Patent Grant
7001747
This Application is a 371 of PCT/GB 9902158, filed on Jul. 6, 1999 which claims benefit under 35 U.S.C. 119 (a–d) to UK 9814622.8, filed on Jul. 6, 1998.
The present invention relates to polyketides, their preparation, and materials for use therein.
Polyketides are a large and structurally diverse class of natural products that includes many compounds possessing antibiotic or other pharmacological properties, such as erythromycin, tetracyclines, rapamycin, avermectin, polyether ionophores, and FK506.
In particular, polyketides are abundantly produced by Streptomyces and related actinomycete bacteria. They are synthesised by the repeated stepwise condensation of acylthioesters in a manner analogous to that of fatty acid biosynthesis. The greater structural diversity found among natural polyketides arises from the selection of (usually) acetate or propionate as “starter” or “extender” units; and from the differing degree of processing of the β-keto group observed after each condensation. Examples of processing steps include reduction to β-hydroxyacyl-, reduction followed by dehydration to 2-enoyl-, and complete reduction to the saturated acylthioester. The stereochemical outcome of these processing steps is also specified for each cycle of chain extension.
The biosynthesis of polyketides is initiated by a group of chain-forming enzymes known as polyketide synthases (PKSs). Two classes of polyketide synthase have been described in actinomycetes. However the novel polyketides and processes which are the subject of the present invention relate mainly to Type I PKSs, represented by the PKSs for the macrolides erythromycin, rapamycin and avermectin. Type I PKSs contain a different set or “module” of enzymes for each cycle of polyketide chain extension (Cortes, J. et al. Nature (1990) 348:176–178; Donadio, S. et al. Science (1991) 252:675–679; MacNeil, D. J. et al. Gene (1991) 115:119–125; Schwecke, T. et al. Proc. Natl. Acad. Sci. USA (1995) 92:7839–7843 and see e.g.
A complete module dictating full reduction contains a ketoacyl-ACP synthase (KS) domain; an acyl carrier protein domain (ACP); an acyl-CoA:ACP acyltransferase (AT) for loading of the extender unit; and a ketoreductase (KR), a dehydratase (DH) and an enoylreductase (ER) domain for accomplishment of the processing of the β-keto group. Since these domains have enzymic activity, they may also be referred to herein as “enzymes”, though this is not intended to imply anything about their structural relationship to other PKS domains. Similarly, the nucleic acid sequences encoding such domains may also be referred to as “genes”, though this is not intended to imply anything about the presence or otherwise of separate regulatory regions for the different domains of a PKS.
The present invention particularly relates to processes for preparing polyketides by replacing the reductive loop (the segment from the end of the AT to the beginning of the ACP comprising either a KR or a KR and a DH or a KR, a DH and a ER) in a selected module of a Type I polyketide synthase gene cluster by the equivalent segment from the same or from a different PKS gene cluster, or by a mutated or synthetic segment, thereby generating new hybrid polyketide synthases that produce polyketides with different extent of reduction and/or stereochemistry in a predictable way.
For the avoidance of doubt, the term “extension module”, as used hereinafter, refers to a set of domains of a Type I PKS, each having enzymic activity, which participate in one cycle of polyketide chain extension. More particularly, an extension module comprises KS, AT, a reductive loop (comprising one or more of KR, DH and ER), and ACP.
Rarely, the reductive loop may include other domains. For example yersiniabacter, which possesses a mixed PKS and polypeptide synthase, possesses a methyl transferase domain.
It has been reported that replacement of the reductive loop of module 2 in DEBSlTE with the equivalent segment of module 3 of the (Type I) erythromycin PKS gene yields a triketide ketolactone when expressed in S. coelicolor CH999 (Bedford, D. et al. Chemistry and Biology (1996) 3:827–831).
Similarly, replacement of the reductive loop of module 2 in DEBSlTE with the equivalent segment of module 5 of the erythromycin PKS yields a triketide lactone with the predicted structure and stereochemistry when expressed in S. coelicolor CH999 (McDaniel, R. et al. Chemistry and Biology (1997) 4:667–674). On the contrary, when the same experiment was carried out using the reductive loop of module 6 of the erythromycin PKS only a ketolactone could be isolated (McDaniel, R. et al. Chemistry and Biology (1997) 4:667–674).
In a further experiment it has been shown, that the reductive loop of module 2 in a trimodular system comprising the loading domain, the first, second and third extension module and the TE of the ery gene can also be substituted by the equivalent segment of module 4 of the rapamycin PKS comprising a KR and DH domain yielding a tetraketide with the predicted double bond when expressed in S. coelicolor CH999 (McDaniel, R. et al. J. Am. Chem. Soc. (1997) 119:4309–4310). In the same system the reductive loop of module 2 has been replaced by the equivalent segment of module 1 of the rapamycin PKS comprising a KR a DH and a ER domain yielding a tetraketide with the predicted oxidation level at C-5 when expressed in S. coelicolor CH999 (Kao, C. M. et al. J. Am. Chem. Soc. (1997) 119:11339–11340). On the contrary, when using the corresponding segment of module 4 of the erythromycin PKS gene only a polyketide with a double bond at the relevant position could be observed and not, as one would predict, full reduction (Kao, C. M. et al. J. Am. Chem. Soc. (1997) 119:11339–11340).
In two similar experiments the reductive loop of module 2 in the trimodular system has been substituted by the corresponding segment of module 2 of the rapamycin PKS containing a KR and an inactive DH domain and by the KR domain of module 4 of the rap PKS (the reductive loop of rap module 4 contains a KR and a DH domain). Both constructs are reported to yield a triketide lactone with a different stereochemistry at C-3 (Kao, C. M. et al. J. Am. Chem. Soc. (1998) 120:2478–2479).
In all the examples described above the same restriction sites, PstI and XbaI, have been used to join the DNA fragments (the location of the PstI site is identical to the PstI site used in the system described below and the XbaI site is in the same place as the Bsu36I site).
A model has been proposed for the structure of the DEB synthase, where the reductive domains form a loop which lies outside the core formed by the KS, AT and the ACP domains (Staunton et al. Nature structural biology (1996) 3:188–192). In addition it has been found that DEBS1 is hydrolysed by proteolytic enzymes at specific locations which mark the boundaries of the domains (Aparicio, J. F. et al. J. Biol. Chem. (1994) 269: 8524–8528). These proteolytic sites are found mainly in linker regions and it seems therefore ideal to join the fragments in close neighbourhood to these sites. Examples of this are documented in WO98/01546.
In one aspect the invention provides nucleic acid (particularly DNA) encoding at least part of a Type I polyketide synthase (PKS), said part comprising at least part of an extension module, wherein the nucleic acid has a polylinker with multiple restriction enzyme sites in place of one or more genes encoding enzymes associated with reduction.
In another aspect the invention provides nucleic acid (particularly DNA) encoding at least part of a Type I polyketide synthase, said part comprising at least part of an extension module, wherein the nucleic acid has a polylinker with multiple restriction enzyme sites which connects nucleic acid encoding (at least part of) AT to nucleic acid encoding (at least part of) ACP.
Such nucleic acids may have an additional nucleic acid, which encodes one or more reductive enzymes, inserted into the polylinker as described in more detail below. Such insertion is preferably performed following digestion of the polylinker-containing nucleic acids by two restriction enzymes. In order to provide a choice of insertion sites, the polylinker preferably includes at least three restriction sites, more preferably at least four, and further preferably at least six or eight restriction sites.
The polylinker may be provided by introducing exogenous (usually synthetic) nucleic acid into the Type I PKS-encoding nucleic acid, or may be provided by engineering the existing sequence of the Type I PKS-encoding nucleic acid. For example, to achieve the latter, restriction sites may be engineered (e.g. by site-directed mutagenesis) into sequences up- and/or downstream (preferably both) of where the absent reductive enzyme-encoding sequence would normally lie, particularly into sequences which encode polypeptide linkers between the reductive enzyme(s) and adjacent domains.
The polylinker desirably includes at least some of the following restriction sites: AvrII, BglII; SnaBI; PstI; SpeI; NsiI; Bsu36l; NheI; and HpaI. More desirably the polylinker includes at least four of these sites.
Preferably at least some of the restriction sites included in the polylinker are absent from the remainder of the nucleic acid into which it is incorporated. Desirably at least some of the sites included in the polylinker are uncommon in or absent from naturally occurring nucleic acid sequences which encode reductive enzymes of other (preferably Type I) PKSs. Desirably at least two of the sites are absent from at least about half, more desirably at least about three quarters, of known nucleic acid sequences encoding reductive enzymes of PKSs. Preferably the restriction sites are rich in A and T residues, since PKS genes tend to be rich in G and C residues.
Desirably the nucleic acids of the invention encode a loading module and/or one or more extension modules.
In another aspect the invention provides nucleic acid generally as indicated above but having further nucleic acid encoding one or more reductive enzymes (e.g. KR and/or DH and/or ER) inserted into the polylinker. The inserted nucleic acid may encode one or more reductive enzymes of the same polyketide synthase as that of the nucleic acid into which the polylinker is inserted, but from a different extension module. Alternatively the inserted nucleic acid may be exogenous, encoding one or more reductive enzymes from a different natural PKS or fatty acid synthase, or may be synthetic or may be mutated from a naturally occurring nucleic acid which encodes one or more reductive enzymes of a PKS or fatty acid synthase. Preferably, the inserted nucleic acid encodes one or more reductive enzymes from the same or another Type I PKS or fatty acid synthase, but alternatively it may encode one or more reductive enzymes from a Type II PKS or fatty acid synthase.
The genes encoding numerous examples of Type I PKSs have been sequenced and these sequences disclosed in publicly available DNA and protein sequence databases including Genbank, EMBL, and Swissprot. For example the sequences are available for the PKSs governing the synthesis of, respectively, erythromycin (Cortes, J. et al. Nature (1990) 348: 176–178; accession number X62569, Donadio, S. et al. Science (1991) 252: 675–679; accession number M63677); rapamycin (Schwecke, T. et al. Proc. Natl. Acad. Sci. USA (1995) 92: 7839–7843; accession number X86780); rifamycin (August et al. (1998); accession number AF040570); and tylosin (Eli Lily, accession number U78289), among others. Furthermore,
It is apparent to those skilled in the art that the overall sequence similarity between the nucleic acids encoding comparable domains or modules of different Type I PKSs is sufficiently high, and the domain organisation of different Type I PKSs so consistent between different polyketide-producing microorganisms, that the processes for obtaining novel hybrid polyketides described in the present invention will be generally applicable to all natural modular Type I PKSs or their derivatives.
In further aspects, the present invention provides vectors, such as plasmids or phages (preferably plasmids), including nucleic acids as defined in the above aspects and host cells (particularly of Streptomyces species) transfected with such nucleic acids or constructs.
In a still further aspect, the present invention provides polyketide synthases expressible by host cells as defined above. Such polyketide synthases may if desired be isolated from the host cells by routine methods, though it is usually preferable not to do so.
In further aspects the invention provides methods of creating novel functional PKS's and nucleic acids encoding them by means of insertion of nucleic acid encoding reductive enzymes into polylinkers as indicated above; and novel polyketides as produced by such PKS's. In a still further aspect, the present invention provides novel processes for the specific or preferential production of particular polyketides, using the materials and methods as defined in previous aspects. For example, the present invention provides processes for the generation by direct fermentation of C22–C23 dihydroavermectins, such as ivermectin (see e.g. Examples 25 and 26), and of B1 avermectins substantially free of B2 avermectins (see e.g. Examples 27 and 28).
In another aspect, the present invention provides novel polyketides and novel stereoisomers of polyketides, such as particular polyketides produced in accordance with one a or more of the Examples.
a is a flow chart depicting the construction of pJLK28, pJLK29 and pJLK41.
b is a flow chart depicting the construction of pJLK35 and pRIF7.
a–7f are the nucleotide sequence of the first two modules of the avermectin PKS from S avermitilis (SEQ ID NO: 1).
In order to enable the exchange of the reductive loop in module 2 of the erythromycin PKS gene in the DEBSlTE system (Cortes J. et al. (1995) 268:1487–1489) a polylinker (multiple cloning site (mcs)) has been inserted in place of the reductive loop of module 2 thereby generating a minimal module comprising a KS, an AT and an ACP. (This system is still functional and produces a ketolactone (see examples 2 and 4).) The mcs contains unique recognition sites for 9 restriction enzymes.
These new restriction sites are situated partly in DNA encoding a linker region near positions where the polyketide synthase is hydrolysed by proteolytic enzymes (vide supra). While some of the restriction sites lie in DNA encoding regions of low homology, others are situated in DNA encoding highly conserved regions (
Because two of the restriction sites cover the same bases it was decided to construct two plasmids containing different mcs (pJLK114 and pJLK117).
The use of an mcs offers the following advantages over a single restriction site on each side of the reductive loop:
The present inventors have made the further surprising discovery that different results may be obtained using the same polylinker-containing nucleic acid and the same nucleic acid encoding one or more reductive enzymes, when the nucleic acid encoding one or more reductive enzymes is incorporated at different sites in the polylinker.
For example, in Examples 7 and 8, the reductive loop of the rapamycin module 13 was inserted into ery module 2 to bring about complete reduction of the polyketide chain as the outcome of the second extension module. The desired triketide lactone products were obtained in good yield. However, in Examples 37 and 38, the same reductive loop, or set of domains, from rap module 13 was inserted into essentially the same position in ery module 2 as in examples 7 and 8, save that different restriction sites of the polylinker were used (AvrII and HpaI instead of BglII and NsiI) and significant amounts of by-products were obtained. Such by-products included triketide lactones in which C-3 was either keto or hydroxy, showing that simply altering the sites used for swapping the reductive loop made the difference between obtaining the desired product and obtaining an undesirable mixture of the desired product with the products of incomplete reduction.
Similarly, in Examples 31 and 32, when the sites PstI and Bsu36I were used to insert the reductive domains of avermectin module 1 (plasmid pGMS2) in place of the reductive loop of ery module 2, the expected product was produced, but also a substantial amount of ketolactone. In the experiment of Examples 29 and 30, when the sites BglII and NheI were used (plasmid pJLK30) hardly any ketolactone byproduct was produced, although the amounts of lactone were in a similar range in each case.
When, entirely analogously to the Examples 29 and 30, in Example 14 the same sites BglII and NheI were used to replace the reductive loop of ery module 2 with the reductive loop of tylosin module 1 (plasmid pJLK35), the same target triketide lactones were produced as in Examples 30 and 32 but with much higher yield, albeit accompanied by some ketolactone, demonstrating that different reductive loops may be most advantageously inserted into different restriction sites.
In Examples 33 and 34, when the sites BglII and NheI were used to insert the reductive domains of avermectin module 2 (plasmid pJLK31) the expected products were produced as the major products. In the experiment of Examples 35 and 36, when the sites SnaBI and Bsu36I were used (plasmid pGMS4) only trace amounts of a triketide lactone mixture could be obtained.
Thus, the present invention provides the opportunity, should the desired and predicted products not be obtained when a particular reductive loop is inserted into a particular PKS, of simple adjustment of the insertion site by use of different restriction enzymes having sites in the polylinker. As demonstrated by the above comparative examples, such readjustment can dramatically affect the outcome and yield of polyketide synthesis.
Construction of Plasmid pJLK114
Plasmid pJLK114 is a pCJR24 based plasmid containing a PKS gene comprising the ery loading module, the first and the second extension modules of the ery PKS and the ery chain-terminating thioesterase except that the DNA segment between the end of the acyltransferase and the beginning of the ACP of the second ery extension module has been substituted by a synthetic oligonucleotide linker containing the recognition sites of the following restriction enzymes: AvrII, BglII, SnaBI, PstI, SpeI, NsiI, Bsu36I and HpaI. It was constructed via several intermediate plasmids as follows (
Construction of Plasmid pJLK02
The approximately 1.47 kbp DNA fragment of the eryAI gene of S. erythraea was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TACCTAGGCCGGGCCGGACTGGTCGACCTGCCGGGTT-3′ (SEQ ID NO:2) and 5′-ATGTTAACCGGTCGCGCAGGCTCTCCGTCT-3′ (SEQ ID NO: 3) and plasmid pNTEP2 (Oliynyk, M. et al., Chemistry and Biology (1996) 3: 833–839; WO98/01546) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK02 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK03
The approximately 1.12 kbp DNA fragment of the eryAI gene of S. erythraea was amplified by PCR using as primers the synthetic oligonucleotides: 5′-ATGTTAACGGGTCTGCCGCGTGCCGAGCGGAC-3′ (SEQ ID NO: 4) and 5′-CTTCTAGACTATGAATTCCCTCCGCCCAGC-3′ (SEQ ID NO: 5 and plasmid pNTEPH as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK03 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK04
Plasmid pJLK02 was digested with PstI and HpaI and the 1.47 kbp insert was ligated with plasmid pJLK03 which had been digested with PstI and HpaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK04 was identified by its restriction pattern.
Construction of Plasmid pJLK05
Plasmid pJLK01 (PCT/GB97/01819) was digested with PstI and AvrII and the 460 bp insert was ligated with plasmid pJLK04 which had been digested with PstI and AvrII. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK05 was identified by its restriction pattern.
Construction of Plasmid pJLK07
Plasmid pJLK05 was digested with ScaI and XbaI and plasmid pNTEP2 was digested with NdeI and ScaI and these two fragments were ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK07 was identified by its restriction pattern.
Construction of Plasmid pJLK114
The two synthetic oligonucleotides Plf and Plb (
Use of Plasmid pJLK114 for Construction of S. erythraea JC2/pJLK114 and the Production of TKL Derivatives
Approximately 5 μg plasmid pJLK114 were used to transform protoplasts of S. erythraea JC2 (strain deposited as No. NCIMB 40802. WO98/01546.) and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE gene. JC2/pJLK114 was plated onto SM3 agar (5.0 g glucose, 50.0 g MD30E maltodextrin, 25.0 g Arkasoy soya flour, 3.0 g molasses (beet), 0.25 g K2HPO4, 2.5 g CaCO3 22.0 g agar distilled water to 1 liter pH=7.0) containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (500 μl) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified as (4S, 5R)-5-hydroxy-2,4-dimethyl-3-oxo-n-hexanoic acid-δ-lactone and as (4S, 5R)-5-hydroxy-2,4-dimethyl-3-oxo-n-heptanoic acid-δ-lactone.
Construction of Plasmid pJLK117
Plasmid PJLK117 is a pCJR24 based plasmid containing a PKS gene comprising the ery loading module, the first and the second extension modules of the ery PKS and the ery chain-terminating thioesterase except that the DNA segment between the end of the acyltransferase and the beginning of the ACP of the second ery extension module has been substituted by a synthetic oligonucleotide linker containing the recognition sites of the following restriction enzymes. AvrII, BglII, SnaBI, PstI, SpeI, NsiI, Bsu36I and NheI.
It was constructed via several intermediate plasmids as follows (
Construction of Plasmid pJLK115
Plasmid pJLK114 was digested with NdeI and XbaI and the approximately 9.9 kbp insert was ligated with plasmid pUC18 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK115 was identified by its restriction pattern.
Construction of Plasmid pJLK116
Plasmid pJLK13 (PCT/GB97/01819) was digested with Bsu36I and XbaI and the 1.1 kbp fragment was ligated with plasmid pJLK115 which had been digested with Bsu36I and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK116 was identified by its restriction pattern.
Construction of Plasmid pJLK117
Plasmid pJLK116 was digested with NdeI and XbaI and the 9.9 kbp fragment was ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK117 was identified by its restriction pattern.
Use of Plasmid pJLK117 for Construction of S. erythraea JC2/pJLK117 and the Production of TKL Derivatives
Approximately 5 μg plasmid pJLK117 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK117 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified as (4S, 5R)-5-hydroxy-2,4-dimethyl-3-oxo-n-hexanoic acid-δ-lactone and as (4S, 5R)-5-hydroxy-2,4-dimethyl-3-oxo-n-heptanoic acid-δ-lactone.
Construction of Plasmid pJLK25
Plasmid pJLK25 is a PJLK114 based plasmid except that the DNA fragment encoding the reductive loop of the second module of the erythromycin PKS gene has been inserted into the mcs.
It was constructed via several intermediate plasmids as follows.
Construction of Plasmid pJLK118
The approximately 1.4 kbp DNA fragment of the eryAI gene of S. erythraea encoding the reductive loop of module 2 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-ATACTAGTCCTCGTGACGAGCTCGACGG-3′ (SEQ ID NO: 6) and 5′-TAATGCATCCGGTTCTCCGGCCCGCTCGCT-3′ (SEQ ID NO: 7) and pNTEP2 as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK118 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK23
Plasmid pJLK118 was digested with SpeI and NsiI and the 1.4 kbp fragment was ligated with plasmid pJLK115 which had been digested with SpeI and NsiI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK23 was identified by its restriction pattern.
Construction of Plasmid pJLK25
Plasmid pJLK23 was digested with NdeI and XbaI and the approximately 11.2 kbp fragment was ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK25 was identified by its restriction pattern.
Use of Plasmid pJLK25 for Construction of S. erythraea JC2/pJLK25 and the Production of Triketides
Approximately 5 μg plasmid pJLK25 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK25 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2R, 3S, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid δ-lactone and as (2R, 3S, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid δ-lactone.
Construction of Plasmid pJLK28
Plasmid pJLK28 is a pJLK117 based plasmid except that the DNA fragment encoding the reductive loop of module 13 of the rap PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows. (
Construction of Plasmid pJLK120
The approximately 3.2 kbp DNA segment of the rapC gene of S. hygroscopicus encoding the reductive loop of module 13 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TAAGATCTTCCGACCTACGCCTTCCAAC-3′ (SEQ ID NO: 8) and 5′-TAATGCATCGACCTCGTTGCGTGCCGCGGT-3′ (SEQ ID NO: 9) and cosmid cos 31 (Schwecke, T. et al. (1995) Proc. Natl. Acad. Sci. USA 92: 7839–7843) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK120 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK28
Plasmid pJLK120 was digested with BglII and NsiI and the 3.2 kbp fragment was ligated with plasmid pJLK117 which had been digested with BglII and NsiI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK28 was identified by its restriction pattern.
Use of Plasmid pJLK28 for Construction of JC2/pJLK28 and the Production of Triketides
Approximately 5 μg plasmid pJLK28 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK28 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2R, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-hexanoic acid δ-lactone and as (2R, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-heptanoic acid δ-lactone.
Construction of Plasmid pJLK41
Plasmid pJLK41 is a pJLK117 based plasmid except that the DNA fragment encoding the reductive loop of module 4 of the ery PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows. (
Construction of Plasmid pJLK32.3
The approximately 3.2 kbp DNA segment of the eryAII gene of S. erythraea encoding the reductive loop of module 4 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-ATAGATCTGCCTACGTACCCGTTCGAACACCAGCGCTTC-3′ (SEQ ID NO: 10) and 5′-ATCCTCAGGTTCGGCCCTGCCGCCTCGGCCTGCCCGGCGGCGCGCAGCTT-3′ (SEQ ID NO: 11) and cosmid cos4B (cosmid containing the erythromycin PKS) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK32.3 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK38
Plasmid pJLK32.3 was digested with BglII and Bsu36I and the 3.2 kbp fragment was ligated with plasmid pJLK116 which had been digested with BglII and Bsu36I. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK38 was identified by its restriction pattern.
Construction of Plasmid pJLK41
Plasmid pJLK38 was digested with NdeI and XbaI and the approximately 13 kbp fragment was ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK41 was identified by its restriction pattern.
Use of Plasmid pJLK41 for Construction of JC2/pJLK41 and the Production of Triketides
Approximately 5 μg plasmid pJLK41 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK41 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2S, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-hexanoic acid δ-lactone and as (2S, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-heptanoic acid δ-lactone.
Construction of Plasmid pJLK29
Plasmid pJLK29 is a pJLK117 based plasmid except that the DNA fragment encoding the reductive loop of module 10 of the rap PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows. (
Construction of Plasmid pJLK121.1
The approximately 2.2 kbp DNA segment of the rapB gene of S. hygroscopicus encoding the reductive loop of module 10 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TAAGATCTTCCGACGTACGCGTTCCAGC-3′ (SEQ ID NO: 12) and 5′-ATGCTAGCCACTGCGCCGACGAATCACCGGTGG-3′ (SEQ ID NO: 13) and as template an approximately 7 kbp fragment, which has been obtained by digestion of cosmid cos 26 (Schwecke, T. et al. (1995) Proc. Natl. Acad. Sci. USA 92: 7839–7843) with ScaI and SphI. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK121.1 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK29
Plasmid pJLK121.1 was digested with BglII and NheI and the 2.2 kbp fragment was ligated with plasmid pJLK117 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK29 was identified by its restriction pattern.
Use of Plasmid pJLK29 for Construction of S. erythraea JC2/pJLK29 and the Production of Triketides
Approximately 5 μg plasmid pJLK29 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK29 was used to inoculate 30 ml of SM3 medium containing 5 μg/ml thiostrepton in a 250 ml flask with a single spring to reduce clumping, shaken at 300 rpm and at 30° C. After 8 days the broth was centrifuged, the supernatant adjusted to pH 3 and extracted three times with an equal volume of ethyl acetate. The solvent was removed by evaporation and the residue dissolved in methanol and analysed by HPLC and electrospray mass spectroscopy and, after conversion to the methyl ester with trimethylsilyl-diazomethane by GC/MS. The major products were identified (by comparison with authentic material) as (4S, 5R)-5-hydroxy-2,4-dimethyl-n-hex-2-enoic acid and as (4S, 5R)-5-hydroxy-2,4-dimethyl0-n-hept-2-enoic acid.
Construction of Plasmid pJLK35
Plasmid pJLK35 is a pJLK117 based plasmid except that the DNA fragment encoding the reductive loop of module 1 of the tylosin PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows. (
Construction of Plasmid pJLK33.1
The approximately 1.6 kbp DNA segment of the tylosin PKS gene of S. fradiae encoding the reductive loop of module 1 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TAAGATCTCCCTACGTACCCCTTCAACCAC-3′ (SEQ ID NO: 14) and 5′-GCTAGCCGCCGCGCCAGCTCGGGC-3′ (SEQ ID NO: 15) and cosmid 6T (cosmid containing the tylosin-producing PKS genes) as template The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK33.1 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK35
Plasmid pJLK33.1 was digested with BglII and NheI and the 1.6 kbp fragment was ligated with plasmid pJLK117 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK35 was identified by its restriction pattern.
Use of Plasmid pJLK35 for Construction of S. erythraea JC2/pJLK35 and the Production of Triketides
Approximately 5 μg plasmid pJLK35 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK35 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid δ-lactone and as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid δ-lactone.
Construction of Plasmid pRIF7
Plasmid pRIF7 is a pJLK117 based plasmid except that the DNA fragment encoding the reductive loop of module 7 of the rifamycin PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows. (
Construction of Plasmid pUCRIF7
The approximately 2.1 kbp DNA segment of the rifamycin PKS gene of Amycolatopsis mediterranei encoding the reductive loop of module 7 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-CCTACGTACGCCTTCGACCACCAGCACTT-3′ (SEQ ID NO: 16) and 5′-CGGCTAGCGGGCGTTCCAGGCCGCCGTCCT (SEQ ID NO: 17) and cosmid 6 (cosmid starting at 35727 and going beyond 76199, numbers according to accession number AF040570) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pUCRIF7 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pRIF7
Plasmid pUCRIF7 was digested with SnaBI and NheI and the 2.1 kbp fragment was ligated with plasmid pJLK117 which had been digested with SnaBI and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pRIF7 was identified by its restriction pattern.
Use of Plasmid pRIF7 for Construction of S. erythraea JC2/pRIF7 and the Production of Triketides
Approximately 5 μg plasmid pRIF7 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pRIF7 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ul formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2S, 3S, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid δ-lactone and as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid δ-lactone.
Construction of Plasmid pJLK52
Plasmid pJLK52 is a pJLK35 based plasmid containing a PKS gene comprising the ery loading module, the first, the second and the third extension modules of the ery cluster and the ery chain-terminating thioesterase except that the DNA segment between the end of the acyltransferase and the beginning of the ACP of the second ery extension module has been substituted by the equivalent segment of module 1 of the tylosin PKS.
It was constructed via several intermediate plasmids as follows.
Construction of Plasmid pJLK50
The approximately 6.1 kbp DNA segment of the erythromycin PKS gene cluster of S. erythraea encoding the DNA fragment from the beginning of the ACP of module 2 to the beginning of the ACP of module 3 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TACCTGAGGGACCGGCTAGCGGGTCTGCCGCGTG-3′ (SEQ ID NO: 18) and 5′-ATGCTAGCCGTTGTGCCGGCTCGCCGGTCGGTCC-3′ (SEQ ID NO: 19) and plasmid pBAM25 as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK50 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK52
Plasmid pJLK50 was digested with NheI and the 6.1 kbp insert was ligated with plasmid pJLK35 which had been digested with NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK52 was identified by its restriction pattern.
Use of Plasmid pJLK52 for Construction of S. erythraea NRRL2338/pJLK52 and the Production of Tetraketides and Macrolides
Approximately 5 μg plasmid pJLK52 were used to transform protoplasts of S. erythraea NRRL2338 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA is obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE.
S. erythraea NRRL2338/pJLK52 was used to inoculate SM3 medium containing 5 μg/ml thiostrepton and allowed to grow for seven to twelve days at 28–30° C. After this time the broth was centrifuged and the pH of the supernatant adjusted to pH=9.5. The supernatant was then extracted three times with an equal volume of ethyl acetate and the solvent was removed by evaporation. The residue was dissolved in methanol and analysed by GC/MS by HPLC/MS and MS-MS. Tetraketides were identified by GC/MS. The major components were
The following macrolide was identified by HPLC/MS, MS-MS and 1H-NMR (it was accompanied by products of incomplete processing by post-PKS enzymes)
Construction of Plasmid pJLK53
Plasmid pJLK53 is a pJLK28 based plasmid containing a PKS gene comprising the ery loading module, the first, the second and the third extension modules of the ery cluster and the ery chain-terminating thioesterase except that the DNA segment between the end of the acyltransferase and the beginning of the ACP of the second ery extension module has been substituted by the equivalent segment of module 13 of the rapamycin PKS. It was constructed as follows.
Plasmid pJLK50 was digested with NheI and the 6.1 kbp insert was ligated with plasmid pJLK28 which had been digested with NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK53 was identified by its restriction pattern.
Use of Plasmid pJLK53 for Construction of S. erythraea NRRL2338/pJLK53 and the Production of TKL Derivatives
Approximately 5 μg plasmid pJLK53 were used to transform protoplasts of S. erythraea NRRL2338 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA is obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE.
S. erythraea NRRL2338/pJLK53 was used to inoculate SM3 medium containing 5 μg/ml thiostrepton and allowed to grow for seven to ten days at 28–30° C. After this time the broth was centrifuged and the pH of the supernatant adjusted to pH=9.5. The supernatant was then extracted three times with an equal volume of ethyl acetate and the solvent was removed by evaporation. The residue was dissolved in methanol and analysed by GC/MS by HPLC/MS and MS-MS. Tetraketides were identified by GC/MS. The major component was
The following macrolide was identified by HPLC/MS, MS-MS and 1H-NMR (it was accompanied by products of incomplete processing by post-PKS enzymes)
Construction of Plasmid pJLK54
Plasmid pJLK54 is a pJLK29 based plasmid containing a PKS gene comprising the ery loading module, the first, the second and the third extension modules of the ery cluster and the ery chain-terminating thioesterase except that the DNA segment between the end of the acyltransferase and the beginning of the ACP of the second ery extension module has been substituted by the equivalent segment of module 10 of the rapamycin PKS.
It was constructed as follows.
Plasmid pJLK50 was digested with NheI and the 6.1 kbp insert was ligated with plasmid pJLK29 which had been digested with NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK54 was identified by its restriction pattern.
Use of Plasmid pJLK54 for Construction of S. erythraea NRRL2338/pJLK54 and the Production of Tetraketide Derivatives and Macrolides
Approximately 5 μg plasmid pJLK54 were used to transform protoplasts of S. erythraea NRRL2338 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA is obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE.
S. erythraea NRRL2338/pJLK54 was used to inoculate SM3 medium containing 5 μg/ml thiostrepton and allowed to grow for seven to ten days at 28–30° C. After this time the broth was centrifuged and the pH of the supernatant adjusted to pH=9.5. The supernatant was then extracted three times with an equal volume of ethyl acetate and the solvent was removed by evaporation. The residue was dissolved in methanol and analysed by GC/MS by HPLC/MS and MS-MS. Tetraketides were identified by GC/MS. The major component was
The following macrolide was identified by HPLC/MS, MS-MS and 1H-NMR (it was accompanied by products of incomplete processing by post-PKS enzymes).
Avermectins
Construction of pJLK136
Plasmid pJLK136 is a pWHM3 based plasmid comprising the upstream and the downstream flanking region of the reductive loop of module 2 of the avermectin PKS gene and the erythromycin resistance gene inserted into the mcs which connects these two fragments. Plasmid pWHM3 is described in Vara J et al, J Bacteriol 1989, 171: 5872–5881. Plasmid pJLK136 was constructed via several intermediate plasmids as follows (
Construction of pJLK130
The approximately 2.4 kbp DNA segment of the avermectin PKS gene of S. avermitilis encoding the region upstream of the reductive loop of module 2 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-GACGCCGAATTCTTCGGCATCAGCCCCCGCGAAG-3′ (SEQ ID NO: 20) and 5′-GAGCTAGCAGGTGGGGAGATCTAGGTGGGTGTGGGTGTGGGGTTGGTTGTGGTGGTGG GTGTA-3′ (SEQ ID NO: 21) and plasmid pIG22 (Galloway, I. S. (1998) Thesis, University of Cambridge, UK) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK130 was identified by its restriction pattern and DNA sequencing.
Construction of pJLK131
The approximately 2.0 kbp DNA segment of the avermectin PKS gene of S. avermitilis encoding the region downstream of the reductive loop of module 2 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-GCCCGGCTAGCCGGCCAGACACACGAACAACAGC-3′ (SEQ ID NO: 22) and 5′-GGGAATTCCTCGAGGATGACGTGGGCGTTGGTGC-3′ (SEQ ID NO: 23) and plasmid pIG25 (Galloway, I. S. (1998) Thesis, University of Cambridge, UK) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK131 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK132
Plasmid pJLK130 was digested with NheI and XbaI and the approximately 2.4 kbp insert was ligated with plasmid pJLK131 which had been digested with NheI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK132 was identified by its restriction pattern.
Construction of Plasmid pJLK133
Plasmid pJLK117 was digested with BglII and NheI and the approximately 0.1 kbp insert was ligated with plasmid pJLK132 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK132 was identified by its restriction pattern.
Construction of pJLK134
The approximately 1.9 kbp DNA segment of the erythromycin gene cluster of S. erythraea encoding the erythromycin resistance was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TAAGATCTAGCGCTCCGAGGTTCTTGCCCG-3′ (SEQ ID NO: 24) and 5′-ATGCTAGCCTACCGCTGCCCGGGTCCGCCG-3′ (SEQ IS NO: 25) and plasmid pRH3 (Dhillon, N, et al. Molecular Microbiology (1989) 3: 1405–1414) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK134 was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK135
Plasmid pJLK134 was digested with BglII and NheI and the approximately 1.9 kbp insert was ligated with plasmid pJLK133 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK135 was identified by its restriction pattern.
Construction of Plasmid pJLK136
Plasmid pJLK135 was digested with EcoRI and the approximately 6.3 kbp insert was ligated with plasmid pWHM3 which had been digested with EcoRI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK136 was identified by its restriction pattern.
Use of Plasmid pJLK136
Approximately 10 μg plasmid pJLK136 were used to transform protoplasts of S. avermitilis (MacNeil, D. J. and Klapko, C. M. Journal of Industrial Microbiology (1987) 2:209–218) and stable thiostrepton and erythromycin resistant colonies were isolated. Individual colonies were selected and subcultured four times in non-selective liquid medium followed by preparation and regeneration of protoplasts (media according to MacNeil T. et al J. Bacteriol. (1993) 175:2552–2563) Thiostrepton sensitive and erythromycin resistant colonies were isolated and characterised by Southern blot hybridisation. One such colony was designated S. avermitilis/JLKl.
Construction of Plasmid pJLK137
Plasmid pJLK120 was digested with BglII and NsiI and the approximately 3.2 kbp insert was ligated with plasmid pJLK133 which had been digested with BglII and NsiI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK137 was identified by its restriction pattern.
Construction of Plasmid pJLK138
Plasmid pJLK137 was digested with EcoRI and the approximately 7.6 kbp insert was ligated with plasmid pWHM3 which had been digested with EcoRI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK138 was identified by its restriction pattern.
Use of Plasmid pJLK138
Approximately 10 μg plasmid pJLK138 were used to transform protoplasts of S. avermitilis (MacNeil, D. J. and Klapko, C. M. Journal of Industrial Microbiology (1987) 2:209–218) and stable thiostrepton and erythromycin resistant colonies were isolated. Individual colonies were selected subcultured four times in non-selective liquid medium followed by preparation and regeneration of protoplasts (media according to MacNeil T. et al J. Bacteriol. (1993) 175:2552–2563) Thiostrepton and erythromycin sensitive colonies were isolated and characterised by Southern blot hybridisation. One colony of S. avermitilis/pJLK138 was used to inoculate liquid media (fermentation according to Pang, C-H. et al J. of Antibiotics (1995) 48:59–66). the cultures were harvested and the products isolated and purified as described in the literature (Pang, C-H. et al J. of Antibiotics (1995) 48:59–66). The products were analysed by HPLC/MS and 1H-NMR and the following compound could be identified:
Construction of Plasmid pJLK139
Plasmid pJLK121.1 was digested with BglII and NheI and the 2.2 kbp fragment was ligated with plasmid pJLK133 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK139 was identified by its restriction pattern.
Construction of Plasmid pJLK140
Plasmid pJLK139 was digested with EcoRI and the approximately 6.6 kbp insert was ligated with plasmid pWHM3 which had been digested with EcoRI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK140 was identified by its restriction pattern.
Use of Plasmid pJLK140
Approximately 10 μg plasmid pJLK140 were used to transform protoplasts of S. avermitilis (MacNeil, D. J. and Klapko, C. M. Journal of Industrial Microbiology (1987) 2:209–218) and stable thiostrepton and erythromycin resistant colonies were isolated. Individual colonies were selected and subcultured four times in non-selective liquid medium followed by preparation and regeneration of protoplasts (media according to MacNeil T. et al J. Bacteriol. (1993) 175:2552–2563) Thiostrepton and erythromycin sensitive colonies were isolated and characterised by Southern blot hybridisation. One colony of S. avermitilis/pJLK140 was used to inoculate liquid media (fermentation according to Pang, C-H. et al J. of Antibiotics (1995) 48:59–66). the cultures were harvested and the products isolated and purified as described in the literature (Pang, C-H. et al J. of Antibiotics (1995) 48:59–66). The products were analysed by HPLC/MS and 1H-NMR and the following compound could be identified:
Construction of Plasmid pJLK30
pJLK30 is a PJLK117 based plasmid except that the DNA encoding the reductive loop of module 1 of the avermectin PKS has been inserted into the polylinker using the restriction sites BglII and NheI. It was constructed via several intermediate plasmids.
Construction of Plasmid pIG67
The approximately 1.7 kbp DNA segment of the gene of the avermectin PKS of S. avermitilis encoding the reductive loop of module 1 was amplified by PCR using the following synthetic oligonucleotides as primers: 5′-CCTAGATCCGCCCACCTACCCCTTCCAACACCAG-3′ (SEQ ID NO: 26) and 5′-TGGGCTAGCGTTTTGTGCAACTCCGCCGGTGGAGTG-3′ (SEQ ID NO: 27) and as template either plasmid pIG155, which contains the first two modules of the avermectin PKS cloned into plasmid pT7-7, or chromosomal DNA of Streptomyces avermitilis. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompotent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pIG67 was identified by its restriction pattern and by DNA sequencing.
Construction of Plasmid pJLK30
Plasmid pIG67 was digested with BglII and NheI and the 1.7 kbp fragment was ligated with plasmid pJLK117 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK30 was identified by its restriction pattern.
Use of Plasmid pJLK30 for the Construction of S. erythraea JC2/pJLK30 and the Production of Triketides.
Approximately 5 mg of plasmid pJLK30 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation to confirm that the plasmid had integrated into the TE. S. erythraea JC2/pJLK30 was plated onto SM3 agar containing 50 mg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 of the plate was homogenized and extracted with a mixture of 1.2 ml ethyl acetate with 20 ml formic acid. The solvent was decanted and evaporated. The residue was dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid δ-lactone and as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid δ-lactone (total of 25 mg/l) Almost none of the corresponding 3-ketolactone could be detected.
Construction of Plasmid pGMS2
pGMS2 is a pJLK117 based plasmid except that the DNA encoding the reductive loop of module 1 of the avermectin PKS has been inserted into the polylinker using the restriction sites PstI and Bsu36I. It was constructed via several intermediate plasmids.
Construction of Plasmid pIG68
The approximately 1.7 kbp DNA segment of the gene of the avermectin PKS of S. avermitilis encoding the reductive loop of module 1 was amplified by PCR using the following synthetic oligonucleotides as primers: 5′-TGGCTGCAGAGCTCACAGCCGGGTGCCGGATCCGGTT-3′ (SEQ ID NO: 28) and 5′-TTTCCTCAGGTCCGCCGGTGGAGTGGGGCGCTGGAC-3′ (SEQ ID NO: 29) and as template either plasmid pIG155, which contains the first two modules of the avermectin PKS cloned into plasmid pT7-7, or chromosomal DNA of Streptomyces avermitilis. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompotent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pIG68 was identified by its restriction pattern and by DNA sequencing.
Construction of Plasmid pGMS1
Plasmid pIG68 was digested with PstI and Bsu36I and the 1.7 kbp fragment was ligated with plasmid pJLK116 which had been digested with PstI and Bsu36I. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid PGMS1 was identified by its restriction pattern.
Construction of Plasmid pGMS2
Plasmid pGMS1 was digested with NdeI and XbaI and the approximately 11.5 kbp fragment was ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pGMS2 was identified by its restriction pattern.
Use of Plasmid pGMS2 for the Construction of S. erythraea JC2/pGMS2 and the Production of Triketides.
Approximately 5 mg of plasmid pGMS2 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation to confirm that the plasmid had integrated into the TE. S. erythraea JC2/pGMS2 was plated onto SM3 agar containing 50 μg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 of the plate was homogenized and extracted with a mixture of 1.2 ml ethyl acetate with 20 ml formic acid. The solvent was decanted and evaporated. The residue was dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The products were identified as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid 5-lactone and as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid α-lactone (total of 17 mg/l), and also a substantial amount of the corresponding 3-ketolactone (5.5 mg/l).
Construction of Plasmid pJLK31
pJLK31 is a pJLK117 based plasmid except that the DNA encoding the reductive loop of module 2 of the avermectin PKS has been inserted into the polylinker using the restriction sites BglII and NheI. It was constructed via several intermediate plasmids.
Construction of Plasmid pIG69
The approximately 2.4 kbp DNA segment of the gene of the avermectin PKS of S. avermitilis encoding the reductive loop of module 2 was amplified by PCR using the following synthetic oligonucleotides as primers: 5′-CCTAGATCTCCCCACCTACCCCTTCCAACACCACCACTACTG-3′ (SEQ ID NO: 30) and 5′-CCGGCTAGCCGGGCGTGCAGCTGGGCGCCGTTGTCCGCAC-3′ (SEQ ID NO: 31) and as template either plasmid pIG155, which contains the first two modules of the avermectin PKS cloned into plasmid pT7-7, or chromosomal DNA of Streptomyces avermitilis. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompotent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pIG69 was identified by its restriction pattern and by DNA sequencing.
Construction of Plasmid pJLK31
Plasmid pIG69 was digested with BglII, NheI and DraI and the 2.4 kbp fragment was ligated with plasmid pJLK117 which had been digested with BglII and NheI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK31 was identified by its restriction pattern.
Use of Plasmid pJLK31 for the Construction of S. erythraea JC2/pJLK31 and the Production of Triketides.
Approximately 5 mg of plasmid pJLK31 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation to confirm that the plasmid had integrated into the TE. S. erythraea JC2/pJLK31 was plated onto SM3 agar containing 50 mg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 of the plate was homogenized and extracted with a mixture of 1.2 ml ethyl acetate with 20 ml formic acid. The solvent was decanted and evaporated. The residue was dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-hexanoic acid 5-lactone and as (2R, 3R, 4S, 5R)-5,3-dihydroxy-2,4-dimethyl-n-heptanoic acid 5-lactone (total of 30 mg/liter).
Construction of Plasmid pGMS4
PGMS4 is a pJLK117 based plasmid except that the DNA encoding the reductive loop of module 2 of the avermectin PKS has been inserted into the polylinker using the restriction sites SnaBI and Bsu36I. It was constructed via several intermediate plasmids.
Construction of Plasmid pIG70
The approximately 2.4 kbp DNA segment the gene of the avermectin PKS of S. avermitilis encoding the reductive loop of module 2 was amplified by PCR using the following synthetic oligonucleotides as primers: 5′-CCCTACGTACCCCTTCCAACACCACTACTGGCTCGAAAG-3′ (SEQ ID NO: 32) and 5′-GGCCCTCAGGTGGGCGCCGTTGTCCGCACCACCGGTA-3′ (SEQ ID NO: 33) as template either plasmid pIG155, which contains the first two modules of the avermectin PKS cloned into plasmid pT7-7, or chromosomal DNA of Streptomyces avermitilis. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompotent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pIG70 was identified by its restriction pattern and by DNA sequencing.
Construction of Plasmid pGMS3
Plasmid pIG70 was digested with SnaBI, Bsu36I and DraI and the 2.4 kbp fragment was ligated with plasmid pJLK116 which had been digested with SnaBI and Bsu36I. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid PGMS3 was identified by its restriction pattern.
Construction of Plasmid PGMS4
Plasmid pGMS2 was digested with NdeI and XbaI and the approximately 12.4 kbp fragment was ligated with plasmid pCJR24 which had been digested with NdeI and XbaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid PGMS4 was identified by its restriction pattern.
Use of Plasmid PGMS4 for the Construction of S. erythraea JC2/pGMS4 and the Production of Triketides.
Approximately 5 mg of plasmid pGMS4 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation to confirm that the plasmid had integrated into the TE. S. erythraea JC2/pGMS4 was plated onto SM3 agar containing 50 mg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 of the plate was homogenized and extracted with a mixture of 1.2 ml ethyl acetate with 20 ml formic acid. The solvent was decanted and evaporated. The residue was dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. Only traces of putative triketide products were detected.
Construction of Plasmid pJLK27
Plasmid pJLK27 is a pJLK114 based plasmid except that the DNA fragment encoding the reductive loop of module 13 of the rap PKS has been inserted into the mcs. It was constructed via several intermediate plasmids as follows.
Construction of Plasmid pJLK120a
The approximately 3.2 kbp DNA segment of the rapC gene of S. hygroscopicus encoding the reductive loop of module 13 was amplified by PCR using as primers the synthetic oligonucleotides: 5′-TACCTAGGCACCACCACAACCCGGGTA-3′ (SEQ ID NO: 34) and 5′-TACAATTGGCCCGCGAGTCCCCGACGCT-3′ (SEQ ID NO: 35) and cosmid cos 31 (Schwecke, T. et al. (1995) Proc. Natl. Acad. Sci. USA 92: 7839–7843) as template. The PCR product was treated with T4 polynucleotide kinase and then ligated with plasmid pUC18, which had been linearised by digestion with SmaI and then treated with alkaline phosphatase. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK120a was identified by its restriction pattern and DNA sequencing.
Construction of Plasmid pJLK27
Plasmid pJLK120a was digested with AvrII and HpaI and the 3.2 kbp fragment was ligated with plasmid pJLK114 which had been digested with AvrII and HpaI. The ligation mixture was used to transform electrocompetent E. coli DH10B cells and individual colonies were checked for their plasmid content. The desired plasmid pJLK27 was identified by its restriction pattern.
Use of Plasmid pJLK27 for Construction of JC2/pJLK27 and the Production of Triketides
Approximately 5 mg plasmid pJLK27 were used to transform protoplasts of S. erythraea JC2 and stable thiostrepton resistant colonies were isolated. From several colonies total DNA was obtained and analysed by Southern blot hybridisation, to confirm that the plasmid has integrated into the TE. JC2/pJLK27 was plated onto SM3 agar containing 50 mg/ml thiostrepton and allowed to grow for twelve days at 30° C. 1 cm2 (0.5 ml) of the plate was homogenised and extracted with a mixture of 1.2 ml ethyl acetate and 20 ml formic acid. The solvent was decanted and removed by evaporation and the residue dissolved in methanol and analysed by GC/MS and electrospray mass spectroscopy. The major products were identified (by comparison with authentic material) as (2R, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-hexanoic acid δ-lactone and as (2R, 4S, 5R)-2,4-dimethyl-5-hydroxy-n-heptanoic acid δ-lactone (total of 41 mg/l), with some of the corresponding 3-ketolactones (total of 12 mg/l) and 3-hydroxylactones (total of 2.8 mg)
All documents and sequence deposits referred to herein are explicitly and individually incorporated herein by reference.
| Number | Date | Country | Kind |
|---|---|---|---|
| 9814622 | Jul 1998 | GB | national |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/GB99/02158 | 7/6/1999 | WO | 00 | 8/24/2001 |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO00/01827 | 1/13/2000 | WO | A |
