The invention provides methods and compositions relating to a novel family of genes, mUCP3s, involved in metabolic regulation. The polypeptides may be produced recombinantly from transformed host cells from the disclosed mUCP3 encoding nucleic acids or purified from mammalian cells. The invention provides isolated mUCP3 hybridization probes, knock-out/in constructs and primers capable of specifically hybridizing with the disclosed mUCP3 genes, mUCP3-specific binding agents such as specific antibodies, animals and cells modified with the subject mUCP3 nucleic acids, and methods of making and using the subject compositions in the biopharmaceutical industry.
Description
INTRODUCTION 1. Field of the Invention The field of this invention is UCP3 genes and their use in biotechnology. 2. Background A mitochondrial protein called uncoupling protein (UCP1) is thought to play an important role in the body's regulation of energy utilization. Such regulation provides wide spread physiological controls including body weight, appetite, glucose metabolism, temperature, immune responses, etc. Mechanistically, UCP1 is thought to create a pathway that allows dissipation of the proton electrochemical gradient across the inner mitochondrial membrane in brown adipose tissue, without coupling to any other energy consuming process (for review, see Nicholis & Locke (1984) Physiol Rev 64, 1-64). Unfortunately, the role of UCP1 in physiologies such as body weight regulation in large adult mammals such as people, cattle, pigs, etc. is likely to be limited, since there is little brown adipose tissue in such animals. UCP2 is a second, related uncoupling protein that is much more widely expressed in large adult mammals (see, e.g. Fleury et al. (1997) Nature Genetics 15, 269-272 and Tartaglia et al. (1996) WO96/05861). Consistent with a role in the regulation of energy utilization generally, and in diabetes and obesity in particular, the UCP2 gene is upregulated in response to fat feeding and maps to regions of the human and mouse genomes linked to hyperinsulinaemia and obesity. More recently, a third structurally related UCP gene, hUCP3 has been charaterized and found to be preferentially expressed in skeletal muscle and brown adipose tissues; see, Vidal-Puig et al. (1997) BBRC 235, 79-82 and Boss et al. (1997) FEBS Letters 408, 39-42. SUMMARY OF THE INVENTION The invention provides methods and compositions relating to isolated mUCP3 polypeptides, related nucleic acids, polypeptide domains thereof having mUCP3-specific structure and activity and modulators of mUCP3 function. mUCP3 polypeptides and modulators of mUCP3 expresssion and/or function can regulate mitochodrial respiration and hence provide important regulators of cell metabolism and function. The polypeptides may be produced recombinantly from transformed host cells or extract from the subject mUCP3 polypeptide encoding nucleic acids or purified from mammalian cells. The invention provides isolated mUCP3 hybridization probes and primers capable of specifically hybridizing with the disclosed mUCP3 genes, mUCP3-specific binding agents such as specific antibodies, and methods of making and using the subject compositions in diagnosis (e.g. genetic hybridization screens for mUCP3 transcripts) and in the biopharmaceutical industry (e.g. as immunogens, reagents for isolating other transcriptional regulators, knockin/out vectors, transgenic animals and cell lines, reagents for screening chemical libraries for lead pharmacological agents, etc.).
BRIEF DESCRIPTION OF THE FIGURES FIG. 1 shows the amino acid sequence of mUCP3a (SEQ ID NO: 2), indicating the amino acid domains in common with hUCP3 in bold. FIGS. 2a-2d show the nucleic acid sequence of mUCP3a (SEQ ID NO: 1), indicating the nucleotide domains in common with hUCP3 in bold. FIG. 3 shows the structures of mUCP3 isoforms a, b and c.
DETAILED DESCRIPTION OF THE INVENTION Exemplary nucleotide sequences of natural cDNAs encoding mUCP3 polypeptides are shown as SEQ ID NO: 1, 3 and 5, and their full conceptual translates are shown as SEQ ID NOS: 2, 4 and 6, respectively. The mUCP3 polypeptides of the invention include incomplete translates of SEQ ID NOS: 1, 3 and 5 which translates and deletion mutants of SEQ ID NOS: 2, 4 and 6 have mUCP3-specific amino acid sequence, binding specificity or function. Preferred translates/deletion mutants comprise at least a 6, preferably at least an 8, more preferably at least a 10, most preferably at least a 12 residue domain of the translates not found in hUCP3. Such domains are readily discemable from alignments of mUCP3 polypeptides and hUCP3. See FIG. 1 for the mUCP3a amino acid domains in common (bold) and not in common with hUCP3 and FIGS. 2a-2d for the mUCP3a nucleic acid domains in common (bold) and not in common with the nucleic acid domains of hUCP3. The subject domains provide mUCP3 domain specific activity or function which are conveniently determined in vitro, cell-based, or in vivo assays: e.g. in vitro binding assays, cell culture assays, in animals (e.g. gene therapy, transgenics, etc.), etc. mUCP3-binding specificity may assayed by binding equilibrium constants (usually at least about 10.sup.7 M.sup.-1, preferably at least about 10.sup.8 M.sup.-1, more preferably at least about 10.sup.9 M.sup.-1), by the ability of the subject polypeptide to function as negative mutants in mUCP3-expressing cells, to elicit mUCP3 specific antibody in a heterologous host (e.g. a rabbit), etc. In any event, the mUCP3 binding specificity of the subject mUCP3 polypeptides necessarily distinguishes that of hUCP3. Preferred peptides demonstrate mUCP3 domain specific activity as assayed by respiratory uncoupling activity, ATP-binding or binding inhibitory activity, mUCP3-specific antibody binding, etc. For example, mUCP3 domain peptides with assay demonstrable mUCP3 domain-specific activities include: SEQ ID NO: 2, residues 3-12; SEQ ID NO: 2, residues 37-58; SEQ ID NO: 2, residues 100-115; SEQ ID NO: 2, residues 144-158; SEQ ID NO: 2, residues 182-198; SEQ ID NO: 2, residues 198-209 SEQ ID NO: 2, residues 242-266; SEQ ID NO: 2, residues 268-290; and SEQ ID NO: 2, residues 297-308. The subject mUCP3 polypeptides are isolated or pure: an "isolated" polypeptide is unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, and more preferably at least about 5% by weight of the total polypeptide in a given sample and a pure polypeptide constitutes at least about 90%, and preferably at least about 99% by weight of the total polypeptide in a given sample. A polypeptide, as used herein, is an polymer of amino acids, generally at least 6 residues, preferably at least about 10 residues, more preferably at least about 25 residues, most preferably at least about 50 residues in length. The mUCP3 polypeptides and polypeptide domains may be synthesized, produced by recombinant technology, or purified from mammalian, preferably murine cells. A wide variety of molecular and biochemical methods are available for biochemical synthesis, molecular expression and purification of the subject compositions, see e.g. Molecular Cloning, A Laboratory Manual (Sambrook, et al. Cold Spring Harbor Laboratory), Current Protocols in Molecular Biology (Eds. Ausubel, et al., Greene Publ. Assoc., Wiley-Interscience, NY) or that are otherwise known in the art. For example, the invention provides a method of making a polypeptide comprising the steps of introducing an isolated or recombinant nucleic acid encoding an mUCP3 polypeptide into a host cell or extract, incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide, and isolating said translation product. The invention provides binding agents specific to the claimed mUCP3 polypeptides, including substrates, agonists, antagonists, natural intracellular binding targets, etc., methods of identifying and making such agents, and their use in pharmaceutical development. Novel mUCP3-specific binding agents include mUCP3-specific receptors, such as somatically recombined polypeptide receptors like specific antibodies or T-cell antigen receptors (see, e.g. Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory) and other natural intracellular binding agents identified with assays such as one-, two- and three-hybrid screens, non-natural intracellular binding agents identified in screens of chemical libraries such as described below, etc. Agents of particular interest modulate mUCP3 function, e.g. mUCP3-dependent respiratory coupling. Accordingly, the invention provides methods for modulating respiration involving an mUCP3 gene product comprising the step of modulating mUCP3 activity, e.g. by contacting the cell with an mUCP3-specific binding agent. The cell may reside in culture or in situ, i.e. within the natural host. Preferred inhibitors are orally active in mammalian hosts. For diagnostic uses, the inhibitors or other mUCP3 binding agents are frequently labeled, such as with fluorescent, radioactive, chemiluminescent, or other easily detectable molecules, either conjugated directly to the binding agent or conjugated to a probe specific for the binding agent. The amino acid sequences of the disclosed mUCP3 polypeptides are used to back-translate mUCP3 polypeptide-encoding nucleic acids optimized for selected expression systems (Holler et al. (1993) Gene 136, 323-328; Martin et al. (1995) Gene 154, 150-166) or used to generate degenerate oligonucleotide primers and probes for use in the isolation of natural mUCP3-encoding nucleic acid sequences ("GCG" software, Genetics Computer Group, Inc, Madison Wis.). mUCP3-encoding nucleic acids used in mUCP3-expression vectors and incorporated into recombinant host cells, e.g. for expression and screening, transgenic animals, e.g. for functional studies such as the efficacy of candidate drugs for disease associated with mUCP3 -modulated cell function, etc. The invention also provides nucleic acid hybridization probes, knockin/out constructs and replication/amplification primers having a mUCP3 cDNA specific sequence comprising SEQ ID NOS: 1, 3 and 5, or fragments thereof sufficient to effect specific hybridization thereto (i.e. specifically hybridize with SEQ ID NOS: 1, 3 and 5 in the presence of the UCP1, UCP2 and hUCP3 cDNA. Such primers or probes are at least 12, preferably at least 24, more preferably at least 36 and most preferably at least 96 bases in length. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formamide in 5.times.SSPE (0.18M NaCl, 0.01M NaPO.sub.4, pH7.7, 0.001M EDTA) buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5.times.SSPE buffer at a temperature of 42.degree. C. and remaining bound when subject to washing at 42.degree. C. with 0.2.times.SSPE buffer at 42.degree. C. mUCP3 nucleic acids can also be distinguished using alignment algorithms, such as BLASTX (Altschul et al. (1990) Basic Local Alignment Search Tool, J Mol Biol 215, 403-410). The subject nucleic acids are of synthetic/non-natural sequences and/or are isolated, i.e. unaccompanied by at least some of the material with which it is associated in its natural state, preferably constituting at least about 0.5%, preferably at least about 5% by weight of total nucleic acid present in a given fraction, and usually recombinant, meaning they comprise a non-natural sequence or a natural sequence joined to nucleotide(s) other than that which it is joined to on a natural chromosome. Recombinant nucleic acids comprising the nucleotide sequence of SEQ ID NOS: 1, 3 and 5, or fragments thereof, contain such sequence or fragment at a terminus, immediately flanked by (i.e. contiguous with) a sequence other than that which it is joined to on a natural chromosome, or flanked by a native flanking region fewer than 10 kb, preferably fewer than 2 kb, which is at a terminus or is immediately flanked by a sequence other than that which it is joined to on a natural chromosome. While the nucleic acids are usually RNA or DNA, it is often advantageous to use nucleic acids comprising other bases or nucleotide analogs to provide modified stability, etc. The subject nucleic acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, knockin/out constructsetc.; use in detecting the presence of mUCP3 genes and gene transcripts and in detecting or amplifying nucleic acids encoding additional mUCP3 homologs and structural analogs. In diagnosis, mUCP3 hybridization probes find use in identifying wild-type and mutant mUCP3 alleles in clinical and laboratory samples. In a particular embodiment, mUCP3 nucleic acids are used to modulate cellular expression or intracellular concentration or availability of active mUCP3 by binding and/or recombining with an endogenous mUCP3 gene or gene transcript. Methods for effecting anti-sense hyridization, homologous and non-homologous recombinations, and generating transgenic animals and cell lines are well-established in the art. The following experimental section and examples are offered by way of illustration and not by way of limitation. EXAMPLES 1. Cloning of mUCP3 cDNAs We searched murine EST databases using human UCP2 cDNA sequence to identify a CDNA with sequence similarity to known human and mouse UCP2 cDNA sequences. Isolated, cloning and sequencing of this clone revealed a novel gene designated mUCP3, with greatest sequence similarity to a human UCP3 gene. Since the clone lacked the 5' end UTR and part of the coding sequence, we designed a primer for 5' end RACE of the cDNA sequence using mouse skeletal muscle cDNA (PCR condition: 95 0C, 40 sec, 55 0C 2 min, 72 0C, 3 min for 30 cycles). Several clones from the RACE PCR contain sequences that overlap with the partial cDNA sequence. A EcoRI tagged forward primer and XbaI tagged reverse primer were used to amplify the fall mUCP3 cDNA using mouse skeletal muscle cDNA. A 2.8 kb mUCP3 cDNA was amplified and cloned into pBlue-Script SK. Several smaller fragments (1.5-2 kb) detected in the PCR products in lesser quantities were also cloned and DNA sequencing confirmed that they were alternatively spliced forms of mUCP3 cDNA. The largest mUCP3 cDNA (mUCP3a) is 2,782 bp long, containing 239 bp 5' end untranslated region, a 816 bp ORF and 1.7 kb 3' end UTR. The mRNA transcript is about 2.8 kb and the translation product contains 308 amino acid residues. It is 85% identical to the hUCP3 and 73% and 54% identical to mUCP2 and mUCP1, respectively, indicating a similar functional roles in uncoupling mitochondrial respiration. Two shorter isoforms, mUCP3b and mUCP3c are 1,949 bp and 1,777 bp, with translation products of 432 and 256 amino acid residues respectively (see, FIG. 3). 2. Expression of mUCP3 cDNAs Because of the extensive DNA sequence homology between our mUCP3 genes and mUCP2, we designed a set of primers designed for PCR amplification of a 335 bp mUCP3 specific DNA sequence and cloned into pBlue-Script SK. The cloned fragment was labeled through reverse transcription using a T3/T7 Reverse Transcription Kit from Ambion and used as a probe for Northern blot analysis of mUCP3 expression. The mouse multiple tissue blots were purchased from Clontech and Northern analysis was performed using a Northern Max kit purchased from Ambion. Northern analysis revealed specific enhanced expression in heart and especially skeletal muscle tissues as compared with negligble expression in brain, spleen, lung, liver, kidney and testis tissues. 3. Protocol for high throughput mUCP3a--antibody binding assay. A. Reagents: Neutralite Avidin: 20 .mu.g/ml in PBS. Blocking buffer: 5% BSA, 0.5% Tween 20 in PBS; 1 hour at room temperature. Assay Buffer: 100 mM KCl, 20 mM HEPES pH 7.6, 1 mM MgCl.sub.2, 1% glycerol, 0.5% NP-40, 50 mM .beta.-mercaptoethanol, 1 mg/ml BSA, cocktail of protease inhibitors. .sup.33 P mUCP3a polypeptide 10.times. stock: 10.sup.-8 -10.sup.-6 M "cold" mUCP3 supplemented with 200,000-250,000 cpm of labeled mUCP3a (Beckman counter). Place in the 4.degree. C. microfridge during screening. Protease inhibitor cocktail (1000X): 10 mg Trypsin Inhibitor (BMB #109894), 10 mg Aprotinin (BMB #236624), 25 mg Benzamidine (Sigma #B-6506), 25 mg Leupeptin (BMB #1017128), 10 mg APMSF (BMB #917575), and 2 mM NaVO.sub.3 (Sigma #S-6508) in 10 ml of PBS. mUCP3-specific antibody: 10.sup.-7 -10.sup.-5 M biotinylated antibody in PBS. B. Preparation of assay plates: Coat with 120 .mu.l of stock N-Avidin per well overnight at 4.degree. C. Wash 2 times with 200 .mu.l PBS. Block with 150 .mu.l of blocking buffer. p1 Wash 2 times with 200 .mu.l PBS. C. Assay: Add 40 .mu.l assay buffer/well. Add 10 .mu.l compound or extract. Add 10 .mu.l .sup.33 P-mUCP3a (20-25,000 cpm/0.1-10 pmoles/well=10.sup.-9 -10.sup.-7 M final conc). Shake at 25.degree. C. for 15 minutes. Incubate additional 45 minutes at 25.degree. C. Add 40 .mu.M biotinylated antibody (0.1-10 pmoles/40 ul in assay buffer) Incubate 1 hour at room temperature. Stop the reaction by washing 4 times with 200 .mu.M PBS. Add 150 .mu.M scintillation cocktail. Count in Topcount. D. Controls for all assays (located on each plate): a. Non-specific binding b. Soluble (non-biotinylated antibody) at 80% inhibition. All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. __________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 6(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2782 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GTCAGCTGGTGCACAGGGCCAGTGCCGAGCCAGGGACAGCAGAGACAACAGTGAATGGTG60AGGCCCGGCCGTCAGATCCTGCTGCTACCTAATGGAGTGGAGCCTTAGGGTGGCCCTGCA120CTACCCAACCTTGGCTAGACGCACAGCTTCCTCCCTGAACTGAAGCAAAAGATTGCCAGG180CAAGCTCTCTCCTCGGACCTCCATAGGCAGCAAAGGAACCAGGCCCATTCCCCGGGACCA240TGGTTGGACTTCAGCCCTCCGAAGTGCCTCCCACAACGGTTGTGAAGTTCCTGGGGGCCG300GCACTGCGGCCTGTTTTGCGGACCTCCTCACTTTTCCCCTGGACACCGCCAAGGTCCGTC360TGCAGATCCAAGGGGAGAACCCAGGGGCTCAGAGCGTGCAGTACCGCGGTGTGCTGGGTA420CCATCCTGACTATGGTGCGCACAGAGGGTCCCCGCAGCCCCTACAGCGGACTGGTCGCTG480GCCTGCACCGCCAGATGAGTTTTGCCTCCATTCGAATTGGCCTCTACGACTCTGTCAAGC540AGTTCTACACCCCCAAGGGAGCGGACCACTCCAGCGTCGCCATCAGGATTCTGGCAGGCT600GCACGACAGGAGCCATGGCAGTGACCTGCGCCCAGCCCACGGATGTGGTGAAGGTCCGAT660TTCAAGCCATGATACGCCTGGGAACTGGAGGAGAGAGGAAATACAGAGGGACTATGGATG720CCTACAGAACCATCGCCAGGGAGGAAGGAGTCAGGGGCCTGTGGAAAGGGACTTGGCCCA780ACATCACAAGAAATGCCATTGTCAACTGTGCTGAGATGGTGACCTACGACATCATCAAGG840AGAAGTTGCTGGAGTCTCACCTGTTTACTGACAACTTCCCCTGTCACTTTGTCTCTGCCT900TTGGAGCTGGCTTCTGTGCCACAGTGGTGGCCTCCCCGGTGGATGTGGTAAAGACCCGAT960ACATGAACGCTCCCCTAGGCAGGTACCGCAGCCCTCTGCACTGTATGCTGAAGATGGCGG1020CTCAGGAGGGACCCACGGCCTTCTACAAAGGATTTGTGCCCTCCTTTCTGCGTCTGGGAG1080CTTGGAACGTGATGATGTTTGTAACATATGAGCAACTGAAGAGGGCCTTAATGAAAGTCC1140AGGTACTGCGGGAATCTCCGTTTTGAACAAGGCAAGCAGGCTGCCTGAAACAGAACAAAG1200CGTCTCTGCCCTGGGGACACAGGCCCACACGGTCCAAAACCCTGCACTGCTGCTGACACG1260AGAAACTGAACTAAAAGAGGAGAGTTTTAGTCCTCCGTGTTTCGTCCTAAAACACCTCTG1320TTTTGCACTGACCTGATGGGAAATAAATTATATTAATTTTTAAACCCCTTCCGGTTGGAT1380GCCTAATATTTAGGCAAGAGACAACAAAGAAAACCAGAGTCAACTCCCTTGAAATGTAGG1440AATAAAGGATGCATAATAAACAGGAAAGGCACAGGTTTTGAGAAGATCAGCCCACAGTGT1500TGTCCTTGAATCAAACAAAATGGTCGGAGGAACCCTTCGGCTTCAGCACAAAGAGGTGAC1560TACAGCCTTCTGGTCACCAGATGACTCCGCCCCTCTGTAATGAGTCTGCCAAGTAGACTC1620TATCAAGATTCTGGGGAAAGGAGAAAGAACACATTGATACTGCACAAATGAGTGGTGCTG1680GGCCCACCGAGGACACTGGAGGATGGAGCGTGATCTGGGATAACAGTCCTTCTCTGTCTG1740CCTCATCAGGGTGTTGGGAAGATAGAAAGCGAAGCAGACATGGAAGCACTTCCTAACAAG1800GCCTGTCATCGTCATCATCTACAAATGTAAGCCTGAGGACAATGTTTTAGGAGAGATTCT1860GTCCAGAGAAGTAGTTTGAGGAAAATGCAGTTTGTAGTGGTAAAGCCATGCACACCTGGA1920CTGCATGGTAAGGACCAGGGGTGACGGAAGCCATGGGGATCCGGTGCCTGGTAACATCAA1980AGGGCTGTGGGGGGGGGGGGGCACTGCCTGTCCATCAGTTCAAAGCAGCAGGACTCAGAA2040TCTCCACCTTAGGGCAAGAACGAGAACAGCTGCTCTTCTGCCTTCTCTCTCGGAGGTTTT2100CTCATCTCAGGGTCCTACCTGCCAGGCTCCTGACCAGCTCCACCTGCCCACACTTCCTCC2160TGCTCTCGCTGCCTTTGGCTGCAGAGCCTTTGCTCCTCCTGTTAAGCCTTCAGTCTTCCA2220TCTGCAAAAGGGAGGGCAAAGCACAGGACCAACTTCCAAGCTTAAAAATGCACATCTGAC2280AACAAAATGGCTCAGTGGGGTCCATTCATGGGACCCACATGGTGGAAGGACAGAATGGAC2340TCTTGCAAATTGTCCTCTGACCTCCATTTGAGCGCCCTATACATGTGACTGTACATATGT2400ACAAACACGATAAAGATGGAAACACATGTAAAAACATAAAAATAAAAAGTTGTACTGGAT2460GTGGTGGTTTGAATGAGATGTTCCTCGTGTCTCGGGCATTTGAAGACTTGCTCCCCAGTT2520GTTGGCGGCTGTTTGGGGAGGCTTAGAAGATGTGGCCTTTTGGGAAGCAGGGTGTCATTG2580AGGACTGGCTTGGAGAGCCTAAAGATCCGAGGCACTCCCAGTTTCTCTGGTTTTTCATTT2640TGAGGTGTGAGGTCTTATTGGCTGCACCAGTCTCCATGCCTGTCTGTTGCCCGGCCTCCT2700CACCATGATGGACTTTTATCTCTCTGTACTTGTAAGCCCCAAATAAACCTTCCATCTGTG2760AAAAAAAAAAAAAAAAAAAAAA2782(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 308 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetValGlyLeuGlnProSerGluValProProThrThrValValLys151015PheLeuGlyAlaGlyThrAlaAlaCysPheAlaAspLeuLeuThrPhe202530ProLeuAspThrAlaLysValArgLeuGlnIleGlnGlyGluAsnPro354045GlyAlaGlnSerValGlnTyrArgGlyValLeuGlyThrIleLeuThr505560MetValArgThrGluGlyProArgSerProTyrSerGlyLeuValAla65707580GlyLeuHisArgGlnMetSerPheAlaSerIleArgIleGlyLeuTyr859095AspSerValLysGlnPheTyrThrProLysGlyAlaAspHisSerSer100105110ValAlaIleArgIleLeuAlaGlyCysThrThrGlyAlaMetAlaVal115120125ThrCysAlaGlnProThrAspValValLysValArgPheGlnAlaMet130135140IleArgLeuGlyThrGlyGlyGluArgLysTyrArgGlyThrMetAsp145150155160AlaTyrArgThrIleAlaArgGluGluGlyValArgGlyLeuTrpLys165170175GlyThrTrpProAsnIleThrArgAsnAlaIleValAsnCysAlaGlu180185190MetValThrTyrAspIleIleLysGluLysLeuLeuGluSerHisLeu195200205PheThrAspAsnPheProCysHisPheValSerAlaPheGlyAlaGly210215220PheCysAlaThrValValAlaSerProValAspValValLysThrArg225230235240TyrMetAsnAlaProLeuGlyArgTyrArgSerProLeuHisCysMet245250255LeuLysMetAlaAlaGlnGluGlyProThrAlaPheTyrLysGlyPhe260265270ValProSerPheLeuArgLeuGlyAlaTrpAsnValMetMetPheVal275280285ThrTyrGluGlnLeuLysArgAlaLeuMetLysValGlnValLeuArg290295300GluSerProPhe305(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1949 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GTCAGCTGGTGCACAGGGCCAGTGCCGAGCCAGGGACAGCAGAGACAACAGTGAATGGTG60AGGCCCGGCCGTCAGATCCTGCTGCTACCTAATGGAGTGGAGCCTTAGGGTGGCCCTGCA120CTACCCAACCTTGGCTAGACGCACAGCTTCCTCCCTGAACTGAAGCAAAAGATTGCCAGG180CAAGCTCTCTCCTCGGACCTCCATAGGCAGCAAAGGAACCAGGCCCATTCCCCGGGACCA240TGGTTGGACTTCAGCCCTCCGAAGTGCCTCCCACAACGGTTGTGAAGTTCCTGGGGGCCG300GCACTGCGGCCTGTTTTGCGGACCTCCTCACTTTTCCCCTGGACACCGCCAAGGTCCGTC360TGCAGATCCAAGGGGAGAACCCAGGGGCTCAGAGCGTGCAGTACCGCGGTGTGCTGGGTA420CCATCCTGACTATGGTGCGCACAGAGGGTCCCCGCAGCCCCTACAGCGGACTGGTCGCTG480GCCTGCACCGCCAGATGAGTTTTGCCTCCATTCGAATTGGCCTCTACGACTCTGTCAAGC540AGTTCTACACCCCCAAGGGAGCGGACCACTCCAGCGTCGCCATCAGGATTCTGGCAGGCT600GCACGACAGGAGCCATGGCAGTGACCTGCGCCCAGCCCACGGATGTGGTGAAGGTCCGAT660TTCAAGCCATGATACGCCTGGGAACTGGAGGAGAGAGGAAATACAGAGGGACTATGGATG720CCTACAGAACCATCGCCAGGGAGGAAGGAGTCAGGGGCCTGTGGAAAGGGACTTGGCCCA780ACATCACAAGAAATGCCATTGTCAACTGTGCTGAGATGGTGACCTACGACATCATCAAGG840AGAAGTTGCTGGAGTCTCACCTGTTTACTGACAACTTCCCCTGTCACTTTGTCTCTGCCT900TTGGAGCTGGCTTCTGTGCCACAGTGGTGGCCTCCCCGGTGGATGTGGTAAAGACCCGAT960ACATGAACGCTCCCCTAGGCAGGTACCGCAGCCCTCTGCACTGTATGCTGAAGATGGTGG1020CTCAGGAGGGACCCACGGCCTTCTACAAAGGATTTGTGCCCTCCTTTCTGCGTCTGGGAG1080CTTGGAACGTGATGATGTTTGTAACATATGAGCAACTGAAGAGGGCCTTAATGAAAGTCC1140AGGGTGTTGGGAAGATAGAAAGCGAAGCAGACATGGAAGCACTTCCTAACAAGGCCTGTC1200ATCGTCATCATCTACAAATGGCAAGAACGAGAACAGCTGCTCTTCTGCCCTCTCTCTCGG1260AGGTTTTCTCATCTCAGGGTCCTACCTGCCAGGCTCCTGACCAGCTCCACCTGCCCACAC1320TTCCTCCTGCTCTCGCTGCCTTTGGCTGCAGAGCCTTTGCTCCTCCTGTTAAGCCTTCAG1380TCTTCCATCTGCAAAAGGGAGGGCAAAGCACAGGACCAACTTCCAAGCTTAAAAATGCAC1440ATCTGACAACAAAATGGCTCAGTGGGGTCCATTCATGGGACCCACATGGTGGAAGGACAG1500AATGGACTCTTGCAAATTGTCCTCTGACCTCCATTTGAGCGCCCTATACATGTGACTGTA1560CATATGTACAAACACGATAAAGATGGAAACACATGTAAAAACATAAAAATAAAAAGTTGT1620ACTGGATGTGGTGGTTTGAATGAGATGTTCCTCGTGTCTCGGGCATTTGAAGACTTGCTC1680CCCAGTTGTTGGCGGCTGTTTGGGGAGGCTTAGAAGATGTGGCCTTTTGGGAAGCAGGGT1740GTCATTGAGGACTGGCTTGGAGAGCCTAAAGATCCGAGGCACTCCCAGTTTCTCTGGTTT1800TTCATTTTGAGGTGTGAGGTCTTATTGGCTGCACCAGTCTCCATGCCTGTCTGTTGCCCG1860GCCTCCTCACCATGATGGACTTTTATCTCTCTGTACTTGTAAGCCCCAAATAAACCTTCC1920ATCTGTGAAAAAAAAAAAAAAAAAAAAAA1949(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 432 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetValGlyLeuGlnProSerGluValProProThrThrValValLys151015PheLeuGlyAlaGlyThrAlaAlaCysPheAlaAspLeuLeuThrPhe202530ProLeuAspThrAlaLysValArgLeuGlnIleGlnGlyGluAsnPro354045GlyAlaGlnSerValGlnTyrArgGlyValLeuGlyThrIleLeuThr505560MetValArgThrGluGlyProArgSerProTyrSerGlyLeuValAla65707580GlyLeuHisArgGlnMetSerPheAlaSerIleArgIleGlyLeuTyr859095AspSerValLysGlnPheTyrThrProLysGlyAlaAspHisSerSer100105110ValAlaIleArgIleLeuAlaGlyCysThrThrGlyAlaMetAlaVal115120125ThrCysAlaGlnProThrAspValValLysValArgPheGlnAlaMet130135140IleArgLeuGlyThrGlyGlyGluArgLysTyrArgGlyThrMetAsp145150155160AlaTyrArgThrIleAlaArgGluGluGlyValArgGlyLeuTrpLys165170175GlyThrTrpProAsnIleThrArgAsnAlaIleValAsnCysAlaGlu180185190MetValThrTyrAspIleIleLysGluLysLeuLeuGluSerHisLeu195200205PheThrAspAsnPheProCysHisPheValSerAlaPheGlyAlaGly210215220PheCysAlaThrValValAlaSerProValAspValValLysThrArg225230235240TyrMetAsnAlaProLeuGlyArgTyrArgSerProLeuHisCysMet245250255LeuLysMetValAlaGlnGluGlyProThrAlaPheTyrLysGlyPhe260265270ValProSerPheLeuArgLeuGlyAlaTrpAsnValMetMetPheVal275280285ThrTyrGluGlnLeuLysArgAlaLeuMetLysValGlnGlyValGly290295300LysIleGluSerGluAlaAspMetGluAlaLeuProAsnLysAlaCys305310315320HisArgHisHisLeuGlnMetAlaArgThrArgThrAlaAlaLeuLeu325330335ProSerLeuSerGluValPheSerSerGlnGlyProThrCysGlnAla340345350ProAspGlnLeuHisLeuProThrLeuProProAlaLeuAlaAlaPhe355360365GlyCysArgAlaPheAlaProProValLysProSerValPheHisLeu370375380GlnLysGlyGlyGlnSerThrGlyProThrSerLysLeuLysAsnAla385390395400HisLeuThrThrLysTrpLeuSerGlyValHisSerTrpAspProHis405410415GlyGlyArgThrGluTrpThrLeuAlaAsnCysProLeuThrSerIle420425430(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1777 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:GTCAGCTGGTGCACAGGGCCAGTGCCGAGCCAGGGACAGCAGAGACAACAGTGAATGGTG60AGGCCCGGCCGTCAGATCCTGCTGCTACCTAATGGAGTGGAGCCTTAGGGTGGCCCTGCA120CTACCCAACCTTGGCTAGACGCACAGCTTCCTCCCTGAACTGAAGCAAAAGATTGCCAGG180CAAGCTCTCTCCTCGGACCTCCATAGGCAGCAAAGGAACCAGGCCCATTCCCCGGGACCA240TGGTTGGACTTCAGCCCTCCGAAGTGCCTCCCACAACGGTTGTGAAGTTCCTGGGGGCCG300GCACTGCGGCCTGTTTTGCGGACCTCCTCACTTTTCCCCTGGACACCGCCAAGGTCCGTC360TGCAGATCCAAGGGGAGAACCCAGGGGCTCAGAGCGTGCAGTACCGCGGTGTGCTGGGTA420CCATCCTGACTATGGTGCGCACAGAGGGTCCCCGCAGCCCCTACAGCGGACTGGTCGCTG480GCCTGCACCGCCAGATGAGTTTTGCCTCCATTCGAATTGGCCTCTACGACTCTGTCAAGC540AGTTCTACACCCCCAAGGGAGCGGACCACTCCAGCGTCGCCATCAGGATTCTGGCAGGCT600GCACGACAGGAGCCATGGCAGTGACCTGCGCCCAGCCCACGGATGTGGTGAAGGTCCGAT660TTCAAGCCATGATACGCCTGGGAACTGGAGGAGAGAGGAAATACAGAGGGACTATGGATG720CCTACAGAACCATCGCCAGGGAGGAAGGAGTCAGGGGCCTGTGGAAAGGGACTTGGCCCA780ACATCACAAGAAATGCCATTGTCAACTGTGCTGAGATGGTGACCTACGACATCATCAAGG840AGAAGTTGCTGGAGTCTCACCTGTTTACTGACAACTTCCCCTGTCACTTTGTCTCTGCCT900TTGGAGCTGGCTTCTGTGCCACAGTGGTGGCCTCCCCGGTGGATGTGGTAAAGACCCGAT960ACATGAACGCTCCCCTAGGCAGGTACCGCAGCAGGACTCAGAATCTTTAGGGAATTGTTA1020GGACTGGTAAAAGAATTTCCACCTTAGGGCAAGAACGAGAACAGCTGCTCTTCTGCCTTC1080TCTCTCGGAGGTTTTCTCATCTCAGGGTCCTACCTGCCAGGCTCCTGACCAGCTCCACCT1140GCCCACACTTCCTCCTGCTCTCGCTGCCTTTGGCTGCAGAGCCTTTGCTCCTCCTGTTAA1200GCCTTCAGTCTTCCATCTGCAAAAGGGAGGGCAAAGCACAGGACCAACTTCCAAGCTTAA1260AAATGCACATCTGACAACAAAATGGCTCAGTGGGGTCCATTCATGGGACCCACATGGTGG1320AAGGACAGAATGGACTCTTGCAAATTGTCCTCTGACCTCCATTTGAGCGCCCTATACATG1380TGACTGTACATATGTACAAACACGATAAAGATGGAAACACATGTAAAAACATAAAAATAA1440AAAGTTGTACTGGATGTGGTGGTTTGAATGAGATGTTCCTCGTGTCTCGGGCATTTGAAG1500ACTTGCTCCCCAGTTGTTGGCGGCTGTTTGGGGAGGCTTAGAAGATGTGGCCTTTTGGGA1560AGCAGGGTGTCATTGAGGACTGGCTTGGAGAGCCTAAAGATCCGAGGCACTCCCAGTTTC1620TCTGGTTTTTCATTTTGAGGTGTGAGGTCTTATTGGCTGCACCAGTCTCCATGCCTGTCT1680GTTGCCCGGCCTCCTCACCATGATGGACTTTTATCTCTCTGTACTTGTAAGCCCCAAATA1740AACCTTCCATCTGTGAAAAAAAAAAAAAAAAAAAAAA1777(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 256 amino acids(B) TYPE: amino acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:MetValGlyLeuGlnProSerGluValProProThrThrValValLys151015PheLeuGlyAlaGlyThrAlaAlaCysPheAlaAspLeuLeuThrPhe202530ProLeuAspThrAlaLysValArgLeuGlnIleGlnGlyGluAsnPro354045GlyAlaGlnSerValGlnTyrArgGlyValLeuGlyThrIleLeuThr505560MetValArgThrGluGlyProArgSerProTyrSerGlyLeuValAla65707580GlyLeuHisArgGlnMetSerPheAlaSerIleArgIleGlyLeuTyr859095AspSerValLysGlnPheTyrThrProLysGlyAlaAspHisSerSer100105110ValAlaIleArgIleLeuAlaGlyCysThrThrGlyAlaMetAlaVal115120125ThrCysAlaGlnProThrAspValValLysValArgPheGlnAlaMet130135140IleArgLeuGlyThrGlyGlyGluArgLysTyrArgGlyThrMetAsp145150155160AlaTyrArgThrIleAlaArgGluGluGlyValArgGlyLeuTrpLys165170175GlyThrTrpProAsnIleThrArgAsnAlaIleValAsnCysAlaGlu180185190MetValThrTyrAspIleIleLysGluLysLeuLeuGluSerHisLeu195200205PheThrAspAsnPheProCysHisPheValSerAlaPheGlyAlaGly210215220PheCysAlaThrValValAlaSerProValAspValValLysThrArg225230235240TyrMetAsnAlaProLeuGlyArgTyrArgSerArgThrGlnAsnLeu245250255__________________________________________________________________________
Claims
1. An isolated or recombinant nucleic acid encoding a polypeptide comprising the amino acid sequence set forth as SEQ ID NO: 2, 4 or 6.
2. The isolated or recombinant nucleic acid according to claim 1, wherein the isolated or recombinant nucleic acid encodes a polypeptide comprising the amino acid sequence set forth as SEQ ID NO: 2.
3. A cell comprising the recombinant nucleic acid according to claim 2.
4. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 2 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
c) isolating said translation product.
5. The isolated or recombinant nucleic acid according to claim 1, wherein the isolated or recombinant nucleic acid encodes a polypeptide comprising the amino acid sequence set forth as SEQ ID NO: 4.
6. A cell comprising the recombinant nucleic acid according to claim 5.
7. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 5 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
c) isolating said translation product.
8. The isolated or recombinant nucleic acid according to claim 1, wherein the isolated or recombinant nucleic acid encodes a polypeptide comprising the amino acid sequence set forth as SEQ ID NO: 6.
9. A cell comprising the recombinant nucleic acid according to claim 8.
10. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 8 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
c) isolating said translation product.
11. An isolated or recombinant nucleic acid comprising an entire strand of the nucleic acid sequence set forth as SEQ ID NO: 1, 3 or 5.
12. The isolated or recombinant nucleic acid according to claim 11, wherein the isolated or recombinant nucleic acid comprises an entire strand of the nucleic acid sequence set forth as SEQ ID NO: 1.
13. A cell comprising the recombinant nucleic acid according to claim 12.
14. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 12 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
c) isolating said translation product.
15. The isolated or recombinant nucleic acid according to claim 11, wherein the isolated or recombinant nucleic acid comprises an entire strand of the nucleic acid sequence set forth as SEQ ID NO: 3.
16. A cell comprising the recombinant nucleic acid according to claim 15.
17. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 15 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
c) isolating said translation product.
18. The isolated or recombinant nucleic acid according to claim 11, wherein the isolated or recombinant nucleic acid comprises an entire strand of the nucleic acid sequence set forth as SEQ ID NO: 5.
19. A cell comprising the recombinant nucleic acid according to claim 18.
20. A method of making a polypeptide, said method comprising the steps of:
a) introducing the isolated or recombinant nucleic acid according to claim 18 into a host cell or extract;
b) incubating said host cell or extract under conditions whereby said isolated or recombinant nucleic acid is expressed as a transcript and said transcript is expressed as a translation product comprising said polypeptide; and
Patent Grant
5846779
