MUTANTS OF CORYNEBACTERIUM GLUTAMICUM WITH EFFICIENT EXPRESSION OF EXOGENOUS PROTEINS AND METHOD OF USE THEREOF

Abstract

The present invention provides a mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins, which can solve the technical problem of low protein expression quantity when existing Corynebacterium glutamicum is used as an exogenous protein expression host. The mutant strain of Corynebacterium glutamicum is deposited in the China General Microbiological Culture Collection Center (CGMCC), and the deposit number is CGMCC No. 20138. The mutant strain of Corynebacterium glutamicum in the present invention, verified by the expression of exogenous proteins, showed significantly enhanced expression of both intracellular and secreted proteins when compared with its initial strain.

Description

CROSS-REFERENCES TO RELATED APPLICATIONS

This application claims priority from Chinese patent application number 202010859729.X filed on Aug. 24, 2020; the disclosure of which are incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

The present invention relates to a mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins and its application, which belongs to the field of bioengineering technology.

BACKGROUND OF THE INVENTION

Corynebacterium glutamicum is a gram-positive bacteria belonging to the Actinomycetales and the Corynebacterium. It is an important protein expression host. It has many advantages, such as endotoxin-free, high-density production and complete protein secretion system. At present, it has been used as a synthetic biological host cell to produce high value-added compounds and recombinant pharmaceutical proteins, such as glutamic acid and lysine. It is also used in food industry and animal feed production.

When Corynebacterium glutamicum serves as an exogenous protein expression host, the amount of protein expression is low. Therefore, it is necessary to perform mutagenesis screening for Corynebacterium glutamicum to make it more efficient in expression of the exogenous protein.

SUMMARY OF THE INVENTION

The present invention provides a mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins, which can solve the technical problem of low protein expression quantity when Corynebacterium glutamicum is used as an exogenous protein expression host.

The technical scheme is a mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins, which is deposited in the China General Microbiological Culture Collection Center (CGMCC), and the deposit number is CGMCC No. 20138.

Further, the mutant strain of Corynebacterium glutamicum is obtained by atmospheric and room temperature plasma (ARTP) mutagenesis and screening using Corynebacterium glutamicum with the deposited number of CGMCC1.15647 as an initial strain.

The present invention also provides a method of use of the above-mentioned mutant strain of Corynebacterium glutamicum for the expression of exogenous proteins.

Further, the exogenous protein is a single domain of heavy chain antibody or N-terminal pro-peptide of human procollagen type I.

Variable domain of heavy chin of heavy-chin antibody (VHH) is a single domain antibody composed of a heavy chain variable region. The heavy chain variable region is derived from a heavy chain antibody that naturally lacks the light chain in camel serum.

The mutant strain of Corynebacterium glutamicum in the present invention, verified by the expression of exogenous proteins, showed significantly enhanced expression of both intracellular and secreted proteins when compared with the initial strain.

Biological Deposit Instructions

• • Latin scientific name: Corynebacterium glutamicum
  • Deposited center: China General Microbiological Culture Collection Center
  • The abbreviation of the deposited center: CGMCC
  • The address of the deposited center: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Institute, Beichen West Road, Chaoyang District, Beijing.
  • The deposit date: Jun. 24, 2020
  • The deposit number: CGMCC NO. 20138

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a relationship between positive mutation rate, lethal rate and mutagenetic treatment time.

FIGS. 2a and 2b show a result for flow sorting mutant strains: FIG. 2a is the initial strain containing pXMJ19-EGFP; FIG. 2b is the mutant strain containing pXMJ19-EGFP; The rectangular boxed section in the upper right hand corner of each of the FIGS. 2a and 2b represents the strain to be collected.

FIG. 3 shows the result of the verification of the mutagenic strain BZH-MLH-YB5. In the figure, 1 is the initial strain containing pXMJ19-EGFP, 2 is the mutant strain BZH-MLH-YB5 containing pXMJ19-EGFP, and 3 is the mutant recombinant strain that was reintroduced into pXMJ19-EGFP after 4 subcultures of BZH-MLH-YB5.

FIGS. 4a and 4b show the WB electrophoresis of the expressed proteins from the recombinant strains. In FIG. 4a, lane 1: the disrupted supernatant of Corynebacterium glutamicum initial strain, lane 2: the disrupted supernatant of initial strain containing pXMJ19-VHH, lane 3: the disrupted supernatant of mutant strain BZH-MLH-YB5 containing pXMJ19-VHH. In FIG. 4b, lane 1: secretory supernatant of the initial strain of Corynebacterium glutamicum initial strain, lane 2: the secretory supernatant of initial strain containing pXMJ19-PINP, lane 3: the secretory supernatant of mutant strain BZH-MLH-YB5 containing pXMJ19-PINP.

DETAILED DESCRIPTION

The E. coli DH5a used in the following examples or application examples was purchased from TAKARA.

The Corynebacterium glutamicum CGMCC 1.15647 used in the following examples or application examples was publicly deposited in 2016, and a person skilled in the art is able to acquire the existing bacterial strain prior to the application date.

The vector backbone pXMJ19 used in the following examples or application examples was purchased from Biovector; catalog number is BiovectorpXMJ19.

The restriction endonucleases EcoR V, XhoI, HindIII and BamHI used in the following examples or application examples were purchased from TaKaRa Company, and the catalog numbers are 1612, 1635, 1615, and 1605, respectively.

The plasmid extraction kits, gel recovery and column recovery kits used in the following examples or application examples were purchased from Axygen, and the catalog numbers are AP-MD-P-10, AP-GX-250, AP-PCR-250, respectively.

The ligase, solutionI, used in the following examples or application examples was purchased from TaKaRa Company, catalog number is D6020A.

In the following examples or application examples, LB medium is used for the cultivation of E. coli. The medium formula is: tryptone 10 g, yeast extract 5 g, NaCl 10 g, and deionized water 1 L.

In the following examples or application examples, LBB medium is used for the cultivation of Corynebacterium glutamicum. The medium formula is: tryptone 10 g, yeast extract 5 g, NaCl 10 g, brain-heart infusion 10 g, and deionized water 1 L.

In the following examples or application examples, LBHIS medium is used for the cultivation of Corynebacterium glutamicum. The medium formula is: tryptone 5 g, yeast extract 2.5 g, NaCl 5 g, brain-heart infusion 18.5 g, sorbitol 91 g, deionized water 1 L.

1. Mutant Strains Basic Information

• • A mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins, named BZH-MLH-YB5, is provided. The mutant strain of Corynebacterium glutamicum is deposited in the in the China General Microbiological Culture Collection Center, and the deposit number is CGMCC No. 20138.

2. Preparation of Mutant Strains

• • The pXMJ19-EGFP plasmid was introduced into Corynebacterium glutamicum CGMCC1.15647 as an initial strain. After resuscitation, the transformed bacteria were spread on solid LBB plates containing 15 μg/mL chloramphenicol, then incubated at 30° C. for 18 hours and selected a single colony in 30 mL of LBB liquid medium. Incubated at 30° C. for 10 hours, and transferred to 10 mL of LBB liquid medium, when the initial OD₆₀₀ was 0.2, then cultured for about 2 h to make the OD₆₀₀ was 0.6, then take 10 uL bacterial liquid on the slide. ARTP mutagenesis was performed under the conditions of power of 100 W, air flow was 10 SLM, and time was 120 s. After mutagenesis, it was placed in a 1.5 ml centrifuge tube with 1 ml PBS and eluted by oscillation. Use the BD FACS AriaIII flow cytometer to perform flow cytometric sorting of the bacterial solution, and used the fluorescence intensity as the sorting signal to screen about 10²-10¹ strains with higher fluorescence intensity. Coating the obtained bacterial solution on the LBB solid plate containing 15 μg/mL chloramphenicol and after culturing at 30° C. for 12 h, single colony was selected in 48 well plate, and 50 strains were screened out again. The strain was transferred to a 100 mL shake flask containing 10 mL of LBB liquid for re-screening. The strain with the highest fluorescence intensity was selected, and the obtained strain was used as the initial strain for the next mutagenesis. After repeated mutagenesis and sorting, the mutant strain with the highest fluorescence intensity was obtained and preserved.

2.1 Preparation of pXMJ19-EGFP Plasmid

• • Using pXMJ19 plasmid as the backbone, the plasmid was digested with EcoR V and XhoI, then the lad part was removed, and the backbone part was recovered in gel. The tac promoter fragment was obtained by PCR with the forward and reverse primers F and R. The promoter fragment was recovered from the column, and the two fragments were digested with the same enzyme to ligate the two fragments to obtain the recombinant pXMJ19 plasmid. The recombinant pXMJ19 plasmid was digested with HindIII and BamHI, and the digested plasmid fragments were recovered by gel recovery. The green fluorescent protein fragment was obtained by PCR with primers EGFP-F and EGFP-R. The gene sequence of EGFP, such as SEQ ID NO:1, was digested with the same enzyme and ligated with ligase to obtain the recombinant pXMJ19-EGFP plasmid.

F:
GATATCAACGTAAATGCCGCTTCGCC;
R:
CTCGAGAATTAATTCTGTTTCCTGTGT;
EGFP-F:
AAGCTTATGGTGAGCAAGGGC;
EGFP-R:
GGATCCTTACTTGTACAGCTCGT

2.2 Determine the Best Mutation Time

• • Different time points, t=0, 15, 30, 45, 60, 75, 90, 120, 150 s, 180 s, were selected to determine the positive mutation rate and lethal rate. The results are shown in FIG. 1. When the mutagenesis time was 120 s, the positive mutation rate reached a maximum of about 42%, and the lethal rate was about 95%. Therefore, 120 s was selected as the best mutagenesis time.

2.3 Screening of Mutant Strains by Flow Cytometry

• • It can be seen from FIGS. 2a-2b that compared with the initial strain, the fluorescence intensity of the mutant strain is significantly shifted to the right, and the proportion of the collected highly fluorescent strains is obviously increased.

2.4 Screening the Best Mutant Strain

• • After three rounds of mutagenesis and sorting, the mutant strain BZH-MLH-YB5 was screened. The fluorescence intensity of the mutant was nearly one-fold higher than the initial strain. However, the fluorescence intensity of the mutant strain obtained after four, five or more rounds of mutagenesis and sorting was lower than that of the mutant strain BZH-MLH-YB5, so the mutant strain BZH-MLH-YB5 is the best mutagenic strain.

2.5 Stability Test of Mutant Strain

• • a. The stability of the mutant strain BZH-MLH-YB5 was verified, sub-cultured 10 times, and the fluorescence value of each generation was measured. The fluctuation range of the fluorescence value of each generation was within 10%, which was basically stable.
  • b. Plasmid loss was measured by sub-culturing the mutant strain BZH-MLH-YB5 four times in a growth medium without resistance then re-introducing pXMJ19-EGFP, cultured and detected the fluorescence intensity. The results are shown in FIG. 3. It is found that the fluorescence value is still one-fold higher, which is basically consistent with the fluorescence intensity of the mutant strain BZH-MLH-YB5. Therefore, it was the mutant strain BZH-MLH-YB5 that caused the significant increase in protein expression, not by the change in pXMJ19-EGFP.

2.6 Exogenous Protein Expression Experiment of Mutant Strains

2.6.1 Intracellular Protein VHH Expression Experiment

• • Preparation of recombinant pXMJ19-VHH plasmid: Taking the recombinant plasmid pXMJ19 as the backbone, digested with HindIII and EcoRI, and recovered in gel to obtain the digested plasmid fragment. Use VHH-F and VHH-R to perform PCR to obtain the VHH fragments. The gene sequence of VHH is SEQ ID NO: 2, and then digested with the same enzyme and ligated with ligase to obtain the recombinant pXMJ19-VHH plasmid.

VHH-F:
AAGCTTATGCAGGTCCAACTGCAAGAAAG;
VHH-R:
GAATTCTCAGTGGTGGTGGTGGTGGTGTGA
AGAGACGGTCACC

The pXMJ19-VHH plasmid was transformed into the mutant strain BZH-MLH-YB5 and the initial strain CGMCC1.15647, and the obtained transformants were individually cultured for 48 hours. The cells were disrupted by sonication, and the supernatant was centrifuged and analyzed by Western blot, and the obtained band pattern is shown in FIG. 4a. Image J is used to gray-scale analysis of the band pattern, and the analysis results are shown in Table 1a.

	TABLE 1a
						Optical
	Lane	Area	Average	Minimum	Max	density value
	2	646	79.167	24	120	51142
	3	1384	174.408	43	210	241381

In FIG. 4a, comparing the mutant strain with the initial strain, the expression of intracellular protein was significantly enhanced. From Table 1a, the mutant strain showed a 3.7-fold increase in VHH protein expression compared with the initial strain.

2.6.2 Secreted Protein PINP Expression Experiment

• • The inducible plasmid pXMJ19-PINP used the original plasmid pXMJ19 as the backbone, digested with HindIII and EcoRI, and recovered in gel to obtain the digested plasmid fragment. PINP-F and PINP-R were used for PCR to obtain PINP fragments. The gene sequence of PINP is SEQ ID NO: 3. Digested with the same enzyme and ligated with ligase to obtain the inducible pXMJ19-PINP plasmid.

PINP-F:
AAGCTTATGCAAGAAGAAGGCCAAGTGGA;
PINP-R:
GAATTCTTACTGGCCGCCGTGGTGATGGTG

The pXMJ19-VHH plasmid was transformed into the mutant strain BZH-MLH-YB5 and the initial strain CGMCC1.15647, and the obtained transformants were individually cultured for 48 hours. The supernatant was centrifuged and analyzed by Western blot, and the obtained band pattern is shown in FIG. 4b. Image J is used to gray-scale analysis of the band pattern, and the analysis results are shown in Table 1b.

	TABLE 1b
						Optical
	Lane	Area	Average	Minimum	Max	density value
	2	720	65.628	13	157	47252
	3	1064	200.36	69	225	213183

In FIG. 4b, comparing the mutant strain with the initial strain, the expression of secreted protein was significantly enhanced. From Table 1b, the mutant strain showed a 3.5-fold increase in PINP protein expression compared with the initial strain.

Sequence Listing:

This application contains a sequence listing which has been submitted in ASCII text file via EFS-Web and is hereby incorporated by reference in its entirety. The ASCII-formatted sequence listing, is named P2059US00_sequence listing.txt, and is 4,402 bytes in size.

SEQ ID NO: 1 in the sequence listing file is the corresponding gene sequence of EGFP, SEQ ID NO: 2 in the sequence listing file is the corresponding gene sequence of VHH, and SEQ ID NO: 3 in the sequence listing file is the corresponding gene sequence of PINP.

SEQ ID NO: 4 in the sequence listing file is the corresponding forward primer F, SEQ ID NO: 5 in the sequence listing file is the corresponding reverse primer R.

SEQ ID NO: 6 in the sequence listing file is the corresponding primer EGFP-F, SEQ ID NO: 7 in the sequence listing file is the corresponding primer EGFP-R.

SEQ ID NO: 8 in the sequence listing file is the corresponding primer VHH-F, SEQ ID NO: 9 in the sequence listing file is the corresponding primer VHH-R.

SEQ ID NO: 10 in the sequence listing file is the corresponding primer PINP-F, SEQ ID NO: 11 in the sequence listing file is the corresponding primer PINP-R.

Claims

1. A mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins, wherein the mutant strain of Corynebacterium glutamicum is deposited in the China General Microbiological Culture Collection Center (CGMCC), and the deposit number is CGMCC No. 20138.

2. The mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins of claim 1, wherein the mutant strain of Corynebacterium glutamicum is obtained by atmospheric and room temperature plasma (ARTP) mutagenesis and screening using Corynebacterium glutamicum with the deposited number of CGMCC1.15647 as an initial strain.

3. The mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins of claim 1, wherein the mutant strain of Corynebacterium glutamicum is for the expression of exogenous proteins.

4. The mutant strain of Corynebacterium glutamicum with efficient expression of exogenous proteins of claim 3, wherein the exogenous protein is a single domain of heavy chain antibody or N-terminal pro-peptide of human procollagen type I.