (TNNI3). Previous studies have demonstrated that the quail TnI gene, when introduced into mouse multipotential cell or into a determined myogenic cell line, exhibits a correct myofiber-specific expression pattern, including the appropriate timing, specificity, and transcription level. In addition, TnI genes introduced into a transgenic mice exhibit normal developmental and tissue-specific pattern.


[0050] In quail, TnI promoter (TNNI2) is located within nt −530 and +60. In human, the promoter sequence is located within nt −146 to +19. The sequence of the TNI2 promoter is provided in SEQ ID NO:23. The human TNI2 promoter was amplified using the following primers:
5(SEQ ID NO:24)5′primer:GTTGAATTCG CGGCCAGGCC AGGCGGCCGG ACA(SEQ ID NO:25)3′primer:GTTGGATCCA GGCCGGCAGC GGCGAGTTGG


[0051] An important regulatory enhancer has been identified within the intron of the quail TnI gene (Yutzey et al., Mol. and Cell. Bio. 1989, 9: 1397-1405). This region, referred to as FIRE (fast internal regulatory element), extends from nt+643 to +781 and has been shown to contain at least four regulatory elements including E-box, a MEF-2 like sequence, a CCAC box and a CAGG sequence (Nakayama et al., Mol. Cell. Bio. 1996, 16: 2408-2417). The FIRE enhancer is position- and orientation-independent and is known to confer a muscle-specific expression pattern on a series of heterologous promoters, whereas the quail TnI promoter region (−530 to +60) alone cannot elicit muscle specific expression in the absence of FIRE. Thus, tissue specificity of expression can be controlled by FIRE.


[0052] The 139 bp quail FIRE enhancer was assembled by annealing a series of synthesized oligonucleotides (Fire 1-Fire 5) as follows:
6(SEQ ID NO:11)Fire 1:GTTACTAGTC CTGGCTGCGT CTGAGGAGACAGCTGCAGCT CCTTGTGCAG CTCCCCAGC(SEQ ID NO:12)Fire 2:GGGTGGGGGG GGAAAGTGCTT CTAAAAATGGCTGGGGAGCT GCACAAGGAG CTGCAGCTGTCTCCTCAGAC G(SEQ ID NO:13)Fire 3:CATTTTTAGA AGCACTTTCC CCCCCCACCCCCTTGCTCTT CCCAGCAATG TGTTGTGCCT(SEQ ID NO:14)Fire 4:GGTCGTACGG GTAAGCTAGC CAAGCTCCCTGAGGAAACCT TATCCTGGAA AATGTGCAGGCACAACACAT TGCTGGGAAG AGCAAGG(SEQ ID NO:15)Fire 5:GCACATTTTC CAGGATAAGG TTTCCTCAGGGAGCTTGGCT AGCTTACCCG TACGACC


[0053] The sequence of the avian FIRE enhancer is represented in SEQ ID NO:22.


[0054] Skeletal Alpha-Actin Regulatory Elements


[0055] The actin multigene family is an abundant protein that polymerizes to form microfilaments which, in turn, play an important role in the maintenance of cell shape, division, and motility. There are at least six actin isoforms in vertebrates: skeletal-alpha actin (SkA) and cardiac alpha-actin are expressed in striated muscle, vascular alpha-actin and enteric gamma-actin are expressed in smooth muscle, and cytoplasmic beta- and gamma-actin are expressed in non-muscle cells. SkA is co-expressed with cardiac alpha-actin in many of the same embryonic tissues. It is up-regulated in fetal myocardium and fetal ventricle, and down-regulated during post-natal development in these tissues. In adult skeletal muscle, SkA is the dominant isoform. The coding sequences of the actin genes are highly conserved during evolution (Alonso et al., J. Mol. Evol. 1987,194: 193-206), however, the 5′ and 3′ UTRs are not highly conserved between different actin isoforms therefore these regions may generally provide isotype-specific probes. Several 5′ flanking regions of the SkA gene have been evolutionarily conserved, e.g., in human, mouse, rat, and chicken. There is about 73% similarity of human and rodent sequences within the 250 nt of 5′ flanking region (Taylor et al., Genomics 1988, 3: 323-336).


[0056] Results of transfection experiments have demonstrated that sequences upstream of the transcription start site of the rat (Melloul et al., EMBO 1984, 3: 983-990) and chicken (Grichnick et al., Nucleic Acid Res. 1986, 14: 1683-1701) SkA genes were sufficient for both stage- and tissue-specific expression. The proximal region (−153 to −87) of the SkA gene promoter is essential for modulating the increased transcription of the gene during myogenesis in L8 cells.


[0057] The sequence of the human alpha-skeletal actin (ASKA) promoter (−481 to +34) is provided in SEQ ID NO:23. The promoter was amplified using the following primers:
7(SEQ ID NO:16)5′primer:GGTGAATTCA AGTGGGAGTT TGGGGATCTG(SEQ ID NO:17)3′primer:ATTAGGATCC AAGCGAGGCT TCACTTGGCG


[0058] Chimeric Regulatory Elements


[0059] The present invention is directed to recombinant transgenes which comprise one or more of the tissue-specific regulatory elements described above. The chimeric tissue-specific regulatory elements of the invention drive transgene expression in myocytes, and, in particular, in cardiomyocytes. The transgenes may be inserted in recombinant viral or non-viral vectors for targeting expression of the associated coding DNA sequences in muscle. In one embodiment, the promoter element is selected from the group consisting of mammalian muscle creatine kinase (MCK) promoter and mammalian (DES) desmin promoter. Alternatively, the promoter element is selected from the group consisting of mammalian MCK promoter, mammalian troponin I (TNNI2) promoter, and mammalian skeletal alpha-actin (ASKA) promoter. In one particular embodiment, the promoter is a human promoter. In another embodiment, the promoter is a murine promoter. In certain embodiments, the promoter is truncated.


[0060] The tissue-specific regulatory elements of this invention include at least one enhancer selected from the group consisting of mammalian MCK enhancer, mammalian DES (also known as DE) enhancer, and vertebrate troponin I IRE (FIRE, also known as TNI IRE) enhancer. One or more of these muscle-specific enhancer elements may be used in combination with a promoter element of the invention. In one embodiment, enhancers are derived from human or mouse. In another embodiment FIRE enhancer is an avian enhancer. In a particular embodiment, the FIRE promoter is a quail promoter. In certain embodiments, the enhancer/enhancer or enhancer/promoter combinations are heterologous, i.e., the elements derived from more that one species. In others, they are derived from the same species. In certain embodiments, enhancer elements are truncated so that binding sites for known transcriptional repressors have been deleted.


[0061] In a particular embodiment, a regulatory element of the invention comprises at least one MCK enhancer operably linked with a DES promoter. In another embodiment, the regulatory element additionally comprises at least one FIRE enhancer, and optionally, at least one DES enhancer. In another embodiment, the regulatory element comprises at least two MCK enhancers linked to a MCK promoter or a DES promoter. In yet another embodiment, a regulatory element comprises at least two DES enhancers linked to a DES promoter.


[0062] It will be understood that the regulatory elements of the invention are not limited to specific sequences referred to in the specification but also encompass their structural and functional analogs/homologues. Such analogs may contain truncations, deletions, insertions, as well as substitutions of one or more nucleotides introduced either by directed or by random mutagenesis. Truncations may be introduced to delete one or more binding sites for known transcriptional repressors. Additionally, such sequences may be derived from sequences naturally found in nature that exhibit a high degree of identity to the sequences in the invention. A nucleic acid of 20 nt or more will be considered to have high degree of identity to a promoter/enhancer sequence of the invention if it hybridizes to such promoter/enhancer sequence under stringent conditions. Alternatively, a nucleic acid will be considered to have a high degree of identity to a promoter/enhancer sequence of the invention if it comprises a contiguous sequence of at least 20 nt, which has percent identity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more as determined by standard alignment algorithms such as, for example, Basic Local Alignment Tool (BLAST) described in Altshul et al., J. Mol. Biol. 1990, 215: 403-410, the algorithm of Needleman et al., J. Mol. Biol. 1970, 48: 444-453, or the algorithm of Meyers et al., Comput. Appl. Biosci. 1988, 4: 11-17. Non-limiting examples of analogs, e.g., homologous promoters sequences and homologous enhancer sequences derived from various species, are described in the present specification.


[0063] The invention further includes vectors, comprising a regulatory element of the invention. In general, there are no known limitations on the use of the regulatory elements of the invention in any vector. In some embodiments, the regulatory elements are incorporated in non-viral plasmid-based vectors. In other exemplary embodiments, a regulatory element of the invention is incorporated into a viral vector such as derived from adenoviruses, adeno-associated viruses (AAV), or retroviruses, including lentivirus such as the human immunodeficiency (HIV) virus.


[0064] In the present invention, the transgene may comprise a DNA sequence encoding proteins involved in metabolic diseases, or disorders and diseases of muscle system, muscle wasting, or muscle repair. Vectors of the invention may include a transgene containing a sequence coding for a therapeutic polypeptide. For gene therapy, such a transgene is selected based upon a desired therapeutic outcome. It may encode, for example, antibodies, hormones, enzymes, receptors, or other proteins of interest or their fragments, such as, for example, TGF-beta receptor, glucagon-like peptide 1, dystrophin, leptin, insulin, pre-proinsulin, follistatin, PTH, FSH, IGF, EGF, TGF-beta, bone morphogeneteic proteins, other tissue growth and regulatory factors, growth hormones, and blood coagulation factors. For example, in treatment of lysosomal storage disease, one may employ transgenes coding for enzymes such as glucocerebrosidase, alpha-galactosidase, beta-glucuronidase, alpha-Liduronidase, iduronate sulphatase, alpha-N-acetylgalactosaminidase, sphingomyelinase and alpha-glucosidase. In the treatment of familial hypercholesterolemia, for example, one may use a transgene encoding LDL receptor (Kobayashi et al., J. Biol. Chem. 271: 6852-6860).


[0065] The invention encompasses methods of transfecting the muscle tissue where such methods utilize the vectors of the invention. It will be understood that vectors of the invention are not limited by the type of the transfection agent in which to be administered to a subject or by the method of administration. Transfection agents may contain compounds that reduce the electrostatic charge of the cell surface and the polynucleotide itself, or increase the permeability of the cell wall. Examples include cationic liposomes, calcium phosphate, polylysine, vascular endothelial growth factor (VEGF), etc. Hypertonic solutions containing, for example, NaCl, sugars, or polyols, can also be used to increase the extracellular osmotic pressure thereby increasing transfection efficiency. Transfection agent may also include enzymes such as proteases and lipases, mild detergents and other compounds that increase permeability of cell membranes. The methods of the invention are not limited to any particular composition of the transfection agent and can be practiced with any suitable agent so long as it is not toxic to the subject or its toxicity is within acceptable limits. Non-limiting examples of suitable transfection agents are given in this specification.


[0066] The invention also includes cells transfected with the DNA containing an enhancer/promoter combination of the invention. Standard methods for transfecting cell with isolated nucleic acid are well known to those skilled in art. Transfected cells may be used, for example, to confirm the identity of a transgene; to study biosynthesis and intracellular transport of proteins encoded by transgenes; or to culture cells ex vivo for subsequent re-implantation into a subject, etc. Methods for in vivo intramuscular injection and transfection of myocytes ex vivo are known in the art. For example, see Shah et al., Transplantation 1999, 31: 641-642; Daly et al., Human Gene Therapy 1999, 10: 85-94.


[0067] Host cells that can be used with the vectors of invention are myocytes found in all muscle types, e.g., skeletal muscle, cardiac muscle, smooth muscle, etc. Myocytes are found and can be isolated from any vertebrate species, including, without limitation, human, orangutan, monkey, chimpanzee, dog, cat, rat, rabbit, mouse, horse, cow, pig, elephant, etc. Alternatively, the host cell can be a prokaryotic cell, e.g., a bacterial cell such as E. coli, that is used, for example, to propagate the vectors.


[0068] It may be desirable in certain circumstances to utilize myocyte progenitor cells such as mesenchymal precursor cells or myoblasts rather than fully differentiated myoblasts. Examples of tissue from which such cells can be isolated include placenta, umbilical cord, bone marrow, skin, muscle, periosteum, or perichondrium. Myocytes can be derived from such cells, for example, by inducing their differentiation in tissue culture. The present invention encompasses not only myocyte precursor/progenitor cells, but also cells that can be trans-differentiated into myocytes, e.g., adipocytes and fibroblasts.


[0069] It may also be desirable to inject vectors of this invention containing a therapeutic transgene into an embryo so that the expression of transgene is suppressed until some stage in development when myocytes have been differentiated. See, e.g., Gene Expression Systems, Eds. J. M. Fernandez and J. P. Hoeffler, Academic Press, San Diego, Calif., 1999.


[0070] Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. While the representative experiments are performed in test animals, similar results are expected in humans. The exact parameters to be used for injections in humans can be easily determined by a person skilled in the art.



EXAMPLES


Example 1


Vector Construction

[0071] Restriction enzymes, T4 DNA ligase, DNA polymerase I and large fragment (Klenow) were purchased from New England BioLabs (Beverly, Mass.).


[0072] Mouse and human genomic DNA was obtained from Clontech (Palo Alto, Calif.). PCR-amplification of regulatory elements from genomic DNA was performed with VentR® DNA polymerase (New England BioLabs, Beverly, Mass.) using primers as indicated in the Detailed Description of Invention as follows: 1 cycle of 4 min at 94° C., 2 min at 45° C., and 5 min at 68° C. with 34 cycles of 1 min at 94° C., 2 min at 55° C., and 5 min at 68° C. SV72 enhancer element containing a 72-bp repeat from the simian virus 40 (SV40) enhancer is described in Li et al., Gene Therapy 2001, 8: 494-497. DNA restriction fragments to be cloned into phagemid or plasmid vectors were isolated from agarose gels using DEAE paper and cloned as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989.


[0073] Multiple copies of various enhancers were cloned between the Spe I and BsiW I sites in Litmus 28™ (New England BioLabs, Beverly, Mass.) using standard recombinant DNA methods. Human alpha skeletal actin promoter (ASKA; −481 to +34) and human troponin promoter (TNN12; −146 to +19) were cloned between the EcoR I and BamH I site in Litmus 28™ while the human muscle creatine kinase promoter (MCK; −496 to +37) and human desmin promoter (DES; −2194 to +1) were cloned into pCR-Blunt II-TOPO (Invitrogen, Carlsbad, Calif.). The desmin promoter was truncated at the Pst I (−228) site before adding enhancer combinations. Promoter and enhancer elements were sequenced to verify integrity.


[0074] Standard cloning techniques were used to introduce the muscle-specific promoter chimeras into the pCFA-HI-SEAP expression vector to generate muscle chimeras which direct transcription of the secreted alkaline phosphatase (SEAP) reporter gene. pCFA-HI-SEAP plasmid, also known as pCF1-SEAP, is described in Yew et al., Hum. Gen. Ther. 1997, 8: 575-584.


[0075] All plasmids were prepared using the Qiagen plasmid Maxi kit (Qiagen, Valencia, Calif.). Before injection into animals, the plasmids were extracted with Triton X-100® (Sigma-Aldrich, St. Louis, Mo.) to remove endotoxins.


[0076] The list of created plasmids is shown in Table 1, wherein “L28” stands for Litmus 28™; “HI” stands for hybrid intron (the sequence is described in MacGregor et al., Nucleic Acids Research 1989, 17: 2365); “>” stands for direct (5′→3′) orientation of an enhancer sequence; “<” stands for inverse (3′→5′) orientation of an enhancer sequence; and the number in parentheses stands for the number of enhancer elements inserted, or a nucleotide position of the promoter in the original gene, as appropriate.



Example 2


Short-Term Expression in Mice

[0077] BALB/C mice were injected with 50 μg test plasmid in 50 μl of phosphate-buffered saline (PBS) into the anterior tibialis. Five mice were used for each test plasmid or the control group. A plasmid containing a CMV promoter/enhancer (−1 to −522) as described in Li et al., Gene Therapy 2001, 8: 494-497, was used in the control animals.


[0078] The overall efficiency of transfection was evaluated by measuring the concentration of SEAP in the serum of animals. Blood was collected intraorbitally at 7 days post-injection. The serum was heated to 65° C. to denature endogenous alkaline phosphatase and assayed for SEAP activity per manufacturer's instructions using an alkaline phosphatase reagent from Sigma-Aldrich (St. Louis, Mo.) and human placental alkaline phosphatase from Calbiochem (LaJolla, Calif.) as a standard. The observed SEAP expression levels were normalized as a percentage of the CMV control.


[0079] SEAP expression levels of various promoter/enhancer chimeras, calculated as a mean of each group, are presented in FIG. 1. As is demonstrated in FIG. 1, truncated desmin promoter constructs DC-308, DC-309, DC-310, and DC-312 exhibited expression levels greater than one third of the CMV control. ASKA chimera DC-276 and MCK chimeras DC-300 and DC-301 expressed SEAP at about half the expression levels of the desmin promoter constructs, while others expressed at below than 10% of the CMV control.



Example 3


Long-Term Expression in Rats

[0080] To investigate persistence of expression in various enhancer/promoter combinations, Sprague Dawley rats were injected into iliac vein with 500 μg test plasmid in 500 μl of phosphate-buffered saline (PBS). Five rats were used for each test plasmid or a control group. A plasmid containing a CMV promoter/enhancer (−1 to −522) as described in Li et al., Gene Therapy 2001, 8: 494-497 was used in control animals. Blood was collected at 1, 7, and 21 days post-injection, and the serum was assayed for SEAP activity as described in Example 1.


[0081] Comparisons of SEAP expression levels among various promoter/enhancer chimeras were made. The SEAP expression levels, calculated as a mean of each group, are presented in FIG. 2 and, in a tabulated form, in Table 2. As is demonstrated, comparable SEAP expression levels to the CMV control were achieved by day 7 in all chimeras tested but, by day 21, DC-301 demonstrated the greatest expression persistence. With DC-308, DC-310, and DC-312, SEAP expression levels were slightly better in rats than in mice. The desmin or MCK enhancers linked to either the desmin or MCK promoters yielded good persistent expression. This is exemplified in FIG. 2 with the following constructs: DC-301, DC-308, DC-310, DC-317, DC-318, and DC-320.


[0082] The specification is most thoroughly understood in light of the teachings of the references cited within the specification, all of which are hereby incorporated by reference in their entirety. The embodiments within the specification provide an illustration of embodiments of the invention and should not be construed to limit the scope of the invention. The skilled artisan recognizes that many other embodiments are encompassed by the claimed invention and that it is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.
8TABLE 1List of Test PlasmidsDesignation ofConstructFeaturesDC-274L28 ASKA HI SEAPDC-275L28 FIRE(2) TNNI2 HI SEAPDC-276L28 MCK(2) ASKA HI SEAPDC-279L28 FIRE ASKA HI SEAPDC-280L28 FIRE(2) ASKA HI SEAPDC-281L28 TNNI2 HI SEAPDC-282L28 DES ASKA HI SEAPDC-285MCK(−496 to +37) HI SEAPDC-289L28 MCK(4) ASKA HI SEAPDC-290MCK(−496 to +37) HI FIRE(2) SEAPDC-291L28 MCK(2) DES ASKA HI SEAPDC-292>DES(1) MCK(−496 to +37) HI SEAPDC-293<DES(1) MCK(−496 to +37) HI SEAPDC-300>MCK(2) MCK(−496 to +37) HI SEAPDC-301<MCK(2) MCK(−496 to +37) HI SEAPDC-305DES(−228) HI SEAPDC-306DES(−2194) HI SEAPDC-308DES(2) DES(−228) HI SEAPDC-309DES(4) DES(−228) HI SEAPDC-310MCK(2) DES(−228) HI SEAPDC-311MCK(4) DES(−228) HI SEAPDC-312FIRE(2) DES(−228) HI SEAPDC-313FIRE(4) DES(−228)DC-317MCK(2) FIRE(2) DES(−228) HI SEAPDC-318DES(2) MCK(2) DES(−228) HI SEAPDC-319FIRE(2) DES(2) DES(−228) HI SEAPDC-320DES(2) SV72 DES(−228) HI SEAPDC-321FIRE(2) SV72 DES(−228) HI SEAP


[0083]

9





TABLE 2










SEAP Expression (ng/ml) in rats as a function of time









Days post-injection












Construct
3
7
21
















DC-301
194.66
3944.17
1512.65



DC-308
1257.28
5070.39
491.83



DC-310
1053.40
4157.77
570.86



DC-312
1497.57
5803.4
5.42



DC-317
6864.08
6864.08
458.64



DC-318
1473.79
5538.83
566.39



DC-319
2679.61
9123.79
1.47



DC-320
1057.28
2694.17
717.59



DC-321
1215.53
6264.56
48.0



CMV HI SEAP
2133.98
8628.64
5.8











[0084]


Claims
  • 1. A recombinant muscle-specific regulatory element for gene expression, comprising: (a) a promoter element selected from the group consisting of the mammalian muscle creatine kinase (MCK) promoter and mammalian desmin (DES) promoter; and (b) at least one enhancer element selected from the group consisting of mammalian MCK enhancer, mammalian DES enhancer, and vertebrate troponin I IRE (FIRE) enhancer, wherein the promoter and enhancer elements are operably linked.
  • 2. The regulatory element of claim 1, wherein the promoter element is a human promoter.
  • 3. The regulatory element of claim 1, wherein the promoter element is murine.
  • 4. The regulatory element of claim 1, wherein the MCK promoter comprises the human MCK promoter of SEQ ID NO:18.
  • 5. The regulatory element of claim 1, wherein the DES promoter comprises the human DES promoter of SEQ ID NO:19.
  • 6. The regulatory element of claim 1, wherein the enhancer element is a human enhancer.
  • 7. The regulatory element of claim 1, wherein the enhancer element is a murine enhancer.
  • 8. The regulatory element of claim 1, wherein the MCK enhancer comprises the mouse MCK enhancer of SEQ ID NO:20.
  • 9. The regulatory element of claim 1, wherein the DES enhancer comprises the human DES enhancer of SEQ ID NO:21.
  • 10. The regulatory element of claim 1, wherein the FIRE enhancer is an avian enhancer.
  • 11. The regulatory element of claim 1, wherein the FIRE enhancer is a mammalian enhancer.
  • 12. The regulatory element of claim 1, wherein the FIRE enhancer is a human enhancer.
  • 13. The regulatory element of claim 1, wherein the FIRE enhancer comprises the quail troponin I enhancer of SEQ ID NO:22.
  • 14. The regulatory element of claim 1, wherein the promoter and enhancer elements are derived from the same species.
  • 15. The regulatory element of claim 1, wherein the promoter and enhancer elements are derived from different species.
  • 16. The regulatory element of claim 1, comprising at least one MCK enhancer and a DES promoter.
  • 17. The regulatory element of claim 1, comprising at least one MCK enhancer, at least one FIRE enhancer, and a DES promoter.
  • 18. The regulatory element of claim 1, comprising at least one MCK enhancer, at least one FIRE enhancer, at least one DES enhancer, and a DES promoter.
  • 19. The regulatory element of claim 1, comprising at least two MCK enhancers and an MCK promoter.
  • 20. The regulatory element of claim 1, comprising at least two MCK enhancers and a DES promoter.
  • 21. The regulatory element of claim 1, comprising at least two DES enhancers and a DES promoter.
  • 22. A vector, comprising the regulatory element according to claim 1.
  • 23. The vector as in claim 22, wherein the vector is selected from the group consisting of a plasmid and a viral vector.
  • 24. The vector as in claim 23, wherein the viral vector is derived from a virus selected from the group consisting of an adenovirus, an adeno-associated virus, and a retrovirus.
  • 25. The vector as in claim 24, wherein the retrovirus is a lentivirus.
  • 26. A method of expressing a gene in the muscle, wherein the muscle is transfected with the vector according to claim 22.
  • 27. A transfected host cell comprising the vector according to claim 22.
  • 28. The transfected host cell of claim 27, wherein the host cell is a prokaryotic cell.
  • 29. The transfected host cell of claim 27, wherein the host cell is mammalian cell.
  • 30. The transfected host cell of claim 27, wherein the host cell is a myocyte.
  • 31. A recombinant transgene useful for expression of a coding sequence, comprising a strong constitutive promoter and one or more muscle-specific enhancer elements, wherein the strong constitutive promoter is selected from the group consisting of mammalian MCK promoter, mammalian troponin I (TNNI2) promoter, and mammalian skeletal alpha-actin (ASKA) promoter and the muscle-specific enhancer is selected from the group consisting of mammalian troponin I internal regulatory elements (FIRE), mammalian muscle creatine kinase (MCK) enhancers, and mammalian desmin (DES) enhancers.
  • 32. A recombinant transgene according to claim 31, wherein the promoter is a truncated promoter from which one or more binding sites for known transcriptional repressors have been deleted.
  • 33. A vector, comprising the transgene of claim 31.
  • 34. The vector as in claim 33, wherein the vector is selected from the group consisting of a plasmid and a viral vector.
  • 35. The vector as in claim 33, wherein the viral vector is derived from a virus selected from an adenovirus, an adeno-associated virus, and a retrovirus.
  • 36. The vector as in claim 35, wherein the retrovirus is a lentivirus.
  • 37. A method of expressing a gene in the muscle, wherein the muscle is transfected with the vector according to claim 33.
  • 38. A transfected host cell comprising the vector according to claim 33.
  • 39. The transfected host cell of claim 38, wherein the host cell is a prokaryotic cell.
  • 40. The transfected host cell of claim 38, wherein the host cell is a mammalian cell.
  • 41. The transfected host cell of claim 38, wherein the host cell is a myocyte.
Parent Case Info

[0001] This application claims priority from U.S. provisional application No. 60/293,304 filed on May 24, 2001.

Provisional Applications (1)
Number Date Country
60293304 May 2001 US