Patent Application
20250084414
Gene therapy is currently limited in clinical application also due to the difficulty of delivering genetic material into cells safely and efficiently.
The approaches used are based on viral and non-viral vectors. Viral vectors are very efficient but generally induce an immune response and require very complex preparation techniques. Non-viral vectors, generally consisting of lipids or cationic/ionizable polymers, are less efficient with respect to viral vectors, but less immunogenic and easier and more versatile to prepare. The presence of cationic polar heads on non-viral vectors also leads to some cytotoxicity.
Alongside an efficient and safe delivery system, another strongly felt need is to be able to non-invasively monitor the biodistribution of the vector, so as to verify its effective reaching of the target site.
Lipid nanoparticles for use as non-viral vectors are summarized by Kulkarni J A et al. in Nucleic Acid Therapeutics 2018; 28, 3.
Gaucheron J et al. in Bioconjugate Chem. 2001; 12, 6, 949-963 describe cationic lipid vectors functionalized with fluorinated glycerophosphoethanolamine.
Wang M et al, in Nat Commun 2014; 5, 3053 describe polymeric vectors with long perfluorinated linear chains.
Functionalization has been shown to favor the internalization of genetic material at the intracellular level and its release from endosomes to perform the desired biological function. However, to obtain the above results, linear perfluorinated chains have been used and a high density of conjugated fluorinated chains on a single polymer is required, resulting in a “congested” polymer surface and the impossibility of intervening with further modifications with other functional ligands. Furthermore, monitoring such vectors by clinical-level imaging techniques becomes difficult unless radiotracers involving complex and expensive preparations are used. In fact, the use of the 19F magnetic resonance technique (19F-MRI) is complicated by the fact that the perfluoroalkyl chains currently used produce multiple magnetic resonance signals due to the presence of magnetically non-equivalent fluorine atoms. This greatly compromises the sensitivity of the analysis. Lastly, the use of perfluoroalkyl chains presents considerable environmental sustainability problems, as compounds containing long fluorinated chains (more than six carbon atoms) have shown high persistence in the environment and high potential for bioaccumulation. Dendrimers are a class of highly branched macromolecular synthetic compounds which have repetitive structures.
The elements characterizing dendrimers are to be found in the architecture thereof, which comprises:
Dendrimers have been suggested as polymeric non-viral vectors (Dufès C et al. Dendrimers in gene delivery. Advance drug delivery reviews 2015; 57:2177-2202). For example, cationic dendrimers belonging to the class of polyamidoamines (PAMAM), polypropylene imines (PPI), poly-L-lysine carbosilanes (CBS) (PLL9) and phosphorus-containing dendrimers have been suggested for the delivery of siRNAs and microRNAs. Each of these classes has advantages and limitations, therefore the need to have non-viral vectors capable of overcoming the limits found with the ligands available to date remains strongly felt.
For the purposes of the present description, “dendriplex” means a carrier comprising at least one dendrimer structure and at least one nucleic acid.
“Lipoplex” means a structure comprising lipofectamine and at least one nucleic acid.
In a dendriplex, “N/P” denotes the ratio of the nitrogen atoms of the dendrimer structure to the phosphorus atoms of the nucleic acid charged therein, in a preferred form of the miRNA.
The present invention first relates to fluorinated amphiphilic dendrimer structures (FJDs) capable of self-assembling into supramolecular systems of different size and shape. The structures of the invention have the general formula (I) and comprise a fluorinated hydrophobic portion and a polyester-based hydrophilic portion.
In Formula (I)
In an embodiment, n is 2 or 3, preferably it is 3.
In an embodiment, R is
In an embodiment, R1 is
In an embodiment, X=NH3+Y− and Y is selected from
preferably Y is
In an embodiment, n=3,
In this embodiment, said compound is referred to as FDG2N.
In an embodiment, n=3,
The present invention further relates to supramolecular complexes comprising at least one of said dendrimer structures and one or more nucleic acids.
The present invention further relates to a composition comprising at least one of said dendrimer structures, an effective amount of a nucleic acid and a pharmaceutically acceptable vector.
Said nucleic acids are selected from both single and double-stranded deoxyribonucleic acid (DNA), ribonucleic acid (RNA), ribosomal RNA (rRNA), catalytic RNA (cRNA), snRNA, messenger RNA (mRNA), transfer RNA (tRNA), siRNA, shRNA, protein nucleic acids (PNA) and substituted nucleic acid oligonucleotides.
In a preferred form, said nucleic acid is a nucleic acid capable of mediating the RNA interference (RNAi) in which the nucleic acid is an RNA molecule selected from the group consisting of an siRNA and an shRNA.
In a preferred form, said nucleic acid is a mimetic miR-124a, i.e., a chemically modified double-stranded RNA molecule designed to mimic endogenous microRNA.
In a preferred form, said dendrimer structure is FDG2N.
In an embodiment, a pharmaceutical formulation comprising the composition described herein is claimed.
The present invention further relates to a method for obtaining said supramolecular complex, where said method comprises providing a dendrimer structure of Formula (I) and dispersing it in a saline aqueous solution with nucleic acids. Said dendrimer structure of Formula (I) and said nucleic acids are dispersed in molar ratio between 50 and 600, in a preferred embodiment 344, i.e., expressing said ratio as NIP, it is between 5 and 40, in an embodiment it is 30.
The present invention further relates to one or more of the supramolecular complexes described for use in gene therapy.
In an embodiment said use is in the treatment of neurological/neurodegenerative diseases.
In an embodiment, said supramolecular complex comprises miR-128 and miR-15 and said complex is for use in the treatment of Alzheimer's disease.
In an embodiment, said supramolecular complex comprises miR-30 and miR-26a and said complex is for use in the treatment of Parkinson's disease (Chakraborty et at, J. Adv. Res. 2021; 28: 127-138).
In an embodiment, said supramolecular complex comprises miR-206 and miR-146a and said complex is for use in the treatment of amyotrophic lateral sclerosis (Rinchetti et al., Mol. Neurobiol. 2018; 2617-2630).
In an embodiment, said supramolecular complex comprises miR-19a and miR-19b and said complex is for use in the treatment of multiple sclerosis (Gao et al., Clin. Chim. Acta. 2021; 92-99).
The present invention further relates to a supramolecular complex according to the present invention for use in tracking dendriplex after the administration thereof.
MiR-124a regulates and induces neuronal differentiation in the adult brain and spinal cord by positively targeting the Distal-Less Homeobox 2 gene (DLX2) (Marcuzzo et al, Exp Neurol. 2014; 91-101; Marcuzzo et al., Mol. Brain 2015; 8, 5). In ependymal stem/progenitor cells (epSPCs) (Haidet-Phillips et al., Nat. Biotechnol. 2011; 824-828; Marcuzzo et at, 2014 cit.) residing in the adult spinal cord, miR-124a is involved in the signaling pathways underlying neurogenesis processes in the spinal cord. The present inventors have thus surprisingly observed that a mimetic miR-124a, administered by the supramolecular complex according to the present invention, is capable of increasing the expression levels of miR-124a in ependymal stem/progenitor cells, without prematurely activating apoptosis, as is instead observed when the same is administered by lipofectamine. The results obtained indicate that the use of the supramolecular complex according to the present invention is an effective method for obtaining mi-RNA-mediated gene regulation.
The dendrimer structures according to the present invention allow to make a multiplicity of equivalent fluorine atoms (27 F) available, useful for example for 19F-MRI purposes, together with a stable and dense packaging, due to branched fluorinated chains' intrinsic tendency to crystallize.
Furthermore, the presence of four ethereal bonds in the nucleus accelerates the degradation of the molecule in the environment, thus overcoming the bioaccumulation problems of PFAs.
Such molecules have shown a finely controllable assembly in aqueous medium, as a function of the equilibrium generated between the two domains, fluorinated and hydrophilic.
The supramolecular complexes according to the present invention have surprisingly shown a higher transfection capacity with respect to that observed using lipid non-viral vectors, associated with significantly reduced cytotoxicity. The in vitro and in vivo results confirm the validity of the approach for the delivery of nucleic acids for the purpose of gene therapy, even where the target is in cells of the nervous system.
The presence of 19F in the complexes according to the present invention advantageously allows the location thereof to be traced when administered in an organism.
For the synthesis, the chemicals used as reagents and solvents were used as received without further purification and purchased with purity>97% from: TCl Deutschland GmbH: Sigma Aldrich, DE; Fluorochem, U.K.
TLC thin layer chromatography was conducted on plates pre-coated with Si 60-F254 silica gel (Merck, Darmstadt, Germany). Flash chromatography was performed on J.T. Baker silica gel mesh size 230-400 and solutions of ninhydrin or potassium permanganate were used as chemical dyes.
The synthesis was carried out following a convergent procedure requiring the separate synthesis of the fluorinated derivative and the hydrophilic part, based on small generation polyester dendrons (1st, 2nd and 3rd) with 2,2-Bis(hydroxymethyl)propionic acid (BIS-MPA) as monomer.
The synthesis of the branched fluorinated structure was optimized and carried out so as to obtain the azide derivative suitable for bonding with the polyester part.
As shown in diagram 1, the synthesis of the azide derivative (F27-N3) starts from pentaerythritol (1 equivalent, 100 g) which is reacted with tert-butyl acrylate (1.2 equivalents) in the presence of NaOH (0.2 equivalents) as base in dimethyl sulfoxide (DMSO, total volume: 128 ml) as solvent. The compound a (1 equivalent, 1.36 g) is then reacted through Mitsunobu reaction with perfluoro-tert-butyl alcohol (6 equivalents) in the presence of triphenylphosphine (PPh3) and diisopropyl azodicarboxylate (DIAD) (6 equivalents each) in dry tetrahydrofuran (THF, total volume: 38 ml). The fluorinated ester, compound b (1 equivalent, 0.4 g), is then reduced to obtain the alcohol derivative in the presence of LiAlH4 (4 equivalents) in anhydrous THE (total volume: 50 ml).
Compound c (1 equivalent, 0.85 g) is converted to the mesylated derivative through a substitution reaction in the presence of methanesulfonyl chloride (MsCl, 3 equivalents) and triethylamine (Et3N, 3 equivalents) as base in anhydrous dichloromethane (CH2Cl2, total volume: 26 ml). Finally, the derivative d (1 equivalent, 2.90 g) can be converted to F27—N3 by a second substitution reaction in the presence of sodium azide (2.2 equivalents) in anhydrous dimethylformamide (DMF, total volume: 19 ml). The compound a was purified by flash chromatography on silica gel using diethyl ether and acetone (1:1) as eluent (Rf=0.3) and permanganate solution as TLC chemical dye. All other intermediates could be purified by extraction from water with organic solvents (mainly dichloromethane or hexane) without further purification. Compound b was recrystallized from ethanol to remove all by-products.
The synthesis of polyester dendrimers was carried out separately starting from the protection of the OH groups of Bis-MPA, as reported in diagram 2.
The reaction is conducted in the presence of Bis-MPA (1 equivalent, 5 g), 2,2-dimethoxypropane (2 equivalents) and a catalytic amount of para-toluenesulfonic acid (pTsOH, 0.1 equivalents) in acetone (total volume: 25 ml). Then the propargyl ester is obtained by exploiting Steglich esterification, Therefore, the compound 1 (1 equivalent, 252 mg) is reacted with propargyl alcohol (2 equivalents) in the presence of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDO, 1.1 equivalents) and 4-dimethylaminopyridine (DMAP, 0.1 equivalents) in anhydrous CH2Cl2 (total volume: 10 ml). Acetonide deprotection is carried out in the presence of compound 2 (1 equivalent, 151 mg) and sulfuric acid (H2SO4, 0.85 equivalents) in methanol (total volume: 3 ml) is to obtain the 1st generation polyester dendron (DG1), Generation growth is obtained by iterative alternation of Steglich esterification with acetonide deprotection. Therefore, in order to obtain the 2nd generation polyester dendrone (DG2), DG1 (1 equivalent, 112 mg) is reacted with the compound 1 (5 equivalents) in the presence of EDO and DMAP (5 and 0.5 equivalents, respectively) in anhydrous CH2Cl2 (total volume: 10 ml); then the compound 3 (1 equivalent, 170 mg) is deprotected in the presence of H2SO4 (1.7 equivalents) in methanol (total volume: 5 mL). Similarly, DG2 (1 equivalent, 150 mg) is reacted with the compound 1 (8 equivalents) in the presence of EDC and DMAP (8 and 0.5 equivalents, respectively) in anhydrous CH2Cl2 (total volume: 13 mL) to achieve intermediate 4. Compound 4 (1 equivalent, 200 mg) is then deprotected acetonide in the presence of sulfuric acid (3.4 equivalents) in methanol (total volume: 7 ml) to obtain the 3rd generation dendron (DG3). Intermediates 2, 3 and 4 were purified by silica flash column chromatography using hexane and ethyl acetate (8:2) as eluent, in the case of 2, or hexane and ethyl acetate (7:3) for 3 and 4. In order to connect the branched fluorinated part and the hydrophilic polyester part through a rigid linker, the copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction was carried out as shown in diagram 3.
This strategy allowed the orthogonal connection of the two portions with good yields and without side products. The synthesis of the first-generation fluorinated amphiphilic dendrimers (FDG1) was carried out by dissolving compound DG1 (1 equivalent, 313 mg) and copper (I) acetate (0.1 equivalents) in DMF. F27—N3 (1 equivalent) was then dissolved in another DMF (total volume: 3 mL) and added to the reaction mixture. Similarly, the synthesis of the second-generation fluorinated dendrimer (FDG2) was achieved by dissolving DG2 (1 equivalent, 110 mg) and copper (I) acetate (0.15 equivalents) in DMF. F27—N3 (1 equivalent) was then dissolved in DMF (total volume: 3 mL) and added to the reaction mixture. Finally, FDG3, the 3rd-generation fluorinated dendrimers, was obtained by mixing DG3 (1 equivalent, 53 mg) and copper(I) acetate (0.5 equivalents) in DMF (total volume: 2.5 ml) and then adding F27—N3 (1 equivalent). All the CuAAC reactions were carried out at 55° C. under an inert atmosphere overnight. The reaction was then stopped, added to ice water and extracted with CH2Cl2; the organic phase was then washed twice with a 0.1% disodium EDTA solution in deionized water to remove copper and once with a saturated NaCl solution. The organic phase was collected, dried with Na2SO4 and rotary evaporated to obtain the compounds of interest. 1H, 13C and 19F-NMR combined with ATR-FTIR and HRESI-MS analyses confirmed the formation of the final dendritic structures.
To construct a gene release vector capable of binding the positive charges of the phosphate groups present in nucleic acids, the surface groups present in FDG2 were chemically modified by inserting four primary ammonium salts. The synthetic steps are highlighted in diagram 4.
FDG2 (1 equivalent, 176 mg) was reacted with Boc-beta-alanine (12 equivalents), EDC (12 equivalents) and DMAP (0.5 equivalents) in anhydrous CH2Cl2 (total volume: 7 ml) under an inert atmosphere overnight to obtain intermediate 5. To purify the product, flash silica column chromatography was carried out using a mixture of hexane and ethyl acetate (1:1) as eluent and a ninhydrin solution as TLC chemical dye (rf: 0.3). To remove the excess Boc-beta-alanine, the purified mixture was dissolved in CH2Cl2 and washed twice with 10% aqueous NaHCO3 solution. The organic phase was dried over Na2SO4 and a pale-yellow oil was recovered after removal of the solvent by rotary evaporation. To achieve the tetra ammonium salt, compound 5 (1 equivalent, 195 mg) was dissolved in CH2Cl2 (total volume: 2 mL) and reacted with trifluoroacetic acid (TFA, 2 mL).
The reaction was carried out until total conversion of the precursor, confirmed by TLC (eluent: a mixture of hexane and ethyl acetate 1:1). After rotary evaporation of the reaction solvents, the compound was then solubilized in hexafluoro-2-propanol and dried again three times to remove the excess TFA. Finally, the product was dissolved in water and lyophilized to obtain FDG2N. 1H, 3C and 19F-NMR combined with ATR-FTIR and HRESI-MS analyses confirmed the formation of the final dendritic structure.
FDG2N solutions were obtained by directly dispersing the amount of solid necessary to obtain the desired concentrations (2.5 mM and 0.5 mM) in the final solvent: MilliQ water, 150 mM NaCl and 10 mM HEPES (4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid) the pH of which was adjusted with a 1M NaOH solution until pH=7.4 was reached. The solutions were aged at constant temperature (25° C.) and analyzed after 1 hour from sample preparation, after 24 hours and 48 hours of aging as previously discussed. The dispersions were analyzed by dynamic light scattering (DLS), Z potential and 19F-NMR. The multi-angle DLS was measured with the ALV compact goniometer system, provided with ALV-5000/EPP correlator, with He—Ne laser (λ=633 nm, output power 22 mW) as light source. The temperature was controlled with a thermostatic bath and set at 25° C. A volume between 800 μL and 1 ml was used for the analysis. DLS was measured at different time points (0, 24, 48 h) and diffusion angles θ=70-130° in 20° increments. Each measurement was the result of the average of three successive tests of 10 seconds each, with a threshold sensitivity of 10%, The data analysis was carried out with ALV-Correlator software. The apparent hydrodynamic rays at different angles were obtained by an intensity-weighted and number-weighted adaptation of the autocorrelation function. The hydrodynamic rays (RH) and polydispersion indices (PdI) were calculated using cumulative coupling. For a more accurate analysis, excluding cumulative adaptation due to the high polydispersion of the samples, CONTIN analyses were carried out. The Z potential was measured at 25° C. in folded capillary cells (U-shaped cells with two gold-plated beryllium/copper electrodes at the top) 48 hours after preparation of the colloidal dispersion with a Zetasizer Nano ZS (Malvern Instrument, Malvern, Worcestershire, UK), provided with a 633 nm laser. Before each measurement, the cells were cleaned with MilliQ water and then filled with about 1 ml of sample solution. The 19F-NMR spectra were performed by analyzing 500 μL of 2.5 and 0.5 mM FDG2N dispersions mixed with 50 μL of deuterated water. The spectra were collected by setting 256 scans as input parameter. The peak of the TFA anions was set at −76.55 ppm. The measurements of T1 and T2 were obtained on the 2.5 mM FDG2N solution in MilliQ water. The data adaptation was carried out by a single exponential adaptation and the raw data was analyzed by Bruker TopSpin software and MestReNova software. The form of the aggregates was further confirmed by Cryo-TEM.
The determination of critical micellar concentration (CMC) was carried out in both water and 150 mM NaCl, determining the pyrene fluorescence. Basically, a small aliquot (17 μl) of a pyrene solution (6.25 μM in methanol) is transferred to FDG2N solutions at increasing concentrations up to a final volume of 1 mL (final pyrene concentration: 100 nM). The fluorescence emission and excitation spectra were obtained with a commercial spectrofluorometer (Jasco, FP˜6500).
To better understand the effect on self-assembly of FDG2N of the nucleic acid bond, Cryo-EM images of dendriplexes (complexes obtained between FDG2N and nucleic acids) were obtained, Briefly, the FDG2N solution (0.56 mM) in 150 mM NaCl was mixed with siRNA (double strand, sequence SEQ ID NO: 1 CUUACGCUGAGUACUUCGA, coding for luciferase) at different nitrogen-phosphorus (N/P) ratios, in particular 20, 30 and 40, to mimic the in vitro conditions discussed below. The features of the aggregates were also confirmed by DLS, potential Z and NMR experiments.
The synthetic procedure adopted allowed the isolation of the cationic fluorinated dendrimer FDG2N with good yield and purity, as confirmed by the experiments 1H and 19F-NMR and highlighted in
The compound is directly dispersible in aqueous media where it tends to self-assemble with CMC less than 50 μM in pure water and 20 μM in NaCl. In pure water and at physiological pH (10 mM HEPES Buffer, pH=7.4) it self-assembles mainly forming small micelles with an average hydrodynamic radius of about 2.5 nm, as confirmed by Cryo-TEM analyses and in accordance with the DLS results. When dissolved in 150 mM NaCl, FDG2N tends to form larger spherical aggregates. In fact, near small micelles (15-20 nm in diameter), larger spherical aggregates (50-100 nm in diameter) can be observed. These larger aggregates are likely responsible for the higher hydrodynamic rays obtained in DLS in NaCl with respect to those observed in HEPES buffer and water.
The measurements of the Z potential reveal that even after 48 h the aggregates are positively charged with values above+40 mV suggesting the possibility of binding the nucleic acids.
The relaxation times T1 and T2 were determined in pure water for a concentration of 2.5 mM FDG2N. Under these conditions, FDG2N showed a T1 of 465 ms and a T2 of 85.4 ms, optimal for 19 F-MRI applications.
Complexation with siRNA was confirmed by Cryo-EM, where it was observed that the presence of siRNA influences the aggregation behavior of FDG2N in solution, causing the formation of spherical aggregates of larger dimensions (
2 μl of the miRNA of interest is diluted in 125 μl of Opti-MEM Medium for each well to be treated. To this 0.5 μM miRNA solution is added 125 μl of the reagent LipofectamineRNAiMAX Reagent (Cat. no. 13778-075 Thermo Fisher) as a control or 125 μl of FDG2N at the concentrations indicated in Table 1. The miRNA used is hsa-miR-124-3p accession number MI0000443 (Mature miRNA Sequence SEQ ID NO: 2 UAAGGCACGCGGUGAAUGCC).
The dendriplexes are thus obtained at the N/P and molar ratios indicated in table 1, i.e., miR-124a N/P5 dendriplex, miR-124a N/P10 dendriplex, miR-124a N/P20 dendriplex, miR-124a N/P30 dendriplex, miR-124a N/P40 dendriplex used in the following examples.
epSPCs (adult spinal cord-derived stem progenitor ependymal cells) were isolated from the spinal cord of 18-week-old mice.
All the animal experiments were carried out in accordance with EU Directive 2010/63, and Italian law (law decree 26/2014) on the protection of animals used for scientific purposes. Control male mice B6.SJL were purchased from Charles River Laboratories, Inc. (Wilmington MA, USA), maintained and raised in compliance with institutional guidelines. The mice were sacrificed for tissue harvesting at 18 weeks of life by CO2 exposure. After removal of the meninges and blood vessels, the spinal cord was cut into small pieces, dissociated with 0.05% collagenase I for 15 minutes at 37° C. and then processed to produce epSPC neurospheres, as described in Marcuzzo et al., 2014. On day 7, the epSPC neurospheres were dissociated into individual cells (cell passage 1, P1) and cultured for another week. This was repeated until day 21 (P3) of in vitro cultures, to obtain sufficient cells for further analyses. The neurospheres were monitored periodically by light microscopy (Eclipse TE 2000-S, Nikon, Tokyo, Japan). At P3, epSPCs were cultured at the density of 8×104 in proliferative medium under different growth conditions: 1) baseline condition; 2) Opti-MEM condition corresponding to baseline condition but in the presence of Opti-MEM transfection medium; 3) negative control (NC) N/P5 consisting of a FDG2N dendriplex charged with a molecule with random miRNA mimetic sequence (Thermo Fisher Scientific Inc., Foster City, MA, USA; in nitrogen-phosphorus ratio equal to 5; 4) NC N/P10; 5) NC N/P20; 6) NC N/P30; 7) NC; 8) Lipofectamine and NC; 9) MiR-124a N/P5 dendriplex consisting of FDG2N charged with SEQ ID: 2 in nitrogen-phosphorus ratio equal to 5; 10) MiR124a N/P10 dendriplex; 11) MiR-124a N/P20 dendriplex; 12) MiR-124a N/P30 dendriplex; 13) MiR-124a N/P40 dendriplex; 13) Lipofectamine and miR-124a; 14) N/P40 empty. The cells were maintained in culture for 72 hours. epSPCs were then collected for molecular and immunofluorescence analyses. Exemplary images of what was observed with a fluorescence microscope under the conditions indicated are shown in
After the dendriplex treatments, the density of epSPCs was similar under all culture conditions. Conversely, the cells cultured in the presence of lipofectamine, negative control (NC) or mimetic miR-124a, showed a reduced cell density with respect to that observed in the absence of lipofectamine. To better assess the impact of the dendriplexes and lipofectamine on epSPC cultures, immunofluorescence staining was performed for nestin, a marker of neural stem/progenitor cells, under baseline conditions and after treatment with miR-124a N/P30 dendriplex or mimetic miR-124a lipofectamine.
For this purpose, epSPC neurospheres were dissociated into individual cells, plated on Matrigel-treated coverslips at the density of 8×104 and maintained 72 hours in proliferative medium under the following conditions: 1) baseline; 2) miR-124a N/P30 dendriplex; and 3) miR-124a mimetic lipofectamine. They were then fixed in 4% paraformaldehyde at room temperature for 20 minutes, permeabilized with 0.1% Triton X-100 and treated with 10% anti-goat in PBS to block the non-specific binding sites. The samples were then incubated with anti-mouse nestin (Mouse-antimouse Nestin IgG, 1:200, Millipore, Billerica, MA). The immunopositivity was revealed with anti-mouse IgG conjugated with Alexa Fluor 488 (Thermo Fischer Scientific). The cells were stained with 4,6-diamidino-2-phenylindole (DAPI) and the coverslips were mounted with FluorSave. Confocal fluorescence images were obtained with a laser scanning microscope (Eclipse TE 2000-E, Nikon) and analyzed using EZ-C1 3.70 imaging software (Nikon). The quantitative evaluation of the individual nestin-positive cells was carried out on 6 randomly selected fields per X60 magnified slide for each condition using ImageJ software (version 1.52 p). Exemplary confocal images obtained under the three different conditions tested are shown in
Total RNA was extracted with TRIzol from 2 to 2.5×105 epSPCs. The RNA quality was verified using a 2100Nano bioanalyzer (Agilent Technologies, Waldbron, Germany). The total RNA was retrotranscribed with TaqMan MicroRNA with miR-124a and U6-specific primers (Thermo Fisher Scientific), the latter as an endogenous control. The cDNA (corresponding to 15 ng of total RNA) was amplified in duplicate by Real Time PCR, using Universal PCR master mix and TaqMan MicroRNA assays (Thermo Fisher Scientific) specific for miR-124a and U6 on Viia7 Real Time PCR System (Applied Biosystem). All the results were normalized with respect to U6 and the relative miRNA expression levels were calculated using the formula 2-ΔCt.
For the gene expression analysis, the total RNA extracted from epSPC, previously screened for miRNA expression, was retro-transcribed using the SuperScript Vilo cDNA synthesis kit (Thermo Fisher Scientific). The cDNA (corresponding to 10 ng of total RNA) was amplified by quantitative real-time PCR, in duplicate, using TaqMan Fast Advanced Master Mix and Taqman gene expression assays (Thermo Fischer Scientific) for caspase-6 (CASP6), cyclin D2 (DIx2) and the 18s housekeeping gene on Viia7 Real-Time PCR (Applied Biosystems). The results are shown in
| Number | Date | Country | Kind |
|---|---|---|---|
| 102022000004496 | Mar 2022 | IT | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2023/052071 | 3/6/2023 | WO |
