Nucleic acids, proteins, and antibodies

Abstract

The present invention relates to novel musculoskeletal system related polynucleotides and the polypeptides encoded by these polynucleotides herein collectively known as “musculoskeletal system antigens,” and the use of such musculoskeletal system antigens for detecting disorders of the musculoskeletal system, particularly the presence of cancer and cancer metastases. More specifically, isolated musculoskeletal system associated nucleic acid molecules are provided encoding novel musculoskeletal system associated polypeptides. Novel musculoskeletal system polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human musculoskeletal system associated polynucleotides and/or polypeptides. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to the musculoskeletal system, including cancer of musculoskeletal tissues, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention further relates to methods and/or compositions for inhibiting the production and function of the polypeptides of the present invention.

Description

STATEMENT UNDER 37 C.F.R. §1.77(b)(4)

[0001] This application refers to a “Sequence Listing” listed below, which is provided as an electronic document on two identical compact discs (CD-R), labeled “Copy 1” and “Copy 2.” These compact discs each contain the file “PC005Cl_seqList.txt” (7,614,434 bytes, created on Sep. 13, 2002), which is hereby incorporated in its entirety herein.

[0002] The Sequence Listing may be viewed on an IBM-PC machine running the MS-Windows operating system.

FIELD OF THE INVENTION

[0003] The present invention relates to novel musculoskeletal system related polynucleotides, the polypeptides encoded by these polynucleotides herein collectively referred to as “musculoskeletal system antigens,” and antibodies that immunospecifically bind these polypeptides, and the use of such musculoskeletal system polynucleotides, antigens, and antibodies for detecting, treating, preventing and/or prognosing disorders of the musculoskeletal system, including, but not limited to, the presence of cancer and cancer metastases. More specifically, isolated musculoskeletal system nucleic acid molecules are provided encoding novel musculoskeletal system polypeptides. Novel musculoskeletal system polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human musculoskeletal system polynucleotides, polypeptides, and/or antibodies. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to the musculoskeletal system, including musculoskeletal system cancer, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The invention further relates to methods and/or compositions for inhibiting or promoting the production and/or function of the polypeptides of the invention.

BACKGROUND OF THE INVENTION

[0004] The Human Musculoskeletal System is comprised of skeleton (e.g., bone), muscle, tendon, ligament, and other components of joints, which constitute the basic structural framework of the body. Together, the components of this system provide the strength, stability, frame, and elasticity necessary for movement. Additionally, the musculoskeletal system protects the internal organs, stores minerals, and produces blood.

[0005] The primary component of the musculoskeletal system is the skeleton itself. The skeleton is a highly organized connection of bones responsible for many functions, including supporting the body against gravity, providing sites for muscle attachment, producing blood cells, protecting the organs and other soft body tissues, and permitting flexible movement.

[0006] Anatomically, two types of bones can be distinguished in the skeleton: flat bones (e.g., skull bones, scapula, manible, and ileum) and long bones (e.g., tibia, femur, and humerus). The long bone is composed of two wider extremities (e.g., the epiphyses), a cylindrical tube in the middle (e.g., the midshaft or diaphysis), and a developmental zone (e.g., the metaphysis) between them. In a growing long bone, the epiphysis and the metaphysis are separated by a layer of cartilage (e.g., epiphyseal cartilage or growth plate), responsible for the longitudinal growth of the bones. The external part of the bones is formed by a layer of calcified tissue (e.g., the cortex or compact bone). In the diaphyisis, the cortex encloses the medullary cavity, the location of the hematopoietic bone marrow. Toward the metaphysis and epiphysis, the cortex becomes progressively thinner, containing a network of thin, calcified trabeculae (e.g., trabecular bone or spongy bone) and hematopoietic bone marrow. At the center of most bones is yellow marrow, which is used to store fats. Therefore, the cortical bone fulfills mainly a mechanical and protective function, and the trabecular bone fulfills a metabolic function.

[0007] Bone is a balanced, dynamic system, constantly degrading and regenerating. Bone is degraded by cells called osteoclasts that remove from the center of the bone, forming the central cavity of the long bones. Osteoblasts are cells found in the osteoid tissue (e.g., bone matrix prior to calcification) and are responsible for the production of the matrix constituents of bone (e.g., collagen and ground substance). As bone matrix is produced, osteoblasts become progressively embedded and differentiate into osteocytes, or bone cells. As calcification occurs, these osteocytes then differentiate into cortical bone or trabecular bone within the calcified collagen fiber matrix. Blood vessels penetrate the newly calcified bone, bringing the blood supply that will form the hematopoietic bone marrow.

[0008] Joints are formed when two bones come together and allow for bending and movement. Tough bands of connective tissue, called ligaments, surround the joints, join the two bones together, and keep the bones properly aligned. The joint capsule is lined by a synovial membrane, which produces synovial fluid for lubricating the joint. Joints may also contain fluid-filled sacs (e.g., bursa) that reduce friction in areas where skin, muscles, tendons, and ligaments rub over bones. Most joints are freely moving synovial joints; however, some joints (e.g, vertebrae) are partly movable and allow some some degree of flexibility with cartilage, or menisci, between the bones, while other joints (e.g., skull sutures) do not allow movement at all.

[0009] Composed of striated bundles of myosin and actin fibers, skeletal muscles have very long fiber-like cells that contract quickly, but only when stimulated by nerve cells. Muscle is attached to the bone by tough connective tissue, called tendons, and arranged in opposing, balancing groups around joints that facilitate balanced movement.

[0010] Although the musculoskeletal system was designed for strength and endurance, the components of this system can become worn, injured, or inflamed. These disorders can range from mild to severe and from acute to chronic. Generally, the treatment depends on the type and severity of the disorder.

[0011] Diseases and Disorders of the Bone

[0012] Several types of bone disorders occur from an imbalance of the growth and breakdown cycles of bone. The most common, osteoporosis, is a progressive decrease in the density of bones, causing them to weaken. Osteoporosis occurs in several different types and is seen more often in older women. Postmenopausal osteoporosis is generally found in women between the ages 51 and 75 and is caused by the lack of estrogen. Senile osteoporosis results not only from the imbalance between growth and breakdown but also from the calcium deficiency associated with age. Secondary osteoporosis is caused by secondary effects of another medical condition (e.g., chronic renal failure, hormonal disorders) or by drugs (e.g., barbiturates, anticonvulsants). Idiopathic juvenile osteoporosis is a rare form that occurs in children and young adults who, for no obvious reason, have weak bones. Treatment for all forms of osteoporosis is aimed at increasing bone density (e.g., estrogen intake, bisphosphonates, fluoride supplements).

[0013] Paget's Disease also results from an imbalance of the growth and breakdown of bone. The turnover rate is areas affected by Paget's Disease increases tremendously; resulting in abnormal, enlarged bone that is soft and weak. Although no specific genetic pattern has been determined, Paget's Disease tends to appear in family lineages. There is no direct treatment for Paget's Disease, rather treatment is given only alleviate pain and discomfort.

[0014] Bone disorders can also result from infection. Bone can be infected through three routes: bloodstream, direct invasion, and adjacent soft tissue infections. Osteomyclitis is a bone infection usually caused by bacteria (e.g., Staphylococcus aureus) which results in swelling of the soft bone marrow tissue, compression of the blood vessels, and possibly death of parts of bone. Pott's disease is an infection of the vertebrae by the bacteria that cause tuberculosis (e.g., Mycobacterium tuberculosis, M. bovis, or M. africanum.) For acute infections, antibiotics are generally the most effective treatment for this disease. However, if the infection is severe or chronic, surgery may also be required to remove the infected tissue and replaced with healthy bone, muscle, or skin.

[0015] Most bone carcinomas are benign. The most common type of benign bone tumor, usually occurring in people aged 10 to 20, is osteochrondroma. Osteochrondromas are growths on the surface of a bone that protrude as hard lumps. Benign chondromas, usually occurring in people aged 10 to 30, develop in the central part of the bone. Chrondroblastomas, usually occurring in people aged 10 to 20, are rare, painful tumors that grow in the ends of bones. Osteoid osteomas are very small tumors that commonly develop in the arms or legs but can occur in any bone. Giant cell tumors, usually occurring in people aged 20-40, most commonly originate in the ends of the bones and may extend into adjacent tissue. Treatment of these tumors generally involves pain management and, possibly, surgery to remove the tumor.

[0016] Although rare, malignant bone tumors may be primary or metastatic. In children, most malignant bone tumors are primary; in adults, most are metastatic. The most common type of malignant primary tumor, multiple myeloma, originates in the red bone marrow cells and most commonly occurs in older people. Osteosarcoma, usually occurring in people aged 10-20, commonly occurs in or around the knee and cause pain and swelling. These tumors tend to spread to the lungs. Chrondrosarcomas are slow-growing tumors composed of cancerous cartilage cells. Ewing's sarcoma, occurring most commonly in males aged 10 to 20, develop most often in arms and legs. These tumors can become large and can affect the entire length of a bone. Metastatic bone tumors most often originate from breast, lung, prostate, kidney and thyroid cancers.

[0017] Treatment for bone tumors depends on the type of cancer. Most treatments are complex and involve a combination of chemotherapy, radiotherapy, and surgery. Prompt treatment is especially important for malignant bone tumors.

[0018] Diseases and Disorders of Joints, Ligaments, and Tendons

[0019] The most commonly diseased tissue in the musculoskeletal system is the joint. Disorders affecting the joints and their associated components are considered connective tissue disorders because of the presence of large amounts of connective tissue in these structures. Most of the disorders of joints involve inflammation and may be the result of an immune or autoimmune reaction.

[0020] Treatment of joint disorders varies according to type and severity. Drug treatment is generally aimed at reducing inflammation. For mild inflammation and pain, drugs such as nonsteroidal anti-inflammatory drugs (NSAIDs, e.g., aspirin and ibuprofen) are commonly used. Alternative drug treatments, used in more severe cases, are corticosteroids (e.g., prednisone) and immunosuppressive drugs (e.g., methotrexate, azathioprine, and cyclophophamide). Other treatment plans, used in conjunction with drugs, include exercise, physical therapy, and sometimes surgery.

[0021] Arthritis, or inflammation of the joint, occurs in several forms. The most common form of arthritis, characterized by the degeneration of joint cartilage and adjacent bone, is osteoarthritis, or degenerative arthritis. Osteoarthritis causes the formation of rough, pitted cartilage in the joint resulting in limited joint movement, stiffness, and pain.

[0022] Another form of arthritis, rheumatoid arthritis, an autoimmune disorder, is caused when the immune system attacks the tissue (e.g., ligaments, synovial membrane, bursas) that surrounds the joints. The joints, including those in the extremities, become symmetrically inflamed, resulting in swelling, pain, and eventually, destruction of the interior of the joint. Psoriatic Arthritis, occurring in people who have psorasis, resembles rheumatoid arthritis; however, it doesn't produce the antibodies characteristic of arthritis.

[0023] Other autoimmune diseases may also affect the joints and tendons. For example, systemic lupus erythematosus may result in episodes of inflammation in the joints and tendons in addition to other connective tissues and organs. Joint inflammation is common with systemic lupus erythematosus and can lead to deformity and permanent damage to the joint and its surrounding tissue; however, the bone does not erode as it does in rheumatoid arthritis.

[0024] Joint disease may also result from infection. Reiter's syndrome, or reactive arthritis, is an inflammation of the joints and tendon attachments resulting from a bacterial infection originating in an area of the body other than the joints. There are two forms of Reiter's syndrome that occur more commonly in men aged 20 to 40. One occurs with sexually transmitted infections (e.g., clamydial infection); the other usually follows an intestinal infection (e.g., salmonellosis). Once a person is exposed to these infections, there appears to be a genetic predisposition to this type of disease.

[0025] Infectious arthritis develops from an infection of the synovial fluid and tissue of a joint. Different bacteria can infect a joint, depending on the person's age. Infants and young children are most commonly infected by gram-negative bacilli, Staphylococci, and Hemophilus influenzae. Older children and adults are most commonly infected by gonococci, staphylococci, and streptococci. Viruses (e.g., HIV, parvoviruses, and the viruses that cause rubella, mumps, and hepatitis B) can infect joints in people of any age. The joints most commonly infected are the knee, shoulder, wrist, hip, finger, and elbow and become red, warm to the touch, swollen, and painful.

[0026] Crystal deposits in the joints can cause arthritis and pain. Gout, characterized by sudden, recurring attacks of painful arthritis, is caused by the deposition of monosodium urate crystals in the joints. This accumulation generally accompanies hyperuricemia. In addition to managing the pain associated with this disorder, treatment also involves the administering of drugs to reduce the levels of uric acid in the blood by increasing the excretion of uric acid in the urine. Pseudogout, characterized by intermittent attacks of painful arthritis, is cause by the deposition of calcium pyrophosphate crystals. This disorder usually occurs in older people and causes the degeneration of the affected joints. Unfortunately, there is no effective long-term treatment available for the removals of the calcium pyrophosphate crystals. The only treatment available for pseudogout is pain management.

[0027] Diseases and Disorders of Muscles

[0028] Damage to muscles can cause pain, limit control over movement, and reduce the normal range of motion. Diseases of the muscles can develop from injury, inflammation, spasms, or inheritance.

[0029] Several muscle disorders are inherited. Muscular dystrophies are a group of inherited muscle disorders leading to muscle weakness. Duchenne's and Becker's muscular dystrophies are caused by different gene defects on the same gene resulting in weakness of the muscles closest to the torso. The gene for both diseases is recessive and carried on the X chromosome. Duchenne's muscular dystrophy is characterized by an almost total lack of dystrophin protein, resulting in progressive muscle loss, including the heart muscle, and ultimately resulting in death by the age of 20. Becker's muscular dystrophy is a less severe illness characterized by production of an oversized dystrophin protein that does not function properly. Landouszy-Dejerine muscular dystrophy is transmitted by an autosomal dominant gene and results in the muscles of the face, shoulder, and legs weakening. Neither Becker's nor Landouszy-Dejerine muscular dystrophy is fatal. Currently, there is no cure for muscular dystrophies. Treatment regimens involve physical therapy and exercise to prevent the muscles from contracting permanently around the joints, and sometimes surgery to release tight, painful muscles.

[0030] Myotonic myopathies are a group of inherited muscle disorders in which the muscles are not capable of fully relaxing after contraction, leading to weakness, muscle spasms, and contractures. For example, Steinert's disease is an autosomal dominant disorder producing both weakness and tight, contracted muscles, especially in the hands. Symptoms can range from mild to severe. In the most severe cases, extreme muscle weakness and many other symptoms (e.g., cataracts, irregular heartbeat, diabetes, and mental retardation) can occur, resulting in death by the age of 50.

[0031] Pompe's disease is a severe, autosomal recessive, glycogen storage disease in infants where glycogen accumulates in the liver, muscles, nerves, and heart, preventing them from functioning properly. This disease is fatal by age 2; however, there are less severe forms of Pompe's disease that can affect older children and adults, causing weakness of the extremities and diminished ability to breathe deeply. Current treatments for the less severe forms of Pompe's disease and other glycogen storage diseases involve limiting exercise and diuretics to reduce the level of myoglobin released into the blood due to the muscle damage.

[0032] Periodic Paralysis is another rare autosomal dominant disorder that causes sudden attacks of weakness and paralysis where the muscles do not respond to normal nerve impulses or artificial stimulation. In some families, periodic paralysis has been linked to the level of potassium in the blood with some families influenced by high levels (hyperkalemia) and some families by low levels (hypokalemia). Diet (e.g., avoidance of carbohydrate-rich food) and treatment with acetazolamide are the most common treatment to control periodic paralysis episodes.

[0033] Muscle disorders may result from inflammation. For example, Polymyositis is a chronic connective tissue disease characterized by painful inflammation and disabling muscle weakness and deterioration. Although the direct cause is unknown, cancer, viruses, or autoimmune reactions may play a role. Current treatment regimens include restricting activities during periods of intense inflammation and treatment with corticosteroids or immunosuppressive drugs to improve the strength and relieve the pain and swelling associated with the disease.

[0034] Although the majority of muscle disorders involve deterioration and weakening of the muscle, some disorder result in only stiffness and pain. For example, Polymyalgia rheumatica causes severe pain and stiffness in the neck, shoulders, and hips, especially in the morning and after periods of inactivity. No damage to the muscle is detected; however, erythrocyte sedimentation rate and C-reactive protein levels in the blood are high. Drug treatment involving corticosteroids are generally used to treat this disease.

[0035] The discovery of new human musculoskeletal system associated polynucleotides, the polypeptides encoded by them, and the antibodies that immunospecifically bind these polypeptides, satisfies a need in the art by providing new compositions which are useful in the diagnosis, treatment, prevention and/or prognosis of disorders of musculoskeletal system, particularly disorders of the musculoskeletal system, including, but not limited to, bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or as described under “Musculoskeletal System Disorders” below.

SUMMARY OF THE INVENTION

[0036] The present invention relates to novel musculoskeletal system related polynucleotides, the polypeptides encoded by these polynucleotides herein collectively referred to as “musculoskeletal system antigens,” and antibodies that immunospecifically bind these polypeptides, and the use of such musculoskeletal system polynucleotides, antigens, and antibodies for detecting, treating, preventing and/or prognosing disorders of the musculoskeletal system system, including, but not limited to, the presence of cancer and cancer metastases. More specifically, isolated musculoskeletal system nucleic acid molecules are provided encoding novel musculoskeletal system polypeptides. Novel musculoskeletal system polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human musculoskeletal system polynucleotides, polypeptides, and/or antibodies. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to the musculoskeletal system, including cancer of musculoskeletal system tissues, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The invention further relates to methods and/or compositions for inhibiting or promoting the production and/or function of the polypeptides of the invention.

DETAILED DESCRIPTION

[0037] Tables

[0038] Table 1A summarizes some of the polynucleotides encompassed by the invention (including cDNA clones related to the sequences (Clone ID NO:Z), contig sequences (contig identifier (Contig ID:) and contig nucleotide sequence identifier (SEQ ID NO:X)) and further summarizes certain characteristics of these polynucleotides and the polypeptides encoded thereby. The first column provides a unique clone identifier, “Clone ID NO:Z”, for a cDNA plasmid related to each musculoskeletal system associated contig sequence disclosed in Table 1A. The second column provides a unique contig identifier, “Contig ID:” for each of the contig sequences disclosed in Table 1A. The third column provides the sequence identifier, “SEQ ID NO:X”, for each of the contig polynucleotide sequences disclosed in Table 1A. The fourth column, “ORF (From-To)”, provides the location (i.e., nucleotide position numbers) within the polynucleotide sequence of SEQ ID NO:X that delineate the preferred open reading frame (ORF) shown in the sequence listing and referenced in Table 1A as SEQ ID NO:Y (column 5). Column 6 lists residues comprising predicted epitopes contained in the polypeptides encoded by each of the preferred ORFs (SEQ ID NO:Y). Identification of potential immunogenic regions was performed according to the method of Jameson and Wolf (CABIOS, 4:181-186 (1988)); specifically, the Genetics Computer Group (GCG) implementation of this algorithm, embodied in the program PEPTIDESTRUCTURE (Wisconsin Package v10.0, Genetics Computer Group (GCG), Madison, Wis.). This method returns a measure of the probability that a given residue is found on the surface of the protein. Regions where the antigenic index score is greater than 0.9 over at least 6 amino acids are indicated in Table 1A as “Predicted Epitopes.” In particular embodiments, musculoskeletal system associated polypeptides of the invention comprise, or alternatively consist of, one, two, three, four, five or more of the predicted epitopes described in Table 1A. It will be appreciated that depending on the analytical criteria used to predict antigenic determinants, the exact address of the determinant may vary slightly. Column 7, “Tissue Distribution” shows the expression profile of tissue, cells, and/or cell line libraries which express the polynucleotides of the invention. The first number in column 7 (preceding the colon), represents the tissue/cell source identifier code corresponding to the code and description provided in Table 4. Expression of these polynucleotides was not observed in the other tissues and/or cell libraries tested. For those identifier codes in which the first two letters are not “AR”, the second number in column 7 (following the colon), represents the number of times a sequence corresponding to the reference polynucleotide sequence (e.g., SEQ ID NO:X) was identified in the tissue/cell source. Those tissue/cell source identifier codes in which the first two letters are “AR” designate information generated using DNA array technology. Utilizing this technology, cDNAs were amplified by PCR and then transferred, in duplicate, onto the array. Gene expression was assayed through hybridization of first strand cDNA probes to the DNA array. cDNA probes were generated from total RNA extracted from a variety of different tissues and cell lines. Probe synthesis was performed in the presence of 33P dCTP, using oligo(dT) to prime reverse transcription. After hybridization, high stringency washing conditions were employed to remove non-specific hybrids from the array. The remaining signal, emanating from each gene target, was measured using a Phosphorimager. Gene expression was reported as Phosphor Stimulating Luminescence (PSL) which reflects the level of phosphor signal generated from the probe hybridized to each of the gene targets represented on the array. A local background signal subtraction was performed before the total signal generated from each array was used to normalize gene expression between the different hybridizations. The value presented after “[array code]:” represents the mean of the duplicate values, following background subtraction and probe normalization. One of skill in the art could routinely use this information to identify normal and/or diseased tissue(s) which show a predominant expression pattern of the corresponding polynucleotide of the invention or to identify polynucleotides which show predominant and/or specific tissue and/or cell expression. Column 8, “Cytologic Band,” provides the chromosomal location of polynucleotides corresponding to SEQ ID NO:X. Chromosomal location was determined by finding exact matches to EST and cDNA sequences contained in the NCBI (National Center for Biotechnology Information) UniGene database. Given a presumptive chromosomal location, disease locus association was determined by comparison with the Morbid Map, derived from Online Mendelian Inheritance in Man (Online Mendelian Inheritance in Man, OMIM™. McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, Md.) 2000. World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/). If the putative chromosomal location of the Query overlapped with the chromosomal location of a Morbid Map entry, an OMIM identification number is provided in Table 1A, column 9 labeled “OMIM Disease Reference(s)”. A key to the OMIM reference identification numbers is provided in Table 5.

[0039] Table 1B summarizes additional polynucleotides encompassed by the invention (including cDNA clones related to the sequences (Clone ID NO:Z), contig sequences (contig identifier (Contig ID:) contig nucleotide sequence identifiers (SEQ ID NO:X)), and genomic sequences (SEQ ID NO:B). The first column provides a unique clone identifier, “Clone ID NO:Z”, for a cDNA clone related to each contig sequence. The second column provides the sequence identifier, “SEQ ID NO:X”, for each contig sequence. The third column provides a unique contig identifier, “Contig ID:” for each contig sequence. The fourth column, provides a BAC identifier “BAC ID NO:A” for the BAC clone referenced in the corresponding row of the table. The fifth column provides the nucleotide sequence identifier, “SEQ ID NO:B” for a fragment of the BAC clone identified in column four of the corresponding row of the table. The sixth column, “Exon From-To”, provides the location (i.e., nucleotide position numbers) within the polynucleotide sequence of SEQ ID NO:B which delineate certain polynucleotides of the invention that are also exemplary members of polynucleotide sequences that encode polypeptides of the invention (e.g., polypeptides containing amino acid sequences encoded by the polynucleotide sequences delineated in column six, and fragments and variants thereof).

[0040] Table 2 summarizes homology and features of some of the polypeptides of the invention. The first column provides a unique clone identifier, “Clone ID NO:Z”, corresponding to a cDNA disclosed in Table 1A. The second column provides the unique contig identifier, “Contig ID:” corresponding to contigs in Table 1A and allowing for correlation with the information in Table 1A. The third column provides the sequence identifier, “SEQ ID NO:X”, for the contig polynucleotide sequences. The fourth column provides the analysis method by which the homology/identity disclosed in the row was determined. Comparisons were made between polypeptides encoded by the polynucleotides of the invention and either a non-redundant protein database (herein referred to as “NR”), or a database of protein families (herein referred to as “PFAM”) as further described below. The fifth column provides a description of PFAM/NR hits having significant matches to a polypeptide of the invention. Column six provides the accession number of the PFAM/NR hit disclosed in the fifth column. Column seven, “Score/Percent Identity”, provides a quality score or the percent identity, of the hit disclosed in column five. Columns 8 and 9, “NT From” and “NT To” respectively, delineate the polynucleotides in “SEQ ID NO:X” that encode a polypeptide having a significant match to the PFAM/NR database as disclosed in the fifth column. In specific embodiments, polypeptides of the invention comprise, or alternatively consist of, an amino acid sequence encoded by the polynucleotides in SEQ ID NO:X as delineated in columns 8 and 9, or fragments or variants thereof.

[0041] Table 3 provides polynucleotide sequences that may be disclaimed according to certain embodiments of the invention. The first column provides a unique clone identifier, “Clone ID NO:Z”, for a cDNA clone related to musculoskeletal system associated contig sequences disclosed in Table 1A. The second column provides the sequence identifier, “SEQ ID NO:X”, for contig polynucleotide sequences disclosed in Table 1A. The third column provides the unique contig identifier, “Contig ID”, for contigs disclosed in Table 1A. The fourth column provides a unique integer ‘a’ where ‘a’ is any integer between 1 and the final nucleotide minus 15 of SEQ ID NO:X, represented as “Range of a”, and the fifth column provides a unique integer ‘b’ where ‘b’ is any integer between 15 and the final nucleotide of SEQ ID NO:X, represented as “Range of b”, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO:X, and where b is greater than or equal to a+14. For each of the polynucleotides shown as SEQ ID NO:X, the uniquely defined integers can be substituted into the general formula of a-b, and used to describe polynucleotides which may be preferably excluded from the invention. In certain embodiments, preferably excluded from the polynucleotides of the invention (including polynucleotide fragments and variants as described herein and diagnostic and/or therapeutic uses based on these polynucleotides) are at least one, two, three, four, five, ten, or more of the polynucleotide sequence(s) having the accession number(s) disclosed in the sixth column of this Table (including for example, published sequence in connection with a particular BAC clone). In further embodiments, preferably excluded from the invention are the specific polynucleotide sequence(s) contained in the clones corresponding to at least one, two, three, four, five, ten, or more of the available material having the accession numbers identified in the sixth column of this Table (including for example, the actual sequence contained in an identified BAC clone).

[0042] Table 4 provides a key to the tissue/cell source identifier code disclosed in Table 1A, column 7. Column 1 provides the key to the tissue/cell source identifier code disclosed in Table 1A, Column 7. Columns 2-5 provide a description of the tissue or cell source. Codes corresponding to diseased tissues are indicated in column 6 with the word “disease”. The use of the word “disease” in column 6 is non-limiting. The tissue or cell source may be specific (e.g. a neoplasm), or may be disease-associated (e.g., a tissue sample from a normal portion of a diseased organ). Furthermore, tissues and/or cells lacking the “disease” designation may still be derived from sources directly or indirectly involved in a disease state or disorder, and therefore may have a further utility in that disease state or disorder. In numerous cases where the tissue/cell source is a library, column 7 identifies the vector used to generate the library.

[0043] Table 5 provides a key to the OMIM™ reference identification numbers disclosed in Table 1A, column 9. OMIM reference identification numbers (Column 1) were derived from Online Mendelian Inheritance in Man (Online Mendelian Inheritance in Man, OMIM™. McKusick-Nathans Institute for Genetic Medicine, Johns Hopkins University (Baltimore, Md.) and National Center for Biotechnology Information, National Library of Medicine, (Bethesda, Md.) 2000. World Wide Web URL: http://www.ncbi.nlm.nih.gov/omim/). Column 2 provides diseases associated with the cytologic band disclosed in Table 1A, column 8, as determined from the Morbid Map database.

[0044] Table 6 summarizes ATCC Deposits, Deposit dates, and ATCC designation numbers of deposits made with the ATCC in connection with the present application.

[0045] Table 7 shows the cDNA libraries sequenced, tissue source description, vector information and ATCC designation numbers relating to these cDNA libraries.

[0046] Table 8 provides a physical characterization of clones encompassed by the invention. The first column provides the unique clone identifier, “Clone ID NO:Z”, for certain cDNA clones of the invention, as described in Table 1A. The second column provides the size of the cDNA insert contained in the corresponding cDNA clone.

[0047] Definitions

[0048] The following definitions are provided to facilitate understanding of certain terms used throughout this specification.

[0049] In the present invention, “isolated” refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. The term “isolated” does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide sequences of the present invention.

[0050] As used herein, a “polynucleotide” refers to a molecule having a nucleic acid sequence encoding SEQ ID NO:Y or a fragment or variant thereof, a nucleic acid sequence contained in SEQ ID NO:X (as described in column 3 of Table 1A) or the complement thereof, a cDNA sequence contained in Clone ID NO:Z (as described in column 1 of Table 1A and contained within a library deposited with the ATCC); a nucleotide sequence encoding the polypeptide encoded by a nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B or a fragment or variant thereof, or a nucleotide coding sequence in SEQ ID NO:B as defined in column 6 of Table 1B or the complement thereof. For example, the polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5′ and 3′ untranslated sequences, the coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence. Moreover, as used herein, a “polypeptide” refers to a molecule having an amino acid sequence encoded by a polynucleotide of the invention as broadly defined (obviously excluding poly-Phenylalanine or poly-Lysine peptide sequences which result from translation of a polyA tail of a sequence corresponding to a cDNA).

[0051] As used herein, a “musculoskeletal system antigen” refers collectively to any polynucleotide disclosed herein (e.g., a nucleic acid sequence contained in SEQ ID NO:X or the complement therof, or cDNA sequence contained in Clone ID NO:Z, or a nucleotide sequence encoding the polypeptide encoded by a nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B, or a nucleotide coding sequence in SEQ ID NO:B as defined in column 6 of Table 1B or the complement thereof and fragments or variants thereof as described herein) or any polypeptide disclosed herein (e.g., an amino acid sequence contained in SEQ ID NO:Y, an amino acid sequence encoded by SEQ ID NO:X, or the complement thereof, an amino acid sequence encoded by the cDNA sequence contained in Clone ID NO:Z, an amino acid sequence encoded by SEQ ID NO:B, or the complement thereof, and fragments or variants thereof as described herein). These musculoskeletal system antigens have been determined to be predominantly expressed in musculoskeletal system tissues, including normal or diseased tissues (as shown in Table 1A column 7 and Table 4).

[0052] In the present invention, “SEQ ID NO:X” was often generated by overlapping sequences contained in multiple clones (contig analysis). A representative clone containing all or most of the sequence for SEQ ID NO:X is deposited at Human Genome Sciences, Inc. (HGS) in a catalogued and archived library. As shown, for example, in column 1 of Table 1A, each clone is identified by a cDNA Clone ID (identifier generally referred to herein as Clone ID NO:Z). Each Clone ID is unique to an individual clone and the Clone ID is all the information needed to retrieve a given clone from the HGS library. Furthermore, certain clones disclosed in this application have been deposited with the ATCC on Oct. 5, 2000, having the ATCC designation numbers PTA 2574 and PTA 2575; and on Jan. 5, 2001, having the depositor reference numbers TS-1, TS-2, AC-1, and AC-2. In addition to the individual cDNA clone deposits, most of the cDNA libraries from which the clones were derived were deposited at the American Type Culture Collection (hereinafter “ATCC”). Table 7 lists the deposited cDNA libraries by name and links each library to an ATCC Deposit. Library names contain four characters, for example, “HTWE.”The name of a cDNA clone (Clone ID NO:Z) isolated from that library begins with the same four characters, for example “HTWEP07”. As mentioned below, Table 1A correlates the Clone ID NO:Z names with SEQ ID NO:X. Thus, starting with an SEQ ID NO:X, one can use Tables 1A, 6 and 7 to determine the corresponding Clone ID NO:Z, which library it came from and which ATCC deposit the library is contained in. Furthermore, it is possible to retrieve a given cDNA clone from the source library by techniques known in the art and described elsewhere herein. The ATCC is located at 10801 University Boulevard, Manassas, Va. 20110-2209, USA. The ATCC deposits were made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedure.

[0053] In specific embodiments, the polynucleotides of the invention are at least 15, at least 30, at least 50, at least 100, at least 125, at least 500, or at least 1000 continuous nucleotides but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, 7.5 kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length. In a further embodiment, polynucleotides of the invention comprise a portion of the coding sequences, as disclosed herein, but do not comprise all or a portion of any intron. In another embodiment, the polynucleotides comprising coding sequences do not contain coding sequences of a genomic flanking gene (i.e., 5′ or 3′ to the gene of interest in the genome). In other embodiments, the polynucleotides of the invention do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).

[0054] A “polynucleotide” of the present invention also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ ID NO:X, or the complement thereof (e.g., the complement of any one, two, three, four, or more of the polynucleotide fragments described herein), the polynucleotide sequence delineated in columns 8 and 9 of Table 2 or the complement thereof, and/or cDNA sequences contained in Clone ID NO:Z (e.g., the complement of any one, two, three, four, or more of the polynucleotide fragments, or the cDNA clone within the pool of cDNA clones deposited with the ATCC, described herein) and/or the polynucleotide sequence delineated in column 6 of Table 1B or the complement thereof. “Stringent hybridization conditions” refers to an overnight incubation at 42 degree C. in a solution comprising 50% formamide, 5×SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 65 degree C.

[0055] Also contemplated are nucleic acid molecules that hybridize to the polynucleotides of the present invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency), salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37 degree C. in a solution comprising 6×SSPE (20×SSPE=3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 ug/ml salmon sperm blocking DNA; followed by washes at 50 degree C. with 1×SSPE, 0.1% SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5×SSC).

[0056] Note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.

[0057] Of course, a polynucleotide which hybridizes only to polyA+ sequences (such as any 3′ terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of “polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using oligo dT as a primer).

[0058] The polynucleotide of the present invention can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the polynucleotide can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. A polynucleotide may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. “Modified” bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, “polynucleotide” embraces chemically, enzymatically, or metabolically modified forms.

[0059] The polypeptide of the present invention can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids. The polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, PROTEINS—STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth. Enzymol. 182:626-646 (1990); Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992).)

[0060] “SEQ ID NO:X” refers to a polynucleotide sequence described, for example, in Tables 1A or 2, while “SEQ ID NO:Y” refers to a polypeptide sequence described in column 5 of Table 1A. SEQ ID NO:X is identified by an integer specified in column 3 of Table 1A. The polypeptide sequence SEQ ID NO:Y is a translated open reading frame (ORF) encoded by polynucleotide SEQ ID NO:X. “Clone ID NO:Z” refers to a cDNA clone described in column 1 of Table 1A.

[0061] “A polypeptide having biological activity” refers to a polypeptide exhibiting activity similar to, but not necessarily identical to, an activity of a polypeptide of the present invention, including mature forms, as measured in a particular biological assay, with or without dose dependency. In the case where dose dependency does exist, it need not be identical to that of the polypeptide, but rather substantially similar to the dose-dependence in a given activity as compared to the polypeptide of the present invention (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity, and most preferably, not more than about three-fold less activity relative to the polypeptide of the present invention).

[0062] Table 1A summarizes some of the musculoskeletal system associated polynucleotides encompassed by the invention (including contig sequences (SEQ ID NO:X) and clones (Clone ID NO:Z) and further summarizes certain characteristics of these polynucleotides and the polypeptides encoded thereby.

[0063] Polynucleotides and Polypeptides

TABLE 1A
				AA		Tissue Distribution
				SEQ		Library code: count		OMIM
Clone ID	Contig	SEQ ID	ORF	ID		(see Table IV for	Cytologic	Disease
NO: Z	ID:	NO: X	(From-To)	NO: Y	Predicted Epitopes	Library Codes)	Band	Reference(s):
HANGA63	927404	11	168-254	1034		S0318: 1 and S0316: 1.
HANGA69	718174	12	86-268	1035	Ser-21 to His-27,	S0318: 1 and S0316: 1.
					Ser-33 to Ser-39.
HANGA85	746265	13	192-317	1036		S0318: 1 and S0316: 1.
HANGA92	791182	14	24-146	1037	Glu-8 to Phe-14,	S0318: 1 and S0316: 1.
					Ser-20 to Gly-27.
HANGC05	674059	15	2-157	1038	Met-2 to His-18,	S0318: 1 and S0316: 1.
					Phe-21 to Thr-27,
					Lys-43 to Lys-49.
HANGC07	952586	16	95-226	1039	Ser-28 to Thr-44.	S0318: 1 and S0316: 1.
HANGC14	952581	17	5-151	1040		S0318: 1 and S0316: 1.
HANGC30	966430	18	16-192	1041	Arg-10 to Ser-17,	S0318: 1 and S0316: 1.
					Tyr-37 to His-43.
HANGC33	702072	19	49-144	1042	Glu-27 to Pro-32.	S0318: 1 and S0316: 1.
HANGC59	653577	20	72-179	1043	Ser-9 to Lys-36.	S0318: 1 and S0316: 1.
HANGC84	715991	21	106-279	1044	Asp-20 to Asn-26.	S0318: 1 and S0316: 1.
HANGF36	952583	22	126-206	1045	Thr-1 to Lys-8.	S0318: 2 and S0316: 1.
HANGF49	722635	23	34-126	1046		S0318: 1 and S0316: 1.
HANGG22	848727	24	17-247	1047	Pro-71 to Thr-77.	S0316: 2
HANGH48	718759	25	89-232	1048	Thr-4 to Leu-11,	S0318: 1 and S0316: 1.
					Gln-27 to Leu-34,
					Gln-41 to Arg-47.
HANGH53	727914	26	75-269	1049	Asn-19 to Glu-25,	S0318: 1 and S0316: 1.
					Val-45 to Asn-54.
HANGH58	811987	27	34-228	1050		S0318: 1 and S0316: 1.
HANGH66	661513	28	2-220	1051	Tyr-1 to Lys-6,	S0318: 1 and S0316: 1.
					Thr-30 to His-36.
HANKD09	625167	29	188-298	1052		S0318: 1 and S0316: 1.
HANKD47	719963	30	227-370	1053	Ala-2 to Ser-9.	S0318: 1 and S0316: 1.
HANKD83	963964	31	130-312	1054	Arg-21 to Ile-30,	S0318: 1 and S0316: 1.
					Lys-42 to Lys-48.
HANKG78	710760	32	3-176	1055		S0318: 1, S0316: 1 and
						L0777: 1.
HANKG90	746282	33	133-366	1056		S0318: 1 and S0316: 1.
HANKH48	721340	34	159-356	1057	Ser-32 to Asn-41,	S0318: 2 and S0316: 1.
					Ser-44 to Ser-51.
HANKH56	733063	35	202-318	1058	His-13 to Pro-18.	S0318: 1 and S0316: 1.
HAOAA57	955693	36	139-2	1059		S0312: 2 and S0314: 1.
HAOAA78	756979	37	384-539	1060		S0312: 3 and S0314: 2.
HAOAA90	919249	38	82-279	1061	Leu-14 to Thr-20,	S0314: 2
					Glu-40 to Asp-52.
HAOAC05	932017	39	118-312	1062	Arg-34 to Thr-43,	S0314: 2 and S0312: 1.
					Glu-53 to Arg-58.
HAOAD47	864899	40	235-384	1063	Met-1 to Thr-12.	S0314: 2
HAOAE53	964029	41	112-381	1064	Arg-1 to Leu-6,	S0312: 1 and S0314: 1.
					Gly-29 to Met-36.
HAOAE56	767915	42	1-234	1065		S0312: 1 and S0314: 1.
HAOAE60	657909	43	2-238	1066	Thr-8 to Gln-16,	S0312: 1 and S0314: 1.
					Pro-58 to Pro-68.
HAOAF68	752788	44	336-581	1067		L0731: 2, S0312: 1 and
						S0314: 1.
HAOAH38	705946	45	239-337	1068		S0312: 1 and S0314: 1.
HAOMA13	915881	46	94-288	1069	Arg-19 to Ser-26,	S0312: 2
					Val-36 to Asn-44,
					Gly-52 to Thr-59.
HAOMB64	960293	47	138-386	1070		S0003: 2 and S0312: 1.
HAOMC21	670518	48	52-237	1071	Ala-11 to Glu-22,	S0312: 2
					Arg-38 to Ser-47.
HAOMD90	788658	49	87-242	1072	Pro-11 to Ser-24,	S0312: 2
					Ser-35 to Pro-41.
HAOME45	705947	50	56-280	1073	Gln-1 to Gln-11,	S0312: 2
					Arg-24 to Ile-46,
					Arg-50 to Cys-61.
HBCGA72	756953	51	1-150	1074	Pro-5 to Pro-20.	S0334: 2
HBCKB24	676825	52	239-412	1075		S0336: 2
HBCKB82	779562	53	232-516	1076		S0336: 2	12q21	217300, 600808
HBCKE22	674041	54	16-159	1077		S0336: 2, L0794: 2,
						L0523: 1, L0607: 1 and
						L0559: 1.
HBCKE78	746109	55	321-659	1078		S0336: 1, S0250: 1,
						L0766: 1 and L0362: 1.
HBFMC73	764150	56	200-334	1079		S0362: 1 and H0529: 1.
HBSAK76	506666	57	51-176	1080	Tyr-6 to Lys-16.	H0381: 2
HBSAL69	573004	58	67-402	1081	Gly-3 to Tyr-8,	H0381: 1 and H0419: 1.
					Gln-11 to Thr-17.
HBSAL80	506580	59	1-378	1082	Pro-3 to Phe-10,	H0381: 1 and H0419: 1.
					His-29 to Leu-34,
					Gln-46 to Val-54,
					Val-70 to Gln-76.
HBSAM46	526732	60	202-345	1083		H0381: 2
HBSAM48	727635	61	26-298	1084		H0381: 1 and S0028: 1.
HBSAP02	920648	62	141-338	1085		H0381: 1 and H0041: 1.
HBSAP73	764589	63	3-227	1086	Thr-22 to Arg-27,	S0028: 2 and H0381: 1.
					His-64 to Thr-73.
HBSAQ64	530344	64	192-308	1087		H0381: 1 and S0003: 1.
HBSDB50	571365	65	2-367	1088	Arg-56 to Glu-76.	AR061: 2, AR089: 0
						H0419: 2
HBSDB63	745211	66	146-343	1089	Pro-18 to Pro-45,	H0419: 2
					Leu-49 to Arg-66.
HBSDD91	775313	67	42-149	1090		H0419: 2
HCDAA94	661278	68	3-167	1091		H0251: 5
HCDAB17	530726	69	187-321	1092		H0251: 2, L0586: 1
						and L0589: 1.
HCDAE77	533925	70	60-251	1093	Lys-34 to Glu-43,	H0251: 4
					Val-59 to Leu-64.
HCDAF27	592244	71	48-200	1094	Ser-3 to Pro-11.	H0251: 5
HCDAF29	533812	72	80-235	1095		H0251: 3
HCDAF54	530529	73	156-434	1096		H0251: 2
HCDAG92	724693	74	66-194	1097		H0251: 7
HCDAG95	533871	75	102-296	1098	Cys-32 to Ile-44.	H0251: 5
HCDAH34	533870	76	45-248	1099	Glu-1 to Gln-10.	H0251: 4
HCDAJ67	925362	77	18-185	1100		H0251: 3
HCDAK93	523648	78	77-199	1101		H0251: 2
HCDAK96	960047	79	3-362	1102	Asp-4 to Ser-9.	H0251: 12
HCDAM34	523607	80	1-231	1103	Phe-30 to Arg-37,	H0251: 3
					Glu-45 to His-50.
HCDAO32	530006	81	192-314	1104		H0251: 2
HCDAT56	533881	82	388-558	1105		H0251: 3, L0766: 1
						and L0756: 1.
HCDBO13	709590	83	41-238	1106		H0251: 10
HCDBR37	968501	84	80-331	1107		H0251: 4	12q14	123829, 147570,
								181430, 252940,
								264700, 600808,
								601284, 601769,
								601769, 602116
HCDBR39	921893	85	2-361	1108	Ala-1 to Arg-9,	H0251: 10 and S0001: 1.
					Arg-15 to Lys-29,
					Ala-47 to Ser-59,
					Gly-81 to Thr-92.
HCDBU77	661272	86	53-172	1109		H0251: 3
HCDBW51	556469	87	48-293	1110		H0251: 5
HCDBW61	960044	88	32-115	1111		H0251: 2 and L0756: 1.
HCDBX78	847580	89	63-257	1112		H0251: 3
HCDCB84	670159	90	3-125	1113	Lys-1 to Asp-6.	H0251: 3
HCDCE48	529893	91	89-205	1114	Asn-1 to His-9,	H0251: 2
					Thr-11 to Lys-19.
HCDCE62	523582	92	21-161	1115		H0251: 3
HCDCF11	967768	93	159-248	1116		H0251: 2
HCDCK07	865908	94	2-148	1117	Leu-22 to Glu-27.	H0251: 2	7q22.1	120160, 120160,
								120160, 120160,
								126650, 126650
HCDCK91	592465	95	18-176	1118	Arg-13 to Ser-21,	H0251: 3
					Ser-40 to Lys-46.
HCDCR26	960048	96	191-319	1119		H0251: 3
HCDCX68	529778	97	30-104	1120		H0251: 2
HCDCY13	921702	98	2-73	1121		H0251: 2
HCDDB52	847581	99	100-267	1122		H0251: 3
HCDDB62	529890	100	43-177	1123		H0251: 2
HCDDI61	529937	101	3-83	1124		H0251: 2
HCDDU07	954177	102	3-173	1125		H0251: 2
HCDDV90	847575	103	20-157	1126	Pro-36 to Lys-46.	H0251: 3
HCDDY57	556465	104	244-363	1127	Arg-12 to Cys-22.	H0251: 4
HCDDZ09	523605	105	160-396	1128		H0251: 2
HCDDZ44	863388	106	3-458	1129		H0251: 4
HCDEB49	847572	107	1-144	1130	Tyr-1 to Gln-16,	H0251: 2
					Asn-21 to Ala-27.
HCDEB78	921710	108	21-119	1131		H0251: 2
HCDEG67	531239	109	257-355	1132		H0251: 2
HCDEG95	533879	110	123-287	1133		H0251: 5
HCDER16	667338	111	85-270	1134	Asn-36 to Cys-41.	H0251: 1 and S0028: 1.
HCDER29	523506	112	2-211	1135		H0251: 3
HCDET89	524045	113	157-342	1136		H0251: 3
HFIAB89	848927	114	1-48	1137		S0192: 2
HFIAB93	713799	115	317-463	1138		S0192: 2
HFIAE82	779898	116	2-124	1139	Pro-1 to Leu-9.	S0192: 1 and S0194: 1.
HFIAH10	964652	117	93-236	1140	Asn-22 to Thr-28.	S0192: 2
HFIAI07	952884	118	21-188	1141		S0192: 2 and L0748: 1.
HFIAP31	697775	119	3-203	1142	Ser-22 to Ala-28,	S0192: 4
					Arg-52 to Arg-66.
HFIAP89	587844	120	145-348	1143		S0192: 3
HFIAP91	925831	121	486-214	1144		S0192: 2
HFIAV83	780358	122	146-36	1145	Lys-24 to Leu-32.	S0192: 2
HFIAZ63	966761	123	137-355	1146	Thr-17 to Ser-22.	S0192: 16 and L0809: 1.
HFIBI48	587871	124	1-210	1147	Arg-1 to Ser-6,	S0192: 5
					Leu-34 to Asp-42.
HFICA06	934675	125	2-244	1148		S0192: 2
HFICE40	587918	126	143-310	1149		S0192: 5
HFICF01	916103	127	111-212	1150		S0192: 2
HFICI52	522239	128	2-568	1151	Arg-1 to Arg-8.	S0028: 1 and S0192: 1.	1q31-q32	114208, 114208,
								119300, 120620,
								120620, 120920,
								134370, 134370,
								134370, 134580,
								145001, 145260,
								150292, 150310,
								150310, 179820,
								191045, 208250,
								226450, 600105,
								600759, 600995,
								601494, 601652,
								601975
HFICM95	587875	129	148-261	1152	Pro-18 to Asn-23.	S0192: 2
HFICZ77	934192	130	1-141	1153	Pro-1 to Arg-11.	S0192: 2
HFIDB12	968922	131	288-509	1154	Ala-2 to Lys-7,	S0192: 2
					Pro-23 to His-29.
HFIDL94	964316	132	122-325	1155	Asn-1 to Ser-11.	S0192: 4
HFIDM69	926894	133	336-485	1156		S0192: 4
HFIDN81	959050	134	454-302	1157		S0192: 3
HFIEC13	883185	135	1-525	1158	Glu-1 to Arg-13.	AR061: 168, AR089:
						145
						S0192: 2
HFIEF04	926824	136	2-112	1159	Pro-16 to Val-26.	S0192: 3
HFIEH79	855196	137	449-640	1160		S0192: 55
HFIHB16	661971	138	1-132	1161	Leu-21 to Gly-26,	S0192: 3 and S0194: 1.
					Leu-29 to Glu-35.
HFIHD91	702324	139	582-734	1162	Asp-10 to Lys-18,	S0194: 2 and L0740: 1.
					Arg-37 to Cys-42,
					Gln-46 to Asn-51.
HFIHE47	857988	140	385-1659	1163	Pro-1 to Gly-6,	AR089: 17, AR061: 17
					Phe-31 to Thr-36,	S0250: 1, L0439: 1 and
					Gln-66 to Leu-75,	S0194: 1.
					Leu-83 to Pro-91.
HFIHF63	944246	141	2-610	1164		AR061: 1, AR089: 1
						L0747: 3, S0250: 1,
						L0777: 1, L0731: 1,
						L0758: 1 and S0194: 1.
	973023	1010	895-530	2033	Pro-6 to Cys-13,
					Pro-15 to Leu-20,
					Pro-47 to Gly-59,
					Asn-82 to Ser-88.
HFIHJ60	740280	142	34-177	1165	Lys-39 to Tyr-45.	S0194: 2
HFIHJ85	707899	143	212-385	1166	Met-1 to Thr-7,	S0276: 4 and S0194: 1.
					Gly-10 to Cys-21,
					Ile-25 to Trp-30,
					Pro-41 to Glu-49.
HFIHL29	690546	144	46-156	1167		S0022: 1 and S0194: 1.
HFIHS76	769952	145	246-404	1168	Asn-16 to Arg-21.	S0194: 2
HFIHZ33	588058	146	279-455	1169	Arg-7 to Cys-14,	L2245: 1, L0731: 1,
					Glu-26 to Ser-32.	L0604: 1, S0194: 1 and
						S0276: 1.
HFIHZ51	725587	147	1-201	1170	Glu-47 to Lys-53.	S0194: 2
HFIIB73	669594	148	262-441	1171		S0194: 1 and S0276: 1.
HFIIS21	670765	149	141-332	1172		S0206: 1 and S0194: 1.
HFIJF34	703972	150	1-144	1173	Glu-1 to Gln-16,	S0194: 1 and S0276: 1.
					Ser-42 to Gly-48.
HFITX48	934328	151	239-466	1174	Thr-1 to Asp-8.	S0196: 3 and S0242: 2.
HFITZ24	677144	152	28-426	1175		S0196: 2
HFIUE17	855119	153	182-307	1176		S0242: 7, S0196: 2 and
						L0792: 1.
HFIUH54	929787	154	246-443	1177		S0196: 16 and S0242:
						13.
HFIUI66	746397	155	2-103	1178	Thr-7 to Asn-12,	S0242: 1 and S0196: 1.
					Ser-21 to Trp-28.
HFIUJ95	735969	156	48-167	1179		S0196: 2
HFIUM59	724249	157	122-244	1180		S0196: 2
HFIUO63	691921	158	161-334	1181	Trp-10 to Pro-15.	L0754: 1, S0242: 1 and
						S0196: 1.
HFIUP04	582296	159	2-88	1182		S0196: 2	1p22	170995, 191540,
								274270, 274270,
								600309, 601414,
								602094
HFIVB03	924021	160	55-195	1183	Ser-5 to Lys-13,	S0196: 3 and S0242: 1.
					Arg-39 to Tyr-47.
HFIVB25	678022	161	20-130	1184		S0196: 2
HFIVB62	741665	162	91-255	1185	Gln-38 to Arg-48.	S0242: 1 and S0196: 1.
HFIVQ02	919802	163	214-453	1186	Glu-46 to Arg-53.	S0242: 1 and S0196: 1.
HFIXA30	692637	164	142-243	1187		L0759: 2, S0242: 2,
						L0766: 1 and L0663: 1.
HFIXC30	692635	165	37-282	1188		S0242: 2
HFIXC44	839536	166	369-554	1189	His-1 to Asp-9.	L0439: 6, S0242: 2 and
						L0438: 1.
HFIXC49	722886	167	2-172	1190	Glu-6 to Leu-17,	S0242: 2
					Ser-36 to Gly-41.
HFIXK83	767156	168	170-364	1191		S0242: 2
HFIXK94	943717	169	58-417	1192		AR089: 2, AR061: 1
						S0242: 1 and S0196: 1.
HFIXM11	966714	170	3-95	1193	Phe-5 to Glu-13.	S0242: 2
HFIXO03	923735	171	269-373	1194		S0242: 2
HFIXV93	597031	172	115-297	1195		S0242: 1 and S0196: 1.
HFIXY13	656812	173	148-258	1196		S0242: 2
HFIXY57	734580	174	143-280	1197		S0242: 2
HFIXY80	965077	175	1-174	1198	Asn-45 to Gly-57.	S0242: 2
HFIYA86	757155	176	192-356	1199		S0242: 1 and S0196: 1.
HFIYB24	952847	177	107-304	1200	Asn-14 to Asn-19.	S0242: 2
HFIYB40	964251	178	101-283	1201	Pro-6 to Arg-13,	S0242: 4 and S0196: 1.
					Gly-46 to Arg-52.
HFIYK01	916125	179	1-123	1202	Gly-1 to Gln-6.	S0242: 2
HFIYL01	919416	180	2-277	1203	Arg-17 to Pro-23,	S0242: 1 and S0276: 1.
					Asp-52 to Lys-74.
HFIYO14	657598	181	2-145	1204		S0242: 2 and L0779: 1.
HFIYP02	919501	182	1-162	1205	Pro-8 to Arg-16,	S0242: 3
					Pro-34 to Leu-46.
HFIYV01	916064	183	264-425	1206	Gly-1 to Gly-12.	S0011: 1 and S0242: 1.
HFIYV03	923755	184	173-298	1207	Lys-31 to Asn-38.	S0242: 2
HFIYV59	861487	185	25-255	1208		S0242: 2
HFIYW08	958978	186	7-198	1209	Gln-47 to Lys-52.	S0242: 2
HFIYZ13	656795	187	1-321	1210	Gln-32 to Arg-40,	S0242: 2
					Ser-49 to Ser-59,
					Asp-71 to Asn-88.
HFIZF95	795734	188	52-204	1211		S0242: 2 and L0754: 1.
HFIZG93	928170	189	239-406	1212		S0242: 4
HFIZH29	953895	190	252-392	1213	Lys-1 to Thr-9,	H0124: 1 and S0242: 1.
					Thr-15 to Gly-23.
HFIZM92	791267	191	403-573	1214		L0754: 2, S0242: 1 and
						S0194: 1.
HFOXA79	774901	192	74-250	1215	Gly-25 to Trp-30,	S0276: 2
					Gly-36 to Pro-47.
HFOXB85	752957	193	195-374	1216		S0276: 2
HFOXC25	677995	194	64-186	1217	Thr-7 to Gly-14,	S0276: 3
					His-30 to Pro-35.
HFOXC35	638311	195	2-358	1218	Pro-1 to Glu-12.	S0276: 2
HFOXE83	587955	196	185-283	1219	Lys-13 to Gly-29.	S0276: 3
HFOXL03	923772	197	160-321	1220		S0276: 2
HFOXM54	587974	198	53-211	1221		S0276: 2
HFOXN89	587984	199	76-2	1222		S0276: 2
HFOXO24	733377	200	247-414	1223	Gly-1 to Tyr-8.	S0214: 1 and S0276: 1.
HFOXR28	587994	201	166-324	1224	Phe-4 to Ser-10.	S0276: 2
HFOXR67	806488	202	3-257	1225	Pro-21 to Asn-30.	S0276: 3
HFOXS81	588052	203	144-383	1226	Ala-5 to Phe-14,	S0276: 2
					His-45 to Lys-58.
HFOXU83	887781	204	1-267	1227		AR051: 17, AR054: 8,
						AR050: 5
						S0276: 3
HFOXU92	588057	205	77-3	1228	Ile-2 to Ala-16.	S0276: 2
HFOXV15	964296	206	159-335	1229		S0276: 2
HFOXV80	771290	207	1-426	1230	Leu-3 to His-14,	S0340: 1 and S0276: 1.
					Pro-19 to Thr-49,
					Ala-54 to Gly-59,
					Leu-77 to Gly-82,
					Gln-87 to Ala-100.
HFOYI36	935532	208	2-178	1231	Val-3 to Leu-10,	S0192: 1 and S0276: 1.
					Asn-18 to Lys-37,
					Pro-45 to Val-51.
HFOYL77	494844	209	9-185	1232		S0276: 2
HMUBM26	908912	210	2-565	1233	Ser-1 to Ser-9,	AR089: 20, AR061: 8
					His-28 to Glu-35,	H0529: 1 and S0032: 1.
					Phe-71 to Asn-76,
					Val-83 to Gly-96,
					Phe-99 to Asn-104,
					Lys-109 to Ser-116,
					Cys-120 to Cys-129,
					His-140 to Glu-150,
					Pro-161 to Trp-170.
HMUBX25	678004	211	1-261	1234	Ser-1 to Ala-8,	H0529: 2
					Pro-65 to Leu-70.
HMUBY88	740311	212	1-372	1235	Tyr-44 to Pro-55,	H0529: 2
					Thr-72 to Arg-77,
					Phe-92 to Lys-110.
HOAAB15	575254	213	1-114	1236	Ser-1 to Gly-7,	H0252: 2
					Gly-18 to Ala-23,
					Lys-25 to Val-36.
HOAAB42	530605	214	3-209	1237		H0252: 2	12p11
HOAAB56	507839	215	2-190	1238	Phe-38 to Gly-50.	H0252: 3
HOAAC31	693597	216	3-95	1239	Thr-3 to Gly-10.	L0766: 3 and H0252: 2.
HOAAD05	932756	217	560-126	1240		H0252: 2, L0753: 2,
						L0455: 1, L0770: 1,
						L0779: 1 and L0731: 1.
HOAAD52	859628	218	140-331	1241	Met-1 to Leu-11,	H0252: 3
					Ser-22 to Lys-29.
HOAAE10	968532	219	89-208	1242		H0252: 2
HOAAE45	530602	220	106-330	1243	Gly-34 to Asn-51.	H0252: 2
HOAAE49	859630	221	78-302	1244	His-6 to Lys-11,	H0041: 1 and H0252: 1.
					Glu-27 to Lys-38.
HOAAE73	960631	222	3-161	1245	Arg-13 to Cys-30,	H0252: 3
					Val-37 to Phe-47.
HOAAF18	530600	223	156-347	1246	Thr-1 to Ala-10.	H0252: 2
HOAAH10	968368	224	200-454	1247	Gly-53 to Asp-64,	H0252: 2, L0748: 2,
					Pro-72 to Arg-85.	L0518: 1 and L0759: 1.
HOAAI05	932537	225	87-251	1248	Asp-32 to Ser-45.	H0252: 2
HOAAJ23	531389	226	28-135	1249	Lys-1 to Asp-8,	H0252: 2
					Lys-12 to Lys-28.
HOAAK90	527490	227	2-178	1250		H0252: 2
HOAAM08	960060	228	25-201	1251	Ala-14 to Thr-36.	H0252: 2
HOAAR14	526530	229	2-202	1252	Arg-17 to Lys-22,	H0252: 2
					Thr-39 to Lys-54.
HOAAV23	527489	230	1-306	1253		H0252: 2
HOAAW21	527487	231	193-309	1254	Val-22 to Gly-28,	H0252: 2
					Gly-31 to Gly-36.
HOAAZ61	531065	232	31-333	1255	Gln-4 to Cys-12.	H0252: 2
HOABA20	932539	233	23-118	1256		H0252: 2
HOABA93	792929	234	78-146	1257		H0252: 2
HOABD58	738359	235	3-110	1258		H0252: 2
HOABP66	507175	236	86-253	1259	Lys-39 to Gly-44.	H0252: 2
H0ABP69	531049	237	2-76	1260		H0252: 2
HOABR40	531051	238	245-358	1261	Gly-1 to Asp-8.	H0252: 2
HOEAK21	954961	239	2-280	1262		S0126: 4
HOEAY14	659258	240	25-132	1263		S0126: 3, L0520: 1 and
						L0749: 1.
HOEBL44	715851	241	69-272	1264		S0126: 2
HOEBO31	693689	242	2-103	1265		S0126: 2
HOEBP01	916957	243	3-470	1266	Lys-11 to Asp-17,	L0439: 3 and S0126: 2.
					Tyr-24 to Asp-29,
					Leu-50 to Ser-64,
					Ala-76 to Phe-81,
					Arg-132 to Ser-137.
HOECN79	723113	244	88-237	1267		S0126: 9, H0658: 1 and
						L0602: 1.
HOECY54	506692	245	31-342	1268	Lys-28 to Glu-33,	S0126: 2
					Lys-38 to Thr-54,
					Pro-61 to Ser-70.
HOEDD40	572900	246	86-346	1269	Pro-8 to Glu-20,	S0126: 2
					Arg-32 to Gly-41,
					Ser-49 to Arg-61.
HOEDD83	578934	247	34-267	1270		S0126: 2
HOEDK10	915054	248	1-276	1271	Gly-10 to Asp-15,	S0126: 9
					Gly-31 to Gly-38,
					Arg-41 to Asp-55.
HOEDT31	826009	249	148-474	1272		S0126: 3
HOEDU54	506576	250	391-513	1273	Asn-9 to Pro-15.	S0126: 5 and L0661: 1.
HOEDU68	713695	251	32-169	1274	Arg-28 to Tyr-36,	S0126: 2
					Pro-40 to Ser-46.
HOEEB63	745039	252	2-310	1275	Gly-6 to Gly-12,	S0126: 2
					Ala-14 to Pro-19.
HOEEC02	919822	253	143-235	1276	Arg-1 to Gly-14.	S0126: 4
HOEEO45	717754	254	62-238	1277		S0126: 2
HOEEQ17	663719	255	173-298	1278	Asp-20 to Ala-25.	S0126: 5
HOEFG22	744340	256	97-285	1279	Ser-13 to Ala-18.	S0126: 1 and S3012: 1.
HOEFL91	790134	257	1-135	1280		S0126: 5, L0022: 1,
						L0752: 1 and L0581: 1.
HOEFN92	698444	258	170-325	1281	Lys-26 to Gly-31,	S0126: 2
					Pro-35 to Asn-45.
HOEFS83	615154	259	2-220	1282		S0126: 2
HOEJE18	666349	260	90-278	1283		S0126: 2
HOEJG04	859251	261	3-482	1284	Asp-76 to Ile-84,	AR089: 1, AR061: 0
					Thr-122 to Trp-139.	S0126: 2, S0028: 1 and 1.
HOEJW84	859225	262	195-425	1285		S0126: 2 and L0748: 2
HOEKH88	924112	263	2-172	1286	Pro-17 to Lys-23,	S0126: 3 and S0028: 1.
					Leu-31 to Ser-36.
HOEKP01	918873	264	3-329	1287	Gln-1 to Arg-13,	S0126: 3
					Pro-27 to Pro-41.
HOEKP79	963337	265	309-467	1288		S0126: 5
HOEME76	974069	266	6-488	1289	Lys-8 to Ser-16,	S0126: 2
					Tyr-81 to Ile-94,
					Ser-97 to Asp-111.
HOEMK02	918364	267	3-89	1290		S0126: 2
HOEMQ65	922789	268	132-323	1291		S0126: 2
HOEOE25	907806	269	2-625	1292	Lys-95 to Asp-103,	L0766: 4, L0517: 2,
					Pro-108 to Leu-115,	S0126: 2, L0794: 1 and
					Lys-150 to Leu-158,	L0366: 1.
					Leu-162 to Trp-167,
					Leu-177 to Lys-186,
					Glu-201 to Gln-208.
HOHAA14	468867	270	185-385	1293		S0250: 2
HOHAB04	665381	271	183-284	1294		S0250: 2
HOHAB21	670814	272	3-158	1295	Ser-10 to Phe-16,	S0250: 2
					Asn-22 to Asn-27.
HOHAE68	781448	273	20-286	1296		S0250: 2
HOHAM36	782043	274	1-138	1297	Gly-27 to Asp-35.	S0250: 2, L0598: 1,
						L0766: 1 and L0745: 1.
HOHBE48	588317	275	77-364	1298	Lys-1 to Ser-6,	S0250: 2
					Thr-9 to Lys-22,
					Ser-65 to Lys-73.
HOHBF30	859046	276	153-518	1299	Leu-43 to Pro-49,	S0250: 2
					Asp-108 to Asp-120.
HOHBL11	966720	277	23-280	1300	Gln-4 to Gly-13,	S0250: 2
					Arg-21 to Glu-29.
HOHBL32	588329	278	273-461	1301	Asn-43 to His-52.	S0250: 2
HOHBO79	588271	279	245-442	1302	Pro-1 to Gly-17,	S0250: 2
					Gln-23 to Gly-34.
HOHBW86	784723	280	111-278	1303	Trp-8 to Gly-17,	S0250: 1 and S0028: 1.
					Glu-25 to Gly-30.
HOHBX75	669536	281	3-497	1304	Gln-13 to Gly-24,	S0250: 2
					Asn-63 to Ala-70.
HOHBY75	840109	282	191-304	1305		S0250: 2 and L0465: 1.
HOHCH04	859047	283	3-581	1306	Cys-1 to Pro-8.	S0250: 2
HOHCI05	935123	284	54-155	1307		S0250: 2
HOHCM38	709295	285	114-227	1308	Tyr-31 to Phe-38.	S0250: 2
HOHCM90	703734	286	3-152	1309		S0250: 2
HOHCO85	751299	287	93-260	1310	Pro-49 to Lys-56.	S0250: 2	6q12-q13	203310
HOHCP35	656516	288	155-295	1311	Tyr-8 to Glu-15,	S0250: 2
					Thr-26 to Lys-34.
HOHCQ76	825236	289	157-330	1312		S0250: 2
HOHCQ77	661480	290	2-115	1313		S0250: 2
HOHCV83	735685	291	8-241	1314		S0250: 2
HOHCW02	919142	292	159-284	1315		S0250: 2
HOHDB11	966413	293	3-440	1316		S0250: 2, L0740: 2 and
						L0777: 1.
HOHDB32	698781	294	1-162	1317	Pro-21 to Asn-32,	S0250: 3
					Gln-37 to Thr-54.
HOHDD23	675616	295	266-412	1318		S0250: 2
HOHDF40	710748	296	2-337	1319	Phe-3 to Trp-10,	S0250: 2 and L0777: 1.
					Asn-27 to Asn-40,
					Ser-43 to Lys-48,
					Thr-52 to Ser-61,
					Met-72 to Asp-77,
					Leu-82 to Thr-89.
HOHDF53	727620	297	219-344	1320		S0250: 2
HOHDI48	966379	298	3-131	1321	Ser-11 to Lys-20.	S0250: 2
HOHDY85	764155	299	189-347	1322	Gln-1 to Gln-17.	S0250: 2
HOHDZ61	741382	300	41-175	1323		S0250: 2
HOHEA19	668208	301	112-273	1324		S0250: 6
HOHEC41	712037	302	27-470	1325	Asp-1 to Asp-11,	S0250: 2, L0807: 1 and
					Glu-24 to Lys-29.	L0591: 1.
HOHEN50	662365	303	2-163	1326		S0250: 2
HOSAB04	531565	304	82-324	1327	Gln-34 to Lys-42,	S0003: 2
					Ser-73 to Arg-81.
HOSAR25	509226	305	2-208	1328		S0003: 2
HOSBR08	925430	306	3-107	1329		S0003: 2
HOSBU17	667195	307	365-505	1330	Leu-25 to Arg-30,	S0003: 2 and L0589: 1.
					Lys-34 to Gln-39.
HOSBU81	508735	308	43-168	1331	Asp-28 to Thr-34.	S0003: 2
HOSBV22	780092	309	1-204	1332	Trp-1 to Asp-7,	S0003: 2, L0775: 2,
					Glu-14 to Trp-28.	L0770: 1, L0804: 1 and
						L0659: 1.
HOSBW16	933016	310	6-155	1333		S0003: 2
HOSCG51	967584	311	129-422	1334		S0003: 1 and S0122: 1.
HOSCM15	921336	312	126-353	1335	Ser-2 to Gln-7,	S0003: 2
					Tyr-40 to Thr-47.
HOSCZ35	707379	313	23-256	1336		S0003: 2 and S0126: 1.	5q22	175100, 175100,
								175100, 175100,
								175100, 175100
HOSDE63	580959	314	3-122	1337		S0003: 1, S0027: 1 and
						S0032: 1.
HOSDG51	523872	315	23-148	1338		S0003: 2
HOSDN27	530459	316	2-154	1339	Ile-1 to Thr-12.	S0003: 2
HOSEB61	741812	317	359-601	1340	Gly-8 to Ser-17,	S0003: 1, S0214: 1 and
					Ala-50 to Asp-62.	L0756: 1.
HOSEM84	831049	318	160-327	1341	Pro-31 to Gly-38,	S0214: 2	2
					Leu-49 to Arg-56.
HOSFO57	736034	319	85-234	1342		S0214: 2
HOSFV63	873010	320	14-112	1343		S0214: 2	10
HOSFY79	774052	321	214-336	1344	Gly-1 to Gln-10,	S0214: 2
					Asn-20 to Gly-25,
					Glu-28 to Arg-35.
HOSFZ39	705351	322	180-344	1345		S0003: 1 and S0214: 1.
HOSGH28	686649	323	3-374	1346	Asn-101 to Lys-108.	S0214: 2, L0758: 2,
						L0596: 2, L0760: 1,
						L0055: 1, L0803: 1,
						L0526: 1 and L0779: 1.
HOSGJ17	508870	324	108-284	1347	Ile-12 to Gln-19.	S0003: 2 and S0214: 1.
HOSMD84	959483	325	529-762	1348		S0003: 2, L0748: 1,
						L0756: 1 and S0196: 1.
HOSNO86	858938	326	150-341	1349	Gln-43 to Glu-54.	S0003: 2 and L0752: 1.
HOSOE05	930946	327	13-192	1350	Gly-32 to Ala-38.	S0214: 2 and S0003: 1.
HRDAB18	509019	328	85-276	1351	Arg-1 to Ser-18.	H0124: 2
HRDAB60	509428	329	134-337	1352	Gln to Asn-47,	H0124: 2 and L0530: 2.
					Val-49 to Lys-56.
HRDAF07	954331	330	36-329	1353	Ser-47 to Gly-63.	H0124: 2
HRDAF69	956269	331	1-225	1354		H0124: 2
HRDAF90	531026	332	90-233	1355	His-31 toThr-40.	H0124: 2
HRDAH91	525525	333	79-240	1356	Gln-1 to Asn-20.	H0124: 2
HRDBA76	534304	334	153-293	1357		H0124: 5
HRDBC02	921144	335	117-284	1358		H0124: 2
HRDBC30	530858	336	3-152	1359	Pro-28 to Arg-33.	H0124: 2
HRDBC52	867169	337	72-278	1360	Asn-32 to Asn-43,	H0124: 2
					Pro-56 to Cys-63.
HRDBD35	525526	338	1-189	1361		H0124: 2
HRDBE07	954289	339	214-369	1362		H0124: 2
HRDBE18	956267	340	145-264	1363	Ser-31 to Asn-40.	H0124: 2, L0776: 1,
						L0748: 1 and L0777: 1.
HRDBE19	534495	341	161-394	1364	Thr-3 to Asp-10,	H0124: 4
					Ser-21 to Asp-26.
HRDBE41	530856	342	3-158	1365	Glu-1 to Pro-10,	H0124: 2
					Thr-14 to Trp-21,
					Gln-33 to Gln-42.
HRDBG59	507381	343	58-234	1366		H0124: 2
HRDBI81	932761	344	116-316	1367		H0124: 2
HRDBJ28	925457	345	234-350	1368		H0124: 2
HRDBK03	925460	346	226-351	1369		H0124: 2
HRDBL61	575229	347	152-334	1370	Gly-1 to Ser-12.	H0124: 2
HRDBL75	524423	348	3-161	1371		H0124: 2
HRDBM42	530849	349	1-375	1372	Asn-1 to Arg-9,	H0124: 2
					Tyr-21 to Cys-27.
HRDBQ18	954274	350	1-183	1373	Asn-1 to Tyr-15.	H0124: 10
HRDBQ38	533939	351	1-165	1374		H0124: 4, L0521: 1
						and L0766: 1.
HRDBQ64	879705	352	1-216	1375	Phe-1 to Gly-6,	H0124: 34
					Ser-17 to Ser-23.
HRDBQ82	533947	353	244-393	1376	Ser-14 to Cys-24.	H0124: 10
HRDBR04	927900	354	220-354	1377		H0124: 4
HRDBR35	867167	355	29-175	1378	Ile-6 to Thr-21,	H0124: 5
					Glu-35 to Ile-40.
HRDBT72	507847	356	226-354	1379		AR089: 49, AR061: 16
						H0124: 3
HRDBU70	971700	357	2-88	1380	Ser-17 to Gly-24.	H0124: 3
HRDCA61	921128	358	280-456	1381		H0124: 12
HRDCB18	968554	359	2-232	1382	Pro-11 to Gln-17,	H0124: 6
					Glu-51 to Ser-59.
HRDCD12	921796	360	247-432	1383		H0124: 12
HRDDF49	867159	361	3-80	1384		H0124: 27
HRDDF95	967837	362	244-435	1385		H0124: 15
HRDDH84	867156	363	18-260	1386	Ser-7 to Ser-19,	H0124: 2
					Arg-58 to Cys-70.
HRDDN54	932764	364	61-183	1387		H0124: 2
HRDDN90	531117	365	118-324	1388		H0124: 2
HRDDY26	526783	366	13-165	1389	Arg-13 to Ser-18.	H0124: 2
HRDDY73	574336	367	96-374	1390		H0124: 2
HRDDZ76	574324	368	3-92	1391	Leu-1 to Pro-10,	H0124: 2
					Glu-12 to Ile-20.
HRDEB78	526861	369	12-152	1392		H0124: 3
HRDEC91	747169	370	287-460	1393		H0124: 2
	790096	1011	2-97	2034	Arg-11 to Glu-20.
HRDED92	936045	371	15-218	1394	Cys-19 to Val-25.	H0124: 2
HRDEG76	574326	372	168-254	1395	His-22 to Asn-29.	H0124: 2
HRDEJ76	574335	373	17-109	1396	Glu-20 to Glu-27.	H0124: 2
HRDEK44	574380	374	31-222	1397		H0124: 2
HRDEL91	790374	375	2-217	1398	Thr-2 to Thr-8,	H0124: 2
					Thr-23 to Ile-28.
HRDEO12	867140	376	3-194	1399	Asn-15 to Lys-21,	H0124: 2
					Asp-49 to Ser-54.
HRDEO76	952894	377	137-256	1400	Pro-7 to Thr-12.	H0251: 1, H0124: 1
						and S0242: 1.
HRDEP31	766222	378	51-143	1401	Asp-1 to Leu-12,	H0124: 2
					Leu-25 to Ser-31.
HRDEP75	574431	379	204-380	1402	Asp-5 to Lys-12.	H0124: 3
HRDEQ30	506774	380	1-144	1403		H0124: 5 and L0749: 1.
HRDEQ96	507543	381	189-428	1404		H0124: 4 and L0599: 1.
HRDES52	867115	382	94-255	1405	Asn-1 to Glu-6,	H0124: 2
					Ile-36 to Ala-42.
HRDES65	526823	383	212-385	1406	Pro-22 to Glu-27,	H0124: 3
					Pro-49 to Thr-54.
HRDET67	825182	384	89-346	1407		H0124: 4
HRDET91	827084	385	68-298	1408		H0124: 3
HRDEU33	572905	386	78-320	1409	Pro-24 to Glu-32,	H0124: 2
					Pro-49 to Arg-65.
HRDEU42	881296	387	56-325	1410	Arg-3 to Gly-9,	H0124: 7
					Arg-53 to Thr-61.
HRDEU43	765813	388	40-159	1411		H0124: 3
HRDEU61	575566	389	349-239	1412	Gly-1 to Tyr-7.	H0124: 7
HRDEU78	573031	390	32-205	1413	Leu-8 to Gln-14,	H0124: 2
					Glu-17 to Tyr-32.
HRDEU93	844316	391	3-461	1414	Arg-2 to Asp-10,	H0124: 3
					Leu-28 to Phe-34,
					Asn-58 to Val-65,
					Pro-79 to Ser-84,
					Arg-106 to Pro-111.
HRDEV13	574442	392	1-120	1415	Asp-18 to Thr-24.	H0124: 2
HRDEW02	848793	393	1-333	1416	Ser-50 to Trp-56,	H0124: 2
					Pro-95 to His-100.
HRDEW30	526812	394	83-238	1417		H0124: 4
HRDEW90	574288	395	110-271	1418		H0124: 2
HRDEY14	574438	396	2-196	1419	Thr-32 to Ser-38,	H0124: 3
					Ser-55 to Trp-64.
HRDEZ06	936072	397	187-282	1420		H0124: 2
HRDEZ54	867127	398	2-307	1421		H0124: 2
HRDEZ60	919386	399	2-220	1422	Gly-24 to Arg-29.	H0124: 2
HRDEZ64	536668	400	2-79	1423	Trp-1 to Cys-7.	H0124: 2
HRDEZ84	575553	401	230-382	1424	Asn-28 to Cys-33.	H0124: 7
HRDFB47	508001	402	2-163	1425	Gln-1 to Trp-7,	H0124: 3
					Ala-29 to Tyr-35.
HRDFB78	589478	403	37-381	1426	Ala-1 to Trp-9,	H0124: 3
					Pro-11 to Ser-20.
HRDFC68	574205	404	2-172	1427		H0124: 4
HRDFE73	574142	405	139-276	1428	Gly-10 to Phe-20.	H0124: 3
HRDFE74	765750	406	152-268	1429		H0124: 3
HRDFF42	953913	407	92-3	1430	Lys-1 to Pro-6,	H0124: 2
					Ser-17 to Thr-26.
HRDFF62	574436	408	237-452	1431		H0124: 2 and L0748: 1.
HRDFG25	574433	409	1-183	1432	Arg-2 to Asn-23.	H0124: 2
HRDFG37	792517	410	3-197	1433	Gln-1 to Gln-7.	H0124: 2
HRDFG46	574439	411	15-299	1434		H0124: 2
HRDFH14	575578	412	24-140	1435	Lys-1 to Gln-17.	H0124: 4
HRDFH24	575245	413	161-388	1436	Thr-1 to Arg-10,	H0124: 2
					Ser-26 to Ile-31,
					Tyr-39 to Ile-46.
HRDFH25	953882	414	3-191	1437		H0124: 3
HRDFH39	574558	415	62-268	1438	Thr-1 to Trp-11.	H0124: 2
HRDFH77	953673	416	208-387	1439	Ser-17 to Gly-26,	H0124: 5
					Glu-29 to Arg-37.
HRDFI13	574561	417	1-177	1440	Gly-1 to Ala-6.	H0124: 2
HRDFJ71	574553	418	173-337	1441	Glu-10 to Ala-19.	H0124: 2
HRDFK03	924925	419	3-305	1442	His-1 to Met-14.	H0124: 3
HRDFK41	867106	420	185-328	1443		H0124: 2
HRDFM18	574435	421	46-120	1444	Gly-7 to Glu-12.	H0124: 2
HRDFN95	574565	422	130-38	1445	Arg-1 to Arg-7.	H0124: 2
HRDFQ64	733847	423	56-268	1446	Val-1 to Gly-6,	H0124: 2
					Gly-23 to His-32.
HRDFQ75	525524	424	3-149	1447	Glu-7 to Phe-15,	H0124: 2
					Asn-32 to Lys-41.
HRDFT06	867109	425	57-245	1448	Pro-31 to Ser-36,	H0124: 3
					Asn-47 to Glu-59.
HRDFT15	574549	426	3-134	1449		H0124: 4
HRDFT45	506584	427	123-527	1450		AR061: 1, AR089: 0
						H0124: 3
HRDFT84	584823	428	3-458	1451	Pro-19 to Lys-25,	H0124: 3	6q16	136550, 602772
					Asp-30 to Pro-42,
					Pro-72 to Asp-83.
HRDFU48	573030	429	3-134	1452		H0124: 2
HSHAX53	518795	430	1-213	1453		S0037: 3
HSHBV66	523348	431	155-316	1454		S0037: 3
HSHBV67	529483	432	188-301	1455		S0037: 2
HSHCF34	529313	433	89-226	1456		S0037: 2
HSKCS36	529163	434	2-187	1457		S0027: 2
HSKCT33	866514	435	1-264	1458	Gly-1 to Gly-6,	S0027: 3
					Arg-11 to Cys-22,
					Phe-65 to Lys-73.
HSKDA70	757183	436	98-613	1459		L0757: 4, L0806: 3,
						L0761: 2, L0800: 2,
						S0027: 2, L0770: 1,
						L0646: 1, L0764: 1,
						L0662: 1, L0653: 1,
						L0659: 1, L0787: 1,
						S0126: 1, S0390: 1,
						S0037: 1 and L0751: 1.
HSKDJ16	661928	437	2-151	1460	Gly-1 to Arg-6.	S0027: 2
HSKEF43	866410	438	1-270	1461	Pro-1 to Thr-11,	S3014: 1 and S0027: 1.
					Ser-23 to Thr-31,
					Pro-49 to Ile-57,
					Thr-75 to Ala-80.
HSKEK63	744336	439	138-284	1462		H0135: 2 and S0027: 1.
HSKEM02	969071	440	3-401	1463	Gln-31 to Gln-36,	S3014: 1 and S0027: 1.
					Thr-38 to Lys-44,
					Arg-58 to Arg-64,
					Tyr-72 to Val-78,
					Val-96 to Phe-101,
					Ala-105 to Gly-119.
HSKET11	967000	441	2-427	1464	Gly-20 to Ser-27,	S0027: 2
					Glu-88 to Lys-95.
HSKHJ11	965002	442	299-421	1465		S0027: 2 and S3014: 1.
HSKHS71	911592	443	1-381	1466	Ala-94 to Cys-100.	AR089: 6, AR061: 4
						S3014: 2
HSKIT38	855173	444	199-381	1467		S3014: 1 and S0194: 1.
HSKJS05	930979	445	1-57	1468		L0766: 1, S3014: 1 and
						S0206: 1.
HSKKD70	916984	446	236-469	1469	Gly-43 to Trp-48,	S3014: 1 and S0028: 1.
					Met-50 to Asn-60.
HSKKL06	934040	447	107-409	1470	Pro-13 to Ser-18,	S0390: 1 and S3014: 1.
					Gly-46 to Thr-52.
HSKNO53	728210	448	384-533	1471		S3012: 1 and S0206: 1.
HSKWA56	916496	449	272-436	1472		S0206: 2
HSKWA78	731756	450	257-406	1473	Glu-10 to Asn-34.	S0206: 2
HSKWA79	733394	451	148-312	1474	Ser-1 to Trp-16.	S0206: 2 and L0749: 1.
HSKXG06	935455	452	221-90	1475		S0206: 2
HSKXJ15	866373	453	121-450	1476		S3012: 1 and S0206: 1.
HSKXN20	668928	454	116-223	1477	Pro-2 to Ile-16,	S0206: 2
					Gln-18 to Lys-23.
HSKXP58	955073	455	3-134	1478	Pro-33 to Trp-38.	S0206: 2
HSKXQ58	736045	456	24-170	1479		S0206: 2
HSKYG66	698007	457	88-345	1480	Arg-7 to His-12,	S0206: 3 and L0758: 1.
					Pro-22 to Gln-28,
					Arg-70 to Pro-77.
HSKYH52	466574	458	189-383	1481	Ser-21 to Lys-32.	S0206: 2
HSKYJ96	921032	459	101-268	1482		H0251: 1 and S0206: 1.
HSKZE12	970639	460	117-61	1483		S0027: 1 and S0206: 1.
HSKZE32	959400	461	129-1	1484	Lys-2 to Cys-15.	S0027: 2, L0748: 2,
						L0751: 2 and S0192: 1.
HSLAB77	772652	462	122-313	1485	Ala-21 to Gly-26.	S0028: 2
HSLBO30	574086	463	1-210	1486	Ala-14 to Arg-21.	S0028: 2
HSLBW19	671738	464	104-226	1487	Val-25 to Lys-32.	S0028: 2
HSLBX08	959911	465	2-271	1488		S0028: 2
HSLBX20	574004	466	139-435	1489	Leu-17 to Asp-22,	S0028: 2
					Pro-30 to Glu-36,
					Asn-40 to Asn-46,
					Pro-61 to Ser-66,
					Arg-76 to Ile-88.
HSLBZ91	573987	467	3-284	1490	Val-17 to Glu-22.	AR089: 8, AR061: 5
						S0028: 3
HSLCB15	693455	468	170-631	1491	Thr-1 to Trp-7,	S0028: 2 and L0744: 1.
					Thr-9 to Gly-18,
					Gly-26 to Pro-40,
					Gln-53 to Asp-66,
					Ala-70 to Met-107,
					Glu-110 to Arg-136.
HSLCJ46	529622	469	3-278	1492	Ser-87 to Asn-92.	S0028: 2
HSLCJ47	908627	470	6-302	1493	Ser-8 to His-20,	S3014: 1 and S0028: 1.
					Glu-28 to Thr-34,
					Leu-64 to Gly-76.
HSLCL38	951028	471	2-202	1494	Asp-24 to Cys-30.	S0028: 2
HSLCP75	529631	472	75-353	1495	Pro-7 to Gln-14.	S0028: 2
HSLCV95	793080	473	164-289	1496		S0028: 2
HSLDA25	679301	474	1-297	1497	Ser-1 to His-9,	S0028: 2
					Gln-32 to Asn-37,
					Tyr-58 to Leu-78.
HSLDB29	866340	475	7-402	1498		S0028: 2
HSLDC06	936010	476	3-227	1499		S0028: 2
HSLDG13	913664	477	17-232	1500	Arg-1 to Arg-18,	S0028: 2
					Glu-28 to Asn-39.
HSLDI16	574014	478	104-184	1501	Ile-1 to Thr-6.	S0028: 2
HSLDJ24	574050	479	1-264	1502	Gln-37 to Ile-43,	S0028: 2
					Pro-50 to Leu-58,
					Glu-64 to Leu-69.
HSLDJ94	753657	480	40-243	1503	Val-17 to Pro-22,	H0251: 1 and S0028: 1.
					Thr-39 to Trp-45,
					Gln-63 to Cys-68.
HSLDK43	675440	481	132-353	1504		S0390: 2 and S0028: 1.
HSLDM32	699486	482	2-163	1505	Pro-8 to Arg-18,	S0028: 2
					Phe-28 to Arg-35.
HSLDM79	526740	483	130-348	1506		S0028: 3
HSLDP16	573210	484	2-277	1507		AR061: 0, AR089: 0
						S0028: 2
HSLDW65	689722	485	238-429	1508		S0028: 2
HSLEB25	669654	486	125-343	1509	Gly-13 to Glu-24.	S0028: 2
HSLEC25	572859	487	2-298	1510	His-35 to Ser-42,	S0028: 2
					Asp-57 to Pro-62,
					Gly-70 to Gly-77.
HSLEC36	936003	488	1-282	1511	Ser-7 to Ala-13,	S0028: 2
					Pro-54 to Cys-59.
HSLED38	709381	489	102-491	1512		AR061: 3, AR089: 2
						S0126: 2 and S0028: 1.
HSLED42	572860	490	38-388	1513	Arg-1 to Pro-8.	S0028: 2
HSLEE46	572878	491	1-297	1514	Asp-1 to Asp-6.	S0028: 2
HSLEF89	572883	492	45-257	1515		S0028: 3
HSLEG74	825500	493	3-221	1516	Ser-12 to Trp-29.	S0037: 1 and S0028: 1.
HSLEH57	584090	494	2-142	1517	Pro-1 to Trp-10,	S0028: 2
					Ala-13 to Glu-18,
					Thr-31 to Trp-38,
					Glu-40 to Cys-47.
HSLEJ22	572863	495	59-247	1518	Gly-1 to Gly-10,	S0028: 2
					Arg-35 to Gly-44.
HSLEL46	573212	496	1-288	1519		S0028: 2
HSLEO70	841952	497	22-207	1520	Asn-20 to Glu-28,	S0028: 2
					Gly-55 to Lys-62.
HSLFE34	706986	498	3-263	1521	Ala-8 to Gly-16,	S0028: 2
					Ser-23 to His-49,
					Phe-73 to Ser-79.
HSLFF91	572885	499	10-339	1522	Pro-63 to Lys-71.	S0028: 3, L0800: 1,
						L0803: 1, L0777: 1 and
						L0731: 1.
HSLFM86	785489	500	2-304	1523	Arg-13 to Gly-22.	S0028: 2
HSLFS42	948740	501	25-300	1524	Pro-1 to His-7,	S0028: 2
					His-12 to Arg-24,
					Thr-32 to Gln-45,
					Arg-80 to Leu-85.
HSLFS45	717782	502	2-136	1525	Arg-1 to Ile-8.	S0028: 2
HSLFT76	725788	503	106-396	1526		S0028: 2
HSLFT89	786061	504	73-390	1527		S0028: 2
HSLFU01	916448	505	83-412	1528		S0028: 2
HSLGD23	675872	506	35-448	1529	Phe-1 to Gly-6,	S0028: 2
					Pro-46 to Gln-56.
HSLGH26	681705	507	160-312	1530	Ile-17 to Gln-23,	S0028: 2
					Arg-44 to Tyr-51.
HSLGK79	774049	508	3-389	1531	Pro-13 to Gly-22,	S0028: 2
					Asp-57 to Ala-63,
					Ser-78 to Ala-88.
HSLGV91	780005	509	50-289	1532	Tyr-1 to His-6.	S0028: 2
HSLGX20	669648	510	115-255	1533	His-8 to Ile-15,	S0028: 2
					Tyr-32 to Thr-37.
HSLHA55	866273	511	99-404	1534		S0028: 3
HSLHC22	673918	512	312-452	1535		S0028: 2 and L0754: 1.
HSLHP20	669210	513	52-432	1536	Gly-29 to Phe-34.	S0028: 2
HSLIA21	668116	514	3-125	1537	Pro-20 to Tyr-28,	S0028: 2
					Pro-30 to Lys-35.
HSLIG54	713982	515	67-396	1538	Arg-1 to Gly-18,	S0028: 2
					Ser-31 to Ser-37,
					Arg-39 to Gly-44.
HSLII61	918071	516	295-426	1539	His-35 to Ser-44.	S0250: 1, S0028: 1,
						L0748: 1 and L0750: 1.
HSLIJ57	659533	517	3-389	1540	Arg-39 to Gln-44.	AR089: 1, AR061: 0
						S0028: 2
HSLJB11	966227	518	1-144	1541	Ala-1 to Trp-6.	S0390: 1 and S0028: 1.
HSLJJ21	670330	519	14-343	1542	Ser-1 to Asp-12,	S0390: 1 and S0028: 1.
					Ala-22 to Asn-28.
HSLJJ83	727874	520	47-307	1543	Gly-19 to Asn-35.	S0390: 1 and S0028: 1.
HSLJK88	923108	521	79-216	1544		S0390: 2
HSLJN31	750394	522	3-251	1545		S0390: 1 and S0028: 1.
HSLJN49	920062	523	83-394	1546	Pro-35 to Ser-41.	S0390: 2 and S0028: 1.
HSLJN61	966267	524	160-498	1547	Glu-1 to Phe-6,	S0390: 2 and S0028: 1.
					Lys-12 to Pro-31,
					Arg-41 to Ile-47,
					Glu-50 to Arg-55.
HSLJN71	759941	525	16-213	1548	Pro-16 to Arg-22,	S0390: 1 and S0028: 1.
					Lys-29 to His-35.
HSLJQ31	961447	526	151-399	1549		S0390: 2
HSLJW53	866261	527	2-94	1550		S0390: 2
HSLKC70	866256	528	102-422	1551		S0390: 1 and S0028: 1.
HSRAX95	747078	529	61-324	1552	His-14 to Leu-21,	S0011: 2
					Glu-34 to Leu-46,
					Glu-62 to Asn-67.
HSRBE02	921205	530	60-269	1553	Gln-19 to Arg-26,	S0011: 2
					Gln-41 to Leu-47,
					Arg-53 to Phe-69.
HSRDE58	519542	531	32-181	1554	Glu-10 to Cys-15,	S0022: 2
					Ser-21 to Cys-39.
HSRDI39	921749	532	144-386	1555	Ser-40 to Lys-47.	S0022: 4 and S0011: 1.
HSRDJ68	530333	533	111-227	1556		S0022: 1 and S0011: 1.
HSRDK92	838033	534	1-222	1557		S0022: 1 and S0011: 1.
HSRDL32	530294	535	110-232	1558	Pro-1 to His-7,	S0022: 2
					Glu-17 to Lys-30.
HSRDM42	523843	536	1-150	1559		S0022: 2 and S0011: 1.
HSRDN23	530334	537	90-212	1560	Arg-16 to Glu-21,	S0022: 2
					Leu-23 to Gly-32.
HSRDQ89	780221	538	6-137	1561		S0022: 1 and S0011: 1.
HSRDS77	530289	539	148-243	1562		S0022: 1 and S0011: 1.
HSREB43	524678	540	3-125	1563	Pro-7 to Cys-27,	S0011: 2
					Tyr-32 to Lys-41.
HSREC27	753810	541	62-310	1564	Pro-15 to Ile-23,	S0011: 2
					Ser-31 to Tyr-36,
					Ala-43 to His-48,
					Pro-54 to Arg-60.
HSRED45	530233	542	3-146	1565		S0011: 2
HSREG25	523815	543	156-323	1566	Val-22 to Phe-36.	S0011: 2 and S0022: 1.
HSREG40	712779	544	1-513	1567	Val-22 to Pro-31,	S0011: 1, S0242: 1 and	17q21.3-q22	109270, 109270,
					Pro-43 to Ser-51,	S0194: 1.		109270, 109270,
					Ala-55 to Ala-86,			109270, 120150,
					Ala-102 to Ile-120,			120150, 120150,
					Pro-122 to Val-148.			139250, 148065,
								148080, 150200,
								154275, 156490,
								171190, 176960,
								185800, 221820,
								249000, 253250,
								600119, 600119,
								600525, 600852,
								601844
HSREG49	723267	545	1-165	1568		S0338: 1 and S0011: 1.
HSRFC96	558385	546	62-178	1569	Met-11 to Asp-16,	S0022: 2
					Ser-23 to Lys-29.
HSRFD34	575288	547	29-151	1570		S0022: 2
HSRFD47	973782	548	163-357	1571		S0022: 6
HSRFE58	556519	549	10-156	1572		S0022: 2
HSRFF03	925369	550	33-143	1573		S0022: 2
HSRFG30	920265	551	1-273	1574		S0022: 2
HSRFR21	529767	552	109-243	1575	Ser-7 to Ser-12,	S0022: 2
					Gln-21 to Trp-27.
HSRFZ71	557976	553	62-289	1576		S0022: 2
HSRGA32	529726	554	134-268	1577		S0022: 2
HSRGB23	974538	555	296-400	1578	Gly-2 to Gly-14.	S0022: 4
HSRGE47	974539	556	2-214	1579	Lys-24 to Gln-34,	S0022: 3
					His-41 to Arg-46.
HSRGG66	556518	557	2-112	1580		S0022: 2
HSRGK48	535012	558	2-124	1581		S0022: 3
HSRGQ30	534479	559	3-248	1582		S0022: 4, L0662: 1 and
						S0011: 1.
HSRGS08	960211	560	7-195	1583		S0022: 3
HSRGV79	921005	561	124-315	1584	Arg-53 to Thr-58.	S0022: 9
HSRGW30	529624	562	170-310	1585		S0022: 2
HSRGZ32	699561	563	1-240	1586		S0022: 5
HSRHA45	974551	564	19-168	1587		S0022: 7
HSSAE47	720685	565	193-318	1588	Ile-1 to Pro-10.	H0135: 2
HSSAF46	508117	566	121-330	1589		H0135: 2
HSSAN96	936108	567	57-251	1590		H0135: 2
HSSAP44	508831	568	46-234	1591	Gln-7 to Arg-18.	H0135: 2
HSSAV18	508832	569	90-200	1592	Ala-1 to Leu-7,	H0135: 2
					Arg-27 to Gly-33.
HSSAV88	508829	570	62-241	1593	Asn-1 to Ser-17.	H0135: 2
HSSBO48	871217	571	2-370	1594		H0135: 2
HSSBO59	707683	572	259-402	1595	Ile-4 to Glu-18.	H0135: 2
HSSCC04	928001	573	46-132	1596	Gly-1 to Asn-9.	H0135: 2
HSSDJ02	871226	574	2-229	1597		H0135: 2
HSSDL20	667599	575	2-172	1598	Ala-1 to Pro-8,	H0124: 2 and H0135: 1.
					Thr-19 to Pro-27.
HSSDL94	526758	576	16-297	1599	His-10 to Arg-25.	H0135: 2
HSSDR63	537329	577	1-225	1600	Ala-28 to Glu-34.	H0135: 2
HSSDX20	783128	578	17-127	1601		H0135: 3
HSSED56	625572	579	182-370	1602	Cys-30 to Arg-35.	H0135: 1 and S0027: 1.
HSSEF29	689837	580	152-403	1603	Pro-41 to Met-46.	H0135: 2
HSSEK75	766507	581	57-176	1604	Arg-10 to Cys-16.	H0135: 2
HSSEU91	766573	582	86-175	1605	Ser-1 to Lys-8.	H0135: 1 and S0028: 1.
HSSEU93	911261	583	116-370	1606	Asn-1 to Gly-17,	H0135: 2
					Gln-23 to His-55,
					Glu-68 to Cys-77.
HSSEV89	572851	584	62-310	1607	Pro-21 to Asp-27,	H0135: 2	16
					Val-50 to Cys-62.
HSSFF80	753589	585	3-299	1608	Gly-8 to Gly-14.	H0135: 2
HSSFQ43	715318	586	209-328	1609	Asp-12 to Asn-21.	H0135: 2
HSSFR41	707006	587	75-359	1610	Pro-13 to Pro-18,	H0135: 2
					Ala-41 to Cys-50.
HSSFX54	708845	588	3-248	1611	Pro-42 to Trp-47,	H0135: 2 and L0581: 1.
					Trp-62 to Pro-68.
HSSGC65	955064	589	2-403	1612	Ala-18 to Ala-24,	H0135: 3 and L0761: 1.
					Pro-26 to Asp-37.
HSSGC66	319740	590	101-3	1613		H0135: 2
HSSGC72	760648	591	2-91	1614		H0135: 2
HSSGD37	739505	592	2-160	1615	Ser-47 to Ser-52.	H0135: 2
HSSGH47	720367	593	66-353	1616	Gln-1 to Lys-8.	H0135: 2
HSSGI20	668919	594	114-341	1617	Tyr-26 to Glu-31.	H0135: 2
HSSGI75	767325	595	255-16	1618		H0135: 2
HSSGI91	789411	596	3-305	1619	Tyr-18 to Pro-27,	H0135: 2
					Gln-32 to Leu-41,
					Pro-90 to Gly-99.
HSSGK96	960636	597	72-287	1620	Gly-12 to His-19.	H0135: 2
HSSGL55	766115	598	177-545	1621		H0135: 4 and L0747: 1.	7q32	180105, 190900,
								222800, 246900
HSSGL78	788924	599	211-390	1622		H0135: 2
HSSGM62	707685	600	2-409	1623	Ser-1 to Tyr-6,	H0135: 2
					Met-87 to Tyr-93,
					Ala-108 to Ala-113.
HSSGN47	707003	601	3-338	1624	His-1 to Gly-28,	H0135: 2, L0794: 2,	19q13.1	164731, 172400,
					Ser-54 to Gly-79,	L0636: 1 and L0749: 1.		172400, 180901,
					Pro-81 to Lys-102.			180901, 221770,
								248600, 600918,
								602716
HSSHA92	792714	602	169-309	1625	Leu-26 to Asn-38.	H0135: 2
HSSJN44	716573	603	340-438	1626		H0124: 1 and H0135: 1.
HSSJN49	708841	604	93-305	1627	Trp-1 to Asn-6,	H0135: 2
					Gln-37 to Cys-52,
					Pro-64 to Lys-70.
HSSJU66	653212	605	1-204	1628	Gly-1 to Ser-6.	H0135: 2
HSSJV60	970749	606	155-373	1629	Arg-1 to Ser-7.	H0135: 2 and L0779: 1.
HSSKB40	711130	607	68-325	1630	Gly-1 to Pro-12,	H0135: 1, S0037: 1 and	22
					Phe-25 to Asn-34,	L0754: 1.
					Arg-40 to Ala-46,
					Pro-73 to Trp-78,
					Gln-80 to Pro-86.
HSSMT78	712468	608	123-380	1631	Gly-6 to Arg-12.	H0135: 2
HYBAE74	925074	609	36-239	1632		H0041: 2
HYBAG11	967880	610	1-207	1633		H0041: 2
HYBAU83	732419	611	106-234	1634		H0041: 2
HYBAX25	456251	612	97-354	1635	Leu-29 to Lys-34,	H0041: 2
					Gly-63 to Cys-69.
HYBAY40	531202	613	2-298	1636		H0041: 2
HYBBB24	584989	614	19-150	1637		H0041: 2, L0764: 1,
						L0766: 1 and L0759: 1.
HYBBI18	584991	615	174-350	1638	Lys-27 to His-39.	H0041: 2
HYBBJ30	693345	616	3-215	1639		H0041: 1 and S0011: 1.
HYBBL17	691328	617	2-166	1640	Arg-20 to Ala-27.	H0041: 2
HYBBK83	505138	618	489-127	1641		H0041: 1
	510490	1012	164-544	2035	Ala-40 to Gln-45,
					Gln-55 to Thr-65,
					Pro-93 to Ser-101.
HYBBG93	531201	619	2-70	1642		H0041: 1
HYBAY92	792923	620	193-438	1643		L0748: 2 and H0041: 1.
HYBAW03	925068	621	110-295	1644		H0041: 1 and L0758: 1.
HYBAH65	518736	622	337-606	1645	Lys-1 to Gly-7,	L0748: 7, H0041: 1
					Arg-12 to Pro-18,	and L0747: 1.
					Val-22 to Trp-29,
					Pro-41 to Leu-49,
					Glu-51 to Asp-64.
HYBAG53	669602	623	296-475	1646		L0748: 2, H0041: 1
						and L0744: 1.
HYBAF63	745585	624	308-508	1647		H0041: 1 and L0756: 1.
HSSMZ93	530752	625	7-246	1648	Arg-1 to Asn-12,	H0135: 1
					Gln-31 to Gly-37,
					Pro-48 to Gly-55.
HSSMZ01	921800	626	72-278	1649	Thr-18 to Val-23,	H0135: 1
					Leu-39 to Gln-45.
HSSMW90	975081	627	3-191	1650		H0135: 1 and L0755: 1.
HSSMT76	928421	628	2-193	1651	Trp-36 to Pro-45.	H0135: 1
HSSMT70	530758	629	59-214	1652	Pro-22 to Ile-28.	H0135: 1
HSSMP20	854092	630	144-299	1653	Asp-2 to Ala-12,	H0135: 1 and L0754: 1.
					Leu-21 to Ser-45.
HSSKD17	726525	631	92-511	1654	Gln-1 to Gly-10,	H0135: 1 and L0747: 1.
					Arg-15 to Arg-22,
					Leu-49 to Asp-58,
					Arg-72 to Trp-78.
HSSJQ60	975185	632	1-147	1655	Lys-30 to Phe-37.	H0135: 1
HSSJP81	911334	633	153-440	1656	Arg-11 to Leu-26,	H0135: 1, L0766: 1
					Pro-29 to Gly-38,	and L0438: 1.
					Leu-78 to Ser-84.
HSSJL22	871170	634	141-569	1657	Ser-37 to Lys-49.	H0135: 1
	894004	1013	528-358	2036	Val-34 to Pro-39.
HSSJK65	747891	635	37-288	1658		L0748: 2, H0135: 1
						and L0749: 1.
HSSJH78	773558	636	84-218	1659	Ile-13 to Cys-19,	H0135: 1, L0439: 1
					Ser-23 to Glu-28.	and L0747: 1.
HSSJA08	959336	637	387-536	1660		L0764: 2, H0135: 1
						and L0804: 1.
HSSGK12	970714	638	236-370	1661	Phe-10 to Lys-17.	AR051: 144, AR050:
						132, AR054: 132
						H0135: 1
HSSGJ84	781975	639	335-505	1662	Lys-9 to Lys-14,	H0135: 1 and L0748: 1.
					Ser-33 to Arg-40.
HSSGD96	796410	640	1-111	1663	Gly-1 to Ser-16.	H0135: 1
HSSGD82	779899	641	168-524	1664	Met-55 to Gly-66.	H0135: 1 and L0741: 1.
HSSGD56	608144	642	209-379	1665	Arg-1 to Asp-10,	H0135: 1
					Gln-16 to Lys-21.
	975065	1014	34-204	2037	Arg-1 to Asp-10,
					Gln-16 to Lys-21.
HSSFW84	781973	643	36-371	1666	Gly-19 to Gly-28,	H0135: 1 and L0439: 1.
					Gly-43 to Gln-67,
					Ser-86 to Glu-93,
					Leu-95 to Val-101.
HSSFU84	888462	644	1-402	1667	Pro-6 to Thr-15,	AR051: 21, AR054:
					Ala-20 to Arg-36,	16, AR050: 10
					Pro-38 to Gln-85.	H0135: 1
HSSFN08	959735	645	243-500	1668		H0135: 1 and L0365: 1.	Xq28	300031, 300044,
								300048, 300049,
								300049, 300055,
								300100, 300100,
								300104, 300126,
								301201, 301590,
								302060, 302060,
								302060, 302060,
								302960, 303700,
								303800, 303900,
								304800, 305900,
								305900, 305900,
								306700, 306995,
								308310, 308840,
								308840, 308840,
								309200, 309548,
								309620, 309900,
								310300, 310400,
								310460, 310460,
								311300, 311510,
								314300, 314400
HSSFK90	788687	646	423-151	1669		H0135: 1
HSSFB73	955200	647	334-137	1670		H0135: 1 and L0748: 1.
HSSEU40	891055	648	101-238	1671	His-6 to Ala-17,	AR054: 8, AR051: 3,
					Thr-37 to Trp-44.	AR050: 1
						H0135: 1 and L0749: 1.
HSSEP69	871211	649	30-287	1672		H0135: 1
HSSEI90	789157	650	2-370	1673	Phe-7 to Arg-13.	H0135: 1 and L0748: 1.
HSSEG25	679351	651	150-338	1674	Pro-10 to Asp-15,	L0766: 2, L0747: 2,
					Leu-38 to Gly-54.	H0135: 1, L0796: 1,
						L0789: 1 and L0752: 1.
HSSEF33	702701	652	274-522	1675		H0135: 1 and L0748: 1.
HSSEC79	775312	653	1-267	1676	Thr-24 to Asp-43,	H0135: 1 and L0592: 1.
					Pro-53 to Asp-58,
					Cys-62 to Gly-67.
HSSDQ07	880720	654	81-419	1677	Gly-6 to Thr-12.	H0135: 1
HSSDI03	924975	655	107-283	1678	Val-1 to Cys-13.	H0135: 1, L0538: 1
						and L0747: 1.
HSSDH37	575460	656	18-251	1679	Pro-2 to Ser-11.	H0135: 1
HSSDC50	724696	657	1-219	1680	Arg-1 to Ser-7,	H0135: 1 and L0439: 1.
					Gln-20 to Gly-28.
HSSCC14	600216	658	647-399	1681		H0135: 1
HSSAZ04	933015	659	15-170	1682		L0766: 2 and H0135: 1.
HSSAY34	703345	660	104-412	1683		H0135: 1 and L0439: 1.
HSSAP68	564334	661	704-417	1684		H0135: 1
HSSAJ89	875882	662	89-316	1685	Val-16 to Gln-26,	H0135: 1 and L0747: 1.
					Ala-32 to Ser-40.
HSSAE52	871244	663	10-180	1686		H0135: 1 and L0606: 1.
HSSAA15	965347	664	42-491	1687	Ser-13 to Ser-19,	AR050: 62, AR054:
					Asp-42 to Arg-49,	51, AR051: 51
					Ser-95 to Lys-104,	H0135: 1
					Gln-145 to Thr-150.
HSRAY10	961237	665	28-240	1688	Ser-19 to Met-36,	L0666: 1 and S0011: 1.
					Ser-39 to Thr-49.
HSRAS82	780222	666	46-237	1689	Thr-5 to Asn-13,	L0748: 1 and S0011: 1.
					Pro-40 to His-46,
					Phe-54 to Phe-59.
HSRAF70	524680	667	194-379	1690	Lys-1 to Gln-8.	S0011: 1
HSRAF11	967886	668	176-271	1691		S0011: 1
HSRAD72	539530	669	3-221	1692		S0011: 1
HSRAD65	871268	670	1-135	1693	Asn-1 to Arg-12.	S0011: 1	8p21-p12	152760, 173370,
								180100, 185430,
								270800, 277700,
								602629
HSRAD53	525490	671	60-335	1694	Ala-1 to Cys-14,	S0011: 1
					Val-72 to Trp-77.
HSRAD49	722134	672	211-390	1695		L0761: 1, L0749: 1,
						L0758: 1 and S0011: 1.
HSRAD31	524845	673	136-249	1696	Cys-2 to Pro-11.	S0011: 1
HSRAD10	968614	674	236-445	1697	Lys-10 to Gly-19,	L0803: 1 and S0011: 1.
					Ala-23 to Cys-29.
HSRAD03	925505	675	120-305	1698	Pro-10 to Met-18,	S0011: 1
					Pro-48 to Glu-62.
HSRAB87	823174	676	3-122	1699	Thr-10 to Gly-18.	S0011: 1
HSRAB82	522945	677	49-246	1700	Leu-44 to Arg-50.	S0011: 1
HSRAB76	508105	678	48-299	1701		S0011: 1
HSRAB36	522946	679	2-163	1702		S0011: 1
HSRAB34	706996	680	3-146	1703	Phe-1 to Asn-12.	S0011: 1
HSRAB08	960411	681	2-145	1704	Ile-1 to Lys-6.	S0011: 1
HSRAA86	527194	682	74-202	1705		S0011: 1
HSRAA80	937640	683	2-325	1706	Ile-1 to Cys-10,	AR061: 150, AR089:
					Arg-95 to Phe-106.	93
						S0011: 1
HSRAA64	955314	684	220-327	1707		S0011: 1
HSRAA51	522834	685	3-326	1708	Ser-16 to Gly-27,	S0011: 1
					Asp-48 to Ala-53,
					Thr-70 to Ser-77.
HSRAA39	719712	686	1-174	1709	Pro-17 to Trp-22.	S0011: 1
HSRAA37	522837	687	29-127	1710	Thr-7 to His-13.	S0011: 1
HSRAA24	795855	688	3-446	1711	Phe-1 to Leu-8,	S0011: 1
					Pro-72 to Trp-86.
HSRAA23	524795	689	3-251	1712	Pro-8 to His-27,	S0011: 1
					Thr-56 to Ser-61,
					Leu-77 to Phe-83.
HSLKB62	905738	690	212-937	1713	Glu-84 to Trp-92,	AR050: 220, AR051:
					Asn-106 to Gly-115,	151, AR054: 146,
					Lys-184 to Arg-191.	AR061: 7, AR089: 2
						S0390: 1
HSLKB37	929743	691	171-374	1714		L0776: 2, L0748: 2,
						L0598: 1, L0529: 1,
						S0390: 1 and L0758: 1.
HSLKA06	934638	692	1-222	1715	Gln-8 to Arg-14,	L0659: 1, L0809: 1 and
					Met-21 to Thr-27.	S0390: 1.
HSLJJ62	742895	693	173-436	1716	His-22 to Tyr-32.	L0748: 3 and S0390: 1.
HSLJF33	938811	694	3-521	1717	Glu-70 to Gly-76.	AR089: 1, AR061: 1
						S0390: 1
HSLJD02	965826	695	47-907	1718	Leu-53 to Gln-58,	AR054: 7, AR051: 1,
					Phe-162 to Gly-167,	AR089: 1, AR061: 1,
					Gln-282 to Ala-287.	AR050: 0
						S0390: 1
HSLIJ48	721248	696	64-570	1719		S0028: 1 and L0748: 1.
HSLIG07	952493	697	269-454	1720	Ser-19 to Asp-24.	L0766: 2, L0740: 2,
						L0803: 1, S0028: 1,
						L0745: 1 and L0759: 1.
HSLIE03	923393	698	163-321	1721	Asn-27 to His-34.	S0028: 1 and L0592: 1.
HSLIC21	670359	699	189-512	1722	Pro-3 to Ser-10.	L0742: 2, S0028: 1 and
						L0366: 1.
HSLHZ82	779067	700	320-526	1723		S0028: 1 and L0748: 1.
HSLHZ10	963808	701	59-307	1724	Val-24 to Asn-29,	S0028: 1 and L0361: 1.
					Arg-56 to Gly-64.
HSLHV27	964075	702	983-21	1725	His-8 to Gly-18.	AR050: 5, AR061: 2,
						AR054: 1, AR089: 1
						S0028: 1
HSLHG49	722570	703	162-290	1726		L0438: 1, S0028: 1 and
						L0439: 1.
HSLHC40	710681	704	230-400	1727		L0755: 2 and S0028: 1.
HSLGY08	959371	705	215-397	1728	Tyr-4 to Ser-12,	S0028: 1 and L0742: 1.
					His-23 to Leu-29.
HSLGQ48	720956	706	141-413	1729	Glu-2 to Thr-9.	L0438: 1, S0028: 1 and
						L0439: 1.
HSLGP07	953305	707	224-442	1730	Asp-7 to Arg-15.	S0028: 1 and L0753: 1.
HSLGO19	668634	708	115-543	1731		L0665: 1, S0028: 1,
						L0748: 1 and L0750: 1.
HSLGN78	773565	709	1-156	1732		S0028: 1 and L0591: 1.
HSLGN52	466026	710	3-266	1733	Thr-26 to Gln-40,	S0028: 1 and L0740: 1.	12
					Glu-47 to Arg-53.
HSLGK46	719031	711	2-226	1734	Gln-8 to Asn-15,	S0028: 1 and L0601: 1.
					His-23 to Gln-28.
HSLGK26	929286	712	422-607	1735		S0028: 1 and L0748: 1.	1q12-1q21.2	104770, 107670,
								110700, 145001,
								146760, 146790,
								159001, 191315,
								600897, 601412,
								601652, 601863,
								602491
HSLGK23	675266	713	176-343	1736		L0747: 2, L0766: 1 and
						S0028: 1.
HSLGJ37	708824	714	120-452	1737	Thr-80 to Cys-87.	S0028: 1 and L0439: 1.
HSLGI76	770035	715	379-558	1738		S0028: 1 and L0748: 1.
HSLGI67	465989	716	47-253	1739		L0439: 6 and S0028: 1.
HSLGH70	871888	717	57-227	1740	Pro-23 to Leu-30.	S0028: 1 and L0745: 1.
HSLGG86	784703	718	38-202	1741		S0028: 1 and L0439: 1.
HSLGG79	775146	719	1-126	1742	Asp-1 to Thr-16.	S0028: 1 and L0740: 1.
HSLGA79	774051	720	2-151	1743		S0028: 1 and L0599: 1.
HSLGA45	717776	721	210-13	1744	Pro-9 to His-17,	S0028: 1 and L0777: 1.
					Gly-19 to Gly-24,
					Gly-30 to Ile-38,
					Leu-42 to Lys-51,
					Pro-54 to Asn-66.
HSLGA24	955333	722	805-284	1745	Pro-45 to Arg-50,	AR089: 14, AR061: 3
					Glu-56 to Ser-62,	S0028: 1
					Ser-70 to Glu-76,
					Asp-141 to Arg-149.
HSLFU18	666405	723	576-842	1746	Asp-7 to Lys-13,	L0770: 3, L0777: 3,
					Asn-63 to Tyr-75.	L0731: 3, L0780: 2,
						L0040: 1, L0764: 1,
						L0766: 1, L0804: 1,
						L0809: 1, L0790: 1,
						L0438: 1, S0028: 1,
						L0439: 1, L0751: 1,
						L0745: 1 and L0749: 1.
HSLFT29	680451	724	1-462	1747	Glu-1 to Phe-8,	AR089: 2, AR061: 2
					Met-55 to Leu-64,	S0028: 1
					Gly-93 to His-99,
					Ala-135 to Cys-141.
HSLFN96	796375	725	3-167	1748	Gln-23 to Arg-39.	S0028: 1
HSLFI01	876881	726	115-342	1749	Asp-12 to Thr-18.	S0028: 1 and L0754: 1.
HSLED70	757319	727	327-515	1750	Ser-40 to Ser-47,	S0028: 1, L0777: 1 and
					Pro-52 to Gly-60.	L0759: 1.
HSLEB84	783130	728	122-280	1751		S0028: 1 and L0754: 1.
HSLDW24	779689	729	33-209	1752	Tyr-38 to His-45.	L0756: 2 and S0028: 1.
HSLDT25	949079	730	1544-867	1753		AR051: 22, AR050:
						20, AR054: 19, AR089:
						17, AR061: 9
						S0028: 1
HSLDR18	578926	731	148-270	1754	Glu-1 to Gly-10,	S0028: 1
					Glu-21 to Asn-32.
HSLDR05	932128	732	83-232	1755	Arg-1 to Asp-7.	S0028: 1
HSLDP66	866331	733	189-401	1756		S0028: 1
HSLDO01	916969	734	33-113	1757		S0028: 1
HSLDM82	780055	735	3-428	1758	Tyr-18 to Leu-23,	L0361: 2 and S0028: 1.	1p36.3	120550, 120570,
					Tyr-64 to Ser-70,			120575, 153454,
					Glu-77 to Arg-82.			236250, 256700
HSLDF25	430328	736	363-1	1759	Gln-38 to Cys-43,	S0028: 1
					Val-55 to Cys-62,
					Pro-64 to Pro-69,
					Lys-76 to Phe-83,
					Ser-85 to Arg-91,
					Lys-113 to Arg-121.
	677994	1015	251-123	2038	Pro-1 to Thr-13,
					Leu-31 to Leu-37.
HSLCY75	766533	737	326-550	1760	Leu-22 to Arg-27.	S0028: 1 and L0749: 1.
HSLCX61	742031	738	343-507	1761	Gly-4 to Tyr-18,	AR089: 3, AR061: 1
					Gly-48 to Gly-55.	L0439: 2 and S0028: 1.
HSLCF96	637670	739	355-1248	1762	Val-2 to Trp-7,	AR054: 38, AR050:
					Lys-9 to Trp-18,	26, AR051: 25, AR061: 2,
					Gln-20 to Gly-25,	AR089: 1
					Gln-79 to His-85,	S0028: 1
					Pro-134 to Asp-139,
					Asp-164 to Thr-171,
					Pro-223 to Arg-228.
	954777	1016	1332-430	2039	Thr-1 to Cys-6,
					Ser-52 to Gly-57,
					Gln-111 to His-117.
HSLBW39	705630	740	1-432	1763	Asp-2 to Trp-28,	S0028: 1 and L0591: 1.
					Pro-33 to Asn-39,
					Pro-88 to Gln-104.
HSKZE91	790166	741	75-335	1764	Val-1 to Leu-7,	S0027: 1 and L0605: 1.
					Pro-11 to Glu-20.
HSKYG48	721631	742	3-296	1765	Arg-6 to Lys-17.	S0206: 1
HSKXA69	754258	743	2-169	1766		L0748: 2, S0206: 1 and
						L0599: 1.
HSKKE11	965857	744	90-245	1767	Arg-1 to Gln-10,	S3014: 1 and L0750: 1.
					Thr-41 to Gln-48.
HSKJR15	866396	745	59-406	1768	Gln-11 to Gly-18,	AR089: 1, AR061: 0
					Asn-25 to Ser-30.	L0666: 1, S3014: 1 and
						L0756: 1.
HSKJC88	866402	746	154-357	1769	Arg-52 to Gln-58.	L0809: 1 and S3014: 1.
HSKII90	788894	747	482-613	1770		L0599: 2 and S3014: 1.
HSKHZ47	720286	748	400-534	1771	Tyr-1 to Tyr-6.	L0745: 3 and S3014: 1.
HSKHT93	957866	749	245-415	1772		L0766: 1 and S3014: 1.	5q11	253200, 600887
HSKHP10	964568	750	136-240	1773		S3014: 1 and L0779: 1.
HSKGS69	755046	751	3-335	1774	Asn-23 to Pro-31.	S3014: 1, L0748: 1 and
						L0749: 1.
HSKEH21	941976	752	2-703	1775	Leu-26 to Gly-38,	AR061: 11, AR089: 4
					Leu-101 to Thr-116,	S0027: 1
					Glu-144 to Val-151,
					Pro-177 to Pro-183,
					Thr-188 to Thr-195,
					Phe-203 to Asn-234.
HSKDC06	935452	753	174-332	1776		S0027: 1 and L0599: 1.
HSKCR54	922730	754	86-547	1777	Gly-45 to Arg-50.	AR061: 8, AR089: 7
						S0027: 1 and L0749: 1.
HSKCD43	714389	755	3-188	1778		L0759: 2, S0027: 1 and	6q21	120110, 121014,
						L0748: 1.		601666, 602772
HSKBW86	785783	756	1-180	1779	Tyr-12 to Ile-24,	AR089: 6, AR061: 3
					Glu-43 to Lys-49.	S0027: 1
HSKBW62	521937	757	23-175	1780		S0027: 1
HSKBW21	671383	758	46-141	1781		S0027: 1 and L0779: 1.
HSKBV67	561585	759	90-257	1782	Leu-15 to Ser-21.	S0027: 1
HSKAE10	968508	760	640-464	1783	Thr-17 to Arg-22.	L0752: 2, L0803: 1 and
						S0027: 1.
HSKAC29	535402	761	184-375	1784		S0027: 1
HSJCA03	925252	762	213-362	1785		S0032: 1 and L0758: 1.
HSJAY64	866540	763	123-284	1786	Pro-4 to Gln-11,	S0032: 1 and L0361: 1.
					Cys-16 to Gly-21.
HSJAB49	723261	764	209-337	1787	Gly-1 to Ser-10.	S0032: 1 and L0748: 1.
HSHCL04	840406	765	640-1053	1788	Arg-34 to Asn-39.	AR051: 23, AR050:
						17, AR054: 12, AR061: 5,
						AR089: 4
						S0037: 1
	957191	1017	331-2	2040	Arg-22 to Asn-27.
	957192	1018	3-173	2041
	957193	1019	344-192	2042
HSHCK86	785392	766	1-291	1789		S0037: 1
	792112	1020	574-353	2043	Gly-22 to Gln-34,
					Tyr-48 to Glu-56.
HSHCJ63	468536	767	73-336	1790	Val-19 to Tyr-25,	S0037: 1
					Gln-82 to Ser-87.
	470736	1021	478-359	2044
HSHBU07	866636	768	227-457	1791	Lys-3 to Lys-15.	S0037: 1
HSHAH05	932689	769	209-96	1792	Gly-31 to Gln-37.	S0037: 1 and L0754: 1.
HSCAF60	537444	770	59-199	1793	Arg-1 to Thr-8,	S0118: 1
					Lys-16 to Asn-21.
HRDFU03	924698	771	187-357	1794	Lys-1 to Trp-18,	H0124: 1 and L0748: 1.
					Thr-36 to Ser-44.
HRDFH46	590391	772	261-464	1795	His-1 to Asp-22,	H0124: 1, L0387: 1,
					Pro-51 to Lys-58.	L0747: 1 and L0588: 1.
HRDFG13	925350	773	1-249	1796		H0124: 1 and L0759: 1.
HRDFF47	740594	774	1-114	1797		H0124: 1, L0598: 1,
						L0655: 1 and L0745: 1.
HRDFD56	733556	775	47-178	1798		H0124: 1, L0439: 1,
						L0745: 1 and L0756: 1.
HRDFA03	867122	776	405-602	1799		AR054: 74, AR051:
						68, AR050: 63
						H0124: 1
HRDEZ73	774414	777	21-254	1800	Gln-52 to Cys-57.	L0777: 2, H0124: 1,
						L0774: 1, L0743: 1,
						L0744: 1, L0757: 1 and
						L0758: 1.
HRDEX24	867123	778	112-258	1801	Met-1 to Lys-6,	L0731: 2, H0124: 1,
					Pro-13 to Asp-19.	L0800: 1, L0803: 1 and
						L0804: 1.
HRDER90	789140	779	3-428	1802		L0748: 2, H0124: 1
						and L0592: 1.
HRDER35	707569	780	66-266	1803		H0124: 1 and L0748: 1.
HRDEP20	690456	781	2-274	1804		H0124: 1, L0755: 1
						and L0604: 1.
HRDEK53	867137	782	2-181	1805		H0124: 1 and L0749: 1.
HRDEJ33	487523	783	123-31	1806		H0124: 1
	867143	1022	260-556	2045
	974260	1023	3-245	2046	Ala-3 to Ala-10,
					Ser-49 to Thr-74,
					Pro-76 to Lys-81.
HRDDX67	460145	784	1-189	1807		H0124: 1
	462510	1024	243-115	2047
HRDDX01	921501	785	388-200	1808	Thr-27 to Trp-42.	H0124: 1, L0659: 1,
						L0783: 1 and L0779: 1.
HRDDU41	712572	786	27-281	1809	Asn-46 to Ser-55.	H0124: 1
HRDDR39	867151	787	1-222	1810		H0124: 1 and L0777: 1.
HRDDQ55	490884	788	278-126	1811	His-3 to Asp-11,	H0124: 1
					Leu-13 to Glu-26,
					Pro-46 to Gly-51.
	514848	1025	188-397	2048	Lys-8 to His-14.
HRDCD44	715769	789	3-197	1812		H0124: 1 and L0740: 1.
HRDBH52	728715	790	48-251	1813	Lys-4 to Lys-10,	H0124: 1, L0748: 1
					Pro-39 to Glu-46.	and L0747: 1.
HRDAB42	800333	791	55-429	1814	Pro-11 to Arg-16,	H0124: 1 and L0748: 1.
					Pro-27 to Ser-32,
					Gln-53 to Thr-63.
HOSOW01	914804	792	19-153	1815	Leu-10 to Pro-16,	L0748: 2 and S0003: 1.
					Leu-39 to Ser-45.
HOSNO25	974291	793	417-566	1816		S0003: 1
HOSMP95	948496	794	3-278	1817	Ser-2 to Leu-24,	L0748: 5 and S0003: 1.
					Pro-33 to Lys-45.
HOSGN29	830653	795	1-432	1818	Ser-12 to Thr-27,	S0214: 1 and L0777: 1.
					Pro-32 to Glu-39,
					Gly-48 to Ile-55,
					Ile-59 to Leu-80,
					Gln-108 to Leu-113,
					Pro-121 to Tyr-131.
HOSFV77	856933	796	468-659	1819	Leu-27 to Met-32.	S0214: 1, L0439: 1,
						L0749: 1 and L0595: 1.
HOSFU59	739262	797	94-255	1820	Lys-1 to Leu-11.	S0214: 1 and L0731: 1.
HOSFL57	734709	798	231-365	1821		S0214: 1 and L0754: 1.
HOSFL07	953183	799	464-583	1822		L0766: 2, L0471: 1,	1p35	118210, 120550,
						S0214: 1, L0748: 1,		120570, 120575,
						L0749: 1 and L0756: 1.		121800, 130500,
								133200, 138140,
								138971, 171760,
								171760, 172411,
								185470, 230350,
								255800, 602771
HOSFK40	711140	800	117-332	1823	Glu-5 to Ser-16,	L0803: 2, S0214: 1,
					Gly-49 to Pro-57,	L0806: 1, L0788: 1,
					Arg-62 to Met-72.	L0779: 1, L0596: 1 and
						L0599: 1.
HOSFI46	719021	801	112-300	1824		S0214: 1 and L0756: 1.
HOSFC66	750560	802	311-574	1825		S0214: 1 and L0602: 1.
HOSFB04	615200	803	238-426	1826	Thr-20 to Phe-29,	L0439: 3 and S0214: 1.
					Tyr-40 to Gly-46.
HOSDR12	971169	804	259-459	1827	Glu-22 to Glu-31.	S0003: 1
HOSDQ78	858983	805	123-290	1828	Ser-1 to His-11,	S0003: 1
					Val-22 to Trp-27.
HOSDP27	682113	806	157-456	1829	Pro-36 to Thr-43.	S0003: 1 and L0740: 1.
HOSDG79	781787	807	3-590	1830	Leu-4 to Lys-17.	L0748: 2, S0003: 1 and
						L0749: 1.
HOSDA04	951842	808	520-362	1831		S0003: 1 and L0731: 1.
HOSCV06	960555	809	59-304	1832	Glu-5 to Gly-15,	AR089: 8, AR061: 7
					Pro-36 to Arg-42,	S0003: 1, L0498: 1 and
					Pro-58 to Asp-70.	L0599: 1.
HOSCT25	783692	810	155-325	1833	Ser-1 to Asn-9,	S0003: 1 and L0748: 1.
					Ala-16 to Lys-22.
HOSCP67	753874	811	158-370	1834	Lys-15 to Tyr-20,	L0591: 2 and S0003: 1.
					Ser-61 to Thr-71.
HOSCO73	764756	812	2-163	1835		S0003: 1 and L0599: 1.
HOSBY89	787182	813	254-364	1836	Thr-12 to Ser-26.	L0748: 2 and S0003: 1.
HOSBX46	719414	814	270-365	1837	Phe-6 to Trp-11.	L0756: 2 and S0003: 1.	14
HOSBX34	706769	815	389-547	1838		L0439: 2, S0003: 1 and
						L0438: 1.
HOSBR53	728525	816	11-208	1839	Ser-8 to Ser-19,	S0003: 1 and L0439: 1.
					Lys-26 to Glu-31,
					Gln-55 to Cys-64.
HOSBO34	706770	817	1-99	1840	Thr-1 to Arg-14.	S0003: 1, L0779: 1 and
						L0589: 1.
HOSBM55	732550	818	269-541	1841	Lys-40 to Thr-45.	L0748: 3 and S0003: 1.
HOSAY52	728759	819	2-154	1842	Leu-29 to Thr-34.	L0756: 2 and S0003: 1.	14
HOSAX03	960942	820	48-812	1843		L0758: 3 and S0003: 1.
HOSAL10	968710	821	3-206	1844	Ala-17 to Asn-22,	S0003: 1 and L0362: 1.
					Pro-24 to Gln-30.
HOSAI41	712708	822	859-1077	1845	Cys-1 to Gly-6,	L0748: 3, L0749: 2 and
					Gln-26 to Leu-45.	S0003: 1.
HOSAH30	693406	823	312-491	1846		S0003: 1 and L0439: 1.
HOSAF19	672078	824	124-267	1847	Ser-14 to Lys-21,	S0003: 1 and L0596: 1.
					Tyr-33 to Ile-39.
HOHEN28	686034	825	2-232	1848		L0794: 6, L0768: 2,
						L0740: 2, L0777: 2,
						S0250: 1, L0764: 1,
						L0766: 1, L0655: 1 and
						L0758: 1.
HOHEG71	760051	826	262-420	1849	Ser-11 to Ser-31,	L0777: 2 and S0250: 1.
					Thr-46 to His-53.
HOHDF94	793970	827	456-671	1850		S0250: 1 and L0594: 1.
HOHCV57	734413	828	66-380	1851	Phe-2 to Lys-7,	S0250: 1 and L0748: 1.
					Ser-38 to Arg-44,
					Gly-71 to Asn-94.
HOHCL29	634778	829	257-6	1852	Asp-7 to Gly-12.	AR054: 9, AR051: 3,
						AR050: 2
						S0250: 1
HOHCH52	588375	830	2-181	1853	Lys-1 to Tyr-8,	S0250: 1 and L0754: 1.
					Lys-10 to Lys-16.
HOHCG79	859029	831	1-156	1854	Asn-47 to Trp-52.	S0250: 1 and L0763: 1.
HOHCD58	973105	832	101-373	1855	Glu-8 to Pro-14.	S0250: 1
HOHBZ27	588364	833	203-376	1856		S0250: 1, L0435: 1 and
						L0439: 1.
HOHBY26	588358	834	3-476	1857	Asp-32 to Asn-38,	S0250: 1 and L0591: 1.
					His-116 to Asn-122,
					Phe-125 to Met-130.
HOHBV67	718562	835	3-179	1858	Pro-19 to Asn-27,	S0250: 1, L0731: 1,
					Tyr-46 to His-51.	L0597: 1 and L0589: 1.
HOHBS10	964324	836	157-408	1859		S0250: 1 and L0758: 1.
HOHBP36	708158	837	416-141	1860	Ser-12 to Cys-17,	L0748: 4 and S0250: 1.
					Lys-74 to Gly-83.
HOHBN56	859041	838	2-208	1861	Asn-46 to Leu-51.	L0766: 4 and S0250: 1.
HOHBL35	973238	839	62-256	1862	Ile-23 to Phe-32,	S0250: 1
					Leu-40 to Ala-47.
HOHBI84	782908	840	62-376	1863	Gly-1 to His-6,	S0250: 1 and L0742: 1.	9q
					Pro-19 to Pro-36,
					Ser-38 to Ser-46.
HOHBB90	588308	841	300-434	1864		S0250: 1 and L0754: 1.	17q25	114290, 138033,
								162100, 170500,
								170500, 170500,
								180860, 264470
HOHAV60	489007	842	96-668	1865		S0250: 1, L0748: 1 and
						L0740: 1.
HOHAT59	867949	843	2-214	1866	Ala-58 to Tyr-66.	S0250: 1 and L0370: 1.
HOHAT11	966727	844	114-473	1867	Lys-37 to Tyr-47.	L0180: 1 and S0250: 1.
HOHAQ65	859057	845	15-209	1868		S0250: 1 and L0748: 1.
HOHAM66	859058	846	1-522	1869	Gln-94 to Met-101,	L0754: 2 and S0250: 1.	17q12	144200, 148066,
					Thr-109 to Gly-124,			148066, 148067,
					Gln-149 to Gly-155.			148067, 148069,
								154275, 180240,
								182138, 600119,
								600119, 600881,
								601363, 601687,
								601954
HOHAI11	947140	847	1510-2127	1870	Phe-22 to Lys-30,	S0250: 1
					Glu-122 to Ser-127,
					Arg-183 to Lys-190.
	965035	1026	338-117	2049
	966030	1027	332-490	2050
HOHAE76	494001	848	94-309	1871		S0250: 1
	859064	1028	156-344	2051
HOEOA28	859156	849	521-739	1872	Gly-46 to Gly-51.	L0731: 2, L0763: 1,
						L0766: 1 and S0126: 1.
HOENH06	934095	850	1-201	1873	Asp-24 to Ala-32.	L0438: 3, L0439: 3,
						S0126: 1, L0743: 1,
						L0747: 1, L0749: 1,
						L0750: 1 and L0758: 1.
HOELI08	958181	851	413-138	1874		L0766: 2, L0769: 1,
						L0800: 1, L0803: 1,
						L0804: 1 and S0126: 1.
HOEEX37	708728	852	553-717	1875		L0744: 2, S0126: 1 and
						L0747: 1.
HOEEU57	932562	853	1-738	1876	Gly-1 to Arg-15.	AR089: 30, AR061: 7
						L0774: 1, S0126: 1 and
						L0780: 1.
HOEER75	767265	854	278-463	1877		L0756: 2 and S0126: 1.
HOECJ59	739426	855	1-462	1878	Cys-1 to Ala-7,	L0750: 2 and S0126: 1.
					Glu-16 to Gly-21,
					Arg-24 to Gln-30,
					Ser-41 to Met-52,
					Trp-75 to His-82.
HOECF70	573426	856	39-161	1879		S0126: 1
HOEBT89	921065	857	215-364	1880		S0126: 1 and L0754: 1.
HOACG06	954572	858	88-252	1881		L0747: 2, H0252: 1 and L0439: 1.
HOABY40	711510	859	248-466	1882		H0252: 1 and L0756: 1.
HOABX26	753954	860	93-275	1883		H0252: 1, L0769: 1,
						L0375: 1, L0748: 1 and
						L0749: 1.
HOABX21	531390	861	3-89	1884	Thr-2 to Lys-18.	H0252: 1
HOABW12	968797	862	11-244	1885	Pro-2 to Ala-7.	H0252: 1 and L0749: 1.
HOABG91	811156	863	1-234	1886	Asp-22 to Ser-27,	H0252: 1	11p11.2-p12	133701, 168500,
					Asn-29 to Glu-40,			171650, 176930,
					His-56 to Gly-73.			176930, 600623,
								600811, 600958
HOABF65	888203	864	149-298	1887		AR050: 12, AR051:
						10, AR054: 7
						H0252: 1
HOABD07	954060	865	156-344	1888	Ser-15 to Gly-20,	H0252: 1 and L0777: 1.
					Ala-26 to Tyr-33.
HOABA95	796063	866	101-316	1889	Lys-8 to Gln-14,	H0252: 1 and L0754: 1.
					Ile-27 to Thr-52.
HOAAX37	708718	867	108-242	1890		H0252: 1 and L0748: 1.
HOAAW11	967660	868	207-395	1891	Leu-1 to Trp-6.	H0252: 1 and L0527: 1.
HOAAW02	920869	869	108-329	1892	Thr-1 to Asn-12,	H0252: 1 and L0766: 1.
					Gly-18 to Phe-24,
					Cys-40 to Trp-45,
					Thr-50 to His-58.
HOAAV77	772512	870	154-378	1893	Cys-30 to Arg-38.	L0740: 2 and H0252: 1.
HOAAO86	859626	871	198-443	1894	Pro-18 to Arg-42,	H0252: 1
					Asn-55 to Ala-60.
HOAAM67	751947	872	108-290	1895	Asp-24 to Pro-31.	H0252: 1 and L0748: 1.
HOAAK71	761445	873	156-389	1896	Thr-18 to Lys-25.	H0252: 1 and L0748: 1.
HOAAK11	859624	874	1-396	1897	Gly-30 to Glu-44,	H0252: 1
					Ser-51 to Glu-56,
					Arg-91 to Asn-99,
					Pro-101 to Gly-108,
					Pro-117 to Leu-122.
HOAAI58	859643	875	104-238	1898		H0023: 4, L0759: 2,
						H0252: 1, L0740: 1 and
						L0596: 1.
HOAAH77	772514	876	2-211	1899	Arg-16 to Ser-23.	H0252: 1 and L0747: 1.
HOAAH41	712601	877	106-246	1900	Ser-9 to Arg-17,	H0252: 1, L0748: 1
					Phe-24 to Leu-33.	and L0749: 1.
HMUBZ11	966856	878	161-316	1901	Gln-45 to Pro-52.	H0023: 1, H0529: 1
						and L0748: 1.
HMUBY48	721586	879	50-154	1902	Ser-8 to Glu-13,	H0529: 1
					Lys-20 to Lys-31.
HMUBY20	669581	880	197-361	1903	Pro-23 to Asn-29.	H0529: 1
HMUBV40	837969	881	3-434	1904	Tyr-70 to Ser-81,	H0529: 1
					Arg-87 to Arg-97.
HMUBR94	793261	882	265-450	1905	Leu-10 to Phe-15.	H0529: 1
HMUBR78	955060	883	75-518	1906	Pro-9 to Pro-17,	H0529: 1 and L0745: 1.
					Asp-24 to Glu-30,
					Asn-65 to Ser-75.
HMUBQ01	918052	884	29-214	1907	Cys-6 to Val-13,	H0529: 1
					Cys-57 to Asn-62.
HMUBP74	765502	885	380-553	1908	Ala-1 to His-6.	H0529: 1
HMUBP38	716800	886	30-206	1909		H0529: 1
HMUBN15	659543	887	258-40	1910	Pro-14 to Lys-23.	H0529: 1
HMUBN05	932057	888	248-439	1911		H0529: 1
HMUBM89	786082	889	458-309	1912		H0529: 1
HMUBM85	784295	890	86-229	1913		H0529: 1
HMUBM23	675296	891	2-319	1914	Pro-41 to Ala-47,	L0439: 3, H0529: 1
					Arg-50 to Gly-58.	and L0438: 1.
HMUBM21	861218	892	316-525	1915		H0529: 1
HMUBM01	916291	893	1-429	1916	Pro-11 to Gly-16,	H0529: 1 and L0601: 1.
					Ser-35 to Gly-55,
					Gln-63 to Leu-68,
					Asp-118 to Ser-123,
					Arg-136 to Ala-141.
HMUBL79	774904	894	110-229	1917	Gly-15 to Lys-20,	H0529: 1
					Ile-25 to Leu-30.
HMUBL25	678011	895	109-291	1918	Glu-19 to Arg-25.	H0529: 1 and L0748: 1.
HMUBI26	424764	896	3-209	1919	Lys-6 to Asp-14,	L0439: 2 and H0529: 1.
					Lys-22 to Cys-27.
HMUBH84	782971	897	33-251	1920	Thr-19 to Thr-28,	H0529: 1 and L0749: 1.
					Ser-43 to Gly-54,
					Asp-67 to Gly-73.
HMUBC76	769968	898	260-415	1921	Gly-15 to Ile-21,	H0529: 1 and L0748: 1.
					Ser-24 to Ser-32.
HMUBA75	767192	899	214-375	1922	Asn-12 to Asn-25.	H0529: 1
HMUBA61	741710	900	56-172	1923		H0529: 1
HMUAT71	772958	901	1-264	1924	Ser-15 to Asp-22,	H0529: 1 and L0601: 1.	6
					Arg-28 to Arg-35.
HMUAE85	783543	902	41-259	1925		H0529: 1 and L0731: 1.
HFOZC29	923288	903	500-195	1926	Cys-2 to Asp-8,	L0384: 1, L0809: 1,
					Ser-59 to Gly-65.	L0731: 1 and S0276: 1.
HFOZA47	909372	904	110-262	1927	Ser-26 to Cys-31.	L0748: 1 and S0276: 1.
HFOYW76	769894	905	129-401	1928	Gln-19 to Cys-28.	L0439: 1 and S0276: 1.
HFOYV08	959038	906	73-255	1929	Leu-2 to Arg-8,	L0021: 1, L0769: 1,
					Lys-42 to Ile-47.	L0794: 1, L0803: 1,
						L0527: 1, L0731: 1,
						L0758: 1 and S0276: 1.
HFOYS58	735816	907	134-280	1930	Val-10 to Pro-20.	L0589: 1 and S0276: 1.
HFOYN65	747740	908	3-167	1931	Gln-1 to Thr-12.	L0439: 3 and S0276: 1.
HFOYN01	854780	909	242-406	1932		L0591: 1 and S0276: 1.
HFOYM48	721455	910	64-279	1933		L0598: 2, L0766: 1,
						L0805: 1, L0777: 1 and
						S0276: 1.
HFOYL33	702209	911	95-508	1934	Ser-1 to Ser-6,	L0640: 1, L0748: 1 and
					Asp-24 to Ala-36,	S0276: 1.
					Arg-130 to Leu-135.
HFOYK21	670653	912	28-180	1935	Glu-21 to Glu-29,	L0758: 2, L0779: 1 and
					Asn-33 to Tyr-39.	S0276: 1.
HFOYK02	919458	913	3-140	1936		L0750: 2 and S0276: 1.
HFOYJ30	932485	914	42-299	1937		L0747: 1 and S0276: 1.
HFOYH01	916055	915	259-432	1938	Thr-4 to Lys-17,	L0761: 1, L0803: 1,
					Ser-35 to Gly-40,	L0774: 1, L0775: 1,
					Thr-44 to Cys-52.	L0599: 1 and S0276: 1.
HFOYG88	494875	916	463-765	1939		L0747: 3 and S0276: 1.
HFOYG86	949496	917	220-62	1940	Pro-19 to Lys-25,	AR050: 13, AR054: 7,
					Phe-37 to Asn-44.	AR089: 3, AR051: 2,
						AR061: 1
						L0777: 2, L0731: 2,
						L0659: 1 and S0276: 1.
	955554	1029	245-760	2052	Arg-27 to Gly-35,
					Tyr-72 to Lys-78,
					Phe-108 to Lys-114.
HFOYC08	958975	918	209-364	1941	Pro-28 to Thr-33.	L0770: 1 and S0276: 1.
HFOYA17	662642	919	94-348	1942	Arg-32 to Pro-41,	L0740: 1 and S0276: 1.
					Pro-43 to Gly-50.
HFOXW67	494854	920	264-485	1943	Gln-29 to Asn-37,	L0439: 1 and S0276: 1.
					Lys-55 to Gln-64.
HFOXV94	794175	921	2-322	1944	Pro-3 to Arg-10,	L0592: 1 and S0276: 1.
					Pro-12 to Arg-18.
HFOXT74	875383	922	281-535	1945	Ala-31 to Gly-38.	L0749: 1 and S0276: 1.
HFOXT35	707088	923	143-325	1946		S0276: 1
HFOXS42	713514	924	352-110	1947	Ser-45 to Lys-55.	S0276: 1
HFOXO57	928171	925	1-507	1948	Pro-5 to Gln-14,	L0439: 1, L0756: 1 and
					Lys-26 to Cys-32,	S0276: 1.
					Tyr-58 to Gln-69,
					Gly-78 to Gly-84,
					Lys-93 to Leu-117.
HFOXO33	702212	926	311-493	1949	Asp-32 to Asn-41.	L0623: 1, L0646: 1,
						L0748: 1 and S0276: 1.
HFOXM53	587972	927	333-560	1950		L0748: 1 and S0276: 1.
HFOXL88	909839	928	90-425	1951	Lys-5 to Ser-12,	L0562: 1 and S0276: 1.	7q22-q31.1	126650, 126650,
					Thr-17 to Ser-24.			150240, 154276,
								173360, 173360,
								180105, 222800,
								246900, 602136,
								602136, 602136,
								602447
HFOXK96	732057	929	83-256	1952	Ser-21 to Ile-35,	L0750: 1 and S0276: 1.
					Gln-48 to His-58.
HFOXK42	587960	930	3-179	1953		L0745: 2, L0415: 1,
						L0769: 1 and S0276: 1.
HFOXF91	790103	931	149-376	1954		L0439: 3, L0602: 2,
						L0756: 2 and S0276: 1.
HFOXF42	854797	932	124-378	1955	Ser-6 to Leu-14.	L0485: 1 and S0276: 1.
HFOXD78	856499	933	136-306	1956		L0438: 1, L0740: 1 and
						S0276: 1.
HFOXB33	701719	934	220-432	1957	Leu-53 to Lys-67.	L0590: 1 and S0276: 1.
HFOXB26	681593	935	273-467	1958	Gln-1 to Val-11.	L0601: 1 and S0276: 1.
HFOXA62	743466	936	266-430	1959		L0748: 1 and S0276: 1.
HFIZP86	785341	937	121-237	1960	Glu-1 to Asn-6.	L0777: 1 and S0242: 1.
HFIZB62	743122	938	167-304	1961		L0596: 1 and S0242: 1.
HFIYX08	958977	939	3-158	1962		L0749: 2, L0369: 1 and
						S0242: 1.
HFIYW79	858618	940	1-249	1963	Phe-2 to Arg-11.	L0766: 1, L0744: 1,
						L0439: 1 and S0242: 1.
HFIYS11	966702	941	93-401	1964	Ser-1 to Ser-6,	L0748: 1 and S0242: 1.
					Gly-58 to Pro-65,
					Gly-75 to Leu-81.
HFIYN50	724175	942	266-379	1965		L0777: 2, L0770: 1,
						L0769: 1, L0780: 1,
						L0752: 1, L0731: 1,
						L0759: 1 and S0242: 1.
HFIYJ92	791305	943	184-306	1966		L0439: 5, L0740: 4,
						L0756: 1, L0752: 1,
						L0731: 1 and S0242: 1.
HFIYA08	962212	944	191-421	1967	Thr-6 to Lys-13,	L0589: 1 and S0242: 1.
					Phe-37 to His-45,
					Ala-58 to Ser-72.
HFIXZ95	915703	945	2-208	1968	Val-2 to Ser-14.	L0608: 1 and S0242: 1.
HFIXZ19	683033	946	613-410	1969		L0758: 1 and S0242: 1.
HFIXR93	894013	947	242-460	1970		L0740: 2 and S0242: 1.
HFIXR68	752858	948	220-342	1971		L0748: 1 and S0242: 1.
HFIXP31	697759	949	3-317	1972	Leu-9 to Asn-16,	AR089: 4, AR061: 1
					Thr-92 to Pro-100.	L0777: 3, L0809: 1 and
						S0242: 1.
HFIXP04	839910	950	185-400	1973	Ser-31 to Glu-36,	L0779: 1 and S0242: 1.
					Lys-44 to Cys-51.
HFIXJ53	489122	951	94-348	1974		L0748: 1 and S0242: 1.
HFIXB77	772116	952	137-352	1975		L0754: 1 and S0242: 1.
HFIVS81	387591	953	2-157	1976		L0439: 1 and S0196: 1.
HFIVS21	855131	954	1-279	1977		L0545: 1 and S0196: 1.
HFIVS08	959272	955	115-255	1978	Pro-1 to Ser-6.	L0021: 1 and S0196: 1.
HFIUZ63	745033	956	74-283	1979	Ser-12 to Gly-17.	L0748: 1 and S0196: 1.
HFIUY49	855133	957	65-382	1980	Leu-10 to Lys-22,	S0196: 1
					Ser-46 to Ala-54,
					Pro-85 to Phe-91.
HFIUV58	735350	958	2-205	1981		L0740: 2, L0747: 2 and
						S0196: 1.
HFIUV18	787095	959	3-248	1982		L0746: 1 and S0196: 1.
HFIUM33	702319	960	214-372	1983		S0196: 1
HFIUH65	747836	961	34-183	1984	Leu-7 to Cys-14,	L0752: 2, L0740: 1,
					Pro-16 to Ser-24,	L0745: 1 and S0196: 1.
					Gln-43 to His-50.
HFIUD47	720254	962	129-380	1985		L0750: 2, L0747: 1,
						L0731: 1, L0591: 1 and
						S0196: 1.
HFITH46	718078	963	295-672	1986		L0745: 1, L0746: 1 and
						S0196: 1.
HFIJG36	707883	964	1-183	1987	Ser-1 to Asp-9.	L0749: 1 and S0194: 1.
HFIJG20	669580	965	307-435	1988		L0748: 1 and S0194: 1.
HFIJF58	735927	966	214-492	1989	Lys-1 to Lys-15,	L0777: 2 and S0194: 1.
					Arg-22 to Arg-31,
					Thr-68 to Pro-73,
					Pro-79 to Ser-86.
HFIIZ92	494044	967	170-3	1990	Asp-1 to Cys-6,	S0194: 1
					Lys-15 to Phe-23,
					Asn-46 to Arg-56.
	533295	1030	1-843	2053	Gly-1 to Val-7,
					Gln-28 to Thr-34,
					Ala-100 to Thr-108,
					Ser-115 to Arg-122,
					Ser-156 to Glu-162,
					Ser-174 to Tyr-186,
					Glu-188 to Phe-193.
HFIIU85	793332	968	242-526	1991		L0598: 1 and S0194: 1.
HFIIR63	744994	969	312-467	1992	Ala-6 to Ile-12.	L0439: 3 and S0194: 1.
HFIIL37	561375	970	3-350	1993	Ser-1 to Gly-18,	AR050: 241, AR051:
					Gly-27 to Leu-39,	230, AR054: 157
					Ser-76 to Thr-89.	S0194: 1
HFIIK75	767222	971	541-810	1994	Trp-1 to Val-6,	L0439: 2, L0777: 2 and
					His-20 to Ser-28,	S0194: 1.
					Arg-47 to Pro-53,
					Thr-65 to Pro-71,
					Ser-78 to Gly-90.
HFIIK32	424259	972	133-321	1995	His-5 to Thr-10.	L0754: 1 and S0194: 1.
HFIIK07	953034	973	84-317	1996		L0663: 1 and S0194: 1.
HFIIJ14	839523	974	429-707	1997	Val-17 to His-33,	AR054: 62, AR050:
					Arg-51 to Leu-60,	59, AR051: 58
					Leu-85 to Pro-93.	S0194: 1
HFIHW91	907618	975	3-527	1998	Trp-5 to Pro-11.	AR089: 13, AR061: 6
						L0779: 1, L0780: 1,
						L0759: 1 and S0194: 1.
HFIHW16	858594	976	3-272	1999	Gln-22 to Trp-27.	L0744: 1 and S0194: 1.
HFIHW11	947856	977	22-201	2000		L0527: 2 and S0194: 1.
HFIHV56	470954	978	70-378	2001	Ser-1 to Arg-7.	L0592: 1 and S0194: 1.
HFIHU76	769948	979	133-246	2002		L0748: 1 and S0194: 1.
HFIHS86	785419	980	146-325	2003		L0598: 1 and S0194: 1.
HFIHR78	773512	981	249-407	2004		L0745: 1 and S0194: 1.
HFIHN35	707075	982	327-560	2005		L0748: 3, L0749: 1 and
						S0194: 1.
HFIHK29	855174	983	97-450	2006	Val-3 to Arg-11,	L0731: 2 and S0194: 1.
					Pro-34 to His-47,
					Ser-58 to Leu-68,
					Pro-72 to Trp-77.
HFIHF53	728259	984	369-500	2007	Ile-7 to Ile-13.	L0754: 1 and S0194: 1.
HFIHD20	669731	985	3-338	2008	Arg-6 to Thr-11,	L0605: 1 and S0194: 1.
					Gly-27 to Leu-33,
					Lys-52 to Phe-61,
					Gln-86 to Lys-92,
					Asn-102 to Arg-112.
HFIDL68	928475	986	2-529	2009	Glu-40 to Lys-46,	AR089: 7, AR061: 4,
					Phe-120 to Ser-132.	AR050: 2, AR054: 2,
						AR051: 1
						S0192: 1
HFIDL06	837524	987	50-487	2010	Val-1 to Gly-8,	L0602: 1 and S0192: 1.
					Gln-48 to Asp-53,
					Glu-61 to Asp-68,
					Val-88 to Lys-96,
					Asp-102 to Lys-108.
HFIBK83	939556	988	2-502	2011	Val-48 to Pro-56,	L0439: 1 and S0192: 1.
					Asp-58 to Gln-69.
HFIAX78	773445	989	80-217	2012		S0192: 1
HFIAS49	722728	990	357-611	2013	Leu-5 to Lys-11.	L0740: 1 and S0192: 1.
HFIAL66	587837	991	339-515	2014		L0740: 1 and S0192: 1.
HCOKA10	907080	992	605-171	2015	Phe-13 to Thr-22.	AR054: 7, AR061: 2,
						AR089: 1, AR051: 1
						H0636: 1
	918918	1031	1663-1220	2054
	919869	1032	1-396	2055	Pro-1 to Ser-9,
					Asp-127 to Asn-132.
HCDEL02	920831	993	167-292	2016		H0251: 1 and L0776: 1.
HCDDZ69	522220	994	198-341	2017		H0251: 1
HCDDY54	529265	995	23-148	2018	Gln-12 to Asp-26.	H0251: 1
HCDDO80	778563	996	85-402	2019	Tyr-8 to Thr-15.	H0251: 1 and L0596: 1.
HCDCD64	863415	997	23-301	2020	Asp-35 to Cys-43.	H0251: 1 and L0740: 1.
HCDBW41	712648	998	2-217	2021	Pro-2 to Lys-7.	L0439: 3 and H0251: 1.
HCDBO86	784617	999	279-509	2022	Thr-62 to Asn-69,	H0251: 1, L0747: 1,
					Cys-71 to Glu-77.	L0756: 1 and L0777: 1.
HCDAO39	704504	1000	3-260	2023		H0251: 1 and L0588: 1.
HCDAA68	753814	1001	412-576	2024	Ala-3 to Thr-9,	H0251: 1 and L0748: 1.
					Arg-16 to Pro-23.
HBSAP57	531874	1002	298-474	2025	Ser-1 to Gly-11,	AR051: 87, AR054:
					Pro-42 to Lys-54.	84, AR050: 83
						H0381: 1
	533619	1033	392-216	2056	Ser-1 to Gly-11,
					Pro-42 to Lys-54.
HBCKF23	675613	1003	168-425	2026	Gly-9 to His-18.	L0758: 3, S0336: 1 and
						L0779: 1.
HBCGD25	677689	1004	97-240	2027	Leu-39 to Lys-46.	L0748: 3 and S0334: 1.
HAOAE95	795674	1005	95-217	2028	Gly-12 to Pro-20.	L0605: 2 and S0314: 1.
HAOAD27	848729	1006	90-335	2029		S0314: 1 and L0747: 1.
HANKG10	963926	1007	34-237	2030	Cys-1 to Phe-6,	S0318: 1, L0766: 1 and
					Leu-30 to Gly-38.	L0803: 1.
HANKB13	827062	1008	2-436	2031	Lys-4 to Gln-16,	S0318: 1, L0766: 1 and
					Lys-32 to Lys-39,	L0666: 1.
					Met-43 to Asn-48,
					Gln-70 to Leu-76.
HAMAC79	872774	1009	337-867	2032		AR089: 20, AR061: 13
						H0122: 1

[0064] The first column in Table 1A provides a unique “Clone ID NO:Z” for a cDNA clone related to each contig sequence disclosed in Table 1A. This clone ID references the cDNA clone which contains at least the 5′ most sequence of the assembled contig, and at least a portion of SEQ ID NO:X was determined by directly sequencing the referenced clone. The reference clone may have more sequence than described in the sequence listing or the clone may have less. In the vast majority of cases, however, the clone is believed to encode a full-length polypeptide. In the case where a clone is not full-length, a full-length cDNA can be obtained by methods known in the art and/or as described elsewhere herein.

[0065] The second column in Table 1A provides a unique “Contig ID” identification for each contig sequence. The third column provides the “SEQ ID NO:X” identifier for each of the musculoskeletal system associated contig polynucleotide sequences disclosed in Table 1A. The fourth column, “ORF (From-To)”, provides the location (i.e., nucleotide position numbers) within the polynucleotide sequence “SEQ ID NO:X” that delineate the preferred open reading frame (ORF) shown in the sequence listing and referenced in Table 1A, column 5, as SEQ ID NO:Y. Where the nucleotide position number “To” is lower than the nucleotide position number “From”, the preferred ORF is the reverse complement of the referenced polynucleotide sequence.

[0066] The fifth column in Table 1A provides the corresponding SEQ ID NO:Y for the polypeptide sequence encoded by the preferred ORF delineated in column 4. In one embodiment, the invention provides an amino acid sequence comprising, or alternatively consisting of, a polypeptide encoded by the portion of SEQ ID NO:X delineated by “ORF (From-To)”. Also provided are polynucleotides encoding such amino acid sequences and the complementary strand thereto.

[0067] Column 6 in Table 1A lists residues comprising epitopes contained in the polypeptides encoded by the preferred ORF (SEQ ID NO:Y), as predicted using the algorithm of Jameson and Wolf, (1988) Comp. Appl. Biosci. 4:181-186. The Jameson-Wolf antigenic analysis was performed using the computer program PROTEAN (Version 3.11 for the Power MacIntosh, DNASTAR, Inc., 1228 South Park Street Madison, Wis.). In specific embodiments, polypeptides of the invention comprise, or alternatively consist of, at least one, two, three, four, five or more of the predicted epitopes as described in Table 1A. It will be appreciated that depending on the analytical criteria used to predict antigenic determinants, the exact address of the determinant may vary slightly.

[0068] Column 7 in Table 1A provides an expression profile and library code: count for each of the contig sequences (SEQ ID NO:X) disclosed in Table 1A, which can routinely be combined with the information provided in Table 4 and used to determine the normal or diseased tissues, cells, and/or cell line libraries which predominantly express the polynucleotides of the invention. The first number in column 7 (preceding the colon), represents the tissue/cell source identifier code corresponding to the code and description provided in Table 4. For those identifier codes in which the first two letters are not “AR”, the second number in column 7 (following the colon) represents the number of times a sequence corresponding to the reference polynucleotide sequence was identified in the tissue/cell source. Those tissue/cell source identifier codes in which the first two letters are “AR” designate information generated using DNA array technology. Utilizing this technology, cDNAs were amplified by PCR and then transferred, in duplicate, onto the array. Gene expression was assayed through hybridization of first strand cDNA probes to the DNA array. cDNA probes were generated from total RNA extracted from a variety of different tissues and cell lines. Probe synthesis was performed in the presence of 33P dCTP, using oligo(dT) to prime reverse transcription. After hybridization, high stringency washing conditions were employed to remove non-specific hybrids from the array. The remaining signal, emanating from each gene target, was measured using a Phosphorimager. Gene expression was reported as Phosphor Stimulating Luminescence (PSL) which reflects the level of phosphor signal generated from the probe hybridized to each of the gene targets represented on the array. A local background signal subtraction was performed before the total signal generated from each array was used to normalize gene expression between the different hybridizations. The value presented after “[array code]:” represents the mean of the duplicate values, following background subtraction and probe normalization. One of skill in the art could routinely use this information to identify normal and/or diseased tissue(s) which show a predominant expression pattern of the corresponding polynucleotide of the invention or to identify polynucleotides which show predominant and/or specific tissue and/or cell expression. The sequences disclosed herein have been determined to be predominantly expressed in musculoskeletal system tissues, including normal and diseased musculoskeletal system tissues (See Table 1A, column 7 and Table 4).

[0069] Column 8 in Table 1A provides a chromosomal map location for certain polynucleotides of the invention. Chromosomal location was determined by finding exact matches to EST and cDNA sequences contained in the NCBI (National Center for Biotechnology Information) UniGene database. Each sequence in the UniGene database is assigned to a “cluster”; all of the ESTs, cDNAs, and STSs in a cluster are believed to be derived from a single gene. Chromosomal mapping data is often available for one or more sequence(s) in a UniGene cluster; this data (if consistent) is then applied to the cluster as a whole. Thus, it is possible to infer the chromosomal location of a new polynucleotide sequence by determining its identity with a mapped UniGene cluster.

[0070] A modified version of the computer program BLASTN (Altshul et al., J. Mol. Biol. 215:403-410 (1990), and Gish et al., Nat. Genet. 3:266-272 (1993)) was used to search the UniGene database for EST or cDNA sequences that contain exact or near-exact matches to a polynucleotide sequence of the invention (the ‘Query’). A sequence from the UniGene database (the ‘Subject’) was said to be an exact match if it contained a segment of 50 nucleotides in length such that 48 of those nucleotides were in the same order as found in the Query sequence. If all of the matches that met this criteria were in the same UniGene cluster, and mapping data was available for this cluster, it is indicated in Table 1A under the heading “Cytologic Band”. Where a cluster had been further localized to a distinct cytologic band, that band is disclosed; where no banding information was available, but the gene had been localized to a single chromosome, the chromosome is disclosed.

[0071] Once a presumptive chromosomal location was determined for a polynucleotide of the invention, an associated disease locus was identified by comparison with a database of diseases which have been experimentally associated with genetic loci. The database used was the Morbid Map, derived from OMIM™ (supra). If the putative chromosomal location of a polynucleotide of the invention (Query sequence) was associated with a disease in the Morbid Map database, an OMIM reference identification number was noted in column 9, Table 1A, labeled “OMIM Disease Reference(s)”. Table 5 is a key to the OMIM reference identification numbers (column 1), and provides a description of the associated disease in Column 2.

TABLE 1B
	SEQ
	ID
Clone ID	NO:	CONTIG		SEQ ID	EXON
NO: Z	X	ID:	BAC ID: A	NO: B	From-To
HANGA63	11	927404	AL133312	2057	1-333
HANGA63	11	927404	AL135752	2058	1-333
HANGA63	11	927404	AL133312	2059	1-467
HANGA63	11	927404	AL135752	2060	1-467
HANGA69	12	718174	AL353590	2061	1-446
HANGA85	13	746265	AC007705	2062	1-330
HANGA92	14	791182	AL359257	2063	1-167
HANGA92	14	791182	AL359257	2064	1-825
					1179-1523
					1777-2115
HANGC05	15	674059	AC024377	2065	1-119
HANGC05	15	674059	AC018496	2066	1-119
HANGC05	15	674059	AC024377	2067	1-202
HANGC05	15	674059	AC018496	2068	1-187
HANGC30	18	966430	AC022618	2069	1-408
HANGC33	19	702072	AC069127	2070	1-272
HANGC84	21	715991	AL137178	2071	1-1034
					1132-1714
HANGC84	21	715991	AC016847	2072	1-1034
					1132-1714
HANGF36	22	952583	AC013496	2073	1-255
HANGF36	22	952583	AC013496	2074	1-616
HANGF49	23	722635	AC013465	2075	1-469
HANGF49	23	722635	AC026298	2076	1-123
HANGF49	23	722635	AC016911	2077	1-469
HANGF49	23	722635	AC016749	2078	1-123
HANGF49	23	722635	AC010080	2079	1-469
HANGF49	23	722635	AC006386	2080	1-469
HANGF49	23	722635	AC026298	2081	1-399
HANGF49	23	722635	AC016749	2082	1-399
HANGG22	24	848727	AL355112	2083	1-374
HANGG22	24	848727	AL355112	2084	1-147
HANGH48	25	718759	AC069530	2085	1-378
HANGH48	25	718759	AC069530	2086	1-509
HANGH53	26	727914	AC073319	2087	1-440
HANGH66	28	661513	AC036194	2088	1-457
HANGH66	28	661513	AC026013	2089	1-457
HANGH66	28	661513	AC025534	2090	1-457
HANKD09	29	625167	AC012521	2091	1-409
HANKD09	29	625167	AC027666	2092	1-409
HANKD47	30	719963	AL355592	2093	1-464
HANKD83	31	963964	AC068969	2094	1-316
HANKD83	31	963964	AC067805	2095	1-316
HANKG78	32	710760	AC006514	2096	1-385
					594-1524
					1793-2194
					4246-4590
					4888-5238
HANKG78	32	710760	AC006510	2097	1-931
					1200-1601
HANKG78	32	710760	AC006510	2098	1-379
HANKG90	33	746282	AP001644	2099	1-437
HANKG90	33	746282	AC021506	2100	1-437
HANKH48	34	721340	AP001203	2101	1-382
HANKH56	35	733063	AC074293	2102	1-417
HANKH56	35	733063	AC068194	2103	1-417
HAOAA78	37	756979	AC008945	2104	1-549
HAOAA78	37	756979	AC008945	2105	1-481
HAOAA90	38	919249	AC044917	2106	1-348
HAOAA90	38	919249	AP001839	2107	1-332
HAOAA90	38	919249	AC023090	2108	1-348
HAOAA90	38	919249	AC018445	2109	1-348
HAOAA90	38	919249	AC044917	2110	1-887
HAOAA90	38	919249	AP001839	2111	1-146
					303-921
HAOAA90	38	919249	AC023090	2112	1-887
HAOAC05	39	932017	AC008279	2113	1-516
HAOAC05	39	932017	AC008279	2114	1-478
HAOAH38	45	705946	AC005036	2115	1-345
HAOMA13	46	915881	AC068969	2116	1-368
HAOMA13	46	915881	AC067805	2117	1-368
HAOMA13	46	915881	AC067805	2118	1-536
HAOMB64	47	960293	AC019144	2119	1-1138
HAOMB64	47	960293	AC019144	2120	1-319
HAOMB64	47	960293	AC019144	2121	1-455
HAOMC21	48	670518	AL354920	2122	1-788
HAOMC21	48	670518	AL354920	2123	1-317
HAOMC21	48	670518	AL354920	2124	1-1979
					3907-4540
					5067-5184
					6386-6845
HAOME45	50	705947	AP001011	2125	1-1739
HAOME45	50	705947	AP000937	2126	1-1738
HAOME45	50	705947	AP000898	2127	1-1738
					1771-4394
HAOME45	50	705947	AC015958	2128	1-1739
					1772-4400
HAOME45	50	705947	AP000937	2129	1-415
					436-874
HAOME45	50	705947	AP001011	2130	1-415
					436-874
HAOME45	50	705947	AP000898	2131	1-415
					436-874
HAOME45	50	705947	AP000937	2132	1-665
HAOME45	50	705947	AC015958	2133	1-414
					435-873
HBCKE22	54	674041	AC016659	2134	1-562
					827-886
					4639-5057
					6461-6525
					6654-7045
					7193-7882
					8357-8477
					11540-11583
					11943-12257
					13444-13934
					14354-14528
					15155-15287
HBCKE22	54	674041	AC012481	2135	1-691
HBCKE22	54	674041	AC016659	2136	1-258
HBCKE22	54	674041	AC012481	2137	1-121
					3184-3224
					3587-3901
					5088-5578
					5998-6172
					6799-6931
HBCKE22	54	674041	AC012481	2138	1-392
HBSAK76	57	506666	AC027632	2139	1-349
HBSAK76	57	506666	AC027632	2140	1-425
HBSAL69	58	573004	AC020791	2141	1-433
HBSAL80	59	506580	AC018712	2142	1-380
HBSAL80	59	506580	AC074334	2143	1-125
HBSAL80	59	506580	AC026718	2144	1-420
HBSAP02	62	920648	AC022496	2145	1-490
HBSAP02	62	920648	AC025456	2146	1-130
					236-725
					796-1013
					2665-2751
					3801-4267
					5755-6475
					7371-7547
					9209-9496
					9611-10511
					11152-11890
					11984-12319
					12651-12745
					16691-17158
					17236-17382
					22177-22609
HBSAP02	62	920648	AC026437	2147	1-122
					228-717
					788-1005
					2655-2741
					3791-4257
					5740-6460
					7356-7532
					9194-9481
					9596-10496
					11137-11875
					11969-12304
					12636-12730
					16676-17143
					17221-17367
					22161-22574
					29380-29520
					36637-36948
					37077-37558
					38020-38322
					39908-40220
					41806-41890
					42060-43287
					43415-44248
					44300-44584
					44929-45056
					45424-45902
					46737-46932
					47156-49997
HBSAP02	62	920648	AC022496	2148	1-218
HBSAP02	62	920648	AC026437	2149	1-751
HBSAP02	62	920648	AC026437	2150	1-934
HBSAQ64	64	530344	AC027573	2151	1-341
HBSAQ64	64	530344	AC073413	2152	1-341
HBSAQ64	64	530344	AC073413	2153	1-92
HBSDD91	67	775313	AC027644	2154	1-286
					361-599
					687-919
					1726-2633
HBSDD91	67	775313	AC027644	2155	1-234
HCDAA94	68	661278	AC026053	2156	1-259
HCDAA94	68	661278	AC022262	2157	1-274
HCDAA94	68	661278	AL020995	2158	1-259
HCDAA94	68	661278	AC022262	2159	1-526
HCDAA94	68	661278	AL020995	2160	1-526
HCDAG92	74	724693	AP001105	2161	1-496
HCDAG92	74	724693	AP001900	2162	1-496
HCDAG92	74	724693	AP001145	2163	1-496
HCDAG95	75	533871	AC018891	2164	1-441
HCDAG95	75	533871	AC018891	2165	1-327
HCDAH34	76	533870	AC010469	2166	1-483
HCDAH34	76	533870	AC026718	2167	1-483
HCDAH34	76	533870	AC010469	2168	1-122
HCDAH34	76	533870	AC010469	2169	1-272
HCDAJ67	77	925362	AL049875	2170	1-317
HCDAJ67	77	925362	AL049875	2171	1-141
HCDAK93	78	523648	AC027474	2172	1-527
HCDAK93	78	523648	AC010332	2173	1-526
HCDAK93	78	523648	AC021112	2174	1-527
HCDAK93	78	523648	AC027474	2175	1-684
HCDAK93	78	523648	AC010332	2176	1-684
HCDAK93	78	523648	AC021112	2177	1-684
HCDAM34	80	523607	AC005969	2178	1-98
					1380-1550
HCDAM34	80	523607	AC005969	2179	1-227
HCDAO32	81	530006	AC068780	2180	1-285
HCDAO32	81	530006	AC073907	2181	1-285
HCDAO32	81	530006	AC068780	2182	1-136
HCDAO32	81	530006	AC073907	2183	1-297
HCDAT56	82	533881	AL109657	2184	1-664
					792-1138
					1613-2026
					6132-6234
					6599-7035
					7168-7446
					8133-8262
					8374-8670
					8831-9478
					9704-9762
					9777-10137
					10260-11201
					11900-12541
HCDAT56	82	533881	AL109657	2185	1-489
HCDAT56	82	533881	AL109657	2186	1-369
HCDBO13	83	709590	AC007411	2187	1-323
HCDBR39	85	921893	AC008594	2188	1-409
HCDBR39	85	921893	AC040160	2189	1-410
HCDBR39	85	921893	AC008594	2190	1-761
HCDBR39	85	921893	AC008594	2191	1-1026
HCDBR39	85	921893	AC040160	2192	1-1026
HCDBR39	85	921893	AC040160	2193	1-761
HCDBU77	86	661272	AL121747	2194	1-400
					540-929
					957-1393
					1904-2140
					3206-3745
					4498-4693
					4849-5203
					6468-6828
					7645-8255
					8418-8525
					9502-10126
HCDBU77	86	661272	AL121747	2195	1-756
HCDBW51	87	556469	AL358472	2196	1-288
HCDBW51	87	556469	AL358472	2197	1-309
HCDBX78	89	847580	AC026340	2198	1-252
HCDBX78	89	847580	AC026340	2199	1-111
HCDCB84	90	670159	AL035634	2200	1-241
HCDCB84	90	670159	AL139330	2201	1-77
					563-1013
					1219-1674
					2670-2885
					4767-5013
					5856-5969
					6030-6407
					6602-8576
HCDCB84	90	670159	AL035634	2202	1-451
					657-1112
HCDCB84	90	670159	AL139330	2203	1-384
HCDCE62	92	523582	AL137065	2204	1-305
HCDCE62	92	523582	AL031177	2205	1-305
HCDCF11	93	967768	AC021163	2206	1-278
HCDCF11	93	967768	AC006942	2207	1-278
HCDCF11	93	967768	AC021163	2208	1-148
					244-287
					843-967
HCDCF11	93	967768	AC006942	2209	1-148
					244-287
					843-967
HCDCF11	93	967768	AC006942	2210	1-476
					718-997
HCDCK91	95	592465	AC024885	2211	1-3448
HCDCR26	96	960048	AP000087	2212	1-429
					732-1074
					1121-1255
					3513-3762
HCDCR26	96	960048	AP000139	2213	1-429
					732-1074
					1121-1255
					3513-3762
HCDCR26	96	960048	AP000226	2214	1-429
					732-1074
					1121-1255
					3513-3762
HCDCR26	96	960048	AP000226	2215	1-2571
HCDCR26	96	960048	AP000087	2216	1-2571
HCDCR26	96	960048	AP000139	2217	1-2571
HCDCX68	97	529778	AC003692	2218	1-44
					153-684
					695-1033
					2881-3167
					3597-8068
					8150-9192
HCDCX68	97	529778	AC003692	2219	1-342
HCDCX68	97	529778	AC003692	2220	1-467
HCDDB62	100	529890	AC015589	2221	1-570
HCDDB62	100	529890	AC010328	2222	1-570
HCDDB62	100	529890	AC015589	2223	1-340
HCDDB62	100	529890	AC010328	2224	1-82
					355-795
					871-998
					1300-1582
					1629-2248
					2727-2918
					4474-4729
					4876-6190
					6240-9439
HCDDB62	100	529890	AC010328	2225	1-340
HCDDI61	101	529937	AC005876	2226	1-428
HCDDI61	101	529937	AL358234	2227	1-428
HCDDI61	101	529937	AL161936	2228	1-428
HCDDI61	101	529937	AC005876	2229	1-247
HCDDI61	101	529937	AL358234	2230	1-247
HCDDI61	101	529937	AL161936	2231	1-247
HCDDU07	102	954177	AC005498	2232	1-1881
HCDDU07	102	954177	AC005498	2233	1-380
HCDDV90	103	847575	AC021553	2234	1-251
HCDDV90	103	847575	AC067837	2235	1-251
HCDDV90	103	847575	AC067837	2236	1-1510
HCDDV90	103	847575	AC067837	2237	1-450
HCDDY57	104	556465	AL354936	2238	1-273
HCDDY57	104	556465	AC021410	2239	1-273
HCDDY57	104	556465	AL354936	2240	1-186
HCDDY57	104	556465	AC021410	2241	1-153
HCDDZ09	105	523605	AC008866	2242	1-156
HCDDZ09	105	523605	AC016641	2243	1-156
HCDEB49	107	847572	AC024998	2244	1-242
HCDEB49	107	847572	AL390122	2245	1-242
HCDEB49	107	847572	AF198096	2246	1-242
HCDEB49	107	847572	AL390122	2247	1-430
HCDEB49	107	847572	AL390122	2248	1-419
HCDEB49	107	847572	AF198096	2249	1-430
HCDEB49	107	847572	AF198096	2250	1-500
HCDEB78	108	921710	AL359513	2251	1-300
HCDER16	111	667338	AC008064	2252	1-315
HCDER16	111	667338	AC008064	2253	1-415
HCDER16	111	667338	AC008064	2254	1-259
HCDER29	112	523506	AC022835	2255	1-203
HCDER29	112	523506	AC012476	2256	1-234
					244-446
					460-664
					814-913
					3082-3278
					3691-4090
HCDER29	112	523506	AC022835	2257	1-155
HCDER29	112	523506	AC012476	2258	1-412
HCDET89	113	524045	AC009719	2259	1-323
HCDET89	113	524045	AC022939	2260	1-323
HCDET89	113	524045	AC009719	2261	1-138
HCDET89	113	524045	AC009719	2262	1-308
HCDET89	113	524045	AC022939	2263	1-138
HCDET89	113	524045	AC022939	2264	1-308
HFIAE82	116	779898	AC020669	2265	1-443
HFIAI07	118	952884	AC005722	2266	1-365
					1763-1914
					2765-3000
					3766-3854
					4573-5237
					6312-7007
					7152-7793
					8026-8551
					8938-9098
					9770-10050
					11976-12661
					12934-13016
					13421-13727
					14047-14140
					14549-14721
					15329-15864
					16167-16198
					21769-21933
					22605-22741
					22939-23176
					24138-24261
					24368-24492
					26100-26500
					26685-28818
HFIAI07	118	952884	AC005722	2267	1-491
HFIAP31	119	697775	AL360269	2268	1-291
HFIAP31	119	697775	AL356323	2269	1-374
HFIAP31	119	697775	AC004916	2270	1-374
HFIAP31	119	697775	AC004916	2271	1-480
HFIAP89	120	587844	AC013526	2272	1-343
HFIAP89	120	587844	AC011769	2273	1-342
HFIAP89	120	587844	AC011766	2274	1-342
HFIAP91	121	925831	AC002094	2275	1-282
					780-1066
					1693-1777
					2672-3234
					3779-3876
					4254-4331
					4547-4658
					5768-5907
					6777-6804
					6988-7438
					7930-8074
					8084-8109
					8407-8492
					9334-13211
					15125-15331
					16116-16166
					16244-16336
					17085-17261
					17834-18163
					18315-19249
					19368-20067
					20077-20493
					21715-21833
HFIAP91	121	925831	AC002094	2276	1-1458
					1484-1825
					2941-3033
					3149-3619
					4464-4687
HFIAP91	121	925831	AC002094	2277	1-139
					960-1288
					3094-3333
					3487-3622
					4951-5037
					5249-5369
					5403-8947
					9834-9970
HFIBI48	124	587871	AL162590	2278	1-574
HFIBI48	124	587871	AL161445	2279	1-574
HFIBI48	124	587871	AL162590	2280	1-697
HFIBI48	124	587871	AL162590	2281	1-326
HFIBI48	124	587871	AL161445	2282	1-326
HFIBI48	124	587871	AL161445	2283	1-697
HFICF01	127	916103	AC017083	2284	1-428
HFIDN81	134	959050	AC013705	2285	1-944
HFIDN81	134	959050	AC011644	2286	1-946
HFIDN81	134	959050	AC013705	2287	1-349
HFIDN81	134	959050	AC013705	2288	1-757
HFIDN81	134	959050	AC011644	2289	1-349
HFIHB16	138	661971	AC025919	2290	1-472
HFIHD91	139	702324	AP001901	2291	1-2143
HFIHD91	139	702324	AC016229	2292	1-2144
HFIHD91	139	702324	AP001901	2293	1-608
HFIHD91	139	702324	AC016229	2294	1-44
					1477-1919
					2015-4862
HFIHE47	140	857988	AC021097	2295	1-1803
					2560-3406
					3921-4106
					4155-6674
					6911-7014
					7135-7264
					7522-8788
HFIHJ60	142	740280	AL132709	2296	1-763
					922-2545
HFIHJ60	142	740280	AL132709	2297	1-383
HFIHL29	144	690546	AC067837	2298	1-384
HFIHL29	144	690546	AC021553	2299	1-384
HFIHL29	144	690546	AC067837	2300	1-450
HFIHZ33	146	588058	AC011822	2301	1-993
					1199-1868
HFIHZ33	146	588058	AF025422	2302	1-991
HFIHZ33	146	588058	AC011822	2303	1-534
					541-1582
HFIHZ33	146	588058	AF025422	2304	1-534
					541-1582
HFIHZ33	146	588058	AF025422	2305	1-670
HFIHZ51	147	725587	AC015480	2306	1-386
HFIIB73	148	669594	AL109757	2307	1-452
HFIIB73	148	669594	AL031296	2308	1-670
					1590-2584
					3609-3751
					4204-4803
					4847-5271
					9874-10146
					11847-12328
					12493-13051
					13395-13635
					15455-15917
					17288-17739
					18945-19908
					21414-22006
					27737-27823
					35955-36575
					36643-37204
					37341-37504
					39154-39312
					41736-42263
					47221-47669
					47712-48167
					50898-51095
					51163-51655
					51716-52580
					52706-58181
HFIIB73	148	669594	AL109757	2309	1-964
HFIIB73	148	669594	AL031296	2310	1-274
HFIIS21	149	670765	AL359372	2311	1-420
					908-1805
					1962-3333
					3335-4572
					5795-5879
					7151-7262
					7320-7927
HFIIS21	149	670765	AL359372	2312	1-709
HFIJF34	150	703972	AC020726	2313	1-462
HFIUE17	153	855119	AL121809	2314	1-576
HFIUE17	153	855119	AL133501	2315	1-577
HFIUE17	153	855119	AL121809	2316	1-374
HFIUE17	153	855119	AL121809	2317	1-67
					286-666
					3060-3146
					3462-3689
					4441-4741
					8067-8220
					9047-9139
					9816-10074
					11133-11965
					14462-14721
					15045-15361
					15605-16026
					17424-17605
					17899-18267
					18702-18860
HFIUE17	153	855119	AL133501	2318	1-374
HFIUH54	154	929787	AC004774	2319	1-403
HFIUH54	154	929787	AC004774	2320	1-519
HFIUI66	155	746397	AC012385	2321	1-326
HFIUI66	155	746397	AC026491	2322	1-439
					1239-1395
					1783-2779
					2956-3540
					3650-3772
					3781-4106
					6023-6283
					6363-7024
					7557-7711
					10937-11233
					12728-12870
					13214-13362
					13714-15432
					16010-16106
HFIUI66	155	746397	AC026491	2323	1-299
HFIUJ95	156	735969	AC009280	2324	1-437
HFIUJ95	156	735969	AC009280	2325	1-296
HFIUO63	158	691921	AC012681	2326	1-969
HFIUO63	158	691921	AC012681	2327	1-614
HFIVB03	160	924021	AC017003	2328	1-335
HFIXC30	165	692635	AP002406	2329	1-418
HFIXC30	165	692635	AC010776	2330	1-418
HFIXC44	166	839536	AC036163	2331	1-588
					625-1391
HFIXC44	166	839536	AC036163	2332	1-2530
HFIXK83	168	767156	AC007991	2333	1-400
					1386-1821
					3975-4075
					4188-4312
					4711-4794
					4915-5054
HFIXK83	168	767156	AC007991	2334	1-114
HFIXK94	169	943717	AC073231	2335	1-430
HFIXK94	169	943717	AF045448	2336	1-430
HFIXK94	169	943717	AF064860	2337	1-430
HFIXK94	169	943717	AF121897	2338	1-430
HFIXK94	169	943717	AC073231	2339	1-527
HFIXK94	169	943717	AF045448	2340	1-49
					3630-4025
HFIXK94	169	943717	AF045448	2341	1-528
HFIXK94	169	943717	AF064860	2342	1-528
HFIXK94	169	943717	AF064860	2343	1-49
					3630-4025
HFIXK94	169	943717	AF121897	2344	1-528
HFIXK94	169	943717	AF121897	2345	1-49
					3630-4025
HFIXM11	170	966714	AL354946	2346	1-677
					1412-3002
					3013-3365
					3460-4359
HFIXM11	170	966714	AL136324	2347	1-677
					1412-3003
					3014-3366
					3461-4360
HFIXM11	170	966714	AL136324	2348	1-418
HFIXM11	170	966714	AL354946	2349	1-418
HFIXV93	172	597031	AC010810	2350	1-452
HFIXV93	172	597031	AC016252	2351	1-3092
					3746-3853
					6998-7134
					7278-7767
					8926-9044
					9829-9973
HFIXV93	172	597031	AC010810	2352	1-960
HFIXV93	172	597031	AC016252	2353	1-308
HFIXV93	172	597031	AC016252	2354	1-479
HFIXY13	173	656812	AC020602	2355	1-350
HFIXY13	173	656812	AC020602	2356	1-372
HFIXY13	173	656812	AC020602	2357	1-1346
HFIYA86	176	757155	AF015722	2358	1-356
HFIYA86	176	757155	AF015720	2359	1-352
HFIYA86	176	757155	AF015722	2360	1-649
					1041-1647
HFIYA86	176	757155	AF015720	2361	1-649
					1048-1655
HFIYB24	177	952847	AL022724	2362	1-372
HFIYB24	177	952847	AL022724	2363	1-317
HFIYB40	178	964251	AC011940	2364	1-467
HFIYB40	178	964251	AC012207	2365	1-467
HFIYB40	178	964251	AC011940	2366	1-432
HFIYB40	178	964251	AC011940	2367	1-360
HFIYB40	178	964251	AC012207	2368	1-360
HFIYB40	178	964251	AC012207	2369	1-432
HFIYK01	179	916125	AC023112	2370	1-1779
					1794-2622
HFIYK01	179	916125	AC023112	2371	1-742
HFIYO14	181	657598	AL359915	2372	1-540
HFIYO14	181	657598	AL359915	2373	1-328
HFIYO14	181	657598	AL359915	2374	1-141
HFIYP02	182	919501	AC025118	2375	1-367
HFIYP02	182	919501	AL137818	2376	1-179
					1123-1340
					1965-2331
					2735-2862
					5533-5858
					6030-6163
HFIYP02	182	919501	AL137818	2377	1-167
HFIYV59	185	861487	AL031730	2378	1-134
					1650-1936
HFIZH29	190	953895	AC024472	2379	1-410
HFIZH29	190	953895	AC026552	2380	1-410
HFIZH29	190	953895	AC010257	2381	1-410
HFIZM92	191	791267	AL049844	2382	1-3525
					3602-4349
					4471-5141
					5317-7513
HFIZM92	191	791267	AL049844	2383	1-440
HFOXA79	192	774901	AC023855	2384	1-90
					326-1081
					1429-1924
					2176-2273
					2445-2800
					3200-3301
					3374-4826
					4855-5109
					5264-5930
HFOXA79	192	774901	AC004150	2385	1-448
					545-657
					996-1130
					1337-1559
					1863-2108
					4233-4445
					5134-5423
					5604-6004
					6095-6263
					7089-7233
					7673-7809
					8154-8277
					8976-9025
					9178-9286
					9464-9847
					10011-10070
					10156-10247
					10481-11236
					11584-12079
					12331-12431
					12600-12955
					13356-13457
					13530-14982
					15011-15265
					15420-16086
HFOXA79	192	774901	AC023855	2386	1-421
HFOXA79	192	774901	AC004150	2387	1-263
					353-526
					634-747
HFOXA79	192	774901	AC004150	2388	1-666
					892-1059
					1257-1378
					1574-1668
					2078-2186
					2497-3209
					4530-4716
					5099-5612
					5629-5808
HFOXB85	193	752957	AL133500	2389	1-945
					1307-1680
					1837-2397
HFOXB85	193	752957	AL135749	2390	1-682
					859-1679
					1836-2396
HFOXC25	194	677995	AC020749	2391	1-351
HFOXC25	194	677995	AC020749	2392	1-1056
HFOXC35	195	638311	AL138760	2393	1-228
					255-361
					370-683
HFOXC35	195	638311	AL138760	2394	1-442
HFOXL03	197	923772	AC024062	2395	1-468
HFOXL03	197	923772	AC019130	2396	1-468
HFOXL03	197	923772	AC024062	2397	1-423
HFOXL03	197	923772	AC019130	2398	1-423
HFOXM54	198	587974	AC046129	2399	1-435
HFOXM54	198	587974	AC016101	2400	1-435
HFOXM54	198	587974	AC064838	2401	1-435
HFOXM54	198	587974	AC046129	2402	1-750
HFOXM54	198	587974	AC016101	2403	1-750
HFOXM54	198	587974	AC064838	2404	1-750
HFOXN89	199	587984	AC034102	2405	1-128
HFOXN89	199	587984	AC025162	2406	1-109
HFOXN89	199	587984	AC034102	2407	1-128
HFOXN89	199	587984	AC025162	2408	1-128
HFOXN89	199	587984	AC034102	2409	1-2775
					2895-3382
					3790-4134
					4616-4957
HFOXR28	201	587994	AC013592	2410	1-325
HFOXR28	201	587994	AC016934	2411	1-325
HFOXU83	204	887781	AL359927	2412	1-649
HFOXU83	204	887781	AC018373	2413	1-649
HFOXU83	204	887781	AL359927	2414	1-604
HFOXU83	204	887781	AC018373	2415	1-604
HFOXU92	205	588057	AC013692	2416	1-380
HFOXU92	205	588057	AC021342	2417	1-380
HFOXU92	205	588057	AC021342	2418	1-370
HFOXV15	206	964296	AC007342	2419	1-143
					238-638
					1310-2178
					2722-2877
					2931-3044
					3725-3818
					4666-4871
					5915-6211
					7936-8000
					8089-8189
					8657-8746
					8826-8896
					9017-9124
					10331-10569
					10740-13141
					13431-14033
					14501-14965
					15153-16043
					18258-18823
					19372-19907
					20059-21591
					22493-22695
					23271-23379
					24039-24110
					24582-24699
HFOYI36	208	935532	AL357565	2420	1-489
HFOYI36	208	935532	AL357565	2421	1-693
HFOYL77	209	494844	AC068103	2422	1-353
HFOYL77	209	494844	AC016487	2423	1-353
HFOYL77	209	494844	AC020669	2424	1-353
HMUBM26	210	908912	AC008555	2425	1-124
					788-1221
					1332-2004
					2074-4006
HMUBM26	210	908912	AC008555	2426	1-194
HOAAB15	213	575254	AC073970	2427	1-348
HOAAB15	213	575254	AC015909	2428	1-516
					865-1153
					1381-1669
					4707-4818
					5309-5534
					5726-6148
					6454-6533
					8810-8836
					9053-9813
					10575-10603
					10889-11099
					11988-12127
					12668-12869
					13224-13274
HOAAB15	213	575254	AC073970	2429	1-289
HOAAB15	213	575254	AC015909	2430	1-106
HOAAB42	214	530605	AC008013	2431	1-106
					220-357
					575-1050
					1060-1459
					3153-3870
					3965-4359
					4392-4496
					4756-4977
					5025-5078
					5198-5418
					5593-5895
					6301-6763
					6941-8173
					8913-9547
					9927-10355
					10651-11058
					11461-11749
HOAAB42	214	530605	AC009533	2432	1-221
					367-759
					1212-1606
					3182-3992
					4509-4666
					4820-4982
					5711-5948
					7122-7382
					7953-8576
					8722-9484
					9977-10227
					10746-10834
					11133-11288
					11304-11966
					12156-12572
					14044-14140
					14735-15547
					15575-16138
					16472-16862
					17405-17560
					18541-18589
					18938-19448
					20178-20525
					21420-21971
					22037-22073
					22331-22434
					22548-22685
					22842-23316
					23334-23726
					25414-26133
					26228-26338
					26375-26622
					26657-26756
					27017-27239
					27287-27340
					27456-27676
					27850-28149
					28593-28639
					28670-29013
					29189-29345
					29359-30420
HOAAB42	214	530605	AC008013	2433	1-751
					869-1288
					1741-2134
					3713-4192
					4219-4525
					5032-5188
					6221-6459
					7627-7887
					8458-9081
					9227-9966
					10464-10713
					11232-11320
					11620-11777
					11791-12453
					12643-13059
					14536-14632
					15693-16508
					16536-17099
					17433-17823
					18365-18520
					19494-19542
					19895-20386
					20452-21075
					21128-21475
					22370-22928
					22994-23030
HOAAB42	214	530605	AC008013	2434	1-418
HOAAB42	214	530605	AC009533	2435	1-636
HOAAB56	215	507839	AC026519	2436	1-363
HOAAB56	215	507839	AP001026	2437	1-363
HOAAB56	215	507839	AP001026	2438	1-89
HOAAB56	215	507839	AP001026	2439	1-419
HOAAC31	216	693597	AC069475	2440	1-557
					813-1462
HOAAC31	216	693597	AL137060	2441	1-557
					813-1462
HOAAC31	216	693597	AC069475	2442	1-398
HOAAD52	218	859628	AC044917	2443	1-319
HOAAD52	218	859628	AC023090	2444	1-319
HOAAD52	218	859628	AP001908	2445	1-319
HOAAD52	218	859628	AC023090	2446	1-448
HOAAD52	218	859628	AP001908	2447	1-443
HOAAD52	218	859628	AC044917	2448	1-450
HOAAE10	219	968532	AC016802	2449	1-324
HOAAE10	219	968532	AC016802	2450	1-462
HOAAE49	221	859630	AL138963	2451	1-304
HOAAE49	221	859630	AL138963	2452	1-383
HOAAE73	222	960631	AC022400	2453	1-939
					945-1386
					2105-2440
					2574-2794
					2935-3532
					3940-4305
					4483-6016
					6421-6829
					7089-9122
HOAAE73	222	960631	AC021320	2454	1-462
					464-587
					1007-1360
					1538-2418
					2450-3078
					3474-3779
					3854-4068
					4130-6114
HOAAE73	222	960631	AC012044	2455	1-956
					1025-1096
					1451-1600
					1640-2005
					3280-3518
					3840-4065
					4611-4921
					5754-6678
					7938-8584
					8639-8910
					10151-10355
					11341-11941
					12710-13025
					15001-15745
					15751-16194
					16911-17246
					17380-17600
					17741-18337
					18768-19114
					19292-20172
					20207-20833
					21241-21551
					21626-21839
					21901-23934
HOAAE73	222	960631	AC025039	2456	1-311
HOAAE73	222	960631	AC018510	2457	1-727
					747-1177
					1908-2243
					2377-2597
					2739-3200
					3202-3325
					3745-4098
					4276-5156
					5188-5816
					6212-6517
					6592-6806
					6868-8900
HOAAE73	222	960631	AC021320	2458	1-221
HOAAE73	222	960631	AC022400	2459	1-413
HOAAE73	222	960631	AC012044	2460	1-1577
					1604-2003
					2074-2569
					3689-4774
					4791-5120
					5331-5822
					5884-10583
					10603-10867
					11401-12562
HOAAE73	222	960631	AC025039	2461	1-209
HOAAE73	222	960631	AC018510	2462	1-474
HOAAF18	223	530600	AC008130	2463	1-357
HOAAF18	223	530600	AC022529	2464	1-355
HOAAF18	223	530600	AC005289	2465	1-357
HOAAF18	223	530600	AC008130	2466	1-327
HOAAF18	223	530600	AC022529	2467	1-327
HOAAF18	223	530600	AC005289	2468	1-327
HOAAH10	224	968368	AC009560	2469	1-606
HOAAH10	224	968368	AC012344	2470	1-606
HOAAH10	224	968368	AC009560	2471	1-361
HOAAH10	224	968368	AC012344	2472	1-361
HOAAI05	225	932537	AC008923	2473	1-304
HOAAI05	225	932537	AC008799	2474	1-304
HOAAI05	225	932537	AC008923	2475	1-306
					609-1254
HOAAI05	225	932537	AC008799	2476	1-306
					608-1253
HOAAJ23	226	531389	AC025698	2477	1-299
HOAAJ23	226	531389	AC013720	2478	1-299
HOAAJ23	226	531389	AC025698	2479	1-183
HOAAJ23	226	531389	AC013720	2480	1-105
HOAAK90	227	527490	AL359841	2481	1-285
HOAAK90	227	527490	AL390314	2482	1-285
HOAAK90	227	527490	AC025122	2483	1-285
HOAAK90	227	527490	AL390314	2484	1-185
HOAAK90	227	527490	AL359841	2485	1-129
HOAAK90	227	527490	AL390314	2486	1-129
HOAAK90	227	527490	AC025122	2487	1-129
HOAAK90	227	527490	AC025122	2488	1-185
HOAAR14	229	526530	AC073119	2489	1-270
HOAAR14	229	526530	AC027262	2490	1-270
HOAAR14	229	526530	AC073119	2491	1-540
HOAAR14	229	526530	AC027262	2492	1-273
HOAAR14	229	526530	AC073119	2493	1-273
HOAAR14	229	526530	AC027262	2494	1-540
HOAAV23	230	527489	AC034291	2495	1-301
HOAAV23	230	527489	AC034291	2496	1-422
HOAAW21	231	527487	AL357873	2497	1-362
HOABA93	234	792929	AC013335	2498	1-203
HOABA93	234	792929	AC013774	2499	1-203
HOABR40	238	531051	AC018603	2500	1-364
HOABR40	238	531051	AC018603	2501	1-504
HOABR40	238	531051	AC018603	2502	1-166
HOEAK21	239	954961	AC073936	2503	1-411
HOEAY14	240	659258	AC011597	2504	1-352
HOEAY14	240	659258	AC067726	2505	1-352
HOEAY14	240	659258	AC074266	2506	1-352
HOEAY14	240	659258	AC011597	2507	1-251
HOEAY14	240	659258	AC067726	2508	1-180
HOEAY14	240	659258	AC074266	2509	1-252
HOEBO31	242	693689	AL158165	2510	1-1964
					2375-2812
					3098-3532
					3563-3705
HOEBO31	242	693689	AL158165	2511	1-432
HOEBO31	242	693689	AL158165	2512	1-324
HOECN79	244	723113	AC015671	2513	1-719
HOECN79	244	723113	AL157936	2514	1-719
HOECN79	244	723113	AC015671	2515	1-315
HOECN79	244	723113	AL157936	2516	1-635
HOEDD83	247	578934	AC013746	2517	1-484
HOEDK10	248	915054	AC012531	2518	1-90
					532-796
HOEDK10	248	915054	AC015947	2519	1-75
					547-793
					1103-1159
					1234-1498
					1641-2181
					2468-2930
HOEDK10	248	915054	AC012531	2520	1-610
					2290-3222
HOEEB63	252	745039	AC010319	2521	1-135
					225-514
					639-710
					1067-1542
					2023-2119
					2159-2299
HOEEB63	252	745039	AC010319	2522	1-323
					1105-1205
					1282-1400
HOEEB63	252	745039	AC010319	2523	1-104
HOEEQ17	255	663719	AC074333	2524	1-458
HOEFL91	257	790134	AL049830	2525	1-123
					262-720
HOEFL91	257	790134	AL049830	2526	1-1002
					1026-1232
					4208-4825
					4861-5260
					5409-5634
					5942-6155
					8211-8327
					8673-8926
					9876-10034
					10125-10164
					11131-11196
					11675-11807
					12890-13048
					15640-16084
HOEFL91	257	790134	AL049830	2527	1-110
HOEFS83	259	615154	AC007643	2528	1-471
HOEFS83	259	615154	AL353719	2529	1-2879
					3337-3596
					4213-4851
					5160-5630
					5674-5732
					6291-6472
					6504-6660
HOEFS83	259	615154	AL133353	2530	1-200
					456-609
					5860-5998
					6526-6629
					8425-8724
					9151-9625
					12117-12252
					15026-15571
					15654-16121
					16221-16852
					19264-19592
					21596-21794
					22707-22795
					23248-23407
					23487-23890
					25183-26429
					26561-27890
					28380-28908
					28953-29430
					29490-32385
					32577-35455
					36789-37427
					37736-38206
					38250-38308
					38867-39048
					39075-39236
					39491-39811
					39971-40302
					40401-40871
					41105-41186
					41719-41801
					43440-43567
					43732-44141
					44689-44855
					46395-46619
					47357-47643
					47700-47887
					48174-48294
					48469-48728
					50284-50469
					52382-52845
HOEFS83	259	615154	AC007643	2531	1-639
HOEFS83	259	615154	AL353719	2532	1-321
HOEFS83	259	615154	AC007643	2533	1-182
HOEFS83	259	615154	AL353719	2534	1-2069
HOEFS83	259	615154	AL133353	2535	1-303
HOEFS83	259	615154	AL133353	2536	1-222
					225-361
					2796-2928
					4044-4119
					5719-5962
					7512-7571
					10952-11165
					11840-11870
					15055-15191
					17157-17497
					18170-18193
					19594-20180
					20819-21289
					21499-22434
					22520-23934
HOEJE18	260	666349	AC025788	2537	1-325
HOEJE18	260	666349	AC026250	2538	1-325
HOEKH88	263	924112	AL355924	2539	1-200
					253-1224
					1241-1709
HOEKP79	265	963337	AC007643	2540	1-471
HOEKP79	265	963337	AL133353	2541	1-464
					2377-2562
					4118-4377
					4552-4672
					4959-5146
					5203-5489
					6227-6451
					7991-8157
					8705-9114
					9279-9406
					11045-11127
					11660-11741
					11975-12445
					12544-12875
					13035-13355
					13610-13771
					13798-13979
					14538-14596
					14640-15110
					15419-16057
					17391-20269
					20461-23356
					23416-23893
					23938-24466
					24956-26285
					26417-27663
					28956-29359
					29439-29598
					30051-30139
					31052-31250
					33254-33582
					35994-36625
					36725-37192
					37275-37820
					40594-40729
					43221-43695
					44122-44421
					46217-46320
					46848-46986
					52237-52390
					52646-52845
HOEKP79	265	963337	AC007643	2542	1-332
HOEKP79	265	963337	AL133353	2543	1-303
HOEKP79	265	963337	AL133353	2544	1-1415
					1501-2436
					2646-3116
					3755-4341
					5742-5765
					6438-6778
					8744-8880
					12065-12095
					12770-12983
					16364-16423
					17973-18216
					19816-19891
					21007-21139
					23574-23710
					23713-23934
HOEMK02	267	918364	AC044789	2545	1-720
HOEMQ65	268	922789	AC019142	2546	1-435
HOEMQ65	268	922789	AC019142	2547	1-461
HOEMQ65	268	922789	AC019142	2548	1-422
HOEOE25	269	907806	AC018850	2549	1-599
HOEOE25	269	907806	AC012342	2550	1-599
HOEOE25	269	907806	AC018850	2551	1-197
HOEOE25	269	907806	AC012342	2552	1-198
HOHAE68	273	781448	AC023504	2553	1-1578
HOHBE48	275	588317	AC023449	2554	1-385
HOHBE48	275	588317	AC023449	2555	1-219
HOHBE48	275	588317	AC023449	2556	1-322
HOHBL11	277	966720	AC020708	2557	1-477
HOHBO79	279	588271	AC022677	2558	1-439
HOHBO79	279	588271	AL136126	2559	1-439
HOHBO79	279	588271	AC022677	2560	1-131
HOHBO79	279	588271	AC022677	2561	1-359
HOHBO79	279	588271	AL136126	2562	1-131
HOHBO79	279	588271	AL136126	2563	1-351
HOHBY75	282	840109	AC009708	2564	1-616
HOHBY75	282	840109	AC021004	2565	1-1236
HOHBY75	282	840109	AC021004	2566	1-47
					2450-2628
					4538-5196
HOHCH04	283	859047	AC024677	2567	1-27
					1762-1878
					2480-3110
					3124-3541
					3681-3783
HOHCH04	283	859047	AC027166	2568	1-631
HOHCH04	283	859047	AL355492	2569	1-27
					1762-1878
					2480-3110
					3124-3541
					3681-3783
HOHCH04	283	859047	AC024677	2570	1-327
HOHCH04	283	859047	AC027166	2571	1-418
HOHCH04	283	859047	AL355492	2572	1-83
					1649-1839
					5074-5151
HOHCI05	284	935123	AL356427	2573	1-393
HOHCI05	284	935123	AL121931	2574	1-393
HOHCO85	287	751299	AL354664	2575	1-149
					867-1007
					3589-3733
					3850-4492
					4600-4734
					4976-5005
HOHCO85	287	751299	AL353703	2576	1-149
					867-1007
					3588-3732
					3849-4491
					4599-4733
					4976-5005
HOHCO85	287	751299	AL096771	2577	1-149
					867-1007
					3589-3733
					3850-4492
					4600-4734
					4976-5005
HOHCO85	287	751299	AL354664	2578	1-588
HOHCO85	287	751299	AL353703	2579	1-588
HOHCO85	287	751299	AL096771	2580	1-588
HOHCQ76	289	825236	AL161454	2581	1-698
HOHCQ76	289	825236	AL161454	2582	1-499
					1477-1593
					2237-2547
HOHCQ77	290	661480	AP000274	2583	1-381
HOHCQ77	290	661480	AP000104	2584	1-381
HOHCQ77	290	661480	AP000180	2585	1-381
HOHCQ77	290	661480	AP000274	2586	1-888
HOHCQ77	290	661480	AP000104	2587	1-888
HOHCQ77	290	661480	AP000180	2588	1-888
HOHCV83	291	735685	AC010321	2589	1-425
HOHCV83	291	735685	AC010321	2590	1-114
HOHCW02	292	919142	AC036174	2591	1-299
HOHCW02	292	919142	AC036174	2592	1-210
HOHCW02	292	919142	AC036174	2593	1-88
HOHDB32	294	698781	AC016724	2594	1-308
HOHDF40	296	710748	AL139021	2595	1-162
					4326-4476
					6562-6730
					6974-7075
					9334-9459
					12688-12802
					13427-13516
					13743-13821
HOHDF40	296	710748	AL135752	2596	1-162
					766-1091
					4330-4480
					6567-6735
					6972-7127
					7762-7921
					9338-9463
					12686-12800
					13414-13546
					13741-13819
HOHDF53	297	727620	AL355052	2597	1-479
HOHDI48	298	966379	AF233070	2598	1-264
HOHDI48	298	966379	AF233070	2599	1-952
HOHEN50	303	662365	AL161784	2600	1-165
HOHEN50	303	662365	AC011969	2601	1-165
HOHEN50	303	662365	AC006558	2602	1-165
HOHEN50	303	662365	AL161784	2603	1-311
HOHEN50	303	662365	AC011969	2604	1-311
HOHEN50	303	662365	AC011969	2605	1-44
					1982-2321
					2357-3841
					3894-4365
					4783-5157
HOHEN50	303	662365	AC006558	2606	1-312
HOHEN50	303	662365	AC006558	2607	1-44
					2087-2223
					2263-2345
					2381-2834
					3157-3876
					3929-4400
					4822-5199
HOSBV22	309	780092	AL354751	2608	1-772
HOSBV22	309	780092	AL354751	2609	1-363
HOSBV22	309	780092	AL354751	2610	1-104
HOSCM15	312	921336	AC023283	2611	1-1174
HOSCM15	312	921336	AC023283	2612	1-248
					328-619
HOSCM15	312	921336	AC023283	2613	1-679
HOSDE63	314	580959	AC073611	2614	1-214
					411-670
HOSDE63	314	580959	AC021103	2615	1-477
					3144-3537
HOSDE63	314	580959	AC073611	2616	1-358
					742-1100
					1213-2219
					2906-2963
					3180-3361
HOSDE63	314	580959	AC021103	2617	1-311
HOSDN27	316	530459	AL121894	2618	1-718
HOSDN27	316	530459	AL121894	2619	1-1248
HOSEB61	317	741812	AL049781	2620	1-1283
HOSEB61	317	741812	AL049781	2621	1-309
HOSEM84	318	831049	AC021980	2622	1-509
					614-987
					1027-2228
					2279-3074
					3162-3379
HOSEM84	318	831049	AC007383	2623	1-1268
					3461-3535
					3629-3768
					4716-4911
					7009-7195
					7458-7577
					9862-10536
					13314-13528
					13695-13799
					13862-14171
					15401-15594
					17534-17648
					18187-18300
					18863-18991
					19607-19754
					20941-21056
					21814-21953
					23800-24012
					24451-24585
					24674-24759
					25941-26016
					26734-26846
					27836-28282
					28454-28791
					28794-28910
					29003-29585
					30139-30525
					30540-30606
					30873-31831
					32925-33206
					35019-35447
					35904-36391
					36475-36983
					37087-37460
					37500-38466
					38662-38692
					38752-39547
					39635-39852
HOSEM84	318	831049	AC021980	2624	1-444
HOSEM84	318	831049	AC021980	2625	1-443
HOSEM84	318	831049	AC007383	2626	1-2585
HOSFO57	319	736034	AC073334	2627	1-325
HOSFO57	319	736034	AC073334	2628	1-562
HOSFO57	319	736034	AC073334	2629	1-95
					232-346
HOSFY79	321	774052	AC018977	2630	1-401
HOSFY79	321	774052	AC018977	2631	1-2343
HOSFZ39	322	705351	AC055117	2632	1-411
HOSFZ39	322	705351	AC055117	2633	1-245
HOSGH28	323	686649	AC068531	2634	1-2365
					2457-2668
					2911-3285
					3553-3980
					4160-4543
HOSGH28	323	686649	AC008630	2635	1-139
					1963-1988
					2524-4898
					4990-5210
					5444-5815
					6084-6515
HOSGH28	323	686649	AC068531	2636	1-141
HOSGH28	323	686649	AC008630	2637	1-423
HOSGJ17	324	508870	AC068234	2638	1-1143
					2745-3406
HOSGJ17	324	508870	AC068234	2639	1-333
HOSNO86	326	858938	AC009644	2640	1-176
					2355-3224
HOSNO86	326	858938	AP000904	2641	1-176
					2354-3223
HOSNO86	326	858938	AP002811	2642	1-176
					2354-3223
HOSOE05	327	930946	AC024400	2643	1-482
HOSOE05	327	930946	AC022059	2644	1-479
HOSOE05	327	930946	AC006512	2645	1-247
					2812-2918
					3488-3953
					3964-4527
					4683-5151
					5330-9121
					9884-10335
					10748-10781
					10960-11055
					11323-12111
					12127-12791
					12911-13262
					13266-13791
					14696-14866
					15107-15207
					16551-16955
					17174-17614
					18504-18749
					19392-19660
					19720-20075
					20785-21233
					21290-21733
					23618-23649
					23982-24188
					24481-24573
					24741-25003
					26591-26705
					26738-27249
					28479-28858
					29065-31669
					31926-32887
					33667-34293
					35229-35682
					38114-38771
HOSOE05	327	930946	AC022059	2646	1-338
					1107-1723
HOSOE05	327	930946	AC006512	2647	1-818
					963-1440
					1469-1958
					2220-3076
					3455-3663
					3931-4285
					4549-4632
					4696-5069
					5245-5337
					5461-5775
HOSOE05	327	930946	AC006512	2648	1-738
HRDAB60	329	509428	AC073285	2649	1-460
HRDAB60	329	509428	AC008082	2650	1-460
HRDAF69	331	956269	AL022320	2651	1-175
					2123-2610
					2802-2918
					5337-5521
					5927-6085
					7196-7332
					8400-8509
					8805-8995
					11185-11337
HRDAF69	331	956269	AL022320	2652	1-227
HRDAF69	331	956269	AL022320	2653	1-157
HRDAF90	332	531026	AL353141	2654	1-311
HRDAF90	332	531026	AL353141	2655	1-314
HRDBA76	334	534304	AL160281	2656	1-654
HRDBA76	334	534304	Z98304	2657	1-654
HRDBA76	334	534304	AL160281	2658	1-323
HRDBA76	334	534304	AL160281	2659	1-339
HRDBA76	334	534304	Z98304	2660	1-323
HRDBA76	334	534304	Z98304	2661	1-339
HRDBC02	335	921144	AL137780	2662	1-120
					179-1066
					1899-2055
					2150-2610
					4802-5459
					5700-5854
					5982-6112
HRDBC02	335	921144	AL354820	2663	1-120
					179-1066
					1899-2055
					2150-2610
					4802-5459
					5700-5854
					5982-6112
HRDBC30	336	530858	AL136173	2664	1-315
					396-1061
HRDBC30	336	530858	AL136173	2665	1-75
					1756-2079
					2376-2736
					3583-4171
HRDBC30	336	530858	AL136173	2666	1-117
HRDBC52	337	867169	AC068528	2667	1-301
HRDBE07	339	954289	AC024583	2668	1-276
					456-663
					1014-1459
					1945-2257
					2609-2739
					5806-6010
					7308-7659
					8014-8242
					9821-9982
					10722-10844
					10921-11553
					12075-12213
					12336-12424
					13519-14781
HRDBE07	339	954289	AC023629	2669	1-369
HRDBE07	339	954289	AC022107	2670	1-276
					456-663
					1014-1460
					1961-2263
					2561-2691
					3029-3584
					3903-4218
					5757-5961
					7262-7613
					7968-8207
HRDBE07	339	954289	AC023629	2671	1-294
HRDBE07	339	954289	AC024583	2672	1-105
HRDBE07	339	954289	AC022107	2673	1-105
HRDBE07	339	954289	AC023629	2674	1-276
					457-665
HRDBE19	341	534495	AC016581	2675	1-472
HRDBE19	341	534495	AC008935	2676	1-472
HRDBE41	342	530856	AC006138	2677	1-2049
					2103-2296
					2446-2562
					2812-2888
					3066-3445
					3609-3858
					3955-4116
					4190-4339
					4598-5041
					5181-5479
					5520-5869
					6069-6244
					6382-6463
					7442-7493
					7906-8006
					8104-8360
					8381-8519
					8678-9386
					9440-9543
HRDBE41	342	530856	AB023049	2678	1-2642
					2696-2889
					3039-3155
					3405-3481
					3659-4038
					4202-4451
					4548-4709
					4783-4932
					5191-5634
					5773-6073
					6113-6462
					6662-6837
					6975-7056
					8035-8086
					8500-8600
					8698-8954
					8975-9113
					9272-9980
					10034-10137
					13874-14412
					15839-16314
					16629-17195
					18035-18278
					18755-18802
					19686-19796
					19902-20001
					20116-20184
					20235-20526
					20771-20927
					21443-21561
					23024-23093
					24623-25138
					25146-25453
					25695-26591
HRDBE41	342	530856	AC006138	2679	1-388
HRDBE41	342	530856	AB023049	2680	1-149
					617-675
					791-885
					1009-1078
					1188-1302
					1484-1797
					2714-2955
					3680-3955
					4502-4651
					4802-5433
					6327-6574
					6847-6963
					7884-8446
					9168-9385
					9477-9730
					9987-10023
					11007-11124
					11660-12154
					12622-12937
					13533-13581
					13608-13983
					14317-14874
					14882-15823
					16071-17843
					18385-18504
					19059-19134
					19207-20247
HRDBE41	342	530856	AB023049	2681	1-103
HRDBG59	343	507381	AL138803	2682	1-313
HRDBG59	343	507381	AL121905	2683	1-313
HRDBG59	343	507381	AL138803	2684	1-123
HRDBG59	343	507381	AL138803	2685	1-193
HRDBG59	343	507381	AL121905	2686	1-104
HRDBJ28	345	925457	AC073334	2687	1-347
HRDBJ28	345	925457	AC073334	2688	1-131
HRDBL61	347	575229	AL359977	2689	1-937
HRDBL61	347	575229	AL359977	2690	1-306
					2924-3292
					3699-4656
HRDBL75	348	524423	AC020557	2691	1-83
					1023-1263
HRDBL75	348	524423	AP001620	2692	1-83
					1023-1263
HRDBL75	348	524423	AC020557	2693	1-285
HRDBL75	348	524423	AP001620	2694	1-285
HRDBQ18	350	954274	U53331	2695	1-86
					1346-1623
					1706-2191
					4151-4593
					4667-4762
					5022-5343
					5875-6206
					9831-10269
					10732-10901
					11640-11747
					12310-12703
					14008-14301
					14840-15086
					16199-16673
					17070-17190
					17916-17996
HRDBQ18	350	954274	U53331	2696	1-139
HRDBQ38	351	533939	AC021305	2697	1-1626
HRDBQ38	351	533939	AC023188	2698	1-148
					201-668
					732-1141
					1534-2038
					3506-5131
					5587-5713
					6756-6945
					7208-7408
					7818-7942
					8257-8658
					9327-9745
					10707-10838
HRDBQ38	351	533939	AF267168	2699	1-1626
HRDBQ38	351	533939	AC021305	2700	1-499
HRDBQ38	351	533939	AC023188	2701	1-427
HRDBQ38	351	533939	AF267168	2702	1-168
HRDBQ38	351	533939	AF267168	2703	1-190
HRDBQ82	353	533947	AC008596	2704	1-574
HRDBQ82	353	533947	AC008431	2705	1-574
HRDBQ82	353	533947	AC018752	2706	1-574
HRDBQ82	353	533947	AC008596	2707	1-459
HRDBQ82	353	533947	AC008431	2708	1-459
HRDBQ82	353	533947	AC018752	2709	1-459
HRDBR35	355	867167	AL137072	2710	1-445
HRDBR35	355	867167	AL137072	2711	1-378
					417-818
					867-1335
HRDCA61	358	921128	AL161775	2712	1-675
HRDCA61	358	921128	AL157877	2713	1-718
					1161-1617
					1682-2115
					2257-2695
					3740-4120
					4204-4329
					5302-5537
					6599-7016
					7601-7779
					7869-9425
					9638-10313
					10567-11108
					11241-11965
					12442-12570
					13069-13267
					13683-13945
					15087-15281
					15761-16052
					17071-17217
					17533-17737
					19140-19633
					19690-19820
HRDCA61	358	921128	AL157877	2714	1-103
HRDCB18	359	968554	AC009152	2715	1-330
HRDCD12	360	921796	AC068195	2716	1-497
HRDDN54	364	932764	AC004853	2717	1-318
HRDDY26	366	526783	AL035669	2718	1-516
					736-1331
					1746-2303
					3453-4698
					4716-5032
					6454-6957
					7257-7792
					8310-8674
					8721-8935
					9029-9968
HRDDY26	366	526783	AL035669	2719	1-157
HRDDZ76	368	574324	AC002210	2720	1-117
HRDDZ76	368	574324	AC004227	2721	1-117
HRDDZ76	368	574324	AC004227	2722	1-986
HRDEB78	369	526861	AC053519	2723	1-322
HRDEB78	369	526861	AC053519	2724	1-193
HRDED92	371	936045	AL136418	2725	1-108
					203-380
					2017-2151
					2671-2870
					4311-5010
					5613-6100
					6341-6502
					6658-6926
					7119-7469
					7746-8431
					8470-8794
					9256-9503
					9582-10158
					10571-10704
					10849-11637
					12112-12236
					13750-13906
					16846-16981
					17153-17729
					18146-18931
					19273-19326
					19553-19737
					20127-20336
					20424-20467
HRDED92	371	936045	AL139054	2726	1-108
					203-380
					2017-2151
					2671-2870
					4311-5010
					5613-6100
					6341-6502
					6658-6926
					7119-7469
					7746-8431
					8470-8794
					9256-9503
					9582-10158
					10571-10704
					10849-11637
					12112-12236
					13750-13906
					16846-16981
					17153-17729
					18146-18931
					19273-19326
					19553-19737
					20127-20336
					20424-20467
HRDED92	371	936045	AL136418	2727	1-121
					402-727
					1924-1974
HRDED92	371	936045	AL139054	2728	1-121
					402-727
					1924-1974
HRDEJ76	373	574335	AL160282	2729	1-483
HRDEJ76	373	574335	AL160282	2730	1-36
					98-230
					529-1060
HRDEJ76	373	574335	AL160282	2731	1-323
HRDEL91	375	790374	AL034553	2732	1-289
HRDEL91	375	790374	AL034553	2733	1-312
HRDEL91	375	790374	AL034553	2734	1-265
HRDEO12	376	867140	AC018519	2735	1-349
HRDEO12	376	867140	AC018519	2736	1-425
HRDEO76	377	952894	AC011787	2737	1-610
HRDEO76	377	952894	AC022467	2738	1-617
HRDEP31	378	766222	AC016493	2739	1-434
HRDEP31	378	766222	AC023577	2740	1-216
HRDEQ30	380	506774	AC026051	2741	1-571
HRDEQ30	380	506774	AC026051	2742	1-335
HRDEQ30	380	506774	AC026051	2743	1-383
HRDEQ96	381	507543	AL391069	2744	1-794
HRDEQ96	381	507543	AL158846	2745	1-794
HRDEQ96	381	507543	AL391069	2746	1-465
HRDEQ96	381	507543	AL158846	2747	1-465
HRDES52	382	867115	AL356785	2748	1-228
					283-429
					1240-1597
					1870-2461
HRDES65	383	526823	AC008610	2749	1-417
HRDES65	383	526823	AC008610	2750	1-293
HRDET91	385	827084	AL354659	2751	1-429
HRDET91	385	827084	AC009420	2752	1-430
HRDEU33	386	572905	AC015467	2753	1-305
HRDEU33	386	572905	AC011927	2754	1-305
HRDEU33	386	572905	AC027542	2755	1-304
HRDEU33	386	572905	AC011927	2756	1-213
HRDEU33	386	572905	AC015467	2757	1-213
HRDEU33	386	572905	AC027542	2758	1-213
HRDEU42	387	881296	AL133411	2759	1-349
HRDEU42	387	881296	AL133411	2760	1-522
HRDEU43	388	765813	AC023817	2761	1-969
					1121-5132
					5167-12104
HRDEU43	388	765813	AL161433	2762	1-155
HRDEU43	388	765813	AC011244	2763	1-1453
HRDEU43	388	765813	AC044800	2764	1-1833
					1988-7642
HRDEU43	388	765813	AC011244	2765	1-299
					1027-1436
					1568-2015
					2133-2823
					2887-3398
					3894-3979
					4893-5014
					5145-5614
					5696-7528
					7544-7570
					7688-15819
HRDEU43	388	765813	AC010237	2766	1-216
					1036-2484
					2512-3057
HRDEU43	388	765813	AL161433	2767	1-216
					1038-3049
HRDEU43	388	765813	AC068735	2768	1-456
HRDEU43	388	765813	AC021725	2769	1-458
HRDEU43	388	765813	AL009030	2770	1-744
HRDEU43	388	765813	AL161433	2771	1-216
					1038-3049
HRDEU43	388	765813	AL135916	2772	1-462
HRDEU43	388	765813	AL133255	2773	1-462
HRDEU43	388	765813	AL157879	2774	1-1453
HRDEU43	388	765813	AL021368	2775	1-462
HRDEU43	388	765813	AC011244	2776	1-130
HRDEU43	388	765813	AC044800	2777	1-468
HRDEU43	388	765813	AC023817	2778	1-1118
HRDEU43	388	765813	AL161433	2779	1-213
HRDEU43	388	765813	AC011244	2780	1-1398
HRDEU43	388	765813	AC010237	2781	1-596
HRDEU43	388	765813	AL161433	2782	1-596
HRDEU43	388	765813	AC068735	2783	1-659
HRDEU43	388	765813	AC044800	2784	1-101
HRDEU43	388	765813	AC021725	2785	1-679
HRDEU43	388	765813	AL009030	2786	1-116
HRDEU43	388	765813	AL161433	2787	1-596
HRDEU43	388	765813	AL161433	2788	1-213
HRDEU43	388	765813	AL135916	2789	1-664
HRDEU43	388	765813	AL161433	2790	1-213
HRDEU43	388	765813	AL133255	2791	1-2680
					2909-4366
					4651-5785
					5798-8014
					8020-11469
HRDEU43	388	765813	AL133255	2792	1-672
HRDEU43	388	765813	AL157879	2793	1-11071
HRDEU43	388	765813	AL021368	2794	1-104
HRDEU43	388	765813	AL021368	2795	1-664
HRDEU61	389	575566	AC040909	2796	1-403
HRDEU61	389	575566	AC020596	2797	1-426
HRDEU78	390	573031	AC004031	2798	1-1144
HRDEU78	390	573031	AC004031	2799	1-93
					2963-3611
					4073-4400
					5450-5677
					6354-6505
					7666-7726
					8063-8297
					8342-9068
					10411-10884
					11187-11272
					11986-12402
					13606-13851
					15238-15358
					16262-16453
					16496-16995
					17115-18395
					18440-19183
HRDEU78	390	573031	AC004031	2800	1-322
HRDEW90	395	574288	AC003077	2801	1-487
HRDEW90	395	574288	AC003077	2802	1-104
					456-579
					905-971
					1038-1354
					2379-2754
					2874-2985
					5130-5202
					6952-7023
HRDEW90	395	574288	AC003077	2803	1-317
HRDEZ60	399	919386	AL358781	2804	1-179
					427-883
					2033-2343
					2644-3466
					3901-6513
					6897-7077
					7651-7777
					8930-9046
					9640-9732
HRDEZ60	399	919386	AL160276	2805	1-146
					567-729
					776-1286
					1630-2424
					2523-2979
					4129-4439
					4740-5562
					5997-8610
					8991-9174
					9748-9874
					11027-11143
					11737-11830
					12258-12386
					12685-12776
					14133-14662
					15697-15794
					17888-17983
					19086-19125
HRDEZ60	399	919386	AL160276	2806	1-106
HRDEZ64	400	536668	AC023671	2807	1-372
HRDFB47	402	508001	AC020913	2808	1-688
HRDFB47	402	508001	AC020913	2809	1-696
HRDFB47	402	508001	AC020913	2810	1-325
HRDFB78	403	589478	AC015962	2811	1-233
					310-395
					960-1280
					1557-2072
					2206-2494
					2569-2818
					2979-3097
					3255-3441
					3612-4965
					5079-5476
HRDFB78	403	589478	AP002393	2812	1-234
					311-396
					961-1281
					1558-2073
					2207-2495
					2570-2819
					2980-3098
					3256-3442
					3613-4965
					5079-5476
HRDFB78	403	589478	AP002393	2813	1-128
HRDFC68	404	574205	AC031980	2814	1-1179
HRDFC68	404	574205	AL109851	2815	1-1179
HRDFC68	404	574205	AL109851	2816	1-357
HRDFE73	405	574142	AL121586	2817	1-454
HRDFE73	405	574142	AL139226	2818	1-452
HRDFE74	406	765750	AL117382	2819	1-2573
HRDFE74	406	765750	AL117382	2820	1-473
					547-956
HRDFG25	409	574433	AL157392	2821	1-132
					790-1110
					1296-1868
HRDFG25	409	574433	AL157392	2822	1-265
HRDFG37	410	792517	AC011922	2823	1-342
HRDFG37	410	792517	AC011922	2824	1-125
					2864-3688
					3709-4369
HRDFG46	411	574439	AL162711	2825	1-474
HRDFG46	411	574439	AL356752	2826	1-474
HRDFG46	411	574439	AC011695	2827	1-474
HRDFG46	411	574439	AL162711	2828	1-342
HRDFG46	411	574439	AL162711	2829	1-87
HRDFG46	411	574439	AL356752	2830	1-364
HRDFG46	411	574439	AC011695	2831	1-87
HRDFG46	411	574439	AL356752	2832	1-87
HRDFG46	411	574439	AC011695	2833	1-364
HRDFH14	412	575578	AC018665	2834	1-158
HRDFH14	412	575578	AC015801	2835	1-63
					453-778
					4523-4680
					5968-6112
					6637-6754
					7236-7304
					8220-8263
					8968-9017
					10646-10836
					10839-11211
					11761-11922
					12118-12230
					12547-13142
					13423-13926
					14192-14430
					14653-15104
					15264-15377
					15434-15969
					16518-16631
					16642-16758
					17442-17552
					18028-18204
					18449-18511
					19115-20053
					21297-21423
HRDFH14	412	575578	AC018665	2836	1-130
HRDFH14	412	575578	AC015801	2837	1-417
HRDFH24	413	575245	AL139013	2838	1-781
HRDFH24	413	575245	AL354953	2839	1-781
					852-1127
					1213-1311
					1403-1624
					1958-2075
					2167-2363
					2673-2786
					4006-4467
					4806-4837
HRDFH24	413	575245	AL139013	2840	1-276
HRDFH25	414	953882	AL136304	2841	1-292
					646-1026
					1500-1664
HRDFH25	414	953882	AL136304	2842	1-499
HRDFH25	414	953882	AL136304	2843	1-125
HRDFH39	415	574558	AC005079	2844	1-58
					168-398
					2136-2596
					4009-4424
					6946-7338
					7495-7617
					9290-9470
					12597-12947
					14399-14487
					17529-17581
					18389-18476
					19225-19699
					20108-20419
					21692-22122
					23411-23477
					25014-25104
					26516-26877
					27011-27457
					28855-28909
					29092-29282
					31251-31492
					31992-32485
HRDFH39	415	574558	AC005079	2845	1-2954
HRDFH39	415	574558	AC005079	2846	1-444
HRDFI13	417	574561	AC023876	2847	1-412
HRDFJ71	418	574553	AP001091	2848	1-446
HRDFJ71	418	574553	AP001091	2849	1-154
					245-346
					386-510
					519-903
					1419-1506
HRDFM18	421	574435	AL356321	2850	1-470
HRDFM18	421	574435	AC011692	2851	1-470
HRDFM18	421	574435	AL356321	2852	1-716
HRDFM18	421	574435	AC011692	2853	1-716
HRDFQ64	423	733847	AC025796	2854	1-273
HRDFQ64	423	733847	AC018638	2855	1-1347
					1588-1655
					1847-2885
					2995-3729
					3747-4192
					5291-5467
					5607-6427
					6453-6942
					7170-8109
					8162-8361
					8634-9418
					9463-11111
					11143-12777
					12930-15535
HRDFQ64	423	733847	AC005627	2856	1-1382
					1388-1474
					1510-1578
					1768-2801
					2912-3644
					3666-4106
					5212-5388
					5528-6348
					6373-6862
					7090-8029
					8082-8281
					8506-9338
					9383-11944
					11951-12483
					12512-12708
					13012-15362
HRDFQ64	423	733847	AC004987	2857	1-1363
					1369-1455
					1491-1558
					1757-2707
					2907-3642
					3660-4103
					5231-5407
					5547-6368
					6393-6885
					7114-7573
					7669-7881
					8109-8308
					8581-9173
					9404-11821
HRDFQ64	423	733847	AC018638	2858	1-946
HRDFQ64	423	733847	AC005627	2859	1-312
HRDFQ64	423	733847	AC005627	2860	1-210
					234-933
					942-1762
					2071-2302
					4137-5246
					5292-5549
HRDFQ64	423	733847	AC004987	2861	1-2357
HRDFQ64	423	733847	AC004987	2862	1-1370
HRDFQ75	424	525524	AL136332	2863	1-303
					455-868
					1310-1564
					2130-2482
					3623-3828
HRDFQ75	424	525524	AL132987	2864	1-302
					454-867
					1309-1563
					2129-2481
					3054-3086
					3756-3807
HRDFQ75	424	525524	AL136332	2865	1-163
HRDFQ75	424	525524	AL136332	2866	1-458
HRDFQ75	424	525524	AL132987	2867	1-163
HRDFQ75	424	525524	AL132987	2868	1-458
HRDFU48	429	573030	AC010193	2869	1-335
HRDFU48	429	573030	AC013252	2870	1-335
HRDFU48	429	573030	AC010193	2871	1-366
HRDFU48	429	573030	AC013252	2872	1-366
HSHAX53	430	518795	AC068497	2873	1-297
					898-1324
HSHAX53	430	518795	AC073936	2874	1-298
HSHAX53	430	518795	AC074283	2875	1-298
HSHAX53	430	518795	AC074283	2876	1-352
HSHAX53	430	518795	AC074283	2877	1-213
HSHBV66	431	523348	AC020921	2878	1-345
HSHBV66	431	523348	AC008908	2879	1-335
HSHBV66	431	523348	AC007554	2880	1-345
HSHBV67	432	529483	AL353777	2881	1-315
HSHBV67	432	529483	AL353777	2882	1-515
HSHCF34	433	529313	AL162404	2883	1-237
HSHCF34	433	529313	AC025990	2884	1-237
HSHCF34	433	529313	AL035415	2885	1-237
HSHCF34	433	529313	AL162404	2886	1-106
HSHCF34	433	529313	AC025990	2887	1-106
HSHCF34	433	529313	AL035415	2888	1-104
HSHCF34	433	529313	AL162404	2889	1-119
HSHCF34	433	529313	AC025990	2890	1-104
HSKCS36	434	529163	AC020884	2891	1-239
HSKCT33	435	866514	AC024714	2892	1-375
HSKCT33	435	866514	AC024714	2893	1-250
HSKEK63	439	744336	AL356734	2894	1-376
HSKEK63	439	744336	AL355388	2895	1-376
HSKEK63	439	744336	AL355388	2896	1-138
HSKEM02	440	969071	AL360170	2897	1-51
					4919-5083
					6145-6269
					6769-6852
					7424-7601
HSKEM02	440	969071	AL133355	2898	1-51
					4919-5083
					6145-6269
					6769-6852
					7424-7601
HSKET11	441	967000	AC022123	2899	1-433
HSKET11	441	967000	AC073689	2900	1-823
HSKIT38	444	855173	AL159994	2901	1-613
HSKIT38	444	855173	AL159994	2902	1-389
HSKJS05	445	930979	AC036191	2903	1-109
					274-433
					756-1187
					1853-2201
					2902-4963
HSKKD70	446	916984	AC020886	2904	1-592
HSKKD70	446	916984	AC008792	2905	1-569
HSKKL06	447	934040	AC006184	2906	1-659
HSKKL06	447	934040	AC006184	2907	1-562
HSKWA56	449	916496	AL357565	2908	1-437
HSKWA56	449	916496	AL357565	2909	1-529
HSKWA56	449	916496	AL357565	2910	1-101
HSKXG06	452	935455	AF189005	2911	1-385
HSKXG06	452	935455	AC027698	2912	1-385
HSKXG06	452	935455	AF189005	2913	1-442
HSKXG06	452	935455	AC027698	2914	1-442
HSKXJ15	453	866373	AL354751	2915	1-1031
HSKXJ15	453	866373	AC018554	2916	1-1046
HSKXJ15	453	866373	AL158080	2917	1-1051
HSKXJ15	453	866373	AL355148	2918	1-1051
HSKXJ15	453	866373	AL117340	2919	1-1051
HSKXJ15	453	866373	AC018554	2920	1-825
HSKXJ15	453	866373	AL354751	2921	1-455
HSKXJ15	453	866373	AL158080	2922	1-442
HSKXJ15	453	866373	AL158080	2923	1-722
HSKXJ15	453	866373	AL355148	2924	1-442
HSKXJ15	453	866373	AL355148	2925	1-722
HSKXJ15	453	866373	AL117340	2926	1-442
HSKXJ15	453	866373	AL117340	2927	1-722
HSKXP58	455	955073	AC007336	2928	1-424
					790-845
					2072-2312
					3699-3937
					4799-4957
					6084-6219
					6394-6569
					9325-9508
					10439-10620
					12486-12768
					13934-14087
					17716-17856
					19078-19243
					23566-23682
					24537-24930
					25444-25739
					26129-27483
HSKXP58	455	955073	AC007336	2929	1-265
HSKYG66	457	698007	AC062036	2930	1-507
HSKYG66	457	698007	AC062036	2931	1-286
HSKYG66	457	698007	AC062036	2932	1-360
HSKYH52	458	466574	AC021437	2933	1-31
					476-587
					1937-2394
					2732-3167
					3483-3664
HSKYH52	458	466574	AC021437	2934	1-282
HSKYH52	458	466574	AC021437	2935	1-333
HSKYJ96	459	921032	AC024502	2936	1-356
HSKYJ96	459	921032	AC024502	2937	1-885
					1599-2695
					2850-3162
HSKZE12	460	970639	AC023121	2938	1-129
HSKZE12	460	970639	AC023121	2939	1-211
HSKZE12	460	970639	AC023121	2940	1-144
HSKZE32	461	959400	AC012522	2941	1-905
					1075-1401
					1439-1665
					1702-2222
					2472-3734
HSKZE32	461	959400	AC006254	2942	1-216
					836-937
					1568-1787
					2544-2645
					2727-2779
					2799-3098
					5623-5715
					5962-6414
					7005-9162
					9332-9658
					9696-9922
					9959-10479
					10729-11991
HSKZE32	461	959400	AC012522	2943	1-322
HSKZE32	461	959400	AC012522	2944	1-1087
HSKZE32	461	959400	AC006254	2945	1-322
HSLAB77	462	772652	AC007392	2946	1-308
HSLAB77	462	772652	AC007392	2947	1-241
HSLAB77	462	772652	AC007392	2948	1-486
HSLBW19	464	671738	AC008443	2949	1-58
					372-819
					1181-1503
					1878-2106
					2630-5031
HSLBW19	464	671738	AL161615	2950	1-323
HSLBW19	464	671738	AC008620	2951	1-558
					2623-2750
					3090-3275
					3856-3989
					6489-6581
					6895-7342
					7704-8026
					8401-8629
					9153-11553
HSLBW19	464	671738	AL161615	2952	1-448
HSLBW19	464	671738	AC008443	2953	1-446
HSLBW19	464	671738	AC008620	2954	1-446
HSLBX08	465	959911	Z95152	2955	1-208
					419-902
					2123-2193
					5253-5361
					5517-5547
					5983-6029
					6154-6270
					6376-6450
					6770-7028
					7865-7945
					7967-8279
					8378-8555
					8794-9615
HSLBX08	465	959911	Z95152	2956	1-903
HSLBX20	466	574004	AC005922	2957	1-113
					538-968
					2413-2534
HSLBX20	466	574004	AC005922	2958	1-26
					2837-2907
					3657-3743
					4961-5086
					5993-6112
HSLBX20	466	574004	AC005922	2959	1-476
HSLBZ91	467	573987	AC016527	2960	1-304
HSLCB15	468	693455	AL022169	2961	1-1057
					1142-1998
HSLCB15	468	693455	AL022169	2962	1-273
HSLCJ46	469	529622	AL096677	2963	1-35
					175-254
					1355-1678
					3882-3987
					4912-4963
					5142-5217
HSLCJ46	469	529622	AL390037	2964	1-35
					175-254
					1355-1678
					3885-3982
					4912-4963
					5142-5217
HSLCJ46	469	529622	AL096677	2965	1-80
					2735-3511
					3742-4196
					5721-6250
HSLCJ46	469	529622	AL096677	2966	1-714
HSLCJ46	469	529622	AL390037	2967	1-714
HSLCJ46	469	529622	AL390037	2968	1-80
					3123-3512
					3603-4197
					5722-6251
HSLCJ47	470	908627	AL159994	2969	1-696
HSLCJ47	470	908627	AL159994	2970	1-241
HSLCL38	471	951028	AC024580	2971	1-246
HSLCP75	472	529631	AC074334	2972	1-139
					258-583
HSLDA25	474	679301	AC022123	2973	1-548
HSLDB29	475	866340	AC005517	2974	1-428
HSLDB29	475	866340	AC005517	2975	1-422
HSLDB29	475	866340	AC005517	2976	1-384
HSLDC06	476	936010	AC015589	2977	1-1110
HSLDC06	476	936010	AC010328	2978	1-1110
HSLDC06	476	936010	AC015589	2979	1-320
HSLDC06	476	936010	AC010328	2980	1-320
HSLDG13	477	913664	AC074219	2981	1-333
					477-952
HSLDI16	478	574014	AC009690	2982	1-1003
HSLDI16	478	574014	AC009690	2983	1-262
HSLDI16	478	574014	AC009690	2984	1-87
HSLDJ94	480	753657	AC068584	2985	1-554
HSLDJ94	480	753657	AC021215	2986	1-554
HSLDJ94	480	753657	AC068584	2987	1-883
					906-1442
					2137-2360
					2379-3586
HSLDJ94	480	753657	AC021215	2988	1-883
					906-1442
					1625-2050
					2136-2359
					2378-3585
					3764-4356
					4418-5605
					5759-6797
					7466-7550
HSLDJ94	480	753657	AC068584	2989	1-464
HSLDJ94	480	753657	AC021215	2990	1-464
HSLDM32	482	699486	AC074220	2991	1-366
HSLDM79	483	526740	AC018550	2992	1-342
HSLDM79	483	526740	AC034250	2993	1-433
HSLDM79	483	526740	AC020764	2994	1-433
HSLDM79	483	526740	AC020764	2995	1-257
HSLEC36	488	936003	AP000822	2996	1-407
HSLEC36	488	936003	AC008102	2997	1-413
HSLEC36	488	936003	AP000822	2998	1-390
HSLEC36	488	936003	AC008102	2999	1-390
HSLEC36	488	936003	AC008102	3000	1-254
HSLED42	490	572860	AC074219	3001	1-439
HSLED42	490	572860	AC074334	3002	1-366
HSLEJ22	495	572863	AC023237	3003	1-408
HSLEJ22	495	572863	AC023499	3004	1-408
HSLEJ22	495	572863	AC023237	3005	1-214
HSLEJ22	495	572863	AC023499	3006	1-214
HSLEJ22	495	572863	AC023237	3007	1-231
HSLEJ22	495	572863	AC023499	3008	1-231
HSLEL46	496	573212	AC073743	3009	1-176
HSLEL46	496	573212	AC020850	3010	1-281
HSLEL46	496	573212	AC073683	3011	1-276
					426-672
HSLEL46	496	573212	AC078911	3012	1-276
HSLEL46	496	573212	AC024582	3013	1-161
					173-284
					432-678
HSLEL46	496	573212	AC073683	3014	1-198
HSLEL46	496	573212	AC078911	3015	1-196
HSLEL46	496	573212	AC073743	3016	1-196
HSLEL46	496	573212	AC020850	3017	1-198
HSLEL46	496	573212	AC024582	3018	1-199
HSLFM86	500	785489	AC016160	3019	1-448
HSLFM86	500	785489	AC074220	3020	1-445
HSLFM86	500	785489	AC009031	3021	1-429
HSLFM86	500	785489	AC074220	3022	1-151
HSLFS42	501	948740	AC009844	3023	1-377
HSLFS42	501	948740	AC020850	3024	1-378
HSLFS42	501	948740	AC020873	3025	1-587
HSLFS45	502	717782	AC068768	3026	1-375
HSLFS45	502	717782	AC068768	3027	1-37
					165-259
					346-389
HSLFS45	502	717782	AC068768	3028	1-202
HSLFT76	503	725788	AC008693	3029	1-615
HSLFT76	503	725788	AC022123	3030	1-886
HSLFU01	505	916448	AC078912	3031	1-412
HSLFU01	505	916448	AC010357	3032	1-415
HSLFU01	505	916448	AC010357	3033	1-276
HSLGD23	506	675872	AC026761	3034	1-452
HSLGD23	506	675872	AC068494	3035	1-451
HSLGD23	506	675872	AC022123	3036	1-429
HSLGK79	508	774049	AC019047	3037	1-391
HSLGK79	508	774049	AC019047	3038	1-386
HSLGX20	510	669648	AP001524	3039	1-147
					1158-1621
HSLGX20	510	669648	AP001524	3040	1-147
HSLHP20	513	669210	AC020791	3041	1-427
HSLHP20	513	669210	AC020791	3042	1-89
HSLIG54	515	713982	AC025152	3043	1-439
					454-684
HSLII61	516	918071	AC017074	3044	1-1642
					1831-2269
					2356-3482
HSLII61	516	918071	AC017074	3045	1-378
HSLII61	516	918071	AC017074	3046	1-221
HSLIJ57	517	659533	AC068497	3047	1-506
HSLIJ57	517	659533	AC015817	3048	1-512
HSLJB11	518	966227	Z83844	3049	1-372
					1469-1781
					2529-2839
					3496-3656
					3731-3846
					4787-4930
					5149-5433
					6116-6202
					7067-9372
HSLJB11	518	966227	Z83844	3050	1-351
HSLJB11	518	966227	Z83844	3051	1-274
HSLJQ31	526	961447	AC008821	3052	1-557
HSLJQ31	526	961447	AC008511	3053	1-164
					351-836
					1683-2140
					2279-2469
					3331-3887
					4692-5352
					6418-7193
					8506-8604
					8913-9207
					9220-9522
					9781-10147
					10996-16123
HSLJQ31	526	961447	AC008821	3054	1-661
HSLJW53	527	866261	AP001495	3055	1-712
HSLJW53	527	866261	AC021527	3056	1-290
					1054-1348
					1697-2100
					2242-2953
					3485-3866
					4447-4756
					5347-5572
HSLJW53	527	866261	AP001031	3057	1-392
HSLJW53	527	866261	AC021527	3058	1-284
					862-894
HSLJW53	527	866261	AP001495	3059	1-404
HSLJW53	527	866261	AP001031	3060	1-403
HSLJW53	527	866261	AP001031	3061	1-121
HSRAX95	529	747078	AL132868	3062	1-125
					590-843
					1027-1154
					1675-2044
					2100-2449
					3073-3176
					4083-4263
					4616-4769
					4903-5110
					5987-7410
					8391-8663
					8964-9308
					9955-10064
					10564-10943
					11465-11991
					12772-13089
					13198-13772
					14016-14322
					14947-15596
					15607-16408
					17561-17863
					22453-23182
					23786-23925
					24209-24324
					25277-25604
					26333-26753
					27095-31132
HSRAX95	529	747078	AL132868	3063	1-791
					881-981
					1133-1401
					2093-2207
					3061-3150
					3393-3470
					3557-3687
					4140-4397
					5208-5297
					6997-7258
					8272-8678
					8835-8894
HSRAX95	529	747078	AL132868	3064	1-513
HSRDK92	534	838033	AC074012	3065	1-148
					1201-1273
HSRDK92	534	838033	AC024085	3066	1-148
					1201-1273
HSRDM42	536	523843	AC024704	3067	1-632
HSRDM42	536	523843	AC016683	3068	1-632
HSRDM42	536	523843	AC024704	3069	1-331
HSRDM42	536	523843	AC016683	3070	1-331
HSRDN23	537	530334	AC021300	3071	1-607
HSRDN23	537	530334	AC005703	3072	1-607
HSRDN23	537	530334	AC021300	3073	1-208
HSRDN23	537	530334	AC021300	3074	1-390
HSRDN23	537	530334	AC005703	3075	1-734
HSRDN23	537	530334	AC005703	3076	1-208
HSRDQ89	538	780221	AP001319	3077	1-471
					761-1159
					2076-2471
					3129-4172
					5710-6153
HSRDQ89	538	780221	AP000485	3078	1-471
HSRDQ89	538	780221	AP000485	3079	1-399
HSRDQ89	538	780221	AP001319	3080	1-790
HSRDQ89	538	780221	AP000485	3081	1-789
HSRDS77	539	530289	AC002059	3082	1-244
HSRDS77	539	530289	AC000026	3083	1-244
HSRDS77	539	530289	AC002059	3084	1-934
HSRDS77	539	530289	AC000026	3085	1-934
HSRDS77	539	530289	AC002059	3086	1-359
					574-891
					1253-1789
					1912-2029
					2681-2847
HSRDS77	539	530289	AC000026	3087	1-359
					574-678
					798-891
					1253-1789
					1912-2029
					2681-2847
HSREB43	540	524678	AC060805	3088	1-276
HSREB43	540	524678	AL356440	3089	1-276
HSREB43	540	524678	AC069107	3090	1-276
HSREB43	540	524678	AL356440	3091	1-476
HSREB43	540	524678	AC069107	3092	1-463
HSREB43	540	524678	AC060805	3093	1-248
HSREB43	540	524678	AL356440	3094	1-248
HSREB43	540	524678	AC069107	3095	1-248
HSRED45	542	530233	AP000442	3096	1-110
					1671-1833
					2258-2541
					2656-3699
					3792-3942
					4306-6277
HSREG49	545	723267	AC018729	3097	1-217
HSREG49	545	723267	AC019250	3098	1-217
HSREG49	545	723267	AC007734	3099	1-219
HSREG49	545	723267	AC024119	3100	1-217
HSREG49	545	723267	AL049715	3101	1-217
HSREG49	545	723267	AC019250	3102	1-390
HSREG49	545	723267	AC007734	3103	1-468
HSREG49	545	723267	AC019250	3104	1-468
HSREG49	545	723267	AC024119	3105	1-468
HSREG49	545	723267	AC024119	3106	1-390
HSREG49	545	723267	AL049715	3107	1-468
HSREG49	545	723267	AL049715	3108	1-390
HSRFD34	547	575288	AP001780	3109	1-145
HSRFD34	547	575288	AL391069	3110	1-170
HSRFD34	547	575288	AC073120	3111	1-301
HSRFD34	547	575288	AL359892	3112	1-583
					1605-1880
					2039-2153
					2927-3485
					3613-3918
					4038-4641
					4679-5013
					5296-5749
HSRFD34	547	575288	AL353759	3113	1-442
					642-976
					1259-1712
HSRFD34	547	575288	AL359892	3114	1-100
HSRFD34	547	575288	AL353759	3115	1-306
HSRFD34	547	575288	AL359892	3116	1-384
HSRFD34	547	575288	AL353759	3117	1-1110
HSRFD47	548	973782	AL138891	3118	1-514
HSRFD47	548	973782	AC002418	3119	1-513
HSRFD47	548	973782	AC004386	3120	1-513
HSRFD47	548	973782	AL138891	3121	1-324
HSRFD47	548	973782	AL138891	3122	1-259
HSRFD47	548	973782	AC002418	3123	1-247
HSRFD47	548	973782	AC002418	3124	1-324
HSRFD47	548	973782	AC004386	3125	1-326
HSRFE58	549	556519	AL359317	3126	1-361
HSRFE58	549	556519	AL359317	3127	1-469
HSRFG30	551	920265	AC074389	3128	1-301
HSRFG30	551	920265	AC074389	3129	1-134
HSRFR21	552	529767	AC068147	3130	1-530
					887-1024
					1825-1890
					1972-2110
					2349-3981
HSRFR21	552	529767	AL355075	3131	1-530
					887-1024
					1825-1890
					1972-2110
					2349-3981
HSRFR21	552	529767	AC068147	3132	1-312
HSRFR21	552	529767	AL355075	3133	1-37
					3559-3797
					4958-5393
					5832-6145
HSRFZ71	553	557976	AC012321	3134	1-371
HSRFZ71	553	557976	AC009032	3135	1-424
HSRFZ71	553	557976	AC012321	3136	1-183
HSRFZ71	553	557976	AC009032	3137	1-117
HSRGA32	554	529726	AC023038	3138	1-651
					2271-3138
HSRGE47	556	974539	AC073835	3139	1-618
HSRGE47	556	974539	AC067884	3140	1-618
HSRGE47	556	974539	AL035404	3141	1-618
HSRGE47	556	974539	AL033526	3142	1-618
HSRGE47	556	974539	AC073835	3143	1-498
HSRGE47	556	974539	AC067884	3144	1-498
HSRGE47	556	974539	AC073835	3145	1-115
HSRGE47	556	974539	AC067884	3146	1-105
HSRGE47	556	974539	AL035404	3147	1-112
HSRGE47	556	974539	AL035404	3148	1-498
HSRGE47	556	974539	AL033526	3149	1-542
HSRGE47	556	974539	AL033526	3150	1-498
HSRGG66	557	556518	AL359317	3151	1-361
HSRGG66	557	556518	AL359317	3152	1-469
HSRGK48	558	535012	AC021704	3153	1-333
					585-958
					1261-2724
					3008-5183
HSRGK48	558	535012	AP000926	3154	1-1742
HSRGK48	558	535012	AC021704	3155	1-216
HSRGK48	558	535012	AP000926	3156	1-133
HSRGK48	558	535012	AC021704	3157	1-302
HSRGQ30	559	534479	AC019290	3158	1-958
					1145-1459
					2194-2545
					5158-5806
					5881-6559
					6817-7280
					9590-11032
					15003-15425
					15440-16134
					16243-17784
HSRGQ30	559	534479	AC019290	3159	1-861
HSRGQ30	559	534479	AC019290	3160	1-106
HSRGS08	560	960211	AC025237	3161	1-313
HSRGS08	560	960211	AC068820	3162	1-294
HSRGS08	560	960211	AC007512	3163	1-313
HSRGS08	560	960211	AC025237	3164	1-170
HSRGV79	561	921005	AL358572	3165	1-347
HSRGV79	561	921005	AL358572	3166	1-272
HSRGW30	562	529624	AC048334	3167	1-443
HSRGW30	562	529624	AC048334	3168	1-590
HSRGZ32	563	699561	AC025360	3169	1-357
HSRGZ32	563	699561	AC025360	3170	1-357
HSRGZ32	563	699561	AL357392	3171	1-297
					1639-2093
					2352-2848
					4569-4713
					4984-5109
					11452-11932
					13121-13288
					13549-13645
					13652-13839
					15524-15838
					16857-18913
					20337-21103
					21352-21708
					22110-22238
					22247-22869
					22965-23776
					23788-23974
					24046-24148
					26447-27494
					30722-30802
					31268-31671
					32004-32170
					32357-32872
					33172-33626
					34576-34976
					34979-35314
					35835-35960
					37121-37649
					38879-38931
					39519-39903
					41171-41423
					42238-42335
					42757-42896
					43312-43990
					44539-44733
					45461-46240
HSRGZ32	563	699561	AL136373	3172	1-357
					759-1545
HSRGZ32	563	699561	AL357392	3173	1-1942
HSRGZ32	563	699561	AL136373	3174	1-767
HSRGZ32	563	699561	AL136373	3175	1-812
HSRHA45	564	974551	AP002474	3176	1-293
					1734-2394
HSRHA45	564	974551	AC017100	3177	1-293
					1736-2380
HSRHA45	564	974551	AC017100	3178	1-295
HSSAE47	565	720685	AL354800	3179	1-399
HSSAE47	565	720685	AL354800	3180	1-2674
HSSAF46	566	508117	AL389915	3181	1-340
HSSAV18	569	508832	AC022827	3182	1-255
HSSAV18	569	508832	AC021755	3183	1-241
HSSAV18	569	508832	AC025429	3184	1-254
HSSAV18	569	508832	AC022827	3185	1-223
HSSAV18	569	508832	AC025429	3186	1-223
HSSBO48	571	871217	AC021150	3187	1-361
					534-773
HSSBO48	571	871217	AC010868	3188	1-652
HSSBO59	572	707683	AC010494	3189	1-6900
					7239-7739
HSSBO59	572	707683	AC010494	3190	1-88
HSSDJ02	574	871226	AL035681	3191	1-339
					570-635
HSSDJ02	574	871226	AL035681	3192	1-274
HSSDR63	577	537329	AC027775	3193	1-344
HSSDR63	577	537329	AC006071	3194	1-1724
					27970-28313
HSSDR63	577	537329	AC002092	3195	1-344
HSSDR63	577	537329	AC027775	3196	1-131
					463-743
					2009-2872
HSSDR63	577	537329	AC006071	3197	1-366
					595-1143
					1448-1878
HSSDR63	577	537329	AC006071	3198	1-181
					496-644
					3728-3863
					26357-26487
					26819-27099
					28365-29228
HSSDR63	577	537329	AC002092	3199	1-108
					437-717
					1984-2853
HSSED56	579	625572	AC016217	3200	1-472
HSSED56	579	625572	AC074059	3201	1-466
HSSED56	579	625572	AC074059	3202	1-357
HSSEF29	580	689837	AC008871	3203	1-570
HSSEF29	580	689837	AC034207	3204	1-570
HSSEF29	580	689837	AC008871	3205	1-279
HSSEF29	580	689837	AC008871	3206	1-760
HSSEF29	580	689837	AC034207	3207	1-760
HSSEF29	580	689837	AC034207	3208	1-276
HSSEK75	581	766507	AC024895	3209	1-422
HSSEK75	581	766507	AC024895	3210	1-116
HSSFF80	585	753589	AC008969	3211	1-514
					1300-1805
					2627-2795
					3012-3127
					3212-3649
					3737-4319
HSSFF80	585	753589	AC008969	3212	1-372
HSSFQ43	586	715318	AC007367	3213	1-405
HSSFQ43	586	715318	AC007367	3214	1-179
HSSFR41	587	707006	AC022554	3215	1-352
HSSFR41	587	707006	AC022554	3216	1-201
					593-712
					1881-2119
HSSGC66	590	319740	AL138932	3217	1-741
HSSGC66	590	319740	AL138932	3218	1-90
					595-734
					881-1278
					1536-1738
HSSGC72	591	760648	AC024698	3219	1-336
HSSGD37	592	739505	AL049569	3220	1-82
					275-341
					1841-1977
					2063-2139
					2194-2691
					5080-5358
					5882-5991
					6077-6125
					6212-6453
					7213-7705
					8540-8750
					9481-9914
					9974-10134
					10248-10369
					10517-10947
					11237-11378
					12087-12252
					12375-12492
					12604-12686
					13449-13596
					13860-14052
					14140-14239
					15107-15333
					15420-15572
					15744-15914
					16014-16419
					16727-16993
					19574-19616
HSSGD37	592	739505	AL049569	3221	1-66
					84-587
					615-747
					1028-1293
HSSGD37	592	739505	AL049569	3222	1-44
					726-974
					3244-3325
					4341-4452
					4637-4911
					5009-5327
					5626-6112
					6215-6292
					6536-7067
HSSGH47	593	720367	AC022702	3223	1-363
HSSGH47	593	720367	AC022702	3224	1-519
HSSGH47	593	720367	AC022702	3225	1-317
					1555-1819
HSSGI20	594	668919	AC021706	3226	1-347
HSSGI20	594	668919	AL136450	3227	1-347
HSSGI20	594	668919	AC021706	3228	1-464
HSSGI20	594	668919	AL136450	3229	1-464
HSSGI75	595	767325	AL139383	3230	1-360
HSSGI75	595	767325	AL138999	3231	1-360
HSSGK96	597	960636	AC020917	3232	1-388
HSSGK96	597	960636	AC020917	3233	1-149
HSSGL78	599	788924	AC005841	3234	1-3246
					4046-4159
					5174-5965
					7066-7244
					7431-7504
					8084-8427
					8694-8902
					9077-9497
					9523-9904
					10260-10424
					11181-11505
					11877-12297
					12756-12874
					14112-14459
					14847-14996
					15082-15195
					16726-17286
HSSGL78	599	788924	AC005841	3235	1-693
HSSGM62	600	707685	AC064828	3236	1-65
					2182-2642
					3222-3329
					3645-3854
					4263-4601
					5303-7155
					8825-9100
					9711-9935
					10619-10701
					11474-11616
					11874-12030
					13114-13218
					13874-14248
					14325-14414
					14931-15123
					15201-15745
HSSGM62	600	707685	AC064828	3237	1-224
HSSGN47	601	707003	AC022315	3238	1-62
					305-1003
HSSGN47	601	707003	AC022315	3239	1-426
HSSHA92	602	792714	AC023063	3240	1-724
					973-1276
					1397-2502
					2614-3602
					3807-4452
					5922-6379
					6627-7572
					7734-8858
					9293-9552
					9731-9814
					9877-10090
					10212-11155
					11222-12167
HSSHA92	602	792714	AC023063	3241	1-141
HSSJV60	606	970749	AL390920	3242	1-431
HSSJV60	606	970749	AL390920	3243	1-583
HSSKB40	607	711130	Z83844	3244	1-372
					1469-1781
					2529-2839
					3496-3656
					3731-3846
					4787-4930
					5149-5433
					6116-6202
					7067-9372
HSSKB40	607	711130	Z83844	3245	1-351
HSSKB40	607	711130	Z83844	3246	1-274
HSSMT78	608	712468	AP001473	3247	1-138
					675-1422
					1573-1870
HSSMT78	608	712468	AP001101	3248	1-748
					899-1196
					1239-1713
HSSMT78	608	712468	AP001473	3249	1-259
HYBAE74	609	925074	AC006121	3250	1-76
					283-455
					1081-2096
					2241-2468
					3824-3881
					4776-4998
					5882-6048
					7438-7572
					8605-8867
					8905-9483
					9616-9748
					10809-11421
					12429-12580
					12991-13310
					14224-14404
					15332-16217
					18288-18453
					18666-19007
					19613-20374
					20936-21073
					21639-22085
					22088-22332
					22816-22950
					24715-24977
					25733-26161
					26930-27124
					27348-27453
					28458-28682
					28764-28863
					31423-31717
					32555-32715
					32956-33127
					33269-33545
					33919-34319
					36103-38140
HYBAE74	609	925074	AL109797	3251	1-76
					283-455
					1081-2096
					2241-2468
					2777-2914
					3824-3881
					4776-4998
					5882-6048
					7438-7572
					8605-8867
					8905-9483
					9614-9744
					10810-11422
					12430-12580
					12992-13311
					14225-14405
					15333-16218
					18289-18454
					18667-19008
					19614-20375
					20937-21074
					21640-22086
					22089-22333
					22817-22951
					25734-26162
					26931-27125
					27349-27454
					28228-28352
					28459-28683
					28765-28864
					31425-31718
					32476-32792
					32957-33128
					33270-33546
					33920-34321
					35214-35796
					36099-38136
HYBAE74	609	925074	AL109797	3252	1-108
HYBAE74	609	925074	AL109797	3253	1-112
HYBAG11	610	967880	AC018381	3254	1-203
HYBAG11	610	967880	AC007734	3255	1-203
HYBAG11	610	967880	AL049715	3256	1-490
HYBAG11	610	967880	AC024119	3257	1-204
HYBAG11	610	967880	AC007734	3258	1-446
HYBAG11	610	967880	AL049715	3259	1-444
HYBAG11	610	967880	AL049715	3260	1-2160
HYBAG11	610	967880	AC024119	3261	1-444
HYBAU83	611	732419	AL353793	3262	1-133
HYBAY40	613	531202	AC022364	3263	1-385
HYBBB24	614	584989	AC024906	3264	1-488
HYBBI18	615	584991	AC073460	3265	1-339
HYBBI18	615	584991	AL354945	3266	1-339
HYBBI18	615	584991	AL355292	3267	1-339
HYBBI18	615	584991	AL355292	3268	1-784
HYBBI18	615	584991	AL354945	3269	1-192
					214-889
HYBBI18	615	584991	AL355292	3270	1-192
					214-889
HYBBJ30	616	693345	AC011973	3271	1-2411
HYBBJ30	616	693345	AC016999	3272	1-2448
HYBBJ30	616	693345	AC011973	3273	1-1242
HYBBJ30	616	693345	AC016999	3274	1-777
HYBBL17	617	691328	AC027074	3275	1-1214
					1541-2851
HYBBL17	617	691328	AC027074	3276	1-503
HYBAY92	620	792923	AC006095	3277	1-443
					460-925
HYBAY92	620	792923	AC012470	3278	1-443
					460-925
HYBAW03	621	925068	AP001628	3279	1-339
HYBAW03	621	925068	AP001628	3280	1-78
					88-287
HYBAW03	621	925068	AP001628	3281	1-1050
HYBAF63	624	745585	AC022188	3282	1-616
HYBAF63	624	745585	AC022188	3283	1-523
HSSMZ93	625	530752	AL365272	3284	1-593
HSSMZ93	625	530752	AL035696	3285	1-593
HSSMW90	627	975081	AL360017	3286	1-734
					1885-2084
					2683-2777
					2921-2978
HSSMW90	627	975081	AC026576	3287	1-734
					1885-2084
					2683-2777
					2921-2978
HSSMW90	627	975081	AL035413	3288	1-734
					1876-2075
					2674-2768
					2912-2969
HSSMT76	628	928421	AC023864	3289	1-142
HSSMT76	628	928421	AC010550	3290	1-127
HSSMT76	628	928421	AL117190	3291	1-102
					2590-2699
					2915-9959
					10043-10287
					13264-13656
					15305-15737
					17026-17496
					18233-18688
					19340-19416
					19587-21391
					21539-24538
					25521-25888
					26530-28357
					28626-29805
					29835-30529
					30546-31506
					33033-34910
HSSMT76	628	928421	AC023864	3292	1-3115
					3220-4704
HSSMT76	628	928421	AL117190	3293	1-441
HSSMT70	629	530758	AC018546	3294	1-735
HSSMT70	629	530758	AC018546	3295	1-189
HSSMP20	630	854092	AC022784	3296	1-377
HSSJP81	633	911334	AC023133	3297	1-126
					276-308
					1686-1833
					4690-4918
					5836-6297
					6805-7376
					8288-8522
					8528-9952
					10213-10496
					10505-11457
					11505-13731
					14167-14297
					14407-14572
					15189-15243
					16434-16536
					17286-17446
					18631-18739
					19790-19945
					20293-20475
					20724-20848
					21136-21270
					22395-22470
					24078-24251
					24582-24791
					24797-25044
					26412-26845
					26967-27066
					27787-28134
					28454-28520
					29195-30013
HSSJK65	635	747891	AC024293	3298	1-911
HSSJK65	635	747891	AC024293	3299	1-83
HSSJK65	635	747891	AC024293	3300	1-369
HSSJH78	636	773558	AC025637	3301	1-136
					557-2246
					2282-2427
					2717-2843
					2949-3739
					3823-4409
					4880-6134
HSSJH78	636	773558	AC024225	3302	1-1255
HSSJH78	636	773558	AC055707	3303	1-489
HSSJH78	636	773558	AC024225	3304	1-177
HSSJH78	636	773558	AC055707	3305	1-177
HSSJH78	636	773558	AC025637	3306	1-177
HSSJH78	636	773558	AC024225	3307	1-145
					433-559
					665-1455
					1539-2125
HSSJA08	637	959336	AC026543	3308	1-1000
					1171-1630
					2138-2439
					2590-3651
HSSJA08	637	959336	AC058799	3309	1-673
HSSJA08	637	959336	AC026543	3310	1-451
HSSGJ84	639	781975	AC023014	3311	1-65
					1437-1596
					1951-2373
					2381-2579
					2587-2748
					3063-3531
					3761-5598
					5758-6269
					6338-7043
					8097-8460
					9089-9348
					9365-10612
HSSGJ84	639	781975	AL161635	3312	1-469
HSSGJ84	639	781975	AL139400	3313	1-65
					1437-1596
					1960-2372
					2380-2578
					2586-2747
					3062-3530
					3760-5597
					5757-6268
					6337-7352
					8100-8463
					9091-9350
					9367-10614
HSSGJ84	639	781975	AC023014	3314	1-195
HSSGJ84	639	781975	AC023014	3315	1-1632
HSSGJ84	639	781975	AL161635	3316	1-162
HSSGJ84	639	781975	AL139400	3317	1-195
HSSGJ84	639	781975	AL139400	3318	1-1632
HSSFW84	643	781973	AC004590	3319	1-126
					4595-5120
					5544-5846
HSSFW84	643	781973	AC021491	3320	1-126
					4596-5122
					5546-5848
HSSFW84	643	781973	AC004590	3321	1-363
					528-624
					1405-1605
					1762-2101
					3675-4861
					4937-5153
					5209-5321
					5476-6047
					6368-6572
					6665-6815
					6882-7049
					7237-7358
					7400-7575
					7693-7815
					8090-8192
					8405-8680
HSSFW84	643	781973	AC021491	3322	1-363
					528-624
					1403-1603
					1760-2099
					3673-4859
					4935-5151
					5207-5319
					5474-6045
					6366-6570
					6663-6813
					6880-7047
					7235-7356
					7398-7573
					7691-7813
					8088-8190
					8403-8677
HSSFU84	644	888462	Z82214	3323	1-554
HSSFU84	644	888462	Z82214	3324	1-468
HSSFU84	644	888462	Z82214	3325	1-37
					826-1969
					3475-3813
HSSFN08	645	959735	AF031078	3326	1-1820
HSSFN08	645	959735	AF030876	3327	1-1820
HSSFN08	645	959735	AF031075	3328	1-1820
HSSFN08	645	959735	AF031078	3329	1-171
HSSFN08	645	959735	AF031078	3330	1-403
HSSFN08	645	959735	AF030876	3331	1-171
HSSFN08	645	959735	AF031075	3332	1-171
HSSFN08	645	959735	AF030876	3333	1-403
HSSFN08	645	959735	AF031075	3334	1-403
HSSFK90	646	788687	Z93014	3335	1-587
HSSFK90	646	788687	AL121601	3336	1-368
					1848-2434
HSSFK90	646	788687	AL121601	3337	1-617
HSSFB73	647	955200	AC022222	3338	1-504
HSSFB73	647	955200	AC007537	3339	1-374
HSSFB73	647	955200	AC007537	3340	1-288
HSSEU40	648	891055	AL137253	3341	1-1147
HSSEU40	648	891055	AL356299	3342	1-994
HSSEU40	648	891055	AL137253	3343	1-276
HSSEU40	648	891055	AL356299	3344	1-276
HSSEU40	648	891055	AL356299	3345	1-125
HSSEP69	649	871211	AC069454	3346	1-380
HSSEP69	649	871211	AC069454	3347	1-498
HSSEG25	651	679351	Z83845	3348	1-504
					658-707
					1786-3045
					3351-4099
HSSEG25	651	679351	Z83845	3349	1-134
					492-798
					1739-1873
					2345-2537
					2704-2846
					3729-3841
					4515-4623
					6820-6962
					8496-8600
					9505-10043
					10660-10776
					11694-11920
					13014-13175
					14177-14195
					14510-16877
HSSEG25	651	679351	Z83845	3350	1-684
HSSDH37	656	575460	AC012645	3351	1-198
					3475-3669
					3852-3972
					4235-4359
					4732-4864
					5008-5124
					5225-5405
					5625-5969
					6143-6258
					6374-6421
					6906-7032
					7306-8679
					8955-8999
					9225-9361
					9451-9491
					9590-9712
					9797-9886
					10489-10631
					10718-11123
					11611-11742
					12900-13178
					13587-13646
					13755-13808
HSSDH37	656	575460	AC012645	3352	1-102
HSSDH37	656	575460	AC012645	3353	1-377
HSSCC14	658	600216	AC010203	3354	1-1677
					2250-3207
					3870-4245
					4249-5488
					6198-6240
					6837-6924
					7178-7390
					7472-7755
					7836-8511
					10534-10971
					11857-12094
					13226-13689
					13754-15275
					16452-16747
HSSCC14	658	600216	AC010203	3355	1-48
					239-1330
HSSCC14	658	600216	AC010203	3356	1-101
HSSAZ04	659	933015	AC027783	3357	1-1623
HSSAZ04	659	933015	AC027576	3358	1-3083
					3314-3536
					3565-4033
HSSAZ04	659	933015	AC005768	3359	1-1734
HSSAZ04	659	933015	AC027783	3360	1-1467
HSSAZ04	659	933015	AC027576	3361	1-759
HSSAZ04	659	933015	AC027576	3362	1-300
HSSAZ04	659	933015	AC005768	3363	1-460
					824-1439
					3142-3504
					3774-6883
HSSAZ04	659	933015	AC005768	3364	1-1314
					1545-1767
					1796-2264
HSSAY34	660	703345	AL138932	3365	1-2635
HSSAY34	660	703345	AL138932	3366	1-308
HSSAJ89	662	875882	AP002776	3367	1-1505
					1576-1638
					1725-2468
					2580-2670
					2740-2899
					3033-3576
					3635-4235
HSSAJ89	662	875882	AP001885	3368	1-160
					294-837
					896-1496
HSSAJ89	662	875882	AP001885	3369	1-91
HSRAY10	665	961237	AC021441	3370	1-696
HSRAY10	665	961237	AC009908	3371	1-696
HSRAS82	666	780222	U73168	3372	1-66
					273-3210
					3587-3673
					3859-5330
					5564-5736
					6777-6884
					7014-7581
					8079-8158
					8239-8314
					9254-9356
					9595-10142
					10389-10474
					10689-11491
					11670-12184
					12238-13548
					13949-14101
					14179-14873
					15079-15168
					15181-15801
					15905-16167
					16535-16718
					16934-18966
HSRAS82	666	780222	U73168	3373	1-1130
HSRAF70	667	524680	AC053513	3374	1-28
					1617-1660
					3033-3127
					4677-4779
					5039-6378
					8362-8557
					10265-11200
					14774-14940
					18361-18501
					20445-20509
					20542-20996
					21185-21285
					21764-21855
					22332-22430
					23457-23543
					23635-24413
					24752-25169
					27477-27906
					28690-29213
					29550-30031
					32052-32497
					32648-33369
					34122-34768
					35360-36282
					39205-39354
					43359-44706
HSRAD72	669	539530	AC048337	3375	1-110
					147-669
HSRAD72	669	539530	AC048337	3376	1-176
HSRAD65	670	871268	AF128834	3377	1-979
					1451-1781
					1817-2962
HSRAD65	670	871268	AF128834	3378	1-195
					1123-1226
					1250-1367
					2556-2701
HSRAD65	670	871268	AF128834	3379	1-784
HSRAD53	671	525490	AL353672	3380	1-316
HSRAD53	671	525490	AC026573	3381	1-316
HSRAD53	671	525490	AL353588	3382	1-316
HSRAD53	671	525490	AL353672	3383	1-523
HSRAD53	671	525490	AC026573	3384	1-526
HSRAD53	671	525490	AL353588	3385	1-526
HSRAD31	673	524845	AC073662	3386	1-247
HSRAD31	673	524845	AP001965	3387	1-247
HSRAD31	673	524845	AC073662	3388	1-1268
HSRAD31	673	524845	AP001965	3389	1-1268
HSRAD10	674	968614	AC018804	3390	1-814
					1343-1452
					1467-1598
					2200-2386
					2433-2474
					4962-5052
					6603-6691
					7946-8094
					8249-8326
					8703-8816
					8926-8978
					9101-9255
					9847-10219
					10951-11510
					11979-12884
					14012-14140
					14282-14371
					17152-17200
HSRAD10	674	968614	AC018804	3391	1-899
					1121-1456
HSRAB87	676	823174	AP000729	3392	1-324
HSRAB82	677	522945	AL031733	3393	1-390
HSRAB82	677	522945	AL031733	3394	1-342
HSRAB76	678	508105	AL359476	3395	1-1292
HSRAB76	678	508105	AL356216	3396	1-286
					1366-2105
					2178-2289
					2920-4211
					4585-4674
HSRAB76	678	508105	AL356216	3397	1-121
HSRAB76	678	508105	AL359476	3398	1-286
					1364-2103
					2176-2286
HSRAB36	679	522946	AC011332	3399	1-379
HSRAB36	679	522946	AC005352	3400	1-379
HSRAB36	679	522946	AC011332	3401	1-329
HSRAB36	679	522946	AC005352	3402	1-329
HSRAB36	679	522946	AC005352	3403	1-189
HSRAB34	680	706996	AC068641	3404	1-298
					389-1077
					1855-2384
					3111-3469
					3930-4264
					4638-4788
					6878-6963
					7577-7613
					8676-8837
					10894-11198
					12629-13341
					13502-13744
					15053-15295
HSRAB34	680	706996	AC068641	3405	1-558
HSRAB08	681	960411	AC011406	3406	1-210
HSRAB08	681	960411	AC011406	3407	1-534
HSRAA64	684	955314	AL132838	3408	1-756
HSRAA64	684	955314	AC005924	3409	1-756
HSRAA51	685	522834	AC024243	3410	1-345
HSRAA51	685	522834	AC024243	3411	1-356
HSRAA24	688	795855	AP000437	3412	1-2275
HSRAA24	688	795855	AC006410	3413	1-174
					873-953
					1050-1077
					1669-3953
HSRAA24	688	795855	AP000437	3414	1-575
HSRAA24	688	795855	AC006410	3415	1-448
					911-1015
HSRAA23	689	524795	AC021586	3416	1-410
HSLKB37	691	929743	AL161799	3417	1-718
HSLKB37	691	929743	AL161799	3418	1-431
HSLKB37	691	929743	AL161799	3419	1-456
HSLKA06	692	934638	AP000594	3420	1-330
					693-1279
					1618-3031
HSLKA06	692	934638	AP001879	3421	1-330
					693-1279
					1618-3065
HSLKA06	692	934638	AP002500	3422	1-330
					693-1279
					1618-3063
HSLKA06	692	934638	AP000594	3423	1-129
HSLKA06	692	934638	AP001879	3424	1-436
HSLKA06	692	934638	AP001879	3425	1-129
HSLKA06	692	934638	AP002500	3426	1-129
HSLKA06	692	934638	AP002500	3427	1-436
HSLJF33	694	938811	AC022123	3428	1-577
					587-898
HSLJF33	694	938811	AC008602	3429	1-577
HSLJD02	695	965826	AC025288	3430	1-904
HSLIJ48	696	721248	AL138792	3431	1-2086
HSLIJ48	696	721248	AL138792	3432	1-280
HSLIG07	697	952493	AL355520	3433	1-39
					3561-3618
					7841-7949
					10375-11270
					11589-11678
					15048-15690
					16028-16134
					18215-18476
					20699-20733
					23616-23861
					30319-35764
HSLIG07	697	952493	AL355520	3434	1-386
HSLIG07	697	952493	AL355520	3435	1-437
HSLHZ82	700	779067	AC026149	3436	1-537
HSLHZ82	700	779067	AC026149	3437	1-625
HSLHG49	703	722570	AC019335	3438	1-442
HSLHG49	703	722570	AC008716	3439	1-142
HSLHG49	703	722570	AC019335	3440	1-309
					863-1408
HSLHG49	703	722570	AC019335	3441	1-302
					1212-1582
HSLHG49	703	722570	AC008716	3442	1-309
					863-1408
HSLHG49	703	722570	AC008716	3443	1-302
					1212-1582
HSLHC40	704	710681	AF233070	3444	1-434
HSLHC40	704	710681	AF233070	3445	1-373
HSLGN78	709	773565	AC019171	3446	1-127
					342-897
					1993-2259
					3055-3372
					3423-4048
					4089-4277
					4324-6037
					6069-8876
					9013-9740
					9791-9906
					10195-10899
					11064-13605
HSLGN78	709	773565	AC019171	3447	1-2093
HSLGN78	709	773565	AC019171	3448	1-739
					2715-2831
					3005-3561
HSLGN52	710	466026	AC023339	3449	1-63
					297-528
					1493-1596
					1818-2263
					3318-3424
					3727-3831
					3969-5442
					6232-6460
					6510-6993
					7378-7695
					7872-7910
					8145-8265
					8574-8985
					9173-9375
HSLGK46	711	719031	AC009185	3450	1-155
					997-1253
					2053-2148
					3496-4043
					7024-7126
					9004-9098
					10407-10717
					10930-11047
HSLGK46	711	719031	AC009185	3451	1-534
HSLGK23	713	675266	AC013713	3452	1-764
HSLGK23	713	675266	AL157820	3453	1-443
HSLGK23	713	675266	AC013713	3454	1-1289
					2601-3182
					3702-4241
					6170-8487
HSLGK23	713	675266	AL157820	3455	1-514
HSLGI76	715	770035	AC068404	3456	1-659
					762-1460
HSLGI76	715	770035	AC068404	3457	1-405
HSLGH70	717	871888	AL133330	3458	1-5227
HSLGH70	717	871888	AL133330	3459	1-619
HSLGG79	719	775146	AC003086	3460	1-403
					677-1512
HSLGG79	719	775146	AC003086	3461	1-399
HSLGA79	720	774051	AC016961	3462	1-505
HSLGA79	720	774051	AC016961	3463	1-291
HSLGA79	720	774051	AC016961	3464	1-148
HSLGA24	722	955333	AC074219	3465	1-807
HSLFU18	723	666405	AC008154	3466	1-3538
HSLFU18	723	666405	AC018646	3467	1-2673
HSLFU18	723	666405	AC008154	3468	1-116
					3689-3797
					4628-4674
					7369-7452
					7659-7721
					9183-9329
					9883-10172
					11683-12183
					13014-13093
					14304-14396
					14402-15694
					15738-16337
HSLFT29	724	680451	AC022123	3469	1-584
HSLFI01	726	876881	AL049611	3470	1-1354
					1780-1884
					2174-2318
					3163-3327
					4645-10514
HSLFI01	726	876881	AL049611	3471	1-617
HSLFI01	726	876881	AL049611	3472	1-89
					350-654
HSLDW24	729	779689	AC073992	3473	1-860
HSLDW24	729	779689	AC005082	3474	1-846
					1190-1616
					1818-2495
					2513-2795
					3162-3896
					4168-6088
					7406-7663
					7675-7765
					8981-9162
					10202-11061
					11082-11558
					11572-12787
					12822-12981
					13008-13158
					13466-13960
					15708-15956
					17748-17924
					18094-18231
					18295-18381
					18409-18765
					18804-19172
HSLDW24	729	779689	AC073992	3475	1-1701
HSLDW24	729	779689	AC073992	3476	1-182
HSLDW24	729	779689	AC005082	3477	1-232
HSLDR18	731	578926	AC022123	3478	1-417
HSLDR05	732	932128	AC020850	3479	1-900
HSLDR05	732	932128	AC009091	3480	1-390
HSLDP66	733	866331	AC004796	3481	1-580
HSLDP66	733	866331	AC004796	3482	1-345
HSLDP66	733	866331	AC004796	3483	1-309
HSLDO01	734	916969	AC023093	3484	1-413
HSLDO01	734	916969	AC023093	3485	1-502
HSLCX61	738	742031	AC016582	3486	1-38
					1536-1812
					3968-4394
					5807-5918
					6477-6925
					7509-8029
					8979-9149
					9479-9566
HSLCX61	738	742031	AC007676	3487	1-38
					1534-1744
					3974-4400
					5302-5403
					5813-5924
					6483-6932
					7515-8035
					8957-9127
					9457-9544
					10602-10844
					12165-12320
					14170-14513
					14771-14943
					15727-15963
					19812-20009
					21301-21954
					24254-24543
					25372-25657
					30663-30778
					31145-31617
					31632-31805
					34572-34953
					38596-38886
					39180-39558
					39601-41424
					43326-43518
HSLCX61	738	742031	AC016582	3488	1-271
HSLCX61	738	742031	AC007676	3489	1-685
HSLCX61	738	742031	AC007676	3490	1-271
HSKZE91	741	790166	AC055855	3491	1-2128
HSKYG48	742	721631	AC027228	3492	1-260
					548-710
					759-1145
					2793-2897
					2990-3131
					3303-3809
					5167-5262
					6266-6427
					6512-6629
					9491-9709
					10402-13824
HSKYG48	742	721631	AC027228	3493	1-125
HSKJR15	745	866396	AC015844	3494	1-134
					226-628
					700-974
					1061-1542
HSKJC88	746	866402	AL161627	3495	1-557
HSKJC88	746	866402	AL161627	3496	1-1635
					2670-5996
HSKJC88	746	866402	AL161627	3497	1-352
HSKII90	747	788894	AC013764	3498	1-643
HSKII90	747	788894	AC013764	3499	1-550
HSKHZ47	748	720286	AC007228	3500	1-1190
					1382-2390
HSKHZ47	748	720286	AC007228	3501	1-589
HSKHZ47	748	720286	AC007228	3502	1-481
HSKHP10	750	964568	AL109928	3503	1-187
					303-387
					1815-3282
					3290-6558
HSKHP10	750	964568	AL109928	3504	1-363
HSKDC06	753	935452	AL138767	3505	1-884
					905-1284
					1325-4776
					4912-5745
					5809-6106
					6202-6417
HSKDC06	753	935452	AL157893	3506	1-4395
HSKDC06	753	935452	AL132656	3507	1-885
					906-1285
					1326-4773
					4909-5744
HSKDC06	753	935452	AL138767	3508	1-1087
HSKDC06	753	935452	AL157893	3509	1-307
HSKDC06	753	935452	AL157893	3510	1-380
HSKDC06	753	935452	AL132656	3511	1-1077
HSKDC06	753	935452	AL132656	3512	1-327
HSKCR54	754	922730	AC027641	3513	1-237
					357-615
					944-1561
					1577-2998
					3073-3185
					3211-3347
					4175-4715
HSKCR54	754	922730	AC027641	3514	1-216
HSKCR54	754	922730	AC027641	3515	1-216
					224-383
HSKCD43	755	714389	AC009282	3516	1-857
					1029-2227
HSKCD43	755	714389	AL390208	3517	1-115
					1487-1848
					1851-2468
					2968-3545
					4003-4349
					4917-5481
					5616-5922
					5999-6459
					7710-7823
					7875-8320
					9771-9966
					11924-12801
					12973-14171
HSKCD43	755	714389	AL133266	3518	1-66
					856-1060
					1675-1854
					3226-3587
					3590-4207
					5831-6177
					6745-7309
					7444-7750
					7827-8287
					9537-9650
					9702-10147
					11599-11794
					13752-14628
					14800-15998
HSKCD43	755	714389	AL158137	3519	1-857
					1029-2227
HSKBW62	757	521937	AC023959	3520	1-329
HSKBW62	757	521937	AC011885	3521	1-329
HSKBW62	757	521937	AC013434	3522	1-329
HSKAE10	760	968508	AC015962	3523	1-697
HSKAE10	760	968508	AP002393	3524	1-697
HSJAY64	763	866540	AC011462	3525	1-1998
					2010-2673
					3157-3587
					3611-3907
					4926-5714
					5719-6572
					8490-8910
					11142-11596
					12706-13113
					13191-13317
					13415-13541
					15366-15613
HSJAY64	763	866540	AC011462	3526	1-467
HSJAY64	763	866540	AC011462	3527	1-384
					472-794
HSCAF60	770	537444	AL080250	3528	1-2220
HSCAF60	770	537444	AL080250	3529	1-487
HRDFU03	771	924698	AC026290	3530	1-365
HRDFU03	771	924698	AC048338	3531	1-365
HRDFU03	771	924698	AC026290	3532	1-521
HRDFU03	771	924698	AC048338	3533	1-521
HRDFH46	772	590391	AL355773	3534	1-854
					2013-2134
					2650-3156
					3284-3379
					3563-3826
					4498-4620
					5597-5673
					7008-7286
					7721-8002
					8099-8648
					9030-9519
HRDFH46	772	590391	AL138499	3535	1-74
					1171-1414
					2003-2145
					5281-5390
					6571-6708
					7273-8042
					8498-8581
					9242-9411
					9823-9893
					11229-11269
					11959-12050
					12418-12490
					12981-13017
					13172-13255
					13739-13807
					16333-16490
					16856-16966
					17025-17457
					19018-19053
					19571-19708
					19739-20018
					20071-20166
					20847-20919
					21057-21542
					21820-21861
					22375-22563
					22606-22687
					23332-23536
					23934-23974
					24441-25133
					25607-26151
					27567-27728
					28089-28180
					30591-30662
					31711-31750
					32025-32303
					32728-33189
					33569-33660
					34582-35243
					36002-36089
					37700-38027
					38479-39379
					39447-39994
					39996-40412
					40939-41175
					42777-42859
					43613-43709
					43834-43926
					44676-44750
					44978-45061
					45219-45304
					45604-46116
					46592-46981
					47116-47969
					49128-49249
					49765-50272
					50400-50495
					50679-50942
					51613-51736
					52713-52789
					54124-54402
					54837-55118
					55215-55764
					56143-56632
HRDFH46	772	590391	AL138499	3536	1-386
					635-1149
HRDFG13	773	925350	Z99716	3537	1-55
					126-186
					610-963
					1193-1368
					2995-3327
HRDFG13	773	925350	Z99716	3538	1-135
HRDFD56	775	733556	AC026198	3539	1-768
HRDFD56	775	733556	AC007174	3540	1-768
HRDFD56	775	733556	AC018812	3541	1-768
HRDFD56	775	733556	AC020752	3542	1-768
HRDFD56	775	733556	AC022012	3543	1-768
HRDFD56	775	733556	AC020750	3544	1-768
HRDFD56	775	733556	AC022002	3545	1-768
HRDFD56	775	733556	AC026198	3546	1-384
HRDFD56	775	733556	AC007174	3547	1-384
HRDFD56	775	733556	AC018812	3548	1-384
HRDFD56	775	733556	AC020752	3549	1-384
HRDFD56	775	733556	AC022012	3550	1-384
HRDFD56	775	733556	AC020750	3551	1-384
HRDFD56	775	733556	AC022002	3552	1-384
HRDFA03	776	867122	AC010240	3553	1-980
HRDFA03	776	867122	AC010240	3554	1-451
HRDFA03	776	867122	AC010240	3555	1-239
HRDEZ73	777	774414	AL049868	3556	1-937
					1243-1407
					1844-2172
					2181-2679
					2706-3392
					3539-4236
HRDEZ73	777	774414	AL359704	3557	1-938
					1244-1408
					1845-2173
					2182-2680
					2707-3393
					3540-4237
HRDEZ73	777	774414	AL391095	3558	1-938
					1244-1408
					1845-2173
					2182-2680
					2707-3393
					3540-4237
HRDEZ73	777	774414	AL049868	3559	1-397
HRDEZ73	777	774414	AL359704	3560	1-397
HRDEZ73	777	774414	AL391095	3561	1-397
HRDEP20	781	690456	AC008663	3562	1-461
					3399-3527
					4652-5129
					5447-6031
					6123-6401
					6651-7418
					8095-9142
HRDEP20	781	690456	AC008663	3563	1-101
HRDEP20	781	690456	AC008663	3564	1-130
HRDEK53	782	867137	AC004832	3565	1-195
					1361-1748
					1778-1875
					1957-2456
					3189-3274
					6415-7628
					8053-8458
					8539-8677
					8730-9585
					10648-10979
					12618-12793
					13105-14385
					14859-16433
					16517-17216
HRDEK53	782	867137	AC005585	3566	1-195
					1361-1748
					1778-1875
					1957-2456
					3189-3274
					6415-7628
					8053-8458
					8539-8677
					8730-9585
					10648-10979
					13105-14385
					14859-16434
					16518-17217
HRDEK53	782	867137	AC004832	3567	1-694
HRDEK53	782	867137	AC004832	3568	1-546
HRDEK53	782	867137	AC005585	3569	1-694
HRDEK53	782	867137	AC005585	3570	1-546
HRDDU41	786	712572	AC016197	3571	1-351
HRDDU41	786	712572	AC022022	3572	1-351
HRDDU41	786	712572	AC016197	3573	1-247
HRDDU41	786	712572	AC016197	3574	1-171
HRDDU41	786	712572	AC022022	3575	1-247
HRDDU41	786	712572	AC022022	3576	1-171
HRDDR39	787	867151	AP001150	3577	1-601
HRDDR39	787	867151	AP001150	3578	1-217
					379-588
					1680-1812
					2108-2969
HRDBH52	790	728715	AP001544	3579	1-573
HRDBH52	790	728715	AP001548	3580	1-573
HRDBH52	790	728715	AC073440	3581	1-573
HRDBH52	790	728715	AP001399	3582	1-573
HRDBH52	790	728715	AP001548	3583	1-490
HRDBH52	790	728715	AP001544	3584	1-490
HRDBH52	790	728715	AC073440	3585	1-490
HRDBH52	790	728715	AP001399	3586	1-490
HRDAB42	791	800333	AC023502	3587	1-435
HRDAB42	791	800333	AC022383	3588	1-864
HRDAB42	791	800333	AC022384	3589	1-861
HRDAB42	791	800333	AC008032	3590	1-864
HRDAB42	791	800333	AC008032	3591	1-101
HRDAB42	791	800333	AC008032	3592	1-282
HOSOW01	792	914804	AC015585	3593	1-927
					954-1515
HOSOW01	792	914804	AC017101	3594	1-927
					954-1515
HOSOW01	792	914804	AC017026	3595	1-927
					954-1515
HOSOW01	792	914804	AC015585	3596	1-1422
HOSOW01	792	914804	AC017026	3597	1-1657
HOSMP95	794	948496	AC004500	3598	1-886
					1535-1939
					2922-3397
					3427-3540
					4001-4264
					4464-5586
					7800-7945
					7959-8108
HOSMP95	794	948496	AC004500	3599	1-226
HOSMP95	794	948496	AC004500	3600	1-56
					310-377
					1495-1589
HOSFV77	796	856933	AC025008	3601	1-3255
HOSFV77	796	856933	AL035411	3602	1-4240
HOSFV77	796	856933	AL035411	3603	1-227
HOSFL07	799	953183	AC016695	3604	1-2306
HOSFL07	799	953183	AC018640	3605	1-2311
HOSFL07	799	953183	AC009244	3606	1-2312
HOSFL07	799	953183	AC016695	3607	1-496
HOSFL07	799	953183	AC018640	3608	1-105
HOSFL07	799	953183	AC018640	3609	1-496
HOSFL07	799	953183	AC009244	3610	1-496
HOSFI46	801	719021	AC069073	3611	1-808
HOSFI46	801	719021	AC069073	3612	1-192
HOSDR12	804	971169	AL161740	3613	1-130
					1984-2058
HOSDR12	804	971169	AL161740	3614	1-220
HOSDQ78	805	858983	AC006474	3615	1-418
					552-1799
HOSDQ78	805	858983	AC006474	3616	1-384
HOSDA04	808	951842	AC012408	3617	1-2186
HOSBY89	813	787182	AC025800	3618	1-37
					980-2429
HOSBY89	813	787182	AC011773	3619	1-66
					1045-1184
					1559-3179
					3239-3435
					3586-3922
					3925-4354
					4655-6627
					7796-7829
					8768-9128
					9311-9788
					10585-10851
					11117-11429
					12515-12583
					15318-15475
					15541-15633
					16787-16951
					17797-17908
HOSBY89	813	787182	AC025800	3620	1-42
					604-718
					2247-2564
					3873-4140
HOSBY89	813	787182	AC011773	3621	1-42
					2263-2579
					3892-4159
HOSBX46	814	719414	AL049781	3622	1-842
					1381-2554
					5735-5992
					6879-7259
					7587-9210
HOSBX46	814	719414	AL049781	3623	1-649
HOSBX46	814	719414	AL049781	3624	1-201
HOSBX34	815	706769	AC008009	3625	1-4301
					4410-5419
HOSBX34	815	706769	AC008009	3626	1-74
					485-636
					859-951
					1364-1487
					3436-3606
					4183-4714
					5900-5979
					9956-10067
					11481-11963
					13607-13693
					15019-15227
					20188-21030
					21682-22252
					22277-22497
					22593-24241
					24399-24692
					25134-26128
					27449-27554
					27875-29607
HOSBX34	815	706769	AC008009	3627	1-1004
					1875-2197
					2217-2290
					3235-3317
					3705-4524
					4663-5005
					5891-6065
HOSBO34	817	706770	AC018606	3628	1-680
					1108-2215
HOSBO34	817	706770	AC018606	3629	1-111
HOSBM55	818	732550	AB014087	3630	1-1183
HOSBM55	818	732550	AC004188	3631	1-1183
HOSBM55	818	732550	AB014087	3632	1-427
HOSBM55	818	732550	AC004188	3633	1-521
HOSBM55	818	732550	AC004188	3634	1-427
HOSAY52	819	728759	AL049781	3635	1-842
					1381-2554
					5735-5992
					6879-7259
					7587-9210
HOSAY52	819	728759	AL049781	3636	1-649
HOSAY52	819	728759	AL049781	3637	1-201
HOSAL10	821	968710	AC015655	3638	1-709
HOSAL10	821	968710	AC025545	3639	1-465
					616-1158
HOSAL10	821	968710	AC069523	3640	1-791
					942-1485
HOSAL10	821	968710	AC025545	3641	1-259
HOSAL10	821	968710	AC069523	3642	1-258
HOSAL10	821	968710	AC069523	3643	1-50
					978-1336
					4572-4971
					5922-6284
HOSAH30	823	693406	AL139162	3644	1-1851
HOSAH30	823	693406	AC073638	3645	1-1371
					1464-3286
					3846-4478
					5145-5389
					6355-6441
					6990-7453
					7636-8097
					8679-9009
					9507-9558
HOSAH30	823	693406	AL139162	3646	1-503
HOSAH30	823	693406	AC073638	3647	1-1605
HOSAF19	824	672078	AC069222	3648	1-576
					755-1350
HOSAF19	824	672078	AC022883	3649	1-576
					755-1350
HOSAF19	824	672078	AC024938	3650	1-576
					755-1350
HOSAF19	824	672078	AC022883	3651	1-450
HOSAF19	824	672078	AC069222	3652	1-450
HOSAF19	824	672078	AC024938	3653	1-450
HOHEN28	825	686034	AC021923	3654	1-194
					1261-1657
					1673-1825
					5781-6120
					7234-7599
					8092-8247
					8353-8637
					8801-10463
					10487-11027
HOHEN28	825	686034	AC018790	3655	1-194
					1261-1657
					1673-1825
					5781-6120
					7234-7599
					8092-8247
					8353-8637
					8801-10463
					10487-11027
HOHEN28	825	686034	AC018790	3656	1-99
HOHEG71	826	760051	AC023120	3657	1-2351
					2406-3121
					3186-3327
					5228-5903
					6301-6724
					6756-7347
					8157-8780
					8929-9270
					9943-10371
					10549-11021
					11844-12347
					17147-17451
					17563-17662
					18026-18260
					18456-18609
					19490-19959
					25372-25481
					26563-26665
					27439-27568
					27673-27966
					29690-29884
					33065-33887
					33968-34187
					35050-35109
					35958-36256
					37813-37925
HOHEG71	826	760051	AC023120	3658	1-1768
HOHEG71	826	760051	AC023120	3659	1-518
HOHDF94	827	793970	AF260011	3660	1-392
					1316-1511
					3951-4175
					4406-4711
					5372-5546
					5952-6147
					6232-6688
					7555-8129
					9753-10326
					12106-12182
					12272-12752
					13231-13444
HOHDF94	827	793970	AF260011	3661	1-25
					165-266
					531-2938
HOHCG79	831	859029	AC044820	3662	1-604
					2939-3404
					4741-5741
HOHCG79	831	859029	AC018590	3663	1-465
HOHCG79	831	859029	AC044820	3664	1-377
HOHCG79	831	859029	AC018590	3665	1-1001
HOHBZ27	833	588364	AL109966	3666	1-2391
HOHBZ27	833	588364	AL109966	3667	1-763
HOHBS10	836	964324	AC009088	3668	1-409
HOHBS10	836	964324	AC009088	3669	1-266
HOHBS10	836	964324	AC009088	3670	1-377
					765-1140
					1231-1302
					1394-1850
					1926-2050
					2098-2221
					2408-3127
					3583-4516
HOHBP36	837	708158	AC013451	3671	1-602
HOHBP36	837	708158	AC013451	3672	1-281
HOHBL35	839	973238	AC055749	3673	1-521
HOHBL35	839	973238	AC023296	3674	1-521
HOHBI84	840	782908	AL359678	3675	1-306
HOHBI84	840	782908	AL359678	3676	1-84
HOHBB90	841	588308	AL035455	3677	1-74
					680-1053
					3541-3691
					3707-4349
					5188-5434
					6048-7834
HOHBB90	841	588308	AL354834	3678	1-74
					680-1053
					3541-3691
					3707-4349
					5188-5434
					6050-7836
HOHBB90	841	588308	AL035455	3679	1-402
HOHBB90	841	588308	AL035455	3680	1-919
HOHBB90	841	588308	AL354834	3681	1-402
HOHAV60	842	489007	AC007279	3682	1-75
					501-565
					911-1115
					1230-1298
					1921-2242
					2324-2419
					2650-2943
					3316-3483
					4338-4457
HOHAV60	842	489007	AC007279	3683	1-278
HOHAV60	842	489007	AC007279	3684	1-508
HOHAT59	843	867949	AC018545	3685	1-442
HOHAT59	843	867949	AC018545	3686	1-113
HOHAQ65	845	859057	AC005042	3687	1-517
HOHAQ65	845	859057	AC005042	3688	1-373
HOEOA28	849	859156	AC002519	3689	1-77
					1106-2134
					2298-2635
					2641-3321
					4046-4668
					5189-6072
HOEOA28	849	859156	AC002519	3690	1-1570
HOENH06	850	934095	AL050306	3691	1-1099
					1852-2331
HOENH06	850	934095	AL050306	3692	1-530
HOENH06	850	934095	AL050306	3693	1-657
HOELI08	851	958181	AC011973	3694	1-34
					56-1333
HOELI08	851	958181	AC016999	3695	1-34
					52-1332
HOELI08	851	958181	AC011973	3696	1-277
HOELI08	851	958181	AC016999	3697	1-280
HOEEX37	852	708728	AC007285	3698	1-804
					2127-2267
					3871-4235
					4812-5113
					7562-7921
					10731-11065
					11792-14461
					14687-16100
HOEEX37	852	708728	AC007285	3699	1-415
HOECF70	856	573426	AL357134	3700	1-461
					2473-2733
					3125-3433
					4108-4457
					5818-5948
					6438-6525
					6727-7121
					7632-7791
HOECF70	856	573426	AL357134	3701	1-550
HOECF70	856	573426	AL357134	3702	1-290
HOACG06	858	954572	AC008414	3703	1-51
					569-1079
					1980-2133
					3558-3656
					4387-4484
					4587-4769
					4787-5117
					5819-6270
					6420-6609
					6704-6770
					7446-7635
					8689-10494
HOACG06	858	954572	AC016564	3704	1-511
HOACG06	858	954572	AC008485	3705	1-51
					569-1079
					1981-2134
					3558-3666
					4399-4504
					4601-4784
					5010-5135
					5837-5946
HOABW12	862	968797	AC011489	3706	1-381
HOABW12	862	968797	AC011489	3707	1-489
					1702-1734
					2236-2554
					2757-3239
					4609-4999
					5125-5159
HOABW12	862	968797	AC011489	3708	1-309
HOABG91	863	811156	AC021573	3709	1-460
					719-769
HOABG91	863	811156	AC021573	3710	1-104
HOABF65	864	888203	AL356274	3711	1-402
HOABF65	864	888203	AC055748	3712	1-402
HOAAX37	867	708718	AC027082	3713	1-1259
					1518-1999
					3241-3674
					4056-4328
					4693-5098
					5853-6779
HOAAX37	867	708718	AL121985	3714	1-1259
					1518-1999
					3241-3674
					4056-4328
					4693-5098
					5853-6779
HOAAX37	867	708718	AC027082	3715	1-408
HOAAX37	867	708718	AL121985	3716	1-408
HOAAW02	869	920869	AC021215	3717	1-435
					440-949
HOAAV77	870	772512	AL121997	3718	1-409
HOAAV77	870	772512	AL121997	3719	1-91
					2824-3176
					3245-3444
					3852-3982
					4333-4864
HOAAV77	870	772512	AL121997	3720	1-147
					621-1118
HOAAM67	872	751947	AC012580	3721	1-378
HOAAM67	872	751947	AL133502	3722	1-378
HOAAM67	872	751947	AC012580	3723	1-495
HOAAM67	872	751947	AL133502	3724	1-575
HOAAM67	872	751947	AC012580	3725	1-575
HOAAM67	872	751947	AL133502	3726	1-495
HOAAK71	873	761445	AL020991	3727	1-33
					4960-5158
					6138-6263
					7108-7229
					9543-9988
					10472-10659
					13310-13494
					15235-15405
					15620-16560
					16591-16788
					16873-17205
					17324-17495
					21634-22394
					22406-22487
					22651-22786
HOAAK71	873	761445	AL020991	3728	1-1630
					2519-3035
					3135-3457
					4050-4123
					4811-4958
					5219-5669
					6291-6373
					7336-7544
HOAAH77	876	772514	AC064860	3729	1-3600
HOAAH77	876	772514	AC010134	3730	1-3600
HOAAH77	876	772514	AC064860	3731	1-544
HOAAH77	876	772514	AC010134	3732	1-544
HOAAH41	877	712601	AC013285	3733	1-489
HOAAH41	877	712601	AC024603	3734	1-489
HMUBZ11	878	966856	AL356420	3735	1-476
HMUBZ11	878	966856	AL157386	3736	1-476
HMUBZ11	878	966856	AL121928	3737	1-476
HMUBZ11	878	966856	AL356420	3738	1-417
HMUBZ11	878	966856	AL356420	3739	1-292
HMUBZ11	878	966856	AL157386	3740	1-417
HMUBZ11	878	966856	AL157386	3741	1-287
HMUBZ11	878	966856	AL121928	3742	1-144
HMUBZ11	878	966856	AL121928	3743	1-417
HMUBY20	880	669581	AC026495	3744	1-433
HMUBY20	880	669581	AC026495	3745	1-425
HMUBY20	880	669581	AC026495	3746	1-1055
HMUBV40	881	837969	AL136087	3747	1-105
					465-969
					4861-4970
HMUBV40	881	837969	AL136087	3748	1-462
HMUBV40	881	837969	AL136087	3749	1-165
HMUBR94	882	793261	AL359264	3750	1-340
					1138-2277
					2905-3562
HMUBQ01	884	918052	AC023648	3751	1-381
HMUBQ01	884	918052	AC008121	3752	1-381
HMUBQ01	884	918052	AC023648	3753	1-2005
HMUBQ01	884	918052	AC008121	3754	1-2005
HMUBQ01	884	918052	AC023648	3755	1-5671
HMUBQ01	884	918052	AC008121	3756	1-5676
HMUBP74	885	765502	AC011553	3757	1-610
					699-939
					1219-1553
HMUBN05	888	932057	AC023534	3758	1-1710
HMUBN05	888	932057	AC023534	3759	1-774
HMUBN05	888	932057	AC023534	3760	1-1423
HMUBM89	889	786082	AL138898	3761	1-976
HMUBM85	890	784295	AL139253	3762	1-495
HMUBM85	890	784295	AL358492	3763	1-495
HMUBM85	890	784295	AL139253	3764	1-292
HMUBM85	890	784295	AL358492	3765	1-299
HMUBM23	891	675296	AC069198	3766	1-334
HMUBM23	891	675296	AC069198	3767	1-253
					1480-1581
					1922-2067
HMUBM21	892	861218	AP001447	3768	1-682
HMUBM21	892	861218	AC023532	3769	1-682
HMUBM21	892	861218	AP000571	3770	1-101
					236-917
					1917-1982
					3068-3361
					5001-5308
					5847-5967
					6768-6892
HMUBM21	892	861218	AP001447	3771	1-478
HMUBM21	892	861218	AC023532	3772	1-478
HMUBM01	893	916291	AC023855	3773	1-1257
					3192-3270
					3630-3976
					4242-4343
					4840-5519
					6021-6104
					6317-6420
					6782-6893
					6977-7017
HMUBM01	893	916291	AC004596	3774	1-192
					639-819
					2985-3379
					5817-7073
					9010-9088
					9448-9794
					10658-11337
					12600-12711
					12795-12835
					13418-13458
					15232-15558
					15880-15985
					16696-16987
					18333-18617
					18987-19269
					19915-20522
HMUBM01	893	916291	AC004596	3775	1-87
HMUBL79	894	774904	AC005586	3776	1-554
HMUBL79	894	774904	AC005586	3777	1-816
HMUBL79	894	774904	AC005586	3778	1-1171
HMUBL25	895	678011	AC004051	3779	1-665
HMUBL25	895	678011	AC004051	3780	1-439
HMUBI26	896	424764	AC016922	3781	1-545
HMUBI26	896	424764	AC016922	3782	1-490
HMUBI26	896	424764	AC016922	3783	1-1159
HMUBH84	897	782971	AL353147	3784	1-108
					1271-1606
					6082-6170
					6275-6854
HMUBH84	897	782971	AL353147	3785	1-337
HMUBC76	898	769968	AC040984	3786	1-479
HMUBC76	898	769968	AL133327	3787	1-480
HMUBC76	898	769968	AL133327	3788	1-613
HMUBC76	898	769968	AL133327	3789	1-545
HMUBA75	899	767192	AC073215	3790	1-43
					178-631
					4480-5300
					5346-9872
					10120-10587
					10955-11119
HMUBA75	899	767192	AC007250	3791	1-43
					178-631
					4479-5299
					5345-9871
					10119-10586
					10957-11121
HMUBA75	899	767192	AC073215	3792	1-274
HMUBA75	899	767192	AC007250	3793	1-274
HMUBA61	900	741710	AC067992	3794	1-96
					245-337
					889-1827
					1921-2211
					2213-2561
					2581-3014
					4496-7045
HMUBA61	900	741710	AC067992	3795	1-258
HMUBA61	900	741710	AC067992	3796	1-4074
HMUAT71	901	772958	AC006165	3797	1-153
					256-1782
					1869-2685
					2766-3299
					3543-3990
					4755-4931
					5175-5337
					5807-6087
					6226-6455
					7594-8044
					8215-8373
					9157-9392
					9509-9883
					11475-11999
					12043-13604
					13610-13734
					13800-14134
					14501-15266
HMUAT71	901	772958	AB023051	3798	1-153
					256-1782
					1869-2685
					2766-3299
					3543-3990
					4755-4931
					5175-5337
					5811-6091
					6230-6459
					7598-8048
					8219-8377
					9162-9397
					9514-9888
					11480-12004
					12048-13609
					13615-13739
					13805-14139
					14506-15271
HMUAT71	901	772958	AC006165	3799	1-1342
					1447-1578
HMUAT71	901	772958	AC006165	3800	1-2094
					2393-2516
					2641-2911
					3529-3786
					4862-5131
HMUAT71	901	772958	AB023051	3801	1-1342
					1447-1578
HMUAT71	901	772958	AB023051	3802	1-2094
					2393-2516
					2641-2911
					3529-3786
					4862-5139
HFOZA47	904	909372	AL133243	3803	1-502
					891-997
					3296-3521
					5357-6137
					7436-7920
					8616-8765
					9182-9311
					10530-11068
					11184-11626
					12025-14398
					14692-15155
					15250-15383
					15828-15994
					17708-19731
					19976-20476
					21720-21860
HFOZA47	904	909372	AL133243	3804	1-428
HFOZA47	904	909372	AL133243	3805	1-1592
HFOYW76	905	769894	AL121926	3806	1-37
					2244-2601
					3232-3454
					3491-3871
					4270-4412
					6007-7043
					11144-11328
					11354-11854
					13821-14176
					16051-16149
					17699-18165
					18180-18878
HFOYW76	905	769894	AL121926	3807	1-176
HFOYW76	905	769894	AL121926	3808	1-156
					159-551
HFOYV08	906	959038	Z98048	3809	1-924
HFOYV08	906	959038	Z98048	3810	1-2141
					2561-2701
					2941-3483
					3789-4096
					4140-5159
					5304-6198
					6305-6424
					8034-8140
					8775-9044
					11025-11657
					14599-15000
					16088-16163
					18758-18801
					18856-19427
					20301-20375
					23760-23837
					24870-24955
					25120-25391
					26285-26348
					27214-28161
					28757-29091
					31718-32125
HFOYV08	906	959038	Z98048	3811	1-507
HFOYN65	908	747740	AL358152	3812	1-1355
					1765-2516
HFOYN65	908	747740	AL358152	3813	1-984
HFOYN65	908	747740	AL358152	3814	1-293
HFOYN01	909	854780	AC027228	3815	1-454
					469-1300
					1311-1530
					3141-3500
					3595-4461
					5573-5640
					6780-6854
					6924-7105
HFOYN01	909	854780	AC027228	3816	1-538
HFOYM48	910	721455	AC000076	3817	1-615
HFOYM48	910	721455	AC000076	3818	1-1684
HFOYM48	910	721455	AC000076	3819	1-38
					63-269
					319-413
					415-847
					2369-3063
					3084-5496
HFOYK21	912	670653	AC010895	3820	1-1048
HFOYK21	912	670653	AC010895	3821	1-381
HFOYH01	915	916055	AC008397	3822	1-1320
HEOYH01	915	916055	AC008397	3823	1-658
					739-3456
HFOYA17	919	662642	AC008602	3824	1-348
HFOYA17	919	662642	AC008602	3825	1-113
HFOXW67	920	494854	AC024606	3826	1-1234
HFOXW67	920	494854	AC024606	3827	1-508
HFOXV94	921	794175	AC005328	3828	1-191
					282-1004
HFOXV94	921	794175	AC005328	3829	1-347
HFOXV94	921	794175	AC005328	3830	1-913
HFOXT35	923	707088	AL354890	3831	1-527
HFOXT35	923	707088	AL354890	3832	1-270
HFOXS42	924	713514	AC015559	3833	1-739
HFOXS42	924	713514	AC015559	3834	1-831
HFOXO57	925	928171	AL022165	3835	1-4237
HFOXO57	925	928171	AL022165	3836	1-601
HFOXO57	925	928171	AL022165	3837	1-229
HFOXM53	927	587972	AC011314	3838	1-563
HFOXM53	927	587972	AC010742	3839	1-563
					692-1031
HFOXM53	927	587972	AC011314	3840	1-247
HFOXM53	927	587972	AC010742	3841	1-247
HFOXM53	927	587972	AC010742	3842	1-307
HFOXK96	929	732057	AC004918	3843	1-70
					582-1137
					2262-2357
					2561-7148
					7282-10885
HFOXK96	929	732057	AC004918	3844	1-269
HFOXK96	929	732057	AC004918	3845	1-2013
HFOXK42	930	587960	AC006487	3846	1-385
					925-963
					1241-1694
					1773-1934
					2006-2474
HFOXK42	930	587960	AC006487	3847	1-1810
HFOXK42	930	587960	AC006487	3848	1-406
HFOXF91	931	790103	AC027731	3849	1-1854
					2517-2610
					2974-3261
					3694-5322
HFOXF91	931	790103	AL355880	3850	1-1856
					2517-2610
					2974-3261
					3694-5322
					9187-9303
					9508-9667
					10248-10546
					11270-11400
					14251-14404
					14486-14589
					16590-16688
					17066-17146
HFOXF91	931	790103	AL034379	3851	1-146
					669-818
					2394-2571
					2805-3392
					3477-3584
					3993-4434
					4623-4804
					5144-5315
					7457-7544
					7619-7747
					8093-10079
					10742-10835
					11199-11486
					11919-13547
					17412-17528
					17733-17892
					18473-18771
					19495-19625
					22477-22630
					24816-24914
					25282-25405
					25841-26405
					26938-27002
					29800-30272
					30380-30568
HFOXF91	931	790103	AC027731	3852	1-129
HFOXF91	931	790103	AL355880	3853	1-110
HFOXF91	931	790103	AL034379	3854	1-392
HFOXD78	933	856499	AC010794	3855	1-3291
HFOXD78	933	856499	AC009985	3856	1-3291
HFOXD78	933	856499	AC010794	3857	1-92
HFOXD78	933	856499	AC010794	3858	1-4024
					4342-4788
					6234-6476
					6856-7117
					7574-7852
HFOXD78	933	856499	AC009985	3859	1-4023
					4341-4787
					6219-6532
					6855-7116
					7573-7851
HFOXB33	934	701719	AL049775	3860	1-633
HFOXB33	934	701719	AL049775	3861	1-734
HFIZP86	937	785341	AC013644	3862	1-1064
HFIZP86	937	785341	AC055747	3863	1-1617
HFIZP86	937	785341	AC013644	3864	1-611
HFIZP86	937	785341	AC055747	3865	1-147
HFIZP86	937	785341	AC055747	3866	1-611
HFIYX08	939	958977	AL158813	3867	1-446
HFIYX08	939	958977	AL096678	3868	1-446
HFIYX08	939	958977	AL158813	3869	1-233
HFIYX08	939	958977	AL158813	3870	1-528
HFIYX08	939	958977	AL096678	3871	1-233
HFIYX08	939	958977	AL096678	3872	1-528
HFIYW79	940	858618	AC025840	3873	1-240
					265-775
					2493-2540
HFIYW79	940	858618	AC008723	3874	1-798
					1753-1907
					2217-2531
					3008-3156
HFIYW79	940	858618	AC008723	3875	1-951
					1396-1557
					5031-5131
					7701-7878
					8580-8685
					8771-8930
					8966-9330
					9366-9665
					13147-13262
					16273-16490
					17741-17892
					18390-18570
					18692-18768
					20484-20585
					20675-20764
					20927-21397
					22110-22308
					22665-22845
					24200-24245
					25983-26076
					26511-26819
					27138-27218
					27987-28086
					30157-30255
					30579-31026
					31198-31314
HFIYS11	941	966702	AC058804	3876	1-491
HFIYS11	941	966702	AC058804	3877	1-508
HFIYN50	942	724175	AC026028	3878	1-577
HFIYN50	942	724175	AL353708	3879	1-456
					936-1243
					1296-2012
HFIYN50	942	724175	AL359853	3880	1-456
					936-1243
					1296-2012
HFIYN50	942	724175	AC026028	3881	1-423
HFIYN50	942	724175	AL359853	3882	1-2482
					2605-3854
HFIYN50	942	724175	AL359853	3883	1-423
HFIYJ92	943	791305	AC000016	3884	1-65
					793-4089
HFIYJ92	943	791305	AC000016	3885	1-140
HFIXR93	947	894013	AL157824	3886	1-33
					5109-7241
					7282-11311
HFIXR93	947	894013	AC012151	3887	1-68
					2079-2213
					2879-2965
					3114-3257
					4198-4337
					6080-6204
					8566-8644
					13691-19866
HFIXR68	948	752858	AC019198	3888	1-1725
					2960-3425
HFIXR68	948	752858	AC015982	3889	1-1725
					2960-3438
					5180-5529
					5615-5769
					6070-6262
					6580-7062
HFIXR68	948	752858	AC019198	3890	1-593
HFIXR68	948	752858	AC015982	3891	1-593
HFIXP31	949	697759	AC009761	3892	1-420
					661-1011
					1193-2688
HFIXP31	949	697759	AC009761	3893	1-369
					518-912
HFIXP04	950	839910	AC009311	3894	1-564
HFIXP04	950	839910	AC009311	3895	1-319
HFIXP04	950	839910	AC009311	3896	1-183
HFIVS08	955	959272	AC007032	3897	1-163
					511-831
					1581-1856
					1918-2584
					2587-2776
					3944-4761
					4855-7799
					7849-8034
					8580-8847
					9303-10448
					11604-12183
					12772-13476
					13563-13793
					14201-14557
					14872-17303
					17312-17604
					17739-18258
					18373-19256
					20321-20694
					20846-22055
					22122-22853
					22866-23293
					23557-24012
					24021-24459
					25225-28897
HFIVS08	955	959272	AC007032	3898	1-445
HFIVS08	955	959272	AC007032	3899	1-449
HFIUZ63	956	745033	AC016065	3900	1-1167
					1243-2315
					2390-2968
HFIUZ63	956	745033	AC018398	3901	1-1167
					1243-2314
					2389-2967
HFIUV58	958	735350	AC063952	3902	1-1120
HFIUV58	958	735350	AC063952	3903	1-1755
HFIUV18	959	787095	AC024064	3904	1-1333
HFIUVI8	959	787095	AC024064	3905	1-161
HFIUM33	960	702319	AC073108	3906	1-595
HFIUM33	960	702319	AL161642	3907	1-562
HFIUM33	960	702319	AC004980	3908	1-457
HFIUM33	960	702319	AC073108	3909	1-113
HFIUM33	960	702319	AL161642	3910	1-101
HFIUM33	960	702319	AC073108	3911	1-101
HFIUM33	960	702319	AL161642	3912	1-1274
					1766-2280
					2300-2807
					2837-3110
HFIUM33	960	702319	AC004980	3913	1-101
HFIUM33	960	702319	AC004980	3914	1-1274
					1766-2280
					2300-2807
					2837-3110
HFIUH65	961	747836	AC022400	3915	1-1987
HFIUH65	961	747836	AC037447	3916	1-1922
HFIUH65	961	747836	AC022400	3917	1-621
					646-1082
					1155-1312
HFIUH65	961	747836	AC037447	3918	1-621
					646-1082
					1155-1312
HFIUD47	962	720254	AC018927	3919	1-1277
HFIUD47	962	720254	AC027797	3920	1-1277
HFIUD47	962	720254	AC018927	3921	1-518
HFIUD47	962	720254	AC027797	3922	1-517
HFITH46	963	718078	AC009220	3923	1-460
					670-783
					1321-1430
					4578-4950
					5053-5122
					8113-8243
					11039-11159
					11712-11992
					12016-12129
					12648-12771
HFITH46	963	718078	AC009220	3924	1-122
HFIJF58	966	735927	AL049780	3925	1-860
HFIJF58	966	735927	AC006530	3926	1-860
HFIJF58	966	735927	AL049780	3927	1-1091
HFIJF58	966	735927	AL049780	3928	1-589
HFIJF58	966	735927	AC006530	3929	1-802
HFIJF58	966	735927	AC006530	3930	1-1090
HFIIR63	969	744994	AL354797	3931	1-693
					700-1411
HFIIR63	969	744994	AC068485	3932	1-693
					700-1411
HFIIR63	969	744994	AC013740	3933	1-4690
					6959-7154
					7209-7389
					7431-7731
					11120-11377
					12689-12782
					13980-14669
					27508-27734
					30606-31559
					31691-32383
					32390-33101
					33665-33950
					35646-35944
					36682-36970
					37681-38105
					38961-39244
					42417-42581
					43432-43781
					45418-45605
					46318-46443
					46498-46727
HFIIR63	969	744994	AL354797	3934	1-954
HFIIR63	969	744994	AL354797	3935	1-286
HFIIR63	969	744994	AC068485	3936	1-286
HFIIR63	969	744994	AC068485	3937	1-954
HFIIR63	969	744994	AC013740	3938	1-345
					615-1006
HFIIR63	969	744994	AC013740	3939	1-231
HFIIK75	971	767222	AC016722	3940	1-701
					1766-2718
HFIIK75	971	767222	AC016722	3941	1-717
HFIIK07	973	953034	AC016394	3942	1-588
					595-1084
					1098-1581
HFIIK07	973	953034	AC068557	3943	1-588
					595-1083
					1097-1580
HFIIK07	973	953034	AC016394	3944	1-558
					652-915
					1677-5669
					5844-5990
					6502-6754
					7996-8461
					8748-8832
					9129-9877
HFIIK07	973	953034	AC068557	3945	1-558
					652-915
					1677-5156
HFIIJ14	974	839523	AP001973	3946	1-102
HFIIJ14	974	839523	AL355880	3947	1-34
HFIHW16	976	858594	AC025891	3948	1-2095
HFIHW16	976	858594	AC016173	3949	1-2712
HFIHW16	976	858594	AP001600	3950	1-2711
HFIHW16	976	858594	AC016173	3951	1-509
HFIHW16	976	858594	AC016173	3952	1-463
HFIHW16	976	858594	AP001600	3953	1-509
HFIHW16	976	858594	AP001600	3954	1-187
					869-1287
					2982-3157
					3423-3674
					8406-8868
HFIHW11	977	947856	AF254981	3955	1-57
					1142-1260
HFIHW11	977	947856	AC023188	3956	1-85
					326-439
					1924-2100
					3184-3563
HFIHW11	977	947856	AC023188	3957	1-204
					939-1163
HFIHW11	977	947856	AC023188	3958	1-475
HFIHV56	978	470954	AC022930	3959	1-121
					959-1377
					2087-2219
					3018-3826
					3852-4165
					4657-4767
					5284-5392
					5999-6311
					6327-6368
					6940-7299
					7610-8439
HFIHV56	978	470954	AF238376	3960	1-623
					721-864
					1041-1249
					1439-1558
					2395-2813
					3523-3655
					4454-5262
					5288-5601
					6093-6203
					6720-6828
					7435-7747
					7763-7804
					8376-8481
					9046-9875
HFIHV56	978	470954	AF238376	3961	1-147
					342-408
HFIHU76	979	769948	AC006995	3962	1-509
HFIHU76	979	769948	AC005098	3963	1-509
HFIHU76	979	769948	AC004166	3964	1-509
HFIHU76	979	769948	AC004883	3965	1-509
HFIHU76	979	769948	AC006995	3966	1-89
HFIHU76	979	769948	AC006995	3967	1-159
HFIHU76	979	769948	AC005098	3968	1-114
					553-988
					1601-1926
					2188-2470
					3568-3753
					4168-4600
					5038-5080
					5881-5976
					6271-6358
					7128-8058
					8786-10907
HFIHU76	979	769948	AC005098	3969	1-160
HFIHU76	979	769948	AC004166	3970	1-77
					541-951
					1564-1889
					2151-2235
					3531-3716
					4131-4563
					4702-4802
					5001-5043
					5844-5939
					6234-6321
					7115-7476
					7548-8020
					8745-10867
HFIHU76	979	769948	AC004166	3971	1-163
HFIHU76	979	769948	AC004883	3972	1-114
					459-988
					1151-1251
					1601-1926
					2188-2470
					3568-3753
					4168-4600
					5038-5080
					5881-5976
					6271-6358
					7585-7796
					7819-9872
					10597-12718
HFIHU76	979	769948	AC004883	3973	1-163
HFIHS86	980	785419	AL158814	3974	1-1188
HFIHS86	980	785419	AL035694	3975	1-3503
HFIHS86	980	785419	AL035694	3976	1-131
					3726-4036
					9191-9552
					10640-12003
HFIHK29	983	855174	AC012040	3977	1-1468
HFIHK29	983	855174	AC026464	3978	1-146
					2144-2248
					3425-4485
					4538-6005
					8727-8898
					9137-9222
					12214-12317
					12384-12622
					12696-12797
					13071-13110
					13572-15071
HFIHK29	983	855174	AC026474	3979	1-146
					2144-2248
					3425-4485
					4538-6005
					9143-9228
					12383-12621
					12695-12796
					13070-13109
					13571-15070
HFIHK29	983	855174	AC026464	3980	1-568
HFIHK29	983	855174	AC012040	3981	1-146
					2144-2248
					3425-4485
HFIHK29	983	855174	AC026474	3982	1-568
HFIAL66	991	587837	AC012306	3983	1-565
HCDEL02	993	920831	AC061980	3984	1-628
HCDEL02	993	920831	AL159167	3985	1-1093
					1477-1978
HCDEL02	993	920831	AC061980	3986	1-410
HCDEL02	993	920831	AL159167	3987	1-410
HCDEL02	993	920831	AL159167	3988	1-389
HCDDZ69	994	522220	AC002310	3989	1-256
					411-537
					2216-2825
					2858-3950
					4039-4108
					4429-4979
					5008-5410
					5591-5625
					5641-7301
					7793-8106
					8114-8234
					11769-12452
HCDDZ69	994	522220	AC002310	3990	1-329
HCDDZ69	994	522220	AC002310	3991	1-1402
					1469-3065
HCDDY54	995	529265	AC012488	3992	1-341
HCDDY54	995	529265	AC012488	3993	1-361
HCDDO80	996	778563	AC025165	3994	1-746
HCDDO80	996	778563	AC025165	3995	1-302
HCDCD64	997	863415	AC022197	3996	1-190
HCDCD64	997	863415	AC022197	3997	1-619
HCDBW41	998	712648	AP001325	3998	1-390
HCDBO86	999	784617	AC073487	3999	1-375
					893-4326
					4474-5168
					5186-6317
					6538-6708
					6755-7192
					7587-9453
HCDBO86	999	784617	AC023055	4000	1-246
					485-1179
					1198-2329
					2550-2720
					2767-3204
					3603-5469
HCDBO86	999	784617	AC073487	4001	1-646
HCDBO86	999	784617	AC023055	4002	1-428
HCDBO86	999	784617	AC023055	4003	1-245
HCDAA68	1001	753814	AL353776	4004	1-560
HCDAA68	1001	753814	AL353776	4005	1-455
HCDAA68	1001	753814	AL353776	4006	1-130
HBCKF23	1003	675613	AC055747	4007	1-533
					1236-1544
					1697-1786
HBCGD25	1004	677689	AC023947	4008	1-691
HBCGD25	1004	677689	AC016946	4009	1-691
HBCGD25	1004	677689	AC022664	4010	1-691
HBCGD25	1004	677689	AC023947	4011	1-423
HBCGD25	1004	677689	AC016946	4012	1-423
HBCGD25	1004	677689	AC022664	4013	1-423
HBCGD25	1004	677689	AC016946	4014	1-100
HAOAE95	1005	795674	AC025225	4015	1-469
					511-892
					1010-2004
HAOAE95	1005	795674	AL034417	4016	1-469
					511-892
					1010-2004
HAOAE95	1005	795674	AC025225	4017	1-696
HAOAE95	1005	795674	AC025225	4018	1-430
HAOAE95	1005	795674	AL034417	4019	1-696
HAOAE95	1005	795674	AL034417	4020	1-430
HAOAD27	1006	848729	AL096776	4021	1-114
					1783-2276
					4713-5206
					7371-10780
HAOAD27	1006	848729	AL096776	4022	1-418
HANKG10	1007	963926	AL353705	4023	1-565
HANKG10	1007	963926	AL353594	4024	1-565
HANKG10	1007	963926	AL353705	4025	1-405
HANKG10	1007	963926	AL353594	4026	1-405
HANKB13	1008	827062	AC023963	4027	1-139
					1779-1929
					2453-2599
HANKB13	1008	827062	AC023963	4028	1-610
HANKB13	1008	827062	AC023963	4029	1-349
HAMAC79	1009	872774	AC019066	4030	1-1701
HAMAC79	1009	872774	AC019066	4031	1-203

[0072] Table 1B summarizes additional polynucleotides encompassed by the invention (including cDNA clones related to the sequences (Clone ID NO:Z), contig sequences (contig identifier (Contig ID:) contig nucleotide sequence identifiers (SEQ ID NO:X)), and genomic sequences (SEQ ID NO:B). The first column provides a unique clone identifier, “Clone ID NO:Z”, for a cDNA clone related to each contig sequence. The second column provides the sequence identifier, “SEQ ID NO:X”, for each contig sequence. The third column provides a unique contig identifier, “Contig ID:” for each contig sequence. The fourth column, provides a BAC identifier “BAC ID NO:A” for the BAC clone referenced in the corresponding row of the table. The fifth column provides the nucleotide sequence identifier, “SEQ ID NO:B” for a fragment of the BAC clone identified in column four of the corresponding row of the table. The sixth column, “Exon From-To”, provides the location (i.e., nucleotide position numbers) within the polynucleotide sequence of SEQ ID NO:B which delineate certain polynucleotides of the invention that are also exemplary members of polynucleotide sequences that encode polypeptides of the invention (e.g., polypeptides containing amino acid sequences encoded by the polynucleotide sequences delineated in column six, and fragments and variants thereof).

TABLE 2
		SEQ				Score/
Clone ID	Contig	ID	Analysis		PFam/NR	Percent	NT	NT
NO: Z	ID:	NO: X	Method	PFam/NR Description	Accession Number	Identity	From	To
HANGC59	653577	20	HMMER 1.8	PFAM: Core histones	PF00125	11.44	96	164
				H2A, H2B, H3 and H4
HAOAE53	964029	41	HMMER 1.8	PFAM: Zinc finger,	PF00098	6.5	136	168
				CCHC class
HAOAE56	767915	42	blastx.2	(AF098066) squamous	gb|AAF00087.1|AF0980661_1	88%	1	228
				cell carcinoma antigen
				recognized by T cell
				[Homo sapiens]
HBCKE78	746109	55	blastx.2	(AF038606) contains	gb|AAB92026.1|	43%	55	225
				similarity to cytoskeletal
				keratin [Caenorhabditis
				elegans]
HBFMC73	764150	56	blastx.2	(AK000496) unnamed	dbj|BAA91205.1|	66%	210	22
				protein product [Homo		100%	23	3
				sapiens]
HBSAL69	573004	58	blastx.2	23 kD protein	gb|AAA61994.1|	71%	423	130
				[Escherichia coli]		100%	103	2
						60%	422	366
HBSAL80	506580	59	blastx.2	No definition line found	gb|AAB18589.1|	86%	378	82
				[Escherichia coli]
HBSAM48	727635	61	blastx.2	Pyruvate formate-lyase	dbj|BAA35637.1|	87%	56	322
				1 activating enzyme (EC
				1.97.1.4). [Escherichia
				coli]
HBSAP73	764589	63	blastx.2	homoserine kinase	gb|AAA20618.1|	99%	467	3
				[Escherichia coli]
HBSDB50	571365	65	HMMER	PFAM: TCP-1/cpn60	PF00118	89.7	2	226
			2.1.1	chaperonin family
			blastx.2	groEL protein (AA 1-548)	emb|CAA30698.1|	79%	2	301
				[Escherichia coli]
HBSDB63	745211	66	blastx.2	(AF090895) PRO0117	gb|AAF24019.1|AF090895_1	68%	224	93
				[Homo sapiens]		71%	91	71
HCDAE77	533925	70	blastx.2	(AC006539)	gb|AAD14470.1|	48%	59	238
				BC39498_2 [Homo		46%	59	232
				sapiens]		45%	59	238
						48%	62	223
						47%	62	238
						40%	59	238
						45%	59	238
						42%	62	238
						39%	59	217
						35%	11	238
						37%	7	69
						35%	4	69
						40%	4	69
						63%	4	36
						37%	241	309
HFICA06	934675	125	blastx.14	NADH: ubiquinone	gi|1946692|gb|AAB52726.1|	82%	122	172
				oxidoreductase MLRQ		33%	2	127
				subunit [Homo sapiens]		66%	302	355
HFIHE47	857988	140	blastx.2	weak similarity to ATP	gb|AAA50619.1|	27%	733	1644
				synthase B chain		37%	403	687
				[Caenorhabditis elegans]
HFIHF63	944246	141	HMMER	PFAM: Immunoglobulin	PF00047	22.4	92	364
			2.1.1	domain
HFITZ24	677144	152	HMMER 1.8	PFAM: Zinc finger,	PF00096	4.13	55	99
				C2H2 type
HFIYL01	919416	180	blastx.14	NADH: ubiquinone	gi|1946692|gb|AAB52726.1|	71%	173	277
				oxidoreductase MLRQ		38%	53	178
				subunit [Homo sapiens]
HMUBM26	908912	210	HMMER	PFAM: Zinc finger,	PF00096	119.7	269	337
			2.1.1	C2H2 type
			blastx.2	zinc finger protein	gb|AAA93261.1|	61%	2	508
				C2H2-25 [Homo		62%	2	460
				sapiens]		60%	8	460
						60%	8	460
						59%	8	460
						59%	8	460
						61%	8	436
						50%	29	460
						51%	167	460
						40%	251	460
						28%	254	478
						83%	511	564
						72%	511	564
						72%	511	564
						66%	511	564
						64%	511	561
						61%	511	564
						68%	511	558
						68%	456	512
						63%	456	512
						63%	456	512
						50%	511	564
						61%	511	564
						68%	456	512
						57%	456	512
						57%	456	512
						63%	456	512
						57%	456	512
						47%	456	512
						55%	459	512
HOEAK21	954961	239	blastx.14	similar to Azorhizobium	gi|396396|gb|AAC43155.1|	85%	327	187
				caulinodans hypoth.
				protein, 1
HOEJG04	859251	261	HMMER	PFAM: Pyruvate	PF01855	227.6	3	431
			2.1.1	flavodoxin/ferredoxin
				oxidoreductase (N
				terminus)
HOEMK02	918364	267	blastx.14	Periplasmic chaperone	gi|4062507|dbj|BAA35694.1|	100%	79	2
				focC protein
				[Escherichia coli]
HOEOE25	907806	269	HMMER 1.8	PFAM: Zinc finger,	PF00097	41.99	59	208
				C3HC4 type (RING
				finger)
			blastx.2	(AJ224819) tumor	emb|CAA12136.1|	41%	32	625
				suppressor [Homo
				sapiens]
HRDAF69	956269	331	blastx.14	(AB012223) ORF2	gi|2981631|dbj|BAA25253.1|	42%	4	171
				[Canis familiaris]
HRDBM42	530849	349	HMMER 1.8	PEAM: Helix-loop-helix	PF00010	8.1	139	246
				DNA-binding domain
HRDBT72	507847	356	HMMER 1.8	PFAM: Zinc-binding	PF00099	7.31	295	324
				metalloprotease domain
HSKET11	967000	441	blastx.14	alternate name ygiP;	gi|1203799|gb|AAA89140.1|	96%	2	343
				ORF_310 [Escherichia		100%	331	363
				coli]
HSKHS71	911592	443	HMMER	PFAM: Ank repeat	PF00023	63.1	94	192
			2.1.1
			blastx.14	contains 10 ankyrin-like	gi|2447128|gb|AAC96986.1|	42%	106	366
				repeats; similar to		36%	97	357
				human 1 [Paramecium		35%	103	372
				bursaria Chlorella virus		35%	100	372
				1]		38%	103	357
						31%	103	366
						40%	196	381
						35%	1	84
HSKKD70	916984	446	blastx.14	ORF_f268a [Escherichia	gi|537144|gb|AAA97199.1|	93%	420	1
				coli]
HSLBZ91	573987	467	HMMER	PFAM: Domain of	PF00990	78.1	6	254
			2.1.1	unknown function
HSLCJ47	908627	470	blastx.14	basonuclin [Homo	gi|179337|gb|AAA35584.1|	54%	263	361
				sapiens]
HSLCL38	951028	471	blastx.14	3-oxoacyl-[acyl-carrier-	gi|4062664|dbj|BAA35903.1|	88%	41	202
				protein] synthase (EC		100%	3	41
				2.3.1.41) II [Escherichia
				coli]
HSLDG13	913664	477	blastx.14	melibiose carrier	gi|146804|gb|AAA24148.1|	96%	274	2
				[Escherichia coli]		66%	314	270
HSLDP16	573210	484	HMMER	PFAM: 6,7-dimethyl-8-	PF00885	184.6	8	271
			2.1.1	ribityllumazine synthase
HSLEC25	572859	487	HMMER	PFAM: Methylmalonyl-	PF01642	20	8	76
			2.1.1	CoA mutase
HSLED38	709381	489	HMMER	PFAM: Fructose-1-6-	PF00316	47.3	369	473
			2.1.1	bisphosphatase
HSLEG74	825500	493	HMMER 1.8	PFAM: Bacterial mutT	PF00293	2.42	30	98
				protein
HSLFS42	948740	501	blastx.14	RhsE protein	gi|1742368|dbj|BAA15087.1|	100%	34	300
				(fragment). [Escherichia		100%	2	34
				coli]
HSLFU01	916448	505	blastx.14	Rod protein FlgC	gi|4062651|dbj|BAA35882.1|	89%	259	5
				[Escherichia coli]		100%	383	261
						100%	408	385
HSLIJ57	659533	517	HMMER	PFAM: Pyridoxal-	PF00278	94	150	365
			2.1.1	dependent
				decarboxylase
HSLJN49	920062	523	blastx.14	Spermidine/putrescine	gi|1651552|dbj|BAA35945.1|	98%	246	1
				transport system		80%	427	245
				permease protein PotB.
				[Escherichia coli]
HSSAN96	936108	567	blastx.14	(AF000531) Tat protein	gi|2245487|gb|AAB62530.1|	63%	246	214
				[Human		63%	56	24
				immunodeficiency		30%	108	49
				virus type 1]
HSSBO48	871217	571	HMMER 1.8	PFAM: Sugar (and	PF00083	9.8	26	232
				other) transporters
HSSEU93	911261	583	blastx.14	(AJ007012) Fish protein	gi|3702174|emb|CAA07416.1|	65%	66	212
				[Mus musculus]		39%	69	212
						53%	191	229
						54%	208	240
HSSAA15	965347	664	blastx.14	SM-20 [Rattus	gi|469478|gb|AAA19321.1|	77%	111	434
				norvegicus]
HSRAA80	937640	683	HMMER 1.8	PFAM: Reverse	PF00078	20.88	11	130
				transcriptase (RNA-
				dependent DNA
				polymerase)
			blastx.14	(AF080232) polymerase	gi|3600069|gb|AAC63292.1|	65%	17	325
				[Human endogenous
				retrovirus K]
HSLKB62	905738	690	HMMER	PFAM:	PF00912	310.2	344	850
			2.1.1	Transglycosylase
			blastx.14	ORF_f242 [Escherichia	gi|606147|gb|AAA58010.1|	93%	290	937
				coli]
HSLJF33	938811	694	blastx.2	(AE000391) putative	gb|AAC76123.1|	84%	3	527
				transport protein
				[Escherichia coli]
HSLJD02	965826	695	HMMER 1.8	PFAM: Sugar (and	PF00083	19.53	464	874
				other) transporters
			blastx.2	UhpC protein	gb|AAA24722.1|	100%	56	907
				[Escherichia coli]
HSLHZ10	963808	701	blastx.14	Hypothetical 17.3 kd	gi|4902983|dbj|BAA77917.1|	97%	308	180
				protein in alpA-gabD		100%	178	128
				intergenic region (o152).
				[Escherichia coli]
HSLHV27	964075	702	HMMER	PFAM: NADH-	PF00361	115.1	917	615
			2.1.1	Ubiquinone/plastoquinone
				(complex I), various
				chains
			blastx.2	NADH dehydrogenase I,	emb|CAA48371.1|	99%	91	954
				subunit nuoL
				[Escherichia coli]
HSLGO19	668634	708	HMMER 1.8	PFAM: Basic region	PF00170	17.19	265	372
				plus leucine zipper
				transcription factors
HSLGA24	955333	722	HMMER	PFAM: Mur ligase	PF01225	119.9	772	386
			2.1.1	family
			blastx.2	UDP-MurNac-tripeptide	dbj|BAA01350.1|	91%	33	476
				synthetase (MurE)		99%	434	805
				[Escherichia coli]
HSLFT29	680451	724	HMMER 1.8	PFAM: Sigma-70	PF00140	224.55	1	399
				factors
HSLDT25	949079	730	HMMER	PFAM: FecCD transport	PF01032	86.6	1331	921
			2.1.1	family
			blastx.2	ferrichrome-iron	gb|AAB08583.1|	92%	32	712
				transport protein FhuB		97%	661	1026
				[Escherichia coli]		35%	673	1011
						28%	101	613
						69%	3	41
HSLDR05	932128	732	blastx.14	UhpC protein	gi|148114|gb|AAA24722.1|	97%	98	220
				[Escherichia coli]		100%	3	95
						42%	127	168
HSLCX61	742031	738	HMMER	PFAM: KRAB box	PF01352	49.2	373	474
			2.1.1
HSLCF96	637670	739	HMMER 1.8	PFAM: Sugar (and	PF00083	10.78	415	576
				other) transporters
			blastx.2	(AE000352) putative	gb|AAC75728.1|	94%	415	1179
				transport protein		100%	297	413
				[Escherichia coli]		70%	1101	1211
						20%	409	600
						26%	1021	1179
HSLCF96	954777	1016	HMMER 1.8	PFAM: Sugar (and	PF00083	30.03	1296	1015
				other) transporters
			blastx.2	(AE000352) putative	gb|AAC75728.1|	96%	303	1127
				transport protein		91%	1147	1215
				[Escherichia coli]
HSKKE11	965857	744	blastx.14	cDNA EST	gi|3877299|emb|CAA93496.1|	88%	117	245
				EMBL: D70203 comes		62%	28	75
				from this gene; cDNA		100%	3	26
				EST 11 yk403g7.5
				comes from this gene;
				cDNA EST
				EMBL: C08962 comes
				from
HSKHT93	957866	749	blastx.14	(AF117815)	gi|4235630|gb|AAD13296.1|	80%	275	364
				molybdopterin synthase
				small subunit [Homo
				sapiens]
HSKEH21	941976	752	blastx.14	diacylglycerol kinase eta	gi|1401232|gb|AAC52714.1|	87%	8	703
				[Cricetinae gen. sp.]
HSKCR54	922730	754	HMMER	PFAM: Ribosomal	PF01196	29.6	260	394
			2.1.1	protein L17
HSKBW86	785783	756	HMMER	PFAM: Bacterial	PF01103	75.2	1	165
			2.1.1	surface antigen
HSHCL04	840406	765	blastx.2	(AF118082) PRO1902	gb|AAF22026.1|AF118094_21	70%	651	559
				[Homo sapiens]		61%	326	273
HOSMP95	948496	794	blastx.14	unknown [Mus	gi|1490330|emb|CAB01546.1|	77%	3	146
				musculus]
HOSCV06	960555	809	blastx.2	(AL133104)	emb|CAB61411.1|	100%	45	191
				hypothetical protein
				[Homo sapiens]
HOHAV60	489007	842	HMMER 1.8	PFAM: PH (pleckstrin	PF00169	15.98	111	212
				homology) domain
HOHAI11	965035	1026	blastx.14	10-	gi|908915|gb|AAA70429.1|	69%	102	422
				formyltetrahydrofolate		100%	431	448
				dehydrogenase [Rattus
				norvegicus]
HOEEU57	932562	853	HMMER	PFAM: MYND finger	PF01753	45.6	139	255
			2.1.1
			blastx.14	skm-BOP2 [Mus	gi|5870834|gb|AAC53022.2|	39%	76	279
				musculus]		41%	556	750
						22%	289	552
HOABG91	811156	863	HMMER 1.8	PFAM: Low-density	PF00058	23.5	46	174
				lipoprotein receptor
				domain class B
HFOZC29	923288	903	blastx.14	coatomer [Bos taurus]	gi|441486|emb|CAA53539.1|	87%	568	422
HFOYG86	955554	1029	blastx.2	G protein-coupled	emb|CAA80651.1|	31%	8	727
				receptor [Lymnaea
				stagnalis]
HFOXL88	909839	928	blastx.14	(AC004084) similar to	gi|2822157|gb|AAB97935.1|	97%	305	171
				GTPase-activating		100%	425	303
				proteins; 1		72%	180	148
						83%	411	394
HFIXP31	697759	949	HMMER	PFAM: BTB/POZ	PF00651	49.8	9	146
			2.1.1	domain
HFIHW91	907618	975	HMMER	PFAM: ADP-	PF00025	82.4	222	500
			2.1.1	ribosylation factor
				family
			blastx.14	GTP-binding protein	gi|290213|gb|AAA74629.1|	31%	288	488
				[Drosophila		54%	222	287
				melanogaster]
HFIHW11	947856	977	blastx.14	Similarity to Yeast	gi|4008355|emb|CAA92596.1|	81%	3	146
				TAT-binding homolog 7
				111 EMB
HFIDL68	928475	986	HMMER 1.8	PFAM: 7	PF00001	50.42	8	319
				transmembrane receptor
				(rhodopsin family)
			blastx.2	G protein-coupled	emb|CAA80651.1|	41%	11	340
				receptor [Lymnaea
				stagnalis]
HFIBK83	939556	988	blastx.14	contains similarity to	gi|1519671|gb|AAB07572.1|	38%	20	289
				ATP/GTP-binding site
				motif (PS: PS00017)
				[Caenorhabditis elegans]
HCOKA10	907080	992	HMMER	PFAM: Ribosomal	PF01199	229.8	509	213
			2.1.1	protein L34e
			blastx.2	ribosomal protein L34	gb|AAC41916.1|	98%	521	216
				[Homo sapiens]
HCOKA10	918918	1031	HMMER	PFAM: Small cytokines	PF00048	124.2	1447	1238
			2.1.1	(intecrine/chemokine),
				interleukin-8 like
			blastx.14	granulocyte chemotactic	pir|B54188|B54188	100%	1444	1223
				protein, GCP-2 —bovine
HCOKA10	919869	1032	HMMER	PFAM: Small cytokines	PF00048	124.2	169	378
			2.1.1	(intecrine/chemokine),
				interleukin-8 like

[0073] Table 2 further characterizes certain encoded polypeptides of the invention, by providing the results of comparisons to protein and protein family databases. The first column provides a unique clone identifier, “Clone ID NO:”, corresponding to a cDNA clone disclosed in Table 1A. The second column provides the unique contig indentifier, “Contig ID:” which allows correlation with the information in Table 1A. The third column provides the sequence identifier, “SEQ ID NO:X”, for the contig polynucleotide sequences. The fourth column provides the analysis method by which the homology/identity disclosed in the row was determined. The fifth column provides a description of PFam/NR hits having significant matches identified by each analysis. Column six provides the accession number of the PFam/NR hit disclosed in the fifth column. Column seven, “Score/Percent Identity”, provides a quality score or the percent identity, of the hit disclosed in column five. Comparisons were made between polypeptides encoded by polynucleotides of the invention and a non-redundant protein database (herein referred to as “NR”), or a database of protein families (herein referred to as “PFam”), as described below.

[0074] The NR database, which comprises the NBRF PIR database, the NCBI GenPept database, and the SIB SwissProt and TrEMBL databases, was made non-redundant using the computer program nrdb2 (Warren Gish, Washington University in Saint Louis). Each of the polynucleotides shown in Table 1A, column 3 (e.g., SEQ ID NO:X or the ‘Query’ sequence) was used to search against the NR database. The computer program BLASTX was used to compare a 6-frame translation of the Query sequence to the NR database (for information about the BLASTX algorithm please see Altshul et al., J. Mol. Biol. 215:403-410 (1990), and Gish et al., Nat. Genet. 3:266-272 (1993)). A description of the sequence that is most similar to the Query sequence (the highest scoring ‘Subject’) is shown in column five of Table 2 and the database accession number for that sequence is provided in column six. The highest scoring ‘Subject’ is reported in Table 2 if (a) the estimated probability that the match occurred by chance alone is less than 1.0e-07, and (b) the match was not to a known repetitive element. BLASTX returns alignments of short polypeptide segments of the Query and Subject sequences which share a high degree of similarity; these segments are known as High-Scoring Segment Pairs or HSPs. Table 2 reports the degree of similarity between the Query and the Subject for each HSP as a percent identity in Column 7. The percent identity is determined by dividing the number of exact matches between the two aligned sequences in the HSP, dividing by the number of Query amino acids in the HSP and multiplying by 100. The polynucleotides of SEQ ID NO:X which encode the polypeptide sequence that generates an HSP are delineated by columns 8 and 9 of Table 2.

[0075] The PFam database, PFam version 5.2, (Sonnhammer et al., Nucl. Acids Res., 26:320-322, (1998)) consists of a series of multiple sequence alignments; one alignment for each protein family. Each multiple sequence alignment is converted into a probability model called a Hidden Markov Model, or HMM, that represents the position-specific variation among the sequences that make up the multiple sequence alignment (see, e.g., R. Durbin et al., Biological sequence analysis. probabilistic models of proteins and nucleic acids, Cambridge University Press, 1998 for the theory of HMMs). The program HMMER version 1.8 (Sean Eddy, Washington University in Saint Louis) was used to compare the predicted protein sequence for each Query sequence (SEQ ID NO:Y in Table 1A) to each of the HMMs derived from PFam version 5.2. A HMM derived from PFam version 5.2 was said to be a significant match to a polypeptide of the invention if the score returned by HMMER 1.8 was greater than 0.8 times the HMMER 1.8 score obtained with the most distantly related known member of that protein family. The description of the PFam family which shares a significant match with a polypeptide of the invention is listed in column 5 of Table 2, and the database accession number of the PFam hit is provided in column 6. Column 7 provides the score returned by HMMER version 1.8 for the alignment. Columns 8 and 9 delineate the polynucleotides of SEQ ID NO:X which encode the polypeptide sequence which shows a significant match to a PFam protein family.

[0076] As mentioned, columns 8 and 9 in Table 2, “NT From” and “NT To”, delineate the polynucleotides of “SEQ ID NO:X” that encode a polypeptide having a significant match to the PFam/NR database as disclosed in the fifth column of Table 2. In one embodiment, the invention provides a protein comprising, or alternatively consisting of, a polypeptide encoded by the polynucleotides of SEQ ID NO:X delineated in columns 8 and 9 of Table 2. Also provided are polynucleotides encoding such proteins, and the complementary strand thereto.

[0077] The nucleotide sequence SEQ ID NO:X and the translated SEQ ID NO:Y are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below. For instance, the nucleotide sequences of SEQ ID NO:X are useful for designing nucleic acid hybridization probes that will detect nucleic acid sequences contained in SEQ ID NO:X or the cDNA contained in Clone ID NO:Z. These probes will also hybridize to nucleic acid molecules in biological samples, thereby enabling immediate applications in chromosome mapping, linkage analysis, tissue identification and/or typing, and a variety of forensic and diagnostic methods of the invention. Similarly, polypeptides identified from SEQ ID NO:Y may be used to generate antibodies which bind specifically to these polypeptides, or fragments thereof, and/or to the polypeptides encoded by the cDNA clones identified in, for example, Table 1A.

[0078] Nevertheless, DNA sequences generated by sequencing reactions can contain sequencing errors. The errors exist as misidentified nucleotides, or as insertions or deletions of nucleotides in the generated DNA sequence. The erroneously inserted or deleted nucleotides cause frame shifts in the reading frames of the predicted amino acid sequence. In these cases, the predicted amino acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than 99.9% identical to the actual DNA sequence (for example, one base insertion or deletion in an open reading frame of over 1000 bases).

[0079] Accordingly, for those applications requiring precision in the nucleotide sequence or the amino acid sequence, the present invention provides not only the generated nucleotide sequence identified as SEQ ID NO:X, and a predicted translated amino acid sequence identified as SEQ ID NO:Y, but also a sample of plasmid DNA containing cDNA Clone ID NO:Z deposited with the ATCC (deposited with the ATCC on Oct. 5, 2000, and receiving ATCC designation numbers PTA 2574 and PTA 2575; deposited with the ATCC on Jan. 5, 2001, having the depositor reference numbers TS-1, TS-2, AC-1, and AC-2; and/or as set forth, for example, in Table 1A, 6 and 7). The nucleotide sequence of each deposited clone can readily be determined by sequencing the deposited clone in accordance with known methods. Further, techniques known in the art can be used to verify the nucleotide sequences of SEQ ID NO:X.

[0080] The predicted amino acid sequence can then be verified from such deposits. Moreover, the amino acid sequence of the protein encoded by a particular clone can also be directly determined by peptide sequencing or by expressing the protein in a suitable host cell containing the deposited human cDNA, collecting the protein, and determining its sequence.

[0081] RACE Protocol for Recovery of Full-Length Genes

[0082] Partial cDNA clones can be made full-length by utilizing the rapid amplification of cDNA ends (RACE) procedure described in Frohman, M. A., et al., Proc. Nat'l. Acad. Sci. USA, 85:8998-9002 (1988). A cDNA clone missing either the 5′ or 3′ end can be reconstructed to include the absent base pairs extending to the translational start or stop codon, respectively. In some cases, cDNAs are missing the start codon of translation. The following briefly describes a modification of this original 5′ RACE procedure. Poly A+ or total RNA is reverse transcribed with Superscript II (Gibco/BRL) and an antisense or complementary primer specific to the cDNA sequence. The primer is removed from the reaction with a Microcon Concentrator (Amicon). The first-strand cDNA is then tailed with dATP and terminal deoxynucleotide transferase (Gibco/BRL). Thus, an anchor sequence is produced which is needed for PCR amplification. The second strand is synthesized from the dA-tail in PCR buffer, Taq DNA polymerase (Perkin-Elmer Cetus), an oligo-dT primer containing three adjacent restriction sites (XhoI, SalI and ClaI) at the 5′ end and a primer containing just these restriction sites. This double-stranded cDNA is PCR amplified for 40 cycles with the same primers as well as a nested cDNA-specific antisense primer. The PCR products are size-separated on an ethidium bromide-agarose gel and the region of gel containing cDNA products the predicted size of missing protein-coding DNA is removed. cDNA is purified from the agarose with the Magic PCR Prep kit (Promega), restriction digested with XhoI or SalI, and ligated to a plasmid such as pBluescript SKII (Stratagene) at XhoI and EcoRV sites. This DNA is transformed into bacteria and the plasmid clones sequenced to identify the correct protein-coding inserts. Correct 5′ ends are confirmed by comparing this sequence with the putatively identified homologue and overlap with the partial cDNA clone. Similar methods known in the art and/or commercial kits are used to amplify and recover 3′ ends.

[0083] Several quality-controlled kits are commercially available for purchase. Similar reagents and methods to those above are supplied in kit form from Gibco/BRL for both 5′ and 3′ RACE for recovery of full length genes. A second kit is available from Clontech which is a modification of a related technique, SLIC (single-stranded ligation to single-stranded cDNA), developed by Dumas et al., Nucleic Acids Res., 19:5227-32 (1991). The major differences in procedure are that the RNA is alkaline hydrolyzed after reverse transcription and RNA ligase is used to join a restriction site-containing anchor primer to the first-strand cDNA. This obviates the necessity for the dA-tailing reaction which results in a polyT stretch that is difficult to sequence past.

[0084] An alternative to generating 5′ or 3′ cDNA from RNA is to use cDNA library double-stranded DNA. An asymmetric PCR-amplified antisense cDNA strand is synthesized with an antisense cDNA-specific primer and a plasmid-anchored primer. These primers are removed and a symmetric PCR reaction is performed with a nested cDNA-specific antisense primer and the plasmid-anchored primer.

[0085] RNA Ligase Protocol for Generating the 5′ or 3′ End Sequences to Obtain Full Length Genes

[0086] Once a gene of interest is identified, several methods are available for the identification of the 5′ or 3′ portions of the gene which may not be present in the original cDNA plasmid. These methods include, but are not limited to, filter probing, clone enrichment using specific probes and protocols similar and identical to 5′ and 3′ RACE. While the full length gene may be present in the library and can be identified by probing, a useful method for generating the 5′ or 3′ end is to use the existing sequence information from the original cDNA to generate the missing information. A method similar to 5′ RACE is available for generating the missing 5′ end of a desired full-length gene. (This method was published by Fromont-Racine et al., Nucleic Acids Res., 21(7):1683-1684 (1993)). Briefly, a specific RNA oligonucleotide is ligated to the 5′ ends of a population of RNA presumably containing full-length gene RNA transcript. A primer set containing a primer specific to the ligated RNA oligonucleotide and a primer specific to a known sequence of the gene of interest, is used to PCR amplify the 5′ portion of the desired full length gene which may then be sequenced and used to generate the full length gene. This method starts with total RNA isolated from the desired source, poly A RNA may be used but is not a prerequisite for this procedure. The RNA preparation may then be treated with phosphatase if necessary to eliminate 5′ phosphate groups on degraded or damaged RNA, which may interfere with the later RNA ligase step. The phosphatase, if used, is then inactivated and the RNA is treated with tobacco acid pyrophosphatase in order to remove the cap structure present at the 5′ ends of messenger RNAs. This reaction leaves a 5′ phosphate group at the 5′ end of the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using T4 RNA ligase. This modified RNA preparation can then be used as a template for first strand cDNA synthesis using a gene specific oligonucleotide. The first strand synthesis reaction can then be used as a template for PCR amplification of the desired 5′ end using a primer specific to the ligated RNA oligonucleotide and a primer specific to the known sequence of the musculoskeletal system antigen of interest. The resultant product is then sequenced and analyzed to confirm that the 5′ end sequence belongs to the relevant musculoskeletal system antigen.

[0087] The present invention also relates to vectors or plasmids, which include such DNA sequences, as well as the use of the DNA sequences. The material deposited with the ATCC (deposited with the ATCC on Oct. 5, 2000, and receiving ATCC designation numbers PTA 2574 and PTA 2575; deposited with the ATCC on Jan. 5, 2001, having the depositor reference numbers TS-1, TS-2, AC-1, and AC-2; and/or as set forth, for example, in Table 1 A, 6 and 7) is a mixture of cDNA clones derived from a variety of human tissue and cloned in either a plasmid vector or a phage vector, as shown, for example, in Table 7. These deposits are referred to as “the deposits” herein. The tissues from which some of the clones were derived are listed in Table 7, and the vector in which the corresponding cDNA is contained is also indicated in Table 7. The deposited material includes cDNA clones corresponding to SEQ ID NO:X described, for example, in Table 1A (Clone ID NO:Z). A clone which is isolatable from the ATCC Deposits by use of a sequence listed as SEQ ID NO:X, may include the entire coding region of a human gene or in other cases such clone may include a substantial portion of the coding region of a human gene. Furthermore, although the sequence listing may in some instances list only a portion of the DNA sequence in a clone included in the ATCC Deposits, it is well within the ability of one skilled in the art to sequence the DNA included in a clone contained in the ATCC Deposits by use of a sequence (or portion thereof) described in, for example Tables 1A or 2 by procedures hereinafter further described, and others apparent to those skilled in the art.

[0088] Also provided in Table 7 is the name of the vector which contains the cDNA clone. Each vector is routinely used in the art. The following additional information is provided for convenience.

[0089] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636), Uni-Zap XR (U.S. Pat. Nos. 5,128,256 and 5,286,636), Zap Express (U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short, J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees, M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK (Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are commercially available from Stratagene Cloning Systems, Inc., 11011 N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an ampicillin resistance gene and pBK contains a neomycin resistance gene. Phagemid pBS may be excised from the Lambda Zap and Uni-Zap XR vectors, and phagemid pBK may be excised from the Zap Express vector. Both phagemids may be transformed into E. coli strain XL-1 Blue, also available from Stratagene.

[0090] Vectors pSport1, pCMVSport 1.0, pCMVSport 2.0 and pCMVSport 3.0, were obtained from Life Technologies, Inc., P. O. Box 6009, Gaithersburg, Md. 20897. All Sport vectors contain an ampicillin resistance gene and may be transformed into E. coli strain DH10B, also available from Life Technologies. See, for instance, Gruber, C. E., et al., Focus 15:59-(1993). Vector lafmid BA (Bento Soares, Columbia University, New York, N.Y.) contains an ampicillin resistance gene and can be transformed into E. coli strain XL-1 Blue. Vector pCR®2.1, which is available from Invitrogen, 1600 Faraday Avenue, Carlsbad, Calif. 92008, contains an ampicillin resistance gene and may be transformed into E. coli strain DH10B, available from Life Technologies. See, for instance, Clark, J. M., Nuc. Acids Res. 16:9677-9686 (1988) and Mead, D. et al., Bio/Technology 9: (1991).

[0091] The present invention also relates to the genes corresponding to SEQ ID NO:X, SEQ ID NO:Y, and/or the deposited clone (Clone ID NO:Z). The corresponding gene can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include preparing probes or primers from the disclosed sequence and identifying or amplifying the corresponding gene from appropriate sources of genomic material.

[0092] Also provided in the present invention are allelic variants, orthologs, and/or species homologs. Procedures known in the art can be used to obtain full-length genes, allelic variants, splice variants, full-length coding portions, orthologs, and/or species homologs of musculoskeletal system associated genes corresponding to SEQ ID NO:X or the complement thereof, polypeptides encoded by SEQ ID NO:X or the complement thereof, and/or the cDNA contained in Clone ID NO:Z, using information from the sequences disclosed herein or the clones deposited with the ATCC. For example, allelic variants and/or species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for allelic variants and/or the desired homologue.

[0093] The polypeptides of the invention can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.

[0094] The polypeptides may be in the form of the secreted protein, including the mature form, or may be a part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production.

[0095] The polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified. A recombinantly produced version of a polypeptide, including the secreted polypeptide, can be substantially purified using techniques described herein or otherwise known in the art, such as, for example, by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988). Polypeptides of the invention also can be purified from natural, synthetic or recombinant sources using techniques described herein or otherwise known in the art, such as, for example, antibodies of the invention raised against the musculoskeletal system polypeptides of the present invention in methods which are well known in the art.

[0096] The present invention provides a polynucleotide comprising, or alternatively consisting of, the nucleic acid sequence of SEQ ID NO:X, and/or the cDNA sequence contained in Clone ID NO:Z. The present invention also provides a polypeptide comprising, or alternatively, consisting of, the polypeptide sequence of SEQ ID NO:Y, a polypeptide encoded by SEQ ID NO:X or a complement thereof, a polypeptide encoded by the cDNA contained in Clone ID NO:Z, and/or the polypeptide sequence encoded by a nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B. Polynucleotides encoding a polypeptide comprising, or alternatively consisting of the polypeptide sequence of SEQ ID NO:Y, a polypeptide encoded by SEQ ID NO:X, a polypeptide encoded by the cDNA contained in Clone ID NO:Z and/or a polypeptide sequence encoded by a nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B are also encompassed by the invention. The present invention further encompasses a polynucleotide comprising, or alternatively consisting of, the complement of the nucleic acid sequence of SEQ ID NO:X, a nucleic acid sequence encoding a polypeptide encoded by the complement of the nucleic acid sequence of SEQ ID NO:X, and/or the cDNA contained in Clone ID NO:Z.

[0097] Moreover, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in Table 1B column 6, or any combination thereof. Additional, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the complementary strand(s) of the sequences delineated in Table 1B column 6, or any combination thereof. In further embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in Table 1B, column 6, and have a nucleic acid sequence which is different from that of the BAC fragment having the sequence disclosed in SEQ ID NO:B (see Table 1B, column 5). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in Table 1B, column 6, and have a nucleic acid sequence which is different from that published for the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in Table 1B, column 6, and have a nucleic acid sequence which is different from that contained in the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides and polypeptides are also encompassed by the invention.

[0098] Further, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1), or any combination thereof. Additional, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the complementary strand(s) of the sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1), or any combination thereof. In further embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1) and have a nucleic acid sequence which is different from that of the BAC fragment having the sequence disclosed in SEQ ID NO:B (see Table 1B, column 5). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1) and have a nucleic acid sequence which is different from that published for the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1) and have a nucleic acid sequence which is different from that contained in the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides and polypeptides are also encompassed by the invention.

[0099] Further, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in column 6 of Table 1B which correspond to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2), or any combination thereof. Additional, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the complementary strand(s) of the sequences delineated in column 6 of Table 1B which correspond to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2), or any combination thereof. In further embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2) and have a nucleic acid sequence which is different from that of the BAC fragment having the sequence disclosed in SEQ ID NO:B (see Table 1B, column 5). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2) and have a nucleic acid sequence which is different from that published for the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in column 6 of Table 1B which correspond to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2) and have a nucleic acid sequence which is different from that contained in the BAC clone identified as BAC ID NO:A (See Table 1B, column 4). Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides and polypeptides are also encompassed by the invention.

[0100] Moreover, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in the same row of Table 1B column 6, or any combination thereof. Additional, representative examples of polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the complementary strand(s) of the sequences delineated in the same row of Table 1B column 6, or any combination thereof. In preferred embodiments, the polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the complementary strand(s) of the sequences delineated in the same row of Table 1B column 6, wherein sequentially delineated sequences in the table (i.e. corresponding to those exons located closest to each other) are directly contiguous in a 5′ to 3′ orientation. In further embodiments, above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in the same row of Table 1B, column 6, and have a nucleic acid sequence which is different from that of the BAC fragment having the sequence disclosed in SEQ ID NO:B (see Table 1B, column 5). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in the same row of Table 1B, column 6, and have a nucleic acid sequence which is different from that published for the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated in the same row of Table 1B, column 6, and have a nucleic acid sequence which is different from that contained in the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0101] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in column 6 of Table 1B, and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1B, column 2) or fragments or variants thereof. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0102] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1), and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1A or 1B) or fragments or variants thereof. In preferred embodiments, the delineated sequence(s) and polynucleotide sequence of SEQ ID NO:X correspond to the same Clone ID NO:Z. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0103] In further specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more of the sequences delineated in the same row of column 6 of Table 1B, and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1A or 1B) or fragments or variants thereof. In preferred embodiments, the delineated sequence(s) and polynucleotide sequence of SEQ ID NO:X correspond to the same row of column 6 of Table 1B. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0104] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of the sequence of SEQ ID NO:X are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0105] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of a fragment or variant of the sequence of SEQ ID NO:X are directly contiguous Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0106] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of the sequence of SEQ ID NO:X and the 5′ 10 polynucleotides of the sequence of one of the sequences delineated in column 6 of Table 1B are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0107] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of a fragment or variant of the sequence of SEQ ID NO:X and the 5′ 10 polynucleotides of the sequence of one of the sequences delineated in column 6 of Table 1B are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides, are also encompassed by the invention.

[0108] In further specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of another sequence in column 6 are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0109] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of another sequence in column 6 corresponding to the same Clone ID NO:Z (see Table 1B, column 1) are directly contiguous. Nucleic acids which hybridize to the complement of these 20 lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0110] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3′ 10 polynucleotides of one sequence in column 6 corresponding to the same contig sequence identifer SEQ ID NO:X (see Table 1B, column 2) are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0111] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of another sequence in column 6 corresponding to the same row are directly contiguous. In preferred embodiments, the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B is directly contiguous with the 5′ 10 polynucleotides of the next sequential exon delineated in Table 1B, column 6. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0112] Many polynucleotide sequences, such as EST sequences, are publicly available and accessible through sequence databases and may have been publicly available prior to conception of the present invention. Preferably, such related polynucleotides are specifically excluded from the scope of the present invention. Accordingly, for each contig sequence (SEQ ID NO:X) listed in the third column of Table 1A, preferably excluded are one or more polynucleotides comprising a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 and the final nucleotide minus 15 of SEQ ID NO:X, b is an integer of 15 to the final nucleotide of SEQ ID NO:X, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO:X, and where b is greater than or equal to a+14. More specifically, preferably excluded are one or more polynucleotides comprising a nucleotide sequence described by the general formula of a-b, where a and b are integers as defined in columns 4 and 5, respectively, of Table 3. In specific embodiments, the polynucleotides of the invention do not consist of at least one, two, three, four, five, ten, or more of the specific polynucleotide sequences referenced by the Genbank Accession No. as disclosed in column 6 of Table 3 (including for example, published sequence in connection with a particular BAC clone). In further embodiments, preferably excluded from the invention are the specific polynucleotide sequence(s) contained in the clones corresponding to at least one, two, three, four, five, ten, or more of the available material having the accession numbers identified in the sixth column of this Table (including for example, the actual sequence contained in an identified BAC clone). In no way is this listing meant to encompass all of the sequences which may be excluded by the general formula, it is just a representative example. All references available through these accessions are hereby incorporated by reference in their entirety.

TABLE 3
	SEQ
	ID		EST Disclaimer
Clone ID	NO:	Contig	Range	Range
NO: Z	X	ID:	of a	of b	Accession #'s
HANGA63	11	927404	1-248	15-262	AL133312.
HANGA69	12	718174	1-431	15-445
HANGA85	13	746265	1-305	15-319
HANGA92	14	791182	1-134	15-148
HANGC05	15	674059	1-144	15-158
HANGC07	16	952586	1-212	15-226
HANGC14	17	952581	1-246	15-260
HANGC30	18	966430	1-324	15-338
HANGC33	19	702072	1-237	15-251
HANGC59	20	653577	1-167	15-181	AI128945, AA181985, AI051473, AI811806, AI742394, AI796471, AA047524,
					AW168284, AA644217, AA461312, AA223990, AI702471, AA449477, AI344611,
					AI084340, AA047404, AI982714, AI655453, AI609227, AI953345, AI918075,
					AI074844, AI948767, AI823646, AI125444, Z40657, AI942374, AA773940,
					AW303808, AA996094, AW235687, AI718217, AW081809, AW339488, R97621,
					AA678046, AA569360, AI581387, AI245396, T80973, AL121270, AI671642,
					AI499483, AL045163, AA809974, AW020592, AL039276, AA715307, AI863629,
					AI624543, AW189802, AA425228, AA975588, AL045620, AW084056, AI923509,
					AA748353, AI064830, AL121328, AA525540, AA768725, AI890507, AA761557,
					N72726, AI343091, AI364788, AW117882, AL119748, AI805774, F37323,
					AI289791, AL043152, AL045500, AI557808, AI432644, AI702065, AI273179,
					AW087445, AI494201, AA641818, AI624279, AI927233, AI312325, AL110402,
					AI269862, AW161202, AI307604, AW019988, AW020419, AI433157, AI648567,
					AI690946, AI554821, AW151136, N99180, AW081349, AA848069, AI539771,
					AI537677, AI636581, AW410430, AI500659, AI866465, AI815232, AI801325,
					AW082113, AL045413, AI500523, AI538850, AI431307, AI887775, AI582932,
					AI590043, AI872423, AI284517, AI923989, AI866786, AI500706, AI445237,
					AI491776, AW151138, AI521560, AI889189, AI500662, AW172723, AI582912,
					AI539800, AI284509, AI889168, AI440263, AI538885, AI866573, AI633493,
					AI434256, AI866469, AI805769, AI434242, AI888661, AW196105, AI500714,
					AI284513, AI888118, AI285439, AI859991, AI436429, AI355779, AI889147,
					AI623736, AI371228, AI581033, AI491710, AI440252, AI860003, AI610557,
					AW162194, AI242736, AW075382, AI828574, AI887499, AW151979, AI539781,
					AI539707, AW071377, AI866820, AI885949, AI285419, AW089557, AI559957,
					AI521571, AI469775, AI866581, AL048644, AI567953, AI815150, AI446495,
					AL042595, AL042745, AW023351, AA743430, AW162189, AL047422, H41759,
					AI348897, AI433037, AI633125, AL041150, AI475817, AI612750, AL037582,
					AL037602, AL043981, AI909696, AI345688, AA460184, R75918, AI867068,
					AL043168, AW197139, AI525669, AI431316, AI275175, AI890907, AA857847,
					AI307494, AW022494, AW269097, AW265004, AI499890, AL040243, AW268072,
					AW268261, AI345608, AI636372, AI620284, AA575874, AI567582, AW020288,
					AI879064, AI309443, AL038564, AI565172, AL039783, AW083804, AI345471,
					AW022299, AL042628, AI561170, AW191003, AI702527, AW020425, AL079799,
					N27632, AI336585, AW020710, AI921057, AI623941, AI309401, AL120254,
					AI923046, AL048375, F36003, AL042627, AI866510, AI557238, AI446373,
					AL039390, AL042365, AL038605, AW238730, AI866461, AF081195, AL117440,
					Z99297, AL122049, AF081197, AC004805, AP000030, E06743, AL137665, E01314,
					AL137574, AL117457, AF141289, AL117435, S68736, I48978, AF113019, S63521,
					S77771, AF111851, A03736, M92439, AC006203, AL133072, I89947, AC004213,
					AR038854, AF162270, Y10080, I46765, Z49258, U77594, A08913, A18777, Z72491,
					AL122106, AC005874, AF134471, A08912, A08910, A08909, I89931, L30117,
					AL034376, AF026124, AF036268, AF158248, I49625, AL122110, AF113690,
					A08908, AL133080, AL133081, S76508, AL133077, AL133049, AR011880,
					AF110520, AF067728, AF058921, AL137558, I89934, I00734, Y10655, D83989,
					AR020905, AF100931, L19437, AL137478, AL137271, AF153205, AF094480,
					AL117649, A91160, E00617, E00717, E00778, AL050092, AL137548, X96540,
					X72889, AF113013, A08916, A65340, AL049314, AF125948, AF022813,
					AR053103, AL031732, AC004544, AF113689, Y10823, S36676, AL080110,
					AF111849, AF090886, AL122121, AC004686, AL033521, AF078844, Z13966,
					AF114818, AC008067, AL110221, M27260, AC005048, AJ010277, AL133568,
					U80742, I03321, AC004383, E07361, D55641, Y11587, AL050277, E02349, Y14314,
					A08907, X67813, U42766, AF061943, AL031274, Z82206, AC004594, AB007812,
					AF061795, AF151685, E06788, E06790, E06789, AJ012755, AL050310, AF169154,
					AF002985, Z98036, AC004989, S75997, AF003737, I89944, A07588, A65341,
					U67958, AL049382, AL133640, AL050172, Z82022, AF183393, AL137554,
					AF106697, J05032, AF113676, X06146, AF151109, AL137488, X93495, AL133565,
					AF061573, AL049452, AL110280, A58524, AL133665, A58523, AF095901, S78214,
					AC005488, AF113691, AL049347, AF026816, X63410, AJ001838, AL133067,
					E03348, AF090934, AF017437, AF113677, A86558, A08911, AF215669, E02253,
					E03349, AF118090, AL080154, U53505, AF079763, AF120268, AR059958, E15324,
					AL117460, AL050108, AF039138, AF039137, and S79832.
HANGC84	21	715991	1-440	15-454
HANGF36	22	952583	1-263	15-277
HANGF49	23	722635	1-112	15-126	AC007320.
HANGG22	24	848727	1-347	15-361
HANGH48	25	718759	1-410	15-424
HANGH53	26	727914	1-460	15-474
HANGH58	27	811987	1-393	15-407
HANGH66	28	661513	1-442	15-456
HANKD09	29	625167	1-334	15-348
HANKD47	30	719963	1-425	15-439
HANKD83	31	963964	1-300	15-314
HANKG78	32	710760	1-180	15-194
HANKG90	33	746282	1-410	15-424
HANKH48	34	721340	1-343	15-357
HANKH56	35	733063	1-360	15-374
HAOAA57	36	955693	1-228	15-242	AW138563, W39428, AA441848, AI928563, AW138262, AI825038, AA985573,
					AW162121, AA063432, AA583586, AW341116, AA372242, N26196, H50245,
					AI565281, AA861973, AA338299, T85197, C00398, AI810565, and AF187318.
HAOAA78	37	756979	1-544	15-558
HAOAA90	38	919249	1-321	15-335
HAOAC05	39	932017	1-502	15-516
HAOAD47	40	864899	1-473	15-487	AC005495.
HAOAE53	41	964029	1-368	15-382
HAOAE56	42	767915	1-323	15-337	AI927761, AW378374, AI932972, AI690765, T58205, AF098066, and Z84488.
HAOAE60	43	657909	1-226	15-240	AA348977.
HAOAF68	44	752788	1-951	15-965	AA031836, AA031837, AA909082, and AL134312.
HAOAH38	45	705946	1-325	15-339	AC005036.
HAOMA13	46	915881	1-414	15-428
HAOMB64	47	960293	1-599	15-613
HAOMC21	48	670518	1-542	15-556
HAOMD90	49	788658	1-395	15-409	AL050343.
HAOME45	50	705947	1-506	15-520
HBCGA72	51	756953	1-137	15-151	AI126076, AI539265, AI458605, AW379387, and AW368357.
HBCKB24	52	676825	1-482	15-496
HBCKB82	53	779562	1-522	15-536	AA961486.
HBCKE22	54	674041	1-147	15-161	AI954693, AI656728, AI281560, and AA491824.
HBCKE78	55	746109	1-647	15-661	AA204666, AA171635, AA632321, AA814237, AA631958, AW389228, AI167680,
					AI274831, AW023312, AA860756, AA631959, AW450236, T49450, AI168544,
					AI332870, AB014543, AC004494, and AC004224.
HBFMC73	56	764150	1-385	15-399	AL135357, AW196064, AI002744, AA536040, AA515905, AA502860, AA493708,
					AI524360, AI252274, AI591375, AW274349, AA527602, AI053911, AI872020,
					AA658362, AA595499, AW020992, AA580808, AA630672, F17555, AA847499,
					AW237875, AI249880, AL046409, AA531079, AW302711, AA715814, AW270784,
					AI267269, AA613232, AI791913, AA527727, AI674873, AI792133, AI053560,
					AI821714, AI564185, AA574442, AI476049, AA664909, AA493845, AI687343,
					AA642060, AA297666, AA521323, AW339622, AW303196, AI144081, AA362698,
					AL037771, AA521399, AA621381, AA679532, AA749235, AI499938, AA652677,
					AA806796, AI744306, AI682665, AI821785, AW378968, AC007540, AP000495,
					AC004686, AC006151, AC005324, AC002352, AC005183, AC005859, AC004150,
					AL031311, AL117693, AF129756, AC004815, AC003982, AF196779, AC004019,
					Z97053, AC004383, AC004895, AL109829, AC005736, AL096867, AC006130,
					AC004144, AP000696, AL132796, AP000504, AC002115, AL021940, AC004263,
					Z68321, AC007617, AC004912, AC002395, D83989, AC007919, AC003006,
					U85195, AL021397, AC005799, AC002091, AE000658, AP000356, AC005327,
					AC005911, AC000052, AC007073, AL031597, Z93241, AL021155, AL022302,
					AC005863, AL031255, AC003109, AC004253, AP000044, AP000112, AC005668,
					AC002563, AC003689, AP000088, AP000365, AL110502, AC007649, AL080285,
					AL023575, AC004167, X75335, AL080114, Z99756, AC006985, AC006449,
					AC004821, AP000548, AC007114, AC004008, AL109628, AP000359, AC000353,
					AL008730, AL031003, AC006511, AC005822, AL030997, AP000117, AL034451,
					U89337, AC001231, AL035072, AC006251, AC002350, Z82976, AL035405,
					AC004655, AP000354, AL009177, AP000143, AC007371, AC006057, AC005261,
					AF111169, AC006539, AC005081, AF227510, U07563, AC005533, AL049636,
					AF006501, AC005058, AL034554, AC005209, AC006211, AC011311, AC007285,
					AL009179, AL022165, AC006241, AC006035, Z83844, AL020995, AL078583,
					AC007917, AL109847, AC008498, AL049775, AC007160, AL021391, AC006487,
					AC005901, AC006037, AC007656, D88268, AB023051, AL121603, AC005399,
					AC005409, AC004890, AP000959, AL133355, AC005377, AC005484, AL022323,
					AC005730, AL034395, AL031767, AC007435, AL021154, AC008040, AC007384,
					U66061, AL024509, AC004472, AC004885, AC006953, AL121658, AC003101,
					AC010205, AL096701, L29074, AC004913, AF130343, AC005019, AC005184,
					AL031276, AL022476, AC002316, AL050341, AC007676, AC007126, Z93930,
					AC005530, AC003664, AL022163, AC004531, AL109798, Z99716, AC006044,
					AL135744, AC004033, AL031668, AL031591, AC006076, AC009516, AB023048,
					AC005255, AL049760, AC006578, M26434, AC005412, AC009028, Z85987,
					AC000114, AC008115, AL049872, AC005015, AC010206, AC005520, AC005695,
					AC007686, AL021878, AP000512, AC004099, AL034420, and AP000501.
HBSAK76	57	506666	1-265	15-279
HBSAL69	58	573004	1-419	15-433
HBSAL80	59	506580	1-366	15-380
HBSAM46	60	526732	1-331	15-345
HBSAM48	61	727635	1-393	15-407
HBSAP02	62	920648	1-325	15-339
HBSAP73	63	764589	1-454	15-468
HBSAQ64	64	530344	1-296	15-310
HBSDB50	65	571365	1-353	15-367
HBSDB63	66	745211	1-331	15-345	AP000689, AC006344, and AL096701.
HBSDD91	67	775313	1-136	15-150	AA069743, and AA069767.
HCDAA94	68	661278	1-265	15-279	AL020995.
HCDAB17	69	530726	1-327	15-341	AA679229.
HCDAE77	70	533925	1-344	15-358	AI908895, and AB027251.
HCDAF27	71	592244	1-488	15-502
HCDAF29	72	533812	1-265	15-279
HCDAF54	73	530529	1-421	15-435
HCDAG92	74	724693	1-363	15-377
HCDAG95	75	533871	1-412	15-426
HCDAH34	76	533870	1-390	15-404
HCDAJ67	77	925362	1-305	15-319	AL049875.
HCDAK93	78	523648	1-186	15-200	T05398, and AC003029.
HCDAK96	79	960047	1-360	15-374
HCDAM34	80	523607	1-265	15-279	AC005969.
HCDAO32	81	530006	1-316	15-330
HCDAT56	82	533881	1-651	15-665	AA252681, N51549, AI026801, AI202595, AI000893, AW450220, W44769,
					AA923523, AI346827, AW090676, AI640582, AI659843, F22685, AI092608,
					AW102828, AA075433, AI350733, AA789132, N32022, N98535, N69933, and
					AL109657.
HCDBO13	83	709590	1-242	15-256
HCDBR37	84	968501	1-329	15-343	AB011101, and AF106069.
HCDBR39	85	921893	1-347	15-361
HCDBU77	86	661272	1-185	15-199
HCDBW51	87	556469	1-281	15-295
HCDBW61	88	960044	1-203	15-217	N51115.
HCDBX78	89	847580	1-243	15-257	Y18642.
HCDCB84	90	670159	1-248	15-262	AI244405, AW072090, AA565081, AI253256, H64704, AW026742, AA243715,
					AW025779, AA455006, AA455005, AW117348, AI767598, AI206307, N46194,
					AA644147, AI420462, AL035634, AF076957, AF121859, and AF131214.
HCDCE48	91	529893	1-334	15-348
HCDCE62	92	523582	1-226	15-240	AL031177.
HCDCF11	93	967768	1-243	15-257	AA844561, AA975423, AW173039, AI400317, AA937116, AI863192, AC006942,
					AC005758, and AL022170.
HCDCK07	94	865908	1-149	15-163	H89524.
HCDCK91	95	592465	1-255	15-269	AI268324.
HCDCR26	96	960048	1-307	15-321	AP000087, and AP000226.
HCDCX68	97	529778	1-103	15-117	AC003692.
HCDCY13	98	921702	1-60	15-74
HCDDB52	99	847581	1-332	15-346	AA535216, AA586656, AA565319, AI251584, AI431434, AW192065, AA654781,
					AI537458, AI537538, AA303040, F13749, AI884383, F23258, AI355986, R33941,
					AI682665, AA484208, AI708005, AA603530, AA338289, AA639946, AA608751,
					AI280771, AW079664, AA487690, AA659608, AW068316, AI814739, AI475954,
					AW162288, AA845209, AC005015, AC006487, AC002126, AC005071, AC005048,
					AL121653, AP000350, AL034351, AL049780, AC002470, AL049539, AF135025,
					AC008273, AC005740, AC007114, AC004967, AC007051, AC006120, AC004814,
					AC004216, AC006530, AL035683, AC005682, AC008498, AJ003147, AL022316,
					AL031659, AC002511, AC006597, AC005231, AL035684, AC003684, AC002375,
					AC006211, U95742, AC007308, Z83822, AC005324, AF111167, AL096701,
					AC005011, Z97630, AC005229, AC005952, AC004815, AC002310, AP000088,
					AL133245, AL034420, AL080317, AC002544, AC005399, Z84466, AC003682,
					AL050341, AL109627, AC006064, AL021368, U89335, AC004125, AC005264,
					AF195658, AC004685, AC004492, AF001549, Z83846, AC005214, AC005081,
					AC005007, AC005261, Z98051, AC005940, AC007676, AC005880, AL049692,
					Z82206, AC007055, AC004796, AF064861, AL021937, AL049794, AC002991,
					AF196972, AL035405, AC004966, AC005378, AC004894, AL109952, Z98200,
					AC007227, AL109865, AC002394, AL133246, U78027, AL049832, AC007151,
					AC002996, AC002112, AC005746, AC005387, AL049591, AC005527, AL034548,
					U85195, AL121769, AC004832, AC006001, AP000692, U47924, AF053356,
					AC007371, AP000354, AL031281, AC007421, AC002483, AL034451, AL078581,
					AC005919, AC002477, AC006071, AC007263, AC004552, AF001552, AC004890,
					AB023049, AL024498, AL109847, AC007283, Z81364, AL035422, AC002350,
					AE000658, AC004897, AC004999, AC004025, AC005839, AC005535, AC005089,
					AC004491, AC006312, AL049829, AC006441, AP000462, AF038458, AC005179,
					AC002045, AC006011, AC005215, AL034379, AB026898, AL031427, AC006277,
					AC009396, AC007981, AC005562, AC005234, AC000025, AC007129, AL008718,
					AC007637, AL132712, AC003962, AC005529, AP000512, AC002546, AP000300,
					AC004382, AL080243, AP000031, Z84480, Z83840, AC016025, AC004934,
					AC006014, AB017654, AC002456, AL049833, AF024533, AC004837, AL110502,
					AC005821, Z82176, AC005067, AB023048, AC005730, AL035400, AJ246003,
					AL031984, AF165926, AC009516, AL035587, AF196969, AC005722, U91323,
					AC007225, Z99716, AC006544, AL031286, AC008372, and U80017.
HCDDB62	100	529890	1-240	15-254
HCDD161	101	529937	1-103	15-117	AI248455, and AC005876.
HCDDU07	102	954177	1-200	15-214	AC005498.
HCDDV90	103	847575	1-241	15-255
HCDDY57	104	556465	1-349	15-363
HCDDZ09	105	523605	1-396	15-410	Z83820, AL022574, AP000261, AP000035, AP000100, and Z69722.
HCDDZ44	106	863388	1-484	15-498
HCDEB49	107	847572	1-238	15-252
HCDEB78	108	921710	1-125	15-139
HCDEG67	109	531239	1-454	15-468
HCDEG95	110	533879	1-467	15-481
HCDER16	111	667338	1-310	15-324	AC008064.
HCDER29	112	523506	1-198	15-212
HCDET89	113	524045	1-341	15-355
HFIAB89	114	848927	1-57	15-71
HFIAB93	115	713799	1-592	15-606	AW299250, AW438583, AI261419, AI271941, AA688176, W19548, AI867634,
					N62642, AI718356, T59367, and AC005179.
HFIAE82	116	779898	1-437	15-451
HEIAH10	117	964652	1-222	15-236
HFIAI07	118	952884	1-528	15-542	H75698, and AC005722.
HFIAP31	119	697775	1-340	15-354	AI394725, T49120, AC004916, AP001052, and AP001051.
HFIAP89	120	587844	1-335	15-349
HFIAP91	121	925831	1-603	15-617	AI754091, AI991838, AW005052, AW054864, AA603953, AA604330, AI147846,
					AI570396, AI497756, AI421847, AA877182, AI494281, N35004, AA775287,
					W46449, AA581458, AI086636, AI148897, AI278835, AA057575, AW168484,
					AW272886, R61553, AW196844, AI888235, AI679184, AW192289, H99897,
					W52277, AI356673, AA428604, AA969120, AI086886, AW167037, W47555,
					N69430, AA972050, AA579776, N93836, AI744805, W88660, F30196, H67841,
					AA703585, R54415, H80849, AA496690, AA777896, AA234453, AA035655,
					AA350919, F37094, AA234061, AA284876, T93624, AI474971, AA886060, F31971,
					AA150893, AA300810, AA376247, AW014654, AA977993, AA496609, H67163,
					AI310732, AI755278, AA430492, AA993506, AA558203, F31374, AA430533,
					AA477605, AA436330, AA410238, AI086193, H54089, AA682577, AI342640,
					AI161001, AI089475, AA290638, AA502644, AA402631, AW151250, AL045805,
					AA676716, U46298, AA724973, F36499, W52276, AA329392, W88866, T74861,
					AI659749, AA432307, W47495, W40292, AA419293, H38512, AA057574,
					AA203205, AL110156, AC002094, AF077203, and AC002324.
HFIAV83	122	780358	1-190	15-204
HFIAZ63	123	966761	1-543	15-557	AI676091, and AC012039.
HFIBI48	124	587871	1-414	15-428
HFICA06	125	934675	1-430	15-444	AA452688, H91923, R18017, R69518, R74244, C04901, W73580, AA315530,
					R83609, AA159260, W84825, H84664, N53738, H28250, R49760, T64564,
					AA486811, H24652, AA931976, T79349, C05147, H92397, R62673, H25249, and
					AA010050.
HFICE40	126	587918	1-441	15-455
HFICF01	127	916103	1-199	15-213
HFICI52	128	522239	1-635	15-649	AW303375, AW173315, AA417652, AI751258, AA364833, C05155, AA600736,
					AI090486, AA258414, AA625303, C04206, AA455496, AI768270, AA599207,
					AA446297, C03119, AA421744, AI828437, AI862133, AA834031, AA024968,
					AA446024, AA419609, AA419525, AI272646, AI148235, AA634323, AI092202,
					AA455497, AI191710, AA593295, AI218226, AA319726, AI754332, AI039656,
					AA774270, AA336003, AA384793, AI350380, AA978105, AI084698, AA912802,
					N64555, AI751035, AI673545, N67061, AI432010, AI754989, AA971661, D31528,
					AI609700, AA478719, AI221431, AI075349, AA456579, AW338252, AA375571,
					AA936765, AA610296, AA258397, T59227, AI564218, D31541, T59268, I76208,
					and AR020615.
HFICM95	129	587875	1-431	15-445
HFICZ77	130	934192	1-323	15-337	AI803895, AI391495, AA974333, AA480293, AI418615, AW303930, AA976516,
					AI376344, AA027959, AI188582, AA772607, AA150835, N49399, W43008,
					AI073381, AI679130, AI679704, AA558944, AA748509, AA854570, AI084408,
					AA863284, AI094952, AI351871, AI271532, AA994580, AI370805, AI401404,
					AW044595, AI214656, R33818, AA772710, W95681, AA993489, AI023527,
					AA025063, AA456325, AI563920, AI887313, AA976183, W07752, AA683499,
					AA873879, AA894918, AA737975, AI432209, N80691, AI299818, AA991522,
					AA975924, AA047682, AA906771, AA665526, AI151172, AI379259, R33819,
					AI707592, AA984396, AA047733, AA025062, W45208, AI095417, AA662634,
					AI147183, C02347, F34897, AA972351, AI041404, AW024289, AA683598,
					AW027714, AW366247, AL119399, AW008226, AI277938, AI261589, AI499570,
					AW079334, AA910330, AI638644, AW166412, AI561177, AI884318, AI364167,
					AL042544, AI266652, AI419826, AW192461, AI275609, AW081383, AW087934,
					AI630947, AL037602, AI538564, AL037582, AI445829, AI934011, AI963763,
					AI679771, N29277, AI744268, AI370623, AA806720, AI421149, AI473536,
					AI633125, AI568293, AI916419, AW152182, AI345415, AA580663, AW129264,
					AI620864, AI522052, AI698391, AW148882, AI538850, AI648509, AI363741,
					AI860348, AL042382, AW089844, AI539690, AI701097, AW190194, AI524626,
					AA019328, AI374987, AI352514, AI679891, AW198090, AI371243, AI125015,
					AA923096, AI370322, AI440444, AW080157, AW151714, AI440239, AI473799,
					AI249962, AI524179, AI500113, AI635016, AI929108, AI624693, AW161098,
					AI689096, AI915291, AI580027, N21402, AI473434, AI887772, AI224027,
					AI745684, AI866040, AA788861, AI587606, AI866419, AI598017, AI871727,
					AL043073, AI869765, AI719817, AI678773, AL134830, AI270706, AI249877,
					AL041573, AI932739, AI802542, AI635851, AI590043, AI696583, AI611743,
					AL043355, AI571439, AW075382, AI702073, AI151136, AI610115, AW149937,
					AI640370, AI801766, AI433157, AI572676, AI421662, AI678446, AW128834,
					AA594927, AI634345, AI270039, AI240978, AI689470, AW168822, AI628331,
					AI863002, AI342023, AW191844, N68309, AW169383, AW152195, AW078712,
					AW149311, AI537024, AI287252, AI589428, AW167895, AI651840, AI973288,
					AI670009, AI579901, R40363, AI567846, AW130088, AI610318, Z97053,
					AL137533, AL050366, AF061981, AL117587, E05822, AL133084, I80062, Y16645,
					U80919, Z82022, A77033, A77035, A21103, AF060866, AL080154, U77594,
					AL133075, AF126372, S61953, AL122050, AL137271, AF030513, Z30970,
					AR038854, AB026995, A65340, AL080159, Y11587, AL137488, AB007812,
					AL137268, I48978, AF167995, AF090934, AL080146, AL049382, U72621,
					AL133049, AL080139, AL080148, AF215669, X99971, AC002464, AR050959,
					A18788, AF085355, U70981, E03671, U83980, AL137284, X78627, AL137555,
					D44497, AF084644, AF084645, A65341, X83544, AF007142, AF150103, X66366,
					A41575, AR066485, AL137574, AL122100, AJ005870, AL050149, AL096744,
					AL133010, L04859, S77771, AF058798, AF118070, A18777, A31001, AF047716,
					A58545, AF118558, AF124728, U73682, X93328, AF139986, AL050138,
					AR034821, AC002467, AL133067, S36676, M77345, AL133062, AF201468,
					A52184, X93495, AC002287, S78214, AL133559, AL133558, A41579, AB028451,
					AC006288, L04849, X60769, X82434, L04852, X84990, X69026, A32826, A30330,
					A32827, A30331, AF036941, AC005091, AL035407, AC002564, U89906,
					AF113699, AL137560, AF106697, AL117440, U49908, AF115410, AF113019,
					AL133088, Y14314, AC004213, AC002471, AC005374, A08910, AF067790,
					AB031064, A08907, A08909, AL133112, I48979, AF126488, A21625, AF000145,
					AL137550, AL031732, A15345, X97332, AL049938, X80340, AF115392,
					AL110296, AL137529, A08908, AL117435, A03736, AF040723, AF162270,
					AF102578, AF032666, AF098162, X53587, E12580, and AF145233.
HFIDB12	131	968922	1-616	15-630
HFIDL94	132	964316	1-390	15-404
HFIDM69	133	926894	1-473	15-487	R31339, and AA251156.
HFIDN81	134	959050	1-441	15-455
HFIEC13	135	883185	1-511	15-525	Z59127.
HFIEF04	136	926824	1-98	15-112	Z99396, AL036418, AL038837, AL037051, AL036725, AA631969, AW392670,
					AL039074, AW372827, AL038509, AL036924, U46341, AL036858, AW384394,
					AL039564, AL119497, AL039085, AW363220, AL039156, AL039108, AL039109,
					AL039128, AL119341, AL037639, AL119443, AL037094, AL039659, AL119457,
					AL134524, AL119319, AL119355, AL036196, AL036190, AL119324, AL119496,
					AL119483, AL119484, AL119363, AL119391, AL042965, AL038531, AL119335,
					U46350, AL037526, AL036767, AL119522, AL037082, AL119396, U46351,
					U46349, AL039625, AL039648, AL045337, AL119418, AL036238, AL038447,
					U46346, AL042978, AL042909, AL119444, AL042433, AL039678, AL039629,
					AL134902, U46347, AL037085, AL039386, AL036268, AL038520, AL134528,
					AL134920, AL039423, AL042551, AL037615, AL039150, AL037077, AL037205,
					AL042614, AL040992, AL119439, AL042984, AL042975, U46345, AL119399,
					AL119401, AL134536, AL036998, AL036733, AI142132, AL134531, AL119464,
					AL042450, AL134525, AL134538, AL042544, AI142131, AL043019, AL042970,
					AL119488, AL037027, AL037178, AL043029, AL039410, AL042973, AL036679,
					AL036719, AL043003, AL042542, AL042850, AI142134, AL036191, AL036765,
					AL037021, AL036774, AL036886, AL036158, AL036999, AL036836, AR066494,
					AR060234, AR069079, A81671, AR023813, AR064707, AR054110, and AB026436.
HFIEH79	137	855196	1-628	15-642	Z99396, AL038837, AL037051, AL036725, AL039074, AA631969, AL039085,
					AL039564, AL039156, AL039108, AL039109, AL039128, AL039659, AL038531,
					AL039625, AL039648, AL045337, AL037526, AL039678, AL039629, AL039150,
					AL039423, AL036924, AL040992, AL042909, AL037639, AL037094, AL037726,
					AL038447, AL039410, AL036858, AL036238, AL036190, AL036196, AL119483,
					AL036767, AL045353, AL037615, AL036973, AL038851, AL037082, AL119484,
					AL039440, AL044407, AL036418, AL038509, AL036268, AL036117, AL037077,
					AL039386, AL134524, AL036733, AL036998, AL039924, AL037027, AL036679,
					AL119418, AW392670, AL036191, AL037178, AL036719, AL037085, AL037021,
					AL037054, AL039538, AW384394, AL119341, AL038520, AL036765, AL119497,
					AL044530, AL036999, AW372827, AW363220, AL119363, U46350, AL119319,
					AL119457, AL036158, AL119443, AL037016, AL119324, AL119444, AL119335,
					AL119391, AL119355, AL119522, U46349, U46341, AL038821, U46351,
					AL119496, AL119396, AL036836, U46347, AL036964, AL119439, AL037205,
					U46346, AL042614, AL134531, AL134528, U46345, AL042984, AL042965,
					AL042975, AL119399, AL134518, AL134538, AL042551, AL042544, AL043019,
					AL043029, AL134542, AL042450, AL042542, AL1119304, AL043003, AL036886,
					AL119464, AL036774, AR060234, AR066494, AR023813, AR064706, AR064707,
					A81671, Y11449, Y11447, AR069079, AB026436, and AR054110.
HFIHB16	138	661971	1-458	15-472
HFIHD91	139	702324	1-721	15-735	N31707.
HFIHE47	140	857988	1-1959	15-1973	AA534198, AI978627, AW166513, AI459812, AW166498, AI819341, AW195142,
					AI139595, AA209319, AI365580, AI620649, AI022352, AA583627, AW005402,
					AA583619, AI475193, AW166054, AI569467, AI540081, AI191668, AA331346,
					AI272323, R51977, AA508608, AA678590, AA524450, AW451651, AI090886,
					AW082159, F09189, R51978, AA378790, AI382250, AI378098, AI917676,
					AI868588, T46979, AI355097, AI635445, AW131365, F11527, AI291485, N64277,
					and T46978.
HFIHF63	141	944246	1-750	15-764	AW182823, AI378016, AI669104, AI420515, AA010826, W95509, AW297177,
					W95412, AA011202, AA782437, AI869000, AI702739, AA450119, AA889785,
					AA255554, and AI291551.
HFIHJ60	142	740280	1-456	15-470
HFIHJ85	143	707899	1-548	15-562
HFIHL29	144	690546	1-367	15-381
HFIHS76	145	769952	1-390	15-404
HFIHZ33	146	588058	1-496	15-510	AA054673, H89424, AA180830, and AF025422.
HFIHZ51	147	725587	1-370	15-384
HFIIB73	148	669594	1-438	15-452	AL031296.
HFIIS21	149	670765	1-529	15-543	AI570906, AL118651, AL118594, AA644545, AL050343, AL133445, AL096791,
					Z93023, AC004020, AC004851, AC007450, AC000353, AL132712, AP000704,
					AC002400, AC004491, U91323, AL021579, AL022334, AL020997, AC005899,
					AL034417, AC002565, AL009181, AC004106, AC007298, AL139054, AC006449,
					AC002425, AC002544, AL109865, AL022313, AJ246003, AC007227, AC005071,
					AC006014, AC006285, AC005529, AC005488, AF205588, Z95152, AP000689,
					AL034419, U73640, AC004966, AC004477, AL035450, AL031577, AL133448,
					AC008372, AC003036, AC004685, AL009183, AC006013, AC005326, AC005225,
					AL117352, AP000240, AL049829, AC007773, AC004526, AP000047, Z85986,
					AC008115, AC005520, AC016025, AL121658, AC004638, AD000092, AL049795,
					AC004448, AC005015, Z98304, AC007050, AC003029, AC003101, AC007226,
					AC006965, and AC012384.
HFIJF34	150	703972	1-448	15-462
HFITX48	151	934328	1-453	15-467	AJ011930, AJ011931, and AP000219.
HFITZ24	152	677144	1-412	15-426
HFIUE17	153	855119	1-452	15-466	AW295133.
HFIUH54	154	929787	1-429	15-443	AC004774.
HFIUI66	155	746397	1-304	15-318
HFIUJ95	156	735969	1-425	15-439	AC009044.
HFIUM59	157	724249	1-308	15-322
HFIUO63	158	691921	1-476	15-490	R64316.
HFIUP04	159	582296	1-158	15-172	R64259, AA344341, AI080039, AL046624, AA629791, AI368952, AW168763,
					AI952419, N26238, AA834946, AI524512, AI264761, AA393317, AI092959,
					N34467, AI167603, AI817019, AI186197, AW024266, AA220934, AI686547,
					AA079792, AI423180, AW294323, AI022487, AA298287, AI125828, AA977969,
					AI041033, AW167771, AI982550, AA577038, AW129990, AI219200, AI745726,
					AI872119, AA568591, AI074179, N23849, AI076303, AI126251, AI873831, H89854,
					AW410097, N73002, AA034187, AI077832, AI144021, AA961792, AA431977,
					AI818881, AI620483, AI827251, AA738013, AW450235, AI277544, AI049595,
					AA738259, AI263352, AI193279, R85594, AW351844, N52553, T57796, AI000731,
					AW177690, AI018741, AI125766, AA744959, AI351749, AI753417, AI865588,
					N76513, H71780, F25828, AI971511, AW389860, AA805498, AI699779,
					AW054724, AA417958, AI754465, AI189605, AA846282, H71692, N58371,
					AW028940, AI168778, AA033792, R85377, AL134572, AA702274, AA001869,
					AA371623, AI270649, AA704581, AA342144, T79160, AA151314, F00140, T99810,
					H90753, H42220, AA903483, AA700585, AA932956, AI557195, AI143854,
					AA682817, T95829, AL110192, AL050150, AF077054, AB020692, AL096773,
					X60127, and X52311.
HFIVB03	160	924021	1-324	15-338
HFIVB25	161	678022	1-269	15-283	AA004777, T66806, AA033897, R75757, and AB014550.
HFIVB62	162	741665	1-241	15-255	AC004002.
HFIVQ02	163	919802	1-441	15-455
HFIXA30	164	692637	1-313	15-327	AI038502, AA993051, AI926924, AA836474, and AW269412.
HFIXC30	165	692635	1-345	15-359
HFIXC44	166	839536	1-541	15-555	R52856, R16202, H09464, R16204, D53134, Z42545, T66661, and T66663.
HFIXC49	167	722886	1-369	15-383
HFIXK83	168	767156	1-351	15-365
HFIXK94	169	943717	1-412	15-426	AF045448, and AF064860.
HFIXM11	170	966714	1-218	15-232
HFIXO03	171	923735	1-361	15-375	AA824654, AA810370, AA644538, AA824655, AA521376, AA649705, AA834755,
					C14793, H02877, AA483223, AA574110, AA704643, AA678436, AA640034,
					AA568778, AA858197, AA503473, AA973803, AA515909, AA719080, AA446657,
					AA906889, AA679009, AA577906, AA602528, AA605032, AA582911, AA804379,
					AA601355, T49241, AA721981, AA235466, AA668578, AA348504, AA533036,
					AA483731, T53128, AA910125, AA425922, AA573020, AA522942, AA533725,
					AA490183, AA304977, AA341336, AA527958, AA143490, AA838096, AA525249,
					AA668902, AA558616, AA191198, AA156538, AA578017, AA663486, AA434388,
					AA670468, AA525876, AA601499, AA846929, AA102006, AA053551, AA633094,
					AA403110, T16056, W16581, AA600222, AA623002, AA861959, AA280632,
					AA437161, AA831904, AA845843, AA127636, AA825357, AA873560, AA665021,
					AA630925, W05364, AA682912, AA521355, AA678453, AA564859, AA487225,
					AA401022, AA461206, AA599920, AA708311, AA649722, AA127517, AA524838,
					AA210852, AA847984, AA972238, AA654761, AA487858, AA644207, AA970213,
					T10560, R32415, AA169756, AI191227, AA634145, AA635442, AA524809,
					AA551201, AA325699, AA714595, AA595825, F32800, AA486885, AA808941,
					N46153, AA357307, AA059472, AA523815, AA664015, F09736, N69316,
					AA167643, AA134347, AA780515, AA569743, AA650271, AA715355, AA720691,
					H48636, AA678772, AA515435, AA629827, AA987619, AA729740, AA309196,
					T94075, AA768905, F23250, AA480790, AA767376, M85966, AA828042,
					AA728889, AA346575, AA604497, AA633266, AA095511, AA630606, AW088058,
					M77899, AA492140, AI002834, AA778110, AA613851, R95704, AA631799,
					T15897, AA081909, AA825455, T24049, AA405453, H02135, AA326589,
					AA434484, H11124, AA744338, AA834756, AA632755, AA774184, AA113376,
					AA486414, AL046457, AA788726, X62695, AP000302, AP000114, AP000046,
					Z83313, Z68192, AP000431, L43392, AF029750, AB012251, Z92844, AC004047,
					AC004216, AL031012, U07000, AC005755, S61977, AC006515, U67274, U20770,
					Y12508, M87919, AC004837, AL109798, AP000548, AL022325, AL031588,
					AC006466, AF193806, AC003681, U02044, U55180, A26236, L04965, AP000501,
					AL132712, L44140, AC007878, U14694, U13056, D49685, AL096765, AF112866,
					AC000047, S70689, AC002482, AL021878, M87918, U02058, U02063, Z82900,
					AC005280, AL117258, AC012627, AP000011, AL023578, U91326, AP000473,
					AC002544, AC006546, AP000098, AC005245, Z48051, AC006162, Z73420,
					AF003530, AL021392, X88791, M74900, AL031542, AC006322, Z97206, I51997,
					U02048, S70697, S70692, AD000092, M94631, AC005778, AL035209, AL008726,
					AF003528, AL031428, AC007899, AC003954, AF139813, AC009044, AC004745,
					AC005907, X54178, X54181, D83253, X54175, AP000097, AC005610, AL022160,
					AL121754, Z15025, AC004820, U02532, AP000151, Z99495, AC002430,
					AC005923, AC006978, AC007314, Z94721, AP000567, AF060568, AC002431,
					AC005060, AC003003, AL122126, U91322, AP000009, AC007384, X58156,
					AL109807, AL031256, AC005384, AC005785, AL117355, AC003088, AL021406,
					AP000966, AF015148, Z49816, AC005071, AC008101, AC004940, AC009069,
					X77859, U18400, AC004825, AC005808, AB019005, L07900, AC005822,
					AC005775, AL121652, AC006055, AL049845, AC007237, AL031848, AL049795,
					AP000152, X55932, U18390, AL109653, U14702, AC000025, AL049757,
					AF027390, Z81311, U11309, AC007386, AC005527, U63721, AC002553, X55928,
					AL096734, X54179, AC005940, AC008115, AC000097, Z99289, AC007254,
					Z72521, AC006022, AC002110, AC002105, AC006049, AC000075, Z97184,
					AC004191, AC004802, AC003030, AP000220, AC010186, Z81364, AC004854,
					AP000513, AP000142, AP000084, AL133289, AC006486, U85196, AL031589,
					AP000090, AC005016, AB023049, AL031295, AC004947, AC007243, AC007114,
					AC005664, AC002402, U85198, AL132641, AC004691, AL035671, AL022310,
					Z98946, AP000470, AC005799, AC002289, U96629, AC005900, AC005324,
					AC007537, AC007392, AC008372, U57005, AC007450, U18393, X55925, U18394,
					AC006547, Z83846, U57006, U18392, AL080250, U18391, X54180, S41998,
					U57007, AC016026, AC003119, Z86090, AL033525, AL031447, AL080248,
					U57009, AL031680, AL096770, AL133399, AL022302, AC005912, and AC004470.
HFIXV93	172	597031	1-361	15-375	AL080075.
HFIXY13	173	656812	1-347	15-361	R54797.
HFIXY57	174	734580	1-352	15-366
HFIXY80	175	965077	1-395	15-409	AA833709, AI342422, AI207067, AW303434, AW005730, and AW002395.
HFIYA86	176	757155	1-343	15-357	AF015720, AF015722, and AJ229041.
HFIYB24	177	952847	1-291	15-305	AL022724.
HFIYB40	178	964251	1-428	15-442
HFIYK01	179	916125	1-154	15-168	W22304, and AC007510.
HFIYL01	180	919416	1-418	15-432	R69518, AA452688, AA315530, R74244, H91923, C04901, AA159260, R18017,
					W73580, H28250, W84825, R49760, R83609, AA486811, N53738, H84664, T64564,
					T79349, H24652, AA931976, C05147, H92397, R62673, and H25249.
HFIYO14	181	657598	1-281	15-295	AA927326.
HFIYP02	182	919501	1-363	15-377
HFIYV01	183	916064	1-413	15-427	AI799462.
HFIYV03	184	923755	1-389	15-403	Z97206, and AL034375.
HFIYV59	185	861487	1-317	15-331	AA502207, AW188742, AA668896, AI355246, AL037771, AA975997, AA668915,
					AW023111, F35684, R64617, AA535736, AA536040, AI653999, AI791131,
					AA494174, AI791130, AA857518, AL119563, T05118, AA487209, AA364860,
					AA906536, F34170, AA084609, H47295, AL040009, AI446336, AI434513,
					AA676971, AA578690, AA581525, AA486565, AA309341, T71936, AI189682,
					AA483606, AA225273, AA737235, AA846923, AA991914, AA485328, AA630535,
					R89560, AA904211, AA689351, H07953, AL041375, AA630122, AI206841,
					AA983673, AA502532, AI866911, AA312303, AA654801, AW316777, AW020736,
					AA709362, N24909, AW192402, N55296, AL031730, AF205588, AC007637,
					AL031005, AC004477, AL109963, AC004000, AC004491, AL021937, AC004841,
					AC005740, AL049758, AL049636, AL117337, AC005670, U91326, AC005899,
					AL096791, AC007227, U96629, AL139054, AC004859, Z98946, AC002070,
					U91323, AC005696, AC005412, AF047825, U73024, Z95331, U80017, AC002301,
					AL031666, AC005317, AC002425, AP000689, AC005911, AC005089, AC005971,
					AC003098, AL022163, U78027, AC004525, AC005225, AC004921, AC008044,
					AC004922, AF001552, Z84480, AL135744, AC002094, AC004967, AF111168,
					AC003962, AJ246003, AC006512, AC005480, AL136295, AL035422, AL049843,
					AC005839, AL096701, AC006211, AC005183, AC005316, L78810, AL035249,
					AP000344, AP000555, AC005914, AC007376, AC005332, AC005523, AL021578,
					AC002477, AC004912, AC007546, AC005988, AL035587, AL049539, AC005704,
					AL078581, AL035417, AB003151, AC006101, U07561, AC005730, AP000557,
					Z84487, AL109758, AC008372, AL008726, AC004876, AC004134, AC005722,
					AC007686, AC002126, Z98750, AJ010770, AC005531, AC006441, AC004985,
					AC004895, AC004263, AC004383, AL031295, AL121658, AC005632, AC006120,
					AC008040, AC005043, AL109984, AC002430, Z99716, AC004966, AL035090,
					AF196779, AC005921, AL080243, AP000208, AC006505, AF117829, Z84466,
					AC006011, AB023051, AL049757, AC005261, AL009181, AC005562, AL035086,
					AL132777, AC002133, AL022318, AC007193, AP000066, AC005902, AC007384,
					AC004929, U85195, AL022336, AL050318, AC005224, AC004584, AC005375,
					AC005520, AC003041, AF053356, AP000115, AL049569, AL031432, AC006305,
					AC005088, U95739, Z68870, AC006480, AC009405, AL049856, AL049759,
					AC005484, AC002544, AC002059, AC005701, AC003689, AC006251, AC004854,
					AC009363, AC006210, Z93023, AC008989, AC004953, M17262, AP000512,
					AL109952, AC006511, AP000099, AC005049, AC005233, AC005529, AE000658,
					AC004517, AC012384, AC004991, AC006077, AC005377, Z92844, AC008115,
					AP001052, AC007551, AL031577, AC002476, AL023553, AL121653, AL049712,
					AL035659, AL049872, AC007057, AF030453, AC005071, AC002997, AC007263,
					AL022313, AC006255, AP000511, AF067844, AL050321, AL132712, AC005231,
					AL031680, U52112, AC004815, Z85986, AC005057, AC005409, AF064861,
					AC004526, AL031311, AL022311, AL109628, AC002369, AL031670, AC004167,
					AC006121, AC002300, AC005697, AC004125, AC007421, AL049780, AC002316,
					AC009516, AC005666, AB000882, Z75887, U62293, AL049631, AC001226,
					AL022320, and AP000036.
HFIYW08	186	958978	1-472	15-486
HFIYZ13	187	656795	1-364	15-378
HFIZF95	188	795734	1-351	15-365	AI470647, and R26573.
HFIZG93	189	928170	1-537	15-551	AW070612.
HFIZH29	190	953895	1-390	15-404
HFIZM92	191	791267	1-559	15-573	H13123, R82393, AI634609, AI925440, AI333038, AW195580, AA504939,
					AB014580, and AL049844.
HFOXA79	192	774901	1-238	15-252	AC004150.
HFOXB85	193	752957	1-362	15-376	AL133500.
HFOXC25	194	677995	1-335	15-349	AC012039.
HFOXC35	195	638311	1-560	15-574	AI284640, AA847499, AI499588, AI754336, AI802835, AA601876, AL138396,
					F12561, AA728812, AI862939, AA847952, AA368059, AA358515, AA765736,
					AA514854, AI002510, F25733, AI537077, AA126450, AA508359, AI282511,
					AA620467, F08248, AW327868, AA935988, AL121235, C06339, N35602,
					AW028392, AA045017, AI338350, AA629992, AI079389, AA780784, AA724333,
					AA169263, AI093030, AI933534, AA493708, AA659360, AI536900, AA579075,
					AA719292, AL045808, AL046156, AI358812, AA347027, AA847515, AI312309,
					H71429, AA683258, AA491862, AA491831, AI564185, AW168618, AI921061,
					AA491650, AW075948, AL042853, AI290405, AW023149, AA368943, AI061143,
					AI076766, AA071393, AA679936, AA634196, AI610435, AI866964, AA351056,
					AI683446, AL134972, U95743, AC002477, AF117829, AF064858, AC002369,
					AC002368, AC008080, AC007298, Z97054, Z94056, AC003957, AF003626,
					AC007546, AC005823, AL034420, AP000113, AP000045, D84394, AC006443,
					Z82203, AF111168, Z86090, Y10196, AC007878, AC004024, AC005049, U80017,
					AC005031, AC005355, Z99916, AC006578, AC008013, AF207550, AC002385,
					AC007221, AC005484, AJ229043, Z83840, AC005915, AC007450, AL034400,
					AL035450, AP000347, AP000351, AF015262, AL049538, AC006137, AC006040,
					AC004032, Z98941, AC004382, AC005004, AC000113, AC005154, AC006536,
					AL023805, AC007065, AP000014, AL031684, AC005736, AC004112, AL022238,
					AL022477, AC004887, AC007225, AC003071, AC004585, AC003029, AC004019,
					AP000104, AL050318, AF149773, AC002350, U91322, AC007245, U91321,
					Z95400, AC006111, AC002091, AL031591, AC004617, AC002089, Z98036,
					AL049874, AC005342, AL022316, AL117354, AP000350, AC004816, AC002364,
					AL035555, AL078624, AC002416, Z97181, AP000355, AL117355, AP000156,
					X96421, AL049835, AL050343, AP000115, AC004496, AC006012, AC004813,
					AC005740, AC004796, AC005284, AC004664, AC005383, AL022323, AL049766,
					AP000048, AC005330, AC004924, AC006530, AL121820, AL035088, AC004386,
					AL009181, AL049780, AC002366, AL049837, AC015853, AC005863, AC003099,
					AC000052, L78833, AL035411, AC004491, AC004841, AC005919, AC016831,
					AC004253, AC004966, AC002994, AC000353, AL049557, AC004144, AL121653,
					AL049829, AL023653, AL050321, AL049869, AC007567, AC006316, AC004531,
					AC005036, AL031230, AC006450, AC005826, AC002316, AC009510, AC007314,
					U95090, AJ251973, AC004849, Z95114, AC005911, AL121652, Z93930, AC002418,
					AC006376, AL035563, AL022318, AC006205, AC002992, AC007684, AC005971,
					AF064862, AC000105, AC009514, U52111, AC006116, AL022723, AF107885,
					AF045555, AP000330, Z98884, AC007685, Z95113, AF001550, AL117667,
					AC002563, AL121578, AL136504, AC005013, AC002420, Z82190, AP000272, and
					AC005244.
HFOXE83	196	587955	1-271	15-285	AA928539, AI590043, AI863382, AI345415, AA830709, AI690813, AI679388,
					AA641818, AI612913, AI819545, AI491842, AW162194, AI954200, AW169291,
					AL047100, AI345612, AI452560, AI479292, AI345416, AI613038, AW198090,
					AI571439, AI702063, AA937566, AI859991, AI370623, AI635851, AI554402,
					AI376425, AW129722, AI885664, AL048538, AW084896, AI538850, AI540831,
					AI698391, R40363, AA804541, AI635216, AL120706, AL043166, AI863002,
					AI633125, AW130362, AI696714, AI909697, AI539800, AI927233, AI539260,
					AI270183, AI619820, AW194014, AW022754, AI950865, AA743430, AW149937,
					AI889189, AI818562, AL042745, AL042744, AI580027, AA814517, AL037602,
					AI766348, AL043293, AW090550, AW152182, AI824688, AL037582, AI696583,
					AI830016, AI688854, AI538564, AI701097, AI872423, AI870192, AI440260,
					AL080045, AI635016, AI690784, AW058202, AI804515, AI699175, AI915291,
					AI678496, AW151974, AW105431, AI583032, AI473536, AI860027, AW022957,
					AL079799, AI884318, AI918677, AW151893, AI494198, AI890907, AW196720,
					N66892, AI868740, AW188525, AI654286, AI470717, AI499570, AI434229,
					AI434969, AI583065, AI653402, AW022636, AA575922, AI827212, AL046200,
					AL040366, AI684244, AI500061, AW148363, AW103628, AI921633, AI547265,
					AI309769, AI147877, AI446511, AW148544, AW151132, AI445025, AI095003,
					AI469784, AL042944, AI609375, AI798359, AI434731, AI440238, AI560569,
					T69241, AI453767, AW022856, AA128660, AI950729, AI358271, AI624543,
					AL046466, AI912356, AI624938, AI637584, AA715307, AI524654, AA809974,
					AW103878, AI419826, AI889191, AW019985, AW128971, AI275956, AI475331,
					AI670895, AI798456, AL043152, AI677796, AI687362, AA748353, AI699823,
					AI973152, AI540354, AI571442, AI161279, AI061405, AI866469, AW131165,
					AA814343, AI673278, AI887163, AI620643, AW090736, T49776, AW148536,
					AW194509, AI801515, AI343325, AI635287, AI469532, AI250282, F34309,
					AI364167, AL045453, AI683606, AI610690, AW089726, AI620056, AC004383,
					AL133029, AL117587, D44497, A17115, A18079, A86558, AF141289, AJ003198,
					AF090900, AL031732, AF013249, AR022283, A93914, AL133623, AL137488,
					AC006203, I33391, AL137459, AF124728, S65585, L04849, L04852, AF080068,
					AL022147, AL137657, AL133637, AF126372, AL137539, X97332, A41579,
					A27171, Z97214, AL136884, I34395, I18358, AF124435, AL133084, I28326,
					AL080146, AL117416, AF126247, AR066485, M85165, A15345, AR038854,
					A12558, AF100931, Y16645, AL133053, I89947, A26498, U38419, AL137530,
					Y13350, AF222801, AF111849, AL080140, AL080148, AL133049, AF102578,
					A60092, A60094, AF031572, A12522, AR050959, AR068753, AR012379,
					AC005291, AL080139, AF004162, A21625, AJ012755, S36676, X63162, X59812,
					AL110158, AL049466, AF002672, U49908, AJ238093, X15132, AF013214,
					AF200464, AJ005690, AL035407, A21103, AL049283, AF054988, AF111851,
					U58996, U75304, X78627, AL133015, AR066486, Y17327, AL122049, AB031064,
					AL050172, AL137254, AL137548, AL050322, AC018767, AF026124, AF061795,
					AF151685, U37359, AL137533, X68560, I03321, AL117575, AL080118, AF076464,
					AL122104, Z93784, E12580, E12888, A20553, AF131773, I33392, A08907,
					AF153205, E03168, AL137529, AL050149, AF060555, AF106657, AC002471,
					AC005374, AF169154, AR013797, X60769, AF145233, E03671, AL049423,
					AL122100, AF058921, U51123, I09499, AF061981, AL133608, AF112208,
					AF116573, X06146, X61049, A23327, AL137478, A76337, I18355, I34392,
					AB020777, X69026, and X99971.
HFOXL03	197	923772	1-309	15-323	AI394067, and AI056068.
HFOXM54	198	587974	1-346	15-360
HFOXN89	199	587984	1-97	15-111
HFOXO24	200	733377	1-517	15-531	AI026814.
HFOXR28	201	587994	1-310	15-324
HFOXR67	202	806488	1-447	15-461	D56451, AI797289, AW008969, AI394269, AI541453, D56220, Z36872, H17761,
					AW009897, AA248589, AI278793, H59335, C04806, R01796, AW062936, N30347,
					H93411, AW263105, R62171, AW178925, AA613553, AI148761, AA960959,
					R52799, AA996071, AW363731, AI026967, AW069303, AA148228, AW247577,
					H41429, N91665, AA837473, AW247732, R86909, T34155, C05230, AA316485,
					N94214, AI751446, AI750270, AI276480, AA865609, T36130, R81681, N93270,
					AI383153, AF153605, and AF151861.
HFOXS81	203	588052	1-502	15-516	AC009509.
HFOXU83	204	887781	1-334	15-348
HFOXU92	205	588057	1-64	15-78	AA225747.
HFOXV15	206	964296	1-451	15-465	AR038762.
HFOXV80	207	771290	1-442	15-456	AA308546, AW157090, AI937913, AW156893, AW162217, AW157724,
					AW161439, AI879643, AW156973, AI879261, AW163058, AI929716, AW087100,
					AA305024, AW157680, AW068829, AI929159, AW160392, AI928949, AI929458,
					AI879102, AI815607, AW163676, AI816107, AI929203, AA533150, AA603376,
					AA315102, AA557858, AI042255, AA316902, AA305999, AI929416, AA467847,
					F20887, AI148106, AA635409, AI080578, C16701, AI735002, AI703215, AI218297,
					AA578143, AA306384, C15041, AI004923, F34246, AI813679, AW161950,
					AI741580, AA558231, F27426, AA315107, AA316386, F28430, AA747217, F19264,
					AA582173, AW162077, AI880659, AI284407, AA969828, AA316519, AI797882,
					AA182966, AA312837, AA593697, AA429825, AA314832, AA534268, AW051532,
					AA551986, AA514368, AI283754, AA314733, AA857416, AA504055, AA099703,
					AA703668, AA813296, AA305425, AA627106, AA658158, AA102518, AA912491,
					W70100, AA806144, F21803, AA729466, AW188624, AA362481, AA578344,
					T58704, AA552195, AA570027, C14962, F27125, AI547077, F24635, AA146770,
					AA569705, F22538, AI051783, AA582239, AA954461, AA523344, F25970,
					AI818276, AA628531, F28354, AI541451, AI286214, AI302226, AI749166,
					AA595326, AA923442, AA970629, AA836780, AA382399, AA358548, AI589583,
					AA553775, AA302481, AA302037, AI015174, AA309890, AA639958, AA994774,
					AI928906, AA868034, F35973, AA366144, AA541672, AW162742, AA385897,
					AA305293, AA358129, AI383381, F19236, F27230, AA372465, AA532593, F35969,
					AA659394, R50158, AI815885, AI816148, AA353710, AA082359, AA320396,
					AA345921, N85393, AA506932, W44688, AA146771, AA894893, AA363398,
					AI347797, C15196, AA084010, H25768, AA352140, AA143324, F27370,
					AA535125, AA482870, AA126459, AA070860, AA112167, AA320816, AA559162,
					AA375521, AA186947, AA741424, AI476367, AA533959, AA302382, AI339429,
					F16378, AA304454, W44689, AI749986, AA303205, AA876719, H67183,
					AA355917, AA371889, AA303560, AA121010, T68786, AA190982, AI609251,
					AA187063, T61564, T47265, AA484195, AA669582, AA746899, AA375705,
					AA318361, AA373707, AI991245, F16990, AA721793, Z22017, AA633759,
					AA480788, AA099379, AI688209, AA181199, F17072, AA627728, AA358130,
					F21668, AA327089, H25809, F22482, AA514522, AA328203, AA608523,
					AA143373, AA531014, AI581577, AA318610, AA301081, Z20171, AA181098,
					T25773, AI906511, F29640, AA344773, AA559980, R29520, T58654, AI828156,
					AA662018, AI612840, T50358, AA126533, F29292, AA191447, AI459942,
					AI818088, AA662715, AA372830, AI420455, AL050273, AF077043, AC004884,
					AC007160, AC003071, and A74819.
HFOYI36	208	935532	1-412	15-426
HFOYL77	209	494844	1-303	15-317
HMUBM26	210	908912	1-551	15-565
HMUBX25	211	678004	1-248	15-262
HMUBY88	212	740311	1-360	15-374	D31124.
HOAAB15	213	575254	1-283	15-297
HOAAB42	214	530605	1-246	15-260	AL047846, AC008013, AC009533, and AR050956.
HOAAB56	215	507839	1-361	15-375
HOAAC31	216	693597	1-368	15-382	AA648984, AA866183, and AA236595.
HOAAD05	217	932756	1-546	15-560	AL045968, AL046394, AW449989, AI351357, AA757688, AI937374, AI129540,
					AI952327, W28986, AI362659, AA704558, AA973323, AP000219, and AJ239328.
HOAAD52	218	859628	1-317	15-331
HOAAE10	219	968532	1-325	15-339	AC005164.
HOAAE45	220	530602	1-316	15-330
HOAAE49	221	859630	1-290	15-304	AI696455, AA631512, AA280198, AA063419, AA730609, AA063493, N53783,
					AJ230815, AA094679, AI919048, T03774, AI547110, AA676462, AA484321,
					T94858, AI800189, AI683125, N64807, N63562, AI832554, AA338436, AA325104,
					AA485778, AW169324, H63173, AA229489, AA297208, AW085626, AA284638,
					AA720594, AA640104, C15279, AW192471, AI754926, T58562, AA594164,
					AA524804, AA524604, AA115769, AA302962, AI267285, AA362670, AA228268,
					R43468, AW086015, AA730325, AI523991, AW085751, H65404, AI708663,
					AA452912, AA516061, AA910236, AI299889, AA494145, AW169183, AA632355,
					AA507657, AI818921, AL079682, AL041740, AA358330, AA174108, AW089646,
					AA300221, H60396, AA082007, AI242994, AI207692, W02485, W45215,
					AL109984, AL035423, AC005763, AC006343, AC007225, AC006930, AC005231,
					AL020995, AB001523, AL021393, AC011594, AC005179, Z69364, AL034379,
					AC002316, AL135745, AC005775, AC001231, AC005082, AC007066, AC004106,
					AC019014, AC005694, AC003969, X64467, AB026906, AC005593, AC006205,
					AC004844, AC007238, AD000092, Y18000, AC005225, AC007686, AC005971,
					AC005527, AC003658, AC005695, AC004525, AC002463, AC006064, AC005277,
					Z93241, AL133243, AC005529, AC004033, AC007298, AC004686, AC005215,
					AL021391, AP000228, AC005412, AL031844, AC002070, AF169035, AP000140,
					AL022316, AF135028, Z85988, AC004447, AC004650, AL035420, AC004022,
					AL034417, AC008044, Z82188, AL031432, AL078474, AF064861, AC002504,
					AC004843, AL096678, AC006011, AC004765, AC010722, AC003013, AL117340,
					AL109628, AC004388, AF036121, AF196972, Z68756, AC005738, AC006120,
					AC003685, AC005516, AP000310, AL096703, AL035249, AP000116, AP000152,
					AP000010, Z97632, AC008085, AP000088, AC003041, AL080276, AC002350,
					AC005369, AL049709, AL022311, AC007050, AF184614, AC005331, AC005102,
					AC005410, AC005832, AC007240, AC006148, AC004816, AC007546, AC002076,
					AC006441, AC005937, AC004073, AB023048, AC005962, Z83844, AF069491,
					L78833, AC007971, Z83843, Z98946, AL033392, AL078581, AF196969, AL049631,
					U85195, AC000134, AP000335, AC004019, AL021453, AC002351, AL035658,
					AC007868, AL031680, AL022165, AC005768, AC006130, AL080242, AF081795,
					AE000658, AL024498, AL021808, U80459, AC003004, AB022785, AC005933,
					U73648, AL031721, AC005785, Z94161, AC006273, AL121934, AC002037,
					AL022237, AP000251, AL031255, AF023268, AL096757, AL031118, AL035398,
					AL049743, AL109963, AC004897, AC004771, AC006071, Z93930, AC005773,
					AP000065, AP000030, AC004079, AC004920, AC004703, AL049757, AL078476,
					AL035400, AC005033, and AL049745.
HOAAE73	222	960631	1-303	15-317
HOAAF18	223	530600	1-343	15-357
HOAAH10	224	968368	1-608	15-622	AI038589, H38572, AA604708, and H59854.
HOAAI05	225	932537	1-296	15-310
HOAAJ23	226	531389	1-257	15-271
HOAAK90	227	527490	1-280	15-294
HOAAM08	228	960060	1-189	15-203
HOAAR14	229	526530	1-230	15-244	H60486, H60440, AW151194, AW378516, AW378511, AC005696, AL031230,
					AC004771, AC006011, AL049872, AL096701, AC005034, AC003103, AC004983,
					AC004000, AP000696, AL109952, AL110122, Z99716, AC005031, AC005839,
					AF196970, AL023575, AL035458, AC004999, L78833, AC006441, AC004859,
					AL034548, AL023553, AC007390, U80017, AC005399, AC008372, M17262,
					AL035398, Z85986, AP000512, AL031680, AC004832, AC004797, and AC007182.
HOAAV23	230	527489	1-294	15-308
HOAAW21	231	527487	1-296	15-310
HOAAZ61	232	531065	1-320	15-334
HOABA20	233	932539	1-104	15-118
HOABA93	234	792929	1-198	15-212
HOABD58	235	738359	1-96	15-110
HOABP66	236	507175	1-277	15-291
HOABP69	237	531049	1-98	15-112
HOABR40	238	531051	1-344	15-358
HOEAK21	239	954961	1-326	15-340
HOEAY14	240	659258	1-336	15-350	AA010406, and AA513951.
HOEBL44	241	715851	1-288	15-302
HOEBO31	242	693689	1-335	15-349
HOEBP01	243	916957	1-565	15-579	R51124, R50890, H09201, F08412, H10008, R23547, and AC007688.
HOECN79	244	723113	1-223	15-237
HOECY54	245	506692	1-532	15-546
HOEDD40	246	572900	1-332	15-346
HOEDD83	247	578934	1-311	15-325
HOEDK10	248	915054	1-314	15-328
HOEDT31	249	826009	1-461	15-475	N40134, AA459424, H23811, AA477809, AW361971, R22603, R80171, AA255699,
					AW388174, R07949, H43071, AA019983, AA491397, AA853328, AW167516,
					AA325547, AA156738, AW388175, N42726, AA333808, AA953943, AA299231,
					N41696, AA715394, T73669, AW083486, T63684, AA838699, AI890778,
					AA046378, AW008861, AW162991, AW300924, AI205997, H38711, AI125503,
					AW166548, AA911687, AA504780, AA434314, AI567841, R78822, and R67144.
HOEDU54	250	506576	1-501	15-515	AI954403.
HOEDU68	251	713695	1-156	15-170
HOEEB63	252	745039	1-299	15-313	R47912.
HOEEC02	253	919822	1-226	15-240
HOEEO45	254	717754	1-336	15-350	Z64883.
HOEEQ17	255	663719	1-357	15-371
HOEFG22	256	744340	1-272	15-286
HOEFL91	257	790134	1-346	15-360	AI042148, T72500, D45636, and AL049830.
HOEFN92	258	698444	1-312	15-326	R45895, AA585325, T18597, R28965, R29218, R28892, D54897, D60765, D60844,
					AA170832, AA585098, R28735, R29445, R29657, R28967, Z32887, D57491,
					D59751, AA585101, Z32822, AA585439, AA283326, C15406, D53161, AI547250,
					D61185, C15069, Z33559, AI546831, AA585476, D61254, AI525316, AI557262,
					C16294, C16315, D55233, AI557864, R28895, Z28355, D59458, AI541356,
					AI525306, AI546875, AI557734, AI525500, D59436, AI546999, AI546921, D54850,
					AI526078, AI526016, AA585155, AI526140, AI541365, AI557740, C16296, C16292,
					D53447, AI546971, C15120, C15762, AI557763, D52835, C16305, C16293,
					AI547122, AI557799, AI541383, D53472, AI546901, AI526194, AI526184,
					AI526109, AI535639, AI557718, AI541517, AI547039, C15737, R29179, AI541374,
					C16300, AI525339, AI557731, AI526112, AI541205, AI526117, AI526191,
					AI525556, D57186, AI557787, AI535660, AI546945, AI557727, AI547202,
					AI541535, AI525431, AI557808, AA585430, AI557809, AI557852, AI547006,
					D60730, AI541346, AI541013, AA585356, AI540903, AI541307, AI557084,
					AI540967, AI541034, AI557264, AI557758, AI557807, AI525320, Z30131,
					AI557408, AI546996, AI557533, AI526024, AI546891, R29262, R29172, AI557602,
					AI557317, AI536138, AI526158, AI541527, C16290, AI526195, AI525114,
					AI557155, R29177, AI547196, C14208, AI525168, AA585453, D61060, AI557279,
					T19407, AI540974, AI547189, AI546954, AI525856, C14210, AI526113, AI526073,
					AI541422, AI524904, AI541515, AI557810, AI557796, T41289, AA585434,
					AA585117, AA514191, AI541321, AI541492, AI541345, AI540944, AI546829,
					AI556967, AI557041, AI557786, AI525076, AI524890, AI046024, T41329,
					AI525656, AI557785, AI547137, AI526169, AI525286, AI541506, AI557039,
					AI541415, AI546841, AC005913, AR038762, AR038855, AR062871, A25909,
					Y09813, X76012, X82786, AJ243486, AR003381, AJ244006, AJ244005, Y16359,
					AF082186, AR031358, X81969, AR031365, D50010, D13509, AJ244004, A20702,
					AR062872, AR062873, A20700, D78345, A43189, A43188, Z32836, AR054723, and
					X55486.
HOEFS83	259	615154	1-240	15-254	AL133353.
HOEJE18	260	666349	1-300	15-314
HOEJG04	261	859251	1-470	15-484	AA1997.
HOEJW84	262	859225	1-511	15-525	R06873, and T84693.
HOEKH88	263	924112	1-692	15-706	AI694533.
HOEKP01	264	918873	1-436	15-450	AA043660, AA336439, D79158, T32005, Z24843, and AA482531.
HOEKP79	265	963337	1-455	15-469	AA506744, AA564925, AW080772, AA972523, W24312, N69686, AA501450,
					AA831345, AA515733, AW029515, AI264579, AI446127, F25580, AA524846,
					AI300054, W61253, R51582, AI421723, T64444, AL119156, AL119182, AL133353,
					AC006480, AC006160, AF011889, AC010206, AC008928, AL133163, AC004849,
					AC004596, AL121653, AL118510, AC008119, AL024498, AL133500, AL109753,
					AL096701, Z84488, AC004605, AC007684, AB020867, AL021940, AL031295,
					AL031602, AC003037, AL021368, AC007221, AL031659, Z98048, AL021877,
					AC005393, U50871, U96409, AF111168, Z95152, and AC003689.
HOEME76	266	974069	1-530	15-544	AA280295, H19334, AI371007, AA127347, N24841, F09340, AA635400, N52087,
					and U60062.
HOEMK02	267	918364	1-94	15-108
HOEMQ65	268	922789	1-309	15-323
HOEOE25	269	907806	1-611	15-625	AW182459, AI376825, AI654638, AA866171, AA984176, AA806823, AA743557,
					AW340266, AA470942, AA470974, AI868578, AA743581, and AA761032.
HOHAA14	270	468867	1-371	15-385
HOHAB04	271	665381	1-271	15-285	AA465435.
HOHAB21	272	670814	1-229	15-243
HOHAE68	273	781448	1-321	15-335	AI751085, AA033678, D30912, and W55850.
HOHAM36	274	782043	1-539	15-553	AA059163, AA864897, H99945, and N64132.
HOHBE48	275	588317	1-386	15-400
HOHBF30	276	859046	1-504	15-518	Z84484, and AC006571.
HOHBL11	277	966720	1-464	15-478
HOHBL32	278	588329	1-538	15-552
HOHBO79	279	588271	1-428	15-442	AI638299, AA918485, and AF077660.
HOHBW86	280	784723	1-264	15-278	AC009247.
HOHBX75	281	669536	1-493	15-507	AI735183.
HOHBY75	282	840109	1-413	15-427	AI215403, AW297341, Z21179, and AL137348.
HOHCH04	283	859047	1-621	15-635
HOHCI05	284	935123	1-380	15-394
HOHCM38	285	709295	1-416	15-430	AA058800, AI268296, N47161, AA303034, and H45390.
HOHCM90	286	703734	1-140	15-154
HOHCO85	287	751299	1-565	15-579	Z21583, and AL096771.
HOHCP35	288	656516	1-281	15-295
HOHCQ76	289	825236	1-549	15-563
HOHCQ77	290	661480	1-103	15-117	AP000274, and AP000104.
HOHCV83	291	735685	1-289	15-303	AI636734, T60940, H01852, AI078143, AI683019, AA854460, R35259, AA541794,
					N74027, AW167909, AI439676, W63553, AI472070, AI538106, AI332676,
					AI446259, W67486, AW245354, AA856817, AW152661, AI459617, AA845825,
					W67485, T49133, AI961232, AL041342, AI149238, AA807579, AA362037,
					AA565232, AA502813, AI434365, M78026, AA988600, AI127133, AA502498,
					T07225, H79586, AA471086, R83068, AA559205, AI223968, N68851, R48980,
					AI679496, N92064, AA702717, AW439625, AI962973, AW439820, N34258,
					AI859849, AI762302, AA636102, AA551548, N22153, AA572982, AW073498,
					AI929410, AI753672, AI750950, AC007371, AF165138, Z94277, AC004084,
					AC004838, AC005520, AC004985, AL008735, AC005751, AC005971, AF029062,
					AB000876, AC004181, AP000506, AL022313, AB000882, AC004655, AL031178,
					AC005377, AL022345, AL031584, AF227509, AF108083, AC005660, AC004941,
					AL035415, AC005486, Z98304, AC000049, AL096774, AC004079, AL033504,
					AC004020, AC007156, AC008372, AF008915, AC004750, AC005568, AC003959,
					AL050350, AL035410, AC005913, AC004805, AC005412, AC004854, AC002407,
					AL050318, AL096716, AC007686, AL022311, AL035587, AL096791, AC006368,
					AL109865, AC003664, AC008040, AF132033, U73630, Z81314, AC006347,
					AC006130, AL049748, AL096861, AL022400, AC003973, AC005081, AC005837,
					AC003991, Z72006, AC004797, AL021707, AP000045, AP000113, AL035417,
					AL079342, AC005043, AC008115, AC004953, AL022302, AL035249, AC005186,
					AL133163, AC004531, AL109628, AC005262, AC004771, AL021920, AC004967,
					AC011604, Z99716, AL049779, AC005005, AF043251, Z49236, AC004235,
					AC004034, AC002450, AF050154, AC005789, AC005233, AC004131, AC004913,
					AC004070, Z95116, AL049631, AL096712, AL031657, AC007114, AL031281,
					AF121782, AL022336, AC009275, AC007011, AC004098, Z98949, AC005058,
					AC006040, AF064857, L47234, AF179633, AL035683, AC012099, AF003529,
					AC009263, AC004893, AC002544, AP000555, AC004585, AL133245, Z97053,
					AC002302, AC005274, Z82173, AC005265, AB015355, AL031602, AL049540,
					AC005067, AC005255, Z98048, AP000502, AL117354, AL008583, AC005754,
					AL031280, U82671, AC005914, AF047825, AC005534, and AL031053.
HOHCW02	292	919142	1-290	15-304
HOHDB11	293	966413	1-650	15-664	N29990, N36333, AI085776, H25536, H26237, H81879, H96029, N26443, N31186,
					W03046, W44451, AA037341, AA079718, AA203198, AA424475, AA745282,
					D82780, C00261, AA249588, and T48492.
HOHDB32	294	698781	1-303	15-317
HOHDD23	295	675616	1-400	15-414
HOHDF40	296	710748	1-357	15-371	AA640725, AI333044, AL042761, and AB011158.
HOHDF53	297	727620	1-410	15-424
HOHDI48	298	966379	1-241	15-255
HOHDY85	299	764155	1-407	15-421
HOHDZ61	300	741382	1-272	15-286
HOHEA19	301	668208	1-385	15-399
HOHEC41	302	712037	1-523	15-537	AI971892, AI683311, AB033063, and AR065869.
HOHEN50	303	662365	1-150	15-164
HOSAB04	304	531565	1-310	15-324	W61042, AA304276, AA099793, AW369803, AA451642, AI908298, AW369815,
					AW369818, AA451620, AW369839, AA192643, AW151982, AI982623, AI857726,
					AW369763, AI204558, AA320140, W27176, AA319885, AW023791, W27949,
					AI670119, AI554355, AW051557, AI804785, AW236073, AI799768, AA192644,
					AA908706, AA888425, AA876810, AA167392, AA577519, AA876691, AA525477,
					AA879274, AI345444, C17613, AI075107, AI114490, F34539, AI492852,
					AA593784, AA738303, F37334, AA566072, N86742, AA886806, AA503355,
					AA523167, AA541429, AA876872, AI933389, AA877045, AI352526, AW050724,
					AI536939, AA886558, AA469371, AI694189, AA937272, AI420436, AA542813,
					W21397, AI418514, AA166702, AA102263, AA522721, AA166638, AA526669,
					AW273151, AW327392, AA999779, F17050, AI042584, AA136123, AA747343,
					AF117616, AL031003, L39354, L39338, L39332, U95676, U95677, U95681,
					L39330, L39334, U95680, U95688, AJ230596, AJ230597, AJ230599, AJ230603,
					AJ230605, AJ230609, AJ230595, AJ230602, AJ230607, AJ230610, AJ230611,
					AJ230613, AJ230600, M76331, M76289, M76288, M76293, M76360, M76286,
					M76297, M76320, M76329, M76314, M76363, M76367, M76364, M76366, M76287,
					M76307, M76342, M76368, M76302, M76339, M76306, U25391, U25395, U25359,
					U25363, U25371, M76315, M76290, M76323, U25357, U25368, U25400, M76316,
					U25379, M76341, M76340, U25409, M76301, M76337, M76356, U25358, U25373,
					U25396, U25407, AF176190, M76296, M76304, M76347, M76348, U25372,
					U25412, AF176182, M76361, U25390, AF176138, AF176179, AF176180, M76335,
					M76351, M76354, U25397, M76362, U25369, AF176174, M76305, AF176202,
					M76328, M76350, U25403, U25408, AF176183, AF176205, M76352, U25364,
					U25366, AF176161, M76330, U25410, AF176171, AF176172, AF176200,
					AF176201, M76333, U25388, U25399, U25405, U25406, AF176166, M76292,
					M76295, M76326, M76359, U25356, U25361, U25384, U25402, U25365, U25370,
					U25374, U25413, AF176132, AF176181, AF176194, AF176203, M76353, U25362,
					U25367, U25392, U25393, U25394, U25401, AF176125, AF176140, AF176141,
					AF176164, AF176178, AF176189, AF176199, U25377, U25378, U25398, AF176130,
					AF176137, AF176142, AF176158, U25404, AF176139, AF176162, AF176167,
					AF176175, AF176204, U25354, U25355, AF176131, AF176134, AF176144,
					AF176159, AF176187, M76309, U25383, AF176126, AF176128, AF176160,
					AF176163, AF176170, AF176185, AF176198, M76319, AF176129, AF176186,
					AF176193, M76324, U25381, U25382, AF176143, AF176173, AF176184,
					AF176133, M76355, M76346, M76299, M76291, M76294, M76312, M76283,
					X93341, M76325, M76334, V00661, M76303, U25411, AF176156, U25360,
					AF176195, X93334, U25375, U25376, L39322, L39320, L39352, L39350, L39326,
					L39328, L39348, U95685, L39344, U95684, AJ230601, AJ230606, M76327, U95687,
					AJ230614, K02485, M12531, AR058756, M76268, M76258, M76313, M76317,
					M76310, M76358, M76298, M76345, M76275, M76336, M76260, M76265, M76266,
					M76344, M76300, U25387, U25389, M76264, M76343, M76349, M76357, U25386,
					AF176169, U25385, M76276, AF176127, AF176168, AF176157, and AF176192.
HOSAR25	305	509226	1-319	15-333
HOSBR08	306	925430	1-94	15-108
HOSBU17	307	667195	1-569	15-583	AA181322.
HOSBU81	308	508735	1-156	15-170
HOSBV22	309	780092	1-252	15-266	AI368409, AI767148, AI347671, AI400068, AA954702, AI583977, AA009615,
					AI418746, and AI457713.
HOSBW16	310	933016	1-238	15-252	AA421843.
HOSCG51	311	967584	1-421	15-435	AA381761.
HOSCM15	312	921336	1-384	15-398	AC005661.
HOSCZ35	313	707379	1-356	15-370	AA330344, and AJ005821.
HOSDE63	314	580959	1-188	15-202	H15344, AI752743, R23438, AA401585, AW339993, Z44943, H06750, H50269, and
					H40825.
HOSDG51	315	523872	1-359	15-373
HOSDN27	316	530459	1-256	15-270
HOSEB61	317	741812	1-883	15-897	N98675, and AL049781.
HOSEM84	318	831049	1-354	15-368	AI073997, H87655, AA326173, AA157664, W45610, AA182685, AA352875,
					AA358040, and AA320365.
HOSFO57	319	736034	1-309	15-323	AW363743.
HOSFV63	320	873010	1-159	15-173	R32290, H56316, H56315, AI701812, AI818182, H02802, AW189354, AA179098,
					AI149010, AA903771, AA846152, AW236253, AI688210, AA219082, AI188637,
					AI457307, AW148946, AI912534, AW008419, AW149032, W56627, AA470757,
					AA464507, AI888588, AI056698, AW168755, AI924212, AA522891, AW089716,
					AW193562, AA987677, AA343171, AA769724, F35157, and AA361146.
HOSFY79	321	774052	1-417	15-431
HOSFZ39	322	705351	1-355	15-369
HOSGH28	323	686649	1-395	15-409	AA364637, AA149539, AA405966, AA828153, AI032490, AA320105, AA237098,
					AA662590, H85808, R64617, R70883, AA838091, AA714999, AI434513, N63149,
					AA632765, C14480, AI471467, AW007424, AA468196, AA558404, N95156,
					AA729512, AA551268, AA603400, AA838161, AL041375, T05118, AA526107,
					AA553579, R81911, AA528566, AA728861, AW117860, AA715955, AI049630,
					AA548968, AI671077, AI452836, AA532732, AL118925, AI302156, AL045476,
					AW440451, N28624, AA612578, AA302978, F16848, N54538, AI870453,
					AA601237, AI249365, AA708132, AA586433, AI912401, AC005520, AC005736,
					AC007371, AC003973, AC007066, AL022165, AC003684, AF109907, AL008582,
					AC005233, AC004859, AF064861, AC005837, AC003108, AP000692, AL034379,
					AC008009, AL096704, Z83826, AC005839, AL022158, AL080243, U91326,
					AL049538, AF111168, AF051976, AC005531, AC007684, AC002558, AC008085,
					AC006023, AC005971, AC003669, L78810, L78760, U51561, U50871, AC003098,
					AC004991, AC004900, AC007845, AL035088, AL033381, AL133353, AC007637,
					AC016026, AL049780, AC007055, AC005486, AC005519, AC002550, AC007666,
					U91318, AC000052, AC004019, AC006211, AC004821, AC003951, AL021155,
					AB033026, AC005058, AC004782, AC006449, AC006947, AC002314, AC008015,
					AL049843, AP000133, AP000211, AL049735, AC005696, AC004000, AB022430,
					Z77852, U53583, AC005214, U89335, AL049653, AC004834, AL096757,
					AC004254, AB020877, AF155238, AC007129, AP000512, AC005164, AC005664,
					AC000025, AC005527, AC006547, AL021938, AC002044, AC005529, AL135744,
					AC005031, AC004712, AL133245, AL024498, AC007676, AP000358, Z93783,
					AL035587, AC002996, Z99716, Z93241, U80017, AL034429, AC004707, AP000353,
					AP000354, AL022330, AL022238, AC006487, AC005722, AC005730, AC005921,
					AL035405, AC002369, AC005412, AP000359, Y14768, AC004638, AC000081,
					AP000043, AP000111, AC005598, AC009247, AL031431, AP000212, AP000134,
					AP000030, AL022313, AC004909, AL049650, AC008122, AC005102, AC000159,
					AP000300, U43572, M84472, AP000299, AC000075, AC000084, AF039907,
					AC002491, AC005786, U34879, Z83847, AC004131, U82668, AF003626,
					AL035408, AC004897, AC005255, AC004913, AC005057, AP000504, AP000113,
					AP000045, AC005231, AC005004, AL031622, AL049748, Z83823, AC004259,
					AC006251, AL031735, AC004600, AC003043, Z84469, AC006996, AL023803,
					AC004534, AC005666, AC009542, AL133241, AP001053, AC009721, U91323,
					AC005695, AC010170, AC009330, AC005920, AL022069, AC005939, AC004216,
					AC007738, AF129756, AL079305, AC010582, AL132985, AL049569, AC005332,
					AC004615, AC005618, AC005663, AL035079, AC006505, AC007206, AP000251,
					AL035249, AL031291, AL035460, Z83844, AL133448, AC000353, AC005399,
					U95742, AL035685, AC008115, AC006441, AC005669, AL080317, AC007450,
					AC006125, AC005288, AF196969, AL023584, AL078638, Z98946, AC007057,
					AC007216, Z82194, Z81365, U91321, and U47924.
HOSGJ17	324	508870	1-319	15-333	AA430297, AI633618, and AW293117.
HOSMD84	325	959483	1-1036	15-1050	N75110, and H71506.
HOSNO86	326	858938	1-464	15-478	W19582.
HOSGE05	327	930946	1-494	15-508	AW341882, AW089950, AW392414, AA768179, AI223968, AA573000, AA429481,
					AI142551, AA135761, AA515172, AA568127, H86579, AW236277, AI185394,
					AI471455, AA626840, AA666295, AW151247, AA527109, AI687343, AA368155,
					AI370470, AA720582, AA507526, AA662629, AA664248, F23327, AA657910,
					AA225100, H01852, AA702717, AA706495, R34070, AI857366, AA480486,
					AA469230, AA338266, AA550959, AA829565, AI521042, AI701250, AA502110,
					AI709174, F23338, AA503142, AA250955, AI358501, AI590404, AI624379,
					T48723, AI521393, C75533, AA655037, AA469441, AW083934, AI523205, T94072,
					AI281943, AA484892, AL048825, AA716460, AI355103, AI431513, AI635440,
					AW080724, AA456937, AA377318, AA773881, AW409763, AA224525,
					AW404666, F34506, AI923331, AA187760, AA736447, AA714110, F27015,
					H85059, AI123488, AI762302, AA643434, AI114657, AA362349, AW068580,
					AA946848, AI821382, AI678812, AA535494, AW272389, AA548710, AI668605,
					AI499954, AI820534, F00688, AA610374, AI679394, AI925423, AA643424,
					AI369076, AI679902, AA228442, AI288033, R80563, AA483483, AA856817,
					W28961, T53133, AA741301, AA808725, AW150167, AA559241, T70539,
					AA678622, AW368401, AA601212, T07903, AA298365, AA487829, AA654464,
					T92803, AW162555, AI811647, AA368012, AI250019, AA598740, AW019964,
					AA709110, AI144055, H81700, AA481779, AI733856, T59930, AI366981,
					AA714073, AA074351, AA572921, AA810158, AA657835, AA468923, AA206163,
					T03928, AA715876, F32248, F35946, H77505, AL048060, AA664169, AA581525,
					R87135, AA373861, AA630845, AA487209, AA992126, AA578973, F26953,
					AA374525, AA568856, AI289505, AI359200, T03576, AF150410, AW157005,
					AI356440, AA507343, AW404647, AA458573, AI114680, AL021578, AC004673,
					AL034421, AC011456, U96629, AC018633, AP000503, AF134726, AL034345,
					AL033521, AC006101, AC002994, AL049869, AL022398, AC003966, AL109952,
					AC004623, AL031431, AC002400, AC004773, AF196779, AL050341, AC007068,
					AC002404, Z83847, AL009183, Z97876, AC005102, AL109827, AP000504,
					AC004849, AL080243, Z94801, AC019014, AF129756, AC004901, AC005189,
					AC006111, AC004895, AC004999, AC006511, Z68323, AF061032, AF003626,
					AL117328, AC000003, AF015164, AL022147, AC004587, AC004741, X64467,
					AF002993, AC004531, AL133245, AP000690, AL109963, AP000689, AC004448,
					AP001053, AC006057, AC005562, Z83846, AL078593, AC007276, AC004645,
					AC005484, U91318, AC005348, U80017, AL021707, AP000355, U73479, U89337,
					AL049570, AL034561, AC022517, AL022345, AC004882, AL049569, AL109628,
					AC004084, AC006344, AC005088, AC004782, AC004209, Z99291, AP000096,
					AL121603, AC004020, AP000240, AP000249, AC005785, AC007312, AC006600,
					AC005386, AC005531, AC005516, AP000555, AC009516, AC007308, AC005257,
					AP001068, AC002563, AP001067, AL031121, AJ011930, U52111, AC007671,
					AC005971, L77035, AC004125, AC006011, AC005031, AC004041, AL008710,
					AC006597, AL031275, AC004796, AC006160, AC006312, AF029308, AF053356,
					AL079305, AC006359, AP000514, AL035682, AC004893, AC004955, AL031283,
					AC006552, AF077186, AB014077, AF187320, AP000347, AL121757, AC005696,
					AC005726, AL008635, AC007228, AC009464, AL122020, AL031230, AC005225,
					AC005399, AL022476, AC000159, AC005944, AP000093, Z98051, AC005207,
					AC004584, L78833, AC002040, U95742, AC004984, AC007381, AC004112,
					AL022238, AC005690, AP000468, AC005907, AJ011932, M26434, AL023578,
					AF030453, AC003663, AP000556, AP000557, AC004383, AF111169, AJ246003,
					AL020997, AP000113, AP000045, AF190465, AL049745, AC006427, AL031657,
					AC008372, AC004706, Z95152, AC009731, AP000237, Z83845, AF107258,
					AC000075, AF051976, AP000210, AP000132, AP000558, AP000553, AL049636,
					Z97056, AL117436, AL031668, AL121658, AP000115, AC006962, AC004506,
					AL024474, AC005477, AC004590, Z77249, AL035089, AL049776, AL035681,
					AL022240, AP001054, Z69720, AC004539, AP000510, AC006449, AC005037,
					AC004883, AC005305, X65032, AC003086, AP000226, AF196969, AL109758,
					AL022332, AC005921, AC007537, AL022163, AC003109, AP000087, AC005378,
					AL020995, AL022311, AC005666, AB000462, Z68279, AC006540, AC005670,
					AP000348, AL049590, AC005619, Z73967, AC005800, AC007279, AC008273,
					AC002312, AC007207, AC006251, AL021808, AC005829, AF008915, AP000312,
					Z74617, and U73644.
HRDAB18	328	509019	1-263	15-277	AA372168.
HRDAB60	329	509428	1-323	15-337	AA372225, AA514809, AA501943, and AC008082.
HRDAF07	330	954331	1-317	15-331
HRDAF69	331	956269	1-212	15-226	AL022320.
HRDAF90	332	531026	1-311	15-325	AB020878.
HRDAH91	333	525525	1-305	15-319
HRDBA76	334	534304	1-337	15-351	Z98304.
HRDBC02	335	921144	1-599	15-613	AA372229.
HRDBC30	336	530858	1-235	15-249
HRDBC52	337	867169	1-299	15-313
HRDBD35	338	525526	1-367	15-381
HRDBE07	339	954289	1-356	15-370
HRDBE18	340	956267	1-466	15-480	AA253263, AA973971, and T88817.
HRDBE19	341	534495	1-381	15-395
HRDBE41	342	530856	1-370	15-384	AB023049, AC006138, and AP000513.
HRDBG59	343	507381	1-300	15-314
HRDBI81	344	932761	1-303	15-317
HRDBJ28	345	925457	1-336	15-350
HRDBK03	346	925460	1-356	15-370	AI694154, N58235, T40838, T40853, AA485402, AI521019, AI761393, AW068580,
					AI620266, C15362, AI018726, AA584493, AA324088, AA326330, T47138,
					AA487415, AI872229, AA614647, AA487296, AA584183, AA487209, AA558404,
					AI955360, R94909, R84335, H94979, AA626840, AA514450, AI243793, AI538491,
					AI270647, AI744933, R76565, AL039761, AA167179, AL034417, AB017602,
					AC005697, Z93023, AL121694, AC005874, AF134471, AC007151, AC004750,
					AC005568, AL034555, AP000144, AC004983, AL031668, Z30952, U07561,
					AC004798, Z82214, AC004988, AC005206, AC008015, AL031662, AC005667,
					AC005288, AC005803, AC004067, AF112441, U63721, U52112, AL109628,
					AC001531, AC007566, AL008718, AP000555, Z98052, AL121603, AL109967,
					U70984, AL109623, AC003051, AC008273, AL031053, Y11493, AC007225,
					AC006277, AL031388, AP000689, AL033521, AC006120, X15943, AC005514,
					Z97876, AF141309, Z83840, AC005231, AL022330, AC007227, AC005600,
					AL031667, AC004478, AC005822, AC005768, AC003690, AC005316, AC005343,
					AL049697, AC005317, AC005406, AC005940, AC007993, AF031076, AC005775,
					U89337, AF031078, AF030876, AC002477, AC003665, U52111, AL096791,
					AC005736, AL021394, AC004149, AC005480, AF196970, AL133448, AL022401,
					AC004477, AC005755, AL050348, AL021578, AC005799, Z83844, AC002991,
					Z97635, AC004973, AL009051, AF196972, L78810, AC005146, AC005036, Z97054,
					AC005529, AL034420, AC002091, AL031597, AC006388, AC004953, AL031432,
					AC006948, AC006449, AJ003147, AC005412, AP000493, AC003036, Z93016,
					AC003002, AC005694, AL021707, AC007541, Z68192, AL022311, AC006130,
					AF015416, AC003661, AC005193, AC005184, AC007738, AC005919, AL080243,
					AC002364, AC006132, AC004414, AC004167, AF107885, AP000277, AC004034,
					AC004651, AC006293, AF184110, and AC004922.
HRDBL61	347	575229	1-336	15-350	AW139046.
HRDBL75	348	524423	1-254	15-268
HRDBM42	349	530849	1-361	15-375
HRDBQ18	350	954274	1-380	15-394	U53331.
HRDBQ38	351	533939	1-310	15-324	AA513046.
HRDBQ64	352	879705	1-478	15-492	AL079303, AL133355, M15366, U91323, AL049569, AF217403, AF165124,
					AC006111, Z84488, and AC006241.
HRDBQ82	353	533947	1-401	15-415
HRDBR04	354	927900	1-340	15-354
HRDBR35	355	867167	1-303	15-317
HRDBT72	356	507847	1-340	15-354
HRDBU70	357	971700	1-75	15-89	AL049745.
HRDCA61	358	921128	1-442	15-456
HRDCB18	359	968554	1-336	15-350
HRDCD12	360	921796	1-419	15-433
HRDDF49	361	867159	1-121	15-135
HRDDF95	362	967837	1-434	15-448
HRDDH84	363	867156	1-470	15-484	AA287503.
HRDDN54	364	932764	1-301	15-315	AC004853.
HRDDN90	365	531117	1-310	15-324	AF015262, and AJ229043.
HRDDY26	366	526783	1-153	15-167
HRDDY73	367	574336	1-439	15-453
HRDDZ76	368	574324	1-113	15-127	AC002210, and AC004227.
HRDEB78	369	526861	1-284	15-298
HRDEC91	370	747169	1-627	15-641
HRDED92	371	936045	1-296	15-310	AL139054.
HRDEG76	372	574326	1-310	15-324
HRDEJ76	373	574335	1-152	15-166
HRDEK44	374	574380	1-210	15-224
HRDEL91	375	790374	1-204	15-218	T84539, AI858864, AL034553, Z85986, AC005288, L78833, AL049576, AL021707,
					AC007919, AL133163, AP000694, AL109799, AC005049, Y10196, AC003007,
					AL049839, AC005057, Z81308, AL023553, AL122020, AL049757, AC005632,
					U62293, AL031281, AL022163, AP000509, AC006530, AC006468, AC005253,
					AC006449, AL035088, AP000692, AC003663, AC004126, AC004526, AP000044,
					AP000112, AC005581, AP000023, AJ246003, AC005231, AC002301, AC006112,
					Z82178, AL031681, AC005746, AC005722, AC002431, AL121603, AC012627,
					AC006285, AC003101, AC007052, and AC005081.
HRDEO12	376	867140	1-279	15-293	AA745407, T52786, AA757869, AA320095, AA779599, AA508103, AA302763,
					F07564, AA745388, AW440424, AA366676, AI002863, AA424249, AA112791,
					AA084148, AA713720, AA083850, AA993165, AA339592, AA351808, AA362440,
					AA508882, AA496309, AA856815, AA230075, AA347203, AA496941, AA336058,
					AA744063, M86139, AI940546, AA015948, AI929418, AI929460, AA454504,
					H27788, AA748840, AI032411, AA768079, AI701898, AA010265, AA372231,
					AW028376, AI345256, T31290, AI571094, AA629939, X84712, AA372389,
					AA383937, AA297496, AA085372, AI337065, AA349923, AA736488, AA368329,
					AI445338, AW407007, AA744018, AA579044, AA557727, AA364006, AW377912,
					AA084950, AA338216, AW157128, AA812542, H87818, AL109801, AL133243,
					Z98036, AC007283, AL031767, AC004895, AL035658, AL034429, AF001548,
					AL132777, AC004893, AC004491, AL031283, AC006509, AC007688, AL021546,
					AF047825, AC007157, AL035454, AC005670, AC006088, AL049830, AC002425,
					U07561, AC005971, M63796, AC003043, AL049538, Z83844, AC012085,
					AC006312, AP000501, AC004158, AC004019, AC005330, AC004985, AL022336,
					AC007240, AC009247, AC004967, AL021453, Z82176, AL135960, AJ131016,
					AC007052, AP000349, AB008681, AC006946, AC004000, AC006148, AP000032,
					AC006101, AC005231, AC006006, AC004223, AL022316, U62293, Z82206,
					AL031295, AL031589, AC008928, AF064857, AF165926, AL117258, AC005057,
					AF134726, AL023775, Z82244, AL035455, AC006130, AL121934, AL117391,
					Z84480, AL034582, AC005516, AC009501, AC002126, AC005740, AL031657,
					AC005015, L05367, AD001527, AC005500, AC004815, AC005081, AC000159,
					AL031650, AC005940, Z95152, AC007367, AL049539, AF207550, AC004520,
					Z95889, AC007541, AC005786, AP000047, AL109628, U02057, AC007686,
					AL049764, AC003690, AL022721, AC004098, AC005871, AL049760, AC006084,
					AC005482, AC005581, AF001549, AC006441, AL031121, AF111168, Z70281,
					AC005599, AP000133, AP000211, AC006141, AL021808, AP000117, AC002350,
					AC004820, AL121658, Z99128, AC005778, AC004526, AP000500, AC004253,
					AC005060, AF111170, AB020868, AC004132, AC006511, AC006965, AL133448,
					AC003086, AL021394, AL031311, AC002369, AC004650, AL031291, U63721,
					AC004922, AL049569, AL031775, AC005565, AC011594, AP000050, AL049843,
					AL020997, AF042089, AL050348, AC004883, AL021392, AL008719, AL035696,
					AL024507, AL023880, AC006071, AP000269, AC006013, AL109952, AL031005,
					AC007243, AL033397, AP000555, AC005512, AC004914, AP000115, AC000070,
					AC004707, U89336, AC002395, AL121754, AL109963, AJ011930, AL035588,
					AC006162, AL117329, AC006063, U47924, AB014087, AC007917, AC008101,
					AC004084, AL008631, AF222684, Z97630, AL035249, AL080243, U81031,
					AC000028, Z93244, AP000116, AF129756, AL031433, AC005049, AC006505,
					AL049776, AC002314, AJ246003, AL080250, AC004856, AC002094, AC008009,
					AL096701, AL035457, AC016027, AP000103, AL096712, AL117330, AC005793,
					AC004188, AC006930, AL022163, AC016830, AC005484, AC004190, AC005531,
					AL022398, AC005914, AC007327, AF195658, AC004832, AL050341, AL035659,
					AL109956, AL031577, AC002470, AF124730, AC006360, AC005695, AL135744,
					and AC005235.
HRDEO76	377	952894	1-606	15-620
HRDEP31	378	766222	1-205	15-219
HRDEP75	379	574431	1-366	15-380
HRDEQ30	380	506774	1-314	15-328	AI051942.
HRDEQ96	381	507543	1-446	15-460	AA634654.
HRDES52	382	867115	1-340	15-354
HRDES65	383	526823	1-395	15-409
HRDET67	384	825182	1-333	15-347
HRDET91	385	827084	1-426	15-440
HRDEU33	386	572905	1-306	15-320
HRDEU42	387	881296	1-323	15-337
HRDEU43	388	765813	1-146	15-160	N95696, AA683130, N95587, N95562, and AL021368.
HRDEU61	389	575566	1-405	15-419
HRDEU78	390	573031	1-321	15-335	AC004031.
HRDEU93	391	844316	1-449	15-463	R97129, and Z92544.
HRDEV13	392	574442	1-107	15-121
HRDEW02	393	848793	1-319	15-333	R69655, AA504728, AW197426, AW239197, R61016, L44427, H09430, N98902,
					Z42694, AA432395, and AA337216.
HRDEW30	394	526812	1-482	15-496	Z68226.
HRDEW90	395	574288	1-415	15-429	AC003077.
HRDEY14	396	574438	1-485	15-499	AC009263.
HRDEZ06	397	936072	1-402	15-416
HRDEZ54	398	867127	1-461	15-475
HRDEZ60	399	919386	1-208	15-222	AI949774, AA493365, AI039944, AI332543, AW082899, AW157648, AA300420,
					AA706469, R88367, AI969957, and AI167160.
HRDEZ64	400	536668	1-66	15-80
HRDEZ84	401	575553	1-474	15-488
HRDFB47	402	508001	1-316	15-330	AI932599, AA486559, AW002350, AA719531, AI345418, Z18873, AI144101,
					AC005332, AC007546, AC004686, AL096791, AC007773, AC005736, AL022165,
					U50871, AL121655, AC002350, Z69838, AC002492, AC006064, AC004526,
					AL049759, AC005488, AL049636, AC005531, AC006449, AC008372, AC002992,
					AL031680, AC007308, AC005207, AC004033, AC003689, AC004797, AC005225,
					AC005081, AL035420, Z98743, AL020993, AC009247, AL049569, AC006285,
					AP000510, AL133246, AC002400, AL031291, AL109758, AC005412, AC004382,
					AC005829, AL022476, AJ229042, AC005632, AC006006, AC005703, AC016027,
					AC006581, AC016830, AL035413, AF129756, U91323, AC005324, AC005071,
					AC002395, AC004832, AL022326, AL049776, AC005015, D84394, AC004477,
					U80017, AP000086, AC002565, AL034548, AF015723, AL096701, AL049709,
					AC004821, AC004983, AC005037, AC005667, AP000117, AC009509, AL035683,
					AC007182, AC000353, U95742, AL049694, AL009183, AC007686, Z98884,
					Z84484, AC007216, U95090, AL049869, AC008018, AC005206, AC005104,
					Z97196, AL050307, AL133448, AC006121, AC006538, AC006160, AC005520,
					AC005924, AC004887, AC004087, AC008045, AC008119, AC004638, AC007435,
					AC002404, AL049539, AL133163, Z83822, AC000003, AL035086, AL117258,
					U07000, U93237, and AC002091.
HRDFB78	403	589478	1-402	15-416	Z78337, AW375353, U55777, T60176, AA364491, AI140371, AW393482,
					AW387144, AW402704, AA338532, and T30802.
HRDFC68	404	574205	1-384	15-398	Z94044.
HRDFE73	405	574142	1-322	15-336
HRDFE74	406	765750	1-301	15-315	AI452477, AA526633, AC006211, AL031276, AC004893, AL096712, AC000025,
					AC003687, AL109760, and AC003101.
HRDFF42	407	953913	1-78	15-92
HRDFF62	408	574436	1-508	15-522	T77462.
HRDFG25	409	574433	1-332	15-346
HRDFG37	410	792517	1-280	15-294
HRDFG46	411	574439	1-365	15-379
HRDFH14	412	575578	1-149	15-163
HRDFH24	413	575245	1-423	15-437	AI284640, W00807, AI291124, R97934, AI471481, AI282832, AA862173,
					AI245679, AA947811, AA362349, AA507547, AW265009, AI801600, AI889781,
					AI357551, AA515224, AI439210, AA806796, AA828704, AA810370, AA348929,
					AA775940, AW339568, F34498, AA557686, M86143, T07451, T05101, AA654771,
					AI457397, AA593247, AI866908, AA584201, AA513293, AI358571, AI291268,
					AI281697, AA678436, AA578861, AA213741, AA493708, AI298710, AA661948,
					H86305, AA669840, AW089322, AA513141, AI049634, AA831375, AI564185,
					AA554319, AI364809, AA525824, AI500454, H51714, AA259245, AA713891,
					AA491284, AI561255, AL046409, AA610611, AW327868, AW338086, AA603156,
					AW103758, AI358343, AI499938, AA579075, AA348017, AA649722, AA346458,
					AA492166, AA847985, AA908468, N25296, AL042853, T41242, AI904894,
					AW265385, AA244357, AA502103, AA649542, AA649484, AA503283, AW168342,
					AW193609, AI859251, F33121, AI888008, AA665330, AA426277, AW265699,
					AI358501, AA630925, F04987, AA503284, AA225246, AI475569, AA916371,
					D83989, M87919, X75335, S70707, U67827, U67829, M37547, AF077058, M37551,
					X55923, AB023052, AC006203, AP000513, M87925, U14706, AC002536, Z94721,
					AC002301, U73024, AC004821, AL031736, AF015151, AC006138, AL031685,
					Y10196, AC005324, U14716, AF015156, U14713, AL133245, AL022238,
					AL096707, AC005622, AC006292, AL035681, AC016830, AF018071, D87675,
					D13624, AC007731, AL109984, AL078613, M19045, J03801, E01888, E02193,
					AL022727, AC006449, AC006004, AL122003, AC002380, AP000141, AC004388,
					AC007546, AB020863, S43650, AC007050, AC004263, AC005261, U07562,
					AL132987, AC006274, AL021368, AC010175, L49046, Z68223, AR047856,
					AC004687, AP001172, AF042090, AC004076, AC007064, AC007363, AF129756,
					AC005900, AC005280, AC006057, AC008039, AC005682, AC008124, AP000326,
					AP000353, AL021937, AC004853, AC002059, AL121934, AL022067, AC004151,
					AP000054, AP000169, AP000359, AC000067, AC005940, Z68192, AL021154,
					AC002480, Z69917, AL110172, AC002073, AL031729, AL022237, S75337, U14695,
					AC006959, AC004858, AC000120, U14710, AL023656, AL117352, AC004408,
					AL031281, AC005771, AC003688, AC002070, AL133371, AC006352, AL008709,
					AL035587, U91326, AL109612, AC006123, AL117258, AC005484, AL008629,
					AC005158, AC006079, AL035695, AL031123, AL080276, AC007450, AF109907,
					AP000122, AC007043, AC005563, X14008, AC004209, AC006001, AC010077,
					AC005703, AC004030, AC004901, AC004895, AC006998, D25272, U69569,
					AC006960, AL031224, AL117354, AP000517, Z92540, AL035496, AC005837,
					AC006285, AL049643, AC007536, AC009516, AC008115, AC007262, U14712,
					AC004638, AF132033, U95740, AC000086, AC006064, AP000349, AC004653, and
					AL035249.
HRDFH25	414	953882	1-370	15-384
HRDFH39	415	574558	1-364	15-378
HRDFH77	416	953673	1-422	15-436
HRDFI13	417	574561	1-363	15-377
HRDFJ71	418	574553	1-406	15-420
HRDFK03	419	924925	1-464	15 -478	AW410890, AL079806, and AB007931.
HRDFK41	420	867106	1-315	15-329	AI002928, AA804808, N55076, AA018258, AA804694, AC004983, AC004775,
					AC005225, AC005519, AL096791, AL031680, AC005291, AL022311, AC003072,
					AC004383, Z98949, AC006285, AL031602, AL021579, AL031985, AC005399,
					AP000113, AP000045, AL109623, Z84469, AC005755, AC007421, AC002395,
					AL022316, AP000555, AC002477, AF045555, Z94801, U66532, Z97056, AC007021,
					AL096701, AC005914, U95741, AL022238, AL049759, AC005696, AC005666,
					AC007225, AC004884, AF109907, AC016025, Y11107, AL008710, M26434,
					U47924, AC006388, Y14768, AP001054, AC005081, AF064861, AC005218,
					AF001548, AC009225, AC005730, AC006367, AC006101, AC005940, AC009509,
					AC005632, AL008718, AC004975, AC007283, and AC006362.
HRDFM18	421	574435	1-108	15-122
HRDFN95	422	574565	1-116	15-130
HRDFQ64	423	733847	1-256	15-270	AA832055, AA077542, AA770651, AC004987, and AL133216.
HRDFQ75	424	525524	1-240	15-254	AL132987.
HRDFT06	425	867109	1-389	15-403
HRDFT15	426	574549	1-415	15-429
HRDFT45	427	506584	1-530	15-544	AC004142.
HRDFT84	428	584823	1-445	15-459	AA309894, AB009022, AB012143, AB012142, AF025654, AF034568, AF025653,
					AB009023, and AB009024.
HRDFU48	429	573030	1-301	15-315
HSHAX53	430	518795	1-302	15-316
HSHBV66	431	523348	1-323	15-337
HSHBV67	432	529483	1-308	15-322	AC007536, and Z97832.
HSHCF34	433	529313	1-214	15-228	AL035415.
HSKCS36	434	529163	1-233	15-247
HSKCT33	435	866514	1-297	15-311
HSKDA70	436	757183	1-599	15-613	W49690, AA284238, W49689, AI950805, AI085909, AI457351, AI866940,
					AW013806, AI246901, AW051765, AI739482, AA394133, AI380566, AI921768,
					AI827273, AI860590, AW009629, AI768051, AI392972, W45591, W45590,
					AI022944, and AB017614.
HSKDJ16	437	661928	1-330	15-344	AL049464.
HSKEF43	438	866410	1-301	15-315
HSKEK63	439	744336	1-376	15-390	AA372904, C16438, AW380254, AW168420, AA534258, AI674174, AA372949,
					T39494, AC005331, AC006013, AL022311, AC004827, Z99570, AL020997,
					AJ010770, Z93023, AC005746, AP000505, AC006007, AC007546, Z75741,
					AC002563, AL024498, AL021546, AC007845, AC002398, Z94722, AC004815,
					AC004703, AL133404, AC004526, Y14768, AC005482, AC005200, AC005039,
					AC002319, AL021451, AC004099, AC004884, AC008119, AC005324, Z95152,
					M29929, AC007877, AC006112, AF129756, AC003101, AF107885, AL031320,
					U82828, AF007136, AC004976, Z69666, AL031668, AC004953, AC006965,
					AF196779, AF064751, AC005355, AC004702, Z81314, AC002541, Z69388, U91318,
					L47234, AC008273, AP000690, AC004152, AF002997, AL031117, AC009784,
					AF111169, AC004106, AL109628, AC004148, AC004253, U07562, and AP000318.
HSKEM02	440	969071	1-426	15-440	AA143157, AA063324, N57369, W81341, and AL133355.
HSKET11	441	967000	1-414	15-428
HSKHJ11	442	965002	1-433	15-447	Z98046.
HSKHS71	443	911592	1-367	15-381
HSKIT38	444	855173	1-369	15-383
HSKJS05	445	930979	1-64	15-78	AA731590.
HSKKD70	446	916984	1-563	15-577
HSKKL06	447	934040	1-646	15-660
HSKNO53	448	728210	1-521	15-535	AW275953.
HSKWA56	449	916496	1-423	15-437
HSKWA78	450	731756	1-516	15-530
HSKWA79	451	733394	1-488	15-502	W90331, AA398850, and AA435854.
HSKXG06	452	935455	1-312	15-326
HSKXJ15	453	866373	1-437	15-451	AL117340.
HSKXN20	454	668928	1-290	15-304	AI610572, AA494027, AW089962, AW020620, AW021195, AP000703, Y10196,
					AC004079, AL080243, AP000702, AC005067, AC005874, AF134471, AC006453,
					AL031255, AL031733, AL049767, AC007450, AC005089, Z83836, U95090,
					AP000347, AC005803, AP000352, AC002381, Z98048, AL033397, AC005777,
					AC005265, AC005696, Z98200, AL024507, and AC002117.
HSKXP58	455	955073	1-352	15-366	AA372956, AL031737, AP000553, AC004491, Z83826, AL050318, L78810,
					AC005484, AC007685, AL078602, AC005667, AC007298, AF049895, AC004699,
					and AC005206.
HSKXQ58	456	736045	1-376	15-390	AI810143, AI799021, AI347650, AW020141, AA143516, AA551503, H56729,
					N29948, N54304, AA601919, AA079101, AW089810, H79394, AW402170,
					AI580898, AL031257, AL022719, AL021808, AC008123, AC003007, AC005632,
					D86864, AC005776, AC005539, AC005262, AL022315, AP000126, AP000204,
					AC005252, AP000556, AP000244, AP000557, AC007050, AC007308, X89398,
					AL031280, AC007637, AF087913, AC005251, AP000150, AP000009, AC006016,
					D28877, AC005071, AC004019, AC006137, AL031386, and AC003684.
HSKYG66	457	698007	1-333	15-347	AI209100.
HSKYH52	458	466574	1-419	15-433
HSKYJ96	459	921032	1-346	15-360
HSKZE12	460	970639	1-104	15-118
HSKZE32	461	959400	1-273	15-287	AA464651, H60107, AA419210, R11432, AW151815, and AC006254.
HSLAB77	462	772652	1-301	15-315	AC007392.
HSLBO30	463	574086	1-198	15-212
HSLBW19	464	671738	1-212	15-226
HSLBX08	465	959911	1-257	15-271	Z95152.
HSLBX20	466	574004	1-422	15-436	AC005922.
HSLBZ91	467	573987	1-281	15-295
HSLCB15	468	693455	1-619	15-633	H24866, AA031368, W47079, W46779, H84840, N30984, W32033, AA018530,
					H26464, N40269, AA459816, AA296636, AI751106, W19406, R24391, R21973,
					AA370945, AW366386, AA374691, N40640, H39859, AA296525, AA446165,
					AW377667, AA322178, AI366199, N28622, AW367978, AA382270, T85743,
					AA337106, AI684270, AW367975, R57416, Z92846, and AF125535.
HSLCJ46	469	529622	1-265	15-279	AL096677.
HSLCJ47	470	908627	1-352	15-366
HSLCL38	471	951028	1-232	15-246
HSLCP75	472	529631	1-340	15-354	E08867.
HSLCV95	473	793080	1-315	15-329
HSLDA25	474	679301	1-370	15-384
HSLDB29	475	866340	1-424	15-438
HSLDC06	476	936010	1-259	15-273	AI672480.
HSLDG13	477	913664	1-325	15-339
HSLDI16	478	574014	1-202	15-216
HSLDJ24	479	574050	1-349	15-363	I09483, I09484, and I09485.
HSLDJ94	480	753657	1-447	15-461
HSLDK43	481	675440	1-521	15-535
HSLDM32	482	699486	1-299	15-313
HSLDM79	483	526740	1-335	15-349
HSLDP16	484	573210	1-433	15-447
HSLDW65	485	689722	1-416	15-430
HSLEB25	486	669654	1-389	15-403
HSLEC25	487	572859	1-400	15-414
HSLEC36	488	936003	1-365	15-379
HSLED38	489	709381	1-506	15-520
HSLED42	490	572860	1-375	15-389
HSLEE46	491	572878	1-322	15-336
HSLEF89	492	572883	1-346	15-360
HSLEG74	493	825500	1-385	15-399	AI526055.
HSLEH57	494	584090	1-130	15-144	F07221, AA307815, N99978, AI660617, AI906507, AW166174, W30916,
					AA877685, AI692837, and AA434201.
HSLEJ22	495	572863	1-304	15-318
HSLEL46	496	573212	1-275	15-289
HSLEO70	497	841952	1-354	15-368	AL048938, AW385766, AA417805, AA134623, AW239566, AA075905, AA167826,
					AA134649, AA375645, AW005427, and AI424382.
HSLFE34	498	706986	1-396	15-410
HSLFF91	499	572885	1-413	15-427	AI095822, AI827514, AA909148, AI635994, AI339613, AI242071, and AI343397.
HSLFM86	500	785489	1-427	15-441
HSLFS42	501	948740	1-287	15-301
HSLFS45	502	717782	1-360	15-374
HSLFT76	503	725788	1-382	15-396
HSLFT89	504	786061	1-378	15-392
HSLFU01	505	916448	1-404	15-418
HSLGD23	506	675872	1-436	15-450
HSLGH26	507	681705	1-426	15-440
HSLGK79	508	774049	1-377	15-391
HSLGV91	509	780005	1-428	15-442
HSLGX20	510	669648	1-424	15-438
HSLHA55	511	866273	1-392	15-406	AI699746, AI869424, AA484365, AA015948, AA788575, AI003051, AA598608,
					AA814719, AA463832, AA243128, AI798714, AA015753, AW148821, AI002786,
					AI383589, W21030, AA665411, AI000381, AI445699, AA846014, AA493245,
					AI791664, AA455804, AI702049, AL138262, AW192930, AI734158, AA455202,
					AL121039, AI734193, AW410844, AI064968, AA653228, D25266, AL038971,
					AA584738, AI167784, AA226133, AI800445, AA300049, AI016729, AW265468,
					AW085626, Z97206, AL022147, Z97181, AC007842, Z84480, AF053356,
					AF006501, AL031622, Z97056, AL031587, AL031117, AC007371, AL109628,
					AL024507, AC005399, AC005409, U82672, AC005565, AC007151, AC007676,
					AC004914, Z86090, X69907, D87008, AC000040, AJ250235, AC004663, D88268,
					AL096757, Z83851, AC005914, AC007690, AC007541, AL117329, AC005375,
					AC004067, AC005531, AC006198, AC005772, AC008040, AF053139, M94634,
					AC005368, AF111169, AC005345, AC000387, AC006006, L47222, AC006261,
					AC005808, AL035079, AC004020, AC002456, AL121595, AC005391, AC005379,
					AL035400, AL021937, AC004785, AJ010598, AC006285, AC009336, AL050333,
					AC004815, AF064865, AC004832, AC005060, D83402, Z69650, AP000227,
					AC002120, Z49918, Z68277, AC005256, AC006138, Z15025, AC002106,
					AC007565, AC005214, AC007536, AL022144, AF038458, AF190465, AP000087,
					AP000513, AL008731, AL020993, AC005033, AC007899, AC005277, AF064866,
					AB023049, Z98950, AC006509, AP000689, AC005844, AL021578, AL031311, and
					AL079342.
HSLHC22	512	673918	1-440	15-454	R64409.
HSLHP20	513	669210	1-418	15-432
HSLIA21	514	668116	1-388	15-402
HSLIG54	515	713982	1-382	15-396
HSLII61	516	918071	1-458	15-472	W19840, R50853, AA482385, T72743, H21057, T72748, R10320, and W01711.
HSLIJ57	517	659533	1-377	15-391
HSLJB11	518	966227	1-131	15-145	Z83844.
HSLJJ21	519	670330	1-329	15-343	A40155, and A40156.
HSLJJ83	520	727874	1-295	15-309	AC007193.
HSLJK88	521	923108	1-203	15-217	AI914865, AW377768, AA767396, AA975495, AA972715, AI991550, AL132776,
					and AB018319.
HSLJN31	522	750394	1-337	15-351
HSLJN49	523	920062	1-448	15-462
HSLJN61	524	966267	1-485	15-499	AI014258, and D89677.
HSLJN71	525	759941	1-335	15-349
HSLJQ31	526	961447	1-427	15-441	H02450, R32623, AA349144, R11455, R27382, AA599094, N31153, N25174,
					N35733, H12488, AA082514, W60949, R06834, N26982, H04870, AW361043, and
					AB020685.
HSLJW53	527	866261	1-240	15-254	AA872180, AW304637, AI927741, R14941, T80162, AA702988, AA226346,
					AA134007, AI216978, AI358513, AA634227, AI151261, AI826253, AA662431,
					AA766883, AW028950, AA838162, AA297145, AA706845, T87973, AC006211,
					AL078639, AP001137, AP000325, AP000168, AP000054, AP000122, AC006344,
					AF196969, AL080239, AF110527, L78833, AC004876, AD000092, AL117330,
					AC004859, AL022476, AC004833, AC005476, Z83840, AC006441, AC006581,
					Z58851, AC005233, AC004057, AL035398, AC002365, AC003046, AC007371,
					AC007537, AL049776, AL022318, AC007868, AC005089, AC002400, AC007551,
					AC002470, AC007308, AF141325, AL121593, AC007377, M55523, AC004522,
					AC004817, AC007263, AC008498, AC005914, AL034420, AC004858, AC002476,
					AF109907, and D87675.
HSLKC70	528	866256	1-410	15-424
HSRAX95	529	747078	1-311	15-325	Z68164.
HSRBE02	530	921205	1-341	15-355	W79904, R73478, H42289, and AL137459.
HSRDE58	531	519542	1-208	15-222	AC000378.
HSRDI39	532	921749	1-381	15-395	AL117454.
HSRDJ68	533	530333	1-244	15-258	AL080190.
HSRDK92	534	838033	1-209	15-223	AF095719.
HSRDL32	535	530294	1-261	15-275	AL045354.
HSRDM42	536	523843	1-136	15-150
HSRDN23	537	530334	1-200	15-214	AC005703.
HSRDQ89	538	780221	1-178	15-192
HSRDS77	539	530289	1-230	15-244	AC000026, and AC002059.
HSREB43	540	524678	1-272	15-286
HSREC27	541	753810	1-296	15-310
HSRED45	542	530233	1-327	15-341
HSREG25	543	523815	1-347	15-361
HSREG40	544	712779	1-534	15-548	AI032560, AI040579, AI040370, AA702902, and AI685149.
HSREG49	545	723267	1-206	15-220
HSRFC96	546	558385	1-279	15-293	AL109852, Z93403, AL035468, Z95124, AC008041, AL035552, AL135783,
					AC007736, and AL008709.
HSRFD34	547	575288	1-139	15-153	AA088873, AI079088, AI160732, AI381253, AW162324, AI992192, AI358948,
					AI933299, Z92910, AR036572, U91328, AC005393, AL035462, AC004890,
					AC005366, AC002509, AC007227, and AC010200.
HSRFD47	548	973782	1-428	15-442	AC004386, AC002418, and Z83843.
HSRFE58	549	556519	1-334	15-348	AC007198, and AC005280.
HSRFF03	550	925369	1-130	15-144
HSRFG30	551	920265	1-286	15-300
HSRFR21	552	529767	1-229	15-243
HSRFZ71	553	557976	1-304	15-318
HSRGA32	554	529726	1-306	15-320	AW192199, AL133312, AC005683, and AF172277.
HSRGB23	555	974538	1-413	15-427	AI207415.
HSRGE47	556	974539	1-327	15-341
HSRGG66	557	556518	1-169	15-183	AC007198, and AC005280.
HSRGK48	558	535012	1-110	15-124	AA373481, and AL134562.
HSRGQ30	559	534479	1-407	15-421	AI493261.
HSRGS08	560	960211	1-299	15-313
HSRGV79	561	921005	1-356	15-370
HSRGW30	562	529624	1-296	15-310
HSRGZ32	563	699561	1-348	15-362	AI963683, and AI742748.
HSRHA45	564	974551	1-391	15-405	AL049871.
HSSAE47	565	720685	1-337	15-351	AA377682.
HSSAF46	566	508117	1-341	15-355
HSSAN96	567	936108	1-239	15-253
HSSAP44	568	508831	1-374	15-388	AA378117, AL048143, and AA378114.
HSSAV18	569	508832	1-186	15-200	AA378135, and AA378220.
HSSAV88	570	508829	1-375	15-389	AA378151.
HSSBO48	571	871217	1-357	15-371
HSSBO59	572	707683	1-396	15-410	AA632960, H82330, R13151, AA528455, AL045709, AA657416, AA658320,
					AI150670, AA721615, AA077776, AI564508, AA652057, AA640979, F17700,
					AW407919, AA437402, AA487542, AA302732, AA516207, D58782, AA298387,
					AA125788, AA482896, F37052, AA775049, AA581914, AI446474, AI284595,
					AI014378, AI888405, T47460, AA362395, AA298386, AA743137, AA491484,
					AA809189, AI862716, AA483655, AW271904, AI679713, AA878140, AA569187,
					AI292236, AA663306, AW265654, AA720732, AA642053, N69462, AA165462,
					AL119025, AA448838, AI628224, AI493264, N45421, H55894, AA572960, H65439,
					AA371409, T48872, AA365744, AI524540, AW075979, AW103383, AA599495,
					AI473701, AI279759, AI471572, AA425922, AI627581, AA558344, AW440633,
					AI540107, AI803827, T03203, AA443426, AI609223, AA577732, AI460390,
					AW339622, AI754291, H65440, AW268277, AA493885, F26719, AI251111,
					AI184226, AW407340, AI114752, N38789, AA747472, AA848143, AL120976,
					AW117976, AA100884, AA654627, AA704643, AL037910, AW021917, AA127916,
					AW189353, AA507991, AI597832, AA283083, AI634323, H94289, AL041083,
					F33511, AI863399, AA167741, AA468051, AA228283, AA745560, AI832000,
					AI689019, F37223, AA632845, AA501418, AW192330, AI978792, R23352,
					AA831388, AA968509, AA192695, AI623563, AI270476, AI872503, AA311071,
					AW167154, AI253797, T94094, AW079809, AI859834, AA516225, R26134,
					AA515937, D56402, AW419081, AI473684, AA655005, AI754037, AI114477,
					AA569202, AA626829, AA467988, AI366982, AA558003, R32200, AI042342,
					H53562, AA579278, C06137, AI859280, AI889921, Z96050, AC004201, AC009510,
					Z82176, U97046, Z96568, AL109798, AL020990, Z95331, AC004902, AL033527,
					AC003991, AC006239, AC003042, AL023806, AC006450, AC006363, AC002065,
					AL121603, AL008710, AL079339, AL035454, AC005378, AL080286, AC005180,
					AC006372, AC005037, AF043105, AL022397, AC006006, AC005546, AC007358,
					AC002381, AC004643, AL024509, Z98743, M63543, M63544, AC006578,
					AC003098, AC006251, AC000083, U89337, AF059675, AP000500, U73167,
					U90094, Z73420, AL009031, Z84484, AC002326, AL009029, AC005011, AJ003147,
					AL031003, Z84469, AC005562, AF020503, M87918, AL021397, AC003101,
					AP000518, M87914, Z70289, AL110114, AL078639, U62317, AC002996,
					AC004531, AR036572, Z99572, AF019413, AL049766, AL117344, AC004816,
					AP000306, AB023054, Z69648, AC002550, AC004972, U63313, AC005095,
					AC003954, AF039401, AC002316, AC004703, AL023574, U95742, AC007216,
					AF001549, AL008725, AC005954, AC003051, AC008163, AC005701, D32202,
					AL035685, Z68224, Z82172, AL121915, AP000289, Z85994, AP000042, AP000110,
					AL031005, AL031447, AC009069, AC005618, AC005823, AC009498, AC005859,
					AF097026, AL096678, AC005664, Z69647, AC004851, AC005755, AL020993,
					AF196969, AC005914, U95740, U91326, AC007385, AC002504, AC004231,
					AC002365, AL049759, AC004024, AC002045, AC002039, AL022394, AL049553,
					AC005881, AC006443, AC009330, AC004762, AL096803, Z83838, AL109654,
					AC008498, Z92546, AC004887, AC005578, AF053356, AP000122, AF016052,
					Z69652, AL033543, AL035400, AL031055, AC002347, AL020997, AC005081,
					AL049761, AF067574, D87005, D88269, AL121587, AL049697, AL031655,
					AC005874, AF134471, AC000097, AC005372, AC004859, AC006547, AP000353,
					Y11312, L29766, AF190631, Z82097, AC004776, AL008635, AL022160, AC005921,
					AC005740, AC004253, AC007263, AC004834, AC004448, AC008124, AC005261,
					AC007327, AP000047, AC004051, AF039954, AB018249, AC005354, AC005339,
					AC004140, AP000093, AC004996, AL031775, AC004675, AL022576, AF047825,
					AP000237, AF107258, AP000473, AL133448, AL022328, AF088219, AC008125,
					AL133445, AC005291, AF052684, AC005971, AC006953, AC004409, AP000251,
					AC006985, AC004656, Z99755, AP000134, AP000212, AP000030, AB020871,
					AL033524, Z99128, AL050307, AC007628, AB020868, AC005411, AC006960,
					AC006111, AC008040, AL049776, AC004596, AL022400, Z93020, AC004152,
					AC004186, U07562, AC004694, AC007382, and AP000207.
HSSCC04	573	928001	1-119	15-133
HSSDJ02	574	871226	1-348	15-362	AL035681, Z93241, AL049839, Z82189, and AP000553.
HSSDL20	575	667599	1-159	15-173	AF084557, AC003025, AF139813, and AC004228.
HSSDL94	576	526758	1-285	15-299	D80188, AI525912, AA514184, and AR008278.
HSSDR63	577	537329	1-213	15-227	AC006071.
HSSDX20	578	783128	1-113	15-127
HSSED56	579	625572	1-358	15-372	AA346009.
HSSEF29	580	689837	1-389	15-403
HSSEK75	581	766507	1-166	15-180
HSSEU91	582	766573	1-163	15-177
HSSEU93	583	911261	1-358	15-372
HSSEV89	584	572851	1-296	15-310	AI961823, AW166279, Y17108, and Z92544.
HSSFF80	585	753589	1-285	15-299
HSSFQ43	586	715318	1-405	15-419	AC007367.
HSSFR41	587	707006	1-346	15-360
HSSFX54	588	708845	1-429	15-443	T71424, R18371, and Z43782.
HSSGC65	589	955064	1-391	15-405	AI982519, AL042376, AL042377, AI361890, AI200168, AI656939, AC000385,
					AF061779, AC004923, and U73627.
HSSGC66	590	319740	1-231	15-245
HSSGC72	591	760648	1-141	15-155
HSSGD37	592	739505	1-308	15-322	AL049569.
HSSGH47	593	720367	1-355	15-369
HSSGI20	594	668919	1-328	15-342	Z81364.
HSSGI75	595	767325	1-333	15-347
HSSGI91	596	789411	1-338	15-352	AP000348, and AP000347.
HSSGK96	597	960636	1-378	15-392	AA378503.
HSSGL55	598	766115	1-599	15-613	W74502, AA602391, AI420864, AW249723, AW166500, AA076659, AA947286,
					AW148931, AA523509, N59225, C14268, AI367349, AI421445, AI936982,
					AI769470, AI368200, AI419527, N98776, AI684498, AI572122, AW206959,
					AI634762, W49625, N34422, AI217398, W31030, AA725340, AI081813,
					AW373882, AI672387, AA641497, AI337000, AA478173, AI766926, AI365401,
					AI813446, AI608807, AI382536, AI950175, AI382559, AA827390, AW183593,
					AI420810, AA309806, AI565511, AI362447, AA478017, AA773507, T11147,
					C14269, AI738446, AI800023, AI242987, AA639592, AI399691, AA659150,
					AA371822, AI243140, AA631086, AI659508, AI927588, AI651868, AI699620,
					AA335673, AI805041, AA336127, W48799, AA335414, N76692, AI916893,
					AI468167, AA335239, AW206563, AI873196, AW137813, AW451053, AW137008,
					AI823968, H16597, AW006577, AW006554, N71461, AI401174, W79098, D19946,
					and AI541353.
HSSGL78	599	788924	1-376	15-390	R83708, AA515728, D44639, AL041894, AL038842, AA515138, AI762528,
					AA158759, AA452887, AI421257, AA581247, AA516320, AI792529, AA502991,
					AA630535, C14858, AI801701, H70108, AA182731, AI054193, AA773098,
					AC005841, AC005071, AF001550, AC007536, AL133448, AC007041, AL020997,
					U95739, AL034429, AL096701, AC005005, AC006597, AC002126, AL008635,
					AL109628, AC006121, AC004953, AC002301, AP000208, AP000130, AP000247,
					AC005324, AC005874, AF134471, AC004797, AC002404, AC007225, AF001549,
					AC005921, AC005919, Z85987, AC005261, AL049776, AC005740, AC007637,
					AC007298, AC003692, AC006130, AP000557, AF111167, AL133246, AC005102,
					AC004659, AC004882, AL109801, AC007537, AC005527, AC007114, AC004975,
					AC005529, AL049795, AF111163, AL096712, AC006312, AC006449, AL031680,
					AC002314, AC006942, AC000353, AC007664, AC005231, AL034420, AC002302,
					AL031295, AC005899, AL035209, AC000025, AC005488, Z95331, AC002472,
					AC002477, AP000704, AC006285, AC005351, AC002350, AC005828, AC008018,
					AF001548, AL096761, AL109623, L44140, AC005520, AC005920, AC002470,
					AF017104, AC005821, AC016025, AC007283, AC016831, AJ003147, Z98200,
					AC005086, AC004386, AC005220, AL022327, AL109984, AC006530, AC007546,
					AC004477, AC006511, AC004000, AL121754, AC004985, AC007040, AL035587,
					AC004534, AC007263, AL049843, AD000671, Z83844, AL117329, AC004019,
					Z95114, AF196779, AF134726, AC003043, Z93023, AC002288, AL021578,
					AC000134, AL132712, AC004999, AP000211, AP000133, AC005881, AL033521,
					AC005049, AL109758, AC005722, AC010209, AC005632, AC005531, AP000193,
					AF104455, AC004259, AL031228, AC004032, AP000050, AC005695, AL035422,
					AC005726, AC004600, AP000555, AP000117, D87675, AC004813, AL031737,
					AC007050, AC004851, AC005082, Z99943, AL024498, AC005332, AL049759,
					U29953, U96629, AL031577, AC009516, AL034548, AL021707, AL023284,
					AL023575, AC003037, AL022302, AC005697, Z99716, AC002425, AL050321,
					AL118497, AL133353, AF196970, AP000346, AC005300, Z95113, AL031005,
					Z83840, AC005624, AC004791, AC004149, AC006487, Z98044, AC006050,
					AL122021, AP001052, AC002310, AC002390, AL031681, AC004990, AC005088,
					AC006455, AC005081, AL022326, AC006203, AC002045, AL034351, AC005338,
					Z81314, Z84469, AP000248, AL021391, U91323, AL034553, AC002544, AL050312,
					AP000212, AP000134, AL031282, AC008015, AC004020, AL049569, AC007421,
					AL122126, AC007388, AC006080, Z93930, AC005067, AC007226, AC004099,
					AL139054, and AC005179.
HSSGM62	600	707685	1-397	15-411
HSSGN47	601	707003	1-324	15-338	AI076644, AI951987, AA969026, AD000671, AF186605, and AJ007041.
HSSHA92	602	792714	1-396	15-410
HSSJN44	603	716573	1-428	15-442	AL139054.
HSSJN49	604	708841	1-331	15-345
HSSJU66	605	653212	1-248	15-262	AW241370.
HSSJV60	606	970749	1-417	15-431	AA972086, and AW241953.
HSSKB40	607	711130	1-558	15-572	R78078, AI672012, AI291253, AW438453, Z83844, AL139054, AL008715, Z85996,
					AL035072, AL035695, AF218772, AC006056, AC006508, AF037046, AF146793,
					AF034692, AL118503, U31796, AF019657, AC006584, AF092084, and U31316.
HSSMT78	608	712468	1-481	15-495	AA378685, AA378686, AP001101, and AC004837.
HYBAE74	609	925074	1-314	15-328	AC006121.
HYBAG11	610	967880	1-194	15-208
HYBAU83	611	732419	1-226	15-240	AA371642, AA345063, N87410, AI886060, AI886365, AA528441, AA652329,
					AI743721, AA987962, AA364488, AI954525, F13749, AA626829, AL135643,
					AW075915, AI982634, AI751162, AW162288, AI696793, N54179, AI610603,
					AA360260, AA258848, AI240339, F32893, AW341903, AI216998, AI370270,
					AI348302, AI024782, AW402145, AW157005, AI028510, AA968509, AI270524,
					AW157492, AI797901, AI653905, AI634691, AI797892, AA372881, AI678785,
					AI471418, AI345657, AI349966, AI879394, AI796594, AI345717, AA772016,
					AA507837, AL039187, AI467877, AA992126, AW088843, AA215335, AI332666,
					AI799303, AL038909, AA364315, H78031, AA367555, AI753365, AA617954,
					AW300776, AA843450, AA226584, AA319813, AI244758, AA657835, AA318652,
					N54764, AA192330, AA206807, AA364330, AI053981, AI051037, H79308, F33121,
					AW271904, AA347040, AI240891, AI719644, AI921541, AA984191, AI079423,
					AI144094, U73167, U90094, Z84469, AL034420, AL031296, AL050307, AC007688,
					Z82097, AC006211, AC004263, AC006441, AC004660, AC004921, AC006241,
					AC005971, AL008635, U80017, AL035089, AC007199, AP000697, AC009501,
					U78027, AC005209, AC007055, AC000353, AP000503, AL035422, AB008681,
					AC006084, AC007486, AC003684, AF134726, U80459, AC004235, AC004382,
					AL022336, U62293, AC005664, AC005071, AC005214, AL117694, AL121655,
					U85195, AC005529, AC000097, AC005856, Z86090, AP000500, AC003101,
					AC002470, AC006547, AC005940, AC006480, AE000658, AC005772, AC005057,
					AL022163, AC007283, AL121769, L78833, AC007842, AC006509, AL021808,
					AP000248, AC004678, AC005988, AL031774, X74984, AC005922, Z98744,
					AL079333, AF129756, AC007038, AC006449, AL022328, AC005086, AF045555,
					AL049795, AL117258, AL008582, AL031447, AL022578, AL078477, Z85986,
					AC008040, AC005844, AC006387, AC004236, AC004129, Z94057, AP000505,
					Z94056, AP000556, AP000557, AC004685, AC001231, AC007041, AC005696,
					AC005913, Z97056, Z93241, AC000070, Z83822, AC002073, AL133245,
					AC006155, AJ006996, AC005527, Y18000, AC005730, AC002350, AL035658,
					AL133448, AP000509, AJ003147, AC004477, AL109628, AP000552, AP000959,
					AC006213, AP000692, AC007276, AC009516, AC005180, Z82244, AJ239027,
					AL136504, AC006530, Z98036, AC004013, Z84474, AC006001, AC004668,
					AC002991, AC002040, AC006277, AC007387, AC006116, AL031053, AC003046,
					AC002310, AC005067, AL049779, D84149, AL049832, AL049540, AC004913,
					AL049834, AC007263, AC005755, AC005808, AF172277, AL024509, Z85996,
					AP000354, AL031675, AL009183, AL031662, AL139054, AC006020, Z84487,
					AC005041, AC007537, AC007073, AL021546, AP000010, AP000152, AC002385,
					AL035659, AC004814, AC002349, AC004882, AC007687, Z84480, AJ010770,
					AC006064, AC000085, AC005089, AL096791, AL049543, AL023804, AC004975,
					AC000134, Z93023, AP000477, Z94160, AL022397, AC005694, AL049761,
					AL034349, AC002425, AD000092, AL049539, AL031680, AP000553, AF222686,
					AC005996, AC005839, AC006013, and AC003688.
HYBAX25	612	456251	1-341	15-355	T55280, Y17457, AL031133, AC005089, AC005412, AC005886, AC004472, and
					AC006509.
HYBAY40	613	531202	1-284	15-298
HYBBB24	614	584989	1-307	15-321	AA806538, AI005244, and AA535437.
HYBBI18	615	584991	1-340	15-354	Z98880.
HYBBJ30	616	693345	1-228	15-242	AB032972.
HYBBL17	617	691328	1-232	15-246	AA046858, AI078144, AA022643, AI809791, N57180, AW170191, AA328923,
					AA401814, H27580, AI869993, AA249586, AA576955, and W67605.
HYBBK83	618	505138	1-595	15-609	AI923052, AW265688, AI862716, AA557911, AI358712, AI932871, AI380617,
					AW408767, AA533054, AA488687, AL039187, R92658, AW085758, AA528516,
					T05118, AI246796, AW268329, AI696955, AA599080, AA828834, AW023975,
					AA604751, AI357823, AI689198, AI821382, AA115865, AA469327, AL049576,
					AC002477, AC006157, AC007283, AC005089, Z98044, AL133448, AF064861,
					AC006071, Z82244, AC006511, AC004913, L44140, AL031589, AB003151,
					AC005399, Z93241, AC007707, AC007227, AC012627, AC005696, AC004254,
					AF134726, AC006312, U95740, Z98752, AC004967, AC004673, AC005409,
					AL030996, V00596, Z98200, AL049709, AC005028, AC002470, AC006057,
					AP000295, AC002352, AC005972, M17262, AC005288, AC005821, AC004878,
					AP000689, AC005519, AF111167, AC004990, AC006241, AC004242, AC002288,
					AC005907, AC004975, AC004933, AC005902, AC002558, AC005488, Z98036,
					AC005274, AC005067, AC004477, AC005379, AC007993, AC002997, AC007226,
					AC007421, AL022320, AL096701, AC003982, AP000270, AL049776, AC005829,
					AC004882, Z93242, AC005726, AC008115, AP000512, AC004752, AC004129,
					AC003108, AC006026, AC007225, AC005871, AC006530, AP000502, X55448,
					AC006050, AC005071, AL050318, AC003109, AL136295, AL008583, AF023268,
					AC005320, AC002492, AC006166, AC002126, AB023051, Z93020, Z99943,
					AL031584, AP000032, AP000553, D84394, AL035420, AC002984, AC000085,
					AL049829, AC004228, AC007040, AL049780, AC006013, AF165142, AL020995,
					AF196969, AC005180, AL031587, AC006080, AL021939, AF196779, AL034549,
					AL034429, AC004185, AC002563, AL035422, AC004985, Z98304, AL031281,
					AC007151, AC002301, AL023553, AC005755, Z94160, AP000346, AC010582,
					AF029308, AC003104, AL133399, AL031667, AP000557, AC009516, U78027,
					AC006064, AC000159, Z85987, AC007686, AL008719, AL109628, AC005520,
					AP000466, AC007276, AC006237, AC005784, AL121748, AC005837, AL096774,
					AC004851, AC004491, AC002040, Z83844, AL031681, AC005670, AF045555,
					AL133244, AC006011, AL109657, AC005736, AF111163, AC007540, AP000704,
					AL034379, AC004007, X96421, AC003093, AC004139, AL021878, AC003983,
					AP001052, AP000248, AC008040, AL031311, AC006040, AC006120, AL133485,
					AF051976, AP000356, AL022323, AC006121, AC004663, AL022316, AL121756,
					AC004020, AL121655, AC004686, AF165926, AC002395, AF207550, AC002314,
					AC005529, AC005527, AL022312, AL021977, U95742, AC004656, AL122020,
					AC004492, AC006285, AP000558, AC006277, Z97181, AC006571, AF139813,
					AC016025, AP000509, AC002038, AC004148, Z98257, AC005037, AP000065,
					AC004019, AL022302, AC000134, AL031432, AC005066, AL080243, AC006132,
					AC005952, Z97196, AC005663, AL021707, AC005697, AC011456, AC016027,
					AC004832, AL121658, AC005081, and AC005786.
HYBBG93	619	531201	1-60	15-74	AF024533, and AC005088.
HYBAY92	620	792923	1-426	15-440	W01795, and N99837.
HYBAW03	621	925068	1-323	15-337	AA435790.
HYBAH65	622	518736	1-592	15-606	H48087, T70307, W72466, H80227, H81398, T78885, AA704555, H73669, T78410,
					and AW236543.
HYBAG53	623	669602	1-463	15-477	H71386, AW408254, H81132, H44291, N21071, AI801120, N36421, AW341639,
					AA878376, C02991, AI758487, and AA280550.
HYBAF63	624	745585	1-649	15-663	N48536.
HSSMZ93	625	530752	1-346	15-360	AA378965, AA378966, and AL035696.
HSSMZ01	626	921800	1-401	15-415	AA378938, H90844, T57767, AA824453, AA492105, AI752358, AA458452,
					AI783911, AA723299, AA812684, AA728973, N67313, AA167489, AA483771,
					AA664604, AI241831, U63721, AC005071, AL049692, AC006312, AC004878,
					AC005229, AC002996, AC005520, AC002544, AL031670, AC005874, AF134471,
					AC004099, AL109984, Z95115, AF134726, AC004263, AC004983, AC004686.
					AF111167, AF095703, AP000692, U80017, U91326, AC007686, AL135783,
					AL031666, AC004475, AC005207, AC004217, AC004996, AC007563, AC006441,
					AL096791, AL022322, AL021154, AL035414, AC005821, AC006026, AC006960,
					U62293, Z83844, AC007450, AL024498, AC004520, AC004659, AL080243,
					AC006512, AP000356, AL049552, AP000505, AC006211, Z98051, AC004019,
					AC000003, AC006101, AL049745, Y14768, AC004132, AC016027, AC005031,
					AC004814, AC002045, AF129756, AC004938, AC005740, AC006111, AL033521,
					AL009181, AL008726, AC006237, AP000280, AC006450, AC005971, AC007344,
					AC007227, AC000025, Z83826, AC004491, AP000248, AC004883, AC002316,
					AC008064, AL035422, AP000503, AF109907, AP000107, AC005972, AC000026,
					AL049636, AC006487, AL109798, AL022316, AC005829, AC004386, AC005668,
					AC007376, AL049869, Z68756, AC005696, AP000552, AC016830, AC005057,
					AL023553, AL023913, AF190465, AP001054, AP000030, AP000133, AP000211,
					AF200465, AC005922, AC008498, AL031311, AL133243, AL117355, AC005369,
					AL022336, AC006511, AC002400, AC005914, AC008372, AF003626, Z95114,
					AL031390, AF196779, AL079304, AC004383, AL021579, AC007308, AC005702,
					AC009891, AP000228, AL133246, AC004125, AC004966, AC003110, AC002565,
					U78027, AC004453, AC006057, AL022323, AL021939, AP000035, AP000104,
					AC002472, AC007277, AL023653, AC003664, AC006040, AF111168, AC007546,
					AL132987, AP000557, AL020989, AL049776, Z93930, AP000497, AP000140,
					AC003667, AC006530, AL049653, AC007073, Z99716, AC005803, AC004032,
					AC004458, AP000696, AC008018, AF152364, AL133163, AC008062, AC005837,
					AC002288, AC007151, AC006254, AC006362, AC004967, Z93241, AC006480,
					AC004815, AC005412, AC005011, Z93017, AL023807, AL109628, AF024533,
					AL021393, AC004808, AC004583, AC007226, AC007540, AC005538, AC004655,
					AC000393, AL049569, AC005553, AC004663, AL049712, AL031729, and
					AL031005.
HSSMW90	627	975081	1-306	15-320	AA378852, AI149537, AW130188, AW173759, AA715418, AI280504, AW149288,
					AA489978, AL035413, AL050332, AB014078, AP000514, Z98749, AC006139,
					AC002468, AC008064, AC005589, Z80901, AL109753, AP000215, AP000128,
					AP000206, AP000245, AP001056, and AC008163.
HSSMT76	628	928421	1-299	15-313	AA378683, N72524, AA378682, N57752, N53565, AA831903, AI017251,
					AW103030, N91572, AI689198, AA655005, AA716348, AI580898, AA077667,
					AW341903, AI336480, AA340747, AW002831, AA347114, C05986, AI457397,
					AA533033, AI866908, AI027056, N75391, AA071334, AW151247, AA599352,
					AI244356, AA086318, AA657416, AA664604, W47183, AI753365, AI824541,
					AI499376, AI500552, AA630535, AA347034, W79504, AI471481, AI537955,
					AA773463, T57267, AA603911, N32878, AI291268, AA086344, AA167659,
					AA644551, AI291124, AI745325, AA488620, AA300391, AA303054, AA613138,
					AA491814, R64617, AA832145, AI801563, AA665021, AA284184, AW277174,
					AI291037, AA568778, AA828637, AI267269, AW270768, AI446205, AA502991,
					AW157005, AA573213, AW438616, AI080618, AW276827, AW193432, AI339845,
					AA916600, AA483771, AI270476, AA362349, AA551503, AA577906, AA446616,
					AA350859, AI688846, AA599920, AA553363, H90844, AA579184, N25296,
					AI687206, AA381138, C15092, AA367986, AA437161, AL041706, AA579736,
					N22797, F01666, AI350211, AA992126, AI580652, AI344844, AI061334, AI679294,
					Z82205, AL049829, AC005666, Z93017, Z83840, AF111168, AC005696, AC006511,
					AC005971, AL049636, AC005488, AL031055, AL022721, AL035413, AC007774,
					AC005924, AC004797, AC005839, AL109628, AC002470, AL133246, AC005726,
					AC005841, AC007136, AP000354, AL109758, AP001053, AF064860, AL008635,
					AL035420, AC005037, AC005619, U80017, AL133448, AC004253, Z84487,
					AC005015, AL024509, AL096791, AC007878, AC004882, AL049832, Z83822,
					AP000555, Z97054, AC002094, AC002302, AL049766, Z82206, AC004862,
					AC002426, AL139054, AF207550, AL121769, Z85987, AC003982, AL079340,
					AC004678, AC005529, AC005829, Z93244, AP000116, AC004686, AL008725,
					AC003041, AC002476, L44140, AC005158, AL008718, AC006372, AL080243,
					Z84480, AC004590, AF134726, AC006285, AC002301, AC004019, AL078581,
					U47924, AR036572, U91328, AC004854, AC016025, AP000692, AC007388,
					AL049557, AC004878, AC002347, AC008372, AC004876, AC006327, AC005578,
					AP000501, AL033527, AC002073, AC006006, AP000547, AC000353, AC005089,
					AC006441, AC004765, AC004242, AC004150, AC005786, Z98884, AL121603,
					AC004983, AL024507, U85195, Z98950, AC002543, AF111167, AC005484,
					AC006274, AC007199, AL049872, AC004601, AC007688, AC003006, AC005070,
					AC002039, AF107885, AC004815, AL132987, AE000658, AB023049, AC003029,
					AL023804, AL022476, AC006088, AC005520, AC002115, Z83826, AL109801,
					AC006312, AC002544, AL133163, AL022237, AF045555, AC010205, AC005914,
					AC004895, U95742, AC005856, AC004477, AL049776, AC007263, AC005874,
					AF134471, AC005399, AC005799, AC005317, AC009509, AL031432, AC005207,
					AC004526, AC007376, AL031311, AC007687, Z97876, AC005899, AC007421,
					AL109952, AL049569, AL035400, AC007938, M63480, AC005086, AC004967,
					U95743, U78027, AF196972, AF196779, AC004448, AC003046, AC007666,
					AL031589, AJ011930, AC006273, AC005694, AC007386, AC005206, AC006241,
					AL049869, AC007308, AC007052, AL031427, AC000026, AC007371, AL049646,
					AC004531, AL049761, AC009516, AC000003, AC005972, AL021391, M63544,
					AC005722, AC005682, AC006480, AL031005, AC004099, AP000131, AP000209,
					AP000065, AC005667, AC002997, AC002119, AC005551, AP000505, AC002044,
					AC005684, AC006120, AL031685, AL008730, AF190465, Z83846, AC002059,
					AC006023, AP000248, AC006039, AC007216, AC005837, AF117829, AC005291,
					AC005527, AL031447, Z98946, U91326, Z85986, Z95115, AC003670, AC005756,
					AJ003147, AL035681, AC010206, AL021877, AL078638, AC005736, AC007363,
					AL135744, AL021397, AC004752, AF011889, AL031588, AF118808, AC010200,
					AC005844, AC005796, and AC005939.
HSSMT70	629	530758	1-284	15-298	AA378674, and AA378675.
HSSMP20	630	854092	1-360	15-374	R70723, and AA378431.
HSSKD17	631	726525	1-552	15-566	W68188, AW248260, AW379441, H14177, R51748, N45444, AA009502,
					AA121499, AI750975, AA521345, AW204392, and AC005306.
HSSJQ60	632	975185	1-192	15-206
HSSJP81	633	911334	1-541	15-555	Z43294, AA252498, AW371259, R07447, AA403066, F07754, and AL133017.
HSSJL22	634	871170	1-1260	15-1274	D31661, L41939, AF025304, L25890, L36643, and D37827.
HSSJK65	635	747891	1-742	15-756	AA010525, R94490, N59062, AI032097, R94491, and AI241480.
HSSJH78	636	773558	1-371	15-385	W58293, H17374, and AC004552.
HSSJA08	637	959336	1-559	15-573	AA516469, AI796388, and AA579963.
HSSGK12	638	970714	1-407	15-421	Z73988, and AL050347.
HSSGJ84	639	781975	1-492	15-506	H53756.
HSSGD96	640	796410	1-98	15-112
HSSGD82	641	779899	1-558	15-572	R87893, and AL110228.
HSSGD56	642	608144	1-501	15-515	AA502843, AA470969, AI345157, AW150524, AL022323, AC002381, AL035555,
					AC005071, AL049776, AL022302, U91321, Z95152, AF165926, AC003029,
					AC006571, AC005154, AC005871, AC002402, AL096701, AC005899, U91323,
					AC005696, AC005089, AC005280, AC006581, Z86090, Z99716, AC007546,
					AP000553, Z83845, Z95116, AC006160, AC002425, Z84480, AP000346, AC007406,
					AC005412, AL121603, AC006441, AC007685, AC005081, AL133353, AC008101,
					AC002990, AF038458, AC002996, AC004859, AC004662, AP000023, AC005520,
					AP000210, AP000132, AL132712, AC007637, U80017, AL031662, AC000066,
					AC007537, Z93783, AC016830, AL021707, AC008045, AC005288, AC005841,
					AL033547, and AC005225.
HSSFW84	643	781973	1-623	15-637	H13333, Z46049, and AC004590.
HSSFU84	644	888462	1-388	15-402	Z82214.
HSSFN08	645	959735	1-529	15-543	AA584893, M62144, AJ132917, AF158180, AF031075, AF031078, and AF030876.
HSSFK90	646	788687	1-534	15-548	AI633959.
HSSFB73	647	955200	1-322	15-336	R16937, and AC007537.
HSSEU40	648	891055	1-352	15-366	AA004732, and R45758.
HSSEP69	649	871211	1-356	15-370	AC005484.
HSSEI90	650	789157	1-373	15-387	H91190, AI903727, AW367564, AW376992, AW367618, AW367543, AW367594,
					and AL080172.
HSSEG25	651	679351	1-490	15-504	AA481165, AA034225, AW131736, AW137070, AA063633, AA844084, AA482038,
					and Z83845.
HSSEF33	652	702701	1-530	15-544	H67629.
HSSEC79	653	775312	1-254	15-268	AA984057, AA084951, AB023138, M96377, and M96376.
HSSDQ07	654	880720	1-492	15-506	AI967980, AL035703, and U72207.
HSSDI03	655	924975	1-389	15-403	AA808840, W74796, W74722, AA723330, and AP000501.
HSSDH37	656	575460	1-256	15-270	AI869797, AA326034, AI689198, F01222, AA526683, AA032001, T30864,
					AA378474, AI590906, AA565319, AA856815, AA513851, AA364137, H93152,
					AA372106, N70449, AA343810, AI193417, AA225486, AA745302, AA714524,
					AA297698, AA384200, AA555232, AA086257, AI354333, AA831408, AA551067,
					AA745351, W44359, AI114557, R52008, AC005899, AC003029, AC007993,
					AC003025, AC004084, AF139813, AC000025, AC005527, AC006511, Z98750,
					AL035681, AC005529, Z94802, AC005399, AL135744, AL049776, AC007193,
					AC006277, AB001523, AC006388, AC000353, AL035659, AC006001, Z98946,
					AP000359, AC002351, AC004651, AL034417, AL109628, AL034420, AC002310,
					AC006023, AL035400, AC007731, AF038458, AC005365, AL049780, AC004491,
					AC005632, AC004973, AC005015, AL031056, AC005102, Z82206, AL133245,
					AC005841, AC005932, AP000689, AL121653, AP000279, AL031662, AC004019,
					AL121603, AL031602, AF031078, AC005081, AJ251973, AC005500, AC006449,
					AP000115, AL008730, AL024498, AL049636, AC004820, AF030876, AL080317,
					AP000305, AB003151, AL133163, AC002126, Z82203, Z99716, AC006121,
					AC004030, AC004967, U62293, AP000106, AP000038, AC005914, AL049694,
					AC002120, AC007226, AL022311, AC004821, AF088219, AC004596, Z85996,
					AL031588, AC005332, AP000045, AP000113, AL050348, AB023049, AC005484,
					AC002470, AP000355, AC002395, AP000209, AL109984, AC000026, AL033392,
					AL139054, AC008372, AC006257, AJ246003, Z93017, AL121658, AC004106,
					AC003982, AC004963, AL022326, AC005288, AP000692, AL049834, AP000116,
					AC006084, AC003041, AL022476, AL022721, AL031666, AC007773, AC002350,
					AP000694, AL049874, AF039906, AC005086, AL031848, AP000047, AL022238,
					AC002059, AL133246, AC004851, L48038, AP000248, AL008582, AC005696,
					AF134726, AC005067, AF196969, AL031427, AC004125, Z98051, AL034421,
					AC002369, AC005839, AL035455, AP000212, AP000134, U91318, AC007934,
					AC005940, Z93241, AL022336, AC004675, AC004655, AC007308, Z83846,
					AL109801, AJ003147, AC003109, AC004890, AC007227, AC002400, AC005378,
					AC002544, AC004975, AC005695, AL079342, U52112, AL117694, U63721,
					AC005972, AP000555, AP000504, AC005089, AC003010, AC004685, AP000553,
					AC005880, AC007066, AP000308, AC004033, Z93020, AL049869, AC005730,
					AC004000, AC007546, AL031295, AC004883, AL117344, AP000514, AL035413,
					and AC002306.
HSSDC50	657	724696	1-244	15-258	H16286, and R53150.
HSSCC14	658	600216	1-898	15-912	AI284640, AI281881, AI679782, AW276827, AA680243, AI334443, C75026,
					AI801591, AA720702, AA491814, AI368745, AW419262, AW162049, AI929531,
					AI683577, AI610159, AI732120, AI005388, AI471534, AW406447, AW088058,
					AW243960, AI469624, AI053672, AI471481, AA503015, AI962050, AI076616,
					AW303196, AW104748, AA649642, F36273, AA581903, AI339850, AW274349,
					AW022379, AW148792, AW166815, AW301350, AI358343, AI298710, AI434706,
					AL037683, AI567674, AL039958, AL048925, AI206785, AL138455, AI143242,
					AI564185, AI286356, AI625244, AL044858, AL119691, AI379719, AA613345,
					AA488746, AI355224, AI446638, AA394271, AA713815, AI927741, AI640702,
					AA178953, AA192740, AL042420, AW021583, AI246409, AW072587, AI133164,
					H71429, AI732186, AI696955, AI192631, AI355206, AI697208, AL044940,
					AW272758, AA521323, AL046898, AI674873, AW270270, AI110770, AI246796,
					AI376100, AI251002, AA665021, AI921649, AA620525, AW302013, AW270716,
					AI890923, W79504, AA521399, AI061227, AI367975, AI364020, AA598586,
					AA493708, AI049722, AI471543, AA587256, AA074130, AI471487, AA758934,
					AI133636, N27584, AW089322, AI434311, AA084070, AI148277, M77974,
					AI859251, AW073470, AW089789, AL134972, AI251436, AI568678, AW162489,
					AA302963, AW406162, AI921188, AW440836, AC004743, AL031005, AP001172,
					AC005037, AC006449, AC005324, AC004862, AC006241, AL031729, Z97053,
					U62293, AC007450, AF042090, AB023052, AC005785, AL117352, AC004263,
					AC005234, AC006468, AC002044, AC006115, AC006044, AP000513, AP000557,
					AC003026, AL022322, AB023049, AC010206, U63721, AP000020, AP001054,
					U91321, AC009516, AC005081, AC002542, AC005755, AC006487, AC009223,
					AC005280, AP000553, AC005261, AL050341, AL078477, AC007676, Z83846,
					AF134726, AD000684, AL031276, AL031965, AL021391, AC005218, AL096701,
					AF088219, AC005520, Z99758, AP000556, AC006079, AP000302, AC008039,
					AC005358, AC005341, AP000115, AC005412, AL096774, AL117258, AL034371,
					AC002429, U78027, AF015147, AL031123, U67221, AC005011, Z86061,
					AC006430, AL121603, AC004067, U07000, AC007308, AL031286, AP000503,
					AL096768, AC006985, AC007263, U07562, AL035659, AC005844, AF077058,
					AP000114, AP000046, AL035422, AC008079, AL008735, AC006213, Z94056,
					AP000359, AC000026, AP000304, U66059, AP000047, Z98200, AL022476,
					AC007842, AC005488, AC005288, AP000558, AL132987, AF123462, AC005778,
					AF109907, AC002525, AC004491, Z99129, AL035420, AC005004, AP000351,
					AL021707, Z98257, AC004492, AC005837, AL008629, AC002059, AL034561,
					AL021368, AC004531, AL022311, AL049569, AC002365, AC005747, AC005231,
					AL023575, AC006277, AL035417, AC007687, AL049759, AC004913, AL021393,
					AC005900, AL031651, AC002452, AC004158, AL078472, U95743, X75335,
					AC002549, AC005104, AL109753, AC004941, L48038, AC007731, AC004605,
					AC006071, AC004675, AC005500, AP000555, AC006459, AL139054, U62317,
					AC005043, AL035587, AC002460, AC003101, AC005664, AC002985, AP000348,
					AL021940, AC007043, AF015167, AP000356, AC005971, AC005257, AC005531,
					AC005175, AC004152, AP000950, AL109852, AC003074, AL031295, AP000689,
					AC005699, AC005682, AF045555, AL035683, AL031848, U47924, AL049562,
					AL021808, U80017, AC006211, AC004028, AC004253, Z95124, AC004987,
					AP001053, AL021977, AC000075, AL049835, AC012599, Z82244, AL096791,
					AC005072, AC022517, Z82210, AC004773, AF017104, AC007565, U18399,
					AF037338, AL022147, AC006998, AC003041, AC005057, AC007151, AL031542,
					and AF001550.
HSSAZ04	659	933015	1-447	15-461	AW104609, AA731470, AA378296, AA093496, AA648807, and AC005768.
HSSAY34	660	703345	1-399	15-413	R35953, AA378260, AL137558, and AB033041.
HSSAP68	661	564334	1-1137	15-1151	AL041924, AA569648, AA595661, AW020150, AI801505, AA974503, AA577706,
					AI521525, AI310670, AL041375, AI479148, AI282253, AW162314, AL036896,
					AA669238, AW151541, AI251034, AA526542, AA287363, AI890297, AW338376,
					AA171400, AI250552, AA218684, AA515728, AA533025, N68677, AW302048,
					AL079734, AW020094, AW069227, AI224583, AW408413, AW021399,
					AW275432, AI251284, AI754653, AI926102, AA313025, AA084320, AI284543,
					AI537020, AI809776, AA583245, N26159, AA719564, AW410844, AI355246,
					AI879968, AW086291, AW162332, AA180056, AI625604, AA610826, AA218851,
					AA935827, AI904840, H77492, AI732151, AI223626, AA197089, AI049845,
					AA829036, AI791659, AA601674, AI345394, AI095197, AI003626, AI049643,
					AW439224, AA584765, AW419389, N95424, AI753131, AI310787, AI719298,
					AI254770, AI733523, AA659324, AA225406, AW274182, AL121039, AI349130,
					AI702049, AI453155, AA598443, AW022796, AI570236, AI915081, AI697235,
					AI654738, AI570067, AI216990, AC006312, AC007151, AC002477, AC005696,
					AF001549, AP000046, AP000114, AC006064, AL024498, AC005480, AC004263,
					AL022323, AC005911, AC005207, AL008718, AL020997, AC002425, AL031602,
					AL031053, AL136295, AL031311, AC006480, AL049869, AC006071, AC007057,
					AL049570, AC004526, AC007055, AF196779, AL031680, AC004659, AF001548,
					AC003101, AF207550, AC005231, AC002312, AC005736, AC006121, AL021918,
					AL034451, AC005049, AF109907, AL034379, AL021393, AL049780, AL050312,
					AC002310, AC005531, AC004000, AL133353, AL022336, AC005913, AC007688,
					AC003982, AL031229, AC002316, AL049694, AC005102, AL049757, AC005486,
					AC003043, AC003665, AC006487, AC005914, AL031685, AC016831, AL031662,
					AP000692, AC005702, AF053356, AC007371, Z94056, AC016025, AL133245,
					U95742, AP000359, AC002044, AL031295, AC007021, AC002400, AC007207,
					AC005081, AL080243, AC005015, AC008040, AC007376, AL078463, AC004671,
					AC005324, Z93023, AL022327, AC007685, AC005288, AC002369, AC007395,
					AL023803, AC006115, AC002470, AB023049, AP000503, AC010205, AL049759,
					AC004382, AC006449, AC005527, AL022476, AC005088, AC007637, Z86090,
					AL022396, AC007227, AL034420, AL035072, AL122021, AC004131, AC007686,
					AL031291, AL031284, L44140, AC006088, AC000025, U85195, AC006581,
					AC002375, AP000555, AC005755, AC004796, AC005225, AP000065, AL139054,
					AC007308, AP000556, AL050341, AL109952, AL035587, AC007687, AE000658,
					AC006046, AL021155, AC004812, AC004890, Z95115, AL008583, AF111169,
					AC005821, AL109758, AC002303, AC004185, AC004699, AC005921, AP000688,
					AC004797, AL049793, AL021546, D87675, AC006023, AL049776, AC004491,
					AC004752, AP000501, AL022316, AC006965, AC002314, AJ003147, AP000514,
					AC005086, Z95113, AC006252, AL109627, AB000565, AC007225, AC004223,
					AC007845, AL034417, Z94801, AL034429, AL096791, AC004686, AC003109,
					AC004905, AC007664, AC005412, AC002544, AL022238, AC006077, AC009516,
					AC007011, AL021707, AC006241, AL023575, AL022313, AC005670, AC005619,
					Z93241, AF024533, AC005255, AL049569, AL035249, AC004814, AC009509,
					AC005529, AP000142, AP000509, AC004816, D84394, AC004253, AC004099,
					AC005726, AC009247, AC004876, AF134726, U62293, AC007193, AC004832,
					AC007684, AC005484, AC003108, AC007216, AC004112, AC005972, U91321,
					AF111168, AL117258, Z94161, AC005280, AL031123, AL121603, AC003663,
					AC005901, AC005971, AL022326, AC004552, AL133216, U91323, Z97056,
					U82828, AC003042, AL031282, AC002565, AL049539, AC005291, U89335,
					AC005800, AC005399, AL035681, Z84466, AC004765, AL031846, AC004963, and
					AL035443.
HSSAJ89	662	875882	1-302	15-316	W92215, AA377828, AI740584, N76763, T84274, R82785, T78575, R17095,
					T87269, R11236, and T79354.
HSSAE52	663	871244	1-167	15-181	AI472653, and AA377685.
HSSAA15	664	965347	1-796	15-810	AI110596, AA278446, R76143, AA312497, AA284193, AA355145, AA490794,
					AA377558, N79277, AA464226, AA363394, R24680, AA490748, AI902621,
					H56984, AA340607, R69950, AI830706, N78524, AW364076, H13787, AA366038,
					N80360, AA442589, AA046344, AA813247, AA215532, H45795, AW250076,
					AA147663, AI393282, AA282719, AI089657, AW043798, AI652874, AA557376,
					AW167542, AI982882, AA490235, AI143182, AI439663, AI017552, T89683,
					AW408401, AW402303, AA534702, AA284082, N51261, AI357897, AI089649,
					C14798, D60855, AA490509, AA864859, AA262577, AA812466, and AL133009.
HSRAY10	665	961237	1-731	15-745	AI565051.
HSRAS82	666	780222	1-259	15-273	AW385413, N78312, and U73168.
HSRAF70	667	524680	1-393	15-407	AB011100.
HSRAF11	668	967886	1-296	15-310	AC002133, and AC004587.
HSRAD72	669	539530	1-434	15-448	R06151, AA385070, AA398993, AA491011, H28273, R00914, H69631, H87597,
					R17024, AW362296, AA064980, AI065074, H28240, AA043619, AA032023,
					AA069630, W81414, N76651, AA037103, H61103, AA243289, R02831, H28759,
					AL120864, T70140, AI735280, AA337374, AF191339, and AB019409.
HSRAD65	670	871268	1-239	15-253	AL119835, AW163089, AW162617, AI928782, and AW162588.
HSRAD53	671	525490	1-321	15-335
HSRAD49	672	722134	1-377	15-391	AI394551, AA812658, and AA776285.
HSRAD31	673	524845	1-235	15-249
HSRAD10	674	968614	1-464	15-478	AA312660, and AI474863.
HSRAD03	675	925505	1-303	15-317	AC002536.
HSRAB87	676	823174	1-325	15-339	AA661583, AI536625, AA078084, AI803827, AI472453, AI932902, T60674,
					AA377621, AA302970, AA372389, F23307, AA496309, AA346485, AW192199,
					AA366936, AA459962, AA371410, AW194802, AC005944, AP000553, AC005895,
					AF165926, Z84718, AC005277, AC005358, AC005971, AL136295, AC005619,
					AP000351, AC005696, Z97054, AC004019, AC002470, AC005225, AC005280,
					AC006515, AC006511, AC007421, AC005940, U78027, AF129756, AC007731,
					AL049653, AL031255, AL035422, AP000505, AL133353, AC005071, AP000512,
					AP000114, AP000046, AC007546, AC020663, AC006946, AL133448, AL031280,
					AL049694, AP000555, AC005746, AC005821, AC005231, AC005500, AC005067,
					AL031722, AC006538, AC005911, AL022331, AL021154, AB023051, AC006509,
					AL035458, AL121934, AP000300, AP000045, AP001056, AL035405, U63721,
					AP000302, Z97056, AL049829, Z86090, AL121653, AF207550, AC004859,
					AL031733, AL008719, AC004814, AC002996, AL049757, AF029308, Z99716,
					AC005041, L78833, Z69917, AL080243, Z85986, AP000113, AL022324, AF196779,
					AC004841, AC007319, AC000025, AL008582, AC006057, AL031311, AC004983,
					AP000557, U91326, AL049872, AL132987, AC006449, AC004963, AC004883,
					AC005288, AC007066, AC005664, AL034548, AC002072, AL050318, AC005529,
					AC002504, AP000031, Z98946, AC003041, AP000345, AC004552, AC007298,
					AL031291, AL049759, AC005694, AL109627, Z92540, AC009516, U52112,
					AC004386, AC005095, AC006479, AC004448, AC005082, Z81369, AC005599,
					AC006992, AF205588, AC000041, AP000563, AC005755, AC005412, AC006539,
					AC006077, AL121603, AL049636, AL031432, AC003030, AC004134, AC004771,
					AL033527, AC002073, AL121915, AL139054, AC002401, AC007283, AC011311,
					AJ003147, AL132712, AL049539, AL133243, AL021977, AC007277, AC004099,
					AC002369, AC005519, AC000353, AC005606, AC003051, AL132992, AC005355,
					AC005695, AL035089, AL079295, U85195, AC005773, AC007308, AC004884,
					AC008041, AC002492, AC005527, AC008115, AC004217, AC007216, AC000379,
					AC002301, Y14768, AL050332, AL034429, AL008718, AL049795, AC004643,
					Z98051, AC005924, AL031662, AL024498, AP000133, Z83843, AF109907,
					AF064861, AC008055, AC004655, AC006125, U62292, L44140, AL096701,
					AC002316, AC004821, Z83846, AC016026, AC002120, AR060470, AC016830,
					AC004559, AC005261, Z93017, and AC004216.
HSRAB82	677	522945	1-388	15-402	AL031733.
HSRAB76	678	508105	1-393	15-407	AW003750, and AA608656.
HSRAB36	679	522946	1-376	15-390	AC005352.
HSRAB34	680	706996	1-399	15-413	L14561.
HSRAB08	681	960411	1-134	15-148
HSRAA86	682	527194	1-415	15-429	Z66025.
HSRAA80	683	937640	1-446	15-460	AC006504, AC007788, AL020995, AL031393, and AC006118.
HSRAA64	684	955314	1-315	15-329	AC005924.
HSRAA51	685	522834	1-314	15-328	AA287418.
HSRAA39	686	719712	1-406	15-420	W57866, AA405363, AW068952, AI347952, AW338731, AW262930, AI650770,
					AI827045, AA406218, AI224572, AI983500, AI659859, AW139817, AI367100,
					AW029065, AA860374, N29563, AI683067, AI148585, AI963162, AA457121,
					AI830485, AW129125, AI983651, AI800368, AA115644, AI817037, H26177,
					AI590898, AI811420, AI963645, AA857298, H99276, AW088836, AI421113,
					H22014, AI753020, Z40200, F04312, AI751902, AA131162, AI698346, AI955784,
					AI290179, R22616, AI955793, AA834648, AA826157, AW057686, R62159, T33749,
					AW392341, H26176, AW274070, AI750657, R22615, AL096713, AB033033,
					AF182317, and AF182316.
HSRAA37	687	522837	1-444	15-458	AC007684.
HSRAA24	688	795855	1-465	15-479	T80334.
HSRAA23	689	524795	1-406	15-420	AI783911, AA502532, AA552724, AA481887, AA376358, AA604147, AA452887,
					F30310, H90878, R95840, AA584756, AA613754, N72170, AA559241, AL048275,
					AA192252, AA975894, AA181363, AI879951, AW265688, AI620585, AA194285,
					AI742168, AI358776, AA564925, AA936718, H62343, AA581247, AA339923,
					AA021429, AA018588, AA021428, AA722336, F00564, R73744, AI431513,
					AA019872, AA470567, AA708753, H78898, AA862253, AA747757, AA078830,
					AA605243, AI302156, AA481970, Z83844, AC006271, AC007226, AC006538,
					AC004841, AC005620, AC005531, AP000030, AC004131, AF196969, AC005696,
					AC006581, Z93930, AC005274, AL080243, U91323, AC000026, AP000694,
					AC006011, AC005011, AC005800, Z98051, AC002059, U91326, AC004815,
					AC005480, AC005736, AL021579, AC006071, AC004887, AC008044, AC005527,
					AL034379, AC005225, AC004526, AL117337, AC005399, Z93023, AC005844,
					Z95116, AC004033, AL050332, AL049766, AC005876, AC007546, AC020663,
					AC006312, AC006966, AC007686, AP000553, AL121658, AC005516, AL133353,
					AC004491, AC004477, AC004929, AC002312, AL008710, AC005193, AC004019,
					AC007688, AC004996, AC003108, AC005667, AL096701, AF196970, AL022320,
					AC005015, Z98946, AL133448, AL008582, AC006468, AC002316, AC004263,
					Z97054, AC008072, AF111168, AC006515, AC002072, AC004551, AC005874,
					AF134471, AC002492, AC012627, AL035587, AL035088, AC005081, AC005358,
					AF053356, Z93017, AL022318, AC004914, U80017, AL050318, AC006449,
					AC006441, AL022323, AC004531, Z84466, AC005046, AC006064, AC004921,
					AL022238, AC000353, AL024506, AL035461, AL034549, AC005529, AL117258,
					AF205588, AL021707, AC005200, AC005839, AL109984, AC004659, AF111169,
					AC009516, AL022336, AP000501, AF109907, AL135744, AF111167, AC004832,
					AC006948, AL034420, AC016027, Z95114, Z98200, AC007308, Z81365,
					AC006111, AC003665, AC005730, U95090, AC000052, U91318, AC016830,
					AC002302, AL023807, D87675, AC006511, AF001549, AL031685, AL031680,
					AC005971, AP000704, AC004858, U07563, AC004087, Z95115, AC004408,
					AC007285, AC005914, AC007225, AC002369, AL034553, AC002476, AC005585,
					AC005088, AJ246003, AL049576, Z83826, AL139054, AC003684, AL035455,
					AL031597, AC002314, Z82203, L78833, AC004622, AC002094, AC006120, I34294,
					AL079342, AC005697, AC005086, AL031432, AL009172, AC005694, AC005231,
					AC002563, AC004812, AP000131, AP000209, AL031587, AL031283, AC004967,
					AC004851, AC005913, AC005067, AL049694, AC005755, AC004134, AL031657,
					AL031846, AC006509, AC004638, AF165926, AC007151, AL031848, AP000251,
					Z98884, AC006130, AL078638, AC005488, AP000355, AC003101, AC005037,
					AC004801, AC004859, AL035462, AP000090, AC005049, AJ251973, AL049631,
					AC007298, AC006088, AC006480, AC010205, AL049569, AL033527, AL034418,
					AC003661, AC005411, AC002425, AL050341, AC004821, AL096791, and U47924.
HSLKB62	690	905738	1-1727	15-1741
HSLKB37	691	929743	1-687	15-701	N68327, AW139202, AI350326, AI279786, AW339260, AA513265, H66480,
					H38171, AI187961, and H69151.
HSLKA06	692	934638	1-838	15-852	AI623826, AI202494, and AL137429.
HSLJJ62	693	742895	1-423	15-437	R10605, T97572, and R91642.
HSLJF33	694	938811	1-542	15-556	T12297, and T12296.
HSLJD02	695	965826	1-942	15-956	AW360811, AW366296, AW375405, AW177440, AI905856, AW178893,
					AW377671, T03269, AW177501, AW177511, AW360844, AW360817, AW352117,
					C14389, AW179328, AW375406, AW378534, AW179332, D58283, AW377672,
					AW179023, AW178905, D59859, AW352170, D80022, C14331, D80166, D80195,
					D80193, D59927, D59467, D51423, D59619, D80210, D51799, D80391, D80164,
					D59275, D80240, D80253, D80043, D59787, D80227, D59502, AW378532,
					AW367967, D81030, D81026, AW178980, C14014, D80212, D80196, D80188,
					D80219, AW178775, AA305578, D80038, C15076, D80269, D59610, AW377676,
					AA305409, AW352171, D57483, C14429, D51022, D50979, D50995, AW177731,
					D80366, D59889, AW178907, AW178906, AW178762, D80248, D80045, D80132,
					AW179019, AW179024, D80522, D80024, D80134, AA514186, AA514188, D80378,
					D51060, D80133, D51097, AW177505, AW179020, AW178909, AW177456,
					D80251, AW179329, AW177733, AW378528, AW178908, AW178754, AW179018,
					AW352158, D58253, AW352174, D80268, AW179004, D80302, AW178914,
					AI535850, C75259, D80439, D80247, AW178774, T48593, D51103, D88547,
					X82626, A84916, A67220, D89785, A62300, A62298, Y17188, AB028859, A78862,
					D34614, D26022, AJ132110, AR018138, AR008278, X67155, Y12724, AF058696,
					A25909, A94995, AB012117, AR025207, I18367, AR008443, I19525, AR066490,
					A85396, D88507, AR066482, A44171, A85477, A86792, AR066488, X93549,
					A82595, AR016514, D50010, D13509, AR060138, A45456, A26615, AR052274,
					Y09669, AR060385, AB002449, AR066487, A43192, A43190, AR038669,
					AR008408, and AR060133.
HSLIJ48	696	721248	1-916	15-930	AL119990, AA524531, AI459232, AW295852, AW274849, AI990971, AI086621,
					AI703399, AI582316, AI887899, AW444954, AI198620, AI201159, AA769116,
					AA908833, AI769819, AI761662, AI678189, AI638810, AW001104, AW339272,
					AI025272, AW151222, AW015232, N30310, AI797112, AA781447, AW083242,
					AA291544, AW003604, AA831760, AI027612, AI624665, AW276610, AW168171,
					AW170708, T62956, AA442455, AI807572, AW080508, AI052790, AW378235,
					AA827853, AA737447, AI969056, AA465529, H03505, R78862, AW205495,
					AA515398, T88738, AI972735, AA436647, AA805386, H03615, N56642, AI825714,
					AA293351, AW292091, AI473377, AA404571, AI349471, T63206, R79349,
					AA399447, Z38283, AI582475, AA252529, AA252574, AA708728, AI670981,
					AA429843, C06324, AA748807, AI650622, AW392315, and D20600.
HSLIG07	697	952493	1-766	15-780	N31935, AI433732, N20982, AA736780, AA721230, AA460997, and AA018340.
HSLIE03	698	923393	1-636	15-650	AA164206, and Z98049.
HSLIC21	699	670359	1-499	15-513	H22544, AI204929, and H46842.
HSLHZ82	700	779067	1-512	15-526	H72516.
HSLHZ10	701	963808	1-294	15-308	T57527.
HSLHV27	702	964075	1-999	15-1013	T03269, D80212, D58283, D80166, D80195, D80193, D59927, D51423, D59619,
					D80210, D51799, D80391, D80240, D80253, D80043, D80227, D59859, D80196,
					D80188, D80219, D80269, D80038, C14429, D59889, D81030, D80366, D59502,
					D57483, D80022, D59275, D80045, D59610, D80024, AW178893, D80378, D50979,
					D50995, AW177440, C14389, AW179328, D59787, D80241, C14014, C75259,
					D80164, D51060, AI905856, C14331, D80134, D59467, AW378532, C15076,
					D51097, AW178775, AW177501, AW177511, AA305409, AW352158, D81026,
					AA285331, F13647, AW178762, AW352117, D80949, D80168, AW360811,
					AW176467, D51022, D58253, D80522, AW377671, AW377672, AA305578,
					AW375405, AW360834, AW360844, AW366296, AW360817, AW179023,
					AW375406, AW178905, AW378534, D80248, AW179332, AW352172, AW177731,
					D59695, D80251, AW352171, AW377676, AW179019, AW352170, AW179024,
					AA514188, AW178907, AW179220, AW177733, AW177505, AW179020,
					AW178909, AW177456, AW378528, AW179018, D80268, AW179329, AW178908,
					AW178754, AA514186, D80133, AW178906, AW178980, AW367967, AW179004,
					AW178911, AW178914, C05695, AW352174, AW178774, D80132, D80302,
					AW178983, T48593, D80439, D80247, AW177723, AW378533, D80157, D51103,
					AW367950, AA033512, AW178986, D45260, C06015, AI535850, C14975,
					AW378542, D80314, C03092, AW360855, AI525923, AI525913, AI525917,
					AA514184, AI535959, A84916, A67220, D89785, A62300, A62298, A78862,
					AJ132110, X67155, A25909, Y17188, D26022, D34614, AR025207, D88547,
					X82626, AR018138, AB012117, Y12724, A85396, AR066482, X68127, A44171,
					AF058696, A85477, I19525, A86792, AR008278, X93549, AB028859, U87250,
					A94995, AF135125, AR008443, I50126, I50132, I50128, I50133, AR016514,
					A82595, AR066488, AR060138, A45456, A26615, AR052274, D88507, AR064240,
					A43192, A43190, AR038669, A30438, D50010, Y09669, AR060385, I18367,
					AR066490, AB002449, AR066487, AR008408, AB033111, Y17187, A63261,
					D13509, AR060133, AR062872, A70867, U87247, A64136, A68321, Z32749,
					AR016691, AR016690, U46128, U79457, AF123263, I14842, X93535, and
					AR008382.
HSLHG49	703	722570	1-455	15-469	T76925, and F13028.
HSLHC40	704	710681	1-386	15-400	H87626, and H87632.
HSLGY08	705	959371	1-459	15-473	H52847, and U73638.
HSLGQ48	706	720956	1-450	15-464	R14758.
HSLGP07	707	953305	1-430	15-444	H52460.
HSLGO19	708	668634	1-530	15-544	T69707, AI364440, N48142, and AI193460.
HSLGN78	709	773565	1-345	15-359	AA648821, AI937873, AW241962, AA085600, AA743475, and AA618255.
HSLGN52	710	466026	1-268	15-282	N44280, and AF030339.
HSLGK46	711	719031	1-479	15-493	AI929533, AA143673, AF160973, AB032994, AL136549, and AF162472.
HSLGK26	712	929286	1-594	15-608	R02405, AI902990, AL049742, and AB033071.
HSLGK23	713	675266	1-447	15-461	AA761431, W23694, and W35274.
HSLGJ37	714	708824	1-438	15-452	R14817.
HSLGI76	715	770035	1-643	15-657	W03269.
HSLGI67	716	465989	1-681	15-695	R15431, R43754, R41977, AI684818, AW263190, R20728, and AA764976.
HSLGH70	717	871888	1-613	15-627	AA020737, AL120362, T04912, AI207884, and AL120567.
HSLGG86	718	784703	1-573	15-587	R13205, F06363, Z42917, Z42916, and AC005550.
HSLGG79	719	775146	1-469	15-483	N49335, N32155, AI378923, AA825350, AI168537, T75454, AA553340, and
					AC003086.
HSLGA79	720	774051	1-487	15-501	T89229.
HSLGA45	721	717776	1-198	15-212	AA456710.
HSLGA24	722	955333	1-793	15-807
HSLFU18	723	666405	1-975	15-989	AI948585, AI091275, AI768335, AA002188, AA054389, AI422809, AA625455,
					AA152352, AA504767, AI091665, AI274082, AI151107, AI356672, AI276227,
					AW363928, AW293599, AI379300, AA028994, T06356, AI401834, D25946,
					Z41039, AA152353, H09081, AI695174, AL118909, AA429474, AI079113, and
					AC008154.
HSLFT29	724	680451	1-448	15-462
HSLFN96	725	796375	1-267	15-281
HSLFI01	726	876881	1-458	15-472	R74609, AW080754, AL049611, and D31762.
HSLED70	727	757319	1-501	15-515	AA463820, AW177073, AA235749, and AI940206.
HSLEB84	728	783130	1-422	15-436	H02965.
HSLDW24	729	779689	1-442	15-456	AW237453, N56967, N47347, AA436760, R96401, H73070, and AC005082.
HSLDT25	730	949079	1-1531	15-1545
HSLDR18	731	578926	1-371	15-385
HSLDR05	732	932128	1-220	15-234
HSLDP66	733	866331	1-389	15-403	AW151855, AC006597, AC004796, AC005844, AC005740, AC007563, AL049780,
					AC005015, AC006530, Z99716, AP000350, AC002365, AC004408, AC005747,
					AC004552, AC005663, AC007057, Z83820, AC005670, AC005242, AC009501,
					AL034343, and AC004125.
HSLDO01	734	916969	1-303	15-317
HSLDM82	735	780055	1-533	15-547	T53015, T53016, and U88969.
HSLDF25	736	430328	1-541	15-555
HSLCY75	737	766533	1-536	15-550	W88780, and AC000078.
HSLCX61	738	742031	1-538	15-552	H19015, R24546, and AC007676.
HSLCF96	739	637670	1-1575	15-1589
HSLBW39	740	705630	1-419	15-433	AA190333, and AB029001.
HSKZE91	741	790166	1-531	15-545	AI904945, T48340, AI921328, AI147425, AW264955, AL079935, AF111163,
					AC004765, AL109827, AP000503, AF134726, AJ003147, AP000201, AF124731,
					AP000097, AL031295, AC000105, AC002565, AC006367, and AC004032.
HSKYG48	742	721631	1-294	15-308	AI204981, W23546, AA862243, AA579469, AA749235, AA572960, AA780929,
					AA808263, AA814778, AI446474, AA508873, AA857381, AL043289, H10143,
					AW022317, H29019, AW082744, AA634786, AA655005, T92957, AA577748,
					AW068394, AA384039, AI870204, AI623899, AA122028, AL120708, AA502175,
					AA426277, AL120897, AI216054, F17700, AI916335, F23327, AI754064, AI446464,
					AA558298, AI355119, AI908093, H45320, AA467988, AA492313, H10859,
					AA364814, AL133353, AL031289, AC007298, AC009479, Z98755, AC004815,
					AC005046, AP000348, AC008249, AL133244, AL133163, AL024498, AC008044,
					AL035455, U91323, AC002347, AC006965, Z97053, AL022318, AC005520,
					AC002477, AL031431, Z95889, AC007564, AC005089, AP000552, AF109907,
					AC002395, U95742, AC003029, AL035685, AL020993, AC005696, AB023049,
					AC005856, AC005837, AL031432, AF117829, AL109984, AC005071, AL117352,
					AL096864, U95740, AC004972, AC004675, AC009510, AC007536, AC005664,
					AL031012, AL050318, Z84466, AL050307, Z98051, AF190465, AL022312,
					AP000355, AC005632, AC005781, AC004149, AL132712, AF088219, Z85986,
					AF207550, AC000085, AC007216, AC005339, AP000117, AC005358, AL121653,
					AC007664, AC005291, AL035072, AC005412, AL021917, AC005776, AC000003,
					AC006450, AL031433, AF152365, AL031447, AF196969, AC004150, AC004797,
					AC002301, AL049694, AC005228, AC012384, AC006547, AC003071, AL031257,
					AP000553, AL049836, AC009516, Z98949, AC005057, AC003102, AC006285,
					AL031848, AC005907, AC004024, AC005538, AP000512, AC003992, AC010382,
					AC002524, AC006449, L78810, AC004765, AC005663, AC005747, AC005919,
					AF108083, Z82188, AL121603, AL031577, Z98752, AC007050, AC007283,
					AC007690, AF053356, AC005399, AC006257, AC002350, AC005500, AC002432,
					AF196779, AC008056, AL031685, AC003111, AL132777, AL023553, AC000075,
					AL008635, AL049776, AC006597, K00059, AL133448, AF196972, AL021453,
					AL096773, AC004883, AC004167, U47924, AL136295, AF129756, AC007376,
					AC004584, AC000084, AC005899, AC006211, AC007731, AC008018, AC006162,
					AC006271, AL033504, AC002351, AL080243, AL035587, AP000514, AC006077,
					AL022721, AC007136, AP000556, AL034402, AC002310, AC004814, AC005702,
					AL049797, AC004226, AL049869, AC007878, AC007191, AC004859, AC005839,
					AL022238, AL008726, AC006512, AC005037, AC006539, AC005790, U85195,
					AL133245, Z82190, Z83846, AC005189, AC004617, AL033521, AC005069,
					AL109985, Z84480, AC004477, AL031296, AC006120, AC004967, AP000313,
					AC005768, AC005988, AP000194, AL049757, AC004016, AC006530, AE000658,
					AC002980, AC005043, AC005701, AC004491, AC004000, Z99716, AL109627,
					AF001549, AP000050, AC005484, AC004983, U91629, AC005914, AC005070,
					AC006071, AC006365, Z85987, AC004810, Z84469, AL022163, AP000472,
					AC005971, AL031276, AC006130, AL121694, AL031277, AC008372, AC007917,
					U91326, AC004526, AC005932, AL031846, AL035089, AC006121, AP001054, and
					AC004849.
HSKXA69	743	754258	1-470	15-484	T71620, AA534420, AA831032, AA594106, AI263883, AI761286, AA983957,
					AI001173, T92198, AW004790, and T89254.
HSKKE11	744	965857	1-231	15-245	W16981, AF195534, and AF005355.
HSKJR15	745	866396	1-394	15-408	AI287342, N49215, and AB020629.
HSKJC88	746	866402	1-543	15-557	AI420428.
HSKII90	747	788894	1-628	15-642	AA216387, AA228676, T63548, and T63473.
HSKHZ47	748	720286	1-623	15-637	AA001179, AA001429, AA018483, AL119995, and AC007228.
HSKHT93	749	957866	1-437	15-451	AA252410, AA095264, AA310368, AA282860, R88254, AA131559, AA043465,
					AA319576, AA315504, AF091871, and AF117815.
HSKHP10	750	964568	1-316	15-330	AI810136, AA974689, AA889167, and AL137442.
HSKGS69	751	755046	1-321	15-335	AI094227, R02713, T86217, W92159, W86709, AA885954, and W86575.
HSKEH21	752	941976	1-952	15-966	AI675047, and U59429.
HSKDC06	753	935452	1-318	15-332	R82607, R64237, and T92293.
HSKCR54	754	922730	1-743	15-757	AA203533, AW129778, W67725, AI760143, AI760154, AI076011, AI141700,
					AW291405, AW084971, AI249711, AI860954, T56255, AA521444, AA933784,
					AI357440, AI126235, AW024151, AW054658, AI073421, AI332800, AI088159,
					AA740986, AI436661, AA636135, AA780513, AA844488, W68184, AI359009,
					AA505079, AA863180, AA011196, AA878994, AI360359, AA435579, N92742,
					AA083868, AI151305, AA098801, AA312160, AI291546, AI370946, AA074916,
					AI298772, AI219280, AI498113, AW451298, AI095138, AA011293, AA947145,
					AA948297, AI962142, AA563646, AA010799, N30192, AA398878, AI076091,
					AA307568, AA316691, AA039627, AA843701, AI266592, F16320, R56976,
					AI918303, AA928915, N40842, AA706164, N57341, AA074919, R76961,
					AA721373, AA098800, AW451443, N29414, AI475037, AA872862, AA083975,
					AA320742, AA010857, AI265777, and T56399.
HSKCD43	755	714389	1-492	15-506	AA424097, AA452654, R02449, AF033120, AF033121, and AF033122.
HSKBW86	756	785783	1-351	15-365
HSKBW62	757	521937	1-316	15-330	AA653323, AA598964, AA653202, AI732164, AI821721, AA745570, AA610482,
					AA569206, AA364953, AI624800, AI092525, AA564510, N25034, AC004253,
					Z83843, AC004386, Z95125, AL137312, AC005899, AL049709, AC007690,
					AC005746, AC003102, AC005616, AL133353, AC002456, AP000507, AL021154,
					Z97206, AC004699, AC004905, AC005844, AC004970, AC002326, AC004887,
					AC003047, AC005031, AC004999, U80017, S83170, AL031662, AC007314,
					AL035420, AL034561, AL135744, AC005011, AL022165, AL035090, AC006312,
					AB000880, AC006441, AC005903, AL031905, AL079342, AL139054, AC007151,
					AL078581, AC004491, AC004601, AL035587, AL050348, AL080243, AC005684,
					AC004832, AC004851, AC004938, AC009516, AC005200, AC006111, AC002978,
					AC002123, AC007425, AL078460, U82828, AC018633, AC004217, AC002465,
					AC002300, X76498, Z97055, AC007999, AC002302, AL035691, AL031003,
					AC007207, AB001523, AC002418, AC003010, AC008372, AL035361, AF111169,
					AC005553, and AL021578.
HSKBW21	758	671383	1-128	15-142	AI218427.
HSKBV67	759	561585	1-245	15-259
HSKAE10	760	968508	1-680	15-694	AI478821, AI034114, AW057617, and AI034113.
HSKAC29	761	535402	1-362	15-376	AA381761.
HSJCA03	762	925252	1-450	15-464	AA813174.
HSJAY64	763	866540	1-301	15-315	T59788, and T59655.
HSJAB49	764	723261	1-325	15-339	H60179.
HSHCL04	765	840406	1-1575	15-1589	AI282710, AA469327, AW272815, AC007637, AL021154, AC007055, AL049780,
					AC007216, AL109827, AL035072, AC002369, AL096791, AL021453, AC002425,
					AP000501, AF196779, Z82206, AL031311, AC005837, AC006241, AC005409,
					L44140, AC004531, Z84469, AL133448, AC005520, AL022316, AP000689,
					AC005740, Z98941, AC005562, AC005914, AC004686, AC007263, AC004905,
					U91318, AC011311, AC005736, AC004525, AL110502, AC004217, AC004895,
					AC005899, AC005288, AC007298, AC005553, AL121658, AC005920, Z99716,
					AF109907, AC006064, AC005972, AL031447, AC005696, Z98742, AL133485,
					AC007225, AC004782, AC002492, AC004125, AL035420, AL022329, AC004985,
					AL008582, AC005280, AC004841, AC005911, AC018633, AC006006, AP000046,
					AP000140, and AL022320.
HSHCK86	766	785392	1-564	15-578
HSHCJ63	767	468536	1-489	15-503
HSHBU07	768	866636	1-443	15-457
HSHAH05	769	932689	1-379	15-393	H02663.
HSCAF60	770	537444	1-372	15-386	AI684502, and AL080250.
HRDFU03	771	924698	1-352	15-366	R07659.
HRDFH46	772	590391	1-523	15-537	AA102589, AA804174, and AA026519.
HRDFG13	773	925350	1-237	15-251	AA443411, Z99716, and AJ236681.
HRDFF47	774	740594	1-101	15-115	H81628, N66263, and AL049835.
HRDFD56	775	733556	1-447	15-461	AW051571, AA662497, AI022097, AA779814, AA649495, AA621426, D62952,
					AA621628, AI470588, D79237, N50823, R51630, AA019034, R42166, and
					AA887956.
HRDFA03	776	867122	1-974	15-988	AI054414, AI608771, AI204309, AL037632, AA290878, AI791227, AA577824,
					AA714224, AI871954, AA547979, AI445582, AW405593, AA287259, AL048969,
					AI133516, AA206629, AI922805, AA601425, AI907046, AA838140, AW238345,
					U51704, AI061646, AL042310, AA443390, AA708108, AA429020, AI581006,
					AI281401, AI925321, AA737309, AW247819, AA829044, AA311156, AA524604,
					W96277, AA610433, AL135377, N49425, AA595093, AI110760, AA581471,
					AI679782, AA603315, AL079869, AA224525, AL138265, AA209415, AI354847,
					AI889426, AA287618, AA429197, AI745133, AC004797, AC005015, AP000134,
					AP000212, AL031281, AC009516, AC006211, U95742, AC007227, AC006285,
					AF047825, AP000692, AP000030, AL049569, AF109907, AC004019, AL049776,
					AL024507, AC007193, AL022238, Y10196, AC007216, AC007637, AC005519,
					AP000558, AC006312, AC004659, AC002477, AL022320, AP000152, AC005696,
					AC005529, AC006480, AC004832, AL049636, AL049869, AC004865, AC007011,
					AC000025, AC005527, AC004217, AC006449, U85195, AL008716, AC009247,
					AL034420, AL021707, AC007546, AC005480, AC005037, AC006064, Z97630,
					AL034423, AC003043, AC002288, AL031311, AB023049, AC007688, AF207550,
					AE000658, AC004685, AL022476, AC016025, AL031284, AC006530, AC002316,
					AL035422, AL078581, AC007014, AC005785, AC005280, AC000353, U96629,
					U95740, AC004876, D88270, AL022316, AC002350, AC007308, U80017,
					AF045555, AL031848, Z98044, AC007684, AL133448, AC002314, AC002039,
					AC005081, AL096701, Z99716, AC002565, D86992, AC004253, AC005412,
					AC007387, AC004815, AC003108, AC005231, Z95152, AF031078, AC005736,
					Z85996, AC005488, AC005180, Z83844, Z93241, AC002310, AC004858,
					AC004675, AP000501, AL031447, AF030876, AL023807, AC005207, AC004686,
					AC000035, AL049780, AC002126, AC003101, Z95114, AC004878, AL049709,
					AC010205, AL049759, AP000553, AC005295, AC000134, AL049766, AC005274,
					AC002470, AC005821, AL031659, AC005071, AC004000, AL035086, AL035405,
					Z97054, AL049643, AP000113, AC004812, AP001052, AL022328, AC006571,
					AF001549, AL121652, Z98742, AP000689, AL021546, AL020997, AC004967,
					AC006966, Z98036, AC006441, AL049757, AL021154, AC005082, AC005920,
					AC005088, AC003695, AF038458, AF088219, Z68870, AC006130, AC006115,
					AC007919, AC006487, AC002303, AC005859, AC004765, AP000502, AL121825,
					AC004383, AL022237, AL096791, AC007934, AP000045, AL031680, AC005666,
					AC005225, U95743, AP000552, Z82190, AC005839, AL031597, AL022326,
					AC004883, AC005793, AC005921, AC005089, AC005031, AC002352, Z93930,
					AC005516, AC004851, AF129756, AC012384, AC007664, AC005520, AL050321,
					AC007225, AC007371, AL109798, AC007066, AC003690, AC005632, AL121655,
					AC004882, AL050348, Y14768, AC005914, AC005972, AC007358, AL050341,
					AL050318, AC004477, AC004491, AC002425, AC005971, AL009181, AL109827,
					AC007192, AF001548, AC004638, Z93023, AC005324, AP000505, AL080242,
					AL133243, AC005544, AC007676, AC006120, AC004933, AF111168, AL079342,
					U82828, AC002472, AC005387, Z83822, U91321, AL022165, AC002558,
					AL050332, AP000688, L78810, AC002544, AC005011, AL049872, AC005041,
					AJ003147, and AC005399.
HRDEZ73	777	774414	1-371	15-385	H26725, H22204, R48422, H40444, AW299397, AI125783, AI003778, AA470331,
					AA470347, AA468450, AA468277, AA468204, and AI924555.
HRDEX24	778	867123	1-750	15-764	AI347412, AA098880, AA099225, AI473261, AI308141, and AI468639.
HRDER90	779	789140	1-414	15-428	AA084891, H82037, T85036, R94550, and R01653.
HRDER35	780	707569	1-447	15-461	W02017, AB011399, AL049698, and AB016897.
HRDEP20	781	690456	1-878	15-892	N41324, AA196645, W80987, N56686, AA317626, H71355, AA305440, AA150080,
					AI885648, W92648, AA070703, AA824341, AW410573, AW157530, AL040266,
					AA045127, AA043642, AA368590, AA325559, AA587915, AW250790, AA778651,
					AA317723, AW410572, AI139138, AW007464, AI819989, AW188549, AI951992,
					AI951978, AA036715, AI677931, H92998, AI364379, AI758826, AA303613,
					AA749431, AW162769, AA584288, AI376410, AI373112, AA383234, AA977318,
					AI187131, AI768324, AI076148, AI934676, AA150015, AA057355, W70033,
					AA682387, AA196549, AI000432, AI040155, AA513466, AA946608, AI038499,
					AI279549, AA778720, AI887548, R60037, N86794, W94564, AA487107, AI758476,
					AW273537, AI077415, AA836837, AW103741, AI199096, AI439996, AI278114,
					AI038357, H94227, AA186980, AI253749, AI700221, AW004637, AA045098,
					AI200368, and T35014.
HRDEK53	782	867137	1-275	15-289	AA703174, AC005585, and AC004832.
HRDEJ33	783	487523	1-110	15-124	AL034344.
HRDDX67	784	460145	1-438	15-452	AC007541.
HRDDX01	785	921501	1-376	15-390	AI871189, AA512915, AI636339, and AI017463.
HRDDU41	786	712572	1-297	15-311	AI280574, AA329535, AI559583, AW089016, AI983047, AA743968, AI453160,
					AI554725, AI564294, AI436330, AA715891, AA657910, AA613775, AA837715,
					AA287502, AA632765, AI471467, AA573693, AA326904, AI306717, AA643451,
					AA636102, AI628859, AI049701, AA577824, AI762528, AI253376, AW007424,
					AA809153, AA017240, D51809, F00688, AA552989, AW073498, AI929410,
					AI753672, AI049512, AI925978, AI750950, AL043212, AA993165, AI280535,
					AA857812, AA233951, AI590598, AA598734, AA099840, AL041019, AW265279,
					AW084100, AI244356, AW188791, AA608520, AA704393, AL041018, AI569363,
					AI002762, N22153, AI524471, AA558404, AA643441, M86139, AI417586,
					AI225179, AL138199, AI564301, T74524, F31654, AA679353, T40629, AA846923,
					AA084506, AI609972, AA302978, AI255004, AI049630, AI255015, AI569546,
					T74259, H74326, T92803, H38769, AI537800, AW263867, AA223910, AA230146,
					T90477, AL120543, AI061313, AW084173, AC004605, AC007283, AP000501,
					AL031659, AC005227, AC005180, AC006515, AP000365, AL049779, AC010206,
					AF003626, AC004707, Z95152, AC007193, AC004662, AL035555, AL031275,
					AL031407, AC004694, AJ003081, U80017, AC004531, Z99943, AL022238,
					AC004955, AC006101, AC002375, AC004019, AL024498, AL031283, Z97876,
					AC008124, AC008119, AL034420, AC007376, AC003101, AF111168, AC008040,
					AC005317, AC004744, AC007050, AL022476, AC005562, AL021578, AC006208,
					AC007386, AC005529, AP000550, AL022324, AC007773, AC008018, Z97353,
					AC004242, AL023575, AC006449, AF064860, AC000025, AC004099, AC006011,
					AL031985, AC005527, AL133238, Z83847, AC004031, AC008009, AC003029,
					AL109963, AC005988, AC004738, AL109839, AC007057, AC002551, AL049758,
					AC005747, AL035682, AL031289, AC003964, AC008039, AL022336, AC004895,
					AP000692, AC016027, AC002312, Z98941, AC007630, Z75887, Z97054, AC007207,
					AL035462, AC004653, AC016830, Z85986, Z93016, AC005884, AB020864,
					AC002563, AC002470, AL049712, AC007938, AL023803, AL031295, AC006511,
					AL049694, AC005071, AL031228, AC005041, AC019014, AC005899, AC005300,
					AC004928, AC005288, AC000353, AF165138, AC004638, AL122020, AL133500,
					AC002395, AL035086, AP000088, AC005089, AL031729, AC006946, AC006254,
					Z73417, AF011889, AC004383, AL049757, AC005074, AF165926, AP000117,
					AL049691, AL021394, Z93023, AC005316, Z95118, AC006160, AL031277,
					AF038458, AB000882, AC005207, AC007240, AF196971, AC004859, AL117694,
					Y11107, AC005231, Z86090, AC005666, AC005280, AC005004, AL034423,
					AC002072, AC007421, AC004150, AC005632, AP000011, Z84480, AC004131,
					AP000032, AL022316, AC007363, Z93096, AC005971, AC012384, AL022165,
					AL049643, AC004088, K03021, AL050307, AL022313, AC002496, AC007664,
					AL031428, AC008115, L48038, AC007011, AC005102, X54150, AC007868,
					AC005412, AC002057, AC004552, AF047825, AF091544, AC005215, Z83840,
					Z93020, AP000313, AF207550, AP001053, AP000194, AL021546, AC005844,
					AL121923, AL031055, AL049642, AF152364, AC006312, AC006581, AC004491,
					AC004222, AC004033, AP000050, AC004381, Z93244, AC005399, AC005393,
					AC004985, U95740, AC006050, AC004921, AC007372, AC004967, AP000270,
					AC009721, AL096816, AC004782, AC005921, AC005837, AP000547, AL121825,
					and AL031735.
HRDDR39	787	867151	1-210	15-224	AA422067, AI822098, AI341461, and AI338541.
HRDDQ55	788	490884	1-598	15-612	AW410844, AW148821, AL121039, AI702049, AI890283, AW265468, AW162314,
					AA640305, AI567676, AA765899, AA507623, AW162332, AI064968, AI884404,
					AW275432, AI174703, AA601336, AW021674, AA280886, AA515727, AW151541,
					AI252005, AI254463, AW439224, AA831426, AA728954, AA313025, AI570067,
					AI250333, AI538404, AA524604, AW192930, AI090377, AA935827, AA558488,
					AL138262, AW328185, AI445699, AA568303, AW238137, AA804177, AI819419,
					AI791659, AI609992, AA551062, AA101744, AI174827, AI039257, AI572680,
					AA496369, AA593168, AW338633, M77964, AI754653, AW057760, AI890857,
					AW020612, H86399, AI857834, AW239465, AW152451, AI890297, AW338376,
					AA171400, AI560241, AI798521, AA218684, AI921744, AA568433, AI281622,
					AI224583, AA661583, AA493245, AA584360, AI500645, R23873, AA568311,
					H05066, AI754421, AI815770, AL044966, AA676592, AI683079, AI926728,
					AC007934, Z85986, AC004150, AC006359, AL122023, AC005900, AL121655,
					AC005696, AC006057, Z98200, AL121595, AD000092, AC005089, AL031311,
					AL021808, AP000556, AC007637, AF109907, Z73979, AL049869, Z83840, Z84474,
					AL031983, AL132712, AL080317, AC002404, AF196779, AP000555, AC004491,
					AC005409, AL031281, AP000280, AL031289, AJ011930, AL121653, AP000107,
					AC016025, AC004796, AC016026, AC004814, AC004099, AC008044, AF129756,
					AC007240, Z98749, AC004000, AC005618, AC002347, U80017, AC007845,
					AC006487, AC005899, AC005175, AC008009, AC005839, Z98044, AC005822,
					AC007055, AC002565, AC005971, AJ003147, AC004891, AL022323, AC004584,
					AC005488, AL024474, AC007565, AP001068, AP000250, AC005500, AL022318,
					AC002310, AL035089, AC010205, AL049694, AP000211, AP000133, AL049538,
					Z92542, AL096712, AC005071, AL080243, AC004019, AP000030, AP000512,
					AC006013, AC005924, AL031670, AF196971, AC005755, AP000691, AC004263,
					AC005519, AC005295, AL133163, AL096791, AL022165, AL020993, AC007227,
					AC005037, AC005666, AP000692, AC008125, AD000864, AB033024, AP000553,
					AC005726, AC004066, AF118808, AC005399, AL049839, AC005730, AC004084,
					AC006121, AP000309, AC004799, AL132992, AC002996, AL049646, AF111168,
					AL022336, AC006050, AF088219, AP000275, AL031257, AC007510, AL109628,
					AC002126, AC005291, AC005280, AP000037, AP000105, AC002036, AC004895,
					AC005003, AL031680, AL024498, AL050308, AC002477, AL034420, AC007688,
					AC005251, AC004685, AP000116, AP000326, AF165926, AL031587, AL022240,
					AC005031, AC000075, AC005722, Z98950, AC006454, AF002993, AC004673,
					AP000054, AP000169, AC006547, AC004821, AC003109, AC004890, AC004913,
					AL031255, AF191071, AC008115, AC002492, AL022326, AC007687, AP000048,
					AC004097, AC005412, Z98048, AC007536, AC005253, AL023879, AL049653,
					AL033539, Z98742, AL049776, AC005921, AL109952, AL035460, AF038458,
					AC004999, AC005881, AL049709, AL021154, AC005261, Z15025, AL078593,
					AP000248, AC005808, AC004593, AL022313, AL022315, AC005531, AL035450,
					AC004907, AC007298, AP000505, AC004033, AC006241, AC002306, AC005701,
					AC009178, U91326, AL049636, AC008134, AC005216, AC003982, AL035086,
					AC005365, AC005844, AC005535, AC004476, AF205588, AC005763, AL020997,
					AC008372, AC003043, AC007676, AC005244, AC005281, AP000036, AL021579,
					AC006160, AC005102, AC004771, AL022320, AL031427, AC006530, U52112,
					AP000039, Z97183, AC006978, AL121825, AL008582, AL050307, AL109753,
					AL034343, AC006369, AC002544, AC005664, AB023051, AF134726, and
					AC006277.
HRDCD44	789	715769	1-558	15-572	W03563.
HRDBH52	790	728715	1-559	15-573	W69216, R85388, AA677237, and AW295702.
HRDAB42	791	800333	1-415	15-429	AA372217, and N74721.
HOSOW01	792	914804	1-472	15-486	R12246, T97409, H20317, F10552, AA642698, AA463715, T03808, AA135561,
					AI912860, T16035, H17063, AL109623, AC010206, AC004787, AL031186, and
					AC007358.
HOSNO25	793	974291	1-601	15-615	AC005243.
HOSMP95	794	948496	1-591	15-605	R09369, N78208, N59653, AW295483, T85232, R09252, T89192, AI638845,
					AI824892, AF161355, AC004500, and AF197927.
HOSGN29	795	830653	1-420	15-434	AA463363, AA490561, AA452944, T66840, AI907242, AA774254, AA972623,
					AA459531, AA355833, N77376, Z20330, AA088535, AI561196, H90342,
					AA610050, AA883211, H90382, and AF155107.
HOSFV77	796	856933	1-645	15-659	AI302244, AI376858, AA744868, AI655166, AA206365, AI016092, AW117621,
					AL135188, AI473834, AA442880, AI218992, AW440891, AI619652, AI218976,
					N58875, AA005386, AA515059, R83118, T66299, R37419, AA227169, R66694,
					N54853, R67572, AW168764, AI862971, R83130, AA782861, R27978, T95799,
					AA731049, Z38308, AA813893, AA256649, R28234, R66224, and AL035411.
HOSFU59	797	739262	1-424	15-438	AA026237.
HOSFL57	798	734709	1-351	15-365	R21661.
HOSFL07	799	953183	1-677	15-691	H80558, AA011699, AA249550, N50173, AA720594, AA812006, N53417,
					AI985322, and AB032996.
HOSFK40	800	711140	1-566	15-580	AA056618, AW015136, AI640750, AI814601, AI215460, AI478294, and T98138.
HOSFI46	801	719021	1-297	15-311	N55220, AA488250, W92994, AA897297, D81949, AP000495, and AC002076.
HOSFC66	802	750560	1-671	15-685	W52745, AB023145, and AB028449.
HOSFB04	803	615200	1-412	15-426	R15372, H16359, and R19326.
HOSDR12	804	971169	1-447	15-461	Z99943, AC004000, L78810, AL117352, AC006387, AF155238, AP000556,
					AP000557, AC003006, AL031685, AL049759, AC004590, AC007371, AC004069,
					and AR038753.
HOSDQ78	805	858983	1-488	15-502	AC006474.
HOSDP27	806	682113	1-500	15-514	N26610.
HOSDG79	807	781787	1-913	15-927	W95020, R91323, H70373, and AI655142.
HOSDA04	808	951842	1-525	15-539	AA846729, AI028108, AA846827, AI609525, AA724378, AA843409, AW195335,
					AI949374, AI129292, AA706724, AI806599, AA700507, AI031774, AI478383,
					AW003724, AA056023, AA029907, AI206246, AW197629, AI082553, AI026964,
					AI023934, AI026963, AW235807, AI079146, AI056148, AA424153, AA854249,
					AA843263, AI022608, AA479110, AI802270, N90579, AA846140, AI168397,
					AI031992, W39235, AA846163, AI022871, AI335584, N52355, AA723602, N35347,
					W04599, W15275, AI026070, AA044387, AA452000, AA772698, AA724104,
					W45008, N52362, N94993, AI478133, R54828, AA772128, W32433, AA479261,
					AA411010, D79933, D79420, AI382712, AA056071, C00297, N75133, D62903, and
					AL110152.
HOSCV06	809	960555	1-346	15-360	AI610013, AI090186, AW173233, AI127920, AA058965, AA099683, AW082370,
					AA146976, AI873263, T94367, AA099684, AA136188, AA137215, AA279168, and
					AL133104.
HOSCT25	810	783692	1-449	15-463	T83223, AI074110, W47135, N27470, W24127, AA284235, Z19637, AA936569,
					and A74325.
HOSCP67	811	753874	1-505	15-519	AA181657, and AA190577.
HOSCO73	812	764756	1-305	15-319	T90400, and AC008063.
HOSBY89	813	787182	1-429	15-443	W03298, AW453073, R91771, AA248939, and AA281702.
HOSBX46	814	719414	1-352	15-366	AI435472, N52787, N48806, AL049781, AB002309, and U17195.
HOSBX34	815	706769	1-533	15-547	H10526, R20107, F05110, and AC008009.
HOSBR53	816	728525	1-613	15-627	H29345.
HOSBO34	817	706770	1-474	15-488	AA167280, AI269650, and AW404853.
HOSBM55	818	732550	1-528	15-542	N70015, N70098, W00901, R17917, W00930, R18009, AB014087, AC004188, and
					AP000516.
HOSAY52	819	728759	1-352	15-366	AA249054, AL118892, N45598, AA628647, AI016287, N57609, AL049781,
					AB002309, and U17195.
HOSAX03	820	960942	1-931	15-945	AA400703, AI684638, AW070184, AI090864, AW183803, AA400657, and
					AW293645.
HOSAL10	821	968710	1-299	15-313	AA075375.
HOSAI41	822	712708	1-1063	15-1077	AA203712, AI807483, AA203713, AI088364, AI131250, AA489726, AA489625,
					AA004409, AA705699, AA723797, AW293365, H95647, T98715, H82415, and
					AI022074.
HOSAH30	823	693406	1-479	15-493	H19428.
HOSAF19	824	672078	1-516	15-530	AA147082, and AA312956.
HOHEN28	825	686034	1-444	15-458	N33237, AI631133, AI917082, AI657012, AI624839, AA902453, AI655635,
					AI273682, AA729233, H27969, AA761232, N21684, AA417084, T06849,
					AW004990, AI280456, AI865276, AI638369, and D31765.
HOHEG71	826	760051	1-529	15-543	AA233884, and AA232830.
HOHDF94	827	793970	1-702	15-716	AA081832, and AB018257.
HOHCV57	828	734413	1-488	15-502	N76235, AB007936, and AL109755.
HOHCL29	829	634778	1-381	15-395	AI525843, AI541231, AI541114, AI541109, AI547179, H41687, AA984744,
					AI547043, AL044967, AI547164, AA094680, AA525444, AW014590, H18262,
					H50911, H45071, H41335, H42388, F33456, AI979115, AI547122, AA484568,
					AA285311, AA090063, AI498779, AA096319, AA426205, M27358, K01364,
					X00686, X56974, X82564, M10098, K03432, U13369, X03205, AF000381, K01593,
					M29839, X01117, V01270, M11188, X06778, J01876, X00640, X59733, X59734,
					K01373, X04025, AF115860, M97576, J00999, X02995, AJ279506, M91183,
					M15821, L11288, M91181, AJ270030, X98837, AB029314, X98838, X98841,
					X98839, X98843, X98842, X98846, M91180, X98840, X98844, M91182, AF169014,
					AB016657, X98836, AF030250, M97575, M97573, M59398, U76257, U11437,
					M59400, M91179, Z61867, M59402, M59401, AF021880, M59384, M59387,
					M59392, M59390, M59383, M59403, M59393, M59397, X98845, M36006, M59389,
					M59385, AB016658, M59386, M16759, S60585, AB016659, M59395, M59391,
					D38360, D38357, D38341, D38358, D38354, D38363, D38362, M59396, M59388,
					D38359, M59399, and M59394.
HOHCH52	830	588375	1-555	15-569	R63803.
HOHCG79	831	859029	1-453	15-467	AI025117.
HOHCD58	832	973105	1-442	15-456
HOHBZ27	833	588364	1-453	15-467	T26461, R12434, and AI909064.
HOHBY26	834	588358	1-464	15-478	AA190664.
HOHBV67	835	718562	1-527	15-541	AA464946, AA045533, AA058869, Z43315, F07427, R34556, D20922, and R17869.
HOHBS10	836	964324	1-396	15-410	AW072006, AA992322, AW183466, AI590479, AI610065, AA524829, H53828,
					AA828610, AA476397, AA572713, AA431949, AW440299, R49657, AI436608,
					AI114557, AA480574, AA847702, AA482953, Z84469, AC005899, AC005822,
					AC006079, AC008125, Z93016, AC002544, AC004408, AC005411, AJ011930,
					AC005996, AC007773, Z98257, AC002553, AC006211, AL035086, AC006088,
					AC005332, AC004263, AC009225, AC004841, D87675, AL133243, AC004884,
					AC004460, AC020663, K03176, K03178, Z99716, AP000961, AC005747,
					AC006080, AC004659, AC006978, Z84480, AC002316, U96629, AC006959,
					AC005186, AC006318, AC007050, AF165176, AL022326, Z68164, AF008191,
					AF017104, AC004230, AJ003147, AC002091, AC011504, and AL022329.
HOHBP36	837	708158	1-468	15-482	N53160, H56717, N58596, H56640, W27084, AA516214, F19606, AA515728,
					AA558487, AA278482, AI823533, AI823535, AW057873, AW151288, AI356264,
					Z54073, AF001548, AF205588, AC004263, AC004982, AC006948, AC005081,
					AC005476, AC002390, AL049843, AL009181, Z82215, AC007312, AL049757,
					AF129756, AC003010, AC009225, AC006312, AP000555, AC004601, AL021878,
					AC005684, AL035411, Z98949, Z93020, AL049709, AF134726, AC004985, Z84476,
					AC003101, AC004820, AL109627, Z85987, Z93241, AC009405, AL049613,
					AC005036, AL109753, AP000091, Z95115, AF196779, and AL008721.
HOHBN56	838	859041	1-897	15-911	AA489227, AA490533, AA504306, and AA490534.
HOHBL35	839	973238	1-462	15-476
HOHBI84	840	782908	1-363	15-377	H46912, AA287471, AA399188, AW007707, AL036600, AA025639, and
					AA405089.
HOHBB90	841	588308	1-448	15-462	R76965, AI077565, AA452929, AI393755, and AL035455.
HOHAV60	842	489007	1-827	15-841	N20939, AI337242, H68935, AI224489, F27732, F37358, and AC007279.
HOHAT59	843	867949	1-454	15-468	AI124699.
HOHAT11	844	966727	1-622	15-636	U83208.
HOHAQ65	845	859057	1-501	15-515	R06584, R06638, AA086435, AW408596, AA111870, C14480, AA279649,
					AI680547, AA608570, AL135363, AA595661, AA158018, AA554257, AA205436,
					AW162227, AA470512, AA599423, AA315361, AA722336, AW082098, AA470559,
					AA569053, H64278, F33037, AA348399, AI298079, AA378489, AI271762, R81167,
					R89129, AW069537, AI440037, AA368659, AC005042, AC005207, AC002425,
					Y08864, AC005531, Z49236, AP000099, AC005598, AL109865, S42653, AC007182,
					AL034420, AC007637, AL022720, AP000036, AC007738, AP000553, AC004820,
					AC004531, AC008273, AF069074, U91326, U68041, AC003684, AL049712,
					AL021453, AC007563, AC005746, AC008015, AL031228, Z49862, AL031681,
					AF181897, Y10196, AC007050, AL023494, AL031311, AL049776, AC004900,
					AL031291, AC002492, AL096791, AP000133, AP000211, AC006211, AC002477,
					L78833, AL022329, AF030453, AC007011, AC003108, AC002094, AC002301,
					AL034429, AL035422, AL049636, AC005082, AC005324, AF099810, AC005412,
					AL121578, AB026898, AF001550, AC002132, AC004472, AC002996, AL049538,
					AC004223, AL035413, AL033521, AC005180, AL121658, AL050318, AP000354,
					AC006312, AP000086, AC005484, AL080243, AL132712, AC004526, AL049569,
					Z49235, AL021155, AP000117, AC002456, X84664, AF196779, AC002375,
					AL096818, AC003966, AC005305, AP000349, AL021546, AC004927, AC005911,
					AC005102, Z93023, AL034423, AC006062, AP000353, AC005048, AC004655,
					AC002347, AC002563, AC006011, AC005486, AC004551, AC003685, AP000555,
					AP000689, AC004750, AC006023, AC004890, AC002429, U95740, AC006057,
					AC004883, AP000047, AC002385, AC005300, AC007388, AC003109, AL035071,
					AC006377, AC008372, AP000049, AC004893, AC006017, AC009516, AL096815,
					AC006538, AP000497, AP000311, Z98036, AL022316, AC010206, AC006071,
					AL030996, AP000223, AC005399, AC004787, AF109907, AC006328, AC004805,
					AC006430, AL096712, AC004881, AF053356, U95742, AL031666, AC005821,
					AC005736, AC007250, AC009399, AF172277, AC005220, AC005914, and U91323.
HOHAM66	846	859058	1-545	15-559	H02088, R30796, AI904000, and AW175694.
HOHAI11	847	947140	1-4073	15-4087	AA424371, AA417690, N72255, AA417582, W02998, AI378916, AA424511, and
					AF086109.
HOHAE76	848	494001	1-453	15-467	T59559, and T59513.
HOEOA28	849	859156	1-786	15-800	AI276895, AW026397, AA053296, AA054752, AA789119, AI745474, AA744964,
					AW087227, AW379213, and AC002519.
HOENH06	850	934095	1-844	15-858	AW007160, AA393649, AI022457, AI139147, AW386744, R40518, H14594,
					Z40081, F01575, R48161, F10287, N93352, AA468505, AA614254, AA228368,
					AA468371, AA230025, AA467760, AA224889, AA228269, AA298789, AA838161,
					AA599710, T47138, AI355385, AA381754, AI418967, AA224815, AI270370,
					AA197218, H63066, AW057873, AA259267, AA558404, AA130647, F00533,
					AI192440, AA836552, AA302971, T49633, AI290405, AA668915, N63149,
					AA668896, AL050306, AC003030, AC006965, AC004491, Z85986, AC007283,
					AL096703, AC004765, AL078581, AL050318, AC005280, AL022311, AC002477,
					AL109628, Z84480, U91318, AC007055, AC004815, AC002472, AC006124,
					AC006071, AC005829, AC005682, AC006079, AC002997, AC004216, AC005932,
					AC007546, AC007664, AC007536, U63721, Z73963, AF047825, AF196969,
					AC005764, AC007566, AC004560, AC005632, AC004222, AC004638, AP000696,
					AL049780, AL049538, AC007226, AC002369, AL032821, AP000112, AP000044,
					AL050348, AL049569, AP000695, AC006006, AC006449, AC006208, AL035398,
					AL035405, AC007917, AL022324, AC006255, AP000501, AC004590, AP000245,
					AP000497, U89337, AC007052, AC005225, AC000052, AC004019, AL035410,
					Z99716, AC004030, AC007541, AC000353, AP000557, AL035422, Z68226, L44140,
					AC005952, AC007066, U82668, AC005899, AL035587, AC005324, AC007537,
					AC005015, U91326, AC007371, AC004655, AC002310, AC003983, AL020997,
					AL035659, AC006480, AC005081, Z93023, AC005529, AC005182, AC006277,
					AL049869, AC006211, AC005291, AP000512, AC007860, Z97054, AL049694,
					AP000115, AB023050, AP000034, AC016025, AC004477, U96629, AC005102,
					AL031577, AL034429, AC004129, AL034548, AP000502, AC005881, AC005231,
					AC012331, Z98745, AC005387, Z98946, AL021878, AC005338, AL022320,
					AL049830, U78027, AC006344, AL035086, AB026898, AC006285, AC005519,
					AL031282, AC005369, Z99128, AC003041, AC005071, AC003010, U95740,
					AC002425, AC006115, AC002303, AC003982, AL022163, U91319, AL008582,
					AB003151, AC005678, AC005058, U82828, AC007216, M13792, AL049576,
					AB022785, AC005694, AC007687, AL022326, AL033397, AC004217, AL031680,
					AP000244, AC006530, AL008719, AF001550, AP000065, Z93017, AL133245,
					U91321, AC005183, AL035555, AC003029, AL031985, AL035249, AP000326,
					AC004686, AC002544, AP000212, AC007738, AC002107, AC005209, AC004526,
					AP000122, AP000054, AP000169, AL049776, AL031311, AC006450, AC005365,
					AC005014, AC005488, and AC004024.
HOELI08	851	958181	1-669	15-683	AI862922, AI983798, AI817696, AA465702, AI768039, AI831870, and AA459562.
HOEEX37	852	708728	1-703	15-717	H44964, AI570044, AI078541, AI570062, AA733022, H45674, AI084055, W94003,
					N28018, and AC007285.
HOEEU57	853	932562	1-818	15-832	AW387014, AI831578, AW387023, AW386986, AA862453, AI276148, AI923983,
					AI925229, AI344497, AI299183, AI343937, AI086925, AW374923, R21305,
					R18269, AA333257, AI991662, AI093616, W02289, R87814, H08423, AA528079,
					Z45607, AA455633, W49743, R58057, AI124525, AA767913, Z42086, and R56671.
HOEER75	854	767265	1-800	15-814	AI989799, AW299570, AI978646, AI638110, AW290948, N67990, AI962847,
					AW167412, AA706538, N80412, AA961236, AI557808, AI525653, AI557238,
					AI525669, AI541321, AI541048, AI557258, AI557602, AI541205, AI541353,
					AI557809, AI535813, AI546829, AI557222, AI535994, AI557543, AI525840,
					AI541346, AI525656, and AL133617.
HOECJ59	855	739426	1-640	15-654	AI016603, AA884245, AI806142, AI199574, W07522, AI492605, AI767868,
					AW014287, AI143416, AA126482, AW072550, AI377899, AW002034, AI223352,
					AW418843, AI033261, AI018587, AI760070, AA908231, N80857, AI660406,
					AW449281, AI479045, AW303620, AW184004, AW195771, AA250993, AI332874,
					AC003959, and AF086145.
HOECF70	856	573426	1-193	15-207	AA602457.
HOEBT89	857	921065	1-352	15-366	R66475, AI692694, AI677948, N32840, AI187227, T19392, AI499800, H51056,
					AA169602, AI208443, AW134907, R67315, and AI209123.
HOACG06	858	954572	1-485	15-499	AW152166, AA011199, H18839, AI718722, and AA010802.
HOABY40	859	711510	1-540	15-554	N62212.
HOABX26	860	753954	1-562	15-576	AA065209, AA077377, T32948, AI571240, T08560, R90825, AI033147, AI277382,
					AI453118, R88021, AA663789, H14060, R87895, AA077707, and AC005071.
HOABX21	861	531390	1-75	15-89
HOABW12	862	968797	1-387	15-401	AI075814.
HOABG91	863	811156	1-221	15-235	AB011540, and AB011533.
HOABF65	864	888203	1-284	15-298
HOABD07	865	954060	1-358	15-372	AI269153.
HOABA95	866	796063	1-405	15-419	R31045.
HOAAX37	867	708718	1-330	15-344	T97580, and AF143887.
HOAAW11	868	967660	1-489	15-503	AA525910, and AC004049.
HOAAW02	869	920869	1-393	15-407	AA284348.
HOAAV77	870	772512	1-398	15-412	H84034, and N44965.
HOAA086	871	859626	1-431	15-445	AA662926, AW204080, AA700032, AA514295, N52358, AA621278, AI126468,
					AA653154, AI986182, AI174766, AA933084, AA829039, AA547947, AL135357,
					T52475, AW303008, AA601356, AA565484, AI366993, AI002744, AA630672,
					AI635819, AA570230, AI630176, AL042756, AW068596, AI920802, N41888,
					F08230, AW263724, AA507612, AI611960, H93097, T90263, AW002350,
					AI583255, AI890324, H73230, AA629872, AI628929, AA443390, AC005914,
					AC002301, AC002395, AC005488, AL109865, AC004801, AC007051, AL034420,
					AL031846, AC002554, AC007298, AC006057, AC007201, AC008055, AC005668,
					AL035089, AC005043, AL049569, AC009247, AC004491, AL133246, AL022319,
					AL009181, AC004216, AF205588, AC003104, AC005482, AP000694, AC007225,
					AL023284, U91323, AC005280, AL031905, AC004859, AC007919, AC005839,
					AC005678, AC004821, AC006313, AC005632, AC000353, AL080243, AC002303,
					AC006211, AF111169, AC002449, AC005225, AC005261, AL049869, AC005694,
					AF181897, AC004659, AC007242, AC005046, AL035685, AC007510, AC005484,
					AL049764, AL139054, U91326, AC006039, AC006026, AL035448, AC006040,
					AF107885, AL121653, AC005874, AF134471, AC007666, AJ246003, AC007358,
					AC004685, Z86061, AC002365, AC004525, AL021707, AC004913, AP000088,
					AC004813, AC007204, AC004955, AL033397, AC006088, AC006312, AL020993,
					AC004887, AC005829, AC007676, AC007559, Z84487, AC006538, AC005378,
					AL133243, AC005015, AP000134, AP000212, AL121658, AC004814, AC005531,
					AC002115, AC005332, AC003962, U91321, AL031055, AL031985, AL096701,
					AC004851, AF196779, AC007546, Z97054, AC006064, AC004953, AL133448,
					AC006501, AC003957, AC020663, AC006115, AP000031, AC004797, AL035361,
					AL008718, AC004595, AL078477, Z98946, AP000152, AC004638, AL035405,
					AC006013, AC004968, AL031255, Z85986, AC005102, AC005152, AC000052,
					AC005386, AL008629, AL023807, AP001052, AC004019, AC010206, AP000039,
					AP000280, AC007011, AL080241, AC005081, Z99916, AC007845, D87675,
					Z85987, AC005088, AC005988, AC002091, Z97055, AC005291, AC005529,
					AC002544, AL031279, AC006480, AL021391, AL021154, U95742, AC004070,
					AF130343, AC007055, AP000107, AC002563, AC006277, AC007245, AL022574,
					AL133355, Z97987, AC009223, AL022238, AC004655, U89337, AL117351,
					AC005690, AL109798, AC006120, AC022517, AC002994, AP000348, AC005740,
					AL135745, AC007216, AL133396, AL031311, AC006449, AL049843, AC006042,
					AL136295, AC004230, Y14768, AC004383, AC007688, AC016025, AL031295,
					AC005913, AL096791, AP000555, AC004967, AC007690, AC016831, AC005701,
					AL096775, AC007057, AC000025, AC004773, Y10196, AC006946, AL031668,
					AL023553, AC006001, AC004593, AC005399, AC005777, AC006285, AC003029,
					AC007684, AC007227, AL117344, AC003688, AC005585, AC018633, AL049766,
					AC005250, AC007193, and AC005175.
HOAAM6 7	872	751947	1-292	15-306	H50680, and AA779243.
HOAAK71	873	761445	1-407	15-421	T95206, Z83821, AL020991, and AF068624.
HOAAK11	874	859624	1-430	15-444
HOAA158	875	859643	1-679	15-693	AW303494, AI039909, AA448710, D31172, D31271, AW195840, D31138, D31112,
					AA133322, H89975, and AB032978.
HOAAH77	876	772514	1-458	15-472	W72892, AA909448, W76097, AA999702, AI051236, and AI419691.
HOAAH41	877	712601	1-468	15-482	H71845, AA703576, and AA203612.
HMUBZ11	878	966856	1-497	15-511	D31554, and H69385.
HMUBY48	879	721586	1-141	15-155	AI250353, AL037582, AL037602, AA782332, AI125109, AI039104, AW263805,
					AI475339, AA830709, AI590043, AI370623, AI500061, AL046466, AI569440,
					AI648699, AI613038, AI612913, AW103928, AI698391, AI887163, AI610714,
					AI299903, AI581088, AW130362, AI537187, AI345010, AW118448, AW166870,
					AW022000, AI636588, AW411225, AW128834, AA720924, AI241741, AI580027,
					AI802542, AI332957, AI524654, AA831128, AI950887, AI912434, AI678681,
					AW050850, AA102339, AA748729, AW073858, AW167926, AI963846, AI758445,
					AW022856, AI184903, AI950892, AI245008, T49776, AI499057, AI923989,
					AI469262, AA824435, AI832038, AI635851, AI538867, AA130341, AI359744,
					AI653829, AI537273, N25033, AW129456, AW103628, AL041587, AI540831,
					AI818562, AI270183, AI697045, AL040161, AI141400, AW027898, AI581362,
					AI612747, AI798456, AI288285, AI282669, AI472650, AI141406, AI828239,
					AW167083, AI638644, AW262552, AI521594, AI554402, AW263709, AL045610,
					AW020425, AI283385, AL119399, AI635016, AI419826, AI638798, AI434109,
					AL046944, AW087199, AI699823, AI473536, N66391, AI682968, AL042193,
					AA814343, AI586931, AI934011, AI250282, AI925164, AW081902, AI241923,
					AI401697, AI590755, AI567513, AI863002, H89138, AW020358, AI884318,
					AI919500, AW188525, F37323, AL040844, AI457589, AI498582, AI634223,
					AW020381, AI452560, AA665612, AW051088, AI956080, AI963191, AI445620,
					AI869765, AW129659, AW169626, AW162194, AI364167, AI623835, AI619820,
					AA872047, AI434731, AI583578, AI421252, AW055252, AI567769, AA761557,
					AI828676, AI446511, AA555145, AW264009, AI075885, AI889189, AI538885,
					AA128641, AA810677, AI114703, AA641577, AI824576, AI688854, AA641818,
					AI633125, AL080011, AI889916, AI784214, AI538564, AI251221, AI915291,
					AW152182, AI819545, AW270013, AI683606, AW104141, AI828806, AA744531,
					AI886355, AI648494, AI701097, AI225000, AI687568, AI282688, AW059818,
					AI499570, AI630932, AI491842, AI627339, AI610446, AI909641, AI624279,
					AI475815, AI445611, AI673363, AW087538, AI818980, AI582529, AI249389,
					AW079075, AI690813, AI962900, AI697359, AI927233, AI539690, AW190297,
					T69241, AI621341, AI147877, AI254731, AW087217, AI580436, AI138221,
					AL134840, AI888480, AA552445, AI696714, AI824746, AI739583, AW131024,
					AW080140, AW129106, AI866090, AI371872, AI345415, AI435253, AI499890,
					AI440284, AI374987, AI608882, AI635634, AI522256, AI093315, AI049733,
					AW080746, AI473652, AI874261, AW089233, AI633434, AW117675, AL117587,
					AC004594, AL110218, A03736, AL136884, A86558, AF102578, I89947, AF076633,
					AL133665, S36676, I09499, AL137550, U00686, AF040751, AL137554, AF008439,
					Z97214, AL035458, I48978, X99971, AL133608, Z94277, Z93784, AF026816,
					AF013214, AP000130, AP000208, AF185614, AF124728, AL137284, AP000247,
					AL133062, AL133619, U83980, AF150103, AF161418, X66871, S59519, AC005091,
					AJ010277, AL049426, AL137292, X96540, AL137529, AF090900, AL133560,
					AR050959, AF100931, AF061795, AF151685, AF044323, AJ005690, AL137479,
					AL110280, AL133637, AF111851, AF106697, U37359, AC006288, A26498,
					AR013797, X82434, AL080146, X61399, AF069506, AF047716, U72621, X66366,
					J05277, AL137270, E12747, X97332, X66862, I80062, AL133088, E07108,
					AL137533, AR034821, A60092, A60094, AF031572, AR038854, AR022283,
					AL137657, AL049324, AL137711, AC009233, AL022147, AL050393, U02475,
					AL049423, AF007142, AF200464, I17544, AL122100, U62807, AF004162, U78525,
					AF106657, U42766, AL137521, AC006112, Y16645, AL137298, AF184965,
					AL133565, AF116573, AF061573, A08912, I34395, I18358, AP000458, A08911,
					I48979, M19658, AB016226, X79812, A77033, A77035, I33392, AL133640, Z72491,
					U53505, AL110228, A08913, AL080118, X61970, AL049447, X98066, AF067790,
					L19437, A65341, Z13966, M85164, AL122098, S76508, S83440, S68736, AL137476,
					AL137254, AL122104, AL117416, AF079763, AF126488, X69026, A21625, I32738,
					U35846, AC009501, AL133558, AF106827, U49434, AF061981, AF019298,
					AJ012755, U75604, AC018767, Z98036, A92311, AF082526, AL035587, AL137557,
					S77771, AB031064, AF090886, A08910, Y09972, U62966, U80742, AL117394,
					AL133113, AI2297, AL080129, AL137548, AF032666, AF055917, M80340,
					U49908, A08907, AC004200, AF130342, A08909, A70386, AF215669, AL080159,
					X83544, AL110296, AF031147, AF111849, AL137658, AF002672, AL050092,
					AL133049, X72889, AC004383, A08908, X06146, AC010202, E12579, E12580, and
					AL133084.
HMUBY20	880	669581	1-425	15-439
HMUBV40	881	837969	1-420	15-434
HMUBR94	882	793261	1-438	15-452	AL135377, AA828637, AA084766, AI446336, AA773463, AA984114, AL036037,
					R20544, AC000025, AC005527, AC005529, AC007227, AL035086, AL035400,
					AC004859, AC002347, AL008719, AC004531, AL078581, AC006312, AC002563,
					AC000353, AC004953, AC006111, AP000512, Z95115, AL024498, AC005821,
					AL023575, AL022238, AC004821, AC006011, AJ246003, AL049589, AC006261,
					AC004644, AC003030, AC006430, AC005520, AC004858, AL109802, AP001054,
					AL033527, Z98200, AC005102, AL109758, AL034420, AL020997, AC002375,
					AC007191, U47924, AC016027, AC005089, Z93930, Z98742, AC003007,
					AC006050, AF196779, AC004815, AC006509, AL049830, AC016830, AL133246,
					AC005209, AC002287, AC006480, AC006117, AC005837, AF129756, AL022316,
					AL049869, AL049776, AL035587, AC007052, AC007773, Z83840, AC002119,
					AP000113, AP000045, AL022322, AC007842, AC004491, AC004983, Z84466,
					AL024508, AL009181, AL031295, AC004967, Z84480, AC006014, AC005180,
					AC007298, AC006004, AC005632, AC004996, AL049697, AL049713, and
					AC005881.
HMUBR78	883	955060	1-526	15-540	AA019047, AI343422, and Z92845.
HMUBQ01	884	918052	1-377	15-391
HMUBP74	885	765502	1-539	15-553	AI432103, N66775, AA555232, AA410788, AA491361, AA228778, AI798449,
					AA084504, W45274, AI753904, AA324059, AA326603, T93109, AF196779,
					Z93017, AP000350, Z95116, AF196972, AC004832, AL023575, AL049776,
					AF024533, AL031311, AL139054, AC003043, AC005089, AC005015, AC005399,
					AC003029, AL121603, AL034417, AC007934, AC005971, AC005736, AL132777,
					AP111167, AC007308, AC006057, AP000008, AC000134, AC000052, AL109801,
					AC002316, AC000159, Z85986, AC007227, AC005088, AC005722, AC004019,
					AC004890, AC002369, AC008394, AP000704, AC007151, AL049780, U91321,
					AC005696, AC006064, Z93930, Z82180, Z85987, AC007666, AC006285,
					AC007878, AP000512, U85195, AC006205, AC003010, AE000658, AC005193,
					AL031295, AC008072, AC004967, AL022316, AC004030, AF196969, AC006088,
					AC003684, AC007055, AL031848, Z95331, AC004999, AC006011, AC007051,
					AC004821, AL035079, and AC005086.
HMUBP38	886	716800	1-274	15-288	D62503, W31481, W31478, AI031797, AW194041, AW050479, AA737576,
					AA693819, AA825328, AA860686, AA843163, AA782544, AI026970, AA450017,
					AA772466, AW152339, AI263677, AI804555, AA347503, AI824356, AI191171,
					AA993329, AI470261, AI886205, AA632359, AA863458, AI289935, AW132079,
					AI678407, AI800349, AI623948, AA450366, AA044819, AW188740, AA878533,
					AI364418, AI874104, AI933937, AA358323, AW131974, AA894788, AW103212,
					N76132, AA897025, AI915173, AI933628, AI913873, AA860713, N30064,
					AI579994, AI299561, AA025007, AA781624, R36254, AA934658, AW088795.
					AW080423, T97261, AI690491, AA614454, AI095864, AW024736, AI016555,
					AI569566, AI298435, R92692, AI266450, AI689224, AI015682, AI889552,
					AW014696, AW189459, AA005320, AI424177, AI041476, AI801066, AW168035,
					W32273, AW152395, AI276661, AI028138, AA954648, AW166786, AA099737,
					AI344521, AI874055, AW193867, AI355584, AI734946, AA860530, AI874021,
					N70641, AI185811, N30060, R00232, AI138761, AI276660, AI362305, AI332470,
					AA024894, N22767, AW139075, AW129011, T57193, N30057, N91781, N71091,
					AI092410, AI288216, AI244973, T57088, AW139081, AI160023, AA490670,
					AI560718, AI887980, AW080420, AW419084, AI126270, AI859726, AI457657,
					AI274779, AI962882, AI564514, AI589042, AI689396, AA993572, N94949,
					AI979109, AA411838, AA602523, AA827550, AW150847, AA772171, AA917826,
					AI859443, AI524525, AW169111, W72460, AA056733, AI126748, AA133968,
					N90530, AI475928, AI344395, R82315, AW303738, AA983225, AA628813,
					AI564394, H13839, AA771989, AI951442, AA024806, AW021070, H22324,
					AI680522, R34368, AA418061, AW129473, AW151046, T48350, AA846743,
					N71006, AA001714, AA027095, T65946, AI921252, AI933525, AI691098,
					AI364257, AA011167, AI357333, T85101, AA772584, AW194109, AW022540,
					AW090282, and AI318244.
HMUBN15	887	659543	1-452	15-466	AA772883.
HMUBN05	888	932057	1-455	15-469	AF090896.
HMUBM89	889	786082	1-444	15-458	AW302705, AW302659, AI792521, AI792499, AL079734, AI801141, AA468505,
					AI635440, AL042667, AL042670, T74524, AW192179, AI962030, AL135357,
					AI053793, AI267269, AI267356, AA603567, AI049709, AA601336, AI267450,
					AI053688, AA772906, H07953, H82636, AA809546, T41134, AA669238,
					AA491767, AI733856, AW023111, AI016560, AA659832, AI982884, AI923050,
					H38769, AI590442, AI754291, Z98044, Z97630, Z84469, AC004764, AL049776,
					AL035422, AC002470, AC004813, AC009247, AL139054, AC007308, AP000694,
					AL079304, AF129756, AC005218, AC005874, AF134471, AL133245, AC004382,
					AL031228, Y10196, AC006511, AF196779, AL049872, AB004907, Z82176,
					AC008055, AF053356, AC006530, Z86090, AC005081, AL121655, AC002425,
					AC003962, AC004655, AC005776, AC006509, AP000354, AC005678, U61375,
					AC006130, AC005520, U07562, AC006050, AP000501, AL031311, U85195,
					AL023803, AF165926, U91323, AL049697, AE000658, AL009181, AC005323,
					AC009516, Z98745, AC005071, AC010200, AC002310, AL096761, AF039907,
					AL135959, AL031276, AL133485, AL021707, AL109798, AC004887, AC007227,
					AC005015, AL133244, AC006312, AC005924, AC005180, AC006544, AF031078,
					AC002430, AL022320, AL050306, AF030876, AC002432, AL109758, AC005701,
					AL132987, AJ003147, AC007384, AC002351, AP000128, AP000206, AP000150,
					AC005531, AL031575, AC000134, AL050332, AL034553, AC003983, AC007688,
					AC004765, AL049538, AC004985, L48038, AC007030, AL021808, AC005913,
					U78027, AC007686, AC007738, AP000009, AC005412, AL021978, AC004967,
					AL049692, AC007899, AL035071, AC006474, AC005829, AL008718, AC004150,
					AP000245, Z84466, AC002350, AC005821, D87675, AL031589, AC002395,
					AC005600, AL022316, AL035089, AC005781, AL020997, AC006071, AC007676,
					AC005803, AC004526, AC002455, AC004638, AC002352, AC005233, AC004895,
					AL022326, AC004231, AP000094, AL136295, AC005914, AF111168, AL031595,
					AC004552, AL049834, AL049653, AL031729, U80017, AL021579, AF123462,
					AC005037, Z83840, AC005632, AL080317, AC003101, AC004386, AC004000,
					AP000555, AC005730, AL050321, AL121825, AC006023, AC003108, AC006441,
					AL020995, AL008715, Z85987, AC007216, AC005625, D49558, AL035455,
					AC004694, AC007536, AC004131, AC007041, AC006450, Z83838, AC000026,
					AC004671, AC006057, AC006581, AC003687, AC016025, AF024534, AC005899,
					AC004945, AC003112, AL008630, AC004999, AC005500, AC004520, AF045555,
					AC006160, AB023050, AC004099, AC004659, AC004855, AC005138, AP000143,
					AC005837, AC007225, AC005004, AL022336, Z98949, AC006313, AL078462,
					AC000159, AL021939, AL022322, AC006241, AL080243, L47234, AC004922,
					AC005288, AP000090, AC004492, AC002059, AC006120, AL121754, AL031650,
					AC005994, AL133371, AL021940, AC004884, AC005846, AC005084, AC002476,
					Z98048, L78810, AC006449, AC003036, AC005684, AC001228, and U47924.
HMUBM85	890	784295	1-492	15-506	AW162314, AW021674, AW265468, N95424, AW438757, AW162332, AI431442,
					AI755227, AW410844, AW022796, AW327673, AI609992, AI475297, AA112864,
					AW148821, AL039471, N99245, AW403177, AA568311, AI114494, AA568303,
					AA631915, AI797998, AA659923, AA618531, AI065031, AA554289, AI076729,
					AW157128, AW410561, AA507623, AI270280, H96966, AA280886, AI038029,
					AI144125, AA064983, AA557945, AI567676, AW162762, N72509, AI538404,
					AA669238, AA568433, AI609107, AI419390, AI568260, AL044701, AI421783,
					AA847341, AA550837, AW020682, AW277240, AA182577, AW409621, AI819419,
					AA640305, AI064968, AA074086, AW301712, AW272513, AI859368, AI828721,
					AA489390, AI224583, AA657392, AI572680, AW246579, AL121039, AW439224,
					AI702049, AW273201, AW273146, AA101265, AI813920, R99253, AI061313,
					AI613459, AI281622, AA658890, AL079734, AA225754, AA632355, AI745666,
					AI862213, N58334, AI744963, AW238699, AW069769, AA225392, AW274180,
					AA935827, AA535558, AA533660, AA158023, AI027602, AI590404, AA829693,
					AA569220, T03928, AI049845, AI569401, AI185856, AI307563, AI174703,
					AI573009, AI300356, AA157876, AL044966, AW239465, AA772818, AA593168,
					AI275631, AA610644, AI884404, AI703335, AI423034, AI419419, AL120616,
					AI049999, AI608751, AA525156, AW008217, AI251024, AA572982, AI283329,
					AI708175, D88268, AF205588, AC005921, AL135744, AL121658, AC007066,
					D87008, Z99943, AC005519, Z86061, AC005057, AL049833, AC005839,
					AL117337, AC007371, AL109809, AL096701, Z84466, AC005913, U62293,
					AP000152, AC007216, Z93023, D87012, Z83844, AL031311, Z97053, AC005081,
					AL050321, AC007934, AC004913, Z84480, AC002350, AP000011, AC003688,
					AC007151, AP000211, AP000133, AC007308, AL034429, AL109623, AC007546,
					AE000659, AL008582, AL022238, AC004231, U91326, AC007676, AF109907,
					Z84469, AC005288, AL022162, AP000703, AE000661, AL035422, U85195,
					AB023050, AF196779, AE000658, AC005084, AC005696, AC007052, AC005920,
					AL022165, Z98946, AC005500, AC004673, AC007298, U89335, AC002115,
					AC004383, AC004841, AL049843, AL049759, AF124731, AC005969, AF118808,
					AC002563, AC005291, AL031733, AL080243, Z84487, AC007899, AC000025,
					AP000044, AP000112, AC005529, AC004890, AL133163, AC005527, Z93241,
					AJ006345, AL132777, AC007686, AC005484, AC002055, AC007240, U95742,
					AC016026, AC003110, AC002369, AL133245, AC004967, AL031985, AF047825,
					AC007845, AC007055, AL049830, AL133312, AC003051, AC007637, AC004929,
					AC004645, AL049872, AC006449, AC003043, AC015853, AC004106, Z98200,
					AC006121, AC002544, AL118497, AC008134, AC006004, AC005594, AL022315,
					Z98742, AC000111, AC005011, AL078621, Z82190, AC002425, AL139054,
					AF023268, AF134726, AC006441, AC009501, AL031589, AL049569, AF207550,
					AL031670, AL035398, AC005261, AC009247, AC004797, AC005808, AF055066,
					AC006317, AL022333, AC005488, AC006166, AC006006, AC005102, AP000555,
					AC012627, AL109963, AL020997, AC005822, AC007666, AC008928, AC004139,
					AL121652, U78027, AC004974, AC004765, AC004686, AC005666, AC005736,
					AC004820, AC004491, AL109758, AF124523, Z84474, Z97056, AC005778,
					AC005277, AC000003, AC004506, AC002470, AP001052, AC005399, AC004019,
					AC006600, AL078639, AC003982, AF001550, AC005971, AC006111, AC007226,
					AL078584, U85199, AL049576, AL034561, AC006211, AC006511, AC004668,
					AC002133, Z84476, AC005914, AL023803, AC016025, AP000511, AC004887,
					AL031282, AL049697, AC004966, AC005516, AC008072, AC005730, AC001226,
					AL031055, AC005911, AC004531, AC006101, AC006026, AP000556, D84394,
					AL031281, Z99570, AL023876, AC005899, Z98950, AC003695, AC005037,
					AL034421, AC004870, AL121754, AP000065, AC006509, AL021940, AL096791,
					AC005632, AC005537, AC007376, AC002301, AC004859, AL034451, Z93017,
					AP001053, AL080317, AC002553, AC005274, M63796, AL049539, AC000353,
					AP000344, and AC004659.
HMUBM23	891	675296	1-361	15-375	R51236, R45099, Z40109, and AF107403.
HMUBM21	892	861218	1-513	15-527
HMUBM01	893	916291	1-541	15-555	AF039239, AA156352, AI928298, and AC004596.
HMUBL79	894	774904	1-279	15-293
HMUBL25	895	678011	1-735	15-749	T83448, and AC004051.
HMUBI26	896	424764	1-534	15-548	R11938, and R17505.
HMUBH84	897	782971	1-467	15-481	AI300542, W91888, N63093, AL117338, AL049569, AL031687, AL035209,
					AP000697, AC004099, AL035415, AL008718, AC005089, and AC002563.
HMUBC76	898	769968	1-466	15-480	H53236.
HMUBA75	899	767192	1-363	15-377	AC007250.
HMUBA61	900	741710	1-429	15-443	AP000365, and AP000547.
HMUAT71	901	772958	1-350	15-364	AA160854, R71813, R71760, R48639, N42220, AW247533, R50575, AW170393,
					AA083908, AA313213, AA455790, AI372424, AI700503, H30234, AI807620,
					AI149104, R85186, H74174, AA371702, H67210, R90881, AI148673, R70330,
					AA380748, W86716, AI421626, R80075, R35880, H30476, W31820, AA099322,
					AI014871, AA323925, H04088, AI951537, AI498026, AW027328, R70448,
					AC006165, AB023051, AP000512, AF085357, AF089750, AF145044, U90435,
					U60976, and U60977.
HMUAE85	902	783543	1-313	15-327	AA027138, AI752271, AI880296, AI752272, and D80011.
HFOZC29	903	923288	1-555	15-569	AI095431, AI571923, AW261883, AI200605, AA482065, AI200699, AI017296,
					AI923202, AW015684, AA767648, AA883935, AA677666, AI573221, AI033576,
					AI126442, AI369853, AI249160, AI142443, AW264134, AA806683, AI092218,
					AA858007, W94283, AI339695, AI262289, AI076383, AI311852, AI910100,
					H46722, W85678, W74408, AA631052, AA918365, AI301845, AA604026, W72883,
					H47019, AA635622, AA045304, AA746223, AW408264, AI038223, AA482654,
					AA137252, AI985703, AW023603, T32125, W07308, AI658934, T30570,
					AA502009, Z25192, H46795, AA326741, H46480, AA658982, H81844, AA736875,
					AI678243, AW401539, AW352130, AA481943, AA359248, AI832746, AI383918,
					H97071, AI784354, AA344343, AA137251, AW339756, AW188941, D56149,
					N57967, AI382332, N48245, H61635, AA086068, AA603737, AI362081, AA434581,
					AA490441, AI828818, AI220855, AA295325, AI814087, AA830821, AI925463,
					AL039086, AL119791, AW079159, AW074993, AW072484, AI349614, AI349937,
					AI349256, AI312152, AI783504, AW075084, AI872910, AI312399, AI334884,
					AI307543, AI345251, AW071412, AI307708, AI312325, AI340659, AW071377,
					AI340644, AI867042, AI334930, AI309443, AI632997, AI307520, AI874166,
					AI499986, AI340664, AI310592, AW193236, AI345739, AI312143, AI349637,
					AI310927, AI307578, AI349955, AW075093, AI312357, AW268072, AI801325,
					AI923989, AL036631, AL040241, AI919345, AW243886, AW071395, AI830029,
					AI273142, AI636719, AW029271, AW089689, AW268964, AW302965, AI349269,
					N71180, AA572758, AI312432, AI811785, AI440263, AI312237, AW196141,
					AI886415, AW071380, AI358701, AL048656, AI343112, AW301300, AI349598,
					AW075207, AI343037, AW269097, N75771, AI345735, AL079963, AI310925,
					AI635067, AW162189, AI863411, AL047422, AL036265, AI307210, AI345224,
					AI625595, AI345156, AI307569, AI311159, AI313320, AI336495, AI336654,
					AW148320, AI313352, AI311892, AI307736, AI345562, AI284517, AI345026,
					AI307454, AI349266, AI334452, AI349787, AI434741, AI345817, AI344808,
					AI312146, AI538342, AI312339, AI309431, AI345674, AI345258, AI344260,
					AI866573, AI312168, AI348879, AW071276, AI344779, AI344785, AI311604,
					AL119863, AI824576, AW168121, AI310945, AL036664, AI312988, AW059828,
					AW151136, AI475377, AI312428, AI696819, AL037454, AI345111, AI863321,
					AW072588, AW160916, AL110306, AI689420, AL045500, AI912866, AI929108,
					AI683684, AI174394, AI349645, AI431408, AW089572, AI345370, AI471361,
					AI282355, AL036274, AI352326, AI284509, AI358455, AI287704, AI345347,
					AW161579, AI538829, H89138, AI432040, AW161156, AL036396, AI620284,
					AL038605, AL036403, AF161529, AF151878, X75935, AB037370, I89947, A08916,
					A08913, AL050108, A08912, AF097996, I48978, A08910, A08909, U00763,
					AL133104, AL049300, I89931, AL110218, I49625, U80742, A07647, AL050393,
					Y10655, E03348, AL122121, I96214, AR034830, AL049283, AL122050, AF106827,
					A93350, AL133077, AF113013, AR038854, A08908, AF054599, U67958, AI8777,
					AR059958, AL050149, A65341, AL049430, AF113699, AL049452, E02349, E07108,
					AL117457, AF113676, AF177401, AL110225, AL117394, AJ012755, AL049314,
					AF090903, AL133606, AL133067, AF111849, AF113691, X65873, AL133560,
					AF113694, AL122049, AF113677, Y16645, AL137557, AF067728, AL133080,
					AL080159, I48979, AL137648, AF183393, AL117585, AL133075, AL133016,
					AL050146, AL122093, U91329, AB019565, AL049466, AL050024, AL110196,
					AL080127, AF090896, AL133072, AF079765, A03736, AL110280, AF119337,
					AF113019, I26207, AL049382, Y11254, AL137560, X70685, AL133081, AJ242859,
					AL137550, AL117460, AL133113, AL137521, AF061573, AF057300, AF057299,
					AL122123, X72889, AL080060, AR020905, AF113690, X82434, AF090934,
					A77033, A77035, AF087943, AL137271, U58996, AL117583, Z82022, AL137459,
					AF079763, AF153205, AL137538, AF090900, Y09972, AF158248, AL133568,
					AF185576, AF146568, AF090901, AL050092, AL133565, AL137479, AL050277,
					AF113689, AF118094, I09360, AJ000937, M30514, A90832, AL133098, X92070,
					AF125948, S78214, U42766, X98834, AL080124, AL049464, AL122110, AF091084,
					AL137283, I89934, AR038969, AL049938, Y11587, I03321, AL133640, AL049465,
					AF125949, X93495, X63574, AF106862, AF104032, AR011880, AF111112,
					AF003737, AF118064, AL137478, U68233, I92592, AF000301, AL110221,
					AL096744, AF039138, AF039137, AI2297, E02221, X96540, I00734, U72620,
					AF026816, A58524, A58523, AF078844, AF126247, AF090943, AL133558, I33392,
					AF051325, L31396, E00617, E00717, E00778, U68387, E15569, AL137488, L31397,
					AF100931, E02253, AF118070, X62580, AL137523, AF118090, I42402, AL050116,
					AF026124, Z37987, Y10080, AF106657, AL117435, U35846, AJ006417, AL137463,
					A93016, AR013797, I89944, X84990, AL133557, Y07905, AL050138, X83508,
					AF061943, AL137556, AF162270, AL133093, AF111851, AL110197, AL122098,
					AF017152, E08631, S68736, AL080137, AL137527, AL137292, I41145, AL080074,
					AF017437, Z72491, AJ238278, AL080158, AL137529, AL133014, AL137476,
					AC004883, E04233, AR000496, AF132676, U39656, AF061836, AL050172,
					U35146, and X52128.
HFOZA47	904	909372	1-303	15-317	T99977, AA386007, AW419200, AI301419, T99978, AA813111, and AL133243.
HFOYW76	905	769894	1-387	15-401	Z43100, R23391, R18897, and AA775801.
HFOYV08	906	959038	1-503	15-517	AI885037, AW005574, AI127653, AI471784, AW002166, AI652199, AA775784,
					AA398384, AA525786, C21259, and Z98048.
HFOYS58	907	735816	1-267	15-281	AA464919, AI360067, and AI563967.
HFOYN65	908	747740	1-403	15-417	R42824, AI418414, AI094617, AI159874, AA614150, AI420613, AI082558,
					AI478270, AA928271, AA477739, H29542, AW297075, F35711, AW292053,
					Z39149, AW362068, F25020, and AI597841.
HFOYN01	909	854780	1-446	15-460	AA188606, and AL109710.
HFOYM48	910	721455	1-461	15-475	N69806, AI692502, AI077479, AA811249, N69787, and AC000076.
HFOYL33	911	702209	1-593	15-607	W03664, and AW070784.
HFOYK21	912	670653	1-852	15-866	AA428559, AA429496, and AA909127.
HFOYK02	913	919458	1-475	15-489	W38502, and W21229.
HFOYJ30	914	932485	1-669	15-683	W67514, AI655409, AW051595, AI799668, AI400464, AA563735, AI183528,
					AI354914, AA652158, AI337235, AA652105, AA961057, AA772564, AI093875,
					AA889803, AA442063, AI652462, H17951, AA442166, W68127, H12516,
					AI365333, N95071, AA861656, AA939316, R71444, AA917342, AA487907,
					R81789, D62541, R71096, AI355106, F13621, AI277031, Z38139, AA773369,
					AI419837, H12464, C18326, AA767156, and AF116827.
HFOYH01	915	916055	1-555	15-569	AI733400, AI392911, AA669057, AI522044, AW293639, AI261721, AI791812,
					AI792235, AA948371, R82728, and AI017805.
HFOYG88	916	494875	1-794	15-808	W81024, AA040397, AI806528, AI626098, AI474320, W81060, AW181963, and
					N92485.
HFOYG86	917	949496	1-549	15-563	AI089319, AA495807, AA122079, AI682875, and AA626188.
HFOYC08	918	958975	1-627	15-641	AI939308, AI089885, AI674951, and AW452881.
HFOYA17	919	662642	1-334	15-348	H85252, and Z59473.
HFOXW67	920	494854	1-497	15-511	R59304, Z41276, and F01353.
HFOXV94	921	794175	1-494	15-508	AA224103, and AC005328.
HFOXT74	922	875383	1-522	15-536	AA203672, AA521316, AW025339, AI971502, AA833669, N71094, AA832189, and
					AC003029.
HFOXT35	923	707088	1-506	15-520
HFOXS42	924	713514	1-462	15-476
HFOXO57	925	928171	1-493	15-507	N62077, AW408398, R14585, W44378, R52298, H29068, AA258983, R14764,
					R60391, and AL022165.
HFOXO33	926	702212	1-555	15-569	R00471, F22586, AI473631, AA773289, AI758435, AI471914, F34093, AA397821,
					H48670, AA251356, AA298788, F27108, AI798493, T06210, AW439008,
					AA130501, AW245331, AA737039, AA523695, AI366902, AA804866, AA523812,
					AI865375, AW021619, AI054339, AC006509, AC011456, AC002504, Z98750,
					AC006960, AC004526, AP000466, Z83844, AF048729, AC005261, AC007695,
					AC006285, AC003043, AC003010, AC004844, AC004067, AC005102, AC004841,
					AC007276, AC005844, AP000354, AC008372, AC016025, AC007546, AL031681,
					AC000029, AG007845, AL035398, AP000045, AP000113, U91326, AC005911,
					AL035086, AL023513, AC005081, AL049569, AL009183, AC005231, AL078581,
					AC004828, L78810, AL031005, AC005326, AC007993, AC005015, AL022316,
					AC006262, Z98749, AL133246, AL008733, AC006480, AL132712, AC005821,
					AC007225, U95739, D86566, AC005328, AC002352, AC003108, AC005520,
					AL121653, AC005969, AC002425, AC007363, AC005562, AC005071, AJ010770,
					AC005632, AL020997, AC006241, AL080243, AL022313, L44140, AC006026,
					AC004985, AF001548, AC005037, AC004216, AL078638, AC005279, AF053356,
					AC003013, AC004815, AL133243, AC005225, U91323, AC005274, AC007686,
					AC006487, U91322, U89335, Z98941, AP000030, AF196969, AC006312, AP000208,
					AP000130, X99832, AC002544, Z99943, AC005578, AC005088, Z83840,
					AC006530, AL031296, AC006947, AC002430, AC006011, L04193, AL133245,
					AL049776, AC003982, AC007878, AC006387, Z98036, AC007384, AL034549,
					AC004589, AC007283, AB003151, AL109627, AP000211, AP000133, AC004590,
					AC005914, AC009946, AL049835, AC004967, AC007938, AC002527, AL023281,
					AC005244, Z95114, AC004491, AC008498, AC004583, AC002126, AC004158,
					Z98742, AL079342, AF139813, AF030453, AC005324, AF111168, AC003684,
					AJ003147, AC000085, AF015262, AC004259, AC002476, AC004600, AJ229043,
					AC006449, AL031670, AF064861, AC005921, AF020503, AL139054, AL132641,
					AC003015, AL049830, U62317, Z94056, AC004686, AC003025, AL031230,
					AC002395, AC005940, AC007773, AL031680, AL136504, AC004605, AL024507,
					AC006511, AC011311, AL031432, AC004953, AC005531, and AP000555.
HFOXM53	927	587972	1-546	15-560	T95196.
HFOXL88	928	909839	1-412	15-426	AA077980, AA010232, AA077893, AA149376, AA029227, AA077669, AA077229,
					AW386712, AW386708, AA076983, AA076893, R53155, AB011110, and
					AC004084.
HFOXK96	929	732057	1-549	15-563	N95619, AI522016, AW418929, AI739123, AI589262, W81467, AA679593,
					AI358082, AI968962, H29504, W81348, AI802044, AA860722, AI299531,
					AA861993, AI240698, AW293669, AA946852, AI538012, AI872899, R40786,
					AA703596, AA426331, N45617, AC004918, and AL049792.
HFOXK42	930	587960	1-400	15-414	AI369443, H40699, H38679, T10030, AI359972, AB032985, and AC006487.
HFOXF91	931	790103	1-640	15-654	AW299538, AI700655, AA542898, AI201894, AW002387, AW299893, AW135284,
					N48798, AI953361, AI088991, AI381950, AI239629, AI206950, AI217419,
					AI361123, AI687555, N62233, AI669545, AI700194, W40211, AI537667,
					AW118331, AI569799, AI300682, H22991, AI686217, R45601, W45433, AI867656,
					AA402541, AA766044, AW156969, AW162279, AW157242, AW301566, and
					AL034379.
HFOXF42	932	854797	1-410	15-424	F00438, AB029032, and AL137384.
HFOXD78	933	856499	1-320	15-334	W00471, AW363484, H05198, F11931, T66107, and AL049471.
HFOXB33	934	701719	1-617	15-631	AA070455, and AL049775.
HFOXB26	935	681593	1-455	15-469	AA159285.
HFOXA62	936	743466	1-435	15-449	T86297.
HFIZP86	937	785341	1-409	15-423	AA418200, AI280402, and AI350784.
HFIZB62	938	743122	1-693	15-707	AA131059.
HFIYX08	939	958977	1-443	15-457	AA605145, AA702116, AA708181, and AL096678.
HFIYW79	940	858618	1-652	15-666	R56716, AW075513, AW002149, H39705, H28690, F11371, AA768949, AA384664,
					AI337892, AI057281, AI458151, AI570407, AW134516, AI350058, AI470179,
					AI215812, AA854471, R26470, AA251002, AA573328, AI216845, AI200607,
					AI984370, AA411536, AI298938, AI818816, AW083096, AI300345, W92747,
					AI147626, AI948774, AI262533, AA725905, AA442075, AI565962, AI301560,
					N52183, AA935514, AW149691, AI194002, AI291200, AI304886, AI953743,
					AW270856, R63834, W35349, AW340470, AI765586, AI298116, and AA292171.
HFIYS11	941	966702	1-467	15-481	N58560.
HFIYN50	942	724175	1-538	15-552	AI458879, AA463632, AA496023, AI168467, AA778374, AI580056, AI056137,
					AI269041, and AI360731.
HFIYJ92	943	791305	1-462	15-476	H96503, AI629004, AI436691, AW264067, AI796727, AW341625, N20097, H15455,
					N24619, AI949464, D62682, D63004, T65294, N23339, N94925, AA099864,
					AI095277, F09804, R40594, R60524, and N59847.
HFIYA08	944	962212	1-536	15-550	AA458753, AI870866, W72843, AA772868, AI130854, AI083630, AA130359,
					AA056018, AA332556, AI199995, AA469081, AA661635, AI183475, AA457490,
					AA931966, W67545, W67527, W81565, AA826675, T12258, W76412, AA989066,
					W81612, AA630878, AI243042, AA027306, and AA056067.
HFIXZ95	945	915703	1-466	15-480	AA126477, AW299841, AI742474, AI672617, AW001691, AW008181, R76817,
					R43164, AI990788, R22570, R28278, H95582, H95556, R75986, R92020, AI983816,
					and AC006055.
HFIXZ19	946	683033	1-600	15-614	AA053791, AI755151, AI633860, AL046181, AA205728, AA211578, AA204943,
					AI635990, AI830932, AI949778, AI949366, AI634857, AI823973, AI423292,
					AI627291, AI418579, AI890410, AA836883, AI480105, AI669422, AI095121,
					AI057276, AI890178, AA205729, AI200542, AW078637, AA166692, AI669371,
					AI332344, AI217515, AI359771, AI378663, AA224514, AI554321, AI990118,
					AA630767, AA410286, AW264316, AW206186, AI669078, AI923406, AA468567,
					AA552010, AA121794, AI754877, N51861, AI823545, AI650324, AA099437,
					AI356067, AI038127, AW129642, AI273625, AI619475, AI767029, AI827395,
					AI022904, AI174419, AI765993, AI091669, AA165151, AA961611, AA780769,
					AW020059, AA169647, N90277, AA035739, AA788579, AA169822, AI830936,
					AA452593, AI002825, AA706408, AI583400, AI559181, AW023827, AA205712,
					D12323, AI367552, D11546, AI571708, AA807016, AW382024, AW382030,
					AW382019, D11548, AI349108, AA027830, AL045597, AI564852, AI914393,
					W35293, AW381974, AA746978, AW393593, AI685993, AA678665, AI392778,
					D54048, F37948, R44031, AI695043, AW382056, AI619567, AA431088, AA664873,
					AW381977, AA860448, F25971, AA760888, AI630054, AA214120, F37021,
					H11493, C15312, AI571876, AA216657, AA779052, AI521854, Z28566, AA436971,
					AA502233, AI300701, AI872541, AA256938, W38598, H13644, AA224488,
					AI567021, Z38535, F01833, AI245064, AA431553, AW382004, H43488, AA884498,
					R57005, H39529, AA912371, AF131807, Z99716, and AL008721.
HFIXR93	947	894013	1-572	15-586	N25971, N29465, AW410261, and AI435020.
HFIXR68	948	752858	1-805	15-819	R11083, and AA393561.
HFIXP31	949	697759	1-453	15-467	AA227552, AI080405, AA227929, AI972469, and U69274.
HFIXP04	950	839910	1-549	15-563	AA883171.
HFIXJ53	951	489122	1-409	15-423	T72754, and AL049713.
HFIXB77	952	772116	1-501	15-515	R82686, and H19381.
HFIVS81	953	387591	1-230	15-244	AI420574, AW237773, AI375677, AI244780, AA528140, AI624970, AI624952,
					H15695, and Z39216.
HFIVS21	954	855131	1-267	15-281	AA578341.
HFIVS08	955	959272	1-390	15-404	C01483, and AC007032.
HFIUZ63	956	745033	1-554	15-568	AI672293, N59774, AW014476, AI091467, AI740712, AI306424, AI215771,
					AI652127, AA683496, AA868095, AA436090, AI379664, AI419802, and
					AA435990.
HFIUY49	957	855133	1-394	15-408	AA501785, T74524, AW274349, AW303196, AW301350, AL049539, AP000555,
					AP000223, and AP000086.
HFIUV58	958	735350	1-752	15-766	N22766, AI094120, W94915, AI140008, AI339057, W91968, AI378174, AA628702,
					AA628693, AI080429, AI168313, H97684, AI868702, AI886569, and AA236390.
HFIUV18	959	787095	1-499	15-513	H29983, AW298799, T86660, T79509, AA400497, AA400589, T96108, H54131,
					R98500, R98518, T80762, and AA359852.
HFIUM33	960	702319	1-359	15-373	AA634147, AC006014, AC005488, AP000696, AC007226, AL109952, U80017,
					AL031985, Z95114, AC005578, Z85987, AL008715, AL031297, AL049576,
					AP000088, AC004765, AC002470, AC007899, Z97054, AL049843, AL022721,
					AC005081, AP000689, AC005924, AC003010, AC004002, AC004662, AC007934,
					AC005399, D87675, AC004966, Z95116, AL133245, Z49236, AC004033,
					AC005520, AC005368, AC007537, AP000047, AC004941, AC007285, AC005280,
					AL109628, AC004890, AL022313, AC002310, AL078475, AP000031, AC004019,
					AL031295, AC007731, AC005874, AF134471, AL022163, AC005500, AL121603,
					Z86090, AC005004, AC007842, AC004668, AL132712, AC005324, AL021918,
					AP000553, AC002425, AL031311, AC004985, AL049869, AC016026, AB023050,
					AC005082, AC005666, AC005527, AF109907, AF030876, AC007227, AC007536,
					Y07848, AC004526, AL024498, AC000025, AP000512, AC004858, AJ251973,
					AC004263, AC004531, AC005971, AC005409, AL049643, AP000115, AP000116,
					AP000049, AL109798, AC005881, AC003041, AC007358, AL021391, AL031670,
					AL021707, AC006026, AB003151, AC004686, AL096791, AC004228, Z81364,
					AL078581, AC002395, AC005736, AL049872, AC007845, AP000311, U95740,
					AC004491, AP000251, AC005598, AC004132, AC002546, AC009247, AL050332,
					Z99127, AC003665, AC004895, Z98742, AC003109, AC005730, AC002544,
					Y10196, AC002477, AF031078, AL133445, U95742, AL049697, AC005899,
					AC005841, AL034379, AC005529, AC016025, AF181896, AL132987, AC002059,
					AF129756, AL024474, AC005911, AC002996, AC005046, AC004067, AP000211,
					AP000133, AP000030, AC000120, AC006511, AC002350, U91323, AC003688,
					AF088219, AC004988, AL049776, AL117337, AL049759, AC005668, AC005839,
					AL009179, AC000134, AC006111, AC006211, AL049795, AC006597, AF196779,
					AD000864, AC007546, AC005233, AC005746, AL080243, AC004841, and
					AL034418.
HFIUH65	961	747836	1-517	15-531	AI608715, AI422803, AI432163, W63666, H81684, C05948, W37721, AI493291,
					AI356167, H84536, AA988027, AA401876, AA872375, AA932978, H84219,
					AA868682, and H81685.
HFIUD47	962	720254	1-570	15-584	W07634, AA194651, W94182, AA133411, and W07638.
HFITH46	963	718078	1-659	15-673	H83995, R84314, AA813574, T05535, and AI915423.
HFIJG36	964	707883	1-733	15-747	AA001287.
HFIJG20	965	669580	1-421	15-435	R05639.
HFIJF58	966	735927	1-659	15-673	AA242859, AA252126, AI693548, H99361, AL049780, and AC006530.
HFIIZ92	967	494044	1-461	15-475	AA493255, and AL049781.
HFIIU85	968	793332	1-789	15-803	AA486519, N75864, AA282436, AI311373, AA987662, AW378576, AA258100,
					D20734, AA398828, AI340090, AI806551, AI827300, AA322510, AW167535,
					AA486153, AI580840, AA307592, AI300646, AI365620, R63162, AW190730,
					N80417, AA074806, AI380183, AI807739, AI683461, AI817082, AI798145,
					AI423017, AI056695, AI590919, AI127969, AW055144, AA648622, AI860727,
					AI571273, AW173640, AW305299, AI445732, AI283109, AA173927, H13876,
					AA486091, AI692781, AI692782, AI475726, AI567671, AW368584, AW339198,
					AA598864, D57989, AA773684, AI347553, AW304900, AI310482, AW103494,
					AA135489, AA300795, AW377765, AA424654, W53016, AI950989, AA150819,
					AI024706, AA360720, AI751636, AI753529, AI950558, AA604851, AA579895,
					AA931400, AW129397, N39046, N35027, AI355248, AI805101, AA424557,
					H07110, AI860066, AW192391, AI469260, N67995, AA223733, AI863857,
					AI302384, AI355266, AI299079, AI148180, AI003944, AI934032, AI830970,
					N70657, AI340222, AW402035, AA554911, AA565608, AL080212, and U07795.
HFIIR63	969	744994	1-732	15-746	R60665, H06153, and R14432.
HFIIL37	970	561375	1-337	15-351	AI185219, Z99396, AL038837, AL037051, AL036725, AL036418, AA631969,
					AL039074, AW392670, AL036858, AL036924, AW372827, AL039564, AL039085,
					AL038509, AL039156, AL039108, AL039109, AL039128, AW384394, AL119497,
					AW363220, AL037094, AL039659, AL038531, AL036196, AL036190, AL119335,
					AL119443, AL037639, AL039625, AL039648, AL119319, AL045337, U46351,
					AL119457, AL036767, AL037082, U46350, AL037526, U46341, AL119496,
					AL119324, AL119484, AL119363, AL119391, AL119483, AL119522, AL039678,
					AL039629, AL119341, AL119355, AL039423, U46349, AL036238, AL119396,
					AL038447, AL039150, AL040992, AL134528, AL042909, AL042450, AL039386,
					U46346, AL134524, AL037077, AL036268, U46347, AL119418, AL042614,
					AL119444, AL037085, AL038520, AL037726, AL119439, AL036998, AL036733,
					AL042975, AL039410, AL037615, AL038851, AL134533, AL037205, U46345,
					AL134518, AL042965, AL134531, AL119399, AL037027, AL036719, AL037178,
					AL042984, AL042970, AL043029, AL042551, AL134538, AL119488, AL036679,
					AL134542, AL036191, AL042544, AL043019, AL042542, AL036765, AL043003,
					AL037054, AL119464, AL036774, AL037021, AL036836, AL036999, AL036886,
					AL036158, AC006001, AR060234, AR066494, A81671, AR023813, AR069079,
					AR064707, AR054110, and AB026436.
HFIIK75	971	767222	1-845	15-859	AI458975, AW296300, R44335, AW452866, AI276446, AI700567, R40979,
					AI264364, AA884637, AA257160, Z17361, and AA257067.
HFIIK32	972	424259	1-396	15-410	R81615.
HFIIK07	973	953034	1-481	15-495	AI630872.
HFIIJ14	974	839523	1-694	15-708	AI888852, AL046620, AL044458, AW085811, AI732327, AA780914, AA618132,
					AI679294, AI679871, AA525818, AA524604, AA640305, AA523718, AI828721,
					AI282322, AL121039, AI702049, AI732720, AI344906, AA313025, AI567676,
					AI285651, AA493245, AA054283, AA631915, AA577706, N27362, AA515727,
					AI984168, AA664963, AA935827, AW072963, AW265006, AA482682, AI049845,
					AI926102, AA493546, AI734075, AI246541, AI734076, AA831913, AI114494,
					AW238242, AI275631, AI570067, AW157128, AI813920, AI572680, AA554289,
					AI242236, N49298, AI733523, AI889177, AA507623, AI538404, AA618531,
					AI038029, AW085626, AA593168, AI174827, AW327673, AA601336, AI860423,
					AI609992, AA601376, AL044701, AA834891, AW419201, AI734119, AA523719,
					AI003068, AA404619, AI521525, W44797, AW268793, AW265468, AI434103,
					AA602939, AA493464, AA425283, AW301483, AA595508, AW021674, AA728954,
					AA723282, AA584360, AI753092, AA557945, AI889236, AI281622, AA676462,
					AI002950, AA629668, AA834799, AI312614, AI826857, AI350189, AA167656,
					AA493808, AI064968, AW057760, AI039257, H29593, AA847341, AA728952,
					R92703, AA299490, AA526542, AA491941, AI744890, AI884404, AA515728,
					AA811451, AW410844, AL118843, AA558488, AI342863, AI061158, AW339619,
					R61887, AA729004, AI745666, AA421536, AI148840, AW103990, AA197089,
					AA636077, AI003391, AA489390, AI889995, AI791720, AI791408, AP000512,
					AL009181, AC005081, AC005911, AC004491, AC004765, U62317, AC005231,
					AC004801, AB017602, AD000092, AL031666, AL117258, AC004967, AC006271,
					AF003626, AL049694, AL136504, AL020997, AC004000, AL031133, AC002310,
					AC005015, AC007637, U47924, AC004671, AL022323, AC004834, AL136295,
					AC005800, AC006449, AC005412, AC009247, AL049569, AC004752, AL133245,
					AL031311, AF111169, AC005046, AC005887, Z95116, AL080243, Z93241,
					AL031668, AP000692, AC005004, AC004805, AC005755, AL008582, AF053356,
					AF109907, AC002565, AL023575, AL031602, AC005088, AL109628, AP000356,
					AC007151, AP000211, AP000133, AL008719, AC004253, AF038458, AC004854,
					AC007934, AF003529, AC007030, AC005041, AL035423, AC007226, AC002477,
					AL096701, AC007666, AF111168, AC006211, AC004659, AF047825, AF067844,
					AL022316, AL031680, AL022326, AF064861, AC007707, AC005562, AB023051,
					AC016025, AP000131, Z99716, AC006450, AC005619, AC006080, AC004799,
					AL031733, AC005722, AL021395, AC006064, AC005089, AL031431, AC003007,
					AC004031, AC005881, AC002314, AP000503, AC005913, AC000353, AL031730,
					AC007055, AC004678, AC005519, AL035413, AC003006, AL133448, AC002425,
					AC005971, AC002404, AL035460, AC005406, AC003956, AL109758, AP000555,
					Z92542, AP000501, AC005067, AL031589, AL133163, AL049757, AL031846,
					AC008044, AF111167, AC005839, AC005102, AF165926, AC006285, AC005180,
					AC004382, AP000350, AC006261, AP000688, AJ003147, AC005696, AF134726,
					AL139054, L78833, AL050348, AC005808, AC002126, Z85986, AL049776,
					AL049780, AC007227, Z86090, AL031657, AL049759, AC006013, AC004703,
					Z98044, AC002381, AC006160, AC005225, AC002470, AC006011, AL031291,
					AC006006, AC005914, AC005280, AL034423, AL034429, AC004686, AC002400,
					AC004216, AC005258, AC003029, AC004983, AP000346, AC005537, AP000152,
					AL050321, AC005736, AC000003, AP000510, AC005527, AL034555, AJ246003,
					Z95114, AC007774, AL008726, AC006101, AL022311, AP000247, AC004560,
					AL121657, AL035587, AC005484, AC005480, AC007688, AC004887, AC004605,
					AL034451, AC000039, AC005632, AC007536, AL049745, U91328, AC002554,
					AC002073, AL050307, AC005921, AC005566, AC007011, AC003950, AC010077,
					AC002558, AC007216, AC004257, AC008009, AP000553, AL034417, AP000511,
					Z98051, AC006057, AC007371, AC006312, AC007450, AC004662, Z98742,
					AP000008, AC004263, AC007050, AL049576, AC004876, AC003982, AP000466,
					AC006205, AC003108, AL050341, AB000882, AC005245, AL121825, U52112,
					AC004033, AJ011930, AC004477, AC004849, AB023048, AP000500, AC004526,
					AC004643, AC006115, AL022302, and AC008372.
HFIHW91	975	907618	1-515	15-529	AI743173, AA909302, AA447375, AI470475, and AI066540.
HFIHW16	976	858594	1-659	15-673	H42111, and AF142099.
HFIHW11	977	947856	1-269	15-283	AA828809, and AA828563.
HFIHV56	978	470954	1-687	15-701	AA160654.
HFIHU76	979	769948	1-347	15-361	AW055256, T59260, H67680, AI002890, H68002, AC004883, and AC005412.
HFIHS86	980	785419	1-344	15-358	H89010, AW021356, AW023646, and AL035694.
HFIHR78	981	773512	1-457	15-471	H84598, AA777769, AA682587, AI090880, and AI862169.
HFIHN35	982	707075	1-895	15-909	N54488, H47963, AA708179, H56418, R92521, H83039, and H60100.
HFIHK29	983	855174	1-834	15-848	AW082328, AA056697, AA058386, AI582825, AW376061, AW204615, AA847499,
					AI923052, AI754105, AI755214, AI754567, AI278972, AA630854, AI962030,
					AW328202, AA584484, AA904211, AA503019, AA410788, T74524, AA704393,
					AI669421, AA084609, AI963720, AA713705, AI653776, AI249688, AW023111,
					AI904586, AI904594, AW272294, AW188427, H07953, AA126450, AW082104,
					AW328331, AI279417, AI635028, AA535216, AW193265, W96522, AA720582,
					AI609972, AI307201, AA613227, AA536040, AI038304, AA225406, AI431303,
					AI918419, AI674840, AI912401, W96277, AI471572, AW020088, AI056177,
					AA228778, AA572974, AI569100, AA634991, AI077941, AI350211, AA525293,
					AW020992, AW192599, AI587349, AA456924, AA838091, AI859438, AI049955,
					AA668455, AW265688, AL037683, AA559241, AW438643, AC005666, AC005288,
					AF053356, AC002563, AC005480, AC006317, Z83843, AC004552, AL022323,
					AC004386, AC002476, AC005914, AC004542, AC002504, AC005367, AL035685,
					AL096701, AL034549, AC005907, AC006211, AC003089, AL035555, AL133355,
					Z95115, AC007655, AC007681, AC006275, AC005726, AC009516, Z97987,
					AC005701, AL035045, AC005899, AC000025, AC004659, AP000208, AP000130,
					AL035405, AC005527, AP000247, U91325, AC002366, AC022517, AC004593,
					AL031283, AC004099, AL117354, AC004805, AL031657, AL035691, AL121825,
					AC003683, AC005808, AC004865, X87344, AL031293, AC007637, AC002407,
					AC004525, AL049869, AC005668, AL022313, AC005529, AL034429, AL050321,
					AC003666, AF001550, AP000045, AC007308, Y10196, AC005255, AC004834,
					AL049780, Z98047, AC004782, AC006441, AL031311, AC005189, AC002978,
					AL133244, AC004585, AC004828, AC004814, AC004815, U95743, AC002418,
					AC005562, AC007899, AL035634, AC007488, AC007686, AC005206, X99832,
					U91318, AF001548, AL008718, Z98884, Z93020, AC005243, AP000356, AC005531,
					AC006960, AL024509, AC005667, Z85986, AC006312, Z82203, AC005859,
					AC006080, AC005049, AL031230, AL031736, AC007055, AC007666, AC005261,
					AF001551, AC000353, AC004019, Z86064, AP000692, AC010202, AC008101,
					AC006974, U95737, AL031650, AL049776, AL035071, AC003043, AL022067,
					AL109758, AC007774, AC007536, AC006515, AC002477, AC002449, AL034379,
					U08988, AC005482, AL022311, AC016830, AL035587, AF001549, AC000118,
					AC005225, AL031575, AC003072, AC007528, AC007390, AC005920, Z95331,
					AC004559, AP000044, AP000112, U89335, AC006958, AL121603, AL031984,
					AC006581, AL024498, AJ246003, X55923, AC000378, Z84469, AC008033,
					AL031178, AL109963, X54181, AC004909, AC004526, Z98751, X54178, X55931,
					AC006111, AC004017, X55925, AL078463, AL031662, AF107885, AL031295,
					AC002990, AC002470, AC006050, AJ229043, U57007, AC005694, D88270,
					AL031276, AC005387, AC005730, AL031666, AF064858, AP000113, AL034417,
					AC006344, AL050332, AC005071, AC004106, AC004475, AC005002, AC009044,
					AF196779, AC005829, AC005952, AL020993, AL035423, AC002352, AL031589,
					AF031078, AL021939, AC002126, AL109952, AC000134, AC007225, AL031767,
					AC005410, AC007652, AC004253, AL031667, AC005409, AC004913, AC004020,
					Z81314, AC007993, AF134726, AP000563, AF111167, AL078581, AF030876,
					Y18000, AC002996, AL121658, AF067844, AC002551, AC004242, AC006120,
					AL035403, AC005375, Z93241, AC004150, AC000088, AL050341, and AC007688.
HFIHF53	984	728259	1-560	15-574	R65697, R65696, AC007688, AF165926, AL022165, AC005702, and AC005519.
HFIHD20	985	669731	1-496	15-510	T55518, AI762631, and AB002380.
HFIDL68	986	928475	1-516	15-530	AI375172.
HFIDL06	987	837524	1-599	15-613	AI141922, W51817, AA515912, AI925832, AA614027, and AL133051.
HFIBK83	988	939556	1-490	15-504	R15292, AW339546, Z42543, AA251688, Z44339, W60548, F06562, AW377760,
					and AA011443.
HFIAX78	989	773445	1-280	15-294
HFIAS49	990	722728	1-599	15-613	N35671, AI301181, and AC007093.
HFIAL66	991	587837	1-503	15-517	AW172309, and N42465.
HCOKA10	992	907080	1-759	15-773	AW327294, F31091, AA528669, AA505384, AW328419, AW328418, AW419243,
					AA187998, AA640483, F31092, AA420717, AI348852, W81029, AA482925,
					AI879569, AA946918, AA314600, AA825612, AA808869, W45176, AA316648,
					AA651658, AI735276, W52650, AA534263, AA314556, AA417254, AI342431,
					AA622408, AA181138, AA506547, W68664, AA635583, AA991834, AA187537,
					AA128015, W96306, AA505394, AA186606, AA524595, AI336250, AA862109,
					N90275, AA187128, AA737195, AA659642, AI879186, AA307087, AA991775,
					AA579430, AA643777, F32467, AA654628, F33074, AW082068, AA484856,
					AA653801, AA469168, AA420763, AI090379, AA421550, AA469285, AA775298,
					N78682, AA225075, AA314013, AI735264, C15999, AI004885, AI185905,
					AA155975, AA541346, AW006688, AA838376, AA507479, AA315116, AA147815,
					AW440264, F25989, AA528681, AI718105, AI185191, AI830011, AI074436,
					AI193986, AA483568, AA844667, F30622, AI598223, AI431978, AA157591,
					AW340929, AI718714, AA147943, AA960763, AI140252, AI131544, AA659113,
					C14408, F28423, AI193088, AI749326, C14506, AA181285, C14409, AI302400,
					AI570974, AI936281, AA229654, AA229788, AA302294, AI982992, F31208,
					AA935155, AI193847, H46476, AA838474, F20187, AA492052, AI609502,
					AI709111, AA469365, F32353, AA608589, AA643956, AA961534, AA226596,
					AI973135, AA128058, AA829205, AA501744, AW276969, AI721218, AI924736,
					AA147740, AA579354, AA995673, AI253661, AA022517, D52050, F27939,
					AA744974, D52103, C14325, F26226, C14332, AI440106, C14532, C14505,
					AA229085, AI205658, W38596, AA613651, H89629, AA029290, AA975314,
					C14296, F33568, W90547, F30424, AI748823, F25844, AA932252, AA229038,
					AA569478, AI300774, AA483111, AA631847, AI523368, AA363475, W81066,
					AI094402, AI440377, AA131139, F29490, AA554888, C14458, AW262694, N57388,
					AA658868, AA320538, F30326, F30077, AI718951, AA664723, W45081, C14216,
					AI151472, AA601532, C14355, AI032761, AI720880, F19339, AA594497,
					AA654880, AI510833, AA320738, AI718725, AA181139, T48033, AA082246,
					AA318164, AA023034, AI379782, AA501349, AI709200, AW020881, F26870,
					AI919316, AA985525, AA318175, AA375674, H47015, AI709292, AI580440,
					T78704, AA226675, AA595613, AA230292, AA528661, AA101676, AA188186,
					AA372741, AA320632, F34274, D51607, F32629, T54178, AI352694, AI720481,
					F31158, AA469169, AA642170, AA230044, AA661507, T40904, T57476, AI832316,
					AA373500, T57504, T54087, C14334, AA729378, F31962, AW272552, D51810,
					AI675421, N29450, AA679894, AA375716, AL021397, L38941, AF147334,
					AF084363, AC003061, AC005372, X14401, AC004796, AC006597, AL049714,
					AF109472, A75356, S76596, AB007181, Y11587, I48979, AF113690, AF118070,
					S78214, AF113691, AL133640, AF090934, AF090900, AF106862, AL050393,
					L31396, L31397, AF090943, AF078844, AL122093, AL117457, AF113694,
					AL117460, U42766, I89947, AL049938, AL050146, AF113013, AF118064, I89931,
					AL133016, AF125949, AL110196, AL110221, A93016, AL050108, AF090901,
					AL133606, AL122050, AF104032, AL050116, AF090896, AJ242859, AF090903,
					AF113676, S68736, AL049452, AB019565, AL137527, AL080060, AF113019,
					AF113677, A08913, AR059958, A08916, AF113689, X84990, AL050149,
					AF113699, AL049314, AL133075, AL049466, AL080124, AL133557, AL050277,
					AL080137, AF017152, AL096744, AF158248, I48978, E03348, AL133565,
					AL137557, E07361, AL133093, AL133080, AL137283, Y16645, AL122121,
					AF111851, AF017437, AL137459, Y11254, AJ000937, X63574, AL122123, X82434,
					AR011880, AF097996, U91329, AL050138, AF091084, AF125948, AF146568,
					AL137550, AL117394, AL110225, AF079765, A65341, AL117585, AL049430,
					AL117435, I49625, AF177401, AL133560, AL117583, A08912, AL049300, U00763,
					E02349, AL049464, A08910, E07108, AJ238278, X72889, AL049382, I33392,
					AL122098, A03736, AF067728, X70685, AL050024, A08909, A77033, A77035,
					AF183393, Z82022, I03321, A58524, A58523, AL122110, AL137271, AF118094,
					AC007390, A12297, S61953, U35846, AL137648, AL137463, AF095901, U72620,
					AL049283, X96540, AC004093, AF061943, AF026816, AL133113, AL035458,
					AL137538, AL080127, X93495, U80742, X65873, E05822, AF087943, X98834,
					AF109906, AC006336, I42402, AL137521, Z72491, AL110197, I09360, U67958,
					AL080159, Y09972, Y07905, E08263, E08264, AL122049, AL133072, AJ012755,
					AF026124, AL137560, I26207, E15569, AC006112, AL050172, I17767, AF003737,
					AC006840, AF210052, AL137294, AF119337, AL133568, AF091512, AF162270,
					A93350, AC004878, AL110280, AF111112, AF057300, AF008439, AF057299,
					M30514, AC004690, AC002467, AL137526, A08911, AC004200, AR013797,
					L13297, I00734, L30117, E00617, E00717, E00778, AL133077, AL137523,
					AC004987, AF185576, AL137556, AR000496, U39656, I66342, AL133014,
					AF000145, AF061795, A07647, AF151685, AL133104, E04233, AL133098,
					AC006371, AF177767, AR038969, T39948, T48092, T53717, T54310, T58614,
					T58631, T58665, T58680, T59454, T59609, T60693, T60724, T61517, T40270,
					H89483, N31100, W15188, W79553, W90546, AA101675, AA177148, AA230059,
					AA230201, AA482934, AA501580, AA514483, AA523478, AA527911, AA533427,
					AA541546, AA548914, F15751, AA579103, AA654916, AA659893, AA662847,
					AA729739, AA746663, AA746696, AA746820, AA917622, AA953954, AA962129,
					N83299, N84751, N85724, N85940, C14425, C14487, C14529, AA090952,
					AA089892, C15916, AA094133, AA095139, AA652445, D11811, D11899, Z19815,
					F22033, AA722737, AA775136, T25716, AI302923, AI370276, AI474980,
					AI567460, AI198759, and AI292268.
HCDEL02	993	920831	1-279	15-293	AI300611, and AI700656.
HCDDZ69	994	522220	1-329	15-343	AA631784, T53408, AA427747, AA904211, AI473671, AA721530, AA721523,
					AA604831, AA017583, AA731361, R94436, AW080215, AW054936, AC002310,
					AC006312, AC005924, AC005519, AC004883, AP000501, U80017, AC009399,
					AP000359, AC004796, AL021154, AC004448, AC012384, AC005088, AC002365,
					AC003110, AC005722, AC005844, AC007666, AC005280, AP000555, AF024533,
					AC004983, AC003029, AC005899, AC005740, AL049759, AL022316, Z93023,
					AP000692, AL133353, AC005209, AB023049, AP000008, AC007308, AL031666,
					AL022318, AL023575, AC009247, AC004895, AC003101, AC002477, AC005932,
					AC005482, AC006057, AC004019, AC007066, Z99943, AC002432, AC006071,
					AC007934, AC003042, AL049709, AL022163, AC003690, AC007298, AC006084,
					and AC002301.
HCDDY54	995	529265	1-344	15-358
HCDDO80	996	778563	1-421	15-435	AI732570, AA134460, AI871333, AI744693, AI610347, and AI563999.
HCDCD64	997	863415	1-389	15-403	N31472, N29138, AI880074, and H85753.
HCDBW41	998	712648	1-463	15-477	R43504, R59580, Z39594, T15652, F01654, and Z95118.
HCDBO86	999	784617	1-672	15-686	W93682, AW242652, AW173253, AI139152, AI553736, AI290544, N49727,
					N52656, Z41613, AI184287, D61097, AI918560, AA258656, and AF028333.
HCDAO39	1000	704504	1-264	15-278	AA188026.
HCDAA68	1001	753814	1-617	15-631	R95822, and AA019299.
HBSAP57	1002	531874	1-631	15-645	AI500721, AA534064, AA829251, AI380617, AW304580, AI826761, AW020150,
					AA714110, AI560085, F35374, AI278972, AA904211, AW303196, AL042735,
					AW301350, AA282951, AW410354, AL079734, AW151541, AA515728, T50676,
					N23913, AA706495, AA983673, AA086318, AA613627, AI440117, AA515048,
					AA503298, AI962030, AI436433, AI683131, AA833875, AA833896, AI133083,
					AI249365, AI049709, AI279417, AI354333, AI755214, AW188427, T74524,
					AW237905, AA704393, AA456924, AI744199, AI754567, AI792521, AA526542,
					AW069769, AI754105, AA535216, AI053398, W96522, AA284247, AI114557,
					AI469577, H63660, AI565084, AI950963, AI114733, AI133552, AI216990,
					AL046746, AL041894, AA809546, AA225406, AI587349, AI355007, AI681962,
					AI186438, AA659832, AI192440, AI923052, AA420801, AW020094, AA502532,
					AA719524, AW272294, AA975779, AW271904, AW019964, H82636, AI343169,
					H73561, AW081303, AL048135, AW157731, AI801505, AI491765, F35097,
					AA654013, AW419389, AW021399, AI609972, AI859438, AA470578, AA524616,
					AI362442, AI499954, AI521525, AI635028, AW243793, AC005746, AC005288,
					AP001060, AC005015, AJ009610, AC005940, AL021453, AC007421, AP000501,
					AC005409, AC005412, Z99714, AC002565, AC010205, Z95331, AC004805,
					AC007376, AL049776, AC007227, AC005378, AL008627, AC006160, AC004242,
					AC007546, AL049869, AL139054, Z84480, AC004895, AC002375, AC006040,
					AC005747, AL022163, AC002302, AC007263, AC005212, AP000696, AB026898,
					AC005089, AL022165, AC005837, AC003101, AC004886, Z97054, U47924,
					AC008154, AL031587, AL022336, AC004134, AL117355, AC002430, AC005261,
					AC007014, AP000704, AL031281, AC003692, AC007384, AF053356, AC006538,
					AP000086, AC005828, AC004019, AC007934, AC006449, AC005041, AC005399,
					AP000555, AL022721, AC005531, AC005037, AF111167, AL022302, AL049766,
					AP000131, AP000209, AC007919, AP000553, AL117354, U91326, AC005722,
					AC007676, AC002299, AC005304, AC006468, AL109984, AP000694, AC007225,
					AL133245, AC011311, AC005071, Z95114, AC002551, Z99716, AC007051,
					AL024498, AC002425, AL050318, AL096701, AL050321, AL049569, AC007055,
					AC005529, AL049712, AC006480, AP000225, AC005102, AC000134, AC002369,
					AC002091, AF001548, L78833, AC007868, AC003109, Z97056, AC016830,
					AL031311, AL022345, AC002544, AC005881, AC004382, AL034451, AF134726,
					AL031602, AL020997, AC004079, AF111168, AC004883, AC005225, AC005829,
					AC004858, AC006211, AP000512, AF196779, AC005209, AL008636, AC003663,
					AL121652, AC004814, AC002563, U91323, AL109628, AP000252, AC007993,
					AL109758, AC004263, AL133163, AL133371, Z86090, AL049871, AC007308,
					AL049872, AC006450, AC005632, AL035071, AC004076, AC005081, AC005046,
					AL021939, AC003982, AC005678, AC006312, AF047825, AL020995, AC003043,
					U62317, L44140, AC004167, AC002070, AC007011, AL050324, AC016027,
					AC005859, AL049780, U78027, AC005808, AP000115, Z83844, AC004821,
					AC010582, AC004882, AC007685, AC005566, AL035461, AC005823, AP000503,
					U91322, AC003108, AC006141, AC005562, AL031666, AC005480, AC005736,
					AL021707, AC007537, AC005291, AL121825, AP000008, D87675, U80017,
					AC005701, AC004057, AC004099, AC006162, AL021918, AC006130, U96629,
					AL078581, AL133246, AC004552, AC007666, AC005921, AL078638, Z98742,
					AC002351, AL035587, M89651, AL096761, AC005004, AC006344, AL135744,
					AC000025, AC000052, AC004990, AC007390, AC005914, AC006463, AC002352,
					AC006333, AC005514, AC005284, AC004232, AL034548, AL034351, AL049757,
					AL024497, AC002115, AC004812, AL035072, AC005565, AC002504, AC005484,
					AC005377, AJ246003, AC004590, AC004985, AL031228, Z93241, AL021393,
					AL122021, AC004797, and U85195.
HBCKF23	1003	675613	1-505	15-519	AA429449, AA428527, AA995146, and AI041267.
HBCGD25	1004	677689	1-462	15-476	H40377, H51703, T70759, T69773, and H40323.
HAOAE95	1005	795674	1-304	15-318	T39786, T39845, and AL034417.
HAOAD27	1006	848729	1-472	15-486	AI123100, AW195077, and AL096776.
HANKG10	1007	963926	1-456	15-470	AI373332, AW243457, AW235081, AA748692, and AW362939.
HANKB13	1008	827062	1-423	15-437	AA278465, AI979103, and AI908300.
HAMAC79	1009	872774	1-1081	15-1095	AI358042, AI874151, AL039730, AI400725, F37364, AI887268, AL080011,
					AW302924, AW193203, AW088899, AW409775, AI433206, AA807088, AA864562,
					AI355008, AI537677, AI434242, AI345347, AI918554, H89138, AI859464,
					AI800464, AW411235, AL038445, AI251221, AA911767, AW168503, AL046926,
					AI521386, AL119863, AI582483, AI886594, AW022682, AI829990, AI922577,
					AW089006, AA464646, AI954422, AL036638, AI612015, AW161579, AW168031,
					AI620093, AW058233, AI573026, AL120853, AI919593, AI590423, AA100772,
					AI539153, AI933992, AL042382, AI345224, AA127565, AL120526, AI917959,
					AI311892, AI697324, AA643261, AI280670, AA603709, AI344928, AI952064,
					AL038069, AA853213, AW021373, AI680498, AI698401, AI580674, AA853539,
					AI659795, AL048871, AI470293, AI570966, AW089932, AI344933, AI554343,
					AI916419, AI677797, AW238730, AI537617, AI494201, AW076127, AI920782,
					AL119791, AL041150, AI335449, AL038076, AW265004, AI927755, AI963040,
					AI582871, W81248, AA761557, AI573093, AW029401, AA420758, AI537837,
					AL046463, AI241819, AI874166, AI340533, AW083804, AL038715, AI955945,
					AI334445, AI336575, AI696969, AW059828, AI073952, AI633477, AW078680,
					AW004886, AW082623, AI312399, AI648502, AW238688, AI802240, AI866127,
					AI335426, AL110306, AI348777, AW410969, AA572758, AI889168, AI671661,
					AI690663, AI929108, AL036772, AI500039, AW162194, AW305233, AI678355,
					AW074869, AI612014, AL037041, AI471361, AI866100, AW160376, AI343059,
					AI284509, AW193134, AI669639, AI866082, AI280661, AA493647, AL042365,
					AI349933, AA420722, AW268261, AI345608, AI285586, AI446124, AI923989,
					AI348897, D50977, AI174591, AI345251, AW020710, AI419650, AW081255,
					AI689420, AW301300, AI348847, AI251830, AI917963, AW193872, R36271,
					AI344819, AI862220, AI648567, AA291456, AW029579, AI434833, AL040241,
					AW075207, AA848053, AI345253, AW020397, AI312152, AI950688, AI343037,
					AW269097, AI345677, AA938383, AI696611, AI446373, AW075084, AW087385,
					AI523806, AW301409, AL047387, AI932458, AI473451, AI340603, AI919345,
					AI290153, AW151714, AW088903, AI364788, AW130863, AW129230, AI830030,
					AW084097, AI307543, AI249877, AI345370, AI932949, AI799234, AI345527,
					AW021717, AI289542, AI348854, AI817430, AI242736, AI699056, AI446092,
					AI307569, AI345471, AI344935, AI805638, AI334820, AI365256, AI366549,
					AI366992, AI636719, AI313320, AW190286, AI336495, AI478123, AI453487,
					AW085786, AW081034, AI539771, AL039086, AI866608, AI472536, AI307520,
					AL043981, AI805688, AI611743, AI340664, AI590686, AL040207, AI368816,
					AA830821, AW191844, AI309431, AI888621, AI348917, L78810, AL035407,
					AC005091, AC006013, AC004686, AC002454, AC004383, AC004878, AL022147,
					U62317, AL137705, AC004837, AC004797, AC007114, AL049594, AC004159,
					AC005250, AC005057, AL035587, AL033521, AC004883, AL031295, AC006222,
					AC004987, AC005488, AC002416, AC007406, AP000030, AL035458, AC007172,
					AL031984, AL137294, Z82206, AP000514, AC005048, AC006039, AC009286,
					AC006112, AF091512, and AP000344.

[0113]

TABLE 4
				Cell
Code	Description	Tissue	Organ	Line	Disease	Vector
AR022	a_Heart	a_Heart
AR023	a_Liver	a_Liver
AR024	a_mammary gland	a_mammary gland
AR025	a_Prostate	a_Prostate
AR026	a_small intestine	a_small intestine
AR027	a_Stomach	a_Stomach
AR028	Blood B cells	Blood B cells
AR029	Blood B cells activated	Blood B cells
		activated
AR030	Blood B cells resting	Blood B cells
		resting
AR031	Blood T cells activated	Blood T cells
		activated
AR032	Blood T cells resting	Blood T cells resting
AR033	brain	brain
AR034	breast	breast
AR035	breast cancer	breast cancer
AR036	Cell Line CAOV3	Cell Line CAOV3
AR037	cell line PA-1	cell line PA-1
AR038	cell line transformed	cell line transformed
AR039	colon	colon
AR040	colon (9808co65R)	colon (9808co65R)
AR041	colon (9809co15)	colon (9809co15)
AR042	colon cancer	colon cancer
AR043	colon cancer	colon cancer
	(9808co64R)	(9808co64R)
AR044	colon cancer 9809co14	colon cancer
		9809co14
AR045	corn clone 5	corn clone 5
AR046	corn clone 6	corn clone 6
AR047	corn clone2	corn clone2
AR048	corn clone3	corn clone3
AR049	Corn Clone4	Corn Clone4
AR050	Donor II B Cells 24 hrs	Donor II B Cells
		24 hrs
AR051	Donor II B Cells 72 hrs	Donor II B Cells
		72 hrs
AR052	Donor II B-Cells 24 hrs.	Donor II B-Cells 24 hrs.
AR053	Donor II B-Cells 72 hrs	Donor II B-Cells
		72 hrs
AR054	Donor II Resting B Cells	Donor II Resting B
		Cells
AR055	Heart	Heart
AR056	Human Lung	Human Lung
	(clonetech)	(clonetech)
AR057	Human Mammary	Human Mammary
	(clontech)	(clontech)
AR058	Human Thymus	Human Thymus
	(clonetech)	(clonetech)
AR059	Jurkat (unstimulated)	Jurkat
		(unstimulated)
AR060	Kidney	Kidney
AR061	Liver	Liver
AR062	Liver (Clontech)	Liver (Clontech)
AR063	Lymphocytes chronic	Lymphocytes
	lymphocytic leukaemia	chronic lymphocytic
		leukaemia
AR064	Lymphocytes diffuse	Lymphocytes
	large B cell lymphoma	diffuse large B cell
		lymphoma
AR065	Lymphocytes follicular	Lymphocytes
	lymphoma	follicular lymphoma
AR066	normal breast	normal breast
AR067	Normal Ovarian	Normal Ovarian
	(4004901)	(4004901)
AR068	Normal Ovary	Normal Ovary
	9508G045	9508G045
AR069	Normal Ovary	Normal Ovary
	9701G208	9701G208
AR070	Normal Ovary	Normal Ovary
	9806G005	9806G005
AR071	Ovarian Cancer	Ovarian Cancer
AR072	Ovarian Cancer	Ovarian Cancer
	(9702G001)	(9702G001)
AR073	Ovarian Cancer	Ovarian Cancer
	(9707G029)	(9707G029)
AR074	Ovarian Cancer	Ovarian Cancer
	(9804G011)	(9804G011)
AR075	Ovarian Cancer	Ovarian Cancer
	(9806G019)	(9806G019)
AR076	Ovarian Cancer	Ovarian Cancer
	(9807G017)	(9807G017)
AR077	Ovarian Cancer	Ovarian Cancer
	(9809G001)	(9809G001)
AR078	ovarian cancer 15799	ovarian cancer
		15799
AR079	Ovarian Cancer	Ovarian Cancer
	17717AID	17717AID
AR080	Ovarian Cancer	Ovarian Cancer
	4004664B1	4004664B1
AR081	Ovarian Cancer	Ovarian Cancer
	4005315A1	4005315A1
AR082	ovarian cancer	ovarian cancer
	94127303	94127303
AR083	Ovarian Cancer	Ovarian Cancer
	96069304	96069304
AR084	Ovarian Cancer	Ovarian Cancer
	9707G029	9707G029
AR085	Ovarian Cancer	Ovarian Cancer
	9807G045	9807G045
AR086	ovarian cancer	ovarian cancer
	9809G001	9809G001
AR087	Ovarian Cancer	Ovarian Cancer
	9905C032RC	9905C032RC
AR088	Ovarian cancer 9907	Ovarian cancer 9907
	C00 3rd	C00 3rd
AR089	Prostate	Prostate
AR090	Prostate (clonetech)	Prostate (clonetech)
AR091	prostate cancer	prostate cancer
AR092	prostate cancer #15176	prostate cancer
		#15176
AR093	prostate cancer #15509	prostate cancer
		#15509
AR094	prostate cancer #15673	prostate cancer
		#15673
AR095	Small Intestine	Small Intestine
	(Clontech)	(Clontech)
AR096	Spleen	Spleen
AR097	Thymus T cells	Thymus T cells
	activated	activated
AR098	Thymus T cells resting	Thymus T cells
		resting
AR099	Tonsil	Tonsil
AR100	Tonsil geminal center	Tonsil geminal
	centroblast	center centroblast
AR101	Tonsil germinal center B	Tonsil germinal
	cell	center B cell
AR102	Tonsil lymph node	Tonsil lymph node
AR103	Tonsil memory B cell	Tonsil memory B
		cell
AR104	Whole Brain	Whole Brain
AR105	Xenograft ES-2	Xenograft ES-2
AR106	Xenograft SW626	Xenograft SW626
H0041	Human Fetal Bone	Human Fetal Bone	Bone			Uni-ZAP
						XR
H0122	Human Adult Skeletal	Human Skeletal	Sk Muscle			Uni-ZAP
	Muscle	Muscle				XR
H0124	Human	Human	Sk Muscle		disease	Uni-ZAP
	Rhabdomyosarcoma	Rhabdomyosarcoma				XR
H0135	Human Synovial	Human Synovial	Synovium			Uni-ZAP
	Sarcoma	Sarcoma				XR
H0251	Human	Human	Cartilage		disease	Uni-ZAP
	Chondrosarcoma	Chondrosarcoma				XR
H0252	Human Osteosarcoma	Human	Bone		disease	Uni-ZAP
		Osteosarcoma				XR
H0381	Bone Cancer	Bone Cancer			disease	Uni-ZAP
						XR
H0419	Bone Cancer, re-	Bone Cancer				Uni-ZAP
	excision					XR
H0529	Myoloid Progenitor Cell	TF-1 Cell Line;				pCMV Sport
	Line	Myoloid progenitor				3.0
		cell line
H0636	Chondrocytes	Chondrocytes				pSport1
H0658	Ovary, Cancer	9809C332- Poorly	Ovary &		disease	pSport1
	(9809C332) Poorly	differentiate	Fallopian
	differentiated		Tubes
	adenocarcinoma
S0001	Brain frontal cortex	Brain frontal cortex	Brain			Lambda
						ZAP II
S0003	Human Osteoclastoma	Osteoclastoma	bone		disease	Uni-ZAP
						XR
S0011	STROMAL -	Osteoclastoma	bone		disease	Uni-ZAP
	OSTEOCLASTOMA					XR
S0022	Human Osteoclastoma	Osteoclastoma				Uni-ZAP
	Stromal Cells -	Stromal Cells				XR
	unamplified
S0027	Smooth muscle, serum	Smooth muscle	Pulmanary	Cell		Uni-ZAP
	treated		artery	Line		XR
S0028	Smooth muscle, control	Smooth muscle	Pulmanary	Cell		Uni-ZAP
			artery	Line		XR
S0032	Smooth muscle-ILb	Smooth muscle	Pulmanary	Cell		Uni-ZAP
	induced		artery	Line		XR
S0037	Smooth muscle, IL1b	Smooth muscle	Pulmanary	Cell		Uni-ZAP
	induced		artery	Line		XR
S0118	Smooth muscle control 2	Smooth muscle	Pulmanary	Cell		Uni-ZAP
			artery	Line		XR
S0122	Osteoclastoma-	Osteoclastoma	bone		disease	pBluescript
	normalized A
S0126	Osteoblasts	Osteoblasts	Knee	Cell		Uni-ZAP
				Line		XR
S0192	Synovial Fibroblasts	Synovial Fibroblasts				pSport1
	(control)
S0194	Synovial hypoxia	Synovial Fibroblasts				pSport1
S0196	Synovial IL-1/TNF	Synovial Fibroblasts				pSport1
	stimulated
S0206	Smooth Muscle-	Smooth muscle	Pulmanary	Cell		pBluescript
	HASTE normalized		artery	Line
S0214	Human Osteoclastoma,	Osteoclastoma	bone		disease	Uni-ZAP
	re-excision					XR
S0242	Synovial Fibroblasts	Synovial Fibroblasts				pSport1
	(Il 1/TNF), subt
S0250	Human Osteoblasts II	Human Osteoblasts	Femur		disease	pCMVSport
						2.0
S0276	Synovial hypoxia-RSF	Synovial fobroblasts	Synovial			pSport1
	subtracted	(rheumatoid)	tissue
S0312	Human	Human			disease	pSport1
	osteoarthritic; fraction II	osteoarthritic
		cartilage
S0314	Human	Human			disease	pSport1
	osteoarthritis; fraction I	osteoarthritic
		cartilage
S0316	Human Normal	Human Normal				pSport1
	Cartilage, Fraction I	Cartilage
S0318	Human Normal	Human Normal				pSport1
	Cartilage Fraction II	Cartilage
S0334	Human Normal	Human Normal				pSport1
	Cartilage Fraction III	Cartilage
S0336	Human Normal	Human Normal				pSport1
	Cartilage Fraction IV	Cartilage
S0338	Human Osteoarthritic	Human			disease	pSport1
	Cartilage Fraction III	osteoarthritic
		cartilage
S0340	Human Osteoarthritic	Human			disease	pSport1
	Cartilage Fraction IV	osteoarthritic
		cartilage
S0362	Human Gastrocnemius	Gastrocnemius				pSport1
		muscle
S0390	Smooth muscle, control;	Smooth muscle	Pulmanary	Cell		Uni-ZAP
	re-excision		artery	Line		XR
S3012	Smooth Muscle Serum	Smooth muscle	Pulmanary	Cell		pBluescript
	Treated, Norm		artery	Line
S3014	Smooth muscle, serum	Smooth muscle	Pulmanary	Cell		pBluescript
	induced, re-exc		artery	Line
L0021	Human adult (K Okubo)
L0022	Human adult lung 3″
	directed MboI cDNA
L0040	Human colon mucosa
L0055	Human promyelocyte
L0180	Human GM-CSF-			GM-
	deprived TF-1 cell line			CSF-
	(Liu, Hongtao)			deprived
				TF-1
				cell line
L0361	Stratagene ovary		ovary			Bluescript
	(#937217)					SK
L0362	Stratagene ovarian					Bluescript
	cancer (#937219)					SK-
L0365	NCI_CGAP_Phe 1	pheochromocytoma				Bluescript
						SK-
L0366	Stratagene schizo brain	schizophrenic brain				Bluescript
	S11	S-11 frontal Iobe				SK-
L0369	NCI_CGAP_AA1	adrenal adenoma	adrenal			Bluescript
			gland			SK-
L0370	Johnston frontal cortex	pooled frontal lobe	brain			Bluescript
						SK-
L0375	NCI_CGAP_Kid6	kidney tumor	kidney			Bluescript
						SK-
L0384	NCI_CGAP_Pr23	prostate tumor	prostate			Bluescript
						SK-
L0387	NCI_CGAP_GCB0	germinal center B-	tonsil			Bluescript
		cells				SK-
L0415	b4HB3MA Cot8-HAP-					Lafmid BA
	Ft
L0435	Infant brain, LLNL					lafmid BA
	array of Dr. M. Soares
	1NIB
L0438	normalized infant brain	total brain	brain			lafmid BA
	cDNA
L0439	Soares infant brain		whole			Lafmid BA
	1NIB		brain
L0455	Human retina cDNA	retina	eye			lambda gt10
	randomly primed
	sublibrary
L0465	TEST1, Human adult					lambda
	Testis tissue					nm1149
L0471	Human fetal heart,					Lambda
	Lambda ZAP Express					ZAP
						Express
L0485	STRATAGENE Human	skeletal muscle	leg muscle			Lambda
	skeletal muscle cDNA					ZAPII
	library, cat. #936215
L0498	NCI_CGAP_HSC3	CD34+, T negative,	bone			pAMP1
		patient with chronic	marrow
		myelogenou
L0517	NCI_CGAP_Pr1					pAMP10
L0518	NCI_CGAP_Pr2					pAMP10
L0520	NCI_CGAP_Alv1	alveolar				pAMP10
		rhabdomyosarcoma
L0521	NCI_CGAP_Ew1	Ewing's sarcoma				pAMP10
L0523	NCI_CGAP_Lip2	liposarcoma				pAMP10
L0526	NCI_CGAP_Pr12	metastatic prostate				pAMP10
		bone lesion
L0527	NCI_CGAP_Ov2	ovary				pAMP10
L0529	NCI_CGAP_Pr6	prostate				pAMP10
L0530	NCI_CGAP_Pr8	prostate				pAMP10
L0538	NCI_CGAP_Ov5	normal surface	ovary			pAMP10
		epithelium
L0545	NCI_CGAP_Pr4.1	prostatic	prostate			pAMP10
		intraepithelial
		neoplasia - high
		grade
L0559	NCI_CGAP_Ov39	papillary serous	ovary			pAMP10
		ovarian metastasis
L0562	Chromosome 7 HeLa			HeLa		pAMP10
	cDNA Library			cell
				line;
				ATCC
L0581	Stratagene liver		liver			pBluescript
	(#937224)					SK
L0586	HTCDL1					pBluescript
						SK(−)
L0588	Stratagene endothelial					pBluescript
	cell 937223					SK-
L0589	Stratagene fetal retina					pBluescript
	937202					SK-
L0590	Stratagene fibroblast					pBluescript
	(#937212)					SK-
L0591	Stratagene HeLa cell s3					pBluescript
	937216					SK-
L0592	Stratagene hNT neuron					pBluescript
	(#937233)					SK-
L0594	Stratagene					pBluescript
	neuroepithelium					SK-
	NT2RAMI 937234
L0595	Stratagene NT2	neuroepithelial cells	brain			pBluescript
	neuronal precursor					SK-
	937230
L0596	Stratagene colon		colon			pBluescript
	(#937204)					SK-
L0597	Stratagene corneal		cornea			pBluescript
	stroma (#937222)					SK-
L0598	Morton Fetal Cochlea	cochlea	ear			pBluescript
						SK-
L0599	Stratagene lung		lung			pBluescript
	(#937210)					SK-
L0601	Stratagene pancreas		pancreas			pBluescript
	(#937208)					SK-
L0602	Pancreatic Islet	pancreatic islet	pancreas			pBluescript
						SK-
L0604	Stratagene muscle	muscle	skeletal			pBluescript
	937209		muscle			SK-
L0605	Stratagene fetal spleen	fetal spleen	spleen			pBluescript
	(#937205)					SK-
L0606	NCI_CGAP_Lym5	follicular lymphoma	lymph			pBluescript
			node			SK-
L0607	NCI_CGAP_Lym6	mantle cell	lymph			pBluescript
		lymphoma	node			SK-
L0608	Stratagene lung	lung carcinoma	lung	NCI-		pBluescript
	carcinoma 937218			H69		SK-
L0623	HM3	pectoral muscle				pcDNAII
		(after mastectomy)				(Invitrogen)
L0636	NCI_CGAP_Pit1	four pooled pituitary	brain			pCMV-
		adenomas				SPORT6
L0640	NCI_CGAP_Br18	four pooled high-	breast			pCMV-
		grade tumors,				SPORT6
		including two prima
L0646	NCI_CGAP_Co14	moderately-	colon			pCMV-
		differentiated				SPORT6
		adenocarcinoma
L0653	NCI_CGAP_Lu28	two pooled	lung			pCMV-
		squamous cell				SPORT6
		carcinomas
L0655	NCI_CGAP_Lym12	lymphoma,	lymph			pCMV-
		follicular mixed	node			SPORT6
		small and large cell
L0659	NCI_CGAP_Pan1	adenocarcinoma	pancreas			pCMV-
						SPORT6
L0661	NCI_CGAP_Mel15	malignant	skin			pCMV-
		melanoma,				SPORT6
		metastatic to lymph
		node
L0662	NCI_CGAP_Gas4	poorly differentiated	stomach			pCMV-
		adenocarcinoma				SPORT6
		with signet r
L0663	NCI_CGAP_Ut2	moderately-	uterus			pCMV-
		differentiated				SPORT6
		endometrial
		adenocarcino
L0665	NCI_CGAP_Ut4	serous papillary	uterus			pCMV-
		carcinoma, high				SPORT6
		grade, 2 pooled t
L0666	NCI_CGAP_Ut1	well-differentiated	uterus			pCMV-
		endometrial				SPORT6
		adenocarcinoma, 7
L0731	Soares_pregnant_uterus—		uterus			pT7T3-Pac
	NbHPU
L0740	Soares melanocyte	melanocyte				pT7T3D
	2NbHM					(Pharmacia)
						with a
						modified
						polylinker
L0741	Soares adult brain		brain			pT7T3D
	N2b4HB55Y					(Pharmacia)
						with a
						modified
						polylinker
L0742	Soares adult brain		brain			pT7T3D
	N2b5HB55Y					(Pharmacia)
						with a
						modified
						polylinker
L0743	Soares breast 2NbHBst		breast			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0744	Soares breast 3NbHBst		breast			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0745	Soares retina N2b4HR	retina	eye			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0746	Soares retina N2b5HR	retina	eye			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0747	Soares_fetal_heart_NbHH19W		heart			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0748	Soares fetal liver spleen		Liver and			pT7T3D
	1NFLS		Spleen			(Pharmacia)
						with a
						modified
						polylinker
L0749	Soares_fetal_liver_spleen—		Liver and			pT7T3D
	1NFLS_S1		Spleen			(Pharmacia)
						with a
						modified
						polylinker
L0750	Soares_fetal_lung_NbHL19W		lung			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0751	Soares ovary tumor	ovarian tumor	ovary			pT7T3D
	NbHOT					(Pharmacia)
						with a
						modified
						polylinker
L0752	Soares_parathyroid_tumor—	parathyroid tumor	parathyroid			pT7T3D
	NbHPA		gland			(Pharmacia)
						with a
						modified
						polylinker
L0753	Soares_pineal_gland_N3HPG		pineal			pT7T3D
			gland			(Pharmacia)
						with a
						modified
						polylinker
L0754	Soares placenta Nb2HP		placenta			pT7T3D
						(Pharmacia)
						with a
						modified
						polylinker
L0755	Soares_placenta_8to9weeks—		placenta			pT7T3D
	2NbHP8to9W					(Pharmacia)
						with a
						modified
						polylinker
L0756	Soares_multiple_sclerosis—	multiple sclerosis				pT7T3D
	2NbHMSP	lesions				(Pharmacia)
						with a
						modified
						polylinker
						V_TYPE
L0757	Soares_senescent_fibroblasts—	senescent fibroblast				pT7T3D
	NbHSF					(Pharmacia)
						with a
						modified
						polylinker
						V_TYPE
L0758	Soares_testis_NHT					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0759	Soares_total_fetus—					pT7T3D-Pac
	Nb2HF8_9w					(Pharmacia)
						with a
						modified
						polylinker
L0760	Barstead aorta HPLRB3	aorta				pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0761	NCI_CGAP_CLL1	B-cell, chronic				pT7T3D-Pac
		lymphotic leukemia				(Pharmacia)
						with a
						modified
						polylinker
L0763	NCI_CGAP_Br2	breast				pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0764	NCI_CGAP_Co3	colon				pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0766	NCI_CGAP_GCB1	germinal center B				pT7T3D-Pac
		cell				(Pharmacia)
						with a
						modified
						polylinker
L0768	NCI_CGAP_GC4	pooled germ cell				pT7T3D-Pac
		tumors				(Pharmacia)
						with a
						modified
						polylinker
L0769	NCI_CGAP_Brn25	anaplastic	brain			pT7T3D-Pac
		oligodendroglioma				(Pharmacia)
						with a
						modified
						polylinker
L0770	NCI_CGAP_Brn23	glioblastoma	brain			pT7T3D-Pac
		(pooled)				(Pharmacia)
						with a
						modified
						polylinker
L0774	NCI_CGAP_Kid3		kidney			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0775	NCI_CGAP_Kid5	2 pooled tumors	kidney			pT7T3D-Pac
		(clear cell type)				(Pharmacia)
						with a
						modified
						polylinker
L0776	NCI_CGAP_Lu5	carcinoid	lung			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0777	Soares_NhHMPu_S1	Pooled human	mixed (see			pT7T3D-Pac
		melanocyte, fetal	below)			(Pharmacia)
		heart, and pregnant				with a
						modified
						polylinker
L0779	Soares_NFL_T_GBC_S1		pooled			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0780	Soares_NSF_F8_9W_OT—		pooled			pT7T3D-Pac
	PA_P_S1					(Pharmacia)
						with a
						modified
						polylinker
L0783	NCI_CGAP_Pr22	normal prostate	prostate			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0787	NCI_CGAP_Sub1					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0788	NCI_CGAP_Sub2					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0789	NCI_CGAP_Sub3					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0790	NCI_CGAP_Sub4					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0792	NCI_CGAP_Sub6					pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0794	NCI_CGAP_GC6	pooled germ cell				pT7T3D-Pac
		tumors				(Pharmacia)
						with a
						modified
						polylinker
L0796	NCI_CGAP_Brn50	medulloblastoma	brain			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0800	NCI_CGAP_Co16	colon tumor, RER+	colon			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0803	NCI_CGAP_Kid11		kidney			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0804	NCI_CGAP_Kid12	2 pooled tumors	kidney			pT7T3D-Pac
		(clear cell type)				(Pharmacia)
						with a
						modified
						polylinker
L0805	NCI_CGAP_Lu24	carcinoid	lung			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0806	NCI_CGAP_Lu19	squamous cell	lung			pT7T3D-Pac
		carcinoma, poorly				(Pharmacia)
		differentiated (4				with a
						modified
						polylinker
L0807	NCI_CGAP_Ov18	fibrotheoma	ovary			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L0809	NCI_CGAP_Pr28		prostate			pT7T3D-Pac
						(Pharmacia)
						with a
						modified
						polylinker
L2245	NEM subtracted human					pUEX1
	fetal kidney cDNA
L2251	Human fetal lung	Fetal lung

[0114]

TABLE 5
OMIM
Reference Description
104770    Amyloidosis, secondary, susceptibility to
107670    Apolipoprotein A-II deficiency
109270    Renal tubular acidosis, distal, 179800
109270    Spherocytosis, hereditary
109270    [Acanthocytosis, one form]
109270    [Elliptocytosis, Malaysian-Melanesian type]
109270    Hemolytic anemia due to band 3 defect
110700    Vivax malaria, susceptibility to
114208    Malignant hyperthermia susceptibility 5, 601887
114208    Hypokalemic periodic paralysis, 170400
114290    Campomelic dysplasia with autosomal sex reversal
118210    Charcot-Marie-Tooth neuropathy-2A
119300    van der Woude syndrome
120110    Metaphyseal chondrodysplasia, Schmid type
120150    Osteogenesis imperfecta, 4 clinical forms, 166200, 166210,
          259420, 166220
120150    Osteoporosis, idiopathic, 166710
120150    Ehlers-Danlos syndrome, type VIIA1, 130060
120160    Osteogenesis imperfecta, 4 clinical forms, 166200, 166210,
          259420, 166220
120160    Osteoporosis, idiopathic, 166710
120160    Ehlers-Danlos syndrome, type VIIA2, 130060
120160    Marfan syndrome, atypical
120550    C1q deficiency, type A
120570    C1q deficiency, type B
120575    C1q deficiency, type C
120620    SLE susceptibility
120620    CR1 deficiency
120920    Measles, susceptibility to
121014    Heterotaxia, visceroatrial, autosomal recessive
121800    Corneal dystrophy, crystalline, Schnyder
123829    Melanoma
126650    Chloride diarrhea, congenital, Finnish type, 214700
126650    Colon cancer
130500    Elliptocytosis-1
133200    Erythrokeratodermia variabilis
133701    Exostoses, multiple, type 2
134370    Factor H deficiency
134370    Hemolytic-uremic syndrome, 235400
134370    Membroproliferative glomerulonephritis
134580    Factor XIIIB deficiency
136550    Macular dystrophy, North Carolina type
138033    Diabetes mellitus, type II
138140    Glucose transport defect, blood-brain barrier
138971    Kostmann neutropenia, 202700
139250    Isolated growth hormone deficiency, Illig type with absent GH
          and Kowarski type with bioinactive GH
144200    Epidermolytic palmoplantar keratoderma
145001    Hyperparathyroidism-jaw tumor syndrome
145260    Pseudohypoaldosteronism, type II
146760    [IgG receptor I, phagocytic, familial deficiency of]
146790    Lupus nephritis, susceptibility to
147570    Interferon, immune, deficiency
148065    White sponge nevus, 193900
148066    Epidermolysis bullosa simplex, Koebner, Dowling-Meara, and
          Weber-Cockayne types, 131900, 131760, 131800
148066    Epidermolysis bullosa simplex, recessive, 601001
148067    Nonepidermolytic palmoplantar keratoderma, 600962
148067    Pachyonychia congenita, Jadassohn-Lewandowsky type,
          167200
148069    Pachyonychia congenita, Jackson-Lawler type, 167210
148080    Epidermolytic hyperkeratosis, 113800
150200    [Placental lactogen deficiency]
150240    Cutis laxa, marfanoid neonatal type
150292    Epidermolysis bullosa, Herlitz junctional type, 226700
150310    Epidermolysis bullosa, Herlitz junctional type, 226700
150310    Epidermolysis bullosa, generalized atrophic benign, 226650
152760    Hypogonadotropic hypogonadism due to GNRH deficiency,
          227200
153454    Ehlers-Danlos syndrome, type VI, 225400
154275    Malignant hyperthermia susceptibility 2
154276    Malignant hyperthermia susceptibility 3
156490    Neuroblastoma
159001    Muscular dystrophy, limb-girdle, type 1B
162100    Neuralgic amyotrophy with predilection for brachial plexus
164731    Ovarian carcinoma, 167000
168500    Parietal foramina
170500    Myotonia congenita, atypical acetazolamide-responsive
170500    Paramyotonia congenita, 168300
170500    Hyperkalemic periodic paralysis
170995    Zellweger syndrome-2
171190    Hypertension, essential, 145500
171650    Lysosomal acid phosphatase deficiency
171760    Hypophosphatasia, adult, 146300
171760    Hypophosphatasia, infantile, 241500
172400    Hemolytic anemia due to glucosephosphate isomerase
          deficiency
172400    Hydrops fetalis, one form
172411    Colorectal cancer, resistance to
173360    Thrombophilia due to excessive plasminogen activator
          inhibitor
173360    Hemorrhagic diathesis due to PAI1 deficiency
173370    Plasminogen activator deficiency
175100    Turcot syndrome, 276300
175100    Adenomatous polyposis coli
175100    Adenomatous polyposis coli, attenuated
175100    Colorectal cancer
175100    Desmoid disease, hereditary, 135290
175100    Gardner syndrome
176930    Dysprothrombinemia
176930    Hypoprothrombinemia
176960    Pituitary tumor, invasive
179820    [Hyperproreninemia]
180100    Retinitis pigmentosa-1
180105    Retinitis pigmentosa-10
180240    Leukemia, acute promyelocytic
180860    Russell-Silver syndrome
180901    Malignant hyperthermia susceptibility 1, 145600
180901    Central core disease, 117000
181430    Scapuloperoneal syndrome, myopathic type
182138    Anxiety-related personality traits
185430    Atherosclerosis, susceptibility to
185470    Myopathy due to succinate dehydrogenase deficiency
185800    Symphalangism, proximal
190900    Colorblindness, tritan
191045    Cardiomyopathy, familial hypertrophic, 2, 115195
191315    Insensitivity to pain, congenital, with anhidrosis, 256800
191540    [Urate oxidase deficiency]
203310    Ocular albinism, autosomal recessive
208250    Jacobs syndrome
217300    Cornea plana congenita, recessive
221770    Polycystic lipomembranous osteodysplasia with sclerosing
          leukencephalopathy
221820    Gliosis, familial progressive subcortical
222800    Hemolytic anemia due to bisphosphoglycerate mutase
          deficiency
226450    Epidermolysis bullosa inversa, junctional
230350    Galactose epimerase deficiency
236250    Homocystinuria due to MTHFR deficiency
246900    Lipoamide dehydrogenase deficiency
248600    Maple syrup urine disease, type Ia
249000    Meckel syndrome
252940    Sanfilippo syndrome, type D
253200    Maroteaux-Lamy syndrome, several forms
253250    Mulibrey nanism
255800    Schwartz-Jampel syndrome
256700    Neuroblastoma
264470    Adrenoleukodystrophy, pseudoneonatal
264700    Pseudo-vitamin D dependency rickets 1
270800    Spastic paraplegia-5A
274270    Thymine-uraciluria
274270    Fluorouracil toxicity, sensitivity to
277700    Werner syndrome
300031    Mental retardation, X-linked, FRAXF type
300044    Wernicke-Korsakoff syndrome, susceptibility to
300048    Intestinal pseudoobstruction, neuronal, X-linked
300049    Nodular heterotopia, bilateral periventricular
300049    BPNH/MR syndrome
300055    Mental retardation with psychosis, pyramidal signs, and
          macroorchidism
300100    Adrenoleukodystrophy
300100    Adrenomyeloneuropathy
300104    Mental retardation, X-linked nonspecific, 309541
300126    Dyskeratosis congenita-1, 305000
301201    Amelogenesis imperfecta-3, hypoplastic type
301590    Anophthalmos-1
302060    Noncompaction of left ventricular myocardium, isolated
302060    Barth syndrome
302060    Cardiomyopathy, X-linked dilated, 300069
302060    Endocardial fibroelastosis-2
302960    Chondrodysplasia punctata, X-linked dominant
303700    Colorblindness, blue monochromatic
303800    Colorblindness, deutan
303900    Colorblindness, protan
304800    Diabetes insipidus, nephrogenic
305900    Favism
305900    G6PD deficiency
305900    Hemolytic anemia due to G6PD deficiency
306700    Hemophilia A
306995    [Homosexuality, male]
308310    Incontinentia pigmenti, familial
308840    Spastic paraplegia, 312900
308840    Hydrocephalus due to aqueductal stenosis, 307000
308840    MASA syndrome, 303350
309200    Manic-depressive illness, X-linked
309548    Mental retardation, X-linked, FRAXE type
309620    Mental retardation-skeletal dysplasia
309900    Mucopolysaccharidosis II
310300    Emery-Dreifuss muscular dystrophy
310400    Myotubular myopathy, X-linked
310460    Myopia-1
310460    Bornholm eye disease
311300    Otopalatodigital syndrome, type I
311510    Waisman parkinsonism-mental retardation syndrome
314300    Goeminne TKCR syndrome
314400    Cardiac valvular dysplasia-1
600105    Retinitis pigmentosa-12, autosomal recessive
600119    Muscular dystrophy, Duchenne-like, type 2
600119    Adhalinopathy, primary
600309    Atrioventricular canal defect-1
600525    Trichodontoosseous syndrome, 190320
600623    Prostate cancer, 176807
600759    Alzheimer disease-4
600808    Enuresis, nocturnal, 2
600811    Xeroderma pigmentosum, group E, DDB-negative subtype,
          278740
600852    Retinitis pigmentosa-17
600881    Cataract, congenital, zonular, with sutural opacities
600887    Endometrial carcinoma
600897    Cataract, zonular pulverulent-1, 116200
600918    Cystinuria, type III
600958    Cardiomyopathy, familial hypertrophic, 4, 115197
600995    Nephrotic syndrome, idiopathic, steroid-resistant
601284    Hereditary hemorrhagic telangiectasia-2, 600376
601363    Wilms tumor, type 4
601412    Deafness, autosomal dominant 7
601414    Retinitis pigmentosa-18
601494    Cardiomyopathy, familial, dilated-2
601652    Glaucoma 1A, primary open angle, juvenile-onset, 137750
601666    Insulin-dependent diabetes mellitus-15
601687    Meesmann corneal dystrophy, 122100
601769    Osteoporosis, involutional
601769    Rickets, vitamin D-resistant, 277440
601844    Pseudohypoaldosteronism type II
601863    Bare lymphocyte syndrome, complementation group C
601954    Muscular dystrophy, limb-girdle, type 2G
601975    Ectodermal dysplasia/skin fragility syndrome
602094    Lipodystrophy, familial partial
602116    Glioma
602136    Refsum disease, infantile, 266510
602136    Zellweger syndrome-1, 214100
602136    Adrenoleukodystrophy, neonatal, 202370
602447    Coronary artery disease, susceptibility to
602491    Hyperlipidemia, familial combined, 1
602629    Dystonia-6, torsion
602716    Nephrosis-1, congenital, Finnish type, 256300
602771    Muscular dystrophy, congenital, with early spine rigidity
602772    Retinitis pitmentosa-24

[0115] Polypeptide and Polypeptide Variants

[0116] The present invention is also directed to variants of the musculoskeletal system associated polynucleotide sequence disclosed in SEQ ID NO:X or the complementary strand thereto, nucleotide sequences encoding the polypeptide of SEQ ID NO:Y, the nucleotide sequence of SEQ ID NO:X encoding the polypeptide sequence as defined in column 6 of Table 1A, nucleotide sequences encoding the polypeptide as defined in column 6 of Table 1A, the nucleotide sequence as defined in columns 8 and 9 of Table 2, nucleotide sequences encoding the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2, the nucleotide sequence as defined in column 6 of Table 1B, nucleotide sequences encoding the polypeptide encoded by the nucleotide sequence as defined in column 6 of Table 1B, the cDNA sequence contained in Clone ID NO:Z, and/or nucleotide sequences encoding a polypeptide encoded by the cDNA sequence contained in Clone ID NO:Z.

[0117] The present invention also encompasses variants of the polypeptide sequence disclosed in SEQ ID NO:Y, a polypeptide sequence as defined in column 6 of Table 1A, a polypeptide sequence encoded by the polynucleotide sequence in SEQ ID NO:X, a polypeptide sequence encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2, a polypeptide sequence encoded by the nucleotide sequence as defined in column 6 of Table 1B, a polypeptide sequence encoded by the complement of the polynucleotide sequence in SEQ ID NO:X, and/or a polypeptide sequence encoded by the cDNA sequence contained in Clone ID NO:Z.

[0118] “Variant” refers to a polynucleotide or polypeptide differing from the polynucleotide or polypeptide of the present invention, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the polynucleotide or polypeptide of the present invention.

[0119] Thus, one aspect of the invention provides an isolated nucleic acid molecule comprising, or alternatively consisting of, a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence described in SEQ ID NO:X or contained in the cDNA sequence of Clone ID NO:Z; (b) a nucleotide sequence in SEQ ID NO:X or the cDNA in Clone ID NO:Z which encodes a mature musculoskeletal system associated polypeptide; (c) a nucleotide sequence in SEQ ID NO:X or the cDNA sequence of Clone ID NO:Z, which encodes a biologically active fragment of a musculoskeletal system associated polypeptide; (d) a nucleotide sequence in SEQ ID NO:X or the cDNA sequence of Clone ID NO:Z, which encodes an antigenic fragment of a musculoskeletal system associated polypeptide; (e) a nucleotide sequence encoding a musculoskeletal system associated polypeptide having the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z; (f) a nucleotide sequence encoding a mature musculoskeletal system associated polypeptide of the amino acid sequence of SEQ ID NO:Y or the amino acid sequence encoded by the cDNA in Clone ID NO:Z; (g) a nucleotide sequence encoding a biologically active fragment of a musculoskeletal system associated polypeptide having the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z; (h) a nucleotide sequence encoding an antigenic fragment of a musculoskeletal system associated polypeptide having the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z; and (i) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), or (h), above.

[0120] The present invention is also directed to nucleic acid molecules which comprise, or alternatively consist of, a nucleotide sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, identical to, for example, any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), or (i) above, the nucleotide coding sequence in SEQ ID NO:X or the complementary strand thereto, the nucleotide coding sequence of the cDNA contained in Clone ID NO:Z or the complementary strand thereto, a nucleotide sequence encoding the polypeptide of SEQ ID NO:Y, a nucleotide sequence encoding a polypeptide sequence encoded by the nucleotide sequence in SEQ ID NO:X, a polypeptide sequence encoded by the complement of the polynucleotide sequence in SEQ ID NO:X, a nucleotide sequence encoding the polypeptide encoded by the cDNA contained in Clone ID NO:Z, the nucleotide coding sequence in SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or the complementary strand thereto, a nucleotide sequence encoding the polypeptide encoded by the nucleotide sequence in SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or the complementary strand thereto, the nucleotide coding sequence in SEQ ID NO:B as defined in column 6 of Table 1B or the complementary strand thereto, a nucleotide sequence encoding the polypeptide encoded by the nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B or the complementary strand thereto, the nucleotide sequence in SEQ ID NO:X encoding the polypeptide sequence as defined in column 6 of Table 1A or the complementary strand thereto, nucleotide sequences encoding a polypeptide as defined in column 6 of Table 1A or the complementary strand thereto, and/or polynucleotide fragments of any of these nucleic acid molecules (e.g., those fragments described herein). Polynucleotides which hybridize to the complement of these nucleic acid molecules under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention, as are polypeptides encoded by these polynucleotides and nucleic acids.

[0121] In a preferred embodiment, the invention encompasses nucleic acid molecules which comprise, or alternatively, consist of a polynucleotide which hybridizes under stringent hybridization conditions, or alternatively, under lower stringency conditions, to a polynucleotide in (a), (b), (c), (d), (e), (f), (g), (h), or (i) above, as are polypeptides encoded by these polynucleotides. In another preferred embodiment, polynucleotides which hybridize to the complement of these nucleic acid molecules under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.

[0122] In another embodiment, the invention provides a purified protein comprising, or alternatively consisting of, a polypeptide having an amino acid sequence selected from the group consisting of: (a) the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z; (b) the amino acid sequence of a mature musculoskeletal system associated polypeptide having the amino acid sequence of SEQ ID NO:Y or the amino acid sequence encoded by the cDNA in Clone ID NO:Z; (c) the amino acid sequence of a biologically active fragment of a musculoskeletal system associated polypeptide having the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z; and (d) the amino acid sequence of an antigenic fragment of a musculoskeletal system associated polypeptide having the complete amino acid sequence of SEQ ID NO:Y or the complete amino acid sequence encoded by the cDNA in Clone ID NO:Z.

[0123] The present invention is also directed to proteins which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100%, identical to, for example, any of the amino acid sequences in (a), (b), (c), or (d), above, the amino acid sequence shown in SEQ ID NO:Y, the amino acid sequence encoded by the cDNA contained in Clone ID NO:Z, the amino acid sequence of the polypeptide encoded by the nucleotide sequence in SEQ ID NO:X as defined in columns 8 and 9 of Table 2, the amino acid sequence of the polypeptide encoded by the nucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B, the amino acid sequence as defined in column 6 of Table 1A, an amino acid sequence encoded by the nucleotide sequence in SEQ ID NO:X, and an amino acid sequence encoded by the complement of the polynucleotide sequence in SEQ ID NO:X. Fragments of these polypeptides are also provided (e.g., those fragments described herein). Further proteins encoded by polynucleotides which hybridize to the complement of the nucleic acid molecules encoding these amino acid sequences under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention, as are the polynucleotides encoding these proteins.

[0124] By a nucleic acid having a nucleotide sequence at least, for example, 95% “identical” to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence referred to in Table 1A or 2 as the ORF (open reading frame), or any fragment specified, as described herein.

[0125] As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the present invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 (1990)). In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is expressed as percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the length of the subject nucleotide sequence, whichever is shorter.

[0126] If the subject sequence is shorter than the query sequence because of 5′ or 3′ deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5′ and 3′ truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5′ or 3′ ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5′ and 3′ of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5′ and 3′ bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.

[0127] For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5′ end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5′ end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5′ and 3′ ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5′ or 3′ of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5′ and 3′ of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.

[0128] By a polypeptide having an amino acid sequence at least, for example, 95% “identical” to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.

[0129] As a practical matter, whether any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequence of a polypeptide referred to in Table 1A (e.g., an amino acid sequence identified in columns 5 or 6) or Table 2 (e.g., the amino acid sequence of the polypeptide encoded by the polynucleotide sequence defined in columns 8 and 9 of Table 2) or a fragment thereof, the amino acid sequence of the polypeptide encoded by the polynucleotide sequence in SEQ ID NO:B as defined in column 6 of Table 1B or a fragment thereof, the amino acid sequence of the polypeptide encoded by the nucleotide sequence in SEQ ID NO:X or a fragment thereof, or an amino acid sequence of the polypeptide encoded by cDNA contained in Clone ID NO:Z, or a fragment thereof, can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.6:237-245 (1990)). In a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is expressed as percent identity. Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter.

[0130] If the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.

[0131] For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C-termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.

[0132] The polynucleotide variants of the invention may contain alterations in the coding regions, non-coding regions, or both. Especially preferred are polynucleotide variants containing alterations, which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred. Moreover, polypeptide variants in which less than 50, less than 40, less than 30, less than 20, less than 10, or 5-50, 5-25, 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred. Polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. coli).

[0133] Naturally occurring variants are called “allelic variants,” and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.

[0134] Using known methods of protein engineering and recombinant DNA technology, variants may be generated to improve or alter the characteristics of the polypeptides of the present invention. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the polypeptides of the present invention without substantial loss of biological function. As an example, the authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), reported variant KGF proteins having heparin binding activity even after deleting 3, 8, or 27 amino-terminal amino acid residues. Similarly, Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988).)

[0135] Moreover, ample evidence demonstrates that variants often retain a biological activity similar to that of the naturally occurring protein. For example, Gayle and coworkers (J. Biol. Chem. 268:22105-22111 (1993)) conducted extensive mutational analysis of human cytokine IL-1a. They used random mutagenesis to generate over 3,500 individual IL-1a mutants that averaged 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations were examined at every possible amino acid position. The investigators found that “[m]ost of the molecule could be altered with little effect on either [binding or biological activity].”In fact, only 23 unique amino acid sequences, out of more than 3,500 nucleotide sequences examined, produced a protein that significantly differed in activity from wild-type.

[0136] Furthermore, even if deleting one or more amino acids from the N-terminus or C-terminus of a polypeptide results in modification or loss of one or more biological functions, other biological activities may still be retained. For example, the ability of a deletion variant to induce and/or to bind antibodies which recognize the secreted form will likely be retained when less than the majority of the residues of the secreted form are removed from the N-terminus or C-terminus. Whether a particular polypeptide lacking N- or C-terminal residues of a protein retains such immunogenic activities can readily be determined by routine methods described herein and otherwise known in the art.

[0137] Thus, the invention further includes polypeptide variants which show a functional activity (e.g., biological activity) of the polypeptides of the invention. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.

[0138] The present application is directed to nucleic acid molecules at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequences disclosed herein, (e.g., encoding a polypeptide having the amino acid sequence of an N and/or C terminal deletion), irrespective of whether they encode a polypeptide having functional activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having functional activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having functional activity include, inter a/ia, (1) isolating a gene or allelic or splice variants thereof in a cDNA library; (2) in situ hybridization (e.g., “FISH”) to metaphase chromosomal spreads to provide precise chromosomal location of the gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); (3) Northern Blot analysis for detecting mRNA expression in specific tissues (e.g., normal musculoskeletal system tissue or diseased musculoskeletal system tissues); and (4) in situ hybridization (e.g., histochemistry) for detecting mRNA expression in specific tissues (e.g., normal musculoskeletal system tissue or diseased musculoskeletal system tissues).

[0139] Preferred, however, are nucleic acid molecules having sequences at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequences disclosed herein, which do, in fact, encode a polypeptide having functional activity. By a polypeptide having “functional activity” is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) protein of the invention. Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a polypeptide of the invention for binding) to an anti-polypeptide of the invention antibody], immunogenicity (ability to generate antibody which binds to a specific polypeptide of the invention), ability to form multimers with polypeptides of the invention, and ability to bind to a receptor or ligand for a polypeptide of the invention.

[0140] The functional activity of the polypeptides, and fragments, variants and derivatives of the invention, can be assayed by various methods.

[0141] For example, in one embodiment where one is assaying for the ability to bind or compete with full-length polypeptide of the present invention for binding to an anti-polypeptide of the invention antibody, various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.

[0142] In another embodiment, where a ligand is identified, or the ability of a polypeptide fragment, variant or derivative of the invention to multimerize is being evaluated, binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky et al., Microbiol. Rev. 59:94-123 (1995). In another embodiment, the ability of physiological correlates of a polypeptide of the present invention to bind to a substrate(s) of the polypeptide of the invention can be routinely assayed using techniques known in the art.

[0143] In addition, assays described herein (see Examples) and otherwise known in the art may routinely be applied to measure the ability of polypeptides of the present invention and fragments, variants and derivatives thereof to elicit polypeptide related biological activity (either in vitro or in vivo). Other methods will be known to the skilled artisan and are within the scope of the invention.

[0144] Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to, for example, the nucleic acid sequence of the cDNA contained in Clone ID NO:Z, a nucleic acid sequence referred to in Table 1A (e.g., SEQ ID NO:X), a nucleic acid sequence disclosed in Table 2 (e.g., the nucleic acid sequence delineated in columns 8 and 9) or fragments thereof, will encode polypeptides “having functional activity.” In fact, since degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having functional activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.

[0145] For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., “Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions,” Science 247:1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.

[0146] The first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.

[0147] The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. See Cunningham et al., Science 244:1081-1085 (1989). The resulting mutant molecules can then be tested for biological activity.

[0148] As the authors state, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gln, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly. Besides conservative amino acid substitutions, variants of the present invention include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitutions with one or more of the amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, serum albumin (preferably human serum albumin) or a fragment or variant thereof, or leader or secretory sequence, or a sequence facilitating purification. Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein.

[0149] For example, polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity. See Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993).

[0150] A further embodiment of the invention relates to polypeptides which comprise the amino acid sequence of a polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions from a polypeptide sequence disclosed herein. Of course it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a polypeptide of SEQ ID NO:Y, an amino acid sequence encoded by SEQ ID NO:X, an amino acid sequence encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, an amino acid sequence encoded by the complement of SEQ ID NO:X, and/or the amino acid sequence encoded by cDNA contained in Clone ID NO:Z which contains, in order of ever-increasing preference, at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions.

[0151] In specific embodiments, the polypeptides of the invention comprise, or alternatively, consist of, fragments or variants of a reference amino acid sequence selected from: (a) the amino acid sequence of SEQ ID NO:Y or fragments thereof (e.g., the mature form and/or other fragments described herein); (b) the amino acid sequence encoded by SEQ ID NO:X or fragments thereof, (c) the amino acid sequence encoded by the complement of SEQ ID NO:X or fragments thereof, (d) the amino acid sequence encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or fragments thereof; and (e) the amino acid sequence encoded by cDNA contained in Clone ID NO:Z or fragments thereof; wherein the fragments or variants have 1-5,5-10, 5-25, 5-50, 10-50 or 50-150, amino acid residue additions, substitutions, and/or deletions when compared to the reference amino acid sequence. In preferred embodiments, the amino acid substitutions are conservative. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0152] Polynucleotide and Polypeptide Fragments

[0153] The present invention is also directed to polynucleotide fragments of the polynucleotides (nucleic acids) of the invention. In the present invention, a “polynucleotide fragment” refers to a polynucleotide having a nucleic acid sequence which, for example: is a portion of the cDNA contained in Clone ID NO:Z or the complementary strand thereto; is a portion of the polynucleotide sequence encoding the polypeptide encoded by the cDNA contained in Clone ID NO:Z or the complementary strand thereto; is a portion of a polynucleotide sequence encoding the amino acid sequence encoded by the region of SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or the complementary strand thereto; is a portion of the polynucleotide sequence of SEQ ID NO:X as defined in columns 8 and 9 of Table 2 or the complementary strand thereto; is a portion of the polynucleotide sequence in SEQ ID NO:X or the complementary strand thereto; is a polynucleotide sequence encoding a portion of the polypeptide of SEQ ID NO:Y; is a polynucleotide sequence encoding a portion of a polypeptide encoded by SEQ ID NO:X; is a polynucleotide sequence encoding a portion of a polypeptide encoded by the complement of the polynucleotide sequence in SEQ ID NO:X; is a portion of a polynucleotide sequence encoding the amino acid sequence encoded by the region of SEQ ID NO:B as defined in column 6 of Table 1B or the complementary strand thereto; or is a portion of the polynucleotide sequence of SEQ ID NO:B as defined in column 6 of Table 1B or the complementary strand thereto.

[0154] The polynucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length. A fragment “at least 20 nt in length,” for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in Clone ID NO:Z, or the nucleotide sequence shown in SEQ ID NO:X or the complementary stand thereto. In this context “about” includes the particularly recited value or a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. These nucleotide fragments have uses that include, but are not limited to, as diagnostic probes and primers as discussed herein. Of course, larger fragments (e.g., at least 160, 170, 180, 190, 200, 250, 500, 600, 1000, or 2000 nucleotides in length) are also encompassed by the invention.

[0155] Moreover, representative examples of polynucleotide fragments of the invention, comprise, or alternatively consist of, a sequence from about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800-850, 851-900, 901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500, 1501-1550, 1551-1600, 1601-1650, 1651-1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400, 2401-2450, 2451-2500, 2501-2550, 2551-2600, 2601-2650, 2651-2700, 2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901-2950, 2951-3000, 3001-3050, 3051-3100, 3101-3150, 3151-3200, 3201-3250, 3251-3300, 3301-3350, 3351-3400, 3401-3450, 3451-3500, 3501-3550, 3551-3600, 3601-3650, 3651-3700, 3701-3750, 3751-3800, 3801-3850, 3851-3900, 3901-3950, 3951-4000, 4001-4050, 4051-4100, 4101-4150, 4151-4200, 4201-4250, 4251-4300, 4301-4350, 4351-4400, 4401-4450, 4451-4500, 4501-4550, 4551-4600, 4601-4650, 4651-4700, 4701-4750, 4751-4800, 4801-4850, 4851-4900, 4901-4950, 4951-5000, 5001-5050, 5051-5100, 5101-5150, 5151-5200, 5201-5250, 5251-5300, 5301-5350, 5351-5400, 5401-5450, 5451-5500, 5501-5550, 5551-5600, 5601-5650, 5651-5700, 5701-5750, 5751-5800, 5801-5850, 5851-5900, 5901-5950, 5951-6000, 6001-6050, 6051-6100, 6101-6150, 6151-6200, 6201-6250, 6251-6300, 6301-6350, 6351-6400, 6401-6450, 6451-6500, 6501-6550, 6551-6600, 6601-6650, 6651-6700, 6701-6750, 6751-6800, 6801-6850, 6851-6900, 6901-6950, 6951-7000, 7001-7050, 7051-7100, 7101-7150, 7151-7200, 7201-7250, 7251-7300 or 7301 to the end of SEQ ID NO:X, or the complementary strand thereto. In this context “about” includes the particularly recited range or a range larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Preferably, these fragments encode a polypeptide which has a functional activity (e.g., biological activity). More preferably, these polynucleotides can be used as probes or primers as discussed herein. Polynucleotides which hybridize to one or more of these polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.

[0156] Further representative examples of polynucleotide fragments of the invention, comprise, or alternatively consist of, a sequence from about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800-850, 851-900, 901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500, 1501-1550, 1551-1600, 1601-1650, 1651-1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400, 2401-2450, 2451-2500, 2501-2550, 2551-2600, 2601-2650, 2651-2700, 2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901-2950, 2951-3000, 3001-3050, 3051-3100, 3101-3150, 3151-3200, 3201-3250, 3251-3300, 3301-3350, 3351-3400, 3401-3450, 3451-3500, 3501-3550, 3551-3600, 3601-3650, 3651-3700, 3701-3750, 3751-3800, 3801-3850, 3851-3900, 3901-3950, 3951-4000, 4001-4050, 4051-4100, 4101-4150, 4151-4200, 4201-4250, 4251-4300, 4301-4350, 4351-4400, 4401-4450, 4451-4500, 4501-4550, 4551-4600, 4601-4650, 4651-4700, 4701-4750, 4751-4800, 4801-4850, 4851-4900, 4901-4950, 4951-5000, 5001-5050, 5051-5100, 5101-5150, 5151-5200, 5201-5250, 5251-5300, 5301-5350, 5351-5400, 5401-5450, 5451-5500, 5501-5550, 5551-5600, 5601-5650, 5651-5700, 5701-5750, 5751-5800, 5801-5850, 5851-5900, 5901-5950, 5951-6000, 6001-6050, 6051-6100, 6101-6150, 6151-6200, 6201-6250, 6251-6300, 6301-6350, 6351-6400, 6401-6450, 6451-6500, 6501-6550, 6551-6600, 6601-6650, 6651-6700, 6701-6750, 6751-6800, 6801-6850, 6851-6900, 6901-6950, 6951-7000, 7001-7050, 7051-7100, 7101-7150, 7151-7200, 7201-7250, 7251-7300 or 7301 to the end of the cDNA sequence contained in Clone ID NO:Z, or the complementary strand thereto. In this context “about” includes the particularly recited range or a range larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Preferably, these fragments encode a polypeptide which has a functional activity (e.g., biological activity). More preferably, these polynucleotides can be used as probes or primers as discussed herein. Polynucleotides which hybridize to one or more of these polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.

[0157] Moreover, representative examples of polynucleotide fragments of the invention comprise, or alternatively consist of, a nucleic acid sequence comprising one, two, three, four, five, six, seven, eight, nine, ten, or more of the above described polynucleotide fragments of the invention in combination with a polynucleotide sequence delineated in Table 1B column 6. Additional, representative examples of polynucleotide fragments of the invention comprise, or alternatively consist of, a nucleic acid sequence comprising one, two, three, four, five, six, seven, eight, nine, ten, or more of the above described polynucleotide fragments of the invention in combination with a polynucleotide sequence that is the complementary strand of a sequence delineated in column 6 of Table 1B. In further embodiments, the above-described polynucleotide fragments of the invention comprise, or alternatively consist of, sequences delineated in Table 1B, column 6, and have a nucleic acid sequence which is different from that of the BAC fragment having the sequence disclosed in SEQ ID NO:B (see Table 1B, column 5). In additional embodiments, the above-described polynucleotide fragments of the invention comprise, or alternatively consist of, sequences delineated in Table 1B, column 6, and have a nucleic acid sequence which is different from that published for the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). In additional embodiments, the above-described polynucleotides of the invention comprise, or alternatively consist of, sequences delineated Table 1B, column 6, and have a nucleic acid sequence which is different from that contained in the BAC clone identified as BAC ID NO:A (see Table 1B, column 4). Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides and polypeptides are also encompassed by the invention.

[0158] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more fragments of the sequences delineated in column 6 of Table 1B, and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1B, column 2) or fragments or variants thereof. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0159] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more fragments of the sequences delineated in column 6 of Table 1B which correspond to the same Clone ID NO:Z (see Table 1B, column 1), and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1A or 1B) or fragments or variants thereof. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0160] In further specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, one, two, three, four, five, six, seven, eight, nine, ten, or more fragments of the sequences delineated in the same row of column 6 of Table 1B, and the polynucleotide sequence of SEQ ID NO:X (e.g., as defined in Table 1A or 1B) or fragments or variants thereof. Polypeptides encoded by these polynucleotides, other polynucleotides that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention.

[0161] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of the sequence of SEQ ID NO:X are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids that encode these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0162] In additional specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of a fragment or variant of the sequence of SEQ ID NO:X (e.g., as described herein) are directly contiguous Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0163] In further specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of a fragment or variant of the sequence of SEQ ID NO:X and the 5′ 10 polynucleotides of the sequence of one of the sequences delineated in column 6 of Table 1 B are directly contiguous. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0164] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of a polynucleotide sequence in which the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B and the 5′ 10 polynucleotides of another sequence in column 6 are directly contiguous. In preferred embodiments, the 3′ 10 polynucleotides of one of the sequences delineated in column 6 of Table 1B is directly contiguous with the 5′ 10 polynucleotides of the next sequential exon delineated in Table 1B, column 6. Nucleic acids which hybridize to the complement of these 20 contiguous polynucleotides under stringent hybridization conditions or alternatively, under lower stringency conditions, are also encompassed by the invention. Polypeptides encoded by these polynucleotides and/or nucleic acids, other polynucleotides and/or nucleic acids encoding these polypeptides, and antibodies that bind these polypeptides are also encompassed by the invention. Additionally, fragments and variants of the above-described polynucleotides, nucleic acids, and polypeptides are also encompassed by the invention.

[0165] In the present invention, a “polypeptide fragment” refers to an amino acid sequence which is a portion of that contained in SEQ ID NO:Y, a portion of an amino acid sequence encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, a portion of an amino acid sequence encoded by the polynucleotide sequence of SEQ ID NO:X, a portion of an amino acid sequence encoded by the complement of the polynucleotide sequence in SEQ ID NO:X, and/or a portion of an amino acid sequence encoded by the cDNA contained in Clone ID NO:Z. Protein (polypeptide) fragments may be “free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, 161-180, 181-200, 201-220, 221-240, 241-260, 261-280, 281-300, 301-320, 321-340, 341-360, 361-380, 381-400, 401-420, 421-440, 441-460, 461-480, 481-500, 501-520, 521-540, 541-560, 561-580, 581-600, 601-620, 621-640, 641-660, 661-680, 681-700, 701-720, 721-740, 741-760, 761-780, 781-800, 801-820, 821-840, 841-860, 861-880, 881-900, 901-920, 921-940, 941-960, 961-980, 981-1000, 1001-1020, 1021-1040, 1041-1060, 1061-1080, 1081-1100, 1101-1120, 1121-1140, 1141-1160, 1161-1180, 1181-1200, 1201-1220, 1221-1240, 1241-1260, 1261-1280, 1281-1300, 1301-1320, 1321-1340, 1341-1360, 1361-1380, 1381-1400, 1401-1420, 1421-1440, or 1441 to the end of the coding region. In a preferred embodiment, polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, 161-180, 181-200, 201-220, 221-240, 241-260, 261-280, 281-300, 301-320, 321-340, 341-360, 361-380, 381-400, 401-420, 421-440, 441-460, 461-480, 481-500, 501-520, 521-540, 541-560, 561-580, 581-600, 601-620, 621-640, 641-660, 661-680, 681-700, 701-720, 721-740, 741-760, 761-780, 781-800, 801-820, 821-840, 841-860, 861-880, 881-900, 901-920, 921-940, 941-960, 961-980, 981-1000, 1001-1020, 1021-1040, 1041-1060, 1061-1080, 1081-1100, 1101-1120, 1121-1140, 1141-1160, 1161-1180, 1181-1200, 1201-1220, 1221-1240, 1241-1260, 1261-1280, 1281-1300, 1301-1320, 1321-1340, 1341-1360, 1361-1380, 1381-1400, 1401-1420, 1421-1440, or 1441 to the end of the coding region of SEQ ID NO:Y. Moreover, polypeptide fragments of the invention may be at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, or 150 amino acids in length. In this context “about” includes the particularly recited ranges or values, or ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes. Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.

[0166] Even if deletion of one or more amino acids from the N-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind a ligand) may still be retained. For example, the ability of shortened muteins to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that a mutein with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six amino acid residues may often evoke an immune response.

[0167] Accordingly, polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids, ranging from 1-60, can be deleted from the amino terminus of either the secreted polypeptide or the mature form. Similarly, any number of amino acids, ranging from 1-30, can be deleted from the carboxy terminus of the secreted protein or mature form. Furthermore, any combination of the above amino and carboxy terminus deletions is preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.

[0168] The present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of a polypeptide disclosed herein (e.g., a polypeptide of SEQ ID NO:Y, a polypeptide encoded by the polynucleotide sequence contained in SEQ ID NO:X or the complement thereof, a polypeptide encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, a polypeptide encoded by the portion of SEQ ID NO:B as defined in column 6 of Table 1B, and/or a polypeptide encoded by the cDNA contained in Clone ID NO:Z). In particular, N-terminal deletions may be described by the general formula m-q, where q is a whole integer representing the total number of amino acid residues in a polypeptide of the invention (e.g., the polypeptide disclosed in SEQ ID NO:Y, or the polypeptide encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2), and m is defined as any integer ranging from 2 to q-6. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0169] The present invention further provides polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of a polypeptide disclosed herein (e.g., a polypeptide of SEQ ID NO:Y, a polypeptide encoded by the polynucleotide sequence contained in SEQ ID NO:X, a polypeptide encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, and/or a polypeptide encoded by the cDNA contained in Clone ID NO:Z). In particular, C-terminal deletions may be described by the general formula 1-n, where n is any whole integer ranging from 6 to q-1, and where n corresponds to the position of amino acid residue in a polypeptide of the invention. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0170] In addition, any of the above described N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted polypeptide. The invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues m-n of a polypeptide encoded by SEQ ID NO:X (e.g., including, but not limited to, the preferred polypeptide disclosed as SEQ ID NO:Y and the polypeptide encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2), the cDNA contained in Clone ID NO:Z, and/or the complement thereof, where n and m are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0171] Also as mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind a ligand) may still be retained. For example the ability of the shortened mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that a mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six amino acid residues may often evoke an immune response.

[0172] The present application is also directed to proteins containing polypeptides at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a polypeptide sequence set forth herein. In preferred embodiments, the application is directed to proteins containing polypeptides at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific N- and C-terminal deletions. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0173] Any polypeptide sequence encoded by, for example, the polynucleotide sequences set forth as SEQ ID NO:X or the complement thereof, (presented, for example, in Tables 1A and 2), the cDNA contained in Clone ID NO:Z, or the polynucleotide sequence as defined in column 6 of Table 1B, may be analyzed to determine certain preferred regions of the polypeptide. For example, the amino acid sequence of a polypeptide encoded by a polynucleotide sequence of SEQ ID NO:X (e.g., the polypeptide of SEQ ID NO:Y and the polypeptide encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2) or the cDNA contained in Clone ID NO:Z may be analyzed using the default parameters of the DNASTAR computer algorithm (DNASTAR, Inc., 1228 S. Park St., Madison, Wis. 53715 USA; http://www.dnastar.com/).

[0174] Polypeptide regions that may be routinely obtained using the DNASTAR computer algorithm include, but are not limited to, Gamier-Robson alpha-regions, beta-regions, tum-regions, and coil-regions; Chou-Fasman alpha-regions, beta-regions, and turn-regions; Kyte-Doolittle hydrophilic regions and hydrophobic regions; Eisenberg alpha- and beta-amphipathic regions; Karplus-Schulz flexible regions; Emini surface-forming regions; and Jameson-Wolf regions of high antigenic index. Among highly preferred polynucleotides of the invention in this regard are those that encode polypeptides comprising regions that combine several structural features, such as several (e.g., 1, 2, 3 or 4) of the features set out above.

[0175] Additionally, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Emini surface-forming regions, and Jameson-Wolf regions of high antigenic index (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) can routinely be used to determine polypeptide regions that exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from data by DNASTAR analysis by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.

[0176] Preferred polypeptide fragments of the invention are fragments comprising, or alternatively, consisting of, an amino acid sequence that displays a functional activity (e.g. biological activity) of the polypeptide sequence of which the amino acid sequence is a fragment. By a polypeptide displaying a “functional activity” is meant a polypeptide capable of one or more known functional activities associated with a full-length protein, such as, for example, biological activity, antigenicity, immunogenicity, and/or multimerization, as described herein.

[0177] Other preferred polypeptide fragments are biologically active fragments. Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the polypeptide of the present invention. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.

[0178] In preferred embodiments, polypeptides of the invention comprise, or alternatively consist of, one, two, three, four, five or more of the antigenic fragments of the polypeptide of SEQ ID NO:Y, or portions thereof. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0179] The present invention encompasses polypeptides comprising, or alternatively consisting of, an epitope of: the polypeptide sequence shown in SEQ ID NO:Y; a polypeptide sequence encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide sequence encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2; the polypeptide sequence encoded by the portion of SEQ ID NO:B as defined in column 6 of Table 1B or the complement thereto; the polypeptide sequence encoded by the cDNA contained in Clone ID NO:Z; or the polypeptide sequence encoded by a polynucleotide that hybridizes to the sequence of SEQ ID NO:X, the complement of the sequence of SEQ ID NO:X, the complement of a portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, or the cDNA sequence contained in Clone ID NO:Z under stringent hybridization conditions or alternatively, under lower stringency hybridization as defined supra. The present invention further encompasses polynucleotide sequences encoding an epitope of a polypeptide sequence of the invention (such as, for example, the sequence disclosed in SEQ ID NO:X, or a fragment thereof), polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope of the invention, and polynucleotide sequences which hybridize to the complementary strand under stringent hybridization conditions or alternatively, under lower stringency hybridization conditions defined supra.

[0180] The term “epitopes,” as used herein, refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human. In a preferred embodiment, the present invention encompasses a polypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide. An “immunogenic epitope,” as used herein, is defined as a portion of a protein that elicits an antibody response in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described infra. (See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002 (1983)). The term “antigenic epitope,” as used herein, is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art, for example, by the immunoassays described herein. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross-reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic.

[0181] Fragments, which function as epitopes may be produced by any conventional means. (See, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985) further described in U.S. Pat. No. 4,631,211.)

[0182] In the present invention, antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 15 to about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof. Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies that specifically bind the epitope. Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these antigenic epitopes. Antigenic epitopes can be used as the target molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science 219:660-666 (1983)).

[0183] Non-limiting examples of epitopes of polypeptides that can be used to generate antibodies of the invention include a polypeptide comprising, or alternatively consisting of, at least one, two, three, four, five, six or more of the portion(s) of SEQ ID NO:Y specified in column 6 of Table 1A. These polypeptide fragments have been determined to bear antigenic epitopes of the proteins of the invention by the analysis of the Jameson-Wolf antigenic index, which is included in the DNAStar suite of computer programs. By “comprise” it is intended that a polypeptide contains at least one, two, three, four, five, six or more of the portion(s) of SEQ ID NO:Y shown in column 6 of Table 1A, but it may contain additional flanking residues on either the amino or carboxyl termini of the recited portion. Such additional flanking sequences are preferably sequences naturally found adjacent to the portion; i.e., contiguous sequence shown in SEQ ID NO:Y. The flanking sequence may, however, be sequences from a heterologous polypeptide, such as from another protein described herein or from a heterologous polypeptide not described herein. In particular embodiments, epitope portions of a polypeptide of the invention comprise one, two, three, or more of the portions of SEQ ID NO:Y shown in column 6 of Table 1A. Polynucleotides encoding these polypeptides are also encompassed by the invention.

[0184] Similarly, immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes. The polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids), the polypeptide may be presented without a carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting).

[0185] Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol, 66:2347-2354 (1985). If in vivo immunization is used, animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing cysteine residues may be coupled to a carrier using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde. Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 μg of peptide or carrier protein and Freund's adjuvant or any other adjuvant known for stimulating an immune response. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.

[0186] As one of skill in the art will appreciate, and as discussed above, the polypeptides of the present invention (e.g., those comprising an immunogenic or antigenic epitope) can be fused to heterologous polypeptide sequences. For example, polypeptides of the present invention (including fragments or variants thereof), may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1, CH2, CH3, or any combination thereof and portions thereof, resulting in chimeric polypeptides. By way of another non-limiting example, polypeptides and/or antibodies of the present invention (including fragments or variants thereof) may be fused with albumin (including but not limited to recombinant human serum albumin or fragments or variants thereof (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein incorporated by reference in their entirety)). In a preferred embodiment, polypeptides and/or antibodies of the present invention (including fragments or variants thereof) are fused with the mature form of human serum albumin (i.e., amino acids 1-585 of human serum albumin as shown in FIGS. 1 and 2 of EP Patent 0 322 094) which is herein incorporated by reference in its entirety. In another preferred embodiment, polypeptides and/or antibodies of the present invention (including fragments or variants thereof) are fused with polypeptide fragments comprising, or alternatively consisting of, amino acid residues 1-z of human serum albumin, where z is an integer from 369 to 419, as described in U.S. Pat. No. 5,766,883 herein incorporated by reference in its entirety. Polypeptides and/or antibodies of the present invention (including fragments or variants thereof) may be fused to either the N- or C-terminal end of the heterologous protein (e.g., immunoglobulin Fc polypeptide or human serum albumin polypeptide). Polynucleotides encoding fusion proteins of the invention are also encompassed by the invention.

[0187] Such fusion proteins as those described above may facilitate purification and may increase half-life in vivo. This has been shown for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827; Traunecker et al., Nature, 331:84-86 (1988). Enhanced delivery of an antigen across the epithelial barrier to the immune system has been demonstrated for antigens (e.g., insulin) conjugated to an FcRn binding partner such as IgG or Fc fragments (see, e.g., PCT Publications WO 96/22024 and WO 99/04813). IgG Fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion desulfide bonds have also been found to be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem, 270:3958-3964 (1995). Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag (e.g., the hemagglutinin (HA) tag or flag tag) to aid in detection and purification of the expressed polypeptide. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. The tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged proteins can be selectively eluted with imidazole-containing buffers.

[0188] Fusion Proteins

[0189] Any polypeptide of the present invention can be used to generate fusion proteins. For example, the polypeptide of the present invention, when fused to a second protein, can be used as an antigenic tag. Antibodies raised against the polypeptide of the present invention can be used to indirectly detect the second protein by binding to the polypeptide. Moreover, because secreted proteins target cellular locations based on trafficking signals, polypeptides of the present invention which are shown to be secreted can be used as targeting molecules once fused to other proteins.

[0190] Examples of domains that can be fused to polypeptides of the present invention include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily need to be direct, but may occur through linker sequences.

[0191] In certain preferred embodiments, proteins of the invention are fusion proteins comprising an amino acid sequence that is an N and/or C-terminal deletion of a polypeptide of the invention. In preferred embodiments, the invention is directed to a fusion protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a polypeptide sequence of the invention. Polynucleotides encoding these proteins are also encompassed by the invention.

[0192] Moreover, fusion proteins may also be engineered to improve characteristics of the polypeptide of the present invention. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.

[0193] As one of skill in the art will appreciate that, as discussed above, polypeptides of the present invention, and epitope-bearing fragments thereof, can be combined with heterologous polypeptide sequences. For example, the polypeptides of the present invention may be fused with heterologous polypeptide sequences, for example, the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CH1, CH2, CH3, and any combination thereof, including both entire domains and portions thereof), or albumin (including, but not limited to, native or recombinant human albumin or fragments or variants thereof (see, e.g., U.S. Pat. No. 5,876,969, issued Mar. 2, 1999, EP Patent 0 413 622, and U.S. Pat. No. 5,766,883, issued Jun. 16, 1998, herein incorporated by reference in their entirety)), resulting in chimeric polypeptides. For example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties (EP-A 0232 262). Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fe portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fe portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995); K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).

[0194] Moreover, the polypeptides of the present invention can be fused to marker sequences, such as a polypeptide, which facilitates purification of the fused polypeptide. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Another peptide tag useful for purification, the “HA” tag, corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984).)

[0195] Additional fusion proteins of the invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as “DNA shuffling”), briefly described below, and further described herein. DNA shuffling may be employed to modulate the activities of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. See, generally, U.S. Pat. Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol. 16(2):76-82 (1998); Hansson et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco, Biotechniques 24(2):308-13 (1998); each of these patents and publications are hereby incorporated by reference in its entirety). In a preferred embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc., of one or more heterologous molecules encoding a heterologous polypeptide.

[0196] Thus, any of these above fusions can be engineered using the polynucleotides or the polypeptides of the present invention.

[0197] Recombinant and Synthetic Production of Polypeptides of the Invention

[0198] The present invention also relates to vectors containing the polynucleotide of the present invention, host cells, and the production of polypeptides by synthetic and recombinant techniques. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.

[0199] The polynucleotides of the invention may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

[0200] The polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.

[0201] As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance, glutamine synthase, for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, NSO and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.

[0202] Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, and PAO815 (all available from Invitrogen, Carlsbad, Calif.). Other suitable vectors will be readily apparent to the skilled artisan.

[0203] Vectors which use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulphoximine or methotrexate, respectively. An advantage of glutamine synthase based vectors is the availabilty of cell lines (e.g., the murine myeloma cell line, NS0) which are glutamine synthase negative. Glutamine synthase expression systems can also function in glutamine synthase expressing cells (e.g., Chinese Hamster Ovary (CHO) cells) by providing additional inhibitor to prevent the functioning of the endogenous gene. A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and WO91/06657, which are hereby incorporated in their entireties by reference herein. Additionally, glutamine synthase expression vectors can be obtained from Lonza Biologics, Inc. (Portsmouth, N.H.). Expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells is described in Bebbington et al., Bio/technology 10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11: 1 (1995) which are herein incorporated by reference.

[0204] The present invention also relates to host cells containing the above-described vector constructs described herein, and additionally encompasses host cells containing nucleotide sequences of the invention that are operably associated with one or more heterologous control regions (e.g., promoter and/or enhancer) using techniques known of in the art. The host cell can be a higher eukaryotic cell, such as a mammalian cell (e.g., a human derived cell), or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. A host strain may be chosen, which modulates the expression of the inserted gene sequences, or modifies and processes the gene product in the specific fashion desired. Expression from certain promoters can be elevated in the presence of certain inducers; thus expression of the genetically engineered polypeptide may be controlled. Furthermore, different host cells have characteristics and specific mechanisms for the translational and post-translational processing and modification (e.g., phosphorylation, cleavage) of proteins. Appropriate cell lines can be chosen to ensure the desired modifications and processing of the foreign protein expressed.

[0205] Introduction of the nucleic acids and nucleic acid constructs of the invention into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986). It is specifically contemplated that the polypeptides of the present invention may in fact be expressed by a host cell lacking a recombinant vector.

[0206] In addition to encompassing host cells containing the vector constructs discussed herein, the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., musculoskeletal system antigen coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with musculoskeletal system associated polynucleotides of the invention, and which activates, alters, and/or amplifies endogenous musculoskeletal system associated polynucleotides. For example, techniques known in the art may be used to operably associate heterologous control regions (e.g., promoter and/or enhancer) and endogenous musculoskeletal system associated polynucleotide sequences via homologous recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International Publication Number WO 96/29411; International Publication Number WO 94/12650; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), the disclosures, of each of which are incorporated by reference in their entireties).

[0207] Polypeptides of the present invention can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.

[0208] In one embodiment, the yeast Pichia pastoris is used to express polypeptides of the invention in a eukaryotic system. Pichia pastoris is a discussed herein, the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., musculoskeletal system antigen coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with musculoskeletal system associated polynucleotides of the invention, and which activates, alters, and/or amplifies endogenous musculoskeletal system associated polynucleotides. For example, techniques known in the art may be used to operably associate heterologous control regions (e.g., promoter and/or enhancer) and endogenous musculoskeletal system associated polynucleotide sequences via homologous recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International Publication Number WO 96/29411; International Publication Number WO 94/12650; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each of which are incorporated by reference in their entireties).

[0209] Polypeptides of the present invention can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.

[0210] In one embodiment, the yeast Pichia pastoris is used to express polypeptides of the invention in a eukaryotic system. Pichia pastoris is a methylotrophic yeast which can metabolize methanol as its sole carbon source. A main step in the methanol metabolization pathway is the oxidation of methanol to formaldehyde using O2. This reaction is catalyzed by the enzyme alcohol oxidase. In order to metabolize methanol as its sole carbon source, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for O2. Consequently, in a growth medium depending on methanol as a main carbon source, the promoter region of one of the two alcohol oxidase genes (AOX1) is highly active. In the presence of methanol, alcohol oxidase produced from the AOX1 gene comprises up to approximately 30% of the total soluble protein in Pichia pastoris. See, Ellis, S. B., et al., Mol. Cell. Biol. 5:1111-21 (1985); Koutz, P. J, et al., Yeast 5:167-77 (1989); Tschopp, J. F., et al., Nucl. Acids Res. 15:3859-76 (1987). Thus, a heterologous coding sequence, such as, for example, a polynucleotide of the present invention, under the transcriptional regulation of all or part of the AOX1 regulatory sequence is expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol.

[0211] In one example, the plasmid vector pPIC9K is used to express DNA encoding a polypeptide of the invention, as set forth herein, in a Pichea yeast system essentially as described in “Pichia Protocols: Methods in Molecular Biology,” D. R. Higgins and J. Cregg, eds. The Humana Press, Totowa, N.J., 1998. This expression vector allows expression and secretion of a polypeptide of the invention by virtue of the strong AOX1 promoter linked to the Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide (i.e., leader) located upstream of a multiple cloning site.

[0212] Many other yeast vectors could be used in place of pPIC9K, such as, pYES2, pYD1, pTEF1/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, and PA0815, as one skilled in the art would readily appreciate, as long as the proposed expression construct provides appropriately located signals for transcription, translation, secretion (if desired), and the like, including an in-frame AUG as required.

[0213] In another embodiment, high-level expression of a heterologous coding sequence, such as, for example, a polynucleotide of the present invention, may be achieved by cloning the heterologous polynucleotide of the invention into an expression vector such as, for example, pGAPZ or pGAPZalpha, and growing the yeast culture in the absence of methanol.

[0214] In addition to encompassing host cells containing the vector constructs discussed herein, the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with polynucleotides of the invention, and which activates, alters, and/or amplifies endogenous polynucleotides. For example, techniques known in the art may be used to operably associate heterologous control regions (e.g., promoter and/or enhancer) and endogenous polynucleotide sequences via homologous recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International Publication No. WO 96/29411, published Sep. 26, 1996; International Publication No. WO 94/12650, published Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each of which are incorporated by reference in their entireties).

[0215] In addition, polypeptides of the invention can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W. H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-111 (1984)). For example, a polypeptide corresponding to a fragment of a polypeptide can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).

[0216] The invention encompasses polypeptides of the present invention which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.

[0217] Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.

[0218] Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include iodine (121I, 123I, 125I, 131I), carbon (14C), sulfur (35S), tritium (3H), indium (111In, 112In, 113mIn, 115mIn), technetium (99Tc, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, and 97Ru.

[0219] In specific embodiments, a polypeptide of the present invention or fragment or variant thereof is attached to macrocyclic chelators that associate with radiometal ions, including but not limited to, 177Lu, 90Y, 166Ho, and 153Sm, to polypeptides. In a preferred embodiment, the radiometal ion associated with the macrocyclic chelators is 111In. In another preferred embodiment, the radiometal ion associated with the macrocyclic chelator is 90Y. In specific embodiments, the macrocyclic chelator is 1,4,7,10-tetraazacyclododecane-N,N′,N″,N′″-tetraacetic acid (DOTA). In other specific embodiments, DOTA is attached to an antibody of the invention or fragment thereof via a linker molecule. Examples of linker molecules useful for conjugating DOTA to a polypeptide are commonly known in the art—see, for example, DeNardo et al., Clin Cancer Res. 4(10):2483-90 (1998); Peterson et al., Bioconjug. Chem. 10(4):553-7 (1999); and Zimmerman et al, Nucl. Med. Biol. 26(8):943-50 (1999); which are hereby incorporated by reference in their entirety.

[0220] As mentioned, the musculoskeletal system associated proteins of the invention may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given musculoskeletal system associated polypeptide. Musculoskeletal system associated polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic musculoskeletal system associated polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, PROTEINS—STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth. Enzymol. 182:626-646 (1990); Rattan et al., Ann. N.Y. Acad. Sci. 663:48-62 (1992)).

[0221] Also provided by the invention are chemically modified derivatives of the polypeptides of the invention which may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Pat. No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.

[0222] The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (the term “about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog). For example, the polyethylene glycol may have an average molecular weight of about 200, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000, 35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000, 85,000, 90,000, 95,000, or 100,000 kDa.

[0223] As noted above, the polyethylene glycol may have a branched structure. Branched polyethylene glycols are described, for example, in U.S. Pat. No. 5,643,575; Morpurgo et al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the disclosures of each of which are incorporated herein by reference.

[0224] The polyethylene glycol molecules (or other chemical moieties) should be attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art, such as, for example, the method disclosed in EP 0 401 384 (coupling PEG to G-CSF), herein incorporated by reference; see also Malik et al., Exp. Hematol. 20:1028-1035 (1992), reporting pegylation of GM-CSF using tresyl chloride. For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.

[0225] As suggested above, polyethylene glycol may be attached to proteins via linkage to any of a number of amino acid residues. For example, polyethylene glycol can be linked to proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic acid, or cysteine residues. One or more reaction chemistries may be employed to attach polyethylene glycol to specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic acid, or cysteine) of the protein or to more than one type of amino acid residue (e.g., lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations thereof) of the protein.

[0226] One may specifically desire proteins chemically modified at the N-terminus. Using polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.

[0227] As indicated above, pegylation of the proteins of the invention may be accomplished by any number of means. For example, polyethylene glycol may be attached to the protein either directly or by an intervening linker. Linkerless systems for attaching polyethylene glycol to proteins are described in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992); Francis et al., Intern. J. of Hematol. 68:1-18 (1998); U.S. Pat. No. 4,002,531; U.S. Pat. No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of each of which are incorporated herein by reference.

[0228] One system for attaching polyethylene glycol directly to amino acid residues of proteins without an intervening linker employs tresylated MPEG, which is produced by the modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride (ClSO2CH2CF3). Upon reaction of protein with tresylated MPEG, polyethylene glycol is directly attached to amine groups of the protein. Thus, the invention includes protein-polyethylene glycol conjugates produced by reacting proteins of the invention with a polyethylene glycol molecule having a 2,2,2-trifluoreothane sulphonyl group.

[0229] Polyethylene glycol can also be attached to proteins using a number of different intervening linkers. For example, U.S. Pat. No. 5,612,460, the entire disclosure of which is incorporated herein by reference, discloses urethane linkers for connecting polyethylene glycol to proteins. Protein-polyethylene glycol conjugates wherein the polyethylene glycol is attached to the protein by a linker can also be produced by reaction of proteins with compounds such as MPEG-succinimidylsuccinate, MPEG activated with 1,1′-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-nitrophenolcarbonate, and various MPEG-succinate derivatives. A number of additional polyethylene glycol derivatives and reaction chemistries for attaching polyethylene glycol to proteins are described in International Publication No. WO 98/32466, the entire disclosure of which is incorporated herein by reference. Pegylated protein products produced using the reaction chemistries set out herein are included within the scope of the invention.

[0230] The number of polyethylene glycol moieties attached to each protein of the invention (i.e., the degree of substitution) may also vary. For example, the pegylated proteins of the invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules. Similarly, the average degree of substitution within ranges such as 1-3,2-4, 3-5,4-6, 5-7,6-8, 7-9,8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17, 16-18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule. Methods for determining the degree of substitution are discussed, for example, in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992).

[0231] The musculoskeletal system associated polypeptides of the invention can be recovered and purified from chemical synthesis and recombinant cell cultures by standard methods which include, but are not limited to, ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification. Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and/or purification.

[0232] Musculoskeletal system associated polynucleotides and polypeptides may be used in accordance with the present invention for a variety of applications, particularly those that make use of the chemical and biological properties of musculoskeletal system associated antigens. Among these are applications in the detection, prevention, diagnosis and/or treatment of diseases associated with musculoskeletal system, such as e.g., bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or those disorders described under “Musculoskeletal System Disorders”. Additional applications relate to diagnosis and to treatment of disorders of cells, tissues and organisms. These aspects of the invention are discussed further below.

[0233] In a preferred embodiment, polynucleotides expressed in a particular tissue type are used to detect, diagnose, treat, prevent and/or prognose disorders associated with the tissue type.

[0234] The polypeptides of the invention may be in monomers or multimers (i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the polypeptides of the invention, their preparation, and compositions (preferably, Therapeutics) containing them. In specific embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers. In additional embodiments, the multimers of the invention are at least dimers, at least trimers, or at least tetramers.

[0235] Multimers encompassed by the invention may be homomers or heteromers. As used herein, the term homomer refers to a multimer containing only polypeptides corresponding to a protein of the invention (e.g., the amino acid sequence of SEQ ID NO:Y, an amino acid sequence encoded by SEQ ID NO:X or the complement of SEQ ID NO:X, the amino acid sequence encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, and/or an amino acid sequence encoded by cDNA contained in Clone ID NO:Z (including fragments, variants, splice variants, and fusion proteins, corresponding to these as described herein)). These homomers may contain polypeptides having identical or different amino acid sequences. In a specific embodiment, a homomer of the invention is a multimer containing only polypeptides having an identical amino acid sequence. In another specific embodiment, a homomer of the invention is a multimer containing polypeptides having different amino acid sequences. In specific embodiments, the multimer of the invention is a homodimer (e.g., containing two polypeptides having identical or different amino acid sequences) or a homotrimer (e.g., containing three polypeptides having identical and/or different amino acid sequences). In additional embodiments, the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.

[0236] As used herein, the term heteromer refers to a multimer containing two or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the polypeptides of the invention. In a specific embodiment, the multimer of the invention is a heterodimer, a heterotrimer, or a heterotetramer. In additional embodiments, the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.

[0237] Multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and/or covalent associations and/or may be indirectly linked by, for example, liposome formation. Thus, in one embodiment, multimers of the invention, such as, for example, homodimers or homotrimers, are formed when polypeptides of the invention contact one another in solution. In another embodiment, heteromultimers of the invention, such as, for example, heterotrimers or heterotetramers, are formed when polypeptides of the invention contact antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in a fusion protein of the invention) in solution. In other embodiments, multimers of the invention are formed by covalent associations with and/or between the polypeptides of the invention. Such covalent associations may involve one or more amino acid residues contained in the polypeptide sequence (e.g., that recited in SEQ ID NO:Y, encoded by the portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, and/or encoded by the cDNA contained in Clone ID NO:Z). In one instance, the covalent associations are cross-linking between cysteine residues located within the polypeptide sequences which interact in the native (i.e., naturally occurring) polypeptide. In another instance, the covalent associations are the consequence of chemical or recombinant manipulation. Alternatively, such covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a fusion protein. In one example, covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, e.g., U.S. Pat. No. 5,478,925). In a specific example, the covalent associations are between the heterologous sequence contained in a Fc fusion protein of the invention (as described herein). In another specific example, covalent associations of fusion proteins of the invention are between heterologous polypeptide sequence from another protein that is capable of forming covalently associated multimers, such as for example, osteoprotegerin (see, e.g., International Publication NO: WO 98/49305, the contents of which are herein incorporated by reference in its entirety). In another embodiment, two or more polypeptides of the invention are joined through peptide linkers. Examples include those peptide linkers described in U.S. Pat. No. 5,073,627 (hereby incorporated by reference). Proteins comprising multiple polypeptides of the invention separated by peptide linkers may be produced using conventional recombinant DNA technology.

[0238] Another method for preparing multimer polypeptides of the invention involves use of polypeptides of the invention fused to a leucine zipper or isoleucine zipper polypeptide sequence. Leucine zipper and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al., Science 240:1759, (1988)), and have since been found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize. Examples of leucine zipper domains suitable for producing soluble multimeric proteins of the invention are those described in PCT application WO 94/10308, hereby incorporated by reference. Recombinant fusion proteins comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimerizes in solution are expressed in suitable host cells, and the resulting soluble multimeric fusion protein is recovered from the culture supernatant using techniques known in the art.

[0239] Trimeric polypeptides of the invention may offer the advantage of enhanced biological activity. Preferred leucine zipper moieties and isoleucine moieties are those that preferentially form trimers. One example is a leucine zipper derived from lung surfactant protein D (SPD), as described in Hoppe et al. (FEBS Letters 344:191, (1994)) and in U.S. patent application Ser. No. 08/446,922, hereby incorporated by reference. Other peptides derived from naturally occurring trimeric proteins may be employed in preparing trimeric polypeptides of the invention.

[0240] In another example, proteins of the invention are associated by interactions between Flag® polypeptide sequence contained in fusion proteins of the invention containing Flag® polypeptide sequence. In a further embodiment, proteins of the invention are associated by interactions between heterologous polypeptide sequence contained in Flag® fusion proteins of the invention and anti-Flag® antibody.

[0241] The multimers of the invention may be generated using chemical techniques known in the art. For example, polypeptides desired to be contained in the multimers of the invention may be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety). Additionally, multimers of the invention may be generated using techniques known in the art to form one or more inter-molecule cross-links between the cysteine residues located within the sequence of the polypeptides desired to be contained in the multimer (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety). Further, polypeptides of the invention may be routinely modified by the addition of cysteine or biotin to the C-terminus or N-terminus of the polypeptide and techniques known in the art may be applied to generate multimers containing one or more of these modified polypeptides (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety). Additionally, techniques known in the art may be applied to generate liposomes containing the polypeptide components desired to be contained in the multimer of the invention (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety).

[0242] Alternatively, multimers of the invention may be generated using genetic engineering techniques known in the art. In one embodiment, polypeptides contained in multimers of the invention are produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety). In a specific embodiment, polynucleotides coding for a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a linker polypeptide and then further to a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety). In another embodiment, recombinant techniques described herein or otherwise known in the art are applied to generate recombinant polypeptides of the invention which contain a transmembrane domain (or hydrophobic or signal peptide) and which can be incorporated by membrane reconstitution techniques into liposomes (see, e.g., U.S. Pat. No. 5,478,925, which is herein incorporated by reference in its entirety).

[0243] Antibodies

[0244] Further polypeptides of the invention relate to antibodies and T-cell antigen receptors (TCR) which immunospecifically bind a polypeptide, polypeptide fragment, or variant of the invention (e.g., a polypeptide or fragment or variant of the amino acid sequence of SEQ ID NO:Y or a polypeptide encoded by the cDNA contained in Clone ID NO:Z, and/or an epitope, of the present invention) as determined by immunoassays well known in the art for assaying specific antibody-antigen binding. Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab′) fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), intracellularly-made antibodies (i.e., intrabodies), and epitope-binding fragments of any of the above. The term “antibody,” as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule. In preferred embodiments, the immunoglobulin molecules of the invention are IgG1. In other preferred embodiments, the immunoglobulin molecules of the invention are IgG4.

[0245] Most preferably the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab′ and F(ab′)2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CH 1, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, “human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.

[0246] The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Pat. Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).

[0247] Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention, which they recognize or specifically bind. The epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, or by size in contiguous amino acid residues, or listed in the Tables and Figures. Preferred epitopes of the invention include those shown in column 6 of Table 1A, as well as polynucleotides that encode these epitopes. Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.

[0248] Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in-the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In a specific embodiment, the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein. Further included in the present invention are antibodies, which bind polypeptides encoded by polynucleotides, which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein). Antibodies of the present invention may also be described or specified in terms of their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant or Kd less than 5×10−2 M, 10−2 M, 5×10−3 M, 10−3 M, 5×10−4 M, 10−4 M, 5×10−5 M, 10−5 M, 5×10−6 M, 10−6M, 5×10−7 M, 10−7 M, 5×10−8 M, 10−8 M, 5×10−9 M, 10−9 M, 5×10−10 M, 10−10 M, 5×10−11 M, 10−11 M, 5×10−12 M, 10−12 M, 5×10−13 M, 10−13 M, 5×10−14 M, 10−14 M, 5×10−15 M, or 10−15 M.

[0249] The invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herei-n. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.

[0250] Antibodies of the present invention may act as agonists or antagonists of the polypeptides of the present invention. For example, the present invention includes antibodies, which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully. Preferably, antibodies of the present invention bind an antigenic epitope disclosed herein, or a portion thereof. The invention features both receptor-specific antibodies and ligand-specific antibodies. The invention also features receptor-specific antibodies, which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art. For example, receptor activation can be determined by detecting the phosphorylation (e.g., tyrosine or serine/threonine) of the receptor or its substrate by immunoprecipitation followed by western blot analysis (for example, as described supra). In specific embodiments, antibodies are provided that inhibit ligand activity or receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% of the activity in absence of the antibody.

[0251] The invention also features receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand. Likewise, included in the invention are neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor. Further included in the invention are antibodies, which activate the receptor. These antibodies may act as receptor agonists, i.e., potentiate or activate either all or a subset of the biological activities of the ligand-mediated receptor activation, for example, by inducing dimerization of the receptor. The antibodies may be specified as agonists, antagonists or inverse agonists for biological activities comprising the specific biological activities of the peptides of the invention disclosed herein. The above antibody agonists can be made using methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Pat. No. 5,811,097; Deng et al., Blood 92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179 (1998); Prat et al., J. Cell. Sci. 111(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods 205(2):177-190 (1997); Liautard et al., Cytokine 9(4):233-241 (1997); Carlson et al., J. Biol. Chem. 272(17):11295-11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995); Muller et al., Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine 8(1):14-20 (1996) (which are all incorporated by reference herein in their entireties).

[0252] Antibodies of the present invention may be used, for example, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies have utility in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., Ahtibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); incorporated by reference herein in its entirety.

[0253] As discussed in more detail below, the antibodies of the present invention may be used either alone or in combination with other compositions. The antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalent and non-covalent conjugations) to polypeptides or other compositions. For example, antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Pat. No. 5,314,995; and EP 396,387; the disclosures of which are incorporated herein by reference in their entireties.

[0254] The antibodies of the invention include derivatives that are modified, i.e., by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from generating an anti-idiotypic response. For example, but not by way of limitation, the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.

[0255] The antibodies of the present invention may be generated by any suitable method known in the art. Polyclonal antibodies to an antigen-of-interest can be produced by various procedures well known in the art. For example, a polypeptide of the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen. Various adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art.

[0256] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references incorporated by reference in their entireties). The term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology. The term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

[0257] Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art and are discussed in detail in the Examples. In a non-limiting example, mice can be immunized with a polypeptide of the invention or a cell expressing such peptide. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.

[0258] Accordingly, the present invention provides methods of generating monoclonal antibodies, as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind a polypeptide of the invention.

[0259] Another well known method for producing both polyclonal and monoclonal human B cell lines is transformation using Epstein Barr Virus (EBV). Protocols for generating EBV-transformed B cell lines are commonly known in the art, such as, for example, the protocol outlined in Chapter 7.22 of Current Protocols in Immunology, Coligan et al., Eds., 1994, John Wiley & Sons, NY, which is hereby incorporated in its entirety by reference herein. The source of B cells for transformation is commonly human peripheral blood, but B cells for transformation may also be derived from other sources including, but not limited to, lymph nodes, tonsil, spleen, tumor tissue, and infected tissues. Tissues are generally made into single cell suspensions prior to EBV transformation. Additionally, steps may be taken to either physically remove or inactivate T cells (e.g., by treatment with cyclosporin A) in B cell-containing samples, because T cells from individuals seropositive for anti-EBV antibodies can suppress B cell immortalization by EBV.

[0260] In general, the sample containing human B cells is innoculated with EBV, and cultured for 3-4 weeks. A typical source of EBV is the culture supernatant of the B95-8 cell line (ATCC #VR-1492). Physical signs of EBV transformation can generally be seen towards the end of the 3-4 week culture period. By phase-contrast microscopy, transformed cells may appear large, clear, hairy and tend to aggregate in tight clusters of cells. Initially, EBV lines are generally polyclonal. However, over prolonged periods of cell cultures, EBV lines may become monoclonal or polyclonal as a result of the selective outgrowth of particular B cell clones. Alternatively, polyclonal EBV transformed lines may be subcloned (e.g., by limiting dilution culture) or fused with a suitable fusion partner and plated at limiting dilution to obtain monoclonal B cell lines. Suitable fusion partners for EBV transformed cell lines include mouse myeloma cell lines (e.g., SP2/0, X63-Ag8.653), heteromyeloma cell lines (human×mouse; e.g, SPAM-8, SBC-H2O, and CB-F7), and human cell lines (e.g., GM 1500, SKO-007, RPMI 8226, and KR-4). Thus, the present invention also provides a method of generating polyclonal or monoclonal human antibodies against polypeptides of the invention or fragments thereof, comprising EBV-transformation of human B cells.

[0261] Antibody fragments, which recognize specific epitopes may be generated by known techniques. For example, Fab and F(ab′)2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab′)2 fragments). F(ab′)2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain. For example, the antibodies of the present invention can also be generated using various phage display methods known in the art and as discussed in detail in the Examples (e.g., Example 10). In phage display methods, functional antibody domains are displayed on the surface of phage particles, which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57:191-280 (1994); PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.

[0262] As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab′ and F(ab′)2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-1043 (1988) (said references incorporated by reference in their entireties).

[0263] Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J. Immunol. Methods 125:191-202; U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816397, which are incorporated herein by reference in their entirety. Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and a framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entireties.) Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332).

[0264] Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.

[0265] Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring, which express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Pat. Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181 and 6,114,598, which are incorporated by reference herein in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.

[0266] Completely human antibodies, which recognize a selected epitope can be generated using a technique referred to as “guided selection.” In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology 12:899-903 (1988)).

[0267] Further, antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that “mimic” polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example, antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that “mimic” the polypeptide multimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand/receptor. For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligand(s)/receptor(s), and thereby block its biological activity. Alternatively, antibodies, which bind to and enhance polypeptide multimerization and/or binding, and/or receptor/ligand multimerization, binding and/or signaling can be used to generate anti-idiotypes that function as agonists of a polypeptide of the invention and/or its ligand/receptor. Such agonistic anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens as agonists of the polypeptides of the invention or its ligand(s)/receptor(s). For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligand(s)/receptor(s), and thereby promote or enhance its biological activity.

[0268] Intrabodies of the invention can be produced using methods known in the art, such as those disclosed and reviewed in Chen et al., Hum. Gene Ther. 5:595-601 (1994); Marasco, W. A., Gene Ther. 4:11-15 (1997); Rondon and Marasco, Annu. Rev. Microbiol. 51:257-283 (1997); Proba et al., J. Mol. Biol. 275:245-253 (1998); Cohen et al., Oncogene 17:2445-2456 (1998); Ohage and Steipe, J. Mol. Biol. 291:1119-1128 (1999); Ohage et al., J. Mol. Biol. 291:1129-1134 (1999); Wirtz and Steipe, Protein Sci. 8:2245-2250 (1999); Zhu et al., J. Immunol. Methods 231:207-222 (1999); and references cited therein.

[0269] Polynucleotides Encoding Antibodies

[0270] The invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or alternatively, under lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a polypeptide having the amino acid sequence of SEQ ID NO:Y, to a polypeptide encoded by a portion of SEQ ID NO:X as defined in columns 8 and 9 of Table 2, and/or to a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0271] The polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

[0272] Alternatively, a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.

[0273] Once the nucleotide sequence and corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.

[0274] In a specific embodiment, the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well know in the art, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody, as described supra. The framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a listing of human framework regions). Preferably, the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds a polypeptide of the invention. Preferably, as discussed supra, one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.

[0275] In addition, techniques developed for the production of “chimeric antibodies” (Morrison et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. As described supra, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies.

[0276] Alternatively, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778; Bird, Science 242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can be adapted to produce single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may also be used (Skerra et al., Science 242:1038-1041 (1988)).

[0277] Methods of Producing Antibodies

[0278] The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques. Methods of producing antibodies include, but are not limited to, hybridoma technology, EBV transformation, and other methods discussed herein as well as through the use recombinant DNA technology, as discussed below.

[0279] Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.

[0280] The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.

[0281] A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).

[0282] In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

[0283] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).

[0284] In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts. (e.g., see Logan & Shenk, Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).

[0285] In addition, a host cell strain may be chosen, which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells, which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.

[0286] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines, which stably express the antibody molecule may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines, which express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.

[0287] A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes can be employed in tk-, hgprt- or aprt-cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); TIB TECH 11(5):155-215 (1993)); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are incorporated by reference herein in their entireties.

[0288] The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).

[0289] Vectors which use glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulphoximine or methotrexate, respectively. An advantage of glutamine synthase based vectors are the availabilty of cell lines (e.g., the murine myeloma cell line, NS0) which are glutamine synthase negative. Glutamine synthase expression systems can also function in glutamine synthase expressing cells (e.g., Chinese Hamster Ovary (CHO) cells) by providing additional inhibitor to prevent the functioning of the endogenous gene. A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87/04462; WO86/05807; WO89/01036; WO89/10404; and WO91/06657 which are incorporated in their entireties by reference herein. Additionally, glutamine synthase expression vectors that may be used according to the present invention are commercially available from suplliers, including, for example Lonza Biologics, Inc. (Portsmouth, N.H.). Expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells is described in Bebbington et al., Bio/technology 10:169(1992) and in Biblia and Robinson Biotechnol. Prog. 11:1 (1995) which are incorporated in their entirities by reference herein.

[0290] The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.

[0291] Once an antibody molecule of the invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. In addition, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.

[0292] The present invention encompasses antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins. The fusion does not necessarily need to be direct, but may occur through linker sequences. The antibodies may be specific for antigens other than polypeptides (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention. For example, antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors. Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Pat. No. 5,474,981; Gillies et al., PNAS 89:1428-1432 (1992); Fell et al., J. Immunol. 146:2446-2452 (1991), which are incorporated by reference in their entireties.

[0293] The present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions. For example, the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof. The antibody portion fused to a polypeptide of the present invention may comprise the constant region, hinge region, CH1 domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof. The polypeptides may also be fused or conjugated to the above antibody portions to form multimers. For example, Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fe portions. Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the present invention to antibody portions are known in the art. See, e.g., U.S. Pat. Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et al., J. Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89:11337-11341 (1992) (said references incorporated by reference in their entireties).

[0294] As discussed, supra, the polypeptides corresponding to a polypeptide, polypeptide fragment, or a variant of SEQ ID NO:Y may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art. Further, the polypeptides corresponding to SEQ ID NO:Y may be fused or conjugated to the above antibody portions to facilitate purification. One reported example describes chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See EP 394,827; Traunecker et al., Nature 331:84-86 (1988). The polypeptides of the present invention fused or conjugated to an antibody having disulfide-linked dimeric structures (due to the IgG) may also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone. See, for example, Fountoulakis et al., J. Biochem. 270:3958-3964 (1995). In many cases, the Fe part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties. See, for example, EP A 232,262. Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fe portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5. (See, Bennett et al., J. Molecular Recognition 8:52-58 (1995); Johanson et al., J. Biol. Chem. 270:9459-9471 (1995)).

[0295] Moreover, the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif., 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the “HA” tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the “flag” tag.

[0296] The present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to, for example, monitor the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions. The detectable substance may be coupled or conjugated either directly to the antibody (or fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Pat. No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention.

[0297] Further, an antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).

[0298] The conjugates of the invention can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See, International Publication No. WO 97/33899), AIM II (See, International Publication No. WO 97/34911), Fas Ligand (Takahashi et al., Int. Immunol., 6:1567-1574 (1994)), VEGI (See, International Publication No. WO 99/23105), a thrombotic agent or an anti-angiogenic agent, e.g., angiostatin or endostatin; or, biological response modifiers such as, for example, lymphokines, interleukin-1 (“IL-1”), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.

[0299] Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

[0300] Techniques for conjugating such therapeutic moiety to antibodies are well known. See, for example., Arnon et al., “Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy”, in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., “Antibodies For Drug Delivery”, in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, “Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review”, in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); “Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy”, in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., “The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates”, Immunol. Rev. 62:119-58 (1982).

[0301] Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Pat. No. 4,676,980, which is incorporated herein by reference in its entirety.

[0302] An antibody, with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.

[0303] Immunophenotyping

[0304] The antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples. Translation products of the genes of the present invention may be useful as cell specific markers, or more specifically as cellular markers that are differentially expressed at various stages of differentiation and/or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker. Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, “panning” with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Pat. No. 5,985,660; and Morrison et al., Cell, 96:737-49 (1999)).

[0305] These techniques allow for the screening of particular populations of cells, such as might be found with hematological malignancies (i.e. minimal residual disease (MRD) in acute leukemic patients) and “non-self” cells in transplantations to prevent Graft-versus-Host Disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.

[0306] Assays for Antibody Binding

[0307] The antibodies of the invention may be assayed for immunospecific binding by any method known in the art. The immunoassays, which can be used, include but are not limited to, competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), “sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, and protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).

[0308] Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C., adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4° C., washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre-clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols see, e.g., Ausubel et al., eds., (1994), Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, section 10.16.1.

[0309] Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%-20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 125I) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al., eds., (1994), Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, section 10.8.1.

[0310] ELISAs comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen. In ELISAs the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the antibody of interest) conjugated to a detectable compound may be added to the well. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as well as other variations of ELISAs known in the art. For further discussion regarding ELISAs see, e.g., Ausubel et al., eds., (1994), Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, section 11.2.1.

[0311] The binding affinity of an antibody to an antigen and the off-rate of an antibody-antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3H or 125I) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of interest for a particular antigen and the binding off-rates can be determined from the data by scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays. In this case, the antigen is incubated with antibody of interest conjugated to a labeled compound (e.g., 3H or 125I) in the presence of increasing amounts of an unlabeled second antibody.

[0312] Antibodies of the invention may be characterized using immunocytochemisty methods on cells (e.g., mammalian cells, such as CHO cells) transfected with a vector enabling the expression of a musculoskeletal system antigen or with vector alone using techniques commonly known in the art. Antibodies that bind musculoskeletal system antigen transfected cells, but not vector-only transfected cells, are musculoskeletal system antigen specific.

[0313] Therapeutic uses

[0314] The present invention is further directed to antibody-based therapies which involve administering antibodies of the invention to an animal, preferably a mammal, and most preferably a human, patient for treating one or more of the disclosed diseases, disorders, or conditions. Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). The antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of a polypeptide of the invention, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein. The treatment and/or prevention of diseases, disorders, or conditions associated with aberrant expression and/or activity of a polypeptide of the invention includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions. Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.

[0315] In a specific and preferred embodiment, the present invention is directed to antibody-based therapies which involve administering antibodies of the invention to an animal, preferably a mammal, and most preferably a human, patient for treating one or more of the diseases, disorders, or conditions of the musculoskeletal system, including, but not limited to, bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or those disorders described under “Musculoskeletal System Disorders”. Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (e.g., antibodies directed to the full length protein expressed on the cell surface of a mammalian cell; antibodies directed to an epitope of a musculoskeletal system associated polypeptide of the invention (such as, a linear epitope (shown in Table 1A, column 6) or a conformational epitope), including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). The antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of a polypeptide of the invention, including, but not limited to, any one or more of the diseases, disorders, or conditions of the musculoskeletal system described herein. The treatment and/or prevention of diseases, disorders, or conditions of the musculoskeletal system associated with aberrant expression and/or activity of a polypeptide of the invention includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions. Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.

[0316] A summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below. Armed with the teachings provided herein, one of ordinary skill in the art will know how to use the antibodies of the present invention for diagnostic, monitoring or therapeutic purposes without undue experimentation.

[0317] The antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to increase the number or activity of effector cells, which interact with the antibodies.

[0318] The antibodies of the invention may be administered alone or in combination with other types of treatments (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents). Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the patient is preferred. Thus, in a preferred embodiment, human antibodies, fragments derivatives, analogs, or nucleic acids, are administered to a human patient for therapy or prophylaxis.

[0319] It is preferred to use high affinity and/or potent in vivo inhibiting and/or neutralizing antibodies against polypeptides or polynucleotides of the present invention, fragments or regions thereof, for both immunoassays directed to and therapy of disorders related to polynucleotides or polypeptides, including fragments thereof, of the present invention. Such antibodies, fragments, or regions, will preferably have an affinity for polynucleotides or polypeptides of the invention, including fragments thereof. Preferred binding affinities include those with a dissociation constant or Kd less than 5×10−2 M, 10−2 M, 5×10−3 M, 10−3 M, 5×10−4 M, 10−4 M, 5×10−5 M, 10−5 M, 5×10−6 M, 10−6 M, 5×10−7 M, 10−7 M, 5×10−8 M, 10−8 M, 5×10−9 M, 10−9 M, 5×10−10 M, 10−10 M, 5×10−11 M, 10−11 M, 5×10−12 M, 10−12 M, 5×10−13 M, 10−13 M, 5×10−14 M, 10−14 M, 5×10−15 M, and 10−15 M.

[0320] Gene Therapy

[0321] In a specific embodiment, nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to treat, inhibit or prevent a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention, by way of gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the invention, the nucleic acids produce their encoded protein that mediates a therapeutic effect.

[0322] Any of the methods for gene therapy available in the art can be used according to the present invention. Exemplary methods are described below.

[0323] For general reviews of the methods of gene therapy, see Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May, TIBTECH 11 (5):155-215 (1993). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990).

[0324] In a preferred embodiment, the compound comprises nucleic acid sequences encoding an antibody, said nucleic acid sequences being part of expression vectors that express the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host. In particular, such nucleic acid sequences have promoters operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue-specific. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989). In specific embodiments, the expressed antibody molecule is a single chain antibody; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments thereof, of the antibody.

[0325] Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid-carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.

[0326] In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retrovirals or other viral vectors (see U.S. Pat. No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc. In another embodiment, nucleic acid-ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989)).

[0327] In a specific embodiment, viral vectors that contains nucleic acid sequences encoding an antibody of the invention are used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient. More detail about retroviral vectors can be found in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdr1 gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993).

[0328] Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). In a preferred embodiment, adenovirus vectors are used.

[0329] Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Pat. No. 5,436,146).

[0330] Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.

[0331] In this embodiment, the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther. 29:69-92m (1985) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.

[0332] The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.

[0333] Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.

[0334] In a preferred embodiment, the cell used for gene therapy is autologous to the patient.

[0335] In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g. PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61:771 (1986)).

[0336] In a specific embodiment, the nucleic acid to be introduced for purposes of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by the presence or absence of an appropriate inducer of transcription.

[0337] Demonstration of Therapeutic or Prophylactic Activity

[0338] The compounds or pharmaceutical compositions of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include, the effect of a compound on a cell line or a patient tissue sample. The effect of the compound or composition on the cell line and/or tissue sample can be determined utilizing techniques known to those of skill in the art including, but not limited to, rosette formation assays and cell lysis assays. In accordance with the invention, in vitro assays which can be used to determine whether administration of a specific compound is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered a compound, and the effect of such compound upon the tissue sample is observed.

[0339] Therapeutic/Prophylactic Administration and Composition

[0340] The invention provides methods of treatment, inhibition and prophylaxis by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably a polypeptide or antibody of the invention. In a preferred embodiment, the compound is substantially purified (e.g., substantially free from substances that limit its effect or produce undesired side-effects). The subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably human.

[0341] Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below.

[0342] Various delivery systems are known and can be used to administer a compound of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds or compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compounds or compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.

[0343] In a specific embodiment, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need or treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a protein, including an antibody, of the invention, care must be taken to use materials to which the protein does not absorb.

[0344] In another embodiment, the compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)

[0345] In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Fla. (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J.Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, e.g., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).

[0346] Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).

[0347] In a specific embodiment where the compound of the invention is a nucleic acid encoding a protein, the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see U.S. Pat. No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci. USA 88:1864-1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination.

[0348] The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a compound, and a pharmaceutically acceptable carrier. In a specific embodiment, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin. Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

[0349] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0350] The compounds of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[0351] The amount of the compound of the invention, which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0352] For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to 100 mg/kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to 10 mg/kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of antibodies of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.

[0353] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.

[0354] Diagnosis and Imaging

[0355] Labeled antibodies, and derivatives and analogs thereof, which specifically bind to a polypeptide of interest can be used for diagnostic purposes to detect, diagnose, or monitor diseases, disorders, and/or conditions associated with the aberrant expression and/or activity of a polypeptide of the invention. The invention provides for the detection of aberrant expression of a polypeptide of interest, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of aberrant expression.

[0356] The invention provides a diagnostic assay for diagnosing a musculoskeletal system disorder, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder. With respect to cancer, the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.

[0357] Antibodies of the invention can be used to assay protein levels in a biological sample using classical immunohistological methods known to those of skill in the art (e.g., see Jalkanen et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen et al., J. Cell. Biol. 105:3087-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0358] One facet of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of a polypeptide of interest in an animal, preferably a mammal and most preferably a human. A preferred embodiment of the invention is the detection and diagnosis of a disease or disorder of the musculoskeletal system associated with aberrant expression of a musculoskeletal system antigen in an animal, preferably a mammal and most preferably a human. In one embodiment, diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled molecule which specifically binds to the polypeptide of interest; b) waiting for a time interval following the administering for permitting the labeled molecule to preferentially concentrate at sites in the subject where the polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.

[0359] It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S. W. Burchiel et al., “Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).

[0360] Depending on several variables, including the type of label used and the mode of administration, the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.

[0361] In an embodiment, monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disorder, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.

[0362] Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.

[0363] In a specific embodiment, the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al., U.S. Pat. No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patent using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).

[0364] Kits

[0365] The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In a specific embodiment, the kits of the present invention contain a substantially isolated polypeptide comprising an epitope which is specifically immunoreactive with an antibody included in the kit. Preferably, the kits of the present invention further comprise a control antibody, which does not react with the polypeptide of interest. In another specific embodiment, the kits of the present invention contain a means for detecting the binding of an antibody to a polypeptide of interest (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate).

[0366] In another specific embodiment of the present invention, the kit is a diagnostic kit for use in screening serum-containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit may include a substantially isolated polypeptide antigen comprising an epitope, which is specifically immunoreactive with at least one anti-polypeptide antigen antibody. Further, such a kit includes means for detecting the binding of said antibody to the antigen (e.g., the antibody may be conjugated to a fluorescent compound such as fluorescein or rhodamine, which can be detected by flow cytometry). In specific embodiments, the kit may include a recombinantly produced or chemically synthesized polypeptide antigen. The polypeptide antigen of the kit may also be attached to a solid support.

[0367] In a more specific embodiment, the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labeled antibody.

[0368] In an additional embodiment, the invention includes a diagnostic kit for use in screening serum-containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody. In one embodiment, the antibody is attached to a solid support. In a specific embodiment, the antibody may be a monoclonal antibody. The detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen.

[0369] In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention. After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support. The reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, Mo.).

[0370] The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).

[0371] Thus, the invention provides an assay system or kit for carrying out this diagnostic method. The kit generally includes a support with surface-bound recombinant antigens, and a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.

[0372] Uses of the Polynucleotides

[0373] Each of the polynucleotides identified herein can be used in numerous ways as reagents. The following description should be considered exemplary and utilizes known techniques.

[0374] The polynucleotides of the present invention are useful for chromosome identification. There exists an ongoing need to identify new chromosome markers, since few chromosome marking reagents, based on actual sequence data (repeat polymorphisms), are presently available. Each sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome, thus each polynucleotide of the present invention can routinely be used as a chromosome marker using techniques known in the art. Table 1A, column 8 provides the chromosome location of some of the polynucleotides of the invention.

[0375] Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably at least 15 bp (e.g., 15-25 bp) from the sequences shown in SEQ ID NO:X. Primers can optionally be selected using computer analysis so that primers do not span more than one predicted exon in the genomic DNA. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to SEQ ID NO:X will yield an amplified fragment.

[0376] Similarly, somatic hybrids provide a rapid method of PCR mapping the polynucleotides to particular chromosomes. Three or more clones can be assigned per day using a single thermal cycler. Moreover, sublocalization of the polynucleotides can be achieved with panels of specific chromosome fragments. Other gene mapping strategies that can be used include in situ hybridization, prescreening with labeled flow-sorted chromosomes, preselection by hybridization to construct chromosome specific-cDNA libraries, and computer mapping techniques (See, e.g., Shuler, Trends Biotechnol 16:456-459 (1998) which is hereby incorporated by reference in its entirety).

[0377] Precise chromosomal location of the polynucleotides can also be achieved using fluorescence in situ hybridization (FISH) of a metaphase chromosomal spread. This technique uses polynucleotides as short as 500 or 600 bases; however, polynucleotides 2,000-4,000 bp are preferred. For a review of this technique, see Verma et al., “Human Chromosomes: a Manual of Basic Techniques,” Pergamon Press, New York (1988).

[0378] For chromosome mapping, the polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes).

[0379] Thus, the present invention also provides a method for chromosomal localization which involves (a) preparing PCR primers from the polynucleotide sequences in Table 1A and/or Table 2 and SEQ ID NO:X and (b) screening somatic cell hybrids containing individual chromosomes.

[0380] The polynucleotides of the present invention would likewise be useful for radiation hybrid mapping, HAPPY mapping, and long range restriction mapping. For a review of these techniques and others known in the art, see, e.g. Dear, “Genome Mapping: A Practical Approach,” IRL Press at Oxford University Press, London (1997); Aydin, J. Mol. Med. 77:691-694 (1999); Hacia et al., Mol. Psychiatry 3:483-492 (1998); Herrick et al., Chromosome Res. 7:409-423 (1999); Hamilton et al., Methods Cell Biol. 62:265-280 (2000); and/or Ott, J. Hered. 90:68-70 (1999), each of which is hereby incorporated by reference in its entirety.

[0381] Once a polynucleotide has been mapped to a precise chromosomal location, the physical position of the polynucleotide can be used in linkage analysis. Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease. (Disease mapping data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library).) Column 9 of Table 1A provides an OMIM reference identification number of diseases associated with the cytologic band disclosed in column 8 of Table 1A, as determined using techniques described herein and by reference to Table 5. Assuming 1 megabase mapping resolution and one gene per 20 kb, a cDNA precisely localized to a chromosomal region associated with the disease could be one of 50-500 potential causative genes.

[0382] Thus, once coinheritance is established, differences in a polynucleotide of the invention and the corresponding gene between affected and unaffected individuals can be examined. First, visible structural alterations in the chromosomes, such as deletions or translocations, are examined in chromosome spreads or by PCR. If no structural alterations exist, the presence of point mutations are ascertained. Mutations observed in some or all affected individuals, but not in normal individuals, indicate that the mutation may cause the disease. However, complete sequencing of the polypeptide and the corresponding gene from several normal individuals is required to distinguish the mutation from a polymorphism. If a new polymorphism is identified, this polymorphic polypeptide can be used for further linkage analysis.

[0383] Furthermore, increased or decreased expression of the gene in affected individuals as compared to unaffected individuals can be assessed using the polynucleotides of the invention. Any of these alterations (altered expression, chromosomal rearrangement, or mutation) can be used as a diagnostic or prognostic marker. Diagnostic and prognostic methods, kits and reagents encompassed by the present invention are briefly described below and more thoroughly elsewhere herein (see e.g., the sections labeled “Antibodies”, “Diagnostic Assays”, and “Methods for Detecting Musculoskeletal System Disease, Including Cancer”).

[0384] Thus, the invention also provides a diagnostic method useful during diagnosis of a disorder, involving measuring the expression level of polynucleotides of the present invention in cells or body fluid from an individual and comparing the measured gene expression level with a standard level of polynucleotide expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a disorder. Additional non-limiting examples of diagnostic methods encompassed by the present invention are more thoroughly described elsewhere herein (see, e.g., Example 12).

[0385] In still another embodiment, the invention includes a kit for analyzing samples for the presence of proliferative and/or cancerous polynucleotides derived from a test subject, as further described herein. In a general embodiment, the kit includes at least one polynucleotide probe containing a nucleotide sequence that will specifically hybridize with a polynucleotide of the invention and a suitable container. In a specific embodiment, the kit includes two polynucleotide probes defining an internal region of the polynucleotide of the invention, where each probe has one strand containing a 31′mer-end internal to the region. In a further embodiment, the probes may be useful as primers for polymerase chain reaction amplification.

[0386] Where a diagnosis of a related disorder, including, for example, diagnosis of a tumor, has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or depressed polynucleotide of the invention expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.

[0387] By “measuring the expression level of polynucleotides of the invention” is intended qualitatively or quantitatively measuring or estimating the level of the polypeptide of the invention or the level of the mRNA encoding the polypeptide of the invention in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the polypeptide level or mRNA level in a second biological sample). Preferably, the polypeptide level or mRNA level in the first biological sample is measured or estimated and compared to a standard polypeptide level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the related disorder or being determined by averaging levels from a population of individuals not having a related disorder. As will be appreciated in the art, once a standard polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.

[0388] By “biological sample” is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains polypeptide of the present invention or the corresponding mRNA. As indicated, biological samples include body fluids (such as semen, lymph, vaginal pool, sera, plasma, urine, synovial fluid and spinal fluid) which contain the polypeptide of the present invention, and tissue sources found to express the polypeptide of the present invention. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.

[0389] The method(s) provided above may preferably be applied in a diagnostic method and/or kits in which polynucleotides and/or polypeptides of the invention are attached to a solid support. In one exemplary method, the support may be a “gene chip” or a “biological chip” as described in U.S. Pat. Nos. 5,837,832, 5,874,219, and 5,856,174. Further, such a gene chip with polynucleotides of the invention attached may be used to identify polymorphisms between the isolated polynucleotide sequences of the invention, with polynucleotides isolated from a test subject. The knowledge of such polymorphisms (i.e., their location, as well as, their existence) would be beneficial in identifying disease loci for many disorders, such as for example, in neural disorders, immune system disorders, muscular disorders, reproductive disorders, gastrointestinal disorders, pulmonary disorders, digestive disorders, cardiovascular disorders, renal disorders, proliferative disorders, and/or cancerous diseases and conditions. Such a method is described in U.S. Pat. Nos. 5,858,659 and 5,856,104. The U.S. Patents referenced supra are hereby incorporated by reference in their entirety herein.

[0390] The present invention encompasses polynucleotides of the present invention that are chemically synthesized, or reproduced as peptide nucleic acids (PNA), or according to other methods known in the art. The use of PNAs would serve as the preferred form if the polynucleotides of the invention are incorporated onto a solid support, or gene chip. For the purposes of the present invention, a peptide nucleic acid (PNA) is a polyamide type of DNA analog and the monomeric units for adenine, guanine, thymine and cytosine are available commercially (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxides, or deoxyribose derivatives, are not present in PNAs. As disclosed by Nielsen et al., Science 254:1497 (1991); and Egholm et al., Nature 365:666 (1993), PNAs bind specifically and tightly to complementary DNA strands and are not degraded by nucleases. In fact, PNA binds more strongly to DNA than DNA itself does. This is probably because there is no electrostatic repulsion between the two strands, and also the polyamide backbone is more flexible. Because of this, PNA/DNA duplexes bind under a wider range of stringency conditions than DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller probes can be used than with DNA due to the strong binding. In addition, it is more likely that single base mismatches can be determined with PNA/DNA hybridization because a single mismatch in a PNA/DNA 15-mer lowers the melting point (T.sub.m) by 8°-20° C., vs. 4°-16° C. for the DNA/DNA 15-mer duplex. Also, the absence of charge groups in PNA means that hybridization can be done at low ionic strengths and reduce possible interference by salt during the analysis.

[0391] The compounds of the present invention have uses, which include, but are not limited to, detecting cancer in mammals. In particular the invention is useful during diagnosis of pathological cell proliferative neoplasias which include, but are not limited to: acute myelogenous leukemias including acute monocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute undifferentiated leukemia, etc.; and chronic myelogenous leukemias including chronic myelomonocytic leukemia, chronic granulocytic leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.

[0392] The compounds of the present invention have preferred uses, which include, but are not limited to, detecting cancer of musculoskeletal system tissues in mammals. In particular the invention is useful during diagnosis of pathological cell proliferative neoplasias which include, but are not limited to: osteochondroma, benign chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma, giant cell tumor, multiple myeloma, osteosarcoma, fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's tumor, and malignant lymphoma of bone. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.

[0393] Pathological cell proliferative disorders are often associated with inappropriate activation of proto-oncogenes. (Gelmann, E. P. et al., “The Etiology of Acute Leukemia: Molecular Genetics and Viral Oncology,” in Neoplastic Diseases of the Blood, Vol 1., Wiernik, P. H. et al. eds., 161-182 (1985)). Neoplasias are now believed to result from the qualitative alteration of a normal cellular gene product, or from the quantitative modification of gene expression by insertion into the chromosome of a viral sequence, by chromosomal translocation of a gene to a more actively transcribed region, or by some other mechanism. (Gelmann et al., supra) It is likely that mutated or altered expression of specific genes is involved in the pathogenesis of some leukemias, among other tissues and cell types. (Gelmann et al., supra) Indeed, the human counterparts of the oncogenes involved in some animal neoplasias have been amplified or translocated in some cases of human leukemia and carcinoma. (Gelmann et al., supra)

[0394] For example, c-myc expression is highly amplified in the non-lymphocytic leukemia cell line HL-60. When HL-60 cells are chemically induced to stop proliferation, the level of c-myc is found to be downregulated. (International Publication Number WO 91/15580). However, it has been shown that exposure of HL-60 cells to a DNA construct that is complementary to the 5′ end of c-myc or c-myb blocks translation of the corresponding mRNAs which downregulates expression of the c-myc or c-myb proteins and causes arrest of cell proliferation and differentiation of the treated cells. (International Publication Number WO 91/15580; Wickstrom et al., Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc. Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan would appreciate the present invention's usefulness is not be limited to treatment, prevention, diagnosis and/or prognosis, of proliferative disorders of cells and tissues of hematopoietic origin, in light of the numerous cells and cell types of varying origins which are known to exhibit proliferative phenotypes. In preferred embodiments, the compounds and/or methods of the invention are used to treat, prevent, diagnose, and/or prognose, proliferative disorders of musculoskeletal system cells and tissues.

[0395] In addition to the foregoing, a polynucleotide of the present invention can be used to control gene expression through triple helix formation or through antisense DNA or RNA. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); “Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991). Both methods rely on binding of the polynucleotide to a complementary DNA or RNA. For these techniques, preferred polynucleotides are usually oligonucleotides 20 to 40 bases in length and complementary to either the region of the gene involved in transcription (triple helix—see Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991)) or to the mRNA itself (antisense—Okano, J. Neurochem. 56:560 (1991); Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988).) Triple helix formation optimally results in a shut-off of RNA transcription from DNA, while antisense RNA hybridization blocks translation of an mRNA molecule into polypeptide. The oligonucleotide described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of polypeptide of the present invention antigens. Both techniques are effective in model systems, and the information disclosed herein can be used to design antisense or triple helix polynucleotides in an effort to treat disease, and in particular, for the treatment of proliferative diseases and/or conditions. Non-limiting antisense and triple helix methods encompassed by the present invention are more thoroughly described elsewhere herein (see, e.g., the section labeled “Antisense and Ribozyme (Antagonists)”).

[0396] Polynucleotides of the present invention are also useful in gene therapy. One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to correct the genetic defect. The polynucleotides disclosed in the present invention offer a means of targeting such genetic defects in a highly accurate manner. Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell. Additional non-limiting examples of gene therapy methods encompassed by the present invention are more thoroughly described elsewhere herein (see, e.g., the sections labeled “Gene Therapy Methods” and Examples 16, 17 and 18).

[0397] The polynucleotides are also useful for identifying individuals from minute biological samples. The United States military, for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel. This method does not suffer from the current limitations of “Dog Tags” which can be lost, switched, or stolen, making positive identification difficult. The polynucleotides of the present invention can be used as additional DNA markers for RFLP.

[0398] The polynucleotides of the present invention can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ID database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples.

[0399] Forensic biology also benefits from using DNA-based identification techniques as disclosed herein. DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine, fecal matter, etc., can be amplified using PCR. In one prior art technique, gene sequences amplified from polymorphic loci, such as DQa class II HLA gene, are used in forensic biology to identify individuals. (Erlich, H., PCR Technology, Freeman and Co. (1992).) Once these specific polymorphic loci are amplified, they are digested with one or more restriction enzymes, yielding an identifying set of bands on a Southern blot probed with DNA corresponding to the DQa class II HLA gene. Similarly, polynucleotides of the present invention can be used as polymorphic markers for forensic purposes.

[0400] There is also a need for reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin. Appropriate reagents can comprise, for example, DNA probes or primers prepared from the sequences of the present invention, specific to tissues, including but not limited to, those sequences referred to in Table 1A. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination. Additional non-limiting examples of such uses are further described herein.

[0401] Because musculoskeletal system antigens are found expressed in musculoskeletal system tissues, the polynucleotides of the present invention are also useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample. Similarly, polypeptides and antibodies directed to polypeptides of the present invention are useful to provide immunological probes for differential identification of the tissue(s) (e.g., immunohistochemistry assays) or cell type(s) (e.g., immunocytochemistry assays). In a specific embodiment, the polynucleotides of the present invention are also useful as hybridization probes for differential identification of musculoskeletal system tissue(s) or cell type(s) present in a biological sample. Similarly, polypeptides and antibodies directed to polypeptides of the present invention are useful to provide immunological probes for differential identification of musculoskeletal system tissue(s) (e.g., immunohistochemistry assays) or cell type(s) (e.g., immunocytochemistry assays). In addition, for a number of disorders of the above tissues or cells, significantly higher or lower levels of gene expression of the polynucleotides/polypeptides of the present invention may be detected in certain tissues (e.g., tissues expressing polypeptides and/or polynucleotides of the present invention, for example, normal musculoskeletal system tissues or diseased musculoskeletal system tissues, and/or those tissues/cells corresponding to the library source relating to a polynucleotide sequence of the invention as disclosed in column 7 of Table 1A, and/or cancerous and/or wounded tissues) or bodily fluids (e.g., semen, lymph, vaginal pool, serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a “standard” gene expression level, i.e., the expression level in healthy tissue from an individual not having the disorder.

[0402] Thus, the invention provides a diagnostic method of a disorder, which involves: (a) assaying gene expression level in cells or body fluid of an individual; (b) comparing the gene expression level with a standard gene expression level, whereby an increase or decrease in the assayed gene expression level compared to the standard expression level is indicative of a disorder.

[0403] In the very least, the polynucleotides of the present invention can be used as molecular weight markers on Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, as a probe to “subtract-out” known sequences in the process of discovering novel polynucleotides, for selecting and making oligomers for attachment to a “gene chip” or other support, to raise anti-DNA antibodies using DNA immunization techniques, and as an antigen to elicit an immune response.

[0404] Uses of the Polypeptides

[0405] Each of the polypeptides identified herein can be used in numerous ways. The following description should be considered exemplary and utilizes known techniques.

[0406] Polypeptides and antibodies directed to polypeptides of the present invention are useful to provide immunological probes for differential identification of the tissue(s) (e.g., immunohistochemistry assays such as, for example, ABC immunoperoxidase (Hsu et al., J. Histochem. Cytochem. 29:577-580 (1981)) or cell type(s) (e.g., immunocytochemistry assays).

[0407] Antibodies can be used to assay levels of polypeptides encoded by polynucleotides of the invention in a biological sample using classical immunohistological methods known to those of skill in the art (see, e.g., Jalkanen, et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell. Biol. 105:3087-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (131I, 125I, 123I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (115mIn, 113mIn, 112In, 111In), and technetium (99Tc, 99mTc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru; luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0408] In addition to assaying levels of polypeptide of the present invention in a biological sample, proteins can also be detected in vivo by imaging. Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.

[0409] A musculoskeletal system antigen-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example, 131I, 112In, 99mTc, (131I, 125I, 123I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (115mIn, 113mIn, 112In, 111In), and technetium (99Tc, 99mTc) thallium (201Ti), gallium (68Ga 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133X), fluorine (18F, 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho, 90Y, 47Sc, 186Re, 188Re, 142Pr, 105Rh, 97Ru), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for musculoskeletal system disorder. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which express the polypeptide encoded by a polynucleotide of the invention. In vivo tumor imaging is described in S. W. Burchiel et al., “Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).

[0410] In one embodiment, the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (e.g., polypeptides encoded by polynucleotides of the invention and/or antibodies) that are associated with heterologous polypeptides or nucleic acids. In one example, the invention provides a method for delivering a therapeutic protein into the targeted cell. In another example, the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.

[0411] In another embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention in association with toxins or cytotoxic prodrugs.

[0412] In a preferred embodiment, the invention provides a method for the specific destruction of musculoskeletal system cells (e.g., aberrant musculoskeletal system cells, musculoskeletal system neoplasm) by administering polypeptides of the invention (e.g., polypeptides encoded by polynucleotides of the invention and/or antibodies) in association with toxins or cytotoxic prodrugs. In another preferred embodiment the invention provides a method for the specific destruction of tissues/cells corresponding to the library source relating to a polynucleotide sequence of the invention as disclosed in column 7 of Table 1A by administering polypeptides of the invention in association with toxins or cytotoxic prodrugs.

[0413] By “toxin” is meant one or more compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. “Toxin” also includes a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi, or other radioisotopes such as, for example, 103Pd, 133Xe, 131I, 111In, 68Ge, 57Co, 65Zn, 85Sr, 32P, 35S, 90Y, 153Sm, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, 90Yttrium, 117Tin, 186Rhenium, 166Holmium, and 188 Rhenium; luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0414] In a specific embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention or antibodies of the invention in association with the radioisotope 90Y. In another specific embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention or antibodies of the invention in association with the radioisotope 111In. In a further specific embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention or antibodies of the invention in association with the radioisotope 131I.

[0415] Techniques known in the art may be applied to label polypeptides of the invention (including antibodies). Such techniques include, but are not limited to, the use of bifunctional conjugating agents (see e.g., U.S. Pat. Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of each of which are hereby incorporated by reference in its entirety).

[0416] Thus, the invention provides a diagnostic method of a disorder, which involves (a) assaying the expression level of a polypeptide of the present invention in cells or body fluid of an individual; and (b) comparing the assayed polypeptide expression level with a standard polypeptide expression level, whereby an increase or decrease in the assayed polypeptide expression level compared to the standard expression level is indicative of a disorder. With respect to cancer, the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.

[0417] Moreover, polypeptides of the present invention can be used to treat or prevent diseases or conditions of the musculoskeletal system such as, for example, bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or those disorders described under “Musculoskeletal System Disorders”. In preferred embodiments, polynucleotides expressed in a particular tissue type (see, e.g., Table 1A, column 7) are used to diagnose, detect, prevent, treat and/or prognose disorders associated with the tissue type. For example, patients can be administered a polypeptide of the present invention in an effort to replace absent or decreased levels of the polypeptide (e.g., insulin), to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the activity of a polypeptide (e.g., an oncogene or tumor supressor), to activate the activity of a polypeptide (e.g., by binding to a receptor), to reduce the activity of a membrane bound receptor by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation), or to bring about a desired response (e.g., blood vessel growth inhibition, enhancement of the immune response to proliferative cells or tissues).

[0418] Similarly, antibodies directed to a polypeptide of the present invention can also be used to treat disease (as described supra, and elsewhere herein). For example, administration of an antibody directed to a polypeptide of the present invention can bind, and/or neutralize the polypeptide, and/or reduce overproduction of the polypeptide. Similarly, administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).

[0419] At the very least, the polypeptides of the present invention can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art. Polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell. Moreover, the polypeptides of the present invention can be used to test the biological activities described herein.

[0420] Diagnostic Asssays

[0421] The compounds of the present invention are useful for diagnosis, treatment, prevention and/or prognosis of various musculoskeletal system related disorders in mammals, preferably humans. Such disorders include, but are not limited to bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or those disorders described under “Musculoskeletal System Disorders”. In preferred embodiments, polynucleotides expressed in a particular tissue type (see, e.g., Table 1A, column 7) are used to diagnose, detect, prevent, treat and/or prognose disorders associated with the tissue type.

[0422] Musculoskeletal system antigens are expressed in the musculoskeletal system, with an increased expression level in musculoskeletal system tissues. For a number of musculoskeletal system-related disorders, substantially altered (increased or decreased) levels of musculoskeletal system antigen gene expression can be detected in musculoskeletal system tissue or other cells or bodily fluids (e.g., sera, plasma, urine, semen, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a “standard” musculoskeletal system antigen gene expression level, that is, the musculoskeletal system antigen expression level in musculoskeletal system tissues or bodily fluids from an individual not having the musculoskeletal system disorder. Thus, the invention provides a diagnostic method useful during diagnosis of a musculoskeletal system disorder, which involves measuring the expression level of the gene encoding the musculoskeletal system associated polypeptide in musculoskeletal system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard musculoskeletal system antigens gene expression level, whereby an increase or decrease in the gene expression level(s) compared to the standard is indicative of a musculoskeletal system disorder.

[0423] In specific embodiments, the invention provides a diagnostic method useful during diagnosis of a disorder of a normal or diseased tissue/cell source corresponding to column 7 of Table 1A, which involves measuring the expression level of the coding sequence of a polynucleotide sequence associated with this tissue/cell source as disclosed in Table 1A in the tissue/cell source or other cells or body fluid from an individual and comparing the expression level of the coding sequence with a standard expression level of the coding sequence of a polynucleotide sequence, whereby an increase or decrease in the gene expression level(s) compared to the standard is indicative of a disorder of a normal or diseased tissue/cell source corresponding to column 7 of Table 1A.

[0424] In particular, it is believed that certain tissues in mammals with cancer of cells or tissue of the musculoskeletal system express significantly enhanced or reduced levels of normal or altered musculoskeletal system antigen expression and mRNA encoding the musculoskeletal system associated polypeptide when compared to a corresponding “standard” level. Further, it is believed that enhanced or depressed levels of the musculoskeletal system associated polypeptide can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) or cells or tissue from mammals with such a cancer when compared to sera from mammals of the same species not having the cancer.

[0425] For example, as disclosed herein, musculoskeletal system associated polypeptides of the invention are expressed in musculoskeletal system tissues. Accordingly, polynucleotides of the invention (e.g., polynucleotide sequences complementary to all or a portion of a musculoskeletal system antigen mRNA nucleotide sequence of SEQ ID NO:X, nucleotide sequence encoding SEQ ID NO:Y, nucleotide sequence encoding a polypeptide encoded by SEQ ID NO:X and/or a nucleotide sequence delineated by columns 8 and 9 of Table 2) and antibodies (and antibody fragments) directed against the polypeptides of the invention may be used to quantitate or qualitate concentrations of cells of the musculoskeletal system expressing musculoskeletal system antigens, preferrably on their cell surfaces. These polynucleotides and antibodies additionally have diagnostic applications in detecting abnormalities in the level of musculoskeletal system antigens gene expression, or abnormalities in the structure and/or temporal, tissue, cellular, or subcellular location of musculoskeletal system antigens. These diagnostic assays may be performed in vivo or in vitro, such as, for example, on blood samples, biopsy tissue or autopsy tissue. In specific embodiments, polynucleotides and antibodies of the invention are used to quantitate or qualitate tissues/cells corresponding to the library source disclosed in column 7 of Table 1A expressing the corresponding musculoskeletal system sequence disclosed in the same row of Table 1A, preferrably on their cell surface.

[0426] Thus, the invention provides a diagnostic method useful during diagnosis of a musculoskeletal system disorder, including cancers, which involves measuring the expression level of the gene encoding the musculoskeletal system antigen polypeptide in musculoskeletal system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard musculoskeletal system antigen gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a musculoskeletal system disorder. In specific embodiments, polynucleotides and antibodies of the invention are used to quantitate or qualitate tissues/cells corresponding to the library source disclosed in column 7 of Table 1A expressing the corresponding musculoskeletal system sequence disclosed in the same row of Table 1A, preferrably on their cell surface.

[0427] Where a diagnosis of a disorder in the musculoskeletal system, including diagnosis of a tumor, has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or depressed musculoskeletal system antigen gene expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.

[0428] By “assaying the expression level of the gene encoding the musculoskeletal system associated polypeptide” is intended qualitatively or quantitatively measuring or estimating the level of the musculoskeletal system antigen polypeptide or the level of the mRNA encoding the musculoskeletal system antigen polypeptide in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the musculoskeletal system associated polypeptide level or mRNA level in a second biological sample). Preferably, the musculoskeletal system antigen polypeptide expression level or mRNA level in the first biological sample is measured or estimated and compared to a standard musculoskeletal system antigen polypeptide level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder of the musculoskeletal system. As will be appreciated in the art, once a standard musculoskeletal system antigen polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.

[0429] By “biological sample” is intended any biological sample obtained from an individual, cell line, tissue culture, or other source containing musculoskeletal system antigen polypeptides (including portions thereof) or mRNA. As indicated, biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain cells expressing musculoskeletal system antigen polypeptides, musculoskeletal system tissue, and other tissue sources found to express the full length or fragments thereof of a musculoskeletal system antigen. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.

[0430] Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels of mRNA encoding the musculoskeletal system antigen polypeptides are then assayed using any appropriate method. These include Northern blot analysis, S1 nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR).

[0431] The present invention also relates to diagnostic assays such as quantitative and diagnostic assays for detecting levels of musculoskeletal system antigen polypeptides, in a biological sample (e.g., cells and tissues), including determination of normal and abnormal levels of polypeptides. Thus, for instance, a diagnostic assay in accordance with the invention for detecting over-expression of musculoskeletal system antigens compared to normal control tissue samples may be used to detect the presence of tumors. Assay techniques that can be used to determine levels of a polypeptide, such as a musculoskeletal system antigen polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays. Assaying musculoskeletal system antigen polypeptide levels in a biological sample can occur using any art-known method.

[0432] Assaying musculoskeletal system antigen polypeptide levels in a biological sample can occur using antibody-based techniques. For example, musculoskeletal system antigen polypeptide expression in tissues can be studied with classical immunohistological methods (Jalkanen et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell. Biol. 105:3087-3096 (1987)). Other antibody-based methods useful for detecting musculoskeletal system antigen polypeptide gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0433] The tissue or cell type to be analyzed will generally include those, which are known, or suspected, to express the musculoskeletal system antigen gene (such as, for example, cells of the musculoskeletal system or cancer of musculoskeletal system tissues). The protein isolation methods employed herein may, for example, be such as those described in Harlow and Lane (Harlow, E. and Lane, D., 1988, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), which is incorporated herein by reference in its entirety. The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the assessment of cells that could be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expression of the musculoskeletal system antigen gene.

[0434] For example, antibodies, or fragments of antibodies, such as those described herein, may be used to quantitatively or qualitatively detect the presence of musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody coupled with light microscopic, flow cytometric, or fluorimetric detection.

[0435] In a preferred embodiment, antibodies, or fragments of antibodies directed to any one or all of the predicted epitope domains of the musculoskeletal system antigen polypeptides (Shown in Table 1A, column 6) may be used to quantitatively or qualitatively detect the presence of musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody coupled with light microscopic, flow cytometric, or fluorimetric detection.

[0436] In an additional preferred embodiment, antibodies, or fragments of antibodies directed to a conformational epitope of a musculoskeletal system antigen may be used to quantitatively or qualitatively detect the presence of musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof. This can be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody coupled with light microscopic, flow cytometric, or fluorimetric detection.

[0437] The antibodies (or fragments thereof), and/or musculoskeletal system antigen polypeptides of the present invention may, additionally, be employed histologically, as in immunofluorescence, immunoelectron microscopy or non-immunological assays, for in situ detection of musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof. In situ detection may be accomplished by removing a histological specimen from a patient, and applying thereto a labeled antibody or musculoskeletal system antigen polypeptide of the present invention. The antibody (or fragment thereof) or musculoskeletal system antigen polypeptide is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. Through the use of such a procedure, it is possible to determine not only the presence of the musculoskeletal system antigen gene product, or conserved variants or peptide fragments, or musculoskeletal system antigen polypeptide binding, but also its distribution in the examined tissue. Using the present invention, those of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection.

[0438] Immunoassays and non-immunoassays for musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof will typically comprise incubating a sample, such as a biological fluid, a tissue extract, freshly harvested cells, or lysates of cells which have been incubated in cell culture, in the presence of a detectably labeled antibody capable of binding musculoskeletal system antigen gene products or conserved variants or peptide fragments thereof, and detecting the bound antibody by any of a number of techniques well-known in the art.

[0439] The biological sample may be brought in contact with and immobilized onto a solid phase support or carrier such as nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled anti-musculoskeletal system antigen antibody or detectable musculoskeletal system antigen polypeptide. The solid phase support may then be washed with the buffer a second time to remove unbound antibody or polypeptide. Optionally the antibody is subsequently labeled. The amount of bound label on solid support may then be detected by conventional means.

[0440] By “solid phase support or carrier” is intended any support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the purposes of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.

[0441] The binding activity of a given lot of anti-musculoskeletal system antigen antibody or musculoskeletal system antigen polypeptide may be determined according to well-known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.

[0442] In addition to assaying musculoskeletal system antigen polypeptide levels or polynucleotide levels in a biological sample obtained from an individual, musculoskeletal system antigen polypeptide or polynucleotide can also be detected in vivo by imaging. For example, in one embodiment of the invention, musculoskeletal system antigen polypeptide and/or anti-musculoskeletal system antigen antibodies are used to image musculoskeletal system diseased cells, such as neoplasms. In another embodiment, musculoskeletal system antigen polynucleotides of the invention (e.g., polynucleotides complementary to all or a portion of musculoskeletal system antigen mRNA) and/or anti-musculoskeletal system antigen antibodies (e.g., antibodies directed to any one or a combination of the epitopes of musculoskeletal system antigens, antibodies directed to a conformational epitope of musculoskeletal system antigens, antibodies directed to the full length polypeptide expressed on the cell surface of a mammalian cell) are used to image diseased or neoplastic cells of the musculoskeletal system.

[0443] Antibody labels or markers for in vivo imaging of musculoskeletal system antigen polypeptides include those detectable by X-radiography, NMR, MRI, CAT-scans or ESR. For X-radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma. Where in vivo imaging is used to detect enhanced levels of musculoskeletal system antigen polypeptides for diagnosis in humans, it may be preferable to use human antibodies or “humanized” chimeric monoclonal antibodies. Such antibodies can be produced using techniques described herein or otherwise known in the art. For example methods for producing chimeric antibodies are known in the art. See, for review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature 314:268 (1985).

[0444] Additionally, any musculoskeletal system antigen polypeptides whose presence can be detected, can be administered. For example, musculoskeletal system antigen polypeptides labeled with a radio-opaque or other appropriate compound can be administered and visualized in vivo, as discussed, above for labeled antibodies. Further such musculoskeletal system antigen polypeptides can be utilized for in vitro diagnostic procedures.

[0445] A musculoskeletal system antigen polypeptide-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example, 131I, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for a musculoskeletal system disorder. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain musculoskeletal system antigen protein. In vivo tumor imaging is described in S. W. Burchiel et al., “Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S. W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).

[0446] With respect to antibodies, one of the ways in which the anti-musculoskeletal system antigen antibody can be detectably labeled is by linking the same to an enzyme and using the linked product in an enzyme immunoassay (EIA) (Voller, A., “The Enzyme Linked Immunosorbent Assay (ELISA)”, 1978, Diagnostic Horizons 2:1-7, Microbiological Associates Quarterly Publication, Walkersville, Md.); Voller et al., J. Clin. Pathol. 31:507-520 (1978); Butler, J. E., Meth. Enzymol. 73:482-523 (1981); Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, Fla.,; Ishikawa, E. et al., (eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo). The enzyme, which is bound to the antibody will react with an appropriate substrate, preferably a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorimetric or by visual means. Enzymes which can be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. Additionally, the detection can be accomplished by colorimetric methods, which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.

[0447] Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling the antibodies or antibody fragments, it is possible to detect musculoskeletal system antigens through the use of a radioimmunoassay (RIA) (see, for example, Weintraub, B., Principles of radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incorporated by reference herein). The radioactive isotope can be detected by means including, but not limited to, a gamma counter, a scintillation counter, or autoradiography.

[0448] It is also possible to label the antibody with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, ophthaldehyde and fluorescamine.

[0449] The antibody can also be detectably labeled using fluorescence emitting metals such as 152Eu, or others of the lanthamide series. These metals can be attached to the antibody using such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).

[0450] The antibody also can be detectably labeled by coupling it to a chemiluminescent compound. The presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.

[0451] Likewise, a bioluminescent compound may be used to label the antibody of the present invention. Bioluminescence is a type of chemiluminescence found in biological systems in, which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin.

[0452] Methods for Detecting Musculoskeletal System Disease, Including Cancer

[0453] In general, a musculoskeletal system disease or cancer may be detected in a patient based on the presence of one or more musculoskeletal system antigen proteins of the invention and/or polynucleotides encoding such proteins in a biological sample (for example, blood, sera, urine, and/or tumor biopsies) obtained from the patient. In other words, such proteins and/or polynucleotides may be used as markers to indicate the presence or absence of a musculoskeletal system disease or disorder, including cancer. Cancers that may be diagnosed, and/or prognosed using the compositions of the invention include but are not limited to, cancer of musculoskeletal system tissues. In addition, such proteins and/or polynucleotides may be useful for the detection of other diseases and cancers, including cancers of tissues/cells corresponding to the library source disclosed in column 7 of Table 1A expressing the corresponding musculoskeletal system sequence disclosed in the same row of Table 1A. The binding agents provided herein generally permit detection of the level of antigen that binds to the agent in the biological sample. Polynucleotide primers and probes may be used to detect the level of mRNA encoding musculoskeletal system antigen polypeptides, which is also indicative of the presence or absence of a musculoskeletal system disease or disorder, including cancer. In general, musculoskeletal system antigen polypeptides should be present at a level that is at least three fold higher in diseased tissue than in normal tissue.

[0454] There are a variety of assay formats known to those of ordinary skill in the art for using a binding agent to detect polypeptide markers in a sample. See, e.g., Harlow and Lane, supra. In general, the presence or absence of a musculoskeletal system disease in a patient may be determined by (a) contacting a biological sample obtained from a patient with a binding agent; (b) detecting in the sample a level of polypeptide that binds to the binding agent; and (c) comparing the level of polypeptide with a predetermined cut-off value.

[0455] In a preferred embodiment, the assay involves the use of binding agent immobilized on a solid support to bind to and remove the musculoskeletal system antigen polypeptide of the invention from the remainder of the sample. The bound polypeptide may then be detected using a detection reagent that contains a reporter group and specifically binds to the binding agent/polypeptide complex. Such detection reagents may comprise, for example, a binding agent that specifically binds to the polypeptide or an antibody or other agent that specifically binds to the binding agent, such as an anti-immunoglobulin, protein G, protein A or a lectin. Alternatively, a competitive assay may be utilized, in which a polypeptide is labeled with a reporter group and allowed to bind to the immobilized binding agent after incubation of the binding agent with the sample. The extent to which components of the sample inhibit the binding of the labeled polypeptide to the binding agent is indicative of the reactivity of the sample with the immobilized binding agent. Suitable polypeptides for use within such assays include musculoskeletal system antigen polypeptides and portions thereof, or antibodies, to which the binding agent binds, as described above.

[0456] The solid support may be any material known to those of skill in the art to which musculoskeletal system antigen polypeptides of the invention may be attached. For example, the solid support may be a test well in a microtiter plate or a nitrocellulose or other suitable membrane. Alternatively, the support may be a bead or disc, such as glass fiberglass, latex or a plastic material such as polystyrene or polyvinylchloride. The support may also be a magnetic particle or a fiber optic sensor, such as those disclosed, for example, in U.S. Pat. No. 5,359,681. The binding agent may be immobilized on the solid support using a variety of techniques known to those of skill in the art, which are amply described in the patent and scientific literature. In the context of the present invention, the term “immobilization” refers to both noncovalent association, such as adsorption, and covalent attachment (which may be a direct linkage between the agent and functional groups on the support or may be a linkage by way of a cross-linking agent). Immobilization by adsorption to a well in a microtiter plate or to a membrane is preferred. In such cases, adsorption may be achieved by contacting the binding agent, in a suitable buffer, with the solid support for the suitable amount of time. The contact time varies with temperature, but is typically between about 1 hour and about 1 day. In general, contacting a well of plastic microtiter plate (such as polystyrene or polyvinylchloride) with an amount of binding agent ranging from about 10 ng to about 10 ug, and preferably about 100 ng to about 1 ug, is sufficient to immobilize an adequate amount of binding agent.

[0457] Covalent attachment of binding agent to a solid support may generally be achieved by first reacting the support with a bifunctional reagent that will react with both the support and a functional group, such as a hydroxyl or amino group, on the binding agent. For example, the binding agent may be covalently attached to supports having an appropriate polymer coating using benzoquinone or by condensation of an aldehyde group on the support with an amine and an active hydrogen on the binding partner (see, e.g., Pierce Immunotechnology Catalog and Handbook, 1991, at A12-A13).

[0458] Gene Therapy Methods

[0459] Also encompassed by the present invention are gene therapy methods for treating or preventing disorders, diseases and conditions. The gene therapy methods relate to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal to achieve expression of a musculoskeletal system antigen of the present invention. This method requires a polynucleotide, which codes for a polypeptide of the present invention operatively linked to a promoter and any other genetic elements necessary for the expression of the polypeptide by the target tissue. Such gene therapy and delivery techniques are known in the art, see, for example, WO90/11092, which is herein incorporated by reference.

[0460] Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) comprising a promoter operably linked to a polynucleotide of the present invention ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide of the present invention. Such methods are well-known in the art. For example, see Belldegrun, A., et al., J. Natl. Cancer Inst. 85: 207-216 (1993); Ferrantini, M. et al., Cancer Research 53: 1107-1112 (1993); Ferrantini, M. et al., J. Immunology 153: 4604-4615 (1994); Kaido, T., et al., Int. J. Cancer 60: 221-229 (1995); Ogura, H., et al., Cancer Research 50: 5102-5106 (1990); Santodonato, L., et al., Human Gene Therapy 7:1-10 (1996); Santodonato, L., et al., Gene Therapy 4:1246-1255 (1997); and Zhang, J.-F. et al., Cancer Gene Therapy 3: 31-38 (1996)), which are herein incorporated by reference. In one embodiment, the cells, which are engineered are arterial cells. The arterial cells may be reintroduced into the patient through direct injection to the artery, the tissues surrounding the artery, or through catheter injection.

[0461] As discussed in more detail below, the polynucleotide constructs can be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, and the like). The polynucleotide constructs may be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

[0462] In one embodiment, the polynucleotide of the present invention is delivered as a naked polynucleotide. The term “naked” polynucleotide, DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, the polynucleotide of the present invention can also be delivered in liposome formulations and lipofectin formulations and the like can be prepared by methods well known to those skilled in the art. Such methods are described, for example, in U.S. Pat. Nos. 5,593,972, 5,589,466, and 5,580,859, which are herein incorporated by reference.

[0463] The polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Appropriate vectors include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia; and pEF1/V5, pcDNA3.1, and pRc/CMV2 available from Invitrogen. Other suitable vectors will be readily apparent to the skilled artisan.

[0464] Any strong promoter known to those skilled in the art can be used for driving the expression of the polynucleotide sequence. Suitable promoters include adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs; the b-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter for the polynucleotide of the present invention.

[0465] Unlike other gene therapy techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.

[0466] The polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue. Interstitial space of the tissues comprises the intercellular, fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.

[0467] For the naked nucleic acid sequence injection, an effective dosage amount of DNA or RNA will be in the range of from about 0.05 mg/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration.

[0468] The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked DNA constructs can be delivered to arteries during angioplasty by the catheter used in the procedure.

[0469] The naked polynucleotides are delivered by any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, and so-called “gene guns”. These delivery methods are known in the art.

[0470] The constructs may also be delivered with delivery vehicles such as viral sequences, viral particles, liposome formulations, lipofectin, precipitating agents, etc. Such methods of delivery are known in the art.

[0471] In certain embodiments, the polynucleotide constructs are complexed in a liposome preparation. Liposomal preparations for use in the instant invention include cationic (positively charged), anionic (negatively charged) and neutral preparations. However, cationic liposomes are particularly preferred because a tight charge complex can be formed between the cationic liposome and the polyanionic nucleic acid. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Felgner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is herein incorporated by reference); mRNA (Malone et al., Proc. Natl. Acad. Sci. USA (1989) 86:6077-6081, which is herein incorporated by reference); and purified transcription factors (Debs et al., J. Biol. Chem. (1990) 265:10189-10192, which is herein incorporated by reference), in functional form.

[0472] Cationic liposomes are readily available. For example, N [1-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are particularly useful and are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y., (see, also, Felgner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is herein incorporated by reference). Other commercially available liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boehringer).

[0473] Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g. PCT Publication No. WO 90/11092 (which is herein incorporated by reference) for a description of the synthesis of DOTAP (1,2-bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes. Preparation of DOTMA liposomes is explained in the literature, see, e.g., P. Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, which is herein incorporated by reference. Similar methods can be used to prepare liposomes from other cationic lipid materials.

[0474] Similarly, anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials. Such materials include phosphatidyl choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others. These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art.

[0475] For example, commercially dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), and dioleoylphosphatidyl ethanolamine (DOPE) can be used in various combinations to make conventional liposomes, with or without the addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can be prepared by drying 50 mg each of DOPG and DOPC under a stream of nitrogen gas into a sonication vial. The sample is placed under a vacuum pump overnight and is hydrated the following day with deionized water. The sample is then sonicated for 2 hours in a capped vial, using a Heat Systems model 350 sonicator equipped with an inverted cup (bath type) probe at the maximum setting while the bath is circulated at 15EC. Alternatively, negatively charged vesicles can be prepared without sonication to produce multilamellar vesicles or by extrusion through nucleopore membranes to produce unilamellar vesicles of discrete size. Other methods are known and available to those of skill in the art.

[0476] The liposomes can comprise multilamellar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs), with SUVs being preferred. The various liposome-nucleic acid complexes are prepared using methods well known in the art. See, e.g., Straubinger et al., Methods of Immunology (1983), 101:512-527, which is herein incorporated by reference. For example, MLVs containing nucleic acid can be prepared by depositing a thin film of phospholipid on the walls of a glass tube and subsequently hydrating with a solution of the material to be encapsulated. SUVs are prepared by extended sonication of MLVs to produce a homogeneous population of unilamellar liposomes. The material to be entrapped is added to a suspension of preformed MLVs and then sonicated. When using liposomes containing cationic lipids, the dried lipid film is resuspended in an appropriate solution such as sterile water or an isotonic buffer solution such as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are mixed directly with the DNA. The liposome and DNA form a very stable complex due to binding of the positively charged liposomes to the cationic DNA. SUVs find use with small nucleic acid fragments. LUVs are prepared by a number of methods, well known in the art. Commonly used methods include Ca2+-EDTA chelation (Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483; Wilson et al., Cell 17:77 (1979); ether injection (Deamer, D. and Bangham, A., Biochim. Biophys. Acta 443:629 (1976); Ostro et al., Biochem. Biophys. Res. Commun. 76:836 (1977); Fraley et al., Proc. Natl. Acad. Sci. USA 76:3348 (1979)); detergent dialysis (Enoch, H. and Strittmatter, P., Proc. Natl. Acad. Sci. USA 76:145 (1979)); and reverse-phase evaporation (REV) (Fraley et al., J. Biol. Chem. 255:10431 (1980); Szoka et al., Proc. Natl. Acad. Sci. USA 75:145 (1978); Schaefer-Ridder et al., Science 215:166 (1982)), which are herein incorporated by reference.

[0477] Generally, the ratio of DNA to liposomes will be from about 10:1 to about 1:10. Preferably, the ration will be from about 5:1 to about 1:5. More preferably, the ration will be about 3:1 to about 1:3. Still more preferably, the ratio will be about 1:1.

[0478] U.S. Pat. No. 5,676,954 (which is herein incorporated by reference) reports on the injection of genetic material, complexed with cationic liposomes carriers, into mice. U.S. Pat. Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622, 5,580,859, 5,703,055, and international publication no. WO 94/9469 (which are herein incorporated by reference) provide cationic lipids for use in transfecting DNA into cells and mammals. U.S. Pat. Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and International Publication No. WO 94/9469 provide methods for delivering DNA-cationic lipid complexes to mammals.

[0479] In certain embodiments, cells are engineered, ex vivo or in vivo, using a retroviral particle containing RNA, which comprises a sequence encoding a polypeptide of the present invention. Retroviruses from which the retroviral plasmid vectors may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, Rous sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.

[0480] The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14×, VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAm12, and DAN cell lines as described in Miller, Human Gene Therapy 1:5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

[0481] The producer cell line generates infectious retroviral vector particles, which include polynucleotide encoding a polypeptide of the present invention. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express a polypeptide of the present invention.

[0482] In certain other embodiments, cells are engineered, ex vivo or in vivo, with polynucleotide contained in an adenovirus vector. Adenovirus can be manipulated such that it encodes and expresses a polypeptide of the present invention, and at the same time is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Adenovirus expression is achieved without integration of the viral DNA into the host cell chromosome, thereby alleviating concerns about insertional mutagenesis. Furthermore, adenoviruses have been used as live enteric vaccines for many years with an excellent safety profile (Schwartz, et al., Am. Rev. Respir. Dis.109:233-238 (1974)). Finally, adenovirus mediated gene transfer has been demonstrated in a number of instances including transfer of alpha-1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68:143-155 (1991)). Furthermore, extensive studies to attempt to establish adenovirus as a causative agent in human cancer were uniformly negative (Green et al., Proc. Natl. Acad. Sci. USA 76:6606 (1979)).

[0483] Suitable adenoviral vectors useful in the present invention are described, for example, in Kozarsky and Wilson, Curr. Opin. Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155 (1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993); Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature 365:691-692 (1993); and U.S. Pat. No. 5,652,224, which are herein incorporated by reference. For example, the adenovirus vector Ad2 is useful and can be grown in human 293 cells. These cells contain the E1 region of adenovirus and constitutively express E1a and E1b, which complement the defective adenoviruses by providing the products of the genes deleted from the vector. In addition to Ad2, other varieties of adenovirus (e.g., Ad3, Ad5, and Ad7) are also useful in the present invention.

[0484] Preferably, the adenoviruses used in the present invention are replication deficient. Replication deficient adenoviruses require the aid of a helper virus and/or packaging cell line to form infectious particles. The resulting virus is capable of infecting cells and can express a polynucleotide of interest, which is operably linked to a promoter, but cannot replicate in most cells. Replication deficient adenoviruses may be deleted in one or more of all or a portion of the following genes: E1a, E1b, E3, E4, E2a or L1 through L5.

[0485] In certain other embodiments, the cells are engineered, ex vivo or in vivo, using an adeno-associated virus (AAV). AAVs are naturally occurring defective viruses that require helper viruses to produce infectious particles (Muzyczka, N., Curr. Topics in Microbiol. Immunol. 158:97 (1992)). It is also one of the few viruses that may integrate its DNA into non-dividing cells. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods for producing and using such AAVs are known in the art. See, for example, U.S. Pat. Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and 5,589,377.

[0486] For example, an appropriate AAV vector for use in the present invention will include all the sequences necessary for DNA replication, encapsidation, and host-cell integration. The polynucleotide construct is inserted into the AAV vector using standard cloning methods, such as those found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989). The recombinant AAV vector is then transfected into packaging cells which are infected with a helper virus, using any standard technique, including lipofection, electroporation, calcium phosphate precipitation, etc. Appropriate helper viruses include adenoviruses, cytomegaloviruses, vaccinia viruses, or herpes viruses. Once the packaging cells are transfected and infected, they will produce infectious AAV viral particles, which contain the polynucleotide construct. These viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo. The transduced cells will contain the polynucleotide construct integrated into its genome, and will express a polypeptide of the invention.

[0487] Another method of gene therapy involves operably associating heterologous control regions and endogenous musculoskeletal system antigen polynucleotide sequences (e.g., encoding a musculoskeletal system antigen polypeptide of the present invention) via homologous recombination (see, e.g., U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International Publication No. WO 96/29411, published Sep. 26, 1996; International Publication No. WO 94/12650, published Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), which are herein incorporated by reference. This method involves the activation of a gene which is present in the target cells, but which is not normally expressed in the cells, or is expressed at a lower level than desired.

[0488] Polynucleotide constructs are made, using standard techniques known in the art, which contain the promoter with targeting sequences flanking the promoter. Suitable promoters are described herein. The targeting sequence is sufficiently complementary to an endogenous sequence to permit homologous recombination of the promoter-targeting sequence with the endogenous sequence. The targeting sequence will be sufficiently near the 5′ end of the desired endogenous polynucleotide sequence so the promoter will be operably linked to the endogenous sequence upon homologous recombination.

[0489] The promoter and the targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5′ and 3′ ends. Preferably, the 3′ end of the first targeting sequence contains the same restriction enzyme site as the 5′ end of the amplified promoter and the 5′ end of the second targeting sequence contains the same restriction site as the 3′ end of the amplified promoter. The amplified promoter and targeting sequences are digested and ligated together.

[0490] The promoter-targeting sequence construct is delivered to the cells, either as naked polynucleotide, or in conjunction with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitating agents, etc., described in more detail above. The P promoter-targeting sequence can be delivered by any method, included direct needle injection, intravenous injection, topical administration, catheter infusion, particle accelerators, etc. The methods are described in more detail below.

[0491] The promoter-targeting sequence construct is taken up by cells. Homologous recombination between the construct and the endogenous sequence takes place, such that an endogenous sequence is placed under the control of the promoter. The promoter then drives the expression of the endogenous sequence.

[0492] The polynucleotide encoding a polypeptide of the present invention may contain a secretory signal sequence that facilitates secretion of the protein. Typically, the signal sequence is positioned in the coding region of the polynucleotide to be expressed towards or at the 5′ end of the coding region. The signal sequence may be homologous or heterologous to the musculoskeletal system antigen polynucleotide of interest and may be homologous or heterologous to the cells to be transfected. Additionally, the signal sequence may be chemically synthesized using methods known in the art.

[0493] Any mode of administration of any of the above-described polynucleotides constructs can be used so long as the mode results in the expression of one or more molecules in an amount sufficient to provide a therapeutic effect. This includes direct needle injection, systemic injection, catheter infusion, biolistic injectors, particle accelerators (i.e., “gene guns”), gelfoam sponge depots, other commercially available depot materials, osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid (tablet or pill) pharmaceutical formulations, and decanting or topical applications during surgery. For example, direct injection of naked calcium phosphate-precipitated plasmid into rat liver and rat spleen or a protein-coated plasmid into the portal vein has resulted in gene expression of the foreign gene in the rat livers (Kaneda et al., Science 243:375 (1989)).

[0494] A preferred method of local administration is by direct injection. Preferably, a recombinant molecule of the present invention complexed with a delivery vehicle is administered by direct injection into or locally within the area of arteries. Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries.

[0495] Another method of local administration is to contact a polynucleotide construct of the present invention in or around a surgical wound. For example, a patient can undergo surgery and the polynucleotide construct can be coated on the surface of tissue inside the wound or the construct can be injected into areas of tissue inside the wound.

[0496] Therapeutic compositions useful in systemic administration, include recombinant molecules of the present invention complexed to a targeted delivery vehicle of the present invention. Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site. In specific embodiments, suitable delivery vehicles for use with systemic administration comprise liposomes comprising polypeptides of the invention for targeting the vehicle to a particular site.

[0497] Preferred methods of systemic administration, include intravenous injection, aerosol, oral and percutaneous (topical) delivery. Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using methods standard in the art (see, for example, Stribling et al., Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is incorporated herein by reference). Oral delivery can be performed by complexing a polynucleotide construct of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers, include plastic capsules or tablets, such as those known in the art. Topical delivery can be performed by mixing a polynucleotide construct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.

[0498] Determining an effective amount of substance to be delivered can depend upon a number of factors including, for example, the chemical structure and biological activity of the substance, the age and weight of the animal, the precise condition requiring treatment and its severity, and the route of administration. The frequency of treatments depends upon a number of factors, such as the amount of polynucleotide constructs administered per dose, as well as the health and history of the subject. The precise amount, number of doses, and timing of doses will be determined by the attending physician or veterinarian.

[0499] Therapeutic compositions of the present invention can be administered to any animal, preferably to mammals and birds. Preferred mammals include humans, dogs, cats, mice, rats, rabbits sheep, cattle, horses and pigs, with humans being particularly preferred.

[0500] Biological Activities

[0501] Polynucleotides or polypeptides, or agonists or antagonists of the present invention, can be used in assays to test for one or more biological activities. If these polynucleotides or polypeptides, or agonists or antagonists of the present invention, do exhibit activity in a particular assay, it is likely that these molecules may be involved in the diseases associated with the biological activity. Thus, the polynucleotides and polypeptides, and agonists or antagonists could be used to treat, prevent diagnose and/or prognose the associated disease.

[0502] The musculoskeletal system antigen polynucleotides and polypeptides of the invention are predicted to have predominant expression in musculoskeletal system tissues.

[0503] Thus, the musculoskeletal system antigens of the invention may be useful as therapeutic molecules. Each would be useful for diagnosis, detection, treatment and/or prevention of diseases or disorders of the musculoskeletal system, including but not limited to bone disorders (e.g., osteoporosis, osteomyelitis, Paget's disease, and sciolosis); joint disorders (e.g., osteoarthritis, rheumatoid arthritis, infectious arthritis, systemic lupus erythematosus, gout, and Reiter's syndrome); ligament, tendon, and bursa disorders (e.g., bursitis, tendinitis, and tenosynovitis); muscle disorders (e.g., muscular dystrophy, Pompe's disease, periodic paralysis, polymyalgia rheumatica, polymyositis, and Steinert's disease), neoplasms and/or cancers of musculoskeletal tissues (e.g., osteochondroma, benign chondroma, chondroblastoma, osteoid osteoma, and giant cell tumor), and/or those disorders described under “Musculoskeletal System Disorders”.

[0504] In a preferred embodiment, polynucleotides of the invention (e.g., a nucleic acid sequence of SEQ ID NO:X or the complement thereof; or the cDNA sequence contained in Clone ID NO:Z, or fragments or variants thereof) and/or polypeptides of the invention (e.g., an amino acid sequence contained in SEQ ID NO:Y, an amino acid sequence encoded by SEQ ID NO:X, or the complement threof, an amino acid sequence encoded by the cDNA sequence contained in Clone ID NO:Z and fragments or variants thereof as described herein) are useful for the diagnosis, detection, treatement, and/or prevention of diseases or disorders of the tissues/cells corresponding to the library source disclosed in column 7 of Table 1A expressing the corresponding musculoskeletal system sequence disclosed in the same row of Table 1A.

[0505] Particularly, the musculoskeletal system antigens may be a useful therapeutic for cancer of musculoskeletal system tissues. Treatment, diagnosis, detection, and/or prevention of musculoskeletal system disorders could be carried out using a musculoskeletal system antigen or soluble form of a musculoskeletal system antigen, a musculoskeletal system antigen ligand, gene therapy, or ex vivo applications. Moreover, inhibitors of a musculoskeletal system antigen, either blocking antibodies or mutant forms, could modulate the expression of the musculoskeletal system antigen. These inhibitors may be useful to treat, diagnose, detect, and/or prevent diseases associated with the misregulation of a musculoskeletal system antigen.

[0506] In one embodiment, the invention provides a method for the specific delivery of compositions of the invention to cells (e.g., normal or diseased musculoskeletal system cells) by administering polypeptides of the invention (e.g., musculoskeletal system antigen polypeptides or anti-musculoskeletal system antigen antibodies) that are associated with heterologous polypeptides or nucleic acids. In one example, the invention provides a method for delivering a therapeutic protein into the targeted cell (e.g., an aberrant musculoskeletal system cell or musculoskeletal system cancer cell). In another example, the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.

[0507] In another embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of aberrant musculoskeletal system cells, including, but not limited to, musculoskeletal system tumor cells) by administering polypeptides of the invention (e.g., musculoskeletal system antigen polypeptides or fragments thereof, or anti-musculoskeletal system antigen antibodies) in association with toxins or cytotoxic prodrugs.

[0508] By “toxin” is meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, cytotoxins (cytotoxic agents), or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. “Toxin” also includes a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi, or other radioisotopes such as, for example, 103Pd, 33Xe, 131I, 68Ge, 57Co, 65Zn, 85Sr, 32P, 35S, 90Y, 153Sm, 153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, 90Yttrium, 117Tin, 186Rhenium, 166Holmium, and 188Rhenium; luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.

[0509] Techniques known in the art may be applied to label antibodies of the invention. Such techniques include, but are not limited to, the use of bifunctional conjugating agents (see e.g., U.S. Pat. Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the contents of each of which are hereby incorporated by reference in its entirety). A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine).

[0510] By “cytotoxic prodrug” is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.

[0511] It will be appreciated that conditions caused by a decrease in the standard or normal level of a musculoskeletal system antigen activity in an individual, particularly disorders of the musculoskeletal system, can be treated by administration of a musculoskeletal system antigen polypeptide (e.g., such as, for example, the complete musculoskeletal system antigen polypeptide, the soluble form of the extracellular domain of a musculoskeletal system antigen polypeptide, or cells expressing the complete protein) or agonist. Thus, the invention also provides a method of treatment of an individual in need of an increased level of musculoskeletal system antigen activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated musculoskeletal system antigen polypeptide of the invention, or agonist thereof (e.g., an agonistic anti-musculoskeletal system antigen antibody), effective to increase the musculoskeletal system antigen activity level in such an individual.

[0512] It will also be appreciated that conditions caused by a increase in the standard or normal level of musculoskeletal system antigen activity in an individual, particularly disorders of the musculoskeletal system, can be treated by administration of musculoskeletal system antigen polypeptides (e.g., such as, for example, the complete musculoskeletal system antigen polypeptide, the soluble form of the extracellular domain of a musculoskeletal system antigen polypeptide, or cells expressing the complete protein) or antagonist (e.g., an antagonistic musculoskeletal system antigen antibody). Thus, the invention also provides a method of treatment of an individual in need of an decreased level of musculoskeletal system antigen activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated musculoskeletal system antigen polypeptide of the invention, or antagonist thereof (e.g., an antagonistic anti-musculoskeletal system antigen antibody), effective to decrease the musculoskeletal system antigen activity level in such an individual.

[0513] In certain embodiments, a polypeptide of the invention, or polynucleotides, antibodies, agonists, or antagonists corresponding to that polypeptide, may be used to diagnose and/or prognose diseases and/or disorders associated with the tissue(s) in which the polypeptide of the invention is expressed, including one, two, three, four, five, or more tissues disclosed in Table 1A, column 7 (Tissue Distribution Library Code).

[0514] More generally, polynucleotides, translation products and antibodies corresponding to this gene may be useful for the diagnosis, prognosis, prevention, and/or treatment of diseases and/or disorders associated with the following systems.

[0515] Musculoskeletal System Disorders

[0516] Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention, may be used to treat, prevent, diagnose, and/or prognose disorders of the musculoskeletal system, including but not limited to, disorders of the bone, joints, ligaments, tendons, bursa, muscle, and/or neoplasms and cancers associated with musculoskeletal tissue.

[0517] Diseases or disorders of the bone include, but are not limited to, Albers-Schönberg disease, bowlegs, heel spurs, Köhler's bone disease, knock-knees, Legg-Calvé-Perthes disease, Marfan's syndrome, mucopolysaccharidoses, Osgood-Schlatter disease, osteochondroses, osteochondrodysplasia, osteomyelitis, osteopetroses, osteoporosis (postmenopausal, senile, and juvenile), Paget's disease, Scheuermann's disease, scoliosis, Sever's disease, and patellofemoral stress syndrome.

[0518] Joint diseases or disorders include, but are not limited to, ankylosing spondylitis, Behcet's syndrome, CREST syndrome, Ehlers-Danlos syndrome, infectious arthritis, discoid lupus erythematosus, systemic lupus erythematosus, Lyme disease, osteoarthritis, psoriatic arthritis, relapsing polychondrites, Reiter's syndrome, rheumatoid arthritis (adult and juvenile), scleroderma, and Still's disease.

[0519] Diseases or disorders affecting ligaments, tendons, or bursa include, but are not limited to, ankle sprain, bursitis, posterior Achilles tendon bursitis (Haglund's deformity), anterior Achilles tendon bursitis (Albert's disease), tendinitis, tenosynovitis, poplieus tendinitis, Achilles tendinitis, medial or lateral epicondylitis, rotator cuff tendinitis, spasmodic torticollis, and fibromyalgia syndrome.

[0520] Muscle diseases or disorders include, but are not limited to, Becker's muscular dystrophy, Duchenne's muscular dystrophy, Landouzy-Dejerine muscular dystrophy, Leyden-Möbius muscular dystrophy, Erb's muscular dystrophy, Charcot's joints, dermatomyositis, gout, pseudogout, glycogen storage diseases, Pompe's disease, mitochondrial myopathy, periodic paralysis, polymyalgia rheumatica, polymyositis, Steinert's disease, Thomsen's disease, anterolateral and posteromedial shin splints, posterior femoral muscle strain, and fibromyositis.

[0521] Musculoskeletal tissue may also develop cancers and/or neoplasms that include, but are not limited to, osteochondroma, benign chondroma, chondroblastoma, chrondromyxoid fibroma, osteoid osteoma, giant cell tumor, multiple myeloma, osteosarcoma, fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing's tumor, and malignant lymphoma of bone.

[0522] Immune Activity

[0523] Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, diagnosing and/or prognosing diseases, disorders, and/or conditions of the immune system, by, for example, activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells. Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells. The etiology of these immune diseases, disorders, and/or conditions may be genetic, somatic, such as cancer and some autoimmune diseases, acquired (e.g., by chemotherapy or toxins), or infectious. Moreover, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention can be used as a marker or detector of a particular immune system disease or disorder.

[0524] In another embodiment, a polypeptide of the invention, or polynucleotides, antibodies, agonists, or antagonists corresponding to that polypeptide, may be used to treat diseases and disorders of the immune system and/or to inhibit or enhance an immune response generated by cells associated with the tissue(s) in which the polypeptide of the invention is expressed, including one, two, three, four, five, or more tissues disclosed in Table 1A, column 7 (Tissue Distribution Library Code).

[0525] Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, diagnosing, and/or prognosing immunodeficiencies, including both congenital and acquired immunodeficiencies. Examples of B cell immunodeficiencies in which immunoglobulin levels B cell function and/or B cell numbers are decreased include: X-linked agammaglobulinemia (Bruton's disease), X-linked infantile agammaglobulinemia, X-linked immunodeficiency with byper IgM, non X-linked immunodeficiency with hyper IgM, X-linked lymphoproliferative syndrome (XLP), agammaglobulinemia including congenital and acquired agammaglobulinemia, adult onset agammaglobulinemia, late-onset agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulinemia, unspecified hypogammaglobulinemia, recessive agammaglobulinemia (Swiss type), Selective IgM deficiency, selective IgA deficiency, selective IgG subclass deficiencies, IgG subclass deficiency (with or without IgA deficiency), Ig deficiency with increased IgM, IgG and IgA deficiency with increased IgM, antibody deficiency with normal or elevated Igs, Ig heavy chain deletions, kappa chain deficiency, B cell lymphoproliferative disorder (BLPD), common variable immunodeficiency (CVID), common variable immunodeficiency (CVI) (acquired), and transient hypogammaglobulinemia of infancy.

[0526] In specific embodiments, ataxia-telangiectasia or conditions associated with ataxia-telangiectasia are treated, prevented, diagnosed, and/or prognosing using the polypeptides or polynucleotides of the invention, and/or agonists or antagonists thereof.

[0527] Examples of congenital immunodeficiencies in which T cell and/or B cell function and/or number is decreased include, but are not limited to: DiGeorge anomaly, severe combined immunodeficiencies (SCID) (including, but not limited to, X-linked SCID, autosomal recessive SCID, adenosine deaminase deficiency, purine nucleoside phosphorylase (PNP) deficiency, Class II MHC deficiency (Bare lymphocyte syndrome), Wiskott-Aldrich syndrome, and ataxia telangiectasia), thymic hypoplasia, third and fourth pharyngeal pouch syndrome, 22q11.2 deletion, chronic mucocutaneous candidiasis, natural killer cell deficiency (NK), idiopathic CD4+ T-lymphocytopenia, immunodeficiency with predominant T cell defect (unspecified), and unspecified immunodeficiency of cell mediated immunity.

[0528] In specific embodiments, DiGeorge anomaly or conditions associated with DiGeorge anomaly are treated, prevented, diagnosed, and/or prognosed using polypeptides or polynucleotides of the invention, or antagonists or agonists thereof.

[0529] Other immunodeficiencies that may be treated, prevented, diagnosed, and/or prognosed using polypeptides or polynucleotides of the invention, and/or agonists or antagonists thereof, include, but are not limited to, chronic granulomatous disease, Chédiak-Higashi syndrome, myeloperoxidase deficiency, leukocyte glucose-6-phosphate dehydrogenase deficiency, X-linked lymphoproliferative syndrome (XLP), leukocyte adhesion deficiency, complement component deficiencies (including C1, C2, C3, C4, C5, C6, C7, C8 and/or C9 deficiencies), reticular dysgenesis, thymic alymphoplasia-aplasia, immunodeficiency with thymoma, severe congenital leukopenia, dysplasia with immunodeficiency, neonatal neutropenia, short limbed dwarfism, and Nezelof syndrome-combined immunodeficiency with Igs.

[0530] In a preferred embodiment, the immunodeficiencies and/or conditions associated with the immunodeficiencies recited above are treated, prevented, diagnosed and/or prognosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention.

[0531] In a preferred embodiment polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention could be used as an agent to boost immunoresponsiveness among immunodeficient individuals. In specific embodiments, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention could be used as an agent to boost immunoresponsiveness among B cell and/or T cell immunodeficient individuals.

[0532] The polynucleotides, polypeptides, antibodies, and/or agonists or gonists of the present invention may be useful in treating, preventing, diagnosing or prognosing autoimmune disorders. Many autoimmune disorders result from propriate recognition of self as foreign material by immune cells. This propriate recognition results in an immune response leading to the destruction of host tissue. Therefore, the administration of polynucleotides and polypeptides of invention that can inhibit an immune response, particularly the proliferation, rentiation, or chemotaxis of T-cells, may be an effective therapy in preventing immune disorders.

[0533] Autoimmune diseases or disorders that may be treated, prevented, nosed and/or prognosed by polynucleotides, polypeptides, antibodies, and/or ists or antagonists of the present invention include, but are not limited to, one or e of the following: systemic lupus erythematosus, rheumatoid arthritis, ankylosing dylitis, multiple sclerosis, autoimmune thyroiditis, Hashimoto's thyroiditis, oimmune hemolytic anemia, hemolytic anemia, thrombocytopenia, autoimmune mbocytopenia purpura, autoimmune neonatal thrombocytopenia, idiopathic ombocytopenia purpura, purpura (e.g., Henloch-Scoenlein purpura), immunocytopenia, Goodpasture's syndrome, Pemphigus vulgaris, myasthenia is, Grave's disease (hyperthyroidism), and insulin-resistant diabetes mellitus.

[0534] Additional disorders that are likely to have an autoimmune component that be treated, prevented, and/or diagnosed with the compositions of the invention ude, but are not limited to, type II collagen-induced arthritis, antiphospholipid drome, dermatitis, allergic encephalomyelitis, myocarditis, relapsing ychondritis, rheumatic heart disease, neuritis, uveitis ophthalmia, endocrinopathies, Reiter's Disease, Stiff-Man Syndrome, autoimmune pulmonary lammation, autism, Guillain-Barre Syndrome, insulin dependent diabetes mellitus, autoimmune inflammatory eye disorders.

[0535] Additional disorders that are likely to have an autoimmune component that be treated, prevented, diagnosed and/or prognosed with the compositions of the invention include, but are not limited to, scleroderma with anti-collagen antibodies (often characterized, e.g., by nucleolar and other nuclear antibodies), mixed connective tissue disease (often characterized, e.g., by antibodies to extractable nuclear antigens (e.g., ribonucleoprotein)), polymyositis (often characterized, e.g., by nonhistone ANA), pernicious anemia (often characterized, e.g., by antiparietal cell, microsomes, and intrinsic factor antibodies), idiopathic Addison's disease (often characterized, e.g., by humoral and cell-mediated adrenal cytotoxicity, infertility (often characterized, e.g., by antispermatozoal antibodies), glomerulonephritis (often characterized, e.g., by glomerular basement membrane antibodies or immune complexes), bullous pemphigoid (often characterized, e.g., by IgG and complement in basement membrane), Sjogren's syndrome (often characterized, e.g., by multiple tissue antibodies, and/or a specific nonhistone ANA (SS-B)), diabetes mellitus (often characterized, e.g., by cell-mediated and humoral islet cell antibodies), and adrenergic drug resistance (including adrenergic drug resistance with asthma or cystic fibrosis) (often characterized, e.g., by beta-adrenergic receptor antibodies).

[0536] Additional disorders that may have an autoimmune component that may be treated, prevented, diagnosed and/or prognosed with the compositions of the invention include, but are not limited to, chronic active hepatitis (often characterized, e.g., by smooth muscle antibodies), primary biliary cirrhosis (often characterized, e.g., by mitochondria antibodies), other endocrine gland failure (often characterized, e.g., by specific tissue antibodies in some cases), vitiligo (often characterized, e.g., by melanocyte antibodies), vasculitis (often characterized, e.g., by Ig and complement in vessel walls and/or low serum complement), post-MI (often characterized, e.g., by myocardial antibodies), cardiotomy syndrome (often characterized, e.g., by myocardial antibodies), urticaria (often characterized, e.g., by IgG and IgM antibodies to IgE), atopic dermatitis (often characterized, e.g., by IgG and IgM antibodies to IgE), asthma (often characterized, e.g., by IgG and IgM antibodies to IgE), and many other inflammatory, granulomatous, degenerative, and atrophic disorders.

[0537] In a preferred embodiment, the autoimmune diseases and disorders and/or conditions associated with the diseases and disorders recited above are treated, prevented, diagnosed and/or prognosed using for example, antagonists or agonists, polypeptides or polynucleotides, or antibodies of the present invention. In a specific preferred embodiment, rheumatoid arthritis is treated, prevented, and/or diagnosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention.

[0538] In another specific preferred embodiment, systemic lupus erythematosus is treated, prevented, and/or diagnosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention. In another specific preferred embodiment, idiopathic thrombocytopenia purpura is treated, prevented, and/or diagnosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention.

[0539] In another specific preferred embodiment IgA nephropathy is treated, prevented, and/or diagnosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention.

[0540] In a preferred embodiment, the autoimmune diseases and disorders and/or conditions associated with the diseases and disorders recited above are treated, prevented, diagnosed and/or prognosed using polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention.

[0541] In preferred embodiments, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a immunosuppressive agent(s).

[0542] Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, prognosing, and/or diagnosing diseases, disorders, and/or conditions of hematopoietic cells. Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with a decrease in certain (or many) types hematopoietic cells, including but not limited to, leukopenia, neutropenia, anemia, and thrombocytopenia. Alternatively, Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with an increase in certain (or many) types of hematopoietic cells, including but not limited to, histiocytosis.

[0543] Allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated, prevented, diagnosed and/or prognosed using polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof. Moreover, these molecules can be used to treat, prevent, prognose, and/or diagnose anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.

[0544] Additionally, polypeptides or polynucleotides of the invention, and/or agonists or antagonists thereof, may be used to treat, prevent, diagnose and/or prognose IgE-mediated allergic reactions. Such allergic reactions include, but are not limited to, asthma, rhinitis, and eczema. In specific embodiments, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to modulate IgE concentrations in vitro or in vivo.

[0545] Moreover, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention have uses in the diagnosis, prognosis, prevention, and/or treatment of inflammatory conditions. For example, since polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists of the invention may inhibit the activation, proliferation and/or differentiation of cells involved in an inflammatory response, these molecules can be used to prevent and/or treat chronic and acute inflammatory conditions. Such inflammatory conditions include, but are not limited to, for example, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome), ischemia-reperfusion injury, endotoxin lethality, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, over production of cytokines (e.g., TNF or IL-1.), respiratory disorders (e.g., asthma and allergy); gastrointestinal disorders (e.g., inflammatory bowel disease); cancers (e.g., gastric, ovarian, lung, bladder, liver, and breast); CNS disorders (e.g., multiple sclerosis; ischemic brain injury and/or stroke, traumatic brain injury, neurodegenerative disorders (e.g., Parkinson's disease and Alzheimer's disease); AIDS-related dementia; and prion disease); cardiovascular disorders (e.g., atherosclerosis, myocarditis, cardiovascular disease, and cardiopulmonary bypass complications); as well as many additional diseases, conditions, and disorders that are characterized by inflammation (e.g., hepatitis, rheumatoid arthritis, gout, trauma, pancreatitis, sarcoidosis, dermatitis, renal ischemia-reperfusion injury, Grave's disease, systemic lupus erythematosus, diabetes mellitus, and allogenic transplant rejection).

[0546] Because inflammation is a fundamental defense mechanism, inflammatory disorders can effect virtually any tissue of the body. Accordingly, polynucleotides, polypeptides, and antibodies of the invention, as well as agonists or antagonists thereof, have uses in the treatment of tissue-specific inflammatory disorders, including, but not limited to, adrenalitis, alveolitis, angiocholecystitis, appendicitis, balanitis, blepharitis, bronchitis, bursitis, carditis, cellulitis, cervicitis, cholecystitis, chorditis, cochlitis, colitis, conjunctivitis, cystitis, dermatitis, diverticulitis, encephalitis, endocarditis, esophagitis, eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis, gingivitis, glossitis, hepatosplenitis, keratitis, labyrinthitis, laryngitis, lymphangitis, mastitis, media otitis, meningitis, metritis, mucitis, myocarditis, myosititis, myringitis, nephritis, neuritis, orchitis, osteochondritis, otitis, pericarditis, peritendonitis, peritonitis, pharyngitis, phlebitis, poliomyelitis, prostatitis, pulpitis, retinitis, rhinitis, salpingitis, scleritis, sclerochoroiditis, scrotitis, sinusitis, spondylitis, steatitis, stomatitis, synovitis, syringitis, tendonitis, tonsillitis, urethritis, and vaginitis.

[0547] In specific embodiments, polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, are useful to diagnose, prognose, prevent, and/or treat organ transplant rejections and graft-versus-host disease. Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response. Similarly, an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues. Polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, that inhibit an immune response, particularly the activation, proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD. In specific embodiments, polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, that inhibit an immune response, particularly the activation, proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing experimental allergic and hyperacute xenograft rejection.

[0548] In other embodiments, polypeptides, antibodies, or polynucleotides of the invention, and/or agonists or antagonists thereof, are useful to diagnose, prognose, prevent, and/or treat immune complex diseases, including, but not limited to, serum sickness, post streptococcal glomerulonephritis, polyarteritis nodosa, and immune complex-induced vasculitis.

[0549] Polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the invention can be used to treat, detect, and/or prevent infectious agents. For example, by increasing the immune response, particularly increasing the proliferation activation and/or differentiation of B and/or T cells, infectious diseases may be treated, detected, and/or prevented. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may also directly inhibit the infectious agent (refer to section of application listing infectious agents, etc), without necessarily eliciting an immune response.

[0550] In another embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a vaccine adjuvant that enhances immune responsiveness to an antigen. In a specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an adjuvant to enhance tumor-specific immune responses.

[0551] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an adjuvant to enhance anti-viral immune responses. Anti-viral immune responses that may be enhanced using the compositions of the invention as an adjuvant, include virus and virus associated diseases or symptoms described herein or otherwise known in the art. In specific embodiments, the compositions of the invention are used as an adjuvant to enhance an immune response to a virus, disease, or symptom selected from the group consisting of: AIDS, meningitis, Dengue, EBV, and hepatitis (e.g., hepatitis B). In another specific embodiment, the compositions of the invention are used as an adjuvant to enhance an immune response to a virus, disease, or symptom selected from the group consisting of: HIV/AIDS, respiratory syncytial virus, Dengue, rotavirus, Japanese B encephalitis, influenza A and B, parainfluenza, measles, cytomegalovirus, rabies, Junin, Chikungunya, Rift Valley Fever, herpes simplex, and yellow fever.

[0552] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an adjuvant to enhance anti-bacterial or anti-fungal immune responses. Anti-bacterial or anti-fungal immune responses that may be enhanced using the compositions of the invention as an adjuvant, include bacteria or fungus and bacteria or fungus associated diseases or symptoms described herein or otherwise known in the art. In specific embodiments, the compositions of the invention are used as an adjuvant to enhance an immune response to a bacteria or fungus, disease, or symptom selected from the group consisting of: tetanus, Diphtheria, botulism, and meningitis type B.

[0553] In another specific embodiment, the compositions of the invention are used as an adjuvant to enhance an immune response to a bacteria or fungus, disease, or symptom selected from the group consisting of: Vibrio cholerae, Mycobacterium leprae, Salmonella typhi, Salmonella paratyphi, Meisseria meningitidis, Streptococcus pneumoniae, Group B streptococcus, Shigella spp., Enterotoxigenic Escherichia coli, Enterohemorrhagic E. coli, and Borrelia burgdorferi.

[0554] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an adjuvant to enhance anti-parasitic immune responses. Anti-parasitic immune responses that may be enhanced using the compositions of the invention as an adjuvant, include parasite and parasite associated diseases or symptoms described herein or otherwise known in the art. In specific embodiments, the compositions of the invention are used as an adjuvant to enhance an immune response to a parasite. In another specific embodiment, the compositions of the invention are used as an adjuvant to enhance an immune response to Plasmodium (malaria) or Leishmania.

[0555] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may also be employed to treat infectious diseases including silicosis, sarcoidosis, and idiopathic pulmonary fibrosis; for example, by preventing the recruitment and activation of mononuclear phagocytes.

[0556] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an antigen for the generation of antibodies to inhibit or enhance immune mediated responses against peptides of the invention.

[0557] In one embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are administered to an animal (e.g., mouse, rat, rabbit, hamster, guinea pig, pigs, micro-pig, chicken, camel, goat, horse, cow, sheep, dog, cat, non-human primate, and human, most preferably human) to boost the immune system to produce increased quantities of one or more antibodies (e.g., IgG, IgA, IgM, and IgE), to induce higher affinity antibody production and immunoglobulin class switching (e.g., IgG, IgA, IgM, and IgE), and/or to increase an immune response.

[0558] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as a stimulator of B responsiveness to pathogens.

[0559] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as an activator of T .

[0560] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as an agent that ates the immune status of an individual prior to their receipt of unosuppressive therapies.

[0561] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as an agent to induce er affinity antibodies.

[0562] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as an agent to increase um immunoglobulin concentrations.

[0563] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as an agent to lerate recovery of immunocompromised individuals.

[0564] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an agent to boost immunoresponsiveness among aged populations and/or neonates.

[0565] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an immune system enhancer prior to, during, or after bone marrow transplant and/or other transplants (e.g., allogeneic or xenogeneic organ transplantation). With respect to transplantation, compositions of the invention may be administered prior to, concomitant with, and/or after transplantation. In a specific embodiment, compositions of the invention are administered after transplantation, prior to the beginning of recovery of T-cell populations. In another specific embodiment, compositions of the invention are first administered after transplantation after the beginning of recovery of T cell populations, but prior to full recovery of B cell populations.

[0566] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an agent to boost immunoresponsiveness among individuals having an acquired loss of B cell function. Conditions resulting in an acquired loss of B cell function that may be ameliorated or treated by administering the polypeptides, antibodies, polynucleotides and/or agonists or antagonists thereof, include, but are not limited to, HIV Infection, AIDS, bone marrow transplant, and B cell chronic lymphocytic leukemia (CLL).

[0567] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an agent to boost immunoresponsiveness among individuals having a temporary immune deficiency. Conditions resulting in a temporary immune deficiency that may be ameliorated or treated by administering the polypeptides, antibodies, polynucleotides and/or agonists or antagonists thereof, include, but are not limited to, recovery from viral infections (e.g., influenza), conditions associated with malnutrition, recovery from infectious mononucleosis, or conditions associated with stress, recovery from measles, recovery from blood transfusion, and recovery from surgery.

[0568] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a regulator of antigen presentation by monocytes, dendritic cells, and/or B-cells. In one embodiment, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention enhance antigen presentation or antagonizes antigen presentation in vitro or in vivo. Moreover, in related embodiments, said enhancement or antagonism of antigen presentation may be useful as an anti-tumor treatment or to modulate the immune system.

[0569] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as an agent to direct an individual's immune system towards development of a humoral response (i.e. TH2) as opposed to a TH1 cellular response.

[0570] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a means to induce tumor proliferation and thus make it more susceptible to anti-neoplastic agents. For example, multiple myeloma is a slowly dividing disease and is thus refractory to virtually all anti-neoplastic regimens. If these cells were forced to proliferate more rapidly their susceptibility profile would likely change.

[0571] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a stimulator of B cell production in pathologies such as AIDS, chronic lymphocyte disorder and/or Common Variable Immunodificiency.

[0572] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a therapy for generation and/or regeneration of lymphoid tissues following surgery, trauma or genetic defect. In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used in the pretreatment of bone marrow samples prior to transplant.

[0573] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a gene-based therapy for genetically inherited disorders resulting in immuno-incompetence/immunodeficiency such as observed among SCID patients.

[0574] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a means of activating monocytes/macrophages to defend against parasitic diseases that effect monocytes such as Leishmania.

[0575] In another specific embodiment, polypeptides, antibodies, polynucleotides or agonists or antagonists of the present invention are used as a means of regulating secreted cytokines that are elicited by polypeptides of the invention.

[0576] In another embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used in one or more of the applications decribed herein, as they may apply to veterinary medicine.

[0577] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a means of blocking various aspects of immune responses to foreign agents or self. Examples of diseases or conditions in which blocking of certain aspects of immune responses may be desired include autoimmune disorders such as lupus, and arthritis, as well as immunoresponsiveness to skin allergies, inflammation, bowel disease, injury and diseases/disorders associated with pathogens.

[0578] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a therapy for preventing the B cell proliferation and Ig secretion associated with autoimmune diseases such as idiopathic thrombocytopenic purpura, systemic lupus erythematosus and multiple sclerosis.

[0579] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a inhibitor of B and/or T cell migration in endothelial cells. This activity disrupts tissue architecture or cognate responses and is useful, for example in disrupting immune responses, and blocking sepsis.

[0580] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a therapy for chronic hypergammaglobulinemia evident in such diseases as monoclonal gammopathy of undetermined significance (MGUS), Waldenstrom's disease, related idiopathic monoclonal gammopathies, and plasmacytomas.

[0581] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may be employed for instance to inhibit polypeptide chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T-cell subsets, e.g., activated and CD8 cytotoxic T cells and natural killer cells, in certain autoimmune and chronic inflammatory and infective diseases. Examples of autoimmune diseases are described herein and include multiple sclerosis, and insulin-dependent diabetes.

[0582] The polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may also be employed to treat idiopathic hyper-eosinophilic syndrome by, for example, preventing eosinophil production and migration.

[0583] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used to enhance or inhibit complement mediated cell lysis.

[0584] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used to enhance or inhibit antibody dependent cellular cytotoxicity.

[0585] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may also be employed for treating atherosclerosis, for example, by preventing monocyte infiltration in the artery wall.

[0586] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may be employed to treat adult respiratory distress syndrome (ARDS).

[0587] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may be useful for stimulating wound and tissue repair, stimulating angiogenesis, and/or stimulating the repair of vascular or lymphatic diseases or disorders. Additionally, agonists and antagonists of the invention may be used to stimulate the regeneration of mucosal surfaces.

[0588] In a specific embodiment, polynucleotides or polypeptides, and/or agonists thereof are used to diagnose, prognose, treat, and/or prevent a disorder characterized by primary or acquired immunodeficiency, deficient serum immunoglobulin production, recurrent infections, and/or immune system dysfunction. Moreover, polynucleotides or polypeptides, and/or agonists thereof may be used to treat or prevent infections of the joints, bones, skin, and/or parotid glands, blood-borne infections (e.g., sepsis, meningitis, septic arthritis, and/or osteomyelitis), autoimmune diseases (e.g., those disclosed herein), inflammatory disorders, and malignancies, and/or any disease or disorder or condition associated with these infections, diseases, disorders and/or malignancies) including, but not limited to, CVID, other primary immune deficiencies, HIV disease, CLL, recurrent bronchitis, sinusitis, otitis media, conjunctivitis, pneumonia, hepatitis, meningitis, herpes zoster (e.g., severe herpes zoster), and/or pneumocystis carnii. Other diseases and disorders that may be prevented, diagnosed, prognosed, and/or treated with polynucleotides or polypeptides, and/or agonists of the present invention include, but are not limited to, HIV infection, HTLV-BLV infection, lymphopenia, phagocyte bactericidal dysfunction anemia, thrombocytopenia, and hemoglobinuria.

[0589] In another embodiment, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention are used to treat, and/or diagnose an individual having common variable immunodeficiency disease (“CVID”; also known as “acquired agammaglobulinemia” and “acquired hypogammaglobulinemia”) or a subset of this disease.

[0590] In a specific embodiment, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to diagnose, prognose, prevent, and/or treat cancers or neoplasms including immune cell or immune tissue-related cancers or neoplasms. Examples of cancers or neoplasms that may be prevented, diagnosed, or treated by polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention include, but are not limited to, acute myelogenous leukemia, chronic myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic anemia (ALL) Chronic lymphocyte leukemia, plasmacytomas, multiple myeloma, Burkitt's lymphoma, EBV-transformed diseases, and/or diseases and disorders described in the section entitled “Hyperproliferative Disorders” elsewhere herein.

[0591] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a therapy for decreasing cellular proliferation of Large B-cell Lymphomas.

[0592] In another specific embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are used as a means of decreasing the involvement of B cells and Ig associated with Chronic Myelogenous Leukemia.

[0593] In specific embodiments, the compositions of the invention are used as an agent to boost immunoresponsiveness among B cell immunodeficient individuals, such as, for example, an individual who has undergone a partial or complete splenectomy.

[0594] Antagonists of the invention include, for example, binding and/or inhibitory antibodies, antisense nucleic acids, ribozymes or soluble forms of the polypeptides of the present invention (e.g., Fc fusion protein; see, e.g., Example 9). Agonists of the invention include, for example, binding or stimulatory antibodies, and soluble forms of the polypeptides (e.g., Fc fusion proteins; see, e.g., Example 9). polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described herein.

[0595] In another embodiment, polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention are administered to an animal (including, but not limited to, those listed above, and also including transgenic animals) incapable of producing functional endogenous antibody molecules or having an otherwise compromised endogenous immune system, but which is capable of producing human immunoglobulin molecules by means of a reconstituted or partially reconstituted immune system from another animal (see, e.g., published PCT Application Nos. WO98/24893, WO/9634096, WO/9633735, and WO/9110741). Administration of polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention to such animals is useful for the generation of monoclonal antibodies against the polypeptides, antibodies, polynucleotides and/or agonists or antagonists of the present invention.

[0596] Blood-Related Disorders

[0597] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to modulate hemostatic (the stopping of bleeding) or thrombolytic (clot dissolving) activity. For example, by increasing hemostatic or thrombolytic activity, polynucleotides or polypeptides, and/or agonists or antagonists of the present invention could be used to treat or prevent blood coagulation diseases, disorders, and/or conditions (e.g., afibrinogenemia, factor deficiencies, hemophilia), blood platelet diseases, disorders, and/or conditions (e.g., thrombocytopenia), or wounds resulting from trauma, surgery, or other causes. Alternatively, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment or prevention of heart attacks (infarction), strokes, or scarring.

[0598] In specific embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to prevent, diagnose, prognose, and/or treat thrombosis, arterial thrombosis, venous thrombosis, thromboembolism, pulmonary embolism, atherosclerosis, myocardial infarction, transient ischemic attack, unstable angina. In specific embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used for the prevention of occulsion of saphenous grafts, for reducing the risk of periprocedural thrombosis as might accompany angioplasty procedures, for reducing the risk of stroke in patients with atrial fibrillation including nonrheumatic atrial fibrillation, for reducing the risk of embolism associated with mechanical heart valves and or mitral valves disease. Other uses for the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention, include, but are not limited to, the prevention of occlusions in extrcorporeal devices (e.g., intravascular canulas, vascular access shunts in hemodialysis patients, hemodialysis machines, and cardiopulmonary bypass machines).

[0599] In another embodiment, a polypeptide of the invention, or polynucleotides, antibodies, agonists, oantntagonists corresponding to that polypeptide, may be used to prevent, diagnose, prognose, and/or treat diseases and disorders of the blood and/or blood forming organs associated with the tissue(s) in which the polypeptide of the invention is expressed, including one, two, three, four, five, or more tissues disclosed in Table 1A, column 7 (Tissue Distribution Library Code).

[0600] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to modulate hematopoietic activity (the formation of blood cells). For example, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to increase the quantity of all or subsets of blood cells, such as, for example, erythrocytes, lymphocytes (B or T cells), myeloid cells (e.g., basophils, eosinophils, neutrophils, mast cells, macrophages) and platelets. The ability to decrease the quantity of blood cells or subsets of blood cells may be useful in the prevention, detection, diagnosis and/or treatment of anemias and leukopenias described below. Alternatively, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to decrease the quantity of all or subsets of blood cells, such as, for example, erythrocytes, lymphocytes (B or T cells), myeloid cells (e.g., basophils, eosinophils, neutrophils, mast cells, macrophages) and platelets. The ability to decrease the quantity of blood cells or subsets of blood cells may be useful in the prevention, detection, diagnosis and/or treatment of leukocytoses, such as, for example eosinophilia.

[0601] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be used to prevent, treat, or diagnose blood dyscrasia.

[0602] Anemias are conditions in which the number of red blood cells or amount of hemoglobin (the protein that carries oxygen) in them is below normal. Anemia may be caused by excessive bleeding, decreased red blood cell production, or increased red blood cell destruction (hemolysis). The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing anemias. Anemias that may be treated prevented or diagnosed by the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention include iron deficiency anemia, hypochromic anemia, microcytic anemia, chlorosis, hereditary siderob;astic anemia, idiopathic acquired sideroblastic anemia, red cell aplasia, megaloblastic anemia (e.g., pernicious anemia, (vitamin B12 deficiency) and folic acid deficiency anemia), aplastic anemia, hemolytic anemias (e.g., autoimmune helolytic anemia, microangiopathic hemolytic anemia, and paroxysmal nocturnal hemoglobinuria). The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing anemias associated with diseases including but not limited to, anemias associated with systemic lupus erythematosus, cancers, lymphomas, chronic renal disease, and enlarged spleens. The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing anemias arising from drug treatments such as anemias associated with methyldopa, dapsone, and/or sulfadrugs. Additionally, rhe polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing anemias associated with abnormal red blood cell architecture including but not limited to, hereditary spherocytosis, hereditary elliptocytosis, glucose-6-phosphate dehydrogenase deficiency, and sickle cell anemia.

[0603] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing hemoglobin abnormalities, (e.g., those associated with sickle cell anemia, hemoglobin C disease, hemoglobin S-C disease, and hemoglobin E disease). Additionally, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating thalassemias, including, but not limited to major and minor forms of alpha-thalassemia and beta-thalassemia.

[0604] In another embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating bleeding disorders including, but not limited to, thrombocytopenia (e.g., idiopathic thrombocytopenic purpura, and thrombotic thrombocytopenic purpura), Von Willebrand's disease, hereditary platelet disorders (e.g., storage pool disease such as Chediak-Higashi and Hermansky-Pudlak syndromes, thromboxane A2 dysfunction, thromboasthenia, and Bernard-Soulier syndrome), hemolytic-uremic syndrome, hemophelias such as hemophelia A or Factor VII deficiency and Christmas disease or Factor IX deficiency, Hereditary Hemorhhagic Telangiectsia, also known as Rendu-Osler-Weber syndrome, allergic purpura (Henoch Schonlein purpura) and disseminated intravascular coagulation.

[0605] The effect of the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention on the clotting time of blood may be monitored using any of the clotting tests known in the art including, but not limited to, whole blood partial thromboplastin time (PTT), the activated partial thromboplastin time (aPTT), the activated clotting time (ACT), the recalcified activated clotting time, or the Lee-White Clotting time.

[0606] Several diseases and a variety of drugs can cause platelet dysfunction. Thus, in a specific embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating acquired platelet dysfunction such as platelet dysfunction accompanying kidney failure, leukemia, multiple myeloma, cirrhosis of the liver, and systemic lupus erythematosus as well as platelet dysfunction associated with drug treatments, including treatment with aspirin, ticlopidine, nonsteroidal anti-inflammatory drugs (used for arthritis, pain, and sprains), and penicillin in high doses.

[0607] In another embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating diseases and disorders characterized by or associated with increased or decreased numbers of white blood cells. Leukopenia occurs when the number of white blood cells decreases below normal. Leukopenias include, but are not limited to, neutropenia and lymphocytopenia. An increase in the number of white blood cells compared to normal is known as leukocytosis. The body generates increased numbers of white blood cells during infection. Thus, leukocytosis may simply be a normal physiological parameter that reflects infection. Alternatively, leukocytosis may be an indicator of injury or other disease such as cancer. Leokocytoses, include but are not limited to, eosinophilia, and accumulations of macrophages. In specific embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating leukopenia. In other specific embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating leukocytosis

[0608] Leukopenia may be a generalized decreased in all types of white blood cells, or may be a specific depletion of particular types of white blood cells. Thus, in specific embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating decreases in neutrophil numbers, known as neutropenia. Neutropenias that may be diagnosed, prognosed, prevented, and/or treated by the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention include, but are not limited to, infantile genetic agranulocytosis, familial neutropenia, cyclic neutropenia, neutropenias resulting from or associated with dietary deficiencies (e.g., vitamin B 12 deficiency or folic acid deficiency), neutropenias resulting from or associated with drug treatments (e.g., antibiotic regimens such as penicillin treatment, sulfonamide treatment, anticoagulant treatment, anticonvulsant drugs, anti-thyroid drugs, and cancer chemotherapy), and neutropenias resulting from increased neutrophil destruction that may occur in association with some bacterial or viral infections, allergic disorders, autoimmune diseases, conditions in which an individual has an enlarged spleen (e.g., Felty syndrome, malaria and sarcoidosis), and some drug treatment regimens.

[0609] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating lymphocytopenias (decreased numbers of B and/or T lymphocytes), including, but not limited lymphocytopenias resulting from or associated with stress, drug treatments (e.g., drug treatment with corticosteroids, cancer chemotherapies, and/or radiation therapies), AIDS infection and/or other diseases such as, for example, cancer, rheumatoid arthritis, systemic lupus erythematosus, chronic infections, some viral infections and/or hereditary disorders (e.g., DiGeorge syndrome, Wiskott-Aldrich Syndome, severe combined immunodeficiency, ataxia telangiectsia).

[0610] The polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating diseases and disorders associated with macrophage numbers and/or macrophage function including, but not limited to, Gaucher's disease, Niemann-Pick disease, Letterer-Siwe disease and Hand-Schuller-Christian disease.

[0611] In another embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating diseases and disorders associated with eosinophil numbers and/or eosinophil function including, but not limited to, idiopathic hypereosinophilic syndrome, eosinophilia-myalgia syndrome, and Hand-Schuller-stian Christian disease.

[0612] In yet another embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating leukemias and lymphomas including, but not limited to, acute lymphocytic (lymphpblastic) leukemia (ALL), acute myeloid (myelocytic, myelogenous, myeloblastic, or myelomonocytic) leukemia, chronic lymphocytic leukemia (e.g., B cell leukemias, T cell leukemias, Sezary syndrome, and Hairy cell leukenia), chronic myelocytic (myeloid, myelogenous, or granulocytic) leukemia, Hodgkin's lymphoma, non-hodgkin's lymphoma, Burkitt's lymphoma, and mycosis fungoides.

[0613] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in diagnosing, prognosing, preventing, and/or treating diseases and disorders of plasma cells including, but not limited to, plasma cell dyscrasias, monoclonal gammaopathies, monoclonal gammopathies of undetermined significance, multiple myeloma, macroglobulinemia, Waldenstrom's macroglobulinemia, cryoglobulinemia, and Raynaud's phenomenon.

[0614] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in treating, preventing, and/or diagnosing myeloproliferative disorders, including but not limited to, polycythemia vera, relative polycythemia, secondary polycythemia, myelofibrosis, acute myelofibrosis, agnogenic myelod metaplasia, thrombocythemia, (including both primary and seconday thrombocythemia) and chronic myelocytic leukemia.

[0615] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful as a treatment prior to surgery, to increase blood cell production.

[0616] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful as an agent to enhance the migration, phagocytosis, superoxide production, antibody dependent cellular cytotoxicity of neutrophils, eosionophils and macrophages.

[0617] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful as an agent to increase the number of stem cells in circulation prior to stem cells pheresis. In another specific embodiment, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful as an agent to increase the number of stem cells in circulation prior to platelet pheresis.

[0618] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful as an agent to increase cytokine production.

[0619] In other embodiments, the polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention may be useful in preventing, diagnosing, and/or treating primary hematopoietic disorders.

[0620] Hyperproliferative Disorders

[0621] Musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists thereof, can be used to treat, prevent, diagnose and/or prognose hyperproliferative diseases, disorders, and/or conditions, including neoplasms.

[0622] In a specific embodiment, musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists thereof, can be used to treat, prevent, and/or diagnose hyperproliferative diseases, disorders, and/or conditions of the musculoskeletal system.

[0623] In a preferred embodiment, musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists thereof, can be used to treat, prevent, and/or diagnose neoplasms of musculoskeletal system tissues.

[0624] Musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists of the invention, may inhibit the proliferation of the disorder through direct or indirect interactions. Alternatively, musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists thereof, may proliferate other cells, which can inhibit the hyperproliferative disorder.

[0625] For example, by increasing an immune response, particularly increasing antigenic qualities of the hyperproliferative disorder or by proliferating, differentiating, or mobilizing T-cells, hyperproliferative diseases, disorders, and/or conditions can be treated, prevented, and/or diagnosed. This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, decreasing an immune response may also be a method of treating, preventing, and/or diagnosing hyperproliferative diseases, disorders, and/or conditions, such as a chemotherapeutic agent.

[0626] Examples of hyperproliferative diseases, disorders, and/or conditions that can be treated, prevented, and/or diagnosed by musculoskeletal system associated polynucleotides or polypeptides, or agonists or antagonists thereof, include, but are not limited to neoplasms located in the: prostate, colon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.

[0627] Similarly, other hyperproliferative disorders can also be treated or detected by polynucleotides or polypeptides, or agonists or antagonists of the present invention. Examples of such hyperproliferative disorders include, but are not limited to: Acute Childhood Lymphoblastic Leukemia, Acute Lymphoblastic Leukemia, Acute Lymphocytic Leukemia, Acute Myeloid Leukemia, Adrenocortical Carcinoma, Adult (Primary) Hepatocellular Cancer, Adult (Primary) Liver Cancer, Adult Acute Lymphocytic Leukemia, Adult Acute Myeloid Leukemia, Adult Hodgkin's Disease, Adult Hodgkin's Lymphoma, Adult Lymphocytic Leukemia, Adult Non-Hodgkin's Lymphoma, Adult Primary Liver Cancer, Adult Soft Tissue Sarcoma, AIDS-Related Lymphoma, AIDS-Related Malignancies, Anal Cancer, Astrocytoma, Bile Duct Cancer, Bladder Cancer, Bone Cancer, Brain Stem Glioma, Brain Tumors, Breast Cancer, Cancer of the Renal Pelvis and Ureter, Central Nervous System (Primary) Lymphoma, Central Nervous System Lymphoma, Cerebellar Astrocytoma, Cerebral Astrocytoma, Cervical Cancer, Childhood (Primary) Hepatocellular Cancer, Childhood (Primary) Liver Cancer, Childhood Acute Lymphoblastic Leukemia, Childhood Acute Myeloid Leukemia, Childhood Brain Stem Glioma, Childhood Cerebellar Astrocytoma, Childhood Cerebral Astrocytoma, Childhood Extracranial Germ Cell Tumors, Childhood Hodgkin's Disease, Childhood Hodgkin's Lymphoma, Childhood Hypothalamic and Visual Pathway Glioma, Childhood Lymphoblastic Leukemia, Childhood Medulloblastoma, Childhood Non-Hodgkin's Lymphoma, Childhood Pineal and Supratentorial Primitive Neuroectodermal Tumors, Childhood Primary Liver Cancer, Childhood Rhabdomyosarcoma, Childhood Soft Tissue Sarcoma, Childhood Visual Pathway and Hypothalamic Glioma, Chronic Lymphocytic Leukemia, Chronic Myelogenous Leukemia, Colon Cancer, Cutaneous T-Cell Lymphoma, Endocrine Pancreas Islet Cell Carcinoma, Endometrial Cancer, Ependymoma, Epithelial Cancer, Esophageal Cancer, Ewing's Sarcoma and Related Tumors, Exocrine Pancreatic Cancer, Extracranial Germ Cell Tumor, Extragonadal Germ Cell Tumor, Extrahepatic Bile Duct Cancer, Eye Cancer, Female Breast Cancer, Gaucher's Disease, Gallbladder Cancer, Gastric Cancer, Gastrointestinal Carcinoid Tumor, Gastrointestinal Tumors, Germ Cell Tumors, Gestational Trophoblastic Tumor, Hairy Cell Leukemia, Head and Neck Cancer, Hepatocellular Cancer, Hodgkin's Disease, Hodgkin's Lymphoma, Hypergammaglobulinemia, Hypopharyngeal Cancer, Intestinal Cancers, Intraocular Melanoma, Islet Cell Carcinoma, Islet Cell Pancreatic, Cancer, Kaposi's Sarcoma, Kidney Cancer, Laryngeal Cancer, Lip and Oral Cavity Cancer, Liver Cancer, Lung Cancer, Lymphoproliferative Disorders, Macroglobulinemia, Male Breast Cancer, Malignant Mesothelioma, Malignant Thymoma, Medulloblastoma, Melanoma, Mesothelioma, Metastatic Occult Primary Squamous Neck Cancer, Metastatic Primary Squamous Neck Cancer, Metastatic Squamous Neck Cancer, Multiple Myeloma, Multiple Myeloma/Plasma Cell Neoplasm, Myelodysplastic Syndrome, Myelogenous Leukemia, Myeloid Leukemia, Myeloproliferative Disorders, Nasal Cavity and Paranasal Sinus Cancer, Nasopharyngeal Cancer, Neuroblastoma, Non-Hodgkin's Lymphoma During Pregnancy, Nonmelanoma Skin Cancer, Non-Small Cell Lung Cancer, Occult Primary Metastatic Squamous Neck Cancer, Oropharyngeal Cancer, Osteo-/Malignant Fibrous Sarcoma, Osteosarcoma/Malignant Fibrous Histiocytoma, Osteosarcoma/Malignant Fibrous Histiocytoma of Bone, Ovarian Epithelial Cancer, Ovarian Germ Cell Tumor, Ovarian Low Malignant Potential Tumor, Pancreatic Cancer, Paraproteinemias, Purpura, Parathyroid Cancer, Penile Cancer, Pheochromocytoma, Pituitary Tumor, Plasma Cell Neoplasm/Multiple Myeloma, Primary Central Nervous System Lymphoma, Primary Liver Cancer, Prostate Cancer, Rectal Cancer, Renal Cell Cancer, Renal Pelvis and Ureter Cancer, Retinoblastoma, Rhabdomyosarcoma, Salivary Gland Cancer, Sarcoidosis Sarcomas, Sezary Syndrome, Skin Cancer, Small Cell Lung Cancer, Small Intestine Cancer, Soft Tissue Sarcoma, Squamous Neck Cancer, Stomach Cancer, Supratentorial Primitive Neuroectodermal and Pineal Tumors, T-Cell Lymphoma, Testicular Cancer, Thymoma, Thyroid Cancer, Transitional Cell Cancer of the Renal Pelvis and Ureter, Transitional Renal Pelvis and Ureter Cancer, Trophoblastic Tumors, Ureter and Renal Pelvis Cell Cancer, Urethral Cancer, Uterine Cancer, Uterine Sarcoma, Vaginal Cancer, Visual Pathway and Hypothalamic Glioma, Vulvar Cancer, Waldenstrom's Macroglobulinemia, Wilms' Tumor, and any other hyperproliferative disease, besides neoplasia, located in an organ system listed above.

[0628] In another preferred embodiment, polynucleotides or polypeptides, or agonists or antagonists of the present invention are used to diagnose, prognose, prevent, and/or treat premalignant conditions and to prevent progression to a neoplastic or malignant state, including but not limited to those disorders described above. Such uses are indicated in conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hyperplasia, metaplasia, or most particularly, dysplasia has occurred (for review of such abnormal growth conditions, see Robbins and Angell, 1976, Basic Pathology, 2d Ed., W. B. Saunders Co., Philadelphia, pp. 68-79.)

[0629] Hyperplasia is a form of controlled cell proliferation, involving an increase in cell number in a tissue or organ, without significant alteration in structure or function. Hyperplastic disorders which can be diagnosed, prognosed, prevented, and/or treated with compositions of the invention (including polynucleotides, polypeptides, agonists or antagonists) include, but are not limited to, angiofollicular mediastinal lymph node hyperplasia, angiolymphoid hyperplasia with eosinophilia, a typical melanocytic hyperplasia, basal cell hyperplasia, benign giant lymph node hyperplasia, cementum hyperplasia, congenital adrenal hyperplasia, congenital sebaceous hyperplasia, cystic hyperplasia, cystic hyperplasia of the breast, denture hyperplasia, ductal hyperplasia, endometrial hyperplasia, fibromuscular hyperplasia, focal epithelial hyperplasia, gingival hyperplasia, inflammatory fibrous hyperplasia, inflammatory papillary hyperplasia, intravascular papillary endothelial hyperplasia, nodular hyperplasia of prostate, nodular regenerative hyperplasia, pseudoepitheliomatous hyperplasia, senile sebaceous hyperplasia, and verrucous hyperplasia.

[0630] Metaplasia is a form of controlled cell growth in which one type of adult or fully differentiated cell substitutes for another type of adult cell. Metaplastic disorders which can be diagnosed, prognosed, prevented, and/or treated with compositions of the invention (including polynucleotides, polypeptides, agonists or antagonists) include, but are not limited to, agnogenic myeloid metaplasia, apocrine metaplasia, atypical metaplasia, autoparenchymatous metaplasia, connective tissue metaplasia, epithelial metaplasia, intestinal metaplasia, metaplastic anemia, metaplastic ossification, metaplastic polyps, myeloid metaplasia, primary myeloid metaplasia, secondary myeloid metaplasia, squamous metaplasia, squamous metaplasia of amnion, and symptomatic myeloid metaplasia.

[0631] Dysplasia is frequently a forerunner of cancer, and is found mainly in the epithelia; it is the most disorderly form of non-neoplastic cell growth, involving a loss in individual cell uniformity and in the architectural orientation of cells. Dysplastic cells often have abnormally large, deeply stained nuclei, and exhibit pleomorphism. Dysplasia characteristically occurs where there exists chronic irritation or inflammation. Dysplastic disorders which can be diagnosed, prognosed, prevented, and/or treated with compositions of the invention (including polynucleotides, polypeptides, agonists or antagonists) include, but are not limited to, anhidrotic ectodermal dysplasia, anterofacial dysplasia, asphyxiating thoracic dysplasia, atriodigital dysplasia, bronchopulmonary dysplasia, cerebral dysplasia, cervical dysplasia, chondroectodermal dysplasia, cleidocranial dysplasia, congenital ectodermal dysplasia, craniodiaphysial dysplasia, craniocarpotarsal dysplasia, craniometaphysial dysplasia, dentin dysplasia, diaphysial dysplasia, ectodermal dysplasia, enamel dysplasia, encephalo-ophthalmic dysplasia, dysplasia epiphysialis hemimelia, dysplasia epiphysialis multiplex, dysplasia epiphysialis punctata, epithelial dysplasia, faciodigitogenital dysplasia, familial fibrous dysplasia of jaws, familial white folded dysplasia, fibromuscular dysplasia, fibrous dysplasia of bone, florid osseous dysplasia, hereditary renal-retinal dysplasia, hidrotic ectodermal dysplasia, hypohidrotic ectodermal dysplasia, lymphopenic thymic dysplasia, mammary dysplasia, mandibulofacial dysplasia, metaphysial dysplasia, Mondini dysplasia, monostotic fibrous dysplasia, mucoepithelial dysplasia, multiple epiphysial dysplasia, oculoauriculovertebral dysplasia, oculodentodigital dysplasia, oculovertebral dysplasia, odontogenic dysplasia, ophthalmomandibulomelic dysplasia, periapical cemental dysplasia, polyostotic fibrous dysplasia, pseudoachondroplastic spondyloepiphysial dysplasia, retinal dysplasia, septo-optic dysplasia, spondyloepiphysial dysplasia, and ventriculoradial dysplasia.

[0632] Additional pre-neoplastic disorders which can be diagnosed, prognosed, prevented, and/or treated with compositions of the invention (including polynucleotides, polypeptides, agonists or antagonists) include, but are not limited to, benign dysproliferative disorders (e.g., benign tumors, fibrocystic conditions, tissue hypertrophy, intestinal polyps, colon polyps, and esophageal dysplasia), leukoplakia, keratoses, Bowen's disease, Farmer's Skin, solar cheilitis, and solar keratosis.

[0633] In another embodiment, a polypeptide of the invention, or polynucleotides, antibodies, agonists, or antagonists corresponding to that polypeptide, may be used to diagnose and/or prognose disorders associated with the tissue(s) in which the polypeptide of the invention is expressed, including one, two, three, four, five, or more tissues disclosed in Table 1A, 7 (Tissue Distribution Library Code).

[0634] In another embodiment, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention conjugated to a toxin or a radioactive isotope, as described herein, may be used to treat cancers and neoplasms, including, but not limited to those described herein. In a further preferred embodiment, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention conjugated to a toxin or a radioactive isotope, as described herein, may be used to treat acute myelogenous leukemia.

[0635] Additionally, polynucleotides, polypeptides, and/or agonists or antagonists of the invention may affect apoptosis, and therefore, would be useful in treating a number of diseases associated with increased cell survival or the inhibition of apoptosis. For example, diseases associated with increased cell survival or the inhibition of apoptosis that could be diagnosed, prognosed, prevented, and/or treated by polynucleotides, polypeptides, and/or agonists or antagonists of the invention, include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) and viral infections (such as herpes viruses, pox viruses and adenoviruses), inflammation, graft v. host disease, acute graft rejection, and chronic graft rejection.

[0636] In preferred embodiments, polynucleotides, polypeptides, and/or agonists or antagonists of the invention are used to inhibit growth, progression, and/or metastasis of cancers, in particular those listed above.

[0637] Additional diseases or conditions associated with increased cell survival that could be diagnosed, prognosed, prevented, and/or treated by polynucleotides, polypeptides, and/or agonists or antagonists of the invention, include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, emangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.

[0638] Diseases associated with increased apoptosis that could be diagnosed, prognosed, prevented, and/or treated by polynucleotides, polypeptides, and/or agonists or antagonists of the invention, include AIDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, retinitis pigmentosa, cerebellar degeneration and brain tumor or prior associated disease); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia), graft v. host disease, ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury), liver injury (e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer); toxin-induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.

[0639] Hyperproliferative diseases and/or disorders that could be diagnosed, prognosed, prevented, and/or treated by polynucleotides, polypeptides, and/or agonists or antagonists of the invention, include, but are not limited to, neoplasms located in the liver, abdomen, bone, breast, digestive system, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, thorax, and urogenital tract.

[0640] Similarly, other hyperproliferative disorders can also be diagnosed, prognosed, prevented, and/or treated by polynucleotides, polypeptides, and/or agonists or antagonists of the invention. Examples of such hyperproliferative disorders include, but are not limited to: hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary Syndrome, Waldenstron's macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hyperproliferative disease, besides neoplasia, located in an organ system listed above.

[0641] One preferred embodiment utilizes polynucleotides of the present invention to inhibit aberrant cellular division, by gene therapy using the present invention, and/or protein fusions or fragments thereof.

[0642] Thus, the present invention provides a method for treating cell proliferative diseases, disorders, and/or conditions by inserting into an abnormally proliferating cell a polynucleotide of the present invention, wherein said polynucleotide represses said cell proliferation, disease, disorder, and/or condition.

[0643] In a preferred embodiment, the present invention provides a method for treating cell proliferative diseases, disorders and/or conditions of the musculoskeletal system by inserting into a cell, a polynucleotide of the present invention, wherein said polynucleotide represses said cell proliferation, disease and/or disorder.

[0644] Another embodiment of the present invention provides a method of treating cell-proliferative diseases, disorders, and/or conditions in individuals comprising administration of one or more active gene copies of the present invention to an abnormally proliferating cell or cells. In a preferred embodiment, polynucleotides of the present invention is a DNA construct comprising a recombinant expression vector effective in expressing a DNA sequence encoding said polynucleotides. In another preferred embodiment of the present invention, the DNA construct encoding the polynucleotides of the present invention is inserted into cells to be treated utilizing a retrovirus, or more preferably an adenoviral vector (see, e.g., G J. Nabel, et. al., PNAS 96: 324-326 (1999), which is hereby incorporated by reference). In a most preferred embodiment, the viral vector is defective and will not transform non-proliferating cells, only proliferating cells. Moreover, in a preferred embodiment, the polynucleotides of the present invention inserted into proliferating cells either alone, or in combination with or fused to other polynucleotides, can then be modulated via an external stimulus (i.e., magnetic, specific small molecule, chemical, or drug administration, etc.), which acts upon the promoter upstream of said polynucleotides to innduce expression of the encoded protein product. As such the beneficial therapeutic affect of the present invention may be expressly modulated (i.e., to increase, decrease, or inhibit expression of the present invention) based upon said external stimulus.

[0645] Polynucleotides of the present invention may be useful in repressing expression of oncogenic genes or antigens. By “repressing expression of the oncogenic genes” is intended the suppression of the transcription of the gene, the degradation of the gene transcript (pre-message RNA), the inhibition of splicing, the destruction of the messenger RNA, the prevention of the post-translational modifications of the protein, the destruction of the protein, or the inhibition of the normal function of the protein.

[0646] For local administration to abnormally proliferating cells, polynucleotides of the present invention may be administered by any method known to those of skill in the art including, but not limited to transfection, electroporation, microinjection of cells, or in vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any other method described throughout the specification. The polynucleotide of the present invention may be delivered by known gene delivery systems such as, but not limited to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci. U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol. Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812 (1985)) known to those skilled in the art. These references are exemplary only and are hereby incorporated by reference. In order to specifically deliver or transfect cells which are abnormally proliferating and spare non-dividing cells, it is preferable to utilize a retrovirus, or adenoviral (as described in the art and elsewhere herein) delivery system known to those of skill in the art. Since host DNA replication is required for retroviral DNA to integrate and the retrovirus will be unable to self replicate due to the lack of the retrovirus genes needed for its life cycle. Utilizing such a retroviral delivery system for polynucleotides of the present invention will target said gene and constructs to abnormally proliferating cells and will spare the non-dividing normal cells.

[0647] The polynucleotides of the present invention may be delivered directly to cell proliferative disorder/disease sites in internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the disease site. The polynucleotides of the present invention may also be administered to disease sites at the time of surgical intervention.

[0648] By “cell proliferative disease” is meant any human or animal disease or disorder, affecting any one or any combination of organs, cavities, or body parts, which is characterized by single or multiple local abnormal proliferations of cells, groups of cells, or tissues, whether benign or malignant.

[0649] Any amount of the polynucleotides of the present invention may be administered as long as it has a biologically inhibiting effect on the proliferation of the treated cells. Moreover, it is possible to administer more than one of the polynucleotide of the present invention simultaneously to the same site. By “biologically inhibiting” is meant partial or total growth inhibition as well as decreases in the rate of proliferation or growth of the cells. The biologically inhibitory dose may be determined by assessing the effects of the polynucleotides of the present invention on target malignant or abnormally proliferating cell growth in tissue culture, tumor growth in animals and cell cultures, or any other method known to one of ordinary skill in the art.

[0650] The present invention is further directed to antibody-based therapies which involve administering of anti-polypeptides and anti-polynucleotide antibodies to a mammalian, preferably human, patient for treating one or more of the described diseases, disorders, and/or conditions. Methods for producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and monoclonal antibodies are described in detail elsewhere herein. Such antibodies may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.

[0651] A summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g., as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below. Armed with the teachings provided herein, one of ordinary skill in the art will know how to use the antibodies of the present invention for diagnostic, monitoring or therapeutic purposes without undue experimentation.

[0652] In particular, the antibodies, fragments and derivatives of the present invention are useful for treating a subject having or developing cell proliferative and/or differentiation diseases, disorders, and/or conditions as described herein. Such treatment comprises administering a single or multiple doses of the antibody, or a fragment, derivative, or a conjugate thereof.

[0653] The antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors, for example, which serve to increase the number or activity of effector cells which interact with the antibodies.

[0654] It is preferred to use high affinity and/or potent in vivo inhibiting and/or neutralizing antibodies against polypeptides or polynucleotides of the present invention, fragments or regions thereof, for both immunoassays directed to and therapy of diseases, disorders, and/or conditions related to polynucleotides or polypeptides, including fragments thereof, of the present invention. Such antibodies, fragments, or regions, will preferably have an affinity for polynucleotides or polypeptides, including fragments thereof. Preferred binding affinities include those with a dissociation constant or Kd less than 5×10−6M, 10−6M, 5×10−7M, 10−7M, 5×10−8M, 10−8M, 5×10−9M, 10−9M, 5×10−10M, 10−10M, 5×10−11M, 10−11M, 5×10−12M, 10−12M, 5×1013M, 10−13M, 5×10−14M, 10−14M, 5×10−15M, and 10−15M.

[0655] Moreover, musculoskeletal system antigen polypeptides of the present invention or fragments thereof, are useful in inhibiting the angiogenesis of proliferative cells or tissues, either alone, as a protein fusion, or in combination with other polypeptides directly or indirectly, as described elsewhere herein. In a most preferred embodiment, said anti-angiogenesis effect may be achieved indirectly, for example, through the inhibition of hematopoietic, tumor-specific cells, such as tumor-associated macrophages (see, e.g., Joseph I B, et al. J Natl Cancer Inst, 90(21):1648-53 (1998), which is hereby incorporated by reference). Antibodies directed to polypeptides or polynucleotides of the present invention may also result in inhibition of angiogenesis directly, or indirectly (see, e.g., Witte L, et al., Cancer Metastasis Rev. 17(2):155-61 (1998), which is hereby incorporated by reference)).

[0656] Polypeptides, including protein fusions, of the present invention, or fragments thereof may be useful in inhibiting proliferative cells or tissues through the induction of apoptosis. Said polypeptides may act either directly, or indirectly to induce apoptosis of proliferative cells and tissues, for example in the activation of a death-domain receptor, such as tumor necrosis factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (see, e.g., Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998), which is hereby incorporated by reference). Moreover, in another preferred embodiment of the present invention, said polypeptides may induce apoptosis through other mechanisms, such as in the activation of other proteins which will activate apoptosis, or through stimulating the expression of said proteins, either alone or in combination with small molecule drugs or adjuvants, such as apoptonin, galectins, thioredoxins, antiinflammatory proteins (See for example, Mutat. Res. 400(1-2):447-55 (1998), Med Hypotheses.50(5):423-33 (1998), Chem. Biol. Interact. April 24;111-112:23-34 (1998), J. Mo. Med. 76(6):402-12 (1998), Int. J. Tissue React. 20(1):3-15 (1998), which are all hereby incorporated by reference).

[0657] Polypeptides, including protein fusions to, or fragments thereof, of the present invention are useful in inhibiting the metastasis of proliferative cells or tissues. Inhibition may occur as a direct result of administering polypeptides, or antibodies directed to said polypeptides as described elsewhere herein, or indirectly, such as activating the expression of proteins known to inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr Top Microbiol Immunol 1998;231:125-41, which is hereby incorporated by reference). Such therapeutic affects of the present invention may be achieved either alone, or in combination with small molecule drugs or adjuvants.

[0658] In another embodiment, the invention provides a method of delivering compositions containing the polypeptides of the invention (e.g., compositions containing polypeptides or anti-musculoskeletal system antigen polypeptide antibodies associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs) to targeted cells expressing the polypeptide of the present invention. Musculoskeletal system antigen polypeptides or anti-musculoskeletal system antigen polypeptide antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.

[0659] Polypeptides, protein fusions to, or fragments thereof, of the present invention are useful in enhancing the immunogenicity and/or antigenicity of proliferating cells or tissues, either directly, such as would occur if the polypeptides of the present invention ‘vaccinated’ the immune response to respond to proliferative antigens and immunogens, or indirectly, such as in activating the expression of proteins known to enhance the immune response (e.g. chemokines), to said antigens and immunogens.

[0660] Urinary System Disorders

[0661] Polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention, may be used to treat, prevent, diagnose, and/or prognose disorders of the urinary system, including but not limited to disorders of the renal system, bladder, ureters, and urethra. Renal disorders include, but are not limited to, kidney failure, nephritis, blood vessel disorders of kidney, metabolic and congenital kidney disorders, urinary disorders of the kidney, autoimmune disorders, sclerosis and necrosis, electrolyte imbalance, and kidney cancers.

[0662] Kidney failure diseases include, but are not limited to, acute kidney failure, chronic kidney failure, atheroembolic renal failure, and end-stage renal disease. Inflammatory diseases of the kidney include acute glomerulonephritis, postinfectious glomerulonephritis, rapidly progressive glomerulonephritis, nephrotic syndrome, membranous glomerulonephritis, familial nephrotic syndrome, membranoproliferative glomerulonephritis I and II, mesangial proliferative glomerulonephritis, chronic glomerulonephritis, acute tubulointerstitial nephritis, chronic tubulointerstitial nephritis, acute post-streptococcal glomerulonephritis (PSGN), pyelonephritis, lupus nephritis, chronic nephritis, interstitial nephritis, and post-streptococcal glomerulonephritis.

[0663] Blood vessel disorders of the kidneys include, but are not limited to, kidney infarction, atheroembolic kidney disease, cortical necrosis, malignant nephrosclerosis, renal vein thrombosis, renal underperfusion, renal ischemia-reperfusion, renal artery embolism, and renal artery stenosis. Kidney disorders resulting form urinary tract problems include, but are not limited to, pyelonephritis, hydronephrosis, urolithiasis (renal lithiasis, nephrolithiasis), reflux nephropathy, urinary tract infections, urinary retention, and acute or chronic unilateral obstructive uropathy.

[0664] Metabolic and congenital disorders of the kidneys include, but are not limited to, renal tubular acidosis, renal glycosuria, nephrogenic diabetes insipidus, cystinuria, Fanconi's syndrome, vitamin D-resistant rickets, Hartnup disease, Bartter's syndrome, Liddle's syndrome, polycystic kidney disease, medullary cystic disease, medullary sponge kidney, Alport's syndrome, nail-patella syndrome, congenital nephrotic syndrome, CRUSH syndrome, horseshoe kidney, diabetic nephropathy, nephrogenic diabetes insipidus, analgesic nephropathy, kidney stones, and membranous nephropathy, Kidney disorders resulting from an autoimmune response include, but are not limited to, systemic lupus erythematosus (SLE), Goodpasture syndrome, IgA nephropathy, and IgM mesangial proliferative glomerulonephritis.

[0665] Sclerotic or necrotic disorders of the kidney include, but are not limited to, glomerulosclerosis, diabetic nephropathy, focal segmental glomerulosclerosis (FSGS); necrotizing glomerulonephritis, and renal papillary necrosis. Kidneys may also develop carcinomas, including, but not limited to, hypernephroma, nephroblastoma, renal cell cancer, transitional cell cancer, squamous cell cancer, and Wilm's tumor.

[0666] Kidney disorders may also result in electrolyte imbalances, including, but not limited to, nephrocalcinosis, pyuria, edema, hydronephritis, proteinuria, hyponatremia, hypernatremia, hypokalemia, hyperkalemia, hypocalcemia, hypercalcemia, hypophosphatemia, and hyperphosphatemia.

[0667] Bladder disorders include, but are not limited to, benign prostatic hyperplasia (BPH), interstitial cystitis (IC), prostatitis, proteinuria, urinary tract infections, urinary incontinence, urinary retention. Disorders of the ureters and urethra include, but are not limited to, acute or chronic unilateral obstructive uropathy. The bladder, ureters, and urethra may also develop carcinomas, including, but not limited to, superficial bladder canccer, invasive bladder cancer, carcinoma of the ureter, and urethra cancers.

[0668] Polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art. Polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering polynucleotides are described in more detail herein.

[0669] Cardiovascular Disorders

[0670] Polynucleotides or polypeptides, or agonists or antagonists of the present invention, may be used to treat, prevent, diagnose, and/or prognose cardiovascular disorders, including, but not limited to, peripheral artery disease, such as limb ischemia.

[0671] Cardiovascular disorders include cardiovascular abnormalities, such as arterio-arterial fistula, arterioyenous fistula, cerebral arterioyenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, total anomalous pulmonary venous connection, hypoplastic left heart syndrome, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, atrioventricular canal defect, trilogy of Fallot, ventricular heart septal defects.

[0672] Cardiovascular disorders also include heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest, sudden cardiac death, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal rupture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, diastolic dysfunction, enlarged heart, heart block, J-curve phenomenon, rheumatic heart disease, Marfan syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.

[0673] Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation. Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.

[0674] Heart valve disease include aortic valve insufficiency, aortic valve stenosis, heart murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insuficiency, tricuspid valve stenosis, and bicuspid aortic valve.

[0675] Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, Barth syndrome, mycardial reperfusion injury, and myocarditis.

[0676] Myocardial ischemias include coronary disease, such as angina pectoris, Prinzmetal's angina, unstable angina, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.

[0677] Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel-Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension (shock), ischemia, peripheral vascular diseases, phlebitis, superficial phlebitis, pulmonary veno-occlusive disease, chronic obstructive pulmonary disease, Buerger's disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia telangiectasia, hereditary hemorrhagic telangiectasia, deep vein thrombosis, varicocele, varicose veins, varicose ulcer, vasculitis, and venous insufficiency.

[0678] Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.

[0679] Arterial occlusive diseases include arteriosclerosis, arteriolosclerosis, atherosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans.

[0680] Cerebrovascular disorders include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arterioyenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.

[0681] Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms. Thrombosis include coronary thrombosis, hepatic vein thrombosis, deep vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.

[0682] Ischemia includes cerebral ischemia, ischemic colitis, silent ischemia, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis.

[0683] Cardiovascular diseases can also occur due to electrolyte imbalances that include, but are not limited to hyponatremia, hypernatremia, hypokalemia, hyperkalemia, hypocalcemia, hypercalcemia, hypophosphatemia, and hyperphophatemia. Neoplasm and/or cancers of the cardiovascular system include, but are not limited to, myxomas, fibromas, and rhabdomyomas.

[0684] Polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art. Polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering polynucleotides are described in more detail herein.

[0685] Respiratory Disorders

[0686] Polynucleotides or polypeptides, or agonists or antagonists of the present invention may be used to treat, prevent, diagnose, and/or prognose diseases and/or disorders of the respiratory system.

[0687] Diseases and disorders of the respiratory system include, but are not limited to, nasal vestibulitis, nonallergic rhinitis (e.g., acute rhinitis, chronic rhinitis, atrophic rhinitis, vasomotor rhinitis), nasal polyps, and sinusitis, juvenile angiofibromas, cancer of the nose and juvenile papillomas, vocal cord polyps, nodules (singer's nodules), contact ulcers, vocal cord paralysis, laryngoceles, pharyngitis (e.g., viral and bacterial), tonsillitis, tonsillar cellulitis, parapharyngeal abscess, laryngitis, laryngoceles, and throat cancers (e.g., cancer of the nasopharynx, tonsil cancer, larynx cancer), lung cancer (e.g., squamous cell carcinoma, small cell (oat cell) carcinoma, large cell carcinoma, and adenocarcinoma), allergic disorders (eosinophilic pneumonia, hypersensitivity pneumonitis (e.g., extrinsic allergic alveolitis, allergic interstitial pneumonitis, organic dust pneumoconiosis, allergic bronchopulmonary aspergillosis, asthma, Wegener's granulomatosis (granulomatous vasculitis), Goodpasture's syndrome)), pneumonia (e.g., bacterial pneumonia (e.g., Streptococcus pneumoniae (pneumoncoccal pneumonia), Staphylococcus aureus (staphylococcal pneumonia), Gram-negative bacterial pneumonia (caused by, e.g., Klebsiella and Pseudomas spp.), Mycoplasma pneumoniae pneumonia, Hemophilus influenzae pneumonia, Legionella pneumophilla (Legionnaires' disease), and Chlamydia psittaci (Psittacosis)), and viral pneumonia (e.g., influenza, chickenpox (varicella).

[0688] Additional diseases and disorders of the respiratory system include, but are not limited to bronchiolitis, polio (poliomyelitis), croup, respiratory syncytial viral infection, mumps, erythema infectiosum (fifth disease), roseola infantum, progressive rubella panencephalitis, german measles, and subacute sclerosing panencephalitis), fungal pneumonia (e.g., Histoplasmosis, Coccidioidomycosis, Blastomycosis, fungal infections in people with severely suppressed immune systems (e.g., cryptococcosis, caused by Cryptococcus neoformans; aspergillosis, caused by Aspergillus spp.; candidiasis, caused by Candida; and mucormycosis)), Pneumocystis carinii (pneumocystis pneumonia), atypical pneumonias (e.g., Mycoplasma and Chlamydia spp.), opportunistic infection pneumonia, nosocomial pneumonia, chemical pneumonitis, and aspiration pneumonia, pleural disorders (e.g., pleurisy, pleural effusion, and pneumothorax (e.g., simple spontaneous pneumothorax, complicated spontaneous pneumothorax, tension pneumothorax)), obstructive airway diseases (e.g., asthma, chronic obstructive pulmonary disease (COPD), emphysema, chronic or acute bronchitis), occupational lung diseases (e.g., silicosis, black lung (coal workers' pneumoconiosis), asbestosis, berylliosis, occupational asthsma, byssinosis, and benign pneumoconioses), Infiltrative Lung Disease (e.g., pulmonary fibrosis (e.g., fibrosing alveolitis, usual interstitial pneumonia), idiopathic pulmonary fibrosis, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, histiocytosis X (e.g., Letterer-Siwe disease, Hand-Schüller-Christian disease, eosinophilic granuloma), idiopathic pulmonary hemosiderosis, sarcoidosis and pulmonary alveolar proteinosis), Acute respiratory distress syndrome (also called, e.g., adult respiratory distress syndrome), edema, pulmonary embolism, bronchitis (e.g., viral, bacterial), bronchiectasis, atelectasis, lung abscess (caused by, e.g., Staphylococcus aureus or Legionella pneumophilla), and cystic fibrosis.

[0689] Anti-Angiogenesis Activity

[0690] The naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is one in which inhibitory influences predominate. Rastinejad et al., Cell 56:345-355 (1989). In those rare instances in which neovascularization occurs under normal physiological conditions, such as wound healing, organ regeneration, embryonic development, and female reproductive processes, angiogenesis is stringently regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as that characterizing solid tumor growth, these regulatory controls fail. Unregulated angiogenesis becomes pathologic and sustains progression of many neoplastic and non-neoplastic diseases. A number of serious diseases are dominated by abnormal neovascularization including solid tumor growth and metastases, arthritis, some types of eye disorders, and psoriasis. See, e.g., reviews by Moses et al., Biotech. 9:630-634 (1991); Folkman et al., N. Engl. J. Med., 333:1757-1763 (1995); Auerbach et al., J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743 (1982); and Folkman et al., Science 221:719-725 (1983). In a number of pathological conditions, the process of angiogenesis contributes to the disease state. For example, significant data have accumulated which suggest that the growth of solid tumors is dependent on angiogenesis. Folkman and Klagsbrun, Science 235:442-447 (1987).

[0691] The present invention provides for treatment of diseases or disorders associated with neovascularization by administration of the polynucleotides and/or polypeptides of the invention, as well as agonists or antagonists of the present invention. Malignant and metastatic conditions which can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention include, but are not limited to, malignancies, solid tumors, and cancers described herein and otherwise known in the art (for a review of such disorders, see Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia (1985)). Thus, the present invention provides a method of treating an angiogenesis-related disease and/or disorder, comprising administration to an individual in need thereof a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist of the invention. For example, polynucleotides, polypeptides, antagonists and/or agonists may be utilized in a variety of additional methods in order to therapeutically treat a cancer or tumor. Cancers which may be treated with polynucleotides, polypeptides, antagonists and/or agonists include, but are not limited to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, uterus, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non-small cell lung cancer; colorectal cancer; advanced malignancies; and blood born tumors such as leukemias. For example, polynucleotides, polypeptides, antagonists and/or agonists may be delivered topically, in order to treat cancers such as skin cancer, head and neck tumors, breast tumors, and Kaposi's sarcoma.

[0692] Within yet other aspects, polynucleotides, polypeptides, antagonists and/or agonists may be utilized to treat superficial forms of bladder cancer by, for example, intravesical administration. Polynucleotides, polypeptides, antagonists and/or agonists may be delivered directly into the tumor, or near the tumor site, via injection or a catheter. Of course, as the artisan of ordinary skill will appreciate, the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.

[0693] Polynucleotides, polypeptides, antagonists and/or agonists may be useful in treating other disorders, besides cancers, which involve angiogenesis. These disorders include, but are not limited to: benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids); nonunion fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis; coronary collaterals; cerebral collaterals; arterioyenous malformations; ischemic limb angiogenesis; Osler-Webber Syndrome; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis.

[0694] For example, within one aspect of the present invention methods are provided for treating hypertrophic scars and keloids, comprising the step of administering a polynucleotide, polypeptide, antagonist and/or agonist of the invention to a hypertrophic scar or keloid.

[0695] Within one embodiment of the present invention polynucleotides, polypeptides, antagonists and/or agonists of the invention are directly injected into a hypertrophic scar or keloid, in order to prevent the progression of these lesions. This therapy is of particular value in the prophylactic treatment of conditions which are known to result in the development of hypertrophic scars and keloids (e.g., burns), and is preferably initiated after the proliferative phase has had time to progress (approximately 14 days after the initial injury), but before hypertrophic scar or keloid development. As noted above, the present invention also provides methods for treating neovascular diseases of the eye, including for example, corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.

[0696] Moreover, ocular disorders associated with neovascularization which can be treated with the polynucleotides and polypeptides of the present invention (including agonists and/or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity macular degeneration, corneal graft neovascularization, as well as other eye inflammatory diseases, ocular tumors and diseases associated with choroidal or iris neovascularization. See, e.g., reviews by Waltman et al., Am. J. Ophthal. 85:704-710 (1978) and Gartner et al., Surv. Ophthal. 22:291-312 (1978).

[0697] Thus, within one aspect of the present invention methods are provided for treating neovascular diseases of the eye such as corneal neovascularization (including corneal graft neovascularization), comprising the step of administering to a patient a therapeutically effective amount of a compound (as described above) to the cornea, such that the formation of blood vessels is inhibited. Briefly, the cornea is a tissue, which normally lacks blood vessels. In certain pathological conditions however, capillaries may extend into the cornea from the pericomeal vascular plexus of the limbus. When the cornea becomes vascularized, it also becomes clouded, resulting in a decline in the patient's visual acuity. Visual loss may become complete if the cornea completely opacitates. A wide variety of disorders can result in corneal neovascularization, including for example, corneal infections (e.g., trachoma, herpes simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (e.g., graft rejection and Stevens-Johnson's syndrome), alkali burns, trauma, inflammation (of any cause), toxic and nutritional deficiency states, and as a complication of wearing contact lenses.

[0698] Within particularly preferred embodiments of the invention, may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations), and administered in eyedrop form. The solution or suspension may be prepared in its pure form and administered several times daily. Alternatively, anti-angiogenic compositions, prepared as described above, may also be administered directly to the cornea. Within preferred embodiments, the anti-angiogenic composition is prepared with a muco-adhesive polymer, which binds to cornea. Within further embodiments, the anti-angiogenic factors or anti-angiogenic compositions may be utilized as an adjunct to conventional steroid therapy. Topical therapy may also be useful prophylactically in corneal lesions which are known to have a high probability of inducing an angiogenic response (such as chemical burns). In these instances the treatment, likely in combination with steroids, may be instituted immediately to help prevent subsequent complications.

[0699] Within other embodiments, the compounds described above may be injected directly into the corneal stroma by an ophthalmologist under microscopic guidance. The preferred site of injection may vary with the morphology of the individual lesion, but the goal of the administration would be to place the composition at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal comea). In most cases this would involve perilimbic corneal injection to “protect” the cornea from the advancing blood vessels. This method may also be utilized shortly after a corneal insult in order to prophylactically prevent corneal neovascularization. In this situation, the material could be injected in the perilimbic cornea interspersed between the corneal lesion and its undesired potential limbic blood supply. Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted comeas. In a sustained-release form, injections might only be required 2-3 times per year. A steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.

[0700] Within another aspect of the present invention, methods are provided for treating neovascular glaucoma, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited. In one embodiment, the compound may be administered topically to the eye in order to treat early forms of neovascular glaucoma. Within other embodiments, the compound may be implanted by injection into the region of the anterior chamber angle. Within other embodiments, the compound may also be placed in any location such that the compound is continuously released into the aqueous humor. Within another aspect of the present invention, methods are provided for treating proliferative diabetic retinopathy, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eyes, such that the formation of blood vessels is inhibited.

[0701] Within particularly preferred embodiments of the invention, proliferative diabetic retinopathy may be treated by injection into the aqueous humor or the vitreous, in order to increase the local concentration of the polynucleotide, polypeptide, antagonist and/or agonist in the retina. Preferably, this treatment should be initiated prior to the acquisition of severe disease requiring photocoagulation.

[0702] Within another aspect of the present invention, methods are provided for treating retrolental fibroplasia, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited. The compound may be administered topically, via intravitreous injection and/or via intraocular implants.

[0703] Additionally, disorders which can be treated with the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osler-Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.

[0704] Moreover, disorders and/or states, which can be treated, prevented, diagnosed and/or prognosed with the polynucleotides, polypeptides, agonists and/or agonists of the invention include, but are not limited to, solid tumors, blood born tumors such as leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vascluogenesis, granulations, hypertrophic scars (keloids), nonunion fractures, scleroderma, trachoma, vascular adhesions, myocardial angiogenesis, coronary collaterals, cerebral collaterals, arteriovenous malformations, ischemic limb angiogenesis, Osler-Webber Syndrome, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma fibromuscular dysplasia, wound granulation, Crohn's disease, atherosclerosis, birth control agent by preventing vascularization required for embryo implantation controlling menstruation, diseases that have angiogenesis as a pathologic consequence such as cat scratch disease (Rochele minalia quintosa), ulcers (Helicobacter pylori), Bartonellosis and bacillary angiomatosis.

[0705] In one aspect of the birth control method, an amount of the compound sufficient to block embryo implantation is administered before or after intercourse and fertilization have occurred, thus providing an effective method of birth control, possibly a “morning after” method. Polynucleotides, polypeptides, agonists and/or agonists may also be used in controlling menstruation or administered as either a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis.

[0706] Polynucleotides, polypeptides, agonists and/or agonists of the present invention may be incorporated into surgical sutures in order to prevent stitch granulomas.

[0707] Polynucleotides, polypeptides, agonists and/or agonists may be utilized in a wide variety of surgical procedures. For example, within one aspect of the present invention a compositions (in the form of, for example, a spray or film) may be utilized to coat or spray an area prior to removal of a tumor, in order to isolate normal surrounding tissues from malignant tissue, and/or to prevent the spread of disease to surrounding tissues. Within other aspects of the present invention, compositions (e.g., in the form of a spray) may be delivered via endoscopic procedures in order to coat tumors, or inhibit angiogenesis in a desired locale. Within yet other aspects of the present invention, surgical meshes, which have been coated with anti-angiogenic compositions of the present invention may be utilized in any procedure wherein a surgical mesh might be utilized. For example, within one embodiment of the invention a surgical mesh laden with an anti-angiogenic composition may be utilized during abdominal cancer resection surgery (e.g., subsequent to colon resection) in order to provide support to the structure, and to release an amount of the anti-angiogenic factor.

[0708] Within further aspects of the present invention, methods are provided for treating tumor excision sites, comprising administering a polynucleotide, polypeptide, agonist and/or agonist to the resection margins of a tumor subsequent to excision, such that the local recurrence of cancer and the formation of new blood vessels at the site is inhibited. Within one embodiment of the invention, the anti-angiogenic compound is administered directly to the tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic compound). Alternatively, the anti-angiogenic compounds may be incorporated into known surgical pastes prior to administration. Within particularly preferred embodiments of the invention, the anti-angiogenic compounds are applied after hepatic resections for malignancy, and after neurosurgical operations.

[0709] Within one aspect of the present invention, polynucleotides, polypeptides, agonists and/or agonists may be administered to the resection margin of a wide variety of tumors, including for example, breast, colon, brain and hepatic tumors. For example, within one embodiment of the invention, anti-angiogenic compounds may be administered to the site of a neurological tumor subsequent to excision, such that the formation of new blood vessels at the site are inhibited.

[0710] The polynucleotides, polypeptides, agonists and/or agonists of the present invention may also be administered along with other anti-angiogenic factors. Representative examples of other anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, Plasminogen Activator Inhibitor-1, Plasminogen Activator Inhibitor-2, and various forms of the lighter “d group” transition metals.

[0711] Lighter “d group” transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes.

[0712] Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates.

[0713] Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.

[0714] A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res. 51:22-26 (1991)); Sulphated Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile famarate; 4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326 (1992)); Chymostatin (Tomkinson et al., Biochem J. 286:475-480 (1992)); Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557 (1990)); Gold Sodium Thiomalate (“GST”; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446 (1987)); anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4):1659-1664 (1987)); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or “CCA”; Takeuchi et al., Agents Actions 36:312-316, 1992); Thalidomide; Angostatic steroid; AGM-1470; carboxynaminolmidazole; and metalloproteinase inhibitors such as BB94.

[0715] Neural Activity and Neurological Diseases

[0716] The polynucleotides, polypeptides and agonists or antagonists of the invention may be used for the diagnosis and/or treatment of diseases, disorders, damage or injury of the brain and/or nervous system. Nervous system disorders that can be treated with the compositions of the invention (e.g., polypeptides, polynucleotides, and/or agonists or antagonists), include, but are not limited to, nervous system injuries, and diseases or disorders which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination. Nervous system lesions which may be treated in a patient (including human and non-human mammalian patients) according to the methods of the invention, include but are not limited to, the following lesions of either the central (including spinal cord, brain) or peripheral nervous systems: (1) ischemic lesions, in which a lack of oxygen in a portion of the nervous system results in neuronal injury or death, including cerebral infarction or ischemia, or spinal cord infarction or ischemia; (2) traumatic lesions, including lesions caused by physical injury or associated with surgery, for example, lesions which sever a portion of the nervous system, or compression injuries; (3) malignant lesions, in which a portion of the nervous system is destroyed or injured by malignant tissue which is either a nervous system associated malignancy or a malignancy derived from non-nervous system tissue; (4) infectious lesions, in which a portion of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency virus, herpes zoster, or herpes simplex virus or with Lyme disease, tuberculosis, or syphilis; (5) degenerative lesions, in which a portion of the nervous system is destroyed or injured as a result of a degenerative process including but not limited to, degeneration associated with Parkinson's disease, Alzheimer's disease, Huntington's chorea, or amyotrophic lateral sclerosis (ALS); (6) lesions associated with nutritional diseases or disorders, in which a portion of the nervous system is destroyed or injured by a nutritional disorder or disorder of metabolism including, but not limited to, vitamin B12 deficiency, folic acid deficiency, Wernicke disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary degeneration of the corpus callosum), and alcoholic cerebellar degeneration; (7) neurological lesions associated with systemic diseases including, but not limited to, diabetes (diabetic neuropathy, Bell's palsy), systemic lupus erythematosus, carcinoma, or sarcoidosis; (8) lesions caused by toxic substances including alcohol, lead, or particular neurotoxins; and (9) demyelinated lesions in which a portion of the nervous system is destroyed or injured by a demyelinating disease including, but not limited to, multiple sclerosis, human immunodeficiency virus-associated myelopathy, transverse myelopathy or various etiologies, progressive multifocal leukoencephalopathy, and central pontine myelinolysis.

[0717] In one embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neural cells from the damaging effects of hypoxia. In a further preferred embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neural cells from the damaging effects of cerebral hypoxia. According to this embodiment, the compositions of the invention are used to treat or prevent neural cell injury associated with cerebral hypoxia. In one non-exclusive aspect of this embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention, are used to treat or prevent neural cell injury associated with cerebral ischemia. In another non-exclusive aspect of this embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with cerebral infarction.

[0718] In another preferred embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with a stroke. In a specific embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent cerebral neural cell injury associated with a stroke.

[0719] In another preferred embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with a heart attack. In a specific embodiment, the polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent cerebral neural cell injury associated with a heart attack.

[0720] The compositions of the invention which are useful for treating or preventing a nervous system disorder may be selected by testing for biological activity in promoting the survival or differentiation of neurons. For example, and not by way of limitation, compositions of the invention which elicit any of the following effects may be useful according to the invention: (1) increased survival time of neurons in culture either in the presence or absence of hypoxia or hypoxic conditions; (2) increased sprouting of neurons in culture or in vivo; (3) increased production of a neuron-associated molecule in culture or in vivo, e.g., choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or (4) decreased symptoms of neuron dysfunction in vivo. Such effects may be measured by any method known in the art. In preferred, non-limiting embodiments, increased survival of neurons may routinely be measured using a method set forth herein or otherwise known in the art, such as, for example, in Zhang et al., Proc Natl Acad Sci USA 97:3637-42 (2000) or in Arakawa et al., J. Neurosci., 10:3507-15 (1990); increased sprouting of neurons may be detected by methods known in the art, such as, for example, the methods set forth in Pestronk et al., Exp. Neurol., 70:65-82 (1980), or Brown et al., Ann. Rev. Neurosci., 4:17-42 (1981); increased production of neuron-associated molecules may be measured by bioassay, enzymatic assay, antibody binding, Northern blot assay, etc., using techniques known in the art and depending on the molecule to be measured; and motor neuron dysfunction may be measured by assessing the physical manifestation of motor neuron disorder, e.g., weakness, motor neuron conduction velocity, or functional disability.

[0721] In specific embodiments, motor neuron disorders that may be treated according to the invention include, but are not limited to, disorders such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as disorders that selectively affect neurons such as amyotrophic lateral sclerosis, and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary Motorsensory Neuropathy (Charcot-Marie-Tooth Disease).

[0722] Further, polypeptides or polynucleotides of the invention may play a role in neuronal survival; synapse formation; conductance; neural differentiation, etc. Thus, compositions of the invention (including polynucleotides, polypeptides, and agonists or antagonists) may be used to diagnose and/or treat or prevent diseases or disorders associated with these roles, including, but not limited to, learning and/or cognition disorders. The compositions of the invention may also be useful in the treatment or prevention of neurodegenerative disease states and/or behavioural disorders. Such neurodegenerative disease states and/or behavioral disorders include, but are not limited to, Alzheimer's Disease, Parkinson's Disease, Huntington's Disease, Tourette Syndrome, schizophrenia, mania, dementia, paranoia, obsessive compulsive disorder, panic disorder, learning disabilities, ALS, psychoses, autism, and altered behaviors, including disorders in feeding, sleep patterns, balance, and perception. In addition, compositions of the invention may also play a role in the treatment, prevention and/or detection of developmental disorders associated with the developing embryo, or sexually-linked disorders.

[0723] Additionally, polypeptides, polynucleotides and/or agonists or antagonists of the invention, may be useful in protecting neural cells from diseases, damage, disorders, or injury, associated with cerebrovascular disorders including, but not limited to, carotid artery diseases (e.g., carotid artery thrombosis, carotid stenosis, or Moyamoya Disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arterioyenous malformations, cerebral artery diseases, cerebral embolism and thrombosis (e.g., carotid artery thrombosis, sinus thrombosis, or Wallenberg's Syndrome), cerebral hemorrhage (e.g., epidural or subdural hematoma, or subarachnoid hemorrhage), cerebral infarction, cerebral ischemia (e.g., transient cerebral ischemia, Subclavian Steal Syndrome, or vertebrobasilar insufficiency), vascular dementia (e.g., multi-infarct), leukomalacia, periventricular, and vascular headache (e.g., cluster headache or migraines).

[0724] In accordance with yet a further aspect of the present invention, there is provided a process for utilizing polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, for therapeutic purposes, for example, to stimulate neurological cell proliferation and/or differentiation. Therefore, polynucleotides, polypeptides, agonists and/or antagonists of the invention may be used to treat and/or detect neurologic diseases. Moreover, polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used as a marker or detector of a particular nervous system disease or disorder.

[0725] Examples of neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include brain diseases, such as metabolic brain diseases which includes phenylketonuria such as maternal phenylketonuria, pyruvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wernicke's Encephalopathy, brain edema, brain neoplasms such as cerebellar neoplasms which include infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms, supratentorial neoplasms, canavan disease, cerebellar diseases such as cerebellar ataxia which include spinocerebellar degeneration such as ataxia telangiectasia, cerebellar dyssynergia, Friederich's Ataxia, Machado-Joseph Disease, olivopontocerebellar atrophy, cerebellar neoplasms such as infratentorial neoplasms, diffuse cerebral sclerosis such as encephalitis periaxialis, globoid cell leukodystrophy, metachromatic leukodystrophy and subacute sclerosing panencephalitis.

[0726] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include cerebrovascular disorders (such as carotid artery diseases which include carotid artery thrombosis, carotid stenosis and Moyamoya Disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arterioyenous malformations, cerebral artery diseases, cerebral embolism and thrombosis such as carotid artery thrombosis, sinus thrombosis and Wallenberg's Syndrome, cerebral hemorrhage such as epidural hematoma, subdural hematoma and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia such as transient cerebral ischemia, Subclavian Steal Syndrome and vertebrobasilar insufficiency, vascular dementia such as multi-infarct dementia, periventricular leukomalacia, vascular headache such as cluster headache and migraine.

[0727] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include dementia such as AIDS Dementia Complex, presenile dementia such as Alzheimer's Disease and Creutzfeldt-Jakob Syndrome, senile dementia such as Alzheimer's Disease and progressive supranuclear palsy, vascular dementia such as multi-infarct dementia, encephalitis which include encephalitis periaxialis, viral encephalitis such as epidemic encephalitis, Japanese Encephalitis, St. Louis Encephalitis, tick-borne encephalitis and West Nile Fever, acute disseminated encephalomyelitis, meningoencephalitis such as uveomeningoencephalitic syndrome, Postencephalitic Parkinson Disease and subacute sclerosing panencephalitis, encephalomalacia such as periventricular leukomalacia, epilepsy such as generalized epilepsy which includes infantile spasms, absence epilepsy, myoclonic epilepsy which includes MERRF Syndrome, tonic-clonic epilepsy, partial epilepsy such as complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, status epilepticus such as Epilepsia Partialis Continua, and Hallervorden-Spatz Syndrome.

[0728] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include hydrocephalus such as Dandy-Walker Syndrome and normal pressure hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms, cerebral malaria, narcolepsy which includes cataplexy, bulbar poliomyelitis, cerebri pseudotumor, Rett Syndrome, Reye's Syndrome, thalamic diseases, cerebral toxoplasmosis, intracranial tuberculoma and Zellweger Syndrome, central nervous system infections such as AIDS Dementia Complex, Brain Abscess, subdural empyema, encephalomyelitis such as Equine Encephalomyelitis, Venezuelan Equine Encephalomyelitis, Necrotizing Hemorrhagic Encephalomyelitis, Visna, and cerebral malaria.

[0729] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include meningitis such as arachnoiditis, aseptic meningtitis such as viral meningtitis which includes lymphocytic choriomeningitis, Bacterial meningtitis which includes Haemophilus Meningtitis, Listeria Meningtitis, Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis and meningeal tuberculosis, fungal meningitis such as Cryptococcal Meningtitis, subdural effusion, meningoencephalitis such as uvemeningoencephalitic syndrome, myelitis such as transverse myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which includes bulbar poliomyelitis and postpoliomyelitis syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Scrapie), and cerebral toxoplasmosis.

[0730] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include central nervous system neoplasms such as brain neoplasms that include cerebellar neoplasms such as infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms and supratentorial neoplasms, meningeal neoplasms, spinal cord neoplasms which include epidural neoplasms, demyelinating diseases such as Canavan Diseases, diffuse cerebral sceloris which includes adrenoleukodystrophy, encephalitis periaxialis, globoid cell leukodystrophy, diffuse cerebral sclerosis such as metachromatic leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy, multiple sclerosis, central pontine myelinolysis, transverse myelitis, neuromyelitis optica, Scrapie, Swayback, Chronic Fatigue Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal cord diseases such as amyotonia congenita, amyotrophic lateral sclerosis, spinal muscular atrophy such as Werdnig-Hoffmann Disease, spinal cord compression, spinal cord neoplasms such as epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff-Man Syndrome, mental retardation such as Angelman Syndrome, Cri-du-Chat Syndrome, De Lange's Syndrome, Down Syndrome, Gangliosidoses such as gangliosidoses G(M1), Sandhoff Disease, Tay-Sachs Disease, Hartnup Disease, homocystinuria, Laurence-Moon-Biedl Syndrome, Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such as fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal syndrome, phenylketonuria such as maternal phenylketonuria, Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi Syndrome, Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities such as holoprosencephaly, neural tube defects such as anencephaly which includes hydrangencephaly, Arnold-Chairi Deformity, encephalocele, meningocele, meningomyelocele, spinal dysraphism such as spina bifida cystica and spina bifida occulta.

[0731] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include hereditary motor and sensory neuropathies which include Charcot-Marie Disease, Hereditary optic atrophy, Refsum's Disease, hereditary spastic paraplegia, Werdnig-Hoffmann Disease, Hereditary Sensory and Autonomic Neuropathies such as Congenital Analgesia and Familial Dysautonomia, Neurologic manifestations (such as agnosia that include Gerstmann's Syndrome, Amnesia such as retrograde amnesia, apraxia, neurogenic bladder, cataplexy, communicative disorders such as hearing disorders that includes deafness, partial hearing loss, loudness recruitment and tinnitus, language disorders such as aphasia which include agraphia, anomia, broca aphasia, and Wernicke Aphasia, Dyslexia such as Acquired Dyslexia, language development disorders, speech disorders such as aphasia which includes anomia, broca aphasia and Wernicke Aphasia, articulation disorders, communicative disorders such as speech disorders which include dysarthria, echolalia, mutism and stuttering, voice disorders such as aphonia and hoarseness, decerebrate state, delirium, fasciculation, hallucinations, meningism, movement disorders such as angelman syndrome, ataxia, athetosis, chorea, dystonia, hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and tremor, muscle hypertonia such as muscle rigidity such as stiff-man syndrome, muscle spasticity, paralysis such as facial paralysis which includes Herpes Zoster Oticus, Gastroparesis, Hemiplegia, ophthalmoplegia such as diplopia, Duane's Syndrome, Horner's Syndrome, Chronic progressive external ophthalmoplegia such as Kearns Syndrome, Bulbar Paralysis, Tropical Spastic Paraparesis, Paraplegia such as Brown-Sequard Syndrome, quadriplegia, respiratory paralysis and vocal cord paralysis, paresis, phantom limb, taste disorders such as ageusia and dysgeusia, vision disorders such as amblyopia, blindness, color vision defects, diplopia, hemianopsia, scotoma and subnormal vision, sleep disorders such as hypersomnia which includes Kleine-Levin Syndrome, insomnia, and somnambulism, spasm such as trismus, unconsciousness such as coma, persistent vegetative state and syncope and vertigo, neuromuscular diseases such as amyotonia congenital amyotrophic lateral sclerosis, Lambert-Eaton Myasthenic Syndrome, motor neuron disease, muscular atrophy such as spinal muscular atrophy, Charcot-Marie Disease and Werdnig-Hoffmann Disease, Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis, Myotonia Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial Periodic Paralysis, Multiplex Paramyloclonus, Tropical Spastic Paraparesis and Stiff-Man Syndrome, peripheral nervous system diseases such as acrodynia, amyloid neuropathies, autonomic nervous system diseases such as Adie's Syndrome, Barre-Lieou Syndrome, Familial Dysautonomia, Homer's Syndrome, Reflex Sympathetic Dystrophy and Shy-Drager Syndrome, Cranial Nerve Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma which includes Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia, Melkersson-Rosenthal Syndrome, ocular motility disorders which includes amblyopia, nystagmus, oculomotor nerve paralysis, ophthalmoplegia such as Duane's Syndrome, Horner's Syndrome, Chronic Progressive External Ophthalmoplegia which includes Kearns Syndrome, Strabismus such as Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve Diseases such as Optic Atrophy which includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic Neuritis such as Neuromyelitis Optica, Papilledema, Trigeminal Neuralgia, Vocal Cord Paralysis, Demyelinating Diseases such as Neuromyclitis Optica and Swayback, and Diabetic neuropathies such as diabetic foot.

[0732] Additional neurologic diseases which can be treated or detected with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include nerve compression syndromes such as carpal tunnel syndrome, tarsal tunnel syndrome, thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve compression syndrome, neuralgia such as causalgia, cervico-brachial neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such as experimental allergic neuritis, optic neuritis, polyneuritis, polyradiculoneuritis and radiculities such as polyradiculitis, hereditary motor and sensory neuropathies such as Charcot-Marie Disease, Hereditary Optic Atrophy, Refsum's Disease, Hereditary Spastic Paraplegia and Werdnig-Hoffmann Disease, Hereditary Sensory and Autonomic Neuropathies which include Congenital Analgesia and Familial Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating and Tetany).

[0733] Endocrine Disorders

[0734] Polynucleotides or polypeptides, or agonists or antagonists of the present invention, may be used to treat, prevent, diagnose, and/or prognose disorders and/or diseases related to hormone imbalance, and/or disorders or diseases of the endocrine system.

[0735] Hormones secreted by the glands of the endocrine system control physical growth, sexual function, metabolism, and other functions. Disorders may be classified in two ways: disturbances in the production of hormones, and the inability of tissues to respond to-hormones. The etiology of these hormone imbalance or endocrine system diseases, disorders or conditions may be genetic, somatic, such as cancer and some autoimmune diseases, acquired (e.g., by chemotherapy, injury or toxins), or infectious. Moreover, polynucleotides, polypeptides, antibodies, and/or agonists or antagonists of the present invention can be used as a marker or detector of a particular disease or disorder related to the endocrine system and/or hormone imbalance.

[0736] Endocrine system and/or hormone imbalance and/or diseases encompass disorders of uterine motility including, but not limited to: complications with pregnancy and labor (e.g., pre-term labor, post-term pregnancy, spontaneous abortion, and slow or stopped labor); and disorders and/or diseases of the menstrual cycle (e.g., dysmenorrhea and endometriosis).

[0737] Endocrine system and/or hormone imbalance disorders and/or diseases include disorders and/or diseases of the pancreas, such as, for example, diabetes mellitus, diabetes insipidus, congenital pancreatic agenesis, pheochromocytoma—islet cell tumor syndrome; disorders and/or diseases of the adrenal glands such as, for example, Addison's Disease, corticosteroid deficiency, virilizing disease, hirsutism, Cushing's Syndrome, hyperaldosteronism, pheochromocytoma; disorders and/or diseases of the pituitary gland, such as, for example, hyperpituitarism, hypopituitarism, pituitary dwarfism, pituitary adenoma, panhypopituitarism, acromegaly, gigantism; disorders and/or diseases of the thyroid, including but not limited to, hyperthyroidism, hypothyroidism, Plummer's disease, Graves' disease (toxic diffuse goiter), toxic nodular goiter, thyroiditis (Hashimoto's thyroiditis, subacute granulomatous thyroiditis, and silent lymphocytic thyroiditis), Pendred's syndrome, myxedema, cretinism, thyrotoxicosis, thyroid hormone coupling defect, thymic aplasia, Hurthle cell tumours of the thyroid, thyroid cancer, thyroid carcinoma, Medullary thyroid carcinoma; disorders and/or diseases of the parathyroid, such as, for example, hyperparathyroidism, hypoparathyroidism; disorders and/or diseases of the hypothalamus.

[0738] In addition, endocrine system and/or hormone imbalance disorders and/or diseases may also include disorders and/or diseases of the testes or ovaries, including cancer. Other disorders and/or diseases of the testes or ovaries further include, for example, ovarian cancer, polycystic ovary syndrome, Klinefelter's syndrome, vanishing testes syndrome (bilateral anorchia), congenital absence of Leydig's cells, cryptorchidism, Noonan's syndrome, myotonic dystrophy, capillary haemangioma of the testis (benign), neoplasias of the testis and neo-testis.

[0739] Moreover, endocrine system and/or hormone imbalance disorders and/or diseases may also include disorders and/or diseases such as, for example, polyglandular deficiency syndromes, pheochromocytoma, neuroblastoma, multiple Endocrine neoplasia, and disorders and/or cancers of endocrine tissues.

[0740] In another embodiment, a polypeptide of the invention, or polynucleotides, antibodies, agonists, or antagonists corresponding to that polypeptide, may be used to diagnose, prognose, prevent, and/or treat endocrine diseases and/or disorders associated with the tissue(s) in which the polypeptide of the invention is expressed, including one, two, three, four, five, or more tissues disclosed in Table 1A, column 7 (Tissue Distribution Library Code).

[0741] Gastrointestinal Disorders

[0742] Polynucleotides or polypeptides, or agonists or antagonists of the present invention, may be used to treat, prevent, diagnose, and/or prognose gastrointestinal disorders, including inflammatory diseases and/or conditions, infections, cancers (e.g., intestinal neoplasms (carcinoid tumor of the small intestine, non-Hodgkin's lymphoma of the small intestine, small bowl lymphoma)), and ulcers, such as peptic ulcers.

[0743] Gastrointestinal disorders include dysphagia, odynophagia, inflammation of the esophagus, peptic esophagitis, gastric reflux, submucosal fibrosis and stricturing, Mallory-Weiss lesions, leiomyomas, lipomas, epidermal cancers, adeoncarcinomas, gastric retention disorders, gastroenteritis, gastric atrophy, gastric/stomach cancers, polyps of the stomach, autoimmune disorders such as pernicious anemia, pyloric stenosis, gastritis (bacterial, viral, eosinophilic, stress-induced, chronic erosive, atrophic, plasma cell, and Ménétrier's), and peritoneal diseases (e.g., chyloperioneum, hemoperitoneum, mesenteric cyst, mesenteric lymphadenitis, mesenteric vascular occlusion, panniculitis, neoplasms, peritonitis, pneumoperitoneum, bubphrenic abscess).

[0744] Gastrointestinal disorders also include disorders associated with the small intestine, such as malabsorption syndromes, distension, irritable bowel syndrome, sugar intolerance, celiac disease, duodenal ulcers, duodenitis, tropical sprue, Whipple's disease, intestinal lymphangiectasia, Crohn's disease, appendicitis, obstructions of the ileum, Meckel's diverticulum, multiple diverticula, failure of complete rotation of the small and large intestine, lymphoma, and bacterial and parasitic diseases (such as Traveler's diarrhea, typhoid and paratyphoid, cholera, infection by Roundworms (Ascariasis lumbricoides), Hookworms (Ancylostoma duodenale), Threadworms (Enterobius vermicularis), Tapeworms (Taenia saginata, Echinococcus granulosus, Diphyllobothrium spp., and T. solium).

[0745] Liver diseases and/or disorders include intrahepatic cholestasis (alagille syndrome, biliary liver cirrhosis), fatty liver (alcoholic fatty liver, reye syndrome), hepatic vein thrombosis, hepatolentricular degeneration, hepatomegaly, hepatopulmonary syndrome, hepatorenal syndrome, portal hypertension (esophageal and gastric varices), liver abscess (amebic liver abscess), liver cirrhosis (alcoholic, biliary and experimental), alcoholic liver diseases (fatty liver, hepatitis, cirrhosis), parasitic (hepatic echinococcosis, fascioliasis, amebic liver abscess), jaundice (hemolytic, hepatocellular, and cholestatic), cholestasis, portal hypertension, liver enlargement, ascites, hepatitis (alcoholic hepatitis, animal hepatitis, chronic hepatitis (autoimmune, hepatitis B, hepatitis C, hepatitis D, drug induced), toxic hepatitis, viral human hepatitis (hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E), Wilson's disease, granulomatous hepatitis, secondary biliary cirrhosis, hepatic encephalopathy, portal hypertension, varices, hepatic encephalopathy, primary biliary cirrhosis, primary sclerosing cholangitis, hepatocellular adenoma, hemangiomas, bile stones, liver failure (hepatic encephalopathy, acute liver failure), and liver neoplasms (angiomyolipoma, calcified liver metastases, cystic liver metastases, epithelial tumors, fibrolamellar hepatocarcinoma, focal nodular hyperplasia, hepatic adenoma, hepatobiliary cystadenoma, hepatoblastoma, hepatocellular carcinoma, hepatoma, liver cancer, liver hemangioendothelioma, mesenchymal hamartoma, mesenchymal tumors of liver, nodular regenerative hyperplasia, benign liver tumors (Hepatic cysts [Simple cysts, Polycystic liver disease, Hepatobiliary cystadenoma, Choledochal cyst], Mesenchymal tumors [Mesenchymal hamartoma, Infantile hemangioendothelioma, Hemangioma, Peliosis hepatis, Lipomas, Inflammatory pseudotumor, Miscellaneous], Epithelial tumors [Bile duct epithelium (Bile duct hamartoma, Bile duct adenoma), Hepatocyte (Adenoma, Focal nodular hyperplasia, Nodular regenerative hyperplasia)], malignant liver tumors [hepatocellular, hepatoblastoma, hepatocellular carcinoma, cholangiocellular, cholangiocarcinoma, cystadenocarcinoma, tumors of blood vessels, angiosarcoma, Karposi's sarcoma, hemangioendothelioma, other tumors, embryonal sarcoma, fibrosarcoma, leiomyosarcoma, rhabdomyosarcoma, carcinosarcoma, teratoma, carcinoid, squamous carcinoma, primary lymphoma]), peliosis hepatis, erythrohepatic porphyria, hepatic porphyria (acute intermittent porphyria, porphyria cutanea tarda), Zellweger syndrome).

[0746] Pancreatic diseases and/or disorders include acute pancreatitis, chronic pancreatitis (acute necrotizing pancreatitis, alcoholic pancreatitis), neoplasms (adenocarcinoma of the pancreas, cystadenocarcinoma, insulinoma, gastrinoma, and glucagonoma, cystic neoplasms, islet-cell tumors, pancreoblastoma), and other pancreatic diseases (e.g., cystic fibrosis, cyst (pancreatic pseudocyst, pancreatic fistula, insufficiency)).

[0747] Gallbladder diseases include gallstones (cholelithiasis and choledocholithiasis), postcholecystectomy syndrome, diverticulosis of the gallbladder, acute cholecystitis, chronic cholecystitis, bile duct tumors, and mucocele.

[0748] Diseases and/or disorders of the large intestine include antibiotic-associated colitis, diverticulitis, ulcerative colitis, acquired megacolon, abscesses, fungal and bacterial infections, anorectal disorders (e.g., fissures, hemorrhoids), colonic diseases (colitis, colonic neoplasms [colon cancer, adenomatous colon polyps (e.g., villous adenoma), colon carcinoma, colorectal cancer], colonic diverticulitis, colonic diverticulosis, megacolon [Hirschsprung disease, toxic megacolon]; sigmoid diseases [proctocolitis, sigmoin neoplasms]), constipation, Crohn's disease, diarrhea (infantile diarrhea, dysentery), duodenal diseases (duodenal neoplasms, duodenal obstruction, duodenal ulcer, duodenitis), enteritis (enterocolitis), HIV enteropathy, ileal diseases (ileal neoplasms, ileitis), immunoproliferative small intestinal disease, inflammatory bowel disease (ulcerative colitis, Crohn's disease), intestinal atresia, parasitic diseases (anisakiasis, balantidiasis, blastocystis infections, cryptosporidiosis, dientamoebiasis, amebic dysentery, giardiasis), intestinal fistula (rectal fistula), intestinal neoplasms (cecal neoplasms, colonic neoplasms, duodenal neoplasms, ileal neoplasms, intestinal polyps, jejunal neoplasms, rectal neoplasms), intestinal obstruction (afferent loop syndrome, duodenal obstruction, impacted feces, intestinal pseudo-obstruction [cecal volvulus], intussusception), intestinal perforation, intestinal polyps (colonic polyps, gardner syndrome, peutzjeghers syndrome), jejunal diseases (jejunal neoplasms), malabsorption syndromes (blind loop syndrome, celiac disease, lactose intolerance, short bowl syndrome, tropical sprue, whipple's disease), mesenteric vascular occlusion, pneumatosis cystoides intestinalis, protein-losing enteropathies (intestinal lymphagiectasis), rectal diseases (anus diseases, fecal incontinence, hemorrhoids, proctitis, rectal fistula, rectal prolapse, rectocele), peptic ulcer (duodenal ulcer, peptic esophagitis, hemorrhage, perforation, stomach ulcer, Zollinger-Ellison syndrome), postgastrectomy syndromes (dumping syndrome), stomach diseases (e.g., achlorhydria, duodenogastric reflux (bile reflux), gastric antral vascular ectasia, gastric fistula, gastric outlet obstruction, gastritis (atrophic or hypertrophic), gastroparesis, stomach dilatation, stomach diverticulum, stomach neoplasms (gastric cancer, gastric polyps, gastric adenocarcinoma, hyperplastic gastric polyp), stomach rupture, stomach ulcer, stomach volvulus), tuberculosis, visceroptosis, vomiting (e.g., hematemesis, hyperemesis gravidarum, postoperative nausea and vomiting) and hemorrhagic colitis.

[0749] Further diseases and/or disorders of the gastrointestinal system include biliary tract diseases, such as, gastroschisis, fistula (e.g., biliary fistula, esophageal fistula, gastric fistula, intestinal fistula, pancreatic fistula), neoplasms (e.g., biliary tract neoplasms, esophageal neoplasms, such as adenocarcinoma of the esophagus, esophageal squamous cell carcinoma, gastrointestinal neoplasms, pancreatic neoplasms, such as adenocarcinoma of the pancreas, mucinous cystic neoplasm of the pancreas, pancreatic cystic neoplasms, pancreatoblastoma, and peritoneal neoplasms), esophageal disease (e.g., bullous diseases, candidiasis, glycogenic acanthosis, ulceration, barrett esophagus varices, atresia, cyst, diverticulum (e.g., Zenker's diverticulum), fistula (e.g., tracheoesophageal fistula), motility disorders (e.g., CREST syndrome, deglutition disorders, achalasia, spasm, gastroesophageal reflux), neoplasms, perforation (e.g., Boerhaave syndrome, Mallory-Weiss syndrome), stenosis, esophagitis, diaphragmatic hernia (e.g., hiatal hernia); gastrointestinal diseases, such as, gastroenteritis (e.g., cholera morbus, norwalk virus infection), hemorrhage (e.g., hematemesis, melena, peptic ulcer hemorrhage), stomach neoplasms (gastric cancer, gastric polyps, gastric adenocarcinoma, stomach cancer)), hernia (e.g., congenital diaphragmatic hernia, femoral hernia, inguinal hernia, obturator hernia, umbilical hernia, ventral hernia), and intestinal diseases (e.g., cecal diseases (appendicitis, cecal neoplasms)).

[0750] Reproductive System Disorders

[0751] The polynucleotides or polypeptides, or agonists or antagonists of the invention may be used for the diagnosis, treatment, or prevention of diseases and/or disorders of the reproductive system. Reproductive system disorders that can be treated by the compositions of the invention, include, but are not limited to, reproductive system injuries, infections, neoplastic disorders, congenital defects, and diseases or disorders which result in infertility, complications with pregnancy, labor, or parturition, and postpartum difficulties.

[0752] Reproductive system disorders and/or diseases include diseases and/or disorders of the testes, including, but not limited to, testicular atrophy, testicular feminization, cryptorchism (unilateral and bilateral), anorchia, ectopic testis, epididymitis and orchitis (typically resulting from infections such as, for example, gonorrhea, mumps, tuberculosis, and syphilis), testicular torsion, vasitis nodosa, germ cell tumors (e.g., seminomas, embryonal cell carcinomas, teratocarcinomas, choriocarcinomas, yolk sac tumors, and teratomas), stromal tumors (e.g., Leydig cell tumors), hydrocele, hematocele, varicocele, spermatocele, inguinal hernia, and disorders of sperm production (e.g., immotile cilia syndrome, aspermia, asthenozoospermia, azoospermia, oligospermia, and teratozoospermia).

[0753] Reproductive system disorders also include, but are not limited to, disorders of the prostate gland, such as acute non-bacterial prostatitis, chronic non-bacterial prostatitis, acute bacterial prostatitis, chronic bacterial prostatitis, prostatodystonia, prostatosis, granulomatous prostatitis, malacoplakia, benign prostatic hypertrophy or hyperplasia, and prostate neoplastic disorders, including adenocarcinomas, transitional cell carcinomas, ductal carcinomas, and squamous cell carcinomas.

[0754] Additionally, the compositions of the invention may be useful in the diagnosis, treatment, and/or prevention of disorders or diseases of the penis and urethra, including, but not limited to, inflammatory disorders, such as balanoposthitis, balanitis xerotica obliterans, phimosis, paraphimosis, syphilis, herpes simplex virus, gonorrhea, non-gonococcal urethritis, chlamydia, mycoplasma, trichomonas, HIV, AIDS, Reiter's syndrome, condyloma acuminatum, condyloma latum, and pearly penile papules; urethral abnormalities, such as hypospadias, epispadias, and phimosis; premalignant lesions, including Erythroplasia of Queyrat, Bowen's disease, Bowenoid paplosis, giant condyloma of Buscke-Lowenstein, and varrucous carcinoma; penile cancers, including squamous cell carcinomas, carcinoma in situ, verrucous carcinoma, and disseminated penile carcinoma; urethral neoplastic disorders, including penile urethral carcinoma, bulbomembranous urethral carcinoma, and prostatic urethral carcinoma; and erectile disorders, such as priapism, Peyronie's disease, erectile dysfunction, and impotence.

[0755] Moreover, diseases and/or disorders of the vas deferens include, but are not limited to, vasculititis and CBAVD (congenital bilateral absence of the vas deferens); additionally, the polynucleotides, polypeptides, and agonists or antagonists of the present invention may be used in the diagnosis, treatment, and/or prevention of diseases and/or disorders of the seminal vesicles, including but not limited to, hydatid disease, congenital chloride diarrhea, and polycystic kidney disease.

[0756] Other disorders and/or diseases of the male reproductive system that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, Klinefelter's syndrome, Young's syndrome, premature ejaculation, diabetes mellitus, cystic fibrosis, Kartagener's syndrome, high fever, multiple sclerosis, and gynecomastia.

[0757] Further, the polynucleotides, polypeptides, and agonists or antagonists of the present invention may be used in the diagnosis, treatment, and/or prevention of diseases and/or disorders of the vagina and vulva, including, but not limited to, bacterial vaginosis, candida vaginitis, herpes simplex virus, chancroid, granuloma inguinale, lymphogranuloma venereum, scabies, human papillomavirus, vaginal trauma, vulvar trauma, adenosis, chlamydia vaginitis, gonorrhea, trichomonas vaginitis, condyloma acuminatum, syphilis, molluscum contagiosum, atrophic vaginitis, Paget's disease, lichen sclerosus, lichen planus, vulvodynia, toxic shock syndrome, vaginismus, vulvovaginitis, vulvar vestibulitis, and neoplastic disorders, such as squamous cell hyperplasia, clear cell carcinoma, basal cell carcinoma, melanomas, cancer of Bartholin's gland, and vulvar intraepithelial neoplasia.

[0758] Disorders and/or diseases of the uterus that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, dysmenorrhea, retroverted uterus, endometriosis, fibroids, adenomyosis, anovulatory bleeding, amenorrhea, Cushing's syndrome, hydatidiform moles, Asherman's syndrome, premature menopause, precocious puberty, uterine polyps, dysfunctional uterine bleeding (e.g., due to aberrant hormonal signals), and neoplastic disorders, such as adenocarcinomas, keiomyosarcomas, and sarcomas. Additionally, the polypeptides, polynucleotides, or agonists or antagonists of the invention may be useful as a marker or detector of, as well as in the diagnosis, treatment, and/or prevention of congenital uterine abnormalities, such as bicomuate uterus, septate uterus, simple unicornuate uterus, unicornuate uterus with a noncavitary rudimentary horn, unicornuate uterus with a non-communicating cavitary rudimentary horn, unicornuate uterus with a communicating cavitary horn, arcuate uterus, uterine didelfus, and T-shaped uterus.

[0759] Ovarian diseases and/or disorders that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, anovulation, polycystic ovary syndrome (Stein-Leventhal syndrome), ovarian cysts, ovarian hypofunction, ovarian insensitivity to gonadotropins, ovarian overproduction of androgens, right ovarian vein syndrome, amenorrhea, hirutism, and ovarian cancer (including, but not limited to, primary and secondary cancerous growth, Sertoli-Leydig tumors, endometriod carcinoma of the ovary, ovarian papillary serous adenocarcinoma, ovarian mucinous adenocarcinoma, and Ovarian Krukenberg tumors).

[0760] Cervical diseases and/or disorders that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, cervicitis, chronic cervicitis, mucopurulent cervicitis, cervical dysplasia, cervical polyps, Nabothian cysts, cervical erosion, cervical incompetence, and cervical neoplasms (including, for example, cervical carcinoma, squamous metaplasia, squamous cell carcinoma, adenosquamous cell neoplasia, and columnar cell neoplasia).

[0761] Additionally, diseases and/or disorders of the reproductive system that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, disorders and/or diseases of pregnancy, including miscarriage and stillbirth, such as early abortion, late abortion, spontaneous abortion, induced abortion, therapeutic abortion, threatened abortion, missed abortion, incomplete abortion, complete abortion, habitual abortion, missed abortion, and septic abortion; ectopic pregnancy, anemia, Rh incompatibility, vaginal bleeding during pregnancy, gestational diabetes, intrauterine growth retardation, polyhydramnios, HELLP syndrome, abruptio placentae, placenta previa, hyperemesis, preeclampsia, eclampsia, herpes gestationis, and urticaria of pregnancy. Additionally, the polynucleotides, polypeptides, and agonists or antagonists of the present invention may be used in the diagnosis, treatment, and/or prevention of diseases that can complicate pregnancy, including heart disease, heart failure, rheumatic heart disease, congenital heart disease, mitral valve prolapse, high blood pressure, anemia, kidney disease, infectious disease (e.g., rubella, cytomegalovirus, toxoplasmosis, infectious hepatitis, chlamydia, HIV, AIDS, and genital herpes), diabetes mellitus, Graves' disease, thyroiditis, hypothyroidism, Hashimoto's thyroiditis, chronic active hepatitis, cirrhosis of the liver, primary biliary cirrhosis, asthma, systemic lupus eryematosis, rheumatoid arthritis, myasthenia gravis, idiopathic thrombocytopenic purpura, appendicitis, ovarian cysts, gallbladder disorders, and obstruction of the intestine.

[0762] Complications associated with labor and parturition that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, premature rupture of the membranes, pre-term labor, post-term pregnancy, postmaturity, labor that progresses too slowly, fetal distress (e.g., abnormal heart rate (fetal or maternal), breathing problems, and abnormal fetal position), shoulder dystocia, prolapsed umbilical cord, amniotic fluid embolism, and aberrant uterine bleeding.

[0763] Further, diseases and/or disorders of the postdelivery period, that may be diagnosed, treated, and/or prevented with the compositions of the invention, include, but are not limited to, endometritis, myometritis, parametritis, peritonitis, pelvic thrombophlebitis, pulmonary embolism, endotoxemia, pyelonephritis, saphenous thrombophlebitis, mastitis, cystitis, postpartum hemorrhage, and inverted uterus.

[0764] Other disorders and/or diseases of the female reproductive system that may be diagnosed, treated, and/or prevented by the polynucleotides, polypeptides, and agonists or antagonists of the present invention include, but are not limited to, Tumer's syndrome, pseudohermaphroditism, premenstrual syndrome, pelvic inflammatory disease, pelvic congestion (vascular engorgement), frigidity, anorgasmia, dyspareunia, ruptured fallopian tube, and Mittelschmerz.

[0765] Developmental and Inherited Disorders

[0766] Polynuceotides or polypeptides, or agonists or antagonists of the present invention may be used to treat, prevent, diagnose, and/or prognose diseases associated with mixed fetal tissues, including, but not limited to, developmental and inherited disorders or defects of the nervous system, musculoskelelal system, execretory system, cardiovascular system, hematopoietic system, gastrointestinal system, reproductive system, and respiratory system. Compositions of the present invention may also be used to treat, prevent, diagnose, and/or prognose developmental and inherited disorders or defects associated with, but not limited to, skin, hair, visual, and auditory tissues, metabolism. Additionally, the compositions of the invention may be useful in the diagnosis, treatment, and/or prevention of disorders or diseases associated with, but not limited to, chromosomal or genetic abnormalities and hyperproliferation or neoplasia.

[0767] Disorders or defects of the nervous system associated with developmental or inherited abnormalities that may be diagnosed, treated, and/or prevented with the compostions of the invention include, but are not limited to, adrenoleukodystrophy, agenesis of corpus callosum, Alexander disease, anencephaly, Angelman syndrome, Arnold-Chiari deformity, Batten disease, Canavan disease, cephalic disorders, Charcot-Marie-Tooth disease, encephalocele, Friedreich's ataxia, Gaucher's disease, Gorlin syndrome, Hallervorden-Spatz disease, hereditary spastic paraplegia, Huntington disease, hydranencephaly, hydrocephalus, Joubert syndrome, Lesch-Nyhan syndrome, leukodystrophy, Menkes disease, microcephaly, Niemann-Pick Type C1, neurofibromatosis, porencephaly, progeria, proteus syndrome, Refsum disease, spina bifida, Sturge-Weber syndrome, Tay-Sachs disease, tuberous sclerosis, and von Hippel-Lindau disease.

[0768] Developmental and inherited disorders resulting in disorders or defects of the musculoskeletal system that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, achondroplasia, atlanto-occipital fusion, arthrogryposis mulitplex congenita, autosomal recessive muscular dystrophy, Becker's muscular dystrophy, cerebral palsy, choanal atresia, cleft lip, cleft palate, clubfoot, congenital amputation, congenital dislocation of the hip, congenital torticollis, congenital scoliosis, dopa-repsonsive dystonia, Duchenne muscular dystrophy, early-onset generalized dystonia, femoral torsion, Gorlin syndrome, hypophosphatasia, Klippel-Feil syndrome, knee dislocation, myoclonic dystonia, myotonic dystrophy, nail-patella syndrome, osteogenesis imperfecta, paroxysmal dystonia, progeria, prune-belly syndrome, rapid-onset dystonia parkinsonism, scolosis, syndactyly, Treacher Collins' syndrome, velocardiofacial syndrome, and X-linked dystonia-parkinsonism.

[0769] Developmental or hereditary disorders or defects of the excretory system that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, Alport's syndrome, Bartter's syndrome, bladder diverticula, bladder exstrophy, cystinuria, epispadias, Fanconi's syndrome, Hartnup disease, horseshoe kidney, hypospadias, kidney agenesis, kidney ectopia, kidney malrotation, Liddle's syndrome, medullary cystic disease, medullary sponge, multicystic kidney, kidney polycystic kidney disease, nail-patella syndrome, Potter's syndrome, urinary tract flow obstruction, vitamin D-resistant rickets, and Wilm's tumor.

[0770] Cardiovascular disorders or defects of developmental or hereditary origin that may be diagnosed, treated, and/or prevented with the compositions of the inventtion include, but are not limited to, aortic valve stenosis, atrial septal defects, artioventricular (A-V) canal defect, bicuspid aortic valve, coarctation or the aorta, dextrocardia, Ebstein's anomaly, Eisenmenger's complex, hypoplastic left heart syndrome, Marfan syndrome, patent ductus arteriosus, progeria, pulmonary atresia, pulmonary valve stenosis, subaortic stenosis, tetralogy of fallot, total anomalous pulmonary venous (P-V) connection, transposition of the great arteries, tricuspid atresia, truncus arteriosus, ventricular septal defects. Developmental or inherited disorders resulting in disorders involving the hematopoietic system that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but not limited to, Bernard-Soulier syndrome, Chédiak-Higashi syndrome, hemophilia, Hermansky-Pudlak syndrome, sickle cell anemia, storage pool disease, thromboxane A2 dysfunction, thrombasthenia, and von Willebrand's disease.

[0771] The compositions of the invention may also be used to diagnose, treat, and/or prevent developmental and inherited disorders resulting in disorders or defects of the gastrointestinal system, including, but not limited to, anal atresia, biliary atresia, esophageal atresia, diaphragmatic hernia, Hirschsprung's disease, Meckel's diverticulum, oligohydramnios, omphalocele, polyhydramnios, porphyria, situs inversus viscera. Developmental or inherited disorders resulting in metabolic disorders that may be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, alpha-1antitrypsin deficiency, cystic fibrosis, hemochromatosis, lysosomal storage disease, phenylketonuria, Wilson's disease, and Zellweger syndrome.

[0772] Disorders of the reproductive system that are developmentally or hereditary related that may also be diagnosed, treated, and/or prevented with the compositions of the invention include, but are not limited to, androgen insensitivity syndrome, ambiguous genitalia, autosomal sex reversal, congenital adreneal hyperplasia, gonadoblastoma, ovarian germ cell cancer, pseudohermphroditism, true hermaphroditism, undescended testis, XX male syndrome, and XY female type gonadal dysgenesis. The compositions of the invention may also be used to diagnose, treat, and/or prevent developmental or inherited respiratory defects including, but not limited to, askin tumor, azygos lobe, congenital diaphragmatic hernia, congenital lobar emphysema, cystic adenomatoid malformation, lobar emphysema, hyaline membrane disease, and pectus excavatum.

[0773] Developmental or inherited disorders may also result from chromosomal or genetic aberration that may be diagnosed, treated, and/or prevented with the compositions of the invention including, but not limited to, 4p-syndrome, cri du chat syndrome, Digeorge syndrome, Down's syndrome, Edward's syndrome, fragile X syndrome, Klinefelter's syndrome, Patau's syndrome, Prader-Willi syndrome, progeria, Turner's syndrome, triple X syndrome, and XYY syndrome. Other developmental disorders that can be diagnosed, treated, and/or prevented with the compositions of the invention, include, but are not limited to, fetal alcohol syndrome, and can be caused by environmental factors surrounding the developing fetus.

[0774] The compositions of the invention may further be able to be used to diagnose, treat, and/or prevent errors in development or a genetic disposition that may result in hyperproliferative disorders or neoplasms, including, but not limited to, acute childhood lymphoblastic leukemia, askin tumor, Beckwith-Wiedemann syndrome, childhood acute myeloid leukemia, childhood brain stem glioma, childhood cerebellar astrocytoma, childhood extracranial germ cell tumors childhood (primary), gonadoblastoma, hepatocellular cancer, childhood Hodgkin's disease, childhood Hodgkin's lymphoma, childhood hypothalamic and visual pathway glioma, childhood (primary) liver cancer, childhood lymphoblastic leukemia, childhood medulloblastoma, childhood non-Hodgkin's lymphoma, childhood pineal and supratentorial primitive neuroectodermal tumors, childhood primary liver cancer, childhood rhabdomyosarcoma, childhood soft tissue sarcoma, Gorlin syndrome, familial multiple endrocrine neoplasia type I, neuroblastoma, ovarian germ cell cancer, pheochromocytoma, retinoblastoma, and Wilm's tumor.

[0775] Polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art. Polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering polynucleotides are described in more detail herein.

[0776] Diseases at the Cellular Level

[0777] Diseases associated with increased cell survival or the inhibition of apoptosis that could be treated, prevented, diagnosed and/or prognosed using polynucleotides or polypeptides, as well as antagonists or agonists of the present invention, include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) and viral infections (such as herpes viruses, pox viruses and adenoviruses), inflammation, graft v. host disease, acute graft rejection, and chronic graft rejection.

[0778] In preferred embodiments, polynucleotides, polypeptides, and/or antagonists of the invention are used to inhibit growth, progression, and/or metastasis of cancers, in particular those [listed above] involving tissues of the musculoskeletal system.

[0779] Additional diseases or conditions associated with increased cell survival that could be treated or detected by polynucleotides or polypeptides, or agonists or antagonists of the present invention include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.

[0780] Diseases associated with increased apoptosis that could be treated, prevented, diagnosted, and/or prognosed using polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, include, but are not limited to, AIDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia), graft v. host disease, ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury), liver injury (e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer); toxin-induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.

[0781] Wound Healing and Epithelial Cell Proliferation

[0782] In accordance with yet a further aspect of the present invention, there is provided a process for utilizing polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, for therapeutic purposes, for example, to stimulate epithelial cell proliferation and basal keratinocytes for the purpose of wound healing, and to stimulate hair follicle production and healing of dermal wounds. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, burns resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associated with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to promote dermal reestablishment subsequent to dermal loss.

[0783] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed. The following are types of grafts that polynucleotides or polypeptides, agonists or antagonists of the present invention, could be used to increase adherence to a wound bed: autografts, artificial skin, allografts, autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts, bone graft, brephoplastic grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia graft, full thickness graft, heterologous graft, xenograft, homologous graft, hyperplastic graft, lamellar graft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft, penetrating graft, split skin graft, thick split graft. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, can be used to promote skin strength and to improve the appearance of aged skin.

[0784] It is believed that polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in the lung, breast, pancreas, stomach, small intestine, and large intestine. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could promote proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells and their progenitors contained within the skin, lung, liver, and gastrointestinal tract. Polynucleotides or polypeptides, agonists or antagonists of the present invention, may promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.

[0785] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, may have a cytoprotective effect on the small intestine mucosa. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections.

[0786] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., repopulation of hair follicles, sweat glands, and sebaceous glands), treatment of other skin defects such as psoriasis. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to treat epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating reepithelialization of these lesions. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could also be used to treat gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly. Inflammatory bowel diseases, such as Crohn's disease and ulcerative colitis, are diseases, which result in destruction of the mucosal surface of the small or large intestine, respectively. Thus, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to promote the resurfacing of the mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease. Treatment with polynucleotides or polypeptides, agonists or antagonists of the present invention, is expected to have a significant effect on the production of mucus throughout the gastrointestinal tract and could be used to protect the intestinal mucosa from injurious substances that are ingested or following surgery. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to treat diseases associate with the under expression.

[0787] Moreover, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to prevent and heal damage to the lungs due to various pathological states. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could stimulate proliferation and differentiation and promote the repair of alveoli and brochiolar epithelium to prevent or treat acute or chronic lung damage. For example, emphysema, which results in the progressive loss of aveoli, and inhalation injuries, i.e., resulting from smoke inhalation and burns, that cause necrosis of the bronchiolar epithelium and alveoli could be effectively treated using polynucleotides or polypeptides, agonists or antagonists of the present invention. Also, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to stimulate the proliferation of and differentiation of type II pneumocytes, which may help treat or prevent disease such as hyaline membrane diseases, such as infant respiratory distress syndrome and bronchopulmonary displasia, in premature infants.

[0788] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat liver diseases and pathologies such as fuliminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art). In addition, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used treat or prevent the onset of diabetes mellitus. In patients with newly diagnosed Types I and II diabetes, where some islet cell function remains, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease. Also, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.

[0789] Infectious Disease

[0790] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention may also directly inhibit the infectious agent, without necessarily eliciting an immune response.

[0791] Viruses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention. Examples of viruses, include, but are not limited to Examples of viruses, include, but are not limited to the following DNA and RNA viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B, and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae, Picornaviridae, Poxyiridae (such as Smallpox or Vaccinia), Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-II, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B). In an additional specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines. In a further specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat AIDS.

[0792] Similarly, bacterial or fungal agents that can cause disease or symptoms and that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, include, but not limited to, the following Gram-Negative and Gram-positive bacteria and bacterial families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia (e.g., Borrelia burgdorferi, Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E. coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Treponema spp., Leptospira spp., Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and Streptococcal (e.g., Streptococcus pneumoniae and Group B Streptococcus). These bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chiamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract infections, wound infections. Polynucleotides or polypeptides, agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases. In specific embodiments, Ppolynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, Diptheria, botulism, and/or meningitis type B.

[0793] Moreover, parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium ovale). These parasites can cause a variety of diseases or symptoms, including, but not limited to: Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., AIDS related), malaria, pregnancy complications, and toxoplasmosis. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases.

[0794] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy). Moreover, the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.

[0795] Regeneration

[0796] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues. (See, Science 276:59-87 (1997).) The regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or systemic cytokine damage.

[0797] Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and lymphatics), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue. Preferably, regeneration occurs without or decreased scarring. Regeneration also may include angiogenesis.

[0798] Moreover, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage. Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention could also be used prophylactically in an effort to avoid damage. Specific diseases that could be treated include of tendinitis, carpal tunnel syndrome, and other tendon or ligament defects. A further example of tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds.

[0799] Similarly, nerve and brain tissue could also be regenerated by using polynucleotides or polypeptides, as well as agonists or antagonists of the present invention, to proliferate and differentiate nerve cells. Diseases that could be treated using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic disorders (e.g., spinal cord disorders, head trauma, cerebrovascular disease, and stoke). Specifically, diseases associated with peripheral nerve injuries, peripheral neuropathy (e.g., resulting from chemotherapy or other medical therapies), localized neuropathies, and central nervous system diseases (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all be treated using the polynucleotides or polypeptides, as well as agonists or antagonists of the present invention.

[0800] Chemotaxis

[0801] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention may have chemotaxis activity. A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hyperproliferation. The mobilized cells can then fight off and/or heal the particular trauma or abnormality.

[0802] Polynucleotides or polypeptides, as well as agonists or antagonists of the present invention may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat wounds.

[0803] It is also contemplated that polynucleotides or polypeptides, as well as agonists or antagonists of the present invention may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, polynucleotides or polypeptides, as well as agonists or antagonists of the present invention could be used as an inhibitor of chemotaxis.

[0804] Binding Activity

[0805] A polypeptide of the present invention may be used to screen for molecules that bind to the polypeptide or for molecules to which the polypeptide binds. The binding of the polypeptide and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the polypeptide or the molecule bound. Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors), or small molecules.

[0806] Preferably, the molecule is closely related to the natural ligand of the polypeptide, e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic. (See, Coligan et al., Current Protocols in Immunology 1(2):Chapter 5 (1991).) Similarly, the molecule can be closely related to the natural receptor to which the polypeptide binds, or at least, a fragment of the receptor capable of being bound by the polypeptide (e.g., active site). In either case, the molecule can be rationally designed using known techniques.

[0807] Preferably, the screening for these molecules involves producing appropriate cells, which express the polypeptide. Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing the polypeptide (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either the polypeptide or the molecule.

[0808] The assay may simply test binding of a candidate compound to the polypeptide, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to the polypeptide.

[0809] Alternatively, the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures. The assay may also simply comprise the steps of mixing a candidate compound with a solution containing a polypeptide, measuring polypeptide/molecule activity or binding, and comparing the polypeptide/molecule activity or binding to a standard.

[0810] Preferably, an ELISA assay can measure polypeptide level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody. The antibody can measure polypeptide level or activity by either binding, directly or indirectly, to the polypeptide or by competing with the polypeptide for a substrate.

[0811] Additionally, the receptor to which the polypeptide of the present invention binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). For example, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NIH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labeled. The polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase.

[0812] Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding single clones that encode the putative receptor.

[0813] As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.

[0814] Moreover, the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as “DNA shuffling”) may be employed to modulate the activities of the polypeptide of the present invention thereby effectively generating agonists and antagonists of the polypeptide of the present invention. See generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol. 16(2):76-82 (1998); Hansson L. O., et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques 24(2):308-13 (1998); each of these patents and publications are hereby incorporated by reference). In one embodiment, alteration of polynucleotides and corresponding polypeptides may be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments into a desired molecule by homologous, or site-specific, recombination. In another embodiment, polynucleotides and corresponding polypeptides may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of the polypeptide of the present invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. In preferred embodiments, the heterologous molecules are family members. In further preferred embodiments, the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF-beta1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).

[0815] Other preferred fragments are biologically active fragments of the polypeptide of the present invention. Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the polypeptide of the present invention. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.

[0816] Additionally, this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention. An example of such an assay comprises combining a mammalian fibroblast cell, the polypeptide of the present invention, the compound to be screened and 3[H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate. A control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3[H] thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography, which measures the incorporation of 3[H] thymidine. Both agonist and antagonist compounds may be identified by this procedure.

[0817] In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured. Alternatively, the response of a known second messenger system following interaction of a compound to be screened and the receptor is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to determine if the compound is a potential agonist or antagonist. Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.

[0818] All of these above assays can be used as diagnostic or prognostic markers. The molecules discovered using these assays can be used to treat disease or to bring about a particular result in a patient (e.g., blood vessel growth) by activating or inhibiting the polypeptide/molecule. Moreover, the assays can discover agents which may inhibit or enhance the production of the polypeptides of the invention from suitably manipulated cells or tissues.

[0819] Therefore, the invention includes a method of identifying compounds which bind to a polypeptide of the invention comprising the steps of: (a) incubating a candidate binding compound with a polypeptide of the present invention; and (b) determining if binding has occurred. Moreover, the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with a polypeptide of the present invention, (b) assaying a biological activity, and (b) determining if a biological activity of the polypeptide has been altered.

[0820] Targeted Delivery

[0821] In another embodiment, the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention.

[0822] As discussed herein, polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions. In one embodiment, the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids. In one example, the invention provides a method for delivering a therapeutic protein into the targeted cell. In another example, the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.

[0823] In another embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodrugs.

[0824] By “toxin” is meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. By “cytotoxic prodrug” is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.

[0825] Drug Screening

[0826] Further contemplated is the use of the polypeptides of the present invention, or the polynucleotides encoding these polypeptides, to screen for molecules, which modify the activities of the polypeptides of the present invention. Such a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding.

[0827] This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques. The polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.

[0828] Thus, the present invention provides methods of screening for drugs or any other agents, which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art. In such a competitive binding assay, the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.

[0829] Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on Sep. 13, 1984, which is incorporated herein by reference herein. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.

[0830] This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.

[0831] Antisense and Ribozyme (Antagonists)

[0832] In specific embodiments, antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ID NO:X, or the complementary strand thereof, and/or to cDNA sequences contained in cDNA Clone ID NO:Z identified for example, in Table 1A. In one embodiment, antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988). Antisense technology can be used tocontrol gene expression through antisense DNA or RNA, or through triple-helix formation. Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.

[0833] For example, the use of c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines was previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with the oligoribonucleotide. A similar procedure for in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRI site on the 5′ end and a HindIII site on the 3′ end. Next, the pair of oligonucleotides is heated at 90° C. for one minute and then annealed in 2×ligation buffer (20 mM TRIS HCl pH 7.5, 10 mM MgCl2, 10 MM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoR1/Hind III site of the retroviral vector PMV7 (WO 91/15580).

[0834] For example, the 5′ coding portion of a polynucleotide that encodes the polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.

[0835] In one embodiment, the antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding the polypeptide of the present invention or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3′ long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.

[0836] The antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a gene of the present invention. However, absolute complementarity, although preferred, is not required. A sequence “complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the larger the hybridizing nucleic acid, the more base mismatches with a RNA it may contain and still form a stable duplex (or triplex as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

[0837] Oligonucleotides that are complementary to the 5′ end of the message, e.g., the 5′ untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3′ untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus, oligonucleotides complementary to either the 5′- or 3′-non-translated, non-coding regions of polynucleotide sequences described herein could be used in an antisense approach to inhibit translation of endogenous mRNA. Oligonucleotides complementary to the 5′ untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5′-, 3′- or coding region of mRNA of the present invention, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

[0838] The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published Dec. 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published Apr. 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

[0839] The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N-6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine,

[0840] The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.

[0841] In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.

[0842] In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2′-1-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).

[0843] Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.

[0844] While antisense nucleotides complementary to the coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.

[0845] Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published Oct. 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5′-UG-3′. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of SEQ ID NO:X. Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5′ end of the mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.

[0846] As in the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells, which express in vivo. DNA constructs encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA. A preferred method of delivery involves using a DNA construct “encoding” the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.

[0847] Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.

[0848] The antagonist/agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.

[0849] The antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing.

[0850] The antagonist/agonist may also be employed to treat the diseases described herein.

[0851] Thus, the invention provides a method of treating disorders or diseases, including but not limited to the disorders or diseases listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention.

[0852] Binding Peptides and Other Molecules

[0853] The invention also encompasses screening methods for identifying polypeptides and nonpolypeptides that bind musculoskeletal system antigen polypeptides, and the musculoskeletal system antigen binding molecules identified thereby. These binding molecules are useful, for example, as agonists and antagonists of the musculoskeletal system antigen polypeptides. Such agonists and antagonists can be used, in accordance with the invention, in the therapeutic embodiments described in detail, below.

[0854] This method comprises the steps of:

[0855] contacting musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides with a plurality of molecules; and

[0856] identifying a molecule that binds the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides.

[0857] The step of contacting the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides with the plurality of molecules may be effected in a number of ways. For example, one may contemplate immobilizing the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides on a solid support and bringing a solution of the plurality of molecules in contact with the immobilized musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides. Such a procedure would be akin to an affinity chromatographic process, with the affinity matrix being comprised of the immobilized musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides. The molecules having a selective affinity for the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides can then be purified by affinity selection. The nature of the solid support, process for attachment of the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides to the solid support, solvent, and conditions of the affinity isolation or selection are largely conventional and well known to those of ordinary skill in the art.

[0858] Alternatively, one may also separate a plurality of polypeptides into substantially separate fractions comprising a subset of or individual polypeptides. For instance, one can separate the plurality of polypeptides by gel electrophoresis, column chromatography, or like method known to those of ordinary skill for the separation of polypeptides. The individual polypeptides can also be produced by a transformed host cell in such a way as to be expressed on or about its outer surface (e.g., a recombinant phage). Individual isolates can then be “probed” by the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides, optionally in the presence of an inducer should one be required for expression, to determine if any selective affinity interaction takes place between the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides and the individual clone. Prior to contacting the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides with each fraction comprising individual polypeptides, the polypeptides could first be transferred to a solid support for additional convenience. Such a solid support may simply be a piece of filter membrane, such as one made of nitrocellulose or nylon. In this manner, positive clones could be identified from a collection of transformed host cells of an expression library, which harbor a DNA construct encoding a polypeptide having a selective affinity for musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides. Furthermore, the amino acid sequence of the polypeptide having a selective affinity for the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides can be determined directly by conventional means or the coding sequence of the DNA encoding the polypeptide can frequently be determined more conveniently. The primary sequence can then be deduced from the corresponding DNA sequence. If the amino acid sequence is to be determined from the polypeptide itself, one may use microsequencing techniques. The sequencing technique may include mass spectroscopy.

[0859] In certain situations, it may be desirable to wash away any unbound musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides, or alternatively, unbound polypeptides, from a mixture of the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides and the plurality of polypeptides prior to attempting to determine or to detect the presence of a selective affinity interaction. Such a wash step may be particularly desirable when the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides or the plurality of polypeptides is bound to a solid support.

[0860] The plurality of molecules provided according to this method may be provided by way of diversity libraries, such as random or combinatorial peptide or nonpeptide libraries, which can be screened for molecules that specifically bind musculoskeletal system antigen polypeptides. Many libraries are known in the art that can be used, e.g., chemically synthesized libraries, recombinant (e.g., phage display libraries), and in vitro translation-based libraries. Examples of chemically synthesized libraries are described in Fodor et al., 1991, Science 251:767-773; Houghten et al., 1991, Nature 354:84-86; Lam et al., 1991, Nature 354:82-84; Medynski, 1994, Bio/Technology 12:709-710; Gallop et al., 1994, J. Medicinal Chemistry 37(9):1233-1251; Ohlmeyer et al., 1993, Proc. Natl. Acad. Sci. USA 90:10922-10926; Erb et al., 1994, Proc. Natl. Acad. Sci. USA 91:11422-11426; Houghten et al., 1992, Biotechniques 13:412; Jayawickreme et al., 1994, Proc. Natl. Acad. Sci. USA 91:1614-1618; Salmon et al., 1993, Proc. Natl. Acad. Sci. USA 90:11708-11712; PCT Publication No. WO 93/20242; and Brenner and Lerner, 1992, Proc. Natl. Acad. Sci. USA 89:5381-5383.

[0861] Examples of phage display libraries are described in Scott and Smith, 1990, Science 249:386-390; Devlin et al., 1990, Science, 249:404-406; Christian, R. B., et al., 1992, J. Mol. Biol. 227:711-718); Lenstra, 1992, J. Immunol. Meth. 152:149-157; Kay et al., 1993, Gene 128:59-65; and PCT Publication No. WO 94/18318 dated Aug. 18, 1994.

[0862] In vitro translation-based libraries include but are not limited to those described in PCT Publication No. WO 91/05058 dated Apr. 18, 1991; and Mattheakis et al., 1994, Proc. Natl. Acad. Sci. USA 91:9022-9026.

[0863] By way of examples of nonpeptide libraries, a benzodiazepine library (see e.g., Bunin et al., 1994, Proc. Natl. Acad. Sci. USA 91:4708-4712) can be adapted for use. Peptoid libraries (Simon et al., 1992, Proc. Natl. Acad. Sci. USA 89:9367-9371) can also be used. Another example of a library that can be used, in which the amide functionalities in peptides have been permethylated to generate a chemically transformed combinatorial library, is described by Ostresh et al. (1994, Proc. Natl. Acad. Sci. USA 91:11138-11142).

[0864] The variety of non-peptide libraries that are useful in the present invention is great. For example, Ecker and Crooke, 1995, Bio/Technology 13:351-360 list benzodiazepines, hydantoins, piperazinediones, biphenyls, sugar analogs, beta-mercaptoketones, arylacetic acids, acylpiperidines, benzopyrans, cubanes, xanthines, aminimides, and oxazolones as among the chemical species that form the basis of various libraries.

[0865] Non-peptide libraries can be classified broadly into two types: decorated monomers and oligomers. Decorated monomer libraries employ a relatively simple scaffold structure upon which a variety functional groups is added. Often the scaffold will be a molecule with a known useful pharmacological activity. For example, the scaffold might be the benzodiazepine structure.

[0866] Non-peptide oligomer libraries utilize a large number of monomers that are assembled together in ways that create new shapes that depend on the order of the monomers. Among the monomer units that have been used are carbamates, pyrrolinones, and morpholinos. Peptoids, peptide-like oligomers in which the side chain is attached to the alpha amino group rather than the alpha carbon, form the basis of another version of non-peptide oligomer libraries. The first non-peptide oligomer libraries utilized a single type of monomer and thus contained a repeating backbone. Recent libraries have utilized more than one monomer, giving the libraries added flexibility.

[0867] Screening the libraries can be accomplished by any of a variety of commonly known methods. See, e.g., the following references, which disclose screening of peptide libraries: Parmley and Smith, 1989, Adv. Exp. Med. Biol. 251:215-218; Scott and Smith, 1990, Science 249:386-390; Fowlkes et al., 1992; BioTechniques 13:422-427; Oldenburg et al., 1992, Proc. Natl. Acad. Sci. USA 89:5393-5397; Yu et al., 1994, Cell 76:933-945; Staudt et al., 1988, Science 241:577-580; Bock et al., 1992, Nature 355:564-566; Tuerk et al., 1992, Proc. Natl. Acad. Sci. USA 89:6988-6992; Ellington et al., 1992, Nature 355:850-852; U.S. Pat. No. 5,096,815, U.S. Pat. No. 5,223,409, and U.S. Pat. No. 5,198,346, all to Ladner et al.; Rebar and Pabo, 1993, Science 263:671-673; and CT Publication No. WO 94/18318.

[0868] In a specific embodiment, screening to identify a molecule that binds musculoskeletal system antigen polypeptides can be carried out by contacting the library members with a musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides immobilized on a solid phase and harvesting those library members that bind to the musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides. Examples of such screening methods, termed “panning” techniques are described by way of example in Parmley and Smith, 1988, Gene 73:305-318; Fowlkes et al., 1992, BioTechniques 13:422-427; International Publication No. WO 94/18318; and in references cited herein.

[0869] In another embodiment, the two-hybrid system for selecting interacting proteins in yeast (Fields and Song, 1989, Nature 340:245-246; Chien et al., 1991, Proc. Natl. Acad. Sci. USA 88:9578-9582) can be used to identify molecules that specifically bind to musculoskeletal system antigen polypeptides or musculoskeletal system antigen-like polypeptides.

[0870] Where the musculoskeletal system antigen binding molecule is a polypeptide, the polypeptide can be conveniently selected from any peptide library, including random peptide libraries, combinatorial peptide libraries, or biased peptide libraries. The term “biased” is used herein to mean that the method of generating the library is manipulated so as to restrict one or more parameters that govern the diversity of the resulting collection of molecules, in this case peptides.

[0871] Thus, a truly random peptide library would generate a collection of peptides in which the probability of finding a particular amino acid at a given position of the peptide is the same for all 20 amino acids. A bias can be introduced into the library, however, by specifying, for example, that a lysine occurs every fifth amino acid or that positions 4, 8, and 9 of a decapeptide library be fixed to include only arginine. Clearly, many types of biases can be contemplated, and the present invention is not restricted to any particular bias. Furthermore, the present invention contemplates specific types of peptide libraries, such as phage displayed peptide libraries and those that utilize a DNA construct comprising a lambda phage vector with a DNA insert.

[0872] As mentioned above, in the case of a musculoskeletal system antigen binding molecule that is a polypeptide, the polypeptide may have about 6 to less than about 60 amino acid residues, preferably about 6 to about 10 amino acid residues, and most preferably, about 6 to about 22 amino acids. In another embodiment, a musculoskeletal system antigen binding polypeptide has in the range of 15-100 amino acids, or 20-50 amino acids.

[0873] The selected musculoskeletal system antigen binding polypeptide can be obtained by chemical synthesis or recombinant expression.

[0874] Other Activities

[0875] A polypeptide, polynucleotide, agonist, or antagonist of the present invention, as a result of the ability to stimulate vascular endothelial cell growth, may be employed in treatment for stimulating re-vascularization of ischemic tissues due to various disease conditions such as thrombosis, arteriosclerosis, and other cardiovascular conditions. The polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to stimulate angiogenesis and limb regeneration, as discussed above.

[0876] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for treating wounds due to injuries, burns, post-operative tissue repair, and ulcers since they are mitogenic to various cells of different origins, such as fibroblast cells and skeletal muscle cells, and therefore, facilitate the repair or replacement of damaged or diseased tissue.

[0877] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to stimulate neuronal growth and to treat and prevent neuronal damage which occurs in certain neuronal disorders or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease, and AIDS-related complex. A polypeptide, polynucleotide, agonist, or antagonist of the present invention may have the ability to stimulate chondrocyte growth; therefore, they may be employed to enhance bone and periodontal regeneration and aid in tissue transplants or bone grafts.

[0878] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may be also be employed to prevent skin aging due to sunburn by stimulating keratinocyte growth.

[0879] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for preventing hair loss, since FGF family members activate hair-forming cells and promotes melanocyte growth. Along the same lines, a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be employed to stimulate growth and differentiation of hematopoietic cells and bone marrow cells when used in combination with other cytokines.

[0880] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to maintain organs before transplantation or for supporting cell culture of primary tissues. A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for inducing tissue of mesodermal origin to differentiate in early embryos.

[0881] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also increase or decrease the differentiation or proliferation of embryonic stem cells, besides, as discussed above, hematopoietic lineage.

[0882] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used to modulate mammalian characteristics, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, and shape (e.g., cosmetic surgery). Similarly, a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to modulate mammalian metabolism affecting catabolism, anabolism, processing, utilization, and storage of energy.

[0883] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to change a mammal's mental state or physical state by influencing biorhythms, caricadic rhythms, depression (including depressive disorders), tendency for violence, tolerance for pain, reproductive capabilities (preferably by Activin or Inhibin-like activity), hormonal or endocrine levels, appetite, libido, memory, stress, or other cognitive qualities.

[0884] A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used as a food additive or preservative, such as to increase or decrease storage capabilities, fat content, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other nutritional components.

[0885] The above-recited applications have uses in a wide variety of hosts. Such hosts include, but are not limited to, human, murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, non-human primate, and human. In specific embodiments, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In preferred embodiments, the host is a mammal. In most preferred embodiments, the host is a human.

[0886] Other Preferred Embodiments

[0887] Other preferred embodiments of the claimed invention include an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least about 50 contiguous nucleotides in the nucleotide sequence of SEQ ID NO:X or the complementary strand thereto, the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto, and/or cDNA contained in Clone ID NO:Z.

[0888] Also preferred is a nucleic acid molecule wherein said sequence of contiguous nucleotides is included in the nucleotide sequence of the portion of SEQ ID NO:X as defined in column 4, “ORF (From-To)”, in Table 1A.

[0889] Also preferred is a nucleic acid molecule wherein said sequence of contiguous nucleotides is included in the nucleotide sequence of the portion of SEQ ID NO:X as defined in columns 8 and 9, “NT From” and “NT To”, respectively, in Table 2.

[0890] Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least about 150 contiguous nucleotides in the nucleotide sequence of SEQ ID NO:X or the complementary strand thereto, the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto, and/or cDNA contained in Clone ID NO:Z.

[0891] Further preferred is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least about 500 contiguous nucleotides in the nucleotide sequence of SEQ ID NO:X or the complementary strand thereto, the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto, and/or cDNA contained in Clone ID NO:Z.

[0892] A further preferred embodiment is a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the nucleotide sequence of the portion of SEQ ID NO:X defined in column 4, “ORF (From-To)”, in Table 1A.

[0893] A further preferred embodiment is a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the nucleotide sequence of the portion of SEQ ID NO:X defined in columns 8 and 9, “NT From” and “NT To”, respectively, in Table 2.

[0894] A further preferred embodiment is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the complete nucleotide sequence of SEQ ID NO:X or the complementary strand thereto, the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto, and/or cDNA contained in Clone ID NO:Z.

[0895] Also preferred is an isolated nucleic acid molecule which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto, the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto, and/or cDNA contained in Clone ID NO:Z, wherein said nucleic acid molecule which hybridizes does not hybridize under stringent hybridization conditions to a nucleic acid molecule having a nucleotide sequence consisting of only A residues or of only T residues.

[0896] Also preferred is a composition of matter comprising a DNA molecule which comprises the cDNA contained in Clone ID NO:Z.

[0897] Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least 50 contiguous nucleotides of the cDNA sequence contained in Clone ID NO:Z.

[0898] Also preferred is an isolated nucleic acid molecule, wherein said sequence of at least 50 contiguous nucleotides is included in the nucleotide sequence of an open reading frame sequence encoded by cDNA contained in Clone ID NO:Z.

[0899] Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to sequence of at least 150 contiguous nucleotides in the nucleotide sequence encoded by cDNA contained in Clone ID NO:Z.

[0900] A further preferred embodiment is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to sequence of at least 500 contiguous nucleotides in the nucleotide sequence encoded by cDNA contained in Clone ID NO:Z.

[0901] A further preferred embodiment is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the complete nucleotide sequence encoded by cDNA contained in Clone ID NO:Z.

[0902] A further preferred embodiment is a method for detecting in a biological sample a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto; the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto; and a nucleotide sequence encoded by cDNA contained in Clone ID NO:Z; which method comprises a step of comparing a nucleotide sequence of at least one nucleic acid molecule in said sample with a sequence selected from said group and determining whether the sequence of said nucleic acid molecule in said sample is at least 95% identical to said selected sequence.

[0903] Also preferred is the above method wherein said step of comparing sequences comprises determining the extent of nucleic acid hybridization between nucleic acid molecules in said sample and a nucleic acid molecule comprising said sequence selected from said group. Similarly, also preferred is the above method wherein said step of comparing sequences is performed by comparing the nucleotide sequence determined from a nucleic acid molecule in said sample with said sequence selected from said group. The nucleic acid molecules can comprise DNA molecules or RNA molecules.

[0904] A further preferred embodiment is a method for identifying the species, tissue or cell type of a biological sample which method comprises a step of detecting nucleic acid molecules in said sample, if any, comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto; the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto; and a nucleotide sequence of the cDNA contained in Clone ID NO:Z.

[0905] The method for identifying the species, tissue or cell type of a biological sample can comprise a step of detecting nucleic acid molecules comprising a nucleotide sequence in a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from said group.

[0906] Also preferred is a method for diagnosing in a subject a pathological condition associated with abnormal structure or expression of a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto; the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto; or the cDNA contained in Clone ID NO:Z which encodes a protein, wherein the method comprises a step of detecting in a biological sample obtained from said subject nucleic acid molecules, if any, comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto; the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto; and a nucleotide sequence of cDNA contained in Clone ID NO:Z.

[0907] The method for diagnosing a pathological condition can comprise a step of detecting nucleic acid molecules comprising a nucleotide sequence in a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from said group.

[0908] Also preferred is a composition of matter comprising isolated nucleic acid molecules wherein the nucleotide sequences of said nucleic acid molecules comprise a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: a nucleotide sequence of SEQ ID NO:X or the complementary strand thereto; the nucleotide sequence as defined in column 4 of Table 1A or columns 8 and 9 of Table 2 or the complementary strand thereto; and a nucleotide sequence encoded by cDNA contained in Clone ID NO:Z. The nucleic acid molecules can comprise DNA molecules or RNA molecules.

[0909] Also preferred is a composition of matter comprising isolated nucleic acid molecules wherein the nucleotide sequences of said nucleic acid molecules comprise a DNA microarray or “chip” of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 100, 150, 200, 250, 300, 500, 1000, 2000, 3000, or 4000 nucleotide sequences, wherein at least one sequence in said DNA microarray or “chip” is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of: a nucleotide sequence of SEQ ID NO:X wherein X is any integer as defined in Table 1A; and a nucleotide sequence encoded by a human cDNA clone identified by a cDNA “Clone ID” in Table 1A.

[0910] Also preferred is an isolated polypeptide comprising an amino acid sequence at least 90% identical to a sequence of at least about 10 contiguous amino acids in the polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and/or a polypeptide encoded by cDNA contained in Clone ID NO:Z.

[0911] Also preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence of at least about 30 contiguous amino acids in the amino acid sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and/or a polypeptide encoded by cDNA contained in Clone ID NO:Z.

[0912] Further preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence of at least about 100 contiguous amino acids in the amino acid sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and/or a polypeptide encoded by cDNA contained in Clone ID NO:Z.

[0913] Further preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to the complete amino acid sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and/or a polypeptide encoded by cDNA contained in Clone ID NO:Z.

[0914] Further preferred is an isolated polypeptide comprising an amino acid sequence at least 90% identical to a sequence of at least about 10 contiguous amino acids in the complete amino acid sequence of a polypeptide encoded by contained in Clone ID NO:Z

[0915] Also preferred is a polypeptide wherein said sequence of contiguous amino acids is included in the amino acid sequence of a portion of said polypeptide encoded by cDNA contained in Clone ID NO:Z; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and/or the polypeptide sequence of SEQ ID NO:Y.

[0916] Also preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence of at least about 30 contiguous amino acids in the amino acid sequence of a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0917] Also preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to a sequence of at least about 100 contiguous amino acids in the amino acid sequence of a polypeptide encoded by cDNA contained in Clone ID NO:Z.

[0918] Also preferred is an isolated polypeptide comprising an amino acid sequence at least 95% identical to the amino acid sequence of a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0919] Further preferred is an isolated antibody which binds specifically to a polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: a polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0920] Further preferred is a method for detecting in a biological sample a polypeptide comprising an amino acid sequence which is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: a polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z; which method comprises a step of comparing an amino acid sequence of at least one polypeptide molecule in said sample with a sequence selected from said group and determining whether the sequence of said polypeptide molecule in said sample is at least 90% identical to said sequence of at least 10 contiguous amino acids.

[0921] Also preferred is the above method wherein said step of comparing an amino acid sequence of at least one polypeptide molecule in said sample with a sequence selected from said group comprises determining the extent of specific binding of polypeptides in said sample to an antibody which binds specifically to a polypeptide comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: a polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0922] Also preferred is the above method wherein said step of comparing sequences is performed by comparing the amino acid sequence determined from a polypeptide molecule in said sample with said sequence selected from said group.

[0923] Also preferred is a method for identifying the species, tissue or cell type of a biological sample which method comprises a step of detecting polypeptide molecules in said sample, if any, comprising an amino acid sequence that is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0924] Also preferred is the above method for identifying the species, tissue or cell type of a biological sample, which method comprises a step of detecting polypeptide molecules comprising an amino acid sequence in a panel of at least two amino acid sequences, wherein at least one sequence in said panel is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the above group.

[0925] Also preferred is a method for diagnosing in a subject a pathological condition associated with abnormal structure or expression of a nucleic acid sequence identified in Table 1A or Table 2 encoding a polypeptide, which method comprises a step of detecting in a biological sample obtained from said subject polypeptide molecules comprising an amino acid sequence in a panel of at least two amino acid sequences, wherein at least one sequence in said panel is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0926] In any of these methods, the step of detecting said polypeptide molecules includes using an antibody.

[0927] Also preferred is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a nucleotide sequence encoding a polypeptide wherein said polypeptide comprises an amino acid sequence that is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0928] Also preferred is an isolated nucleic acid molecule, wherein said nucleotide sequence encoding a polypeptide has been optimized for expression of said polypeptide in a prokaryotic host.

[0929] Also preferred is a polypeptide molecule, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z.

[0930] Further preferred is a method of making a recombinant vector comprising inserting any of the above isolated nucleic acid molecule into a vector. Also preferred is the recombinant vector produced by this method. Also preferred is a method of making a recombinant host cell comprising introducing the vector into a host cell, as well as the recombinant host cell produced by this method.

[0931] Also preferred is a method of making an isolated polypeptide comprising culturing this recombinant host cell under conditions such that said polypeptide is expressed and recovering said polypeptide. Also preferred is this method of making an isolated polypeptide, wherein said recombinant host cell is a eukaryotic cell and said polypeptide is a human protein comprising an amino acid sequence selected from the group consisting of: polypeptide sequence of SEQ ID NO:Y; a polypeptide encoded by SEQ ID NO:X or the complementary strand thereto; the polypeptide encoded by the nucleotide sequence as defined in columns 8 and 9 of Table 2; and a polypeptide encoded by the cDNA contained in Clone ID NO:Z. The isolated polypeptide produced by this method is also preferred.

[0932] Also preferred is a method of treatment of an individual in need of an increased level of a protein activity, which method comprises administering to such an individual a Therapeutic comprising an amount of an isolated polypeptide, polynucleotide, immunogenic fragment or analogue thereof, binding agent, antibody, or antigen binding fragment of the claimed invention effective to increase the level of said protein activity in said individual.

[0933] Also preferred is a method of treatment of an individual in need of a decreased level of a protein activity, which method comprised administering to such an individual a Therapeutic comprising an amount of an isolated polypeptide, polynucleotide, immunogenic fragment or analogue thereof, binding agent, antibody, or antigen binding fragment of the claimed invention effective to decrease the level of said protein activity in said individual.

[0934] Also preferred is a method of treatment of an individual in need of a specific delivery of toxic compositions to diseased cells (e.g., tumors, leukemias or lymphomas), which method comprises administering to such an individual a Therapeutic comprising an amount of an isolated polypeptide of the invention, including, but not limited to a binding agent, or antibody of the claimed invention that are associated with toxin or cytotoxic prodrugs.

[0935] Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting.

TABLE 6
ATCC Deposits	Deposit Date	ATCC Designation Number
LP01, LP02, LP03,	May-20-97	209059, 209060, 209061,
LP04, LP05, LP06,		209062, 209063, 209064, 209065,
LP07, LP08, LP09,		209066, 209067, 209068, 209069
LP10, LP11,
LP12	Jan-12-98	209579
LP13	Jan-12-98	209578
LP14	Jul-16-98	203067
LP15	Jul-16-98	203068
LP16	Feb-1-99	203609
LP17	Feb-1-99	203610
LP20	Nov-17-98	203485
LP21	Jun-18-99	PTA-252
LP22	Jun-18-99	PTA-253
LP23	Dec-22-99	PTA-1081

EXAMPLES

Example 1

Isolation of a Selected cDNA Clone from the Deposited Sample

[0936] Each Clone ID NO:Z is contained in a plasmid. Table 7 identifies the vectors used to construct the cDNA library from which each clone was isolated. In many cases, the vector used to construct the library is a phage vector from which a plasmid has been excised. The following correlates the related plasmid for each phage vector used in constructing the cDNA library. For example, where a particular clone is identified in Table 7 as being isolated in the vector “Lambda Zap,” the corresponding deposited clone is in “pBluescript.”

Vector Used to Construct Library Corresponding Deposited Plasmid
Lambda Zap                       pBluescript (pBS)
Uni-Zap XR                       pBluescript (pBS)
Zap Express                      pBK
lafmid BA                        plafmid BA
pSport 1                         pSport 1
pCMVSport 2.0                    pCMVSport 2.0
pCMVSport 3.0                    pCMVSport 3.0
pCR ®2.1                         pCR ®2.1

[0937] Vectors Lambda Zap (U.S. Pat. Nos. 5,128,256 and 5,286,636), Uni-Zap XR (U.S. Pat. Nos. 5,128, 256 and 5,286,636), Zap Express (U.S. Pat. Nos. 5,128,256 and 5,286,636), pBluescript (pBS) (Short, J. M. et al., Nucleic Acids Res. 16:7583-7600 (1988); Alting-Mees, M. A. and Short, J. M., Nucleic Acids Res. 17:9494 (1989)) and pBK (Alting-Mees, M. A. et al., Strategies 5:58-61 (1992)) are commercially available from Stratagene Cloning Systems, Inc., 11011 N. Torrey Pines Road, La Jolla, Calif., 92037. pBS contains an ampicillin resistance gene and pBK contains a neomycin resistance gene. Both can be transformed into E. coli strain XL-1 Blue, also available from Stratagene. pBS comes in 4 forms SK+, SK−, KS+ and KS. The S and K refers to the orientation of the polylinker to the T7 and T3 primer sequences which flank the polylinker region (“S” is for SacI and “K” is for KpnI which are the first sites on each respective end of the linker). “+” or “−” refer to the orientation of the f1 origin of replication (“ori”), such that in one orientation, single stranded rescue initiated from the f1 ori generates sense strand DNA and in the other, antisense.

[0938] Vectors pSport1, pCMVSport 2.0 and pCMVSport 3.0, were obtained from Life Technologies, Inc., P. O. Box 6009, Gaithersburg, Md. 20897. All Sport vectors contain an ampicillin resistance gene and may be transformed into E. coli strain DH10B, also available from Life Technologies. (See, for instance, Gruber, C. E., et al., Focus 15:59 (1993).) Vector lafmid BA (Bento Soares, Columbia University, NY) contains an ampicillin resistance gene and can be transformed into E. coli strain XL-1 Blue. Vector pCR®2.1, which is available from Invitrogen, 1600 Faraday Avenue, Carlsbad, Calif. 92008, contains an ampicillin resistance gene and may be transformed into E. coli strain DH10B, available from Life Technologies. (See, for instance, Clark, J. M., Nuc. Acids Res. 16:9677-9686 (1988) and Mead, D. et al., Bio/Technology 9: (1991).) Preferably, a polynucleotide of the present invention does not comprise the vector sequences identified for the particular clone in Table 7, as well as the corresponding plasmid vector sequences designated above.

[0939] The deposited material in the sample assigned the ATCC Deposit Number cited by reference to Tables 1A, 2, 6 and 7 for any given cDNA clone also may contain one or more additional plasmids, each comprising a cDNA clone different from that given clone. Thus, deposits sharing the same ATCC Deposit Number contain at least a plasmid for each Clone ID NO:Z.

TABLE 7
			ATCC
Libraries owned by Catalog	Catalog Description	Vector	Deposit
HUKA HUKB HUKC HUKD	Human Uterine Cancer	Lambda ZAP II	LP01
HUKE HUKF HUKG
HCNA HCNB	Human Colon	Lambda Zap II	LP01
HFFA	Human Fetal Brain, random primed	Lambda Zap II	LP01
HTWA	Resting T-Cell	Lambda ZAP II	LP01
HBQA	Early Stage Human Brain, random	Lambda ZAP II	LP01
	primed
HLMB HLMF HLMG HLMH	breast lymph node CDNA library	Lambda ZAP II	LP01
HLMI HLMJ HLMM HLMN
HCQA HCQB	human colon cancer	Lamda ZAP II	LP01
HMEA HMEC HMED HMEE	Human Microvascular Endothelial	Lambda ZAP II	LP01
HMEF HMEG HMEI HMEJ	Cells, fract. A
HMEK HMEL
HUSA HUSC	Human Umbilical Vein Endothelial	Lambda ZAP II	LP01
	Cells, fract. A
HLQA HLQB	Hepatocellular Tumor	Lambda ZAP II	LP01
HHGA HHGB HHGC HHGD	Hemangiopericytoma	Lambda ZAP II	LP01
HSDM	Human Striatum Depression, re-rescue	Lambda ZAP II	LP01
HUSH	H Umbilical Vein Endothelial Cells,	Lambda ZAP II	LP01
	frac A, re-excision
HSGS	Salivary gland, subtracted	Lambda ZAP II	LP01
HFXA HFXB HFXC HFXD	Brain frontal cortex	Lambda ZAP II	LP01
HFXE HFXF HFXG HFXH
HPQA HPQB HPQC	PERM TF274	Lambda ZAP II	LP01
HFXJ HFXK	Brain Frontal Cortex, re-excision	Lambda ZAP II	LP01
HCWA HCWB HCWC HCWD	CD34 positive cells (Cord Blood)	ZAP Express	LP02
HCWE HCWF HCWG HCWH
HCWI HCWJ HCWK
HCUA HCUB HCUC	CD34 depleted Buffy Coat (Cord	ZAP Express	LP02
	Blood)
HRSM	A-14 cell line	ZAP Express	LP02
HRSA	A1-CELL LINE	ZAP Express	LP02
HCUD HCUE HCUF HCUG	CD34 depleted Buffy Coat (Cord	ZAP Express	LP02
HCUH HCUI	Blood), re-excision
HBXE HBXF HBXG	H. Whole Brain #2, re-excision	ZAP Express	LP02
HRLM	L8 cell line	ZAP Express	LP02
HBXA HBXB HBXC HBXD	Human Whole Brain #2 - Oligo dT >	ZAP Express	LP02
	1.5 Kb
HUDA HUDB HUDC	Testes	ZAP Express	LP02
HHTM HHTN HHTO	H. hypothalamus, frac A; re-excision	ZAP Express	LP02
HHTL	H. hypothalamus, frac A	ZAP Express	LP02
HASA HASD	Human Adult Spleen	Uni-ZAP XR	LP03
HFKC HFKD HFKE HFKF	Human Fetal Kidney	Uni-ZAP XR	LP03
HFKG
HE8A HE8B HE8C HE8D HE8E	Human 8 Week Whole Embryo	Uni-ZAP XR	LP03
HE8F HE8M HE8N
HGBA HGBD HGBE HGBF	Human Gall Bladder	Uni-ZAP XR	LP03
HGBG HGBH HGBI
HLHA HLHB HLHC HLHD	Human Fetal Lung III	Uni-ZAP XR	LP03
HLHE HLHF HLHG HLHH
HLHQ
HPMA HPMB HPMC HPMD	Human Placenta	Uni-ZAP XR	LP03
HPME HPMF HPMG HPMH
HPRA HPRB HPRC HPRD	Human Prostate	Uni-ZAP XR	LP03
HSIA HSIC HSID HSIE	Human Adult Small Intestine	Uni-ZAP XR	LP03
HTEA HTEB HTEC HTED HTEE	Human Testes	Uni-ZAP XR	LP03
HTEF HTEG HTEH HTEI HTEJ
HTEK
HTPA HTPB HTPC HTPD HTPE	Human Pancreas Tumor	Uni-ZAP XR	LP03
HTTA HTTB HTTC HTTD HTTE	Human Testes Tumor	Uni-ZAP XR	LP03
HTTF
HAPA HAPB HAPC HAPM	Human Adult Pulmonary	Uni-ZAP XR	LP03
HETA HETB HETC HETD HETE	Human Endometrial Tumor	Uni-ZAP XR	LP03
HETF HETG HETH HETI
HHFB HHFC HHFD HHFE HHFF	Human Fetal Heart	Uni-ZAP XR	LP03
HHFG HHFH HHFI
HHPB HHPC HHPD HHPE HHPF	Human Hippocampus	Uni-ZAP XR	LP03
HHPG HHPH
HCE1 HCE2 HCE3 HCE4 HCE5	Human Cerebellum	Uni-ZAP XR	LP03
HCEB HCEC HCED HCEE HCEF
HCEG
HUVB HUVC HUVD HUVE	Human Umbilical Vein, Endo. remake	Uni-ZAP XR	LP03
HSTA HSTB HSTC HSTD	Human Skin Tumor	Uni-ZAP XR	LP03
HTAA HTAB HTAC HTAD	Human Activated T-Cells	Uni-ZAP XR	LP03
HTAE
HFEA HFEB HFEC	Human Fetal Epithelium (Skin)	Uni-ZAP XR	LP03
HJPA HJPB HJPC HJPD	HUMAN JURKAT MEMBRANE	Uni-ZAP XR	LP03
	BOUND POLYSOMES
HESA	Human epithelioid sarcoma	Uni-Zap XR	LP03
HLTA HLTB HLTC HLTD HLTE	Human T-Cell Lymphoma	Uni-ZAP XR	LP03
HLTF
HFTA HFTB HFTC HFTD	Human Fetal Dura Mater	Uni-ZAP XR	LP03
HRDA HRDB HRDC HRDD	Human Rhabdomyosarcoma	Uni-ZAP XR	LP03
HRDE HRDF
HCAA HCAB HCAC	Cem cells cyclohexamide treated	Uni-ZAP XR	LP03
HRGA HRGB HRGC HRGD	Raji Cells, cyclohexamide treated	Uni-ZAP XR	LP03
HSUA HSUB HSUC HSUM	Supt Cells, cyclohexamide treated	Uni-ZAP XR	LP03
HT4A HT4C HT4D	Activated T-Cells, 12 hrs.	Uni-ZAP XR	LP03
HE9A HE9B HE9C HE9D HE9E	Nine Week Old Early Stage Human	Uni-ZAP XR	LP03
HE9F HE9G HE9H HE9M HE9N
HATA HATB HATC HATD	Human Adrenal Gland Tumor	Uni-ZAP XR	LP03
HATE
HT5A	Activated T-Cells, 24 hrs.	Uni-ZAP XR	LP03
HFGA HFGM	Human Fetal Brain	Uni-ZAP XR	LP03
HNEA HNEB HNEC HNED	Human Neutrophil	Uni-ZAP XR	LP03
HNEE
HBGB HBGD	Human Primary Breast Cancer	Uni-ZAP XR	LP03
HBNA HBNB	Human Normal Breast	Uni-ZAP XR	LP03
HCAS	Cem Cells, cyclohexamide treated,	Uni-ZAP XR	LP03
	subtra
HHPS	Human Hippocampus, subtracted	pBS	LP03
HKCS HKCU	Human Colon Cancer, subtracted	pBS	LP03
HRGS	Raji cells, cyclohexamide treated,	pBS	LP03
	subtracted
HSUT	Supt cells, cyclohexamide treated,	pBS	LP03
	differentially expressed
HT4S	Activated T-Cells, 12 hrs, subtracted	Uni-ZAP XR	LP03
HCDA HCDB HCDC HCDD	Human Chondrosarcoma	Uni-ZAP XR	LP03
HCDE
HOAA HOAB HOAC	Human Osteosarcoma	Uni-ZAP XR	LP03
HTLA HTLB HTLC HTLD HTLE	Human adult testis, large inserts	Uni-ZAP XR	LP03
HTLF
HLMA HLMC HLMD	Breast Lymph node cDNA library	Uni-ZAP XR	LP03
H6EA H6EB H6EC	HL-60, PMA 4H	Uni-ZAP XR	LP03
HTXA HTXB HTXC HTXD	Activated T-Cell (12 hs)/Thiouridine	Uni-ZAP XR	LP03
HTXE HTXF HTXG HTXH	labelledEco
HNFA HNFB HNFC HNFD	Human Neutrophil, Activated	Uni-ZAP XR	LP03
HNFE HNFF HNFG HNFH HNFJ
HTOB HTOC	HUMAN TONSILS, FRACTION 2	Uni-ZAP XR	LP03
HMGB	Human OB MG63 control fraction I	Uni-ZAP XR	LP03
HOPB	Human OB HOS control fraction I	Uni-ZAP XR	LP03
HORB	Human OB HOS treated (10 nM E2)	Uni-ZAP XR	LP03
	fraction I
HSVA HSVB HSVC	Human Chronic Synovitis	Uni-ZAP XR	LP03
HROA	HUMAN STOMACH	Uni-ZAP XR	LP03
HBJA HBJB HBJC HBJD HBJE	HUMAN B CELL LYMPHOMA	Uni-ZAP XR	LP03
HBJF HBJG HBJH HBJI HBJJ
HBJK
HCRA HCRB HCRC	human corpus colosum	Uni-ZAP XR	LP03
HODA HODB HODC HODD	human ovarian cancer	Uni-ZAP XR	LP03
HDSA	Dermatofibrosarcoma Protuberance	Uni-ZAP XR	LP03
HMWA HMWB HMWC HMWD	Bone Marrow Cell Line (RS4; 11)	Uni-ZAP XR	LP03
HMWE HMWF HMWG HMWH
HMWI HMWJ
HSOA	stomach cancer (human)	Uni-ZAP XR	LP03
HERA	SKIN	Uni-ZAP XR	LP03
HMDA	Brain-medulloblastoma	Uni-ZAP XR	LP03
HGLA HGLB HGLD	Glioblastoma	Uni-ZAP XR	LP03
HEAA	H. Atrophic Endometrium	Uni-ZAP XR	LP03
HBCA HBCB	H. Lymph node breast Cancer	Uni-ZAP XR	LP03
HPWT	Human Prostate BPH, re-excision	Uni-ZAP XR	LP03
HFVG HFVH HFVI	Fetal Liver, subtraction II	pBS	LP03
HNFI	Human Neutrophils, Activated, re-	pBS	LP03
	excision
HBMB HBMC HBMD	Human Bone Marrow, re-excision	pBS	LP03
HKML HKMM HKMN	H. Kidney Medulla, re-excision	pBS	LP03
HKIX HKIY	H. Kidney Cortex, subtracted	pBS	LP03
HADT	H. Amygdala Depression, subtracted	pBS	LP03
H6AS	HI-60, untreated, subtracted	Uni-ZAP XR	LP03
H6ES	HL-60, PMA 4H, subtracted	Uni-ZAP XR	LP03
H6BS	HL-60, RA 4 h, Subtracted	Uni-ZAP XR	LP03
H6CS	HL-60, PMA 1d, subtracted	Uni-ZAP XR	LP03
HTXJ HTXK	Activated T-cell(12 h)/Thiouridine-re-	Uni-ZAP XR	LP03
	excision
HMSA HMSB HMSC HMSD	Monocyte activated	Uni-ZAP XR	LP03
HMSE HMSF HMSG HMSH
HMSI HMSJ HMSK
HAGA HAGB HAGC HAGD	Human Amygdala	Uni-ZAP XR	LP03
HAGE HAGF
HSRA HSRB HSRE	STROMAL-OSTEOCLASTOMA	Uni-ZAP XR	LP03
HSRD HSRF HSRG HSRH	Human Osteoclastoma Stromal Cells -	Uni-ZAP XR	LP03
	unamplified
HSQA HSQB HSQC HSQD	Stromal cell TF274	Uni-ZAP XR	LP03
HSQE HSQF HSQG
HSKA HSKB HSKC HSKD	Smooth muscle, serum treated	Uni-ZAP XR	LP03
HSKE HSKF HSKZ
HSLA HSLB HSLC HSLD HSLE	Smooth muscle, control	Uni-ZAP XR	LP03
HSLF HSLG
HSDA HSDD HSDE HSDF	Spinal cord	Uni-ZAP XR	LP03
HSDG HSDH
HPWS	Prostate-BPH subtracted II	pBS	LP03
HSKW HSKX HSKY	Smooth Muscle- HASTE normalized	pBS	LP03
HFPB HFPC HFPD	H. Frontal cortex, epileptic; re-excision	Uni-ZAP XR	LP03
HSDI HSDJ HSDK	Spinal Cord, re-excision	Uni-ZAP XR	LP03
HSKN HSKO	Smooth Muscle Serum Treated, Norm	pBS	LP03
HSKG HSKH HSKI	Smooth muscle, serum induced, re-exc	pBS	LP03
HFCA HFCB HFCC HFCD HFCE	Human Fetal Brain	Uni-ZAP XR	LP04
HFCF
HPTA HPTB HPTD	Human Pituitary	Uni-ZAP XR	LP04
HTHB HTHC HTHD	Human Thymus	Uni-ZAP XR	LP04
HE6B HE6C HE6D HE6E HE6F	Human Whole Six Week Old Embryo	Uni-ZAP XR	LP04
HE6G HE6S
HSSA HSSB HSSC HSSD HSSE	Human Synovial Sarcoma	Uni-ZAP XR	LP04
HSSF HSSG HSSH HSSI HSSJ
HSSK
HE7T	7 Week Old Early Stage Human,	Uni-ZAP XR	LP04
	subtracted
HEPA HEPB HEPC	Human Epididymus	Uni-ZAP XR	LP04
HSNA HSNB HSNC HSNM	Human Synovium	Uni-ZAP XR	LP04
HSNN
HPFB HPFC HPFD HPFE	Human Prostate Cancer, Stage C	Uni-ZAP XR	LP04
	fraction
HE2A HE2D HE2E HE2H HE2I	12 Week Old Early Stage Human	Uni-ZAP XR	LP04
HE2M HE2N HE2O
HE2B HE2C HE2F HE2G HE2P	12 Week Old Early Stage Human, II	Uni-ZAP XR	LP04
HE2Q
HPTS HPTT HPTU	Human Pituitary, subtracted	Uni-ZAP XR	LP04
HAUA HAUB HAUC	Amniotic Cells - TNF induced	Uni-ZAP XR	LP04
HAQA HAQB HAQC HAQD	Amniotic Cells - Primary Culture	Uni-ZAP XR	LP04
HWTA HWTB HWTC	wilm's tumor	Uni-ZAP XR	LP04
HBSD	Bone Cancer, re-excision	Uni-ZAP XR	LP04
HSGB	Salivary gland, re-excision	Uni-ZAP XR	LP04
HSJA HSJB HSJC	Smooth muscle-ILb induced	Uni-ZAP XR	LP04
HSXA HSXB HSXC HSXD	Human Substantia Nigra	Uni-ZAP XR	LP04
HSHA HSHB HSHC	Smooth muscle, IL1b induced	Uni-ZAP XR	LP04
HOUA HOUB HOUC HOUD	Adipocytes	Uni-ZAP XR	LP04
HOUE
HPWA HPWB HPWC HPWD	Prostate BPH	Uni-ZAP XR	LP04
HPWE
HELA HELB HELC HELD HELE	Endothelial cells-control	Uni-ZAP XR	LP04
HELF HELG HELH
HEMA HEMB HEMC HEMD	Endothelial-induced	Uni-ZAP XR	LP04
HEME HEMF HEMG HEMH
HBIA HBIB HBIC	Human Brain, Striatum	Uni-ZAP XR	LP04
HHSA HHSB HHSC HHSD	Human Hypothalmus, Schizophrenia	Uni-ZAP XR	LP04
HHSE
HNGA HNGB HNGC HNGD	neutrophils control	Uni-ZAP XR	LP04
HNGE HNGF HNGG HNGH
HNGI HNGJ
HNHA HNHB HNHC HNHD	Neutrophils IL-1 and LPS induced	Uni-ZAP XR	LP04
HNHE HNHF HNHG HNHH
HNHI HNHJ
HSDB HSDC	STRIATUM DEPRESSION	Uni-ZAP XR	LP04
HHPT	Hypothalamus	Uni-ZAP XR	LP04
HSAT HSAU HSAV HSAW	Anergic T-cell	Uni-ZAP XR	LP04
HSAX HSAY HSAZ
HBMS HBMT HBMU HBMV	Bone marrow	Uni-ZAP XR	LP04
HBMW HBMX
HOEA HOEB HOEC HOED	Osteoblasts	Uni-ZAP XR	LP04
HOEE HOEF HOEJ
HAIA HAIB HAIC HAID HAIE	Epithelial-TNFa and INF induced	Uni-ZAP XR	LP04
HAIF
HTGA HTGB HTGC HTGD	Apoptotic T-cell	Uni-ZAP XR	LP04
HMCA HMCB HMCC HMCD	Macrophage-oxLDL	Uni-ZAP XR	LP04
HMCE
HMAA HMAB HMAC HMAD	Macrophage (GM-CSF treated)	Uni-ZAP XR	LP04
HMAE HMAF HMAG
HPHA	Normal Prostate	Uni-ZAP XR	LP04
HPIA HPIB HPIC	LNCAP prostate cell line	Uni-ZAP XR	LP04
HPJA HPJB HPJC	PC3 Prostate cell line	Uni-ZAP XR	LP04
HOSE HOSF HOSG	Human Osteoclastoma, re-excision	Uni-ZAP XR	LP04
HTGE HTGF	Apoptotic T-cell, re-excision	Uni-ZAP XR	LP04
HMAJ HMAK	H Macrophage (GM-CSF treated), re-	Uni-ZAP XR	LP04
	excision
HACB HACC HACD	Human Adipose Tissue, re-excision	Uni-ZAP XR	LP04
HFPA	H. Frontal Cortex, Epileptic	Uni-ZAP XR	LP04
HFAA HFAB HFAC HFAD	Alzheimers, spongy change	Uni-ZAP XR	LP04
HFAE
HFAM	Frontal Lobe, Dementia	Uni-ZAP XR	LP04
HMIA HMIB HMIC	Human Manic Depression Tissue	Uni-ZAP XR	LP04
HTSA HTSE HTSF HTSG HTSH	Human Thymus	pBS	LP05
HPBA HPBB HPBC HPBD HPBE	Human Pineal Gland	pBS	LP05
HSAA HSAB HSAC	HSA 172 Cells	pBS	LP05
HSBA HSBB HSBC HSBM	HSC172 cells	pBS	LP05
HJAA HJAB HJAC HJAD	Jurkat T-cell G1 phase	pBS	LP05
HJBA HJBB HJBC HJBD	Jurkat T-Cell, S phase	pBS	LP05
HAFA HAFB	Aorta endothelial cells + TNF-a	pBS	LP05
HAWA HAWB HAWC	Human White Adipose	pBS	LP05
HTNA HTNB	Human Thyroid	pBS	LP05
HONA	Normal Ovary, Premenopausal	pBS	LP05
HARA HARB	Human Adult Retina	pBS	LP05
HLJA HLJB	Human Lung	pCMVSport 1	LP06
HOFM HOFN HOFO	H. Ovarian Tumor, II, OV5232	pCMVSport 2.0	LP07
HOGA HOGB HOGC	OV 10-3-95	pCMVSport 2.0	LP07
HCGL	CD34+ cells, II	pCMVSport 2.0	LP07
HDLA	Hodgkin's Lymphoma I	pCMVSport 2.0	LP07
HDTA HDTB HDTC HDTD	Hodgkin's Lymphoma II	pCMVSport 2.0	LP07
HDTE
HKAA HKAB HKAC HKAD	Keratinocyte	pCMVSport 2.0	LP07
HKAE HKAF HKAG HKAH
HCIM	CAPFINDER, Crohn's Disease, lib 2	pCMVSport 2.0	LP07
HKAL	Keratinocyte, lib 2	pCMVSport 2.0	LP07
HKAT	Keratinocyte, lib 3	pCMVSport 2.0	LP07
HNDA	Nasal polyps	pCMVSport 2.0	LP07
HDRA	H Primary Dendritic Cells, lib 3	pCMVSport 2.0	LP07
HOHA HOHB HOHC	Human Osteoblasts II	pCMVSport 2.0	LP07
HLDA HLDB HLDC	Liver, Hepatoma	pCMVSport 3.0	LP08
HLDN HLDO HLDP	Human Liver, normal	pCMVSport 3.0	LP08
HMTA	pBMC stimulated w/poly I/C	pCMVSport 3.0	LP08
HNTA	NTERA2, control	pCMVSport 3.0	LP08
HDPA HDPB HDPC HDPD	Primary Dendritic Cells, lib 1	pCMVSport 3.0	LP08
HDPF HDPG HDPH HDPI HDPJ
HDPK
HDPM HDPN HDPO HDPP	Primary Dendritic cells, frac 2	pCMVSport 3.0	LP08
HMUA HMUB HMUC	Myoloid Progenitor Cell Line	pCMVSport 3.0	LP08
HHEA HHEB HHEC HHED	T Cell helper I	pCMVSport 3.0	LP08
HHEM HHEN HHEO HHEP	T cell helper II	pCMVSport 3.0	LP08
HEQA HEQB HEQC	Human endometrial stromal cells	pCMVSport 3.0	LP08
HJMA HJMB	Human endometrial stromal cells-	pCMVSport 3.0	LP08
	treated with progesterone
HSWA HSWB HSWC	Human endometrial stromal cells-	pCMVSport 3.0	LP08
	treated with estradiol
HSYA HSYB HSYC	Human Thymus Stromal Cells	pCMVSport 3.0	LP08
HLWA HLWB HLWC	Human Placenta	pCMVSport 3.0	LP08
HRAA HRAB HRAC	Rejected Kidney, lib 4	pCMVSport 3.0	LP08
HMTM	PCR, pBMC I/C treated	PCRII	LP09
HMJA	H. Meniingima, M6	pSport 1	LP10
HMKA HMKB HMKC HMKD	H. Meningima, M1	pSport 1	LP10
HMKE
HUSG HUSI	Human umbilical vein endothelial cells,	pSport 1	LP10
	IL-4 induced
HUSX HUSY	Human Umbilical Vein Endothelial	pSport 1	LP10
	Cells, uninduced
HOFA	Ovarian Tumor I, OV5232	pSport 1	LP10
HCFA HCFB HCFC HCFD	T-Cell PHA 16 hrs	pSport 1	LP10
HCFL HCFM HCFN HCFO	T-Cell PHA 24 hrs	pSport 1	LP10
HADA HADC HADD HADE	Human Adipose	pSport 1	LP10
HADF HADG
HOVA HOVB HOVC	Human Ovary	pSport 1	LP10
HTWB HTWC HTWD HTWE	Resting T-Cell Library, II	pSport 1	LP10
HTWF
HMMA	Spleen metastic melanoma	pSport 1	LP10
HLYA HLYB HLYC HLYD	Spleen, Chronic lymphocytic leukemia	pSport 1	LP10
HLYE
HCGA	CD34+ cell, I	pSport 1	LP10
HEOM HEON	Human Eosinophils	pSport 1	LP10
HTDA	Human Tonsil, Lib 3	pSport 1	LP10
HSPA	Salivary Gland, Lib 2	pSport 1	LP10
HCHA HCHB HCHC	Breast Cancer cell line, MDA 36	pSport 1	LP10
HCHM HCHN	Breast Cancer Cell line, angiogenic	pSport 1	LP10
HCIA	Crohn's Disease	pSport 1	LP10
HDAA HDAB HDAC	HEL cell line	pSport 1	LP10
HABA	Human Astrocyte	pSport 1	LP10
HUFA HUFB HUFC	Ulcerative Colitis	pSport 1	LP10
HNTM	NTERA2 + retinoic acid, 14 days	pSport 1	LP10
HDQA	Primary Dendritic cells, CapFinder2,	pSport 1	LP10
	frac 1
HDQM	Primary Dendritic Cells, CapFinder,	pSport 1	LP10
	frac 2
HLDX	Human Liver,	pSport 1	LP10
	normal, CapFinder
HULA HULB HULC	Human Dermal Endothelial	pSport 1	LP10
	Cells, untreated
HUMA	Human Dermal Endothelial cells, treated	pSport 1	LP10
HCJA	Human Stromal Endometrial	pSport 1	LP10
	fibroblasts, untreated
HCJM	Human Stromal endometrial fibroblasts,	pSport 1	LP10
	treated w/estradiol
HEDA	Human Stromal endometrial fibroblasts,	pSport 1	LP10
	treated with progesterone
HFNA	Human ovary tumor cell OV350721	pSport 1	LP10
HKGA HKGB HKGC HKGD	Merkel Cells	pSport 1	LP10
HISA HISB HISC	Pancreas Islet Cell Tumor	pSport 1	LP10
HLSA	Skin, burned	pSport 1	LP10
HBZA	Prostate, BPH, Lib 2	pSport 1	LP10
HBZS	Prostate BPH, Lib 2, subtracted	pSport 1	LP10
HFIA HFIB HFIC	Synovial Fibroblasts (control)	pSport 1	LP10
HFIH HFII HFIJ	Synovial hypoxia	pSport 1	LP10
HFIT HFIU HFIV	Synovial IL-1/TNF stimulated	pSport 1	LP10
HGCA	Messangial cell, frac 1	pSport 1	LP10
HMVA HMVB HMVC	Bone Marrow Stromal Cell, untreated	pSport 1	LP10
HFIX HFIY HFIZ	Synovial Fibroblasts (I11/TNF), subt	pSport 1	LP10
HFOX HFOY HFOZ	Synovial hypoxia-RSF subtracted	pSport 1	LP10
HMQA HMQB HMQC HMQD	Human Activated Monocytes	Uni-ZAP XR	LP11
HLIA HLIB HLIC	Human Liver	pCMVSport 1	LP012
HHBA HHBB HHBC HHBD	Human Heart	pCMVSport 1	LP012
HHBE
HBBA HBBB	Human Brain	pCMVSport 1	LP012
HLJA HLJB HLJC HLJD HLJE	Human Lung	pCMVSport 1	LP012
HOGA HOGB HOGC	Ovarian Tumor	pCMVSport 2.0	LP012
HTJM	Human Tonsils, Lib 2	pCMVSport 2.0	LP012
HAMF HAMG	KMH2	pCMVSport 3.0	LP012
HAJA HAJB HAJC	L428	pCMVSport 3.0	LP012
HWBA HWBB HWBC HWBD	Dendritic cells, pooled	pCMVSport 3.0	LP012
HWBE
HWAA HWAB HWAC HWAD	Human Bone Marrow, treated	pCMVSport 3.0	LP012
HWAE
HYAA HYAB HYAC	B Cell lymphoma	pCMVSport 3.0	LP012
HWHG HWHH HWHI	Healing groin wound, 6.5 hours post	pCMVSport 3.0	LP012
	incision
HWHP HWHQ HWHR	Healing groin wound; 7.5 hours post	pCMVSport 3.0	LP012
	incision
HARM	Healing groin wound - zero hr post-	pCMVSport 3.0	LP012
	incision (control)
HBIM	Olfactory epithelium; nasalcavity	pCMVSport 3.0	LP012
HWDA	Healing Abdomen wound; 70&90 min	pCMVSport 3.0	LP012
	post incision
HWEA	Healing Abdomen Wound; 15 days post	pCMVSport 3.0	LP012
	incision
HWJA	Healing Abdomen Wound; 21&29 days	pCMVSport 3.0	LP012
HNAL	Human Tongue, frac 2	pSport 1	LP012
HMJA	H. Meniingima, M6	pSport 1	LP012
HMKA HMKB HMKC HMKD	H. Meningima, M1	pSport 1	LP012
HMKE
HOFA	Ovarian Tumor I, OV5232	pSport 1	LP012
HCFA HCFB HCFC HCFD	T-Cell PHA 16 hrs	pSport 1	LP012
HCFL HCFM HCFN HCFO	T-Cell PHA 24 hrs	pSport 1	LP012
HMMA HMMB HMMC	Spleen metastic melanoma	pSport 1	LP012
HTDA	Human Tonsil, Lib 3	pSport 1	LP012
HDBA	Human Fetal Thymus	pSport 1	LP012
HDUA	Pericardium	pSport 1	LP012
HBZA	Prostate, BPH, Lib 2	pSport 1	LP012
HWCA	Larynx tumor	pSport 1	LP012
HWKA	Normal lung	pSport 1	LP012
HSMB	Bone marrow stroma, treated	pSport 1	LP012
HBHM	Normal trachea	pSport 1	LP012
HLFC	Human Larynx	pSport 1	LP012
HLRB	Siebben Polyposis	pSport 1	LP012
HNIA	Mammary Gland	pSport 1	LP012
HNJB	Palate carcinoma	pSport 1	LP012
HNKA	Palate normal	pSport 1	LP012
HMZA	Pharynx carcinoma	pSport 1	LP012
HABG	Cheek Carcinoma	pSport 1	LP012
HMZM	Pharynx Carcinoma	pSport 1	LP012
HDRM	Larynx Carcinoma	pSport 1	LP012
HVAA	Pancreas normal PCA4 No	pSport 1	LP012
HICA	Tongue carcinoma	pSport 1	LP012
HUKA HUKB HUKC HUKD	Human Uterine Cancer	Lambda ZAP II	LP013
HUKE
HFFA	Human Fetal Brain, random primed	Lambda ZAP II	LP013
HTUA	Activated T-cell labeled with 4-thioluri	Lambda ZAP II	LP013
HBQA	Early Stage Human Brain, random	Lambda ZAP II	LP013
	primed
HMEB	Human microvascular Endothelial cells,	Lambda ZAP II	LP013
	fract. B
HUSH	Human Umbilical Vein Endothelial	Lambda ZAP II	LP013
	cells, fract. A, re-excision
HLQC HLQD	Hepatocellular tumor, re-excision	Lambda ZAP II	LP013
HTWJ HTWK HTWL	Resting T-cell, re-excision	Lambda ZAP II	LP013
HF6S	Human Whole 6 week Old Embryo (II),	pBluescript	LP013
	subt
HHPS	Human Hippocampus, subtracted	pBluescript	LP013
HL1S	LNCAP, differential expression	pBluescript	LP013
HLHS HLHT	Early Stage Human Lung, Subtracted	pBluescript	LP013
HSUS	Supt cells, cyclohexamide treated,	pBluescript	LP013
	subtracted
HSUT	Supt cells, cyclohexamide treated,	pBluescript	LP013
	differentially expressed
HSDS	H. Striatum Depression, subtracted	pBluescript	LP013
HPTZ	Human Pituitary, Subtracted VII	pBluescript	LP013
HSDX	H. Striatum Depression, subt II	pBluescript	LP013
HSDZ	H. Striatum Depression, subt	pBluescript	LP013
HPBA HPBB HPBC HPBD HPBE	Human Pineal Gland	pBluescript SK-	LP013
HRTA	Colorectal Tumor	pBluescript SK-	LP013
HSBA HSBB HSBC HSBM	HSC172 cells	pBluescript SK-	LP013
HJAA HJAB HJAC HJAD	Jurkat T-cell G1 phase	pBluescript SK-	LP013
HJBA HJBB HJBC HJBD	Jurkat T-cell, S1 phase	pBluescript SK-	LP013
HTNA HTNB	Human Thyroid	pBluescript SK-	LP013
HAHA HAHB	Human Adult Heart	Uni-ZAP XR	LP013
HE6A	Whole 6 week Old Embryo	Uni-ZAP XR	LP013
HFCA HFCB HFCC HFCD HFCE	Human Fetal Brain	Uni-ZAP XR	LP013
HFKC HFKD HFKE HFKF	Human Fetal Kidney	Uni-ZAP XR	LP013
HFKG
HGBA HGBD HGBE HGBF	Human Gall Bladder	Uni-ZAP XR	LP013
HGBG
HPRA HPRB HPRC HPRD	Human Prostate	Uni-ZAP XR	LP013
HTEA HTEB HTEC HTED HTEE	Human Testes	Uni-ZAP XR	LP013
HTTA HTTB HTTC HTTD HTTE	Human Testes Tumor	Uni-ZAP XR	LP013
HYBA HYBB	Human Fetal Bone	Uni-ZAP XR	LP013
HFLA	Human Fetal Liver	Uni-ZAP XR	LP013
HHFB HHFC HHFD HHFE HHFF	Human Fetal Heart	Uni-ZAP XR	LP013
HUVB HUVC HUVD HUVE	Human Umbilical Vein, End remake	Uni-ZAP XR	LP013
HTHB HTHC HTHD	Human Thymus	Uni-ZAP XR	LP013
HSTA HSTB HSTC HSTD	Human Skin Tumor	Uni-ZAP XR	LP013
HTAA HTAB HTAC HTAD	Human Activated T-cells	Uni-ZAP XR	LP013
HTAE
HFEA HFEB HFEC	Human Fetal Epithelium (skin)	Uni-ZAP XR	LP013
HJPA HJPB HJPC HJPD	Human Jurkat Membrane Bound	Uni-ZAP XR	LP013
	Polysomes
HESA	Human Epithelioid Sarcoma	Uni-ZAP XR	LP013
HALS	Human Adult Liver, Subtracted	Uni-ZAP XR	LP013
HFTA HFTB HFTC HFTD	Human Fetal Dura Mater	Uni-ZAP XR	LP013
HCAA HCAB HCAC	Cem cells, cyclohexamide treated	Uni-ZAP XR	LP013
HRGA HRGB HRGC HRGD	Raji Cells, cyclohexamide treated	Uni-ZAP XR	LP013
HE9A HE9B HE9C HE9D HE9E	Nine Week Old Early Stage Human	Uni-ZAP XR	LP013
HSFA	Human Fibrosarcoma	Uni-ZAP XR	LP013
HATA HATB HATC HATD	Human Adrenal Gland Tumor	Uni-ZAP XR	LP013
HATE
HTRA	Human Trachea Tumor	Uni-ZAP XR	LP013
HE2A HE2D HE2E HE2H HE2I	12 Week Old Early Stage Human	Uni-ZAP XR	LP013
HE2B HE2C HE2F HE2G HE2P	12 Week Old Early Stage Human, II	Uni-ZAP XR	LP013
HNEA HNEB HNEC HNED	Human Neutrophil	Uni-ZAP XR	LP013
HNEE
HBGA	Human Primary Breast Cancer	Uni-ZAP XR	LP013
HPTS HPTT HPTU	Human Pituitary, subtracted	Uni-ZAP XR	LP013
HMQA HMQB HMQC HMQD	Human Activated Monocytes	Uni-ZAP XR	LP013
HOAA HOAB HOAC	Human Osteosarcoma	Uni-ZAP XR	LP013
HTOA HTOD HTOE HTOF	human tonsils	Uni-ZAP XR	LP013
HTOG
HMGB	Human OB MG63 control fraction I	Uni-ZAP XR	LP013
HOPB	Human OB HOS control fraction I	Uni-ZAP XR	LP013
HOQB	Human OB HOS treated (1 nM E2)	Uni-ZAP XR	LP013
	fraction I
HAUA HAUB HAUC	Amniotic Cells - TNF induced	Uni-ZAP XR	LP013
HAQA HAQB HAQC HAQD	Amniotic Cells - Primary Culture	Uni-ZAP XR	LP013
HROA HROC	HUMAN STOMACH	Uni-ZAP XR	LP013
HBJA HBJB HBJC HBJD HBJE	HUMAN B CELL LYMPHOMA	Uni-ZAP XR	LP013
HODA HODB HODC HODD	human ovarian cancer	Uni-ZAP XR	LP013
HCPA	Corpus Callosum	Uni-ZAP XR	LP013
HSOA	stomach cancer (human)	Uni-ZAP XR	LP013
HERA	SKIN	Uni-ZAP XR	LP013
HMDA	Brain-medulloblastoma	Uni-ZAP XR	LP013
HGLA HGLB HGLD	Glioblastoma	Uni-ZAP XR	LP013
HWTA HWTB HWTC	wilm's tumor	Uni-ZAP XR	LP013
HEAA	H. Atrophic Endometrium	Uni-ZAP XR	LP013
HAPN HAPO HAPP HAPQ	Human Adult Pulmonary; re-excision	Uni-ZAP XR	LP013
HAPR
HLTG HLTH	Human T-cell lymphoma; re-excision	Uni-ZAP XR	LP013
HAHC HAHD HAHE	Human Adult Heart; re-excision	Uni-ZAP XR	LP013
HAGA HAGB HAGC HAGD	Human Amygdala	Uni-ZAP XR	LP013
HAGE
HSJA HSJB HSJC	Smooth muscle-ILb induced	Uni-ZAP XR	LP013
HSHA HSHB HSHC	Smooth muscle, IL1b induced	Uni-ZAP XR	LP013
HPWA HPWB HPWC HPWD	Prostate BPH	Uni-ZAP XR	LP013
HPWE
HPIA HPIB HPIC	LNCAP prostate cell line	Uni-ZAP XR	LP013
HPJA HPJB HPJC	PC3 Prostate cell line	Uni-ZAP XR	LP013
HBTA	Bone Marrow Stroma, TNF&LPS ind	Uni-ZAP XR	LP013
HMCF HMCG HMCH HMCI	Macrophage-oxLDL; re-excision	Uni-ZAP XR	LP013
HMCJ
HAGG HAGH HAGI	Human Amygdala; re-excision	Uni-ZAP XR	LP013
HACA	H. Adipose Tissue	Uni-ZAP XR	LP013
HKFB	K562 + PMA (36 hrs), re-excision	ZAP Express	LP013
HCWT HCWU HCWV	CD34 positive cells (cord blood), re-ex	ZAP Express	LP013
HBWA	Whole brain	ZAP Express	LP013
HBXA HBXB HBXC HBXD	Human Whole Brain #2 - Oligo dT >	ZAP Express	LP013
	1.5 Kb
HAVM	Temporal cortex-Alzheizmer	pT-Adv	LP014
HAVT	Hippocampus, Alzheimer Subtracted	pT-Adv	LP014
HHAS	CHME Cell Line	Uni-ZAP XR	LP014
HAJR	Larynx normal	pSport 1	LP014
HWLE HWLF HWLG HWLH	Colon Normal	pSport 1	LP014
HCRM HCRN HCRO	Colon Carcinoma	pSport 1	LP014
HWLI HWLJ HWLK	Colon Normal	pSport 1	LP014
HWLQ HWLR HWLS HWLT	Colon Tumor	pSport 1	LP014
HBFM	Gastrocnemius Muscle	pSport 1	LP014
HBOD HBOE	Quadriceps Muscle	pSport 1	LP014
HBKD HBKE	Soleus Muscle	pSport 1	LP014
HCCM	Pancreatic Langerhans	pSport 1	LP014
HWGA	Larynx carcinoma	pSport 1	LP014
HWGM HWGN	Larynx carcinoma	pSport 1	LP014
HWLA HWLB HWLC	Normal colon	pSport 1	LP014
HWLM HWLN	Colon Tumor	pSport 1	LP014
HVAM HVAN HVAO	Pancreas Tumor	pSport 1	LP014
HWGQ	Larynx carcinoma	pSport 1	LP014
HAQM HAQN	Salivary Gland	pSport 1	LP014
HASM	Stomach; normal	pSport 1	LP014
HBCM	Uterus; normal	pSport 1	LP014
HCDM	Testis; normal	pSport 1	LP014
HDJM	Brain; normal	pSport 1	LP014
HEFM	Adrenal Gland, normal	pSport 1	LP014
HBAA	Rectum normal	pSport 1	LP014
HFDM	Rectum tumor	pSport 1	LP014
HGAM	Colon, normal	pSport 1	LP014
HHMM	Colon, tumor	pSport 1	LP014
HCLB HCLC	Human Lung Cancer	Lambda Zap II	LP015
HRLA	L1 Cell line	ZAP Express	LP015
HHAM	Hypothalamus, Alzheimer's	pCMVSport 3.0	LP015
HKBA	Ku 812F Basophils Line	pSport 1	LP015
HS2S	Saos2, Dexamethosome Treated	pSport 1	LP016
HA5A	Lung Carcinoma A549 TNFalpha	pSport 1	LP016
	activated
HTFM	TF-1 Cell Line GM-CSF Treated	pSport 1	LP016
HYAS	Thyroid Tumor	pSport 1	LP016
HUTS	Larynx Normal	pSport 1	LP016
HXOA	Larynx Tumor	pSport 1	LP016
HEAH	Ea.hy.926 cell line	pSport 1	LP016
HINA	Adenocarcinoma Human	pSport 1	LP016
HRMA	Lung Mesothelium	pSport 1	LP016
HLCL	Human Pre-Differentiated Adipocytes	Uni-Zap XR	LP017
HS2A	Saos2 Cells	pSport 1	LP020
HS2I	Saos2 Cells; Vitamin D3 Treated	pSport 1	LP020
HUCM	CHME Cell Line, untreated	pSport 1	LP020
HEPN	Aryepiglottis Normal	pSport 1	LP020
HPSN	Sinus Piniformis Tumor	pSport 1	LP020
HNSA	Stomach Normal	pSport 1	LP020
HNSM	Stomach Tumor	pSport 1	LP020
HNLA	Liver Normal Met5No	pSport 1	LP020
HUTA	Liver Tumor Met 5 Tu	pSport 1	LP020
HOCN	Colon Normal	pSport 1	LP020
HOCT	Colon Tumor	pSport 1	LP020
HTNT	Tongue Tumor	pSport 1	LP020
HLXN	Larynx Normal	pSport 1	LP020
HLXT	Larynx Tumor	pSport 1	LP020
HTYN	Thymus	pSport 1	LP020
HPLN	Placenta	pSport 1	LP020
HTNG	Tongue Normal	pSport 1	LP020
HZAA	Thyroid Normal (SDCA2 No)	pSport 1	LP020
HWES	Thyroid Thyroiditis	pSport 1	LP020
HFHD	Ficolled Human Stromal Cells, 5Fu	pTrip1Ex2	LP021
	treated
HFHM,HFHN	Ficolled Human Stromal Cells,	pTrip1Ex2	LP021
	Untreated
HPCI	Hep G2 Cells, lambda library	lambda Zap-CMV	LP021
		XR
HBCA,HBCB,HBCC	H. Lymph node breast Cancer	Uni-ZAP XR	LP021
HCOK	Chondrocytes	pSport 1	LP022
HDCA, HDCB, HDCC	Dendritic Cells From CD34 Cells	pSport 1	LP022
HDMA, HDMB	CD40 activated monocyte dendritic	pSport 1	LP022
	cells
HDDM, HDDN, HDDO	LPS activated derived dendritic cells	pSport 1	LP022
HPCR	Hep G2 Cells, PCR library	lambda Zap-CMV	LP022
		XR
HAAA, HAAB, HAAC	Lung, Cancer (4005313A3): Invasive	pSport 1	LP022
	Poorly Differentiated Lung
	Adenocarcinoma
HIPA, HIPB, HIPC	Lung, Cancer (4005163 B7): Invasive,	pSport 1	LP022
	Poorly Diff. Adenocarcinoma,
	Metastatic
HOOH, HOOI	Ovary, Cancer: (4004562 B6) Papillary	pSport 1	LP022
	Serous Cystic Neoplasm, Low
	Malignant Pot
HIDA	Lung, Normal: (4005313 B1)	pSport 1	LP022
HUJA,HUJB,HUJC,HUJD,HUJE	B-Cells	pCMVSport 3.0	LP022
HNOA,HNOB,HNOC,HNOD	Ovary, Normal. (9805C040R)	pSport 1	LP022
HNLM	Lung, Normal. (4005313 B1)	pSport 1	LP022
HSCL	Stromal Cells	pSport 1	LP022
HAAX	Lung, Cancer: (4005313 A3) Invasive	pSport 1	LP022
	Poorly-differentiated Metastatic lung
	adenocarcinoma
HUUA,HUUB,HUUC,HUUD	B-cells (unstimulated)	pTrip1Ex2	LP022
HWWA,HWWB,HWWC,HWWD,	B-cells (stimulated)	pSport 1	LP022
HWWE,HWWF,HWWG
HCCC	Colon, Cancer: (9808C064R)	pCMVSport 3.0	LP023
HPDO HPDP HPDQ HPDR HPD	Ovary, Cancer (9809C332): Poorly	pSport 1	LP023
	differentiated adenocarcinoma
HPCO HPCP HPCQ HPCT	Ovary, Cancer (15395A1F): Grade II	pSport 1	LP023
	Papillary Carcinoma
HOCM HOCO HOCP HOCQ	Ovary, Cancer: (15799A1F) Poorly	pSport 1	LP023
	differentiated carcinoma
HCBM HCBN HCBO	Breast, Cancer: (4004943 A5)	pSport 1	LP023
HNBT HNBU HNBV	Breast, Normal: (4005522B2)	pSport 1	LP023
HBCP HBCQ	Breast, Cancer: (4005522 A2)	pSport 1	LP023
HBCJ	Breast, Cancer: (9806C012R)	pSport 1	LP023
HSAM HSAN	Stromal cells 3.88	pSport 1	LP023
HVCA HVCB HVCC HVCD	Ovary, Cancer: (4004332 A2)	pSport 1	LP023
HSCK HSEN HSEO	Stromal cells (HBM3 18)	pSport 1	LP023
HSCP HSCQ	stromal cell clone 2.5	pSport 1	LP023
HUXA	Breast Cancer: (4005385 A2)	pSport 1	LP023
HCOM HCON HCOO HCOP	Ovary, Cancer (4004650 A3): Well-	pSport 1	LP023
HCOQ	Differentiated Micropapillary Serous
	Carcinoma
HBNM	Breast, Cancer: (9802C020E)	pSport 1	LP023
HVVA HVVB HVVC HVVD	Human Bone Marrow, treated	pSport 1	LP023
HVVE

[0940] Two nonlimiting examples are provided below for isolating a particular clone from the deposited sample of plasmid cDNAs cited for that clone in Table 7. First, a plasmid is directly isolated by screening the clones using a polynucleotide probe corresponding to the nucleotide sequence of SEQ ID NO:X.

[0941] Particularly, a specific polynucleotide with 30-40 nucleotides is synthesized using an Applied Biosystems DNA synthesizer according to the sequence reported. The oligonucleotide is labeled, for instance, with 32P-γ-ATP using T4 polynucleotide kinase and purified according to routine methods. (E.g., Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring, N.Y. (1982).) The plasmid mixture is transformed into a suitable host, as indicated above (such as XL-1 Blue (Stratagene)) using techniques known to those of skill in the art, such as those provided by the vector supplier or in related publications or patents cited above. The transformants are plated on 1.5% agar plates (containing the appropriate selection agent, e.g., ampicillin) to a density of about 150 transformants (colonies) per plate. These plates are screened using Nylon membranes according to routine methods for bacterial colony screening (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edit., (1989), Cold Spring Harbor Laboratory Press, pages 1.93 to 1.104), or other techniques known to those of skill in the art.

[0942] Alternatively, two primers of 17-20 nucleotides derived from both ends of the nucleotide sequence of SEQ ID NO:X are synthesized and used to amplify the desired cDNA using the deposited cDNA plasmid as a template. The polymerase chain reaction is carried out under routine conditions, for instance, in 25 μl of reaction mixture with 0.5 ug of the above cDNA template. A convenient reaction mixture is 1.5-5 mM MgCl2, 0.01% (w/v) gelatin, 20 μM each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase. Thirty five cycles of PCR (denaturation at 94° C. for 1 min; annealing at 55° C. for 1 min; elongation at 72° C. for 1 min) are performed with a Perkin-Elmer Cetus automated thermal cycler. The amplified product is analyzed by agarose gel electrophoresis and the DNA band with expected molecular weight is excised and purified. The PCR product is verified to be the selected sequence by subcloning and sequencing the DNA product.

[0943] Several methods are available for the identification of the 5′ or 3′ non-coding coding portions of a gene which may not be present in the deposited clone. These methods include but are not limited to, filter probing, clone enrichment using specific probes, and protocols similar or identical to 5′ and 3′ “RACE” protocols which are well known in the art. For instance, a method similar to 5′ RACE is available for generating the missing 5′ end of a desired full-length transcript. (Fromont-Racine et al., Nucleic Acids Res. 21(7):1683-1684 (1993).)

[0944] Briefly, a specific RNA oligonucleotide is ligated to the 5′ ends of a population of RNA presumably containing full-length gene RNA transcripts. A primer set containing a primer specific to the ligated RNA oligonucleotide and a primer specific to a known sequence of the gene of interest is used to PCR amplify the 5′ portion of the desired full-length gene. This amplified product may then be sequenced and used to generate the full length gene.

[0945] This above method starts with total RNA isolated from the desired source, although poly-A+ RNA can be used. The RNA preparation can then be treated with phosphatase if necessary to eliminate 5′ phosphate groups on degraded or damaged RNA which may interfere with the later RNA ligase step. The phosphatase should then be inactivated and the RNA treated with tobacco acid pyrophosphatase in order to remove the cap structure present at the 5′ ends of messenger RNAs. This reaction leaves a 5′ phosphate group at the 5′ end of the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using T4 RNA ligase.

[0946] This modified RNA preparation is used as a template for first strand cDNA synthesis using a gene specific oligonucleotide. The first strand synthesis reaction is used as a template for PCR amplification of the desired 5′ end using a primer specific to the ligated RNA oligonucleotide and a primer specific to the known sequence of the gene of interest. The resultant product is then sequenced and analyzed to confirm that the 5′ end sequence belongs to the desired gene.

Example 2

Isolation of Genomic Clones Corresponding to a Polynucleotide

[0947] A human genomic P1 library (Genomic Systems, Inc.) is screened by PCR using primers selected for the sequence corresponding to SEQ ID NO:X according to the method described in Example 1. (See also, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edn., (1989), Cold Spring Harbor Laboratory Press).

Example 3

Tissue Specific Expression Analysis

[0948] The Human Genome Sciences, Inc. (HGS) database is derived from sequencing tissue and/or disease specific cDNA libraries. Libraries generated from a particular tissue are selected and the specific tissue expression pattern of EST groups or assembled contigs within these libraries is determined by comparison of the expression patterns of those groups or contigs within the entire database. ESTs and assembled contigs which show tissue specific expression are selected.

[0949] The original clone from which the specific EST sequence was generated, or in the case of an assembled contig, the clone from which the 5′ most EST sequence was generated, is obtained from the catalogued library of clones and the insert amplified by PCR using methods known in the art. The PCR product is denatured and then transferred in 96 or 384 well format to a nylon membrane (Schleicher and Scheull) generating an array filter of tissue specific clones. Housekeeping genes, maize genes, and known tissue specific genes are included on the filters. These targets can be used in signal normalization and to validate assay sensitivity. Additional targets are included to monitor probe length and specificity of hybridization.

[0950] Radioactively labeled hybridization probes are generated by first strand cDNA synthesis per the manufacturer's instructions (Life Technologies) from mRNA/RNA samples prepared from the specific tissue being analyzed (e.g., bone, bone cancer, muscle, muscular cancer, joints, cancers of joints, tendons, cancers of tendons, prostate, prostate cancer, ovarian, ovarian cancer, etc.). The hybridization probes are purified by gel exclusion chromatography, quantitated, and hybridized with the array filters in hybridization bottles at 65° C. overnight. The filters are washed under stringent conditions and signals are captured using a Fuji phosphorimager.

[0951] Data is extracted using AIS software and following background subtraction, signal normalization is performed. This includes a normalization of filter-wide expression levels between different experimental runs. Genes that are differentially expressed in the tissue of interest are identified.

Example 4

Chromosomal Mapping of the Polynucleotides

[0952] An oligonucleotide primer set is designed according to the sequence at the 5′ end of SEQ ID NO:X. This primer preferably spans about 100 nucleotides. This primer set is then used in a polymerase chain reaction under the following set of conditions: 30 seconds, 95° C.; 1 minute, 56° C.; 1 minute, 70° C. This cycle is repeated 32 times followed by one 5 minute cycle at 70° C. Human, mouse, and hamster DNA is used as template in addition to a somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc). The reactions are analyzed on either 8% polyacrylamide gels or 3.5% agarose gels. Chromosome mapping is determined by the presence of an approximately 100 bp PCR fragment in the particular somatic cell hybrid.

Example 5

Bacterial Expression of a Polypeptide

[0953] A polynucleotide encoding a polypeptide of the present invention is amplified using PCR oligonucleotide primers corresponding to the 5′ and 3′ ends of the DNA sequence, as outlined in Example 1, to synthesize insertion fragments. The primers used to amplify the cDNA insert should preferably contain restriction sites, such as BamHI and XbaI, at the 5′ end of the primers in order to clone the amplified product into the expression vector. For example, BamHI and XbaI correspond to the restriction enzyme sites on the bacterial expression vector pQE-9. (Qiagen, Inc., Chatsworth, Calif.). This plasmid vector encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter/operator (P/O), a ribosome binding site (RBS), a 6-histidine tag (6-His), and restriction enzyme cloning sites.

[0954] The pQE-9 vector is digested with BamHI and XbaI and the amplified fragment is ligated into the pQE-9 vector maintaining the reading frame initiated at the bacterial RBS. The ligation mixture is then used to transform the E. coli strain M15/rep4 (Qiagen, Inc.) which contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis.

[0955] Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG (Isopropyl-B-D-thi.ogalacto pyranoside) is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression.

[0956] Cells are grown for an extra 3 to 4 hours. Cells are then harvested by centrifugation (20 mins at 6000×g). The cell pellet is solubilized in the chaotropic agent 6 Molar Guamidine HCl by stirring for 3-4 hours at 4° C. The cell debris is removed by centrifugation, and the supernatant containing the polypeptide is loaded onto a nickel-nitrilo-tri-acetic acid (“Ni-NTA”) affinity resin column (available from QIAGEN, Inc., supra). Proteins with a 6×His tag bind to the Ni-NTA resin with high affinity and can be purified in a simple one-step procedure (for details see: The QIAexpressionist (1995) QIAGEN, Inc., supra).

[0957] Briefly, the supernatant is loaded onto the column in 6 M guanidine-HCl, pH 8. The column is first washed with 10 volumes of 6 M guanidine-HCl, pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6, and finally the polypeptide is eluted with 6 M guanidine-HCl, pH 5.

[0958] The purified protein is then renatured by dialyzing it against phosphate-buffered saline (PBS) or 50 mM Na-acetate, pH 6 buffer plus 200 mM NaCl. Alternatively, the protein can be successfully refolded while immobilized on the Ni-NTA column. The recommended conditions are as follows: renature using a linear 6M-1M urea gradient in 500 mM NaCl, 20% glycerol, 20 mM Tris/HCl pH 7.4, containing protease inhibitors. The renaturation should be performed over a period of 1.5 hours or more. After renaturation the proteins are eluted by the addition of 250 mM imidazole. Immidazole is removed by a final dialyzing step against PBS or 50mM sodium acetate pH 6 buffer plus 200 mM NaCl. The purified protein is stored at 4° C. or frozen at −80° C.

[0959] In addition to the above expression vector, the present invention further includes an expression vector, called pHE4a (ATCC Accession Number 209645, deposited on Feb. 25, 1998) which contains phage operator and promoter elements operatively linked to a polynucleotide of the present invention. This vector contains: 1) a neomycinphosphotransferase gene as a selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter sequence, 4) two lac operator sequences, 5) a Shine-Delgamo sequence, and 6) the lactose operon repressor gene (lacIq). The origin of replication (oriC) is derived from pUC19 (LTI, Gaithersburg, Md.). The promoter and operator sequences are made synthetically.

[0960] DNA can be inserted into the pHE4a by restricting the vector with NdeI and XbaI, BamHI, XhoI, or Asp718, running the restricted product on a gel, and isolating the larger fragment (the stuffer fragment should be about 310 base pairs). The DNA insert is generated according to the PCR protocol described in Example 1, using PCR primers having restriction sites for NdeI (5′ primer) and XbaI, BamHI, XhoI, or Asp718 (3′ primer). The PCR insert is gel purified and restricted with compatible enzymes. The insert and vector are ligated according to standard protocols.

[0961] The engineered vector could easily be substituted in the above protocol to express protein in a bacterial system.

Example 6

Purification of a Polypeptide from an Inclusion Body

[0962] The following alternative method can be used to purify a polypeptide expressed in E coli when it is present in the form of inclusion bodies. Unless otherwise specified, all of the following steps are conducted at 4-10° C.

[0963] Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10° C. and the cells harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.

[0964] The cells are then lysed by passing the solution through a microfluidizer (Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The homogenate is then mixed with NaCl solution to a final concentration of 0.5 M NaCl, followed by centrifugation at 7000×g for 15 min. The resultant pellet is washed again using 0.5M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.

[0965] The resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000×g centrifugation for 15 min., the pellet is discarded and the polypeptide containing supernatant is incubated at 4° C. overnight to allow further GuHCl extraction.

[0966] Following high speed centrifugation (30,000×g) to remove insoluble particles, the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCl, 2 mM EDTA by vigorous stirring. The refolded diluted protein solution is kept at 4° C. without mixing for 12 hours prior to further purification steps.

[0967] To clarify the refolded polypeptide solution, a previously prepared tangential filtration unit equipped with 0.16 μm membrane filter with appropriate surface area (e.g., Filtron), equilibrated with 40 mM sodium acetate, pH 6.0 is employed. The filtered sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive Biosystems). The column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the same buffer, in a stepwise manner. The absorbance at 280 nm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS-PAGE.

[0968] Fractions containing the polypeptide are then pooled and mixed with 4 volumes of water. The diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins. The columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20 column is then eluted using a 10 column volume linear gradient ranging from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCl, 50 mM sodium acetate, pH 6.5. Fractions are collected under constant A280 monitoring of the effluent. Fractions containing the polypeptide (determined, for instance, by 16% SDS-PAGE) are then pooled.

[0969] The resultant polypeptide should exhibit greater than 95% purity after the above refolding and purification steps. No major contaminant bands should be observed from Commassie blue stained 16% SDS-PAGE gel when 5 μg of purified protein is loaded. The purified protein can also be tested for endotoxin/LPS contamination, and typically the LPS content is less than 0.1 ng/ml according to LAL assays.

Example 7

Cloning and Expression of a Polypeptide in a Baculovirus Expression System

[0970] In this example, the plasmid shuttle vector pA2 is used to insert a polynucleotide into a baculovirus to express a polypeptide. This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718. The polyadenylation site of the simian virus 40 (“SV40”) is used for efficient polyadenylation. For easy selection of recombinant virus, the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene. The inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable virus that express the cloned polynucleotide.

[0971] Many other baculovirus vectors can be used in place of the vector above, such as pAc373, pVL941, and pAcIMi, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in-frame AUG as required. Such vectors are described, for instance, in Luckow et al., Virology 170:31-39 (1989).

[0972] Specifically, the cDNA sequence contained in the deposited clone, including the AUG initiation codon, is amplified using the PCR protocol described in Example 1. If a naturally occurring signal sequence is used to produce the polypeptide of the present invention, the pA2 vector does not need a second signal peptide. Alternatively, the vector can be modified (pA2 GP) to include a baculovirus leader sequence, using the standard methods described in Summers et al., “A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures,” Texas Agricultural Experimental Station Bulletin No. 1555 (1987).

[0973] The amplified fragment is isolated from a 1% agarose gel using a commercially available kit (“Geneclean,” BIO 101 Inc., La Jolla, Calif.). The fragment then is digested with appropriate restriction enzymes and again purified on a 1% agarose gel.

[0974] The plasmid is digested with the corresponding restriction enzymes and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is then isolated from a 1% agarose gel using a commercially available kit (“Geneclean” BIO 101 Inc., La Jolla, Calif.).

[0975] The fragment and the dephosphorylated plasmid are ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Stratagene Cloning Systems, La Jolla, Calif.) cells are transformed with the ligation mixture and spread on culture plates. Bacteria containing the plasmid are identified by digesting DNA from individual colonies and analyzing the digestion

[0976] roduct by gel electrophoresis. The sequence of the cloned fragment is confirmed by DNA sequencing.

[0977] Five μg of a plasmid containing the polynucleotide is co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA (“BaculoGold™ baculovirus DNA”, Pharmingen, San Diego, Calif.), using the lipofection method described by Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417 (1987). One μg of BaculoGold™ virus DNA and 5 μg of the plasmid are mixed in a sterile well of a microtiter plate containing 50 μl of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, Md.). Afterwards, 10 μl Lipofectin plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is then incubated for 5 hours at 27° C. The transfection solution is then removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. Cultivation is then continued at 27° C. for four days.

[0978] After four days the supernatant is collected and a plaque assay is performed, as described by Summers and Smith, supra. An agarose gel with “Blue Gal” (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a “plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10.) After appropriate incubation, blue stained plaques are picked with the tip of a micropipettor (e.g., Eppendorf). The agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 μl of Grace's medium and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then they are stored at 4° C.

[0979] To verify the expression of the polypeptide, Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus containing the polynucleotide at a multiplicity of infection (“MOI”) of about 2. If radiolabeled proteins are desired, 6 hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, Md.). After 42 hours, 5 μCi of 35S methionine and 5 μCi 35S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then are harvested by centrifugation. The proteins in the supernatant as well as the intracellular proteins are analyzed by SDS-PAGE followed by autoradiography (if radiolabeled).

[0980] Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the produced protein.

Example 8

Expression of a Polypeptide in Mammalian Cells

[0981] The polypeptide of the present invention can be expressed in a mammalian cell. A typical mammalian expression vector contains a promoter element, which mediates the initiation of transcription of mRNA, a protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription is achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV). However, cellular elements can also be used (e.g., the human actin promoter).

[0982] Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport 3.0. Mammalian host cells that could be used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and Chinese hamster ovary (CHO) cells.

[0983] Alternatively, the polypeptide can be expressed in stable cell lines containing the polynucleotide integrated into a chromosome. The co-transfection with a selectable marker such as DHFR, gpt, neomycin, or hygromycin allows the identification and isolation of the transfected cells.

[0984] The transfected gene can also be amplified to express large amounts of the encoded protein. The DHFR (dihydrofolate reductase) marker is useful in developing cell lines that carry several hundred or even several thousand copies of the gene of interest. (See, e.g., Alt, F. W., et al., J. Biol. Chem. 253:1357-1370 (1978); Hamlin, J. L. and Ma, C., Biochem. et Biophys. Acta, 1097:107-143 (1990); Page, M. J. and Sydenham, M. A., Biotechnology 9:64-68 (1991).) Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et al., Bio/Technology 10:169-175 (1992). Using these markers, the mammalian cells are grown in selective medium and the cells with the highest resistance are selected. These cell lines contain the amplified gene(s) integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for the production of proteins.

[0985] Derivatives of the plasmid pSV2-dhfr (ATCC Accession No. 37146), the expression vectors pC4 (ATCC Accession No. 209646) and pC6 (ATCC Accession No.209647) contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985).) Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the cloning of the gene of interest. The vectors also contain the 3′ intron, the polyadenylation and termination signal of the rat preproinsulin gene, and the mouse DHFR gene under control of the SV40 early promoter.

[0986] Specifically, the plasmid pC6, for example, is digested with appropriate restriction enzymes and then dephosphorylated using calf intestinal phosphates by edures known in the art. The vector is then isolated from a 1% agarose gel.

[0987] A polynucleotide of the present invention is amplified according to the protocol outlined in Example 1. If a naturally occurring signal sequence is used to produce the polypeptide of the present invention, the vector does not need a second signal peptide. Alternatively, if a naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, e.g., International Publication No. WO 96/34891.)

[0988] The amplified fragment is isolated from a 1% agarose gel using a commercially available kit (“Geneclean,” BIO 101 Inc., La Jolla, Calif.). The fragment then is digested with appropriate restriction enzymes and again purified on a 1% agarose gel.

[0989] The amplified fragment is then digested with the same restriction enzyme and purified on a 1% agarose gel. The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli HB101 or XL-1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC6 using, for instance, restriction enzyme analysis.

[0990] Chinese hamster ovary cells lacking an active DHFR gene is used for transfection. Five μg of the expression plasmid pC6 or pC4 is cotransfected with 0.5 μg of the plasmid pSVneo using lipofectin (Felgner et al., supra). The plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of methotrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones growing at the highest concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 μM, 2 μM, 5 μM, 10 mM, 20 mM). The same procedure is repeated until clones are obtained which grow at a concentration of 100-200 μM. Expression of the desired gene product is analyzed, for instance, by SDS-PAGE and Western blot or by reversed phase HPLC analysis.

Example 9

Protein Fusions

[0991] The polypeptides of the present invention are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of the present polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 5; see also EP A 394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo. Nuclear localization signals fused to the polypeptides of the present invention can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Example 5.

[0992] Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5′ and 3′ ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.

[0993] For example, if pC4 (ATCC Accession No. 209646) is used, the human Fc portion can be ligated into the BamHI cloning site. Note that the 3′ BamHI site should be destroyed. Next, the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and a polynucleotide of the present invention, isolated by the PCR protocol described in Example 1, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.

[0994] If the naturally occurring signal sequence is used to produce the polypeptide of the present invention, pC4 does not need a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, e.g., International Publication No. WO 96/34891.)

Human IgG Fc region:
(SEQ ID NO: 1)
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGC
CCAGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAA
CCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTG
GTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGA
CGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTAC
AACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGG
CTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAAC
CCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCAC
AGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGGTC
AGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAG
TGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGT
GCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGGACAA
GAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGG
CTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTAAAT
GAGTGCGACGGCCGCGACTCTAGAGGAT

Example 10

Production of an Antibody from a Polypeptide

[0995] Hybridoma Technology

[0996] The antibodies of the present invention can be prepared by a variety of methods. (See, Current Protocols, Chapter 2.) As one example of such methods, cells expressing polypeptide of the present invention are administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of polypeptide of the present invention is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.

[0997] Monoclonal antibodies specific for polypeptide of the present invention are prepared using hybridoma technology (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)). In general, an animal (preferably a mouse) is immunized with polypeptide of the present invention or, more preferably, with a secreted polypeptide of the present invention-expressing cell. Such polypeptide-expressing cells are cultured in any suitable tissue culture medium, preferably in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56° C.), and supplemented with about 10 g/l of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 μg/ml of streptomycin.

[0998] The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP20), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the polypeptide of the present invention.

[0999] Alternatively, additional antibodies capable of binding to polypeptide of the present invention can be produced in a two-step procedure using anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, protein specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the polypeptide of the present invention-specific antibody can be blocked by polypeptide of the present invention. Such antibodies comprise anti-idiotypic antibodies to the polypeptide of the present invention-specific antibody and are used to immunize an animal to induce formation of further polypeptide of the present invention-specific antibodies.

[1000] For in vivo use of antibodies in humans, an antibody is “humanized”. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed herein. (See, for review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Pat. No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al., International Publication No. WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature 314:268 (1985).)

[1001] Isolation of Antibody Fragments Directed Against Polypeptide of the Present Invention from a Library of scFvs

[1002] Naturally occurring V-genes isolated from human PBLs are constructed into a library of antibody fragments which contain reactivities against polypeptide of the present invention to which the donor may or may not have been exposed (see e.g., U.S. Pat. No. 5,885,793 incorporated herein by reference in its entirety).

[1003] Rescue of the Library. A library of scFvs is constructed from the RNA of human PBLs as described in International Publication No. WO 92/01047. To rescue phage displaying antibody fragments, approximately 109 E. coli harboring the phagemid are used to inoculate 50 ml of 2×TY containing 1% glucose and 100 μg/ml of ampicillin (2×TY-AMP-GLU) and grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to inoculate 50 ml of 2×TY-AMP-GLU, 2×108 TU of delta gene 3 helper (Ml 3 delta gene III, see International Publication No. WO 92/01047) are added and the culture incubated at 37° C. for 45 minutes without shaking and then at 37° C. for 45 minutes with shaking. The culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet resuspended in 2 liters of 2×TY containing 100 μg/ml ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are prepared as described in International Application No. WO 92/01047.

[1004] M13 delta gene III is prepared as follows: M13 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious M13 delta gene III particles are made by growing the helper phage in cells harboring a pUC19 derivative supplying the wild type gene III protein during phage morphogenesis. The culture is incubated for 1 hour at 37° C. without shaking and then for a further hour at 37° C. with shaking. Cells are spun down (IEC-Centra 8,400 r.p.m. for 10 min), resuspended in 300 ml 2×TY broth containing 100 μg ampicillin/ml and 25 μg kanamycin/ml (2×TY-AMP-KAN) and grown overnight, shaking at 37° C. Phage particles are purified and concentrated from the culture medium by two PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 μm filter (Minisart NML; Sartorius) to give a final concentration of approximately 1013 transducing units/ml (ampicillin-resistant clones).

[1005] Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS with 4 ml of either 100 μg/ml or 10 μg/ml of a polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37° C. and then washed 3 times in PBS. Approximately 1013 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1 by incubating eluted phage with bacteria for 30 minutes at 37° C. The E. coli are then plated on TYE plates containing 1% glucose and 100 μg/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection. This process is then repeated for a total of 4 rounds of affinity purification with tube-washing increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS for rounds 3 and 4.

[1006] Characterization of Binders. Eluted phage from the 3rd and 4th rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991) from single colonies for assay. ELISAs are performed with microtitre plates coated with 10 pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR fingerprinting (see, e.g., International Application No. WO 92/01047) and then by sequencing. These ELISA positive clones may also be further characterized by techniques known in the art, such as, for example, epitope mapping, binding affinity, receptor signal transduction, ability to block or competitively inhibit antibody/antigen binding, and competitive agonistic or antagonistic activity.

Example 11

Method of Determining Alterations in a Gene Corresponding to a Polynucleotide

[1007] RNA isolated from entire families or individual patients presenting with a phenotype of interest (such as a disease) is isolated. cDNA is then generated from these RNA samples using protocols known in the art. (See, Sambrook.) The cDNA is then used as a template for PCR, employing primers surrounding regions of interest in SEQ ID NO:X; and/or the nucleotide sequence of the cDNA contained in Clone ID NO:Z. Suggested PCR conditions consist of 35 cycles at 95 degrees C. for 30 seconds; 60-120 seconds at 52-58 degrees C.; and 60-120 seconds at 70 degrees C., using buffer solutions described in Sidransky et al., Science 252:706 (1991).

[1008] PCR products are then sequenced using primers labeled at their 5′ end with T4 polynucleotide kinase, employing SequiTherm Polymerase (Epicentre Technologies). The intron-exon boundaries of selected exons is also determined and genomic PCR products analyzed to confirm the results. PCR products harboring suspected mutations are then cloned and sequenced to validate the results of the direct sequencing.

[1009] PCR products are cloned into T-tailed vectors as described in Holton et al., Nucleic Acids Research, 19:1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations not present in unaffected individuals.

[1010] Genomic rearrangements are also observed as a method of determining alterations in a gene corresponding to a polynucleotide. Genomic clones isolated according to Example 2 are nick-translated with digoxigenindeoxy-uridine 5′-triphosphate (Boehringer Manheim), and FISH performed as described in Johnson et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with the labeled probe is carried out using a vast excess of human cot-1 DNA for specific hybridization to the corresponding genomic locus.

[1011] Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C- and R-bands. Aligned images for precise mapping are obtained using a triple-band filter set (Chroma Technology, Brattleboro, Vt.) in combination with a cooled charge-coupled device camera (Photometrics, Tucson, Ariz.) and variable excitation wavelength filters. (Johnson et al., Genet. Anal. Tech. Appl., 8:75 (1991).) Image collection, analysis and chromosomal fractional length measurements are performed using the ISee Graphical Program System. (Inovision Corporation, Durham, N.C.) Chromosome alterations of the genomic region hybridized by the probe are identified as insertions, deletions, and translocations. These alterations are used as a diagnostic marker for an associated disease.

Example 12

Method of Detecting Abnormal Levels of a Polypeptide in a Biological Sample

[1012] A polypeptide of the present invention can be detected in a biological sample, and if an increased or decreased level of the polypeptide is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.

[1013] For example, antibody-sandwich ELISAs are used to detect polypeptides in a sample, preferably a biological sample. Wells of a microtiter plate are coated with specific antibodies, at a final concentration of 0.2 to 10 ug/ml. The antibodies are either monoclonal or polyclonal and are produced by the method described in Example 10. The wells are blocked so that non-specific binding of the polypeptide to the well is reduced.

[1014] The coated wells are then incubated for >2 hours at RT with a sample containing the polypeptide. Preferably, serial dilutions of the sample should be used to validate results. The plates are then washed three times with deionized or distilled water to remove unbound polypeptide.

[1015] Next, 50 ul of specific antibody-alkaline phosphatase conjugate, at a concentration of 25-400 ng, is added and incubated for 2 hours at room temperature. The plates are again washed three times with deionized or distilled water to remove unbound conjugate.

[1016] Add 75 ul bf 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution to each well and incubate 1 hour at room temperature. Measure the reaction by a microtiter plate reader. Prepare a standard curve, using serial dilutions of a control sample, and plot polypeptide concentration on the X-axis (log scale) and fluorescence or absorbance of the Y-axis (linear scale). Interpolate the concentration of the polypeptide in the sample using the standard curve.

Example 13

Formulation

[1017] The invention also provides methods of treatment and/or prevention of diseases or disorders (such as, for example, any one or more of the diseases or disorders disclosed herein) by administration to a subject of an effective amount of a Therapeutic. By therapeutic is meant polynucleotides or polypeptides of the invention (including fragments and variants), agonists or antagonists thereof, and/or antibodies thereto, in combination with a pharmaceutically acceptable carrier type (e.g., a sterile carrier).

[1018] The Therapeutic will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the Therapeutic alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners. The “effective amount” for purposes herein is thus determined by such considerations.

[1019] As a general proposition, the total pharmaceutically effective amount of the Therapeutic administered parenterally per dose will be in the range of about 1 ug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the Therapeutic is typically administered at a dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.

[1020] Therapeutics can be are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray. “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any. The term “parenteral” as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

[1021] Therapeutics of the invention are also suitably administered by sustained-release systems. Suitable examples of sustained-release Therapeutics are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray. “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term “parenteral” as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

[1022] Therapeutics of the invention are also suitably administered by sustained-release systems. Suitable examples of sustained-release Therapeutics include suitable polymeric materials (such as, for example, semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt).

[1023] Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556 (1983)), poly (2-hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15:167-277 (1981), and Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or poly-D-(−)-3-hydroxybutyric acid (EP 133,988).

[1024] Sustained-release Therapeutics also include liposomally entrapped Therapeutics of the invention (see generally, Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 317-327 and 353-365 (1989)). Liposomes containing the Therapeutic are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.(USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal Therapeutic.

[1025] In yet an additional embodiment, the Therapeutics of the invention are delivered by way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)).

[1026] Other controlled release systems are discussed in the review by Langer (Science 249:1527-1533 (1990)).

[1027] For parenteral administration, in one embodiment, the Therapeutic is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the Therapeutic.

[1028] Generally, the formulations are prepared by contacting the Therapeutic uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.

[1029] The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.

[1030] The Therapeutic is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.

[1031] Any pharmaceutical used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutics generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.

[1032] Therapeutics ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-mi vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized Therapeutic using bacteriostatic Water-for-Injection.

[1033] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the Therapeutics of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the Therapeutics may be employed in conjunction with other therapeutic compounds.

[1034] The Therapeutics of the invention may be administered alone or in combination with adjuvants. Adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG (e.g., THERACYS®), MPL and nonviable prepartions of Corynebacterium parvum. In a specific embodiment, Therapeutics of the invention are administered in combination with alum. In another specific embodiment, Therapeutics of the invention are administered in combination with QS-21. Further adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be administered with the Therapeutics of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration “in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.

[1035] The Therapeutics of the invention may be administered alone or in combination with other therapeutic agents. Therapeutic agents that may be administered in combination with the Therapeutics of the invention, include but not limited to, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents, and/or therapeutic treatments described below. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration “in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.

[1036] In certain embodiments, Therapeutics of the invention are administered in combination with antiretroviral agents, nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs), non-nucleoside reverse transcriptase inhibitors (NNRTIs), and/or protease inhibitors (PIs). NRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, RETROVIR™ (zidovudine/AZT), VIDEX™ (didanosine/ddI), HIVID™ (zalcitabine/ddC), ZERIT™ (stavudine/d4T), EPIVIR™ (lamivudine/3TC), and COMBIVIR™ (zidovudine/lamivudine). NNRTIs that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VIRAMUNE™ (nevirapine), RESCRIPTOR™ (delavirdine), and SUSTIVA™ (efavirenz). Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CRIXIVAN™ (indinavir), NORVIR™ (ritonavir), INVIRASE™ (saquinavir), and VIRACEPT™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection.

[1037] Additional NRTIs include LODENOSINE™ (F-ddA; an acid-stable adenosine NRTI; Triangle/Abbott; COVIRACIL™ (emtricitabine/FTC; structurally related to lamivudine (3TC) but with 3- to 10-fold greater activity in vitro; Triangle/Abbott); dOTC (BCH-10652, also structurally related to lamivudine but retains activity against a substantial proportion of lamivudine-resistant isolates; Biochem Pharma); Adefovir (refused approval for anti-HIV therapy by FDA; Gilead Sciences); PREVEON® (Adefovir Dipivoxil, the active prodrug of adefovir; its active form is PMEA-pp); TENOFOVIR™ (bis-POC PMPA, a PMPA prodrug; Gilead); DAPD/DXG (active metabolite of DAPD; Triangle/Abbott); D-D4FC (related to 3TC, with activity against AZT/3TC-resistant virus); GW420867X (Glaxo Wellcome); ZIAGEN™ (abacavir/159U89; Glaxo Wellcome Inc.); CS-87 (3′azido-2′,3′dideoxyuridine; WO 99/66936); and S-acyl-2-thioethyl (SATE)-bearing prodrug forms of β-L-FD4C and β-L-FddC (WO 98/17281).

[1038] Additional NNRTIs include COACTINON™ (Emivirine/MKC-442, potent NNRTI of the HEPT class; Triangle/Abbott); CAPRAVIRINE™ (AG-1549/S-1153, a next generation NNRTI with activity against viruses containing the K 103N mutation; Agouron); PNU-142721 (has 20- to 50-fold greater activity than its predecessor delavirdine and is active against K103N mutants; Pharmacia & Upjohn); DPC-961 and DPC-963 (second-generation derivatives of efavirenz, designed to be active against viruses with the K103N mutation; DuPont); GW-420867×(has 25-fold greater activity than HBY097 and is active against K103N mutants; Glaxo Wellcome); CALANOLIDE A (naturally occurring agent from the latex tree; active against viruses containing either or both the Y181C and K103N mutations); and Propolis (WO 99/49830).

[1039] Additional protease inhibitors include LOPINAVIR™ (ABT378/r; Abbott Laboratories); BMS-232632 (an azapeptide; Bristol-Myres Squibb); TIPRANAVIR™ PNU-140690, a non-peptic dihydropyrone; Pharmacia & Upjohn); PD-178390 (a nonpeptidic dihydropyrone; Parke-Davis); BMS 232632 (an azapeptide; Bristol-Myers Squibb); L-756,423 (an indinavir analog; Merck); DMP-450 (a cyclic urea compound; Avid & DuPont); AG-1776 (a peptidomimetic with in vitro activity against protease inhibitor-resistant viruses; Agouron); VX-175/GW-433908 (phosphate prodrug of amprenavir; Vertex & Glaxo Welcome); CGP61755 (Ciba); and AGENERASE™ (amprenavir; Glaxo Wellcome Inc.).

[1040] Additional antiretroviral agents include fusion inhibitors/gp41 binders. Fusion inhibitors/gp41 binders include T-20 (a peptide from residues 643-678 of the HIV gp41 transmembrane protein ectodomain which binds to gp41 in its resting state and prevents transformation to the fusogenic state; Trimeris) and T-1249 (a second-generation fusion inhibitor; Trimeris).

[1041] Additional antiretroviral agents include fusion inhibitors/chemokine receptor antagonists. Fusion inhibitors/chemokine receptor antagonists include CXCR4 antagonists such as AMD 3100 (a bicyclam), SDF-1 and its analogs, and ALX40-4C (a cationic peptide), T22 (an 18 amino acid peptide; Trimeris) and the T22 analogs T134 and T140; CCR5 antagonists such as RANTES (9-68), AOP-RANTES, NNY-RANTES, and TAK-779; and CCR5/CXCR4 antagonists such as NSC 651016 (a distamycin analog). Also included are CCR2B, CCR3, and CCR6 antagonists. Chemokine recpetor agonists such as RANTES, SDF-1, MIP-1α, MIP-1β, etc., may also inhibit fusion.

[1042] Additional antiretroviral agents include integrase inhibitors. Integrase inhibitors include dicaffeoylquinic (DFQA) acids; L-chicoric acid (a dicaffeoyltartaric (DCTA) acid); quinalizarin (QLC) and related anthraquinones; ZINTEVIR™ (AR 177, an oligonucleotide that probably acts at cell surface rather than being a true integrase inhibitor; Arondex); and naphthols such as those disclosed in WO 98/50347.

[1043] Additional antiretroviral agents include hydroxyurea-like compunds such as BCX-34 (a purine nucleoside phosphorylase inhibitor; Biocryst); ribonucleotide reductase inhibitors such as DIDOX™ (Molecules for Health); inosine monophosphate dehydrogenase (IMPDH) inhibitors sucha as VX-497 (Vertex); and myvopholic acids such as CellCept (mycophenolate mofetil; Roche).

[1044] Additional antiretroviral agents include inhibitors of viral integrase, inhibitors of viral genome nuclear translocation such as arylene bis(methylketone) compounds; inhibitors of HIV entry such as AOP-RANTES, NNY-RANTES, RANTES-IgG fusion protein, soluble complexes of RANTES and glycosaminoglycans (GAG), and AMD-3100; nucleocapsid zinc finger inhibitors such as dithiane compounds; targets of HIV Tat and Rev; and pharmacoenhancers such as ABT-378.

[1045] Other antiretroviral therapies and adjunct therapies include cytokines and lymphokines such as MIP-1α, MIP-1β, SDF-1α, IL-2, PROLEUKIN™ (aldesleukin/L2-7001; Chiron), IL-4, IL-10, IL-12, and IL-13; interferons such as IFN-α2a; antagonists of TNFs, NFκB, GM-CSF, M-CSF, and IL-10; agents that modulate immune activation such as cyclosporin and prednisone; vaccines such as Remune™ (HIV Immunogen), APL 400-003 (Apollon), recombinant gp120 and fragments, bivalent (B/E) recombinant envelope glycoprotein, rgp120CM235, MN rgp120, SF-2 rgp120, gp120/soluble CD4 complex, Delta JR-FL protein, branched synthetic peptide derived from discontinuous gp120 C3/C4 domain, fusion-competent immunogens, and Gag, Pol, Nef, and Tat vaccines; gene-based therapies such as genetic suppressor elements (GSEs; WO 98/54366), and intrakines (genetically modified CC chemokines targetted to the ER to block surface expression of newly synthesized CCR5 (Yang et al., PNAS 94:11567-72 (1997); Chen et al., Nat. Med. 3:1110-16 (1997)); antibodies such as the anti-CXCR4 antibody 12G5, the anti-CCR5 antibodies 2D7, 5C7, PA8, PA9, PA10, PA11, PA12, and PA14, the anti-CD4 antibodies Q4120 and RPA-T4, the anti-CCR3 antibody 7B11, the anti-gp120 antibodies 17b, 48d, 447-52D, 257-D, 268-D and 50.1; anti-Tat antibodies, anti-TNF-α antibodies, and monoclonal antibody 33A; aryl hydrocarbon (AH) receptor agonists and antagonists such as TCDD, 3,3′,4,4′,5-pentachlorobiphenyl, 3,3′,4,4′-tetrachlorobiphenyl, and α-naphthoflavone (WO 98/30213); and antioxidants such as γ-L-glutamyl-L-cysteine ethyl ester (γ-GCE; WO 99/56764).

[1046] In a further embodiment, the Therapeutics of the invention are administered in combination with an antiviral agent. Antiviral agents that may be administered with the Therapeutics of the invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine.

[1047] In other embodiments, Therapeutics of the invention may be administered in combination with anti-opportunistic infection agents. Anti-opportunistic agents that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDINE™, ATOVAQUONE™, ISONIAZID™, RIFAMPIN™, PYRAZINAMIDE™, ETHAMBUTOL™, RIFABUTIN™, CLARITHROMYCIN™, AZITHROMYCIN™, GANCICLOVIR™, FOSCARNET™, CIDOFOVIR™, FLUCONAZOLE™, ITRACONAZOLE™, KETOCONAZOLE™, ACYCLOVIR™, FAMCICOLVIR™, PYRIMETHAMINE™, LEUCOVORIN™, NEUPOGEN™ (filgrastim/G-CSF), and LEUKINE™ (sargramostim/GM-CSF). In a specific embodiment, Therapeutics of the invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDINE™, and/or ATOVAQUONE™ to prophylactically treat or prevent an opportunistic Pneumocystis carinii pneumonia infection. In another specific embodiment, Therapeutics of the invention are used in any combination with ISONIAZID™, RIFAMPIN™, PYRAZINAMIDE™, and/or ETHAMBUTOL™ to prophylactically treat or prevent an opportunistic Mycobacterium avium complex infection. In another specific embodiment, Therapeutics of the invention are used in any combination with RIFABUTIN™, CLARITHROMYCIN™, and/or AZITHROMYCIN™ to prophylactically treat or prevent an opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, Therapeutics of the invention are used in any combination with GANCICLOVIR™, FOSCARNET™, and/or CIDOFOVIR™ to prophylactically treat or prevent an opportunistic cytomegalovirus infection. In another specific embodiment, Therapeutics of the invention are used in any combination with FLUCONAZOLE™, ITRACONAZOLE™, and/or KETOCONAZOLE™ to prophylactically treat or prevent an opportunistic fungal infection. In another specific embodiment, Therapeutics of the invention are used in any combination with ACYCLOVIR™ and/or FAMCICOLVIR™ to prophylactically treat or prevent an opportunistic herpes simplex virus type I and/or type II infection. In another specific embodiment, Therapeutics of the invention are used in any combination with PYRIMETHAMINE™ and/or LEUCOVORIN™ to prophylactically treat or prevent an opportunistic Toxoplasma gondii infection. In another specific embodiment, Therapeutics of the invention are used in any combination with LEUCOVORIN™ and/or NEUPOGEN™ to prophylactically treat or prevent an opportunistic bacterial infection.

[1048] In a further embodiment, the Therapeutics of the invention are administered in combination with an antibiotic agent. Antibiotic agents that may be administered with the Therapeutics of the invention include, but are not limited to, amoxicillin, beta-lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rapamycin, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin.

[1049] In other embodiments, Therapeutics of the invention are administered in combination with immunosuppressive agents. Immunosuppressive agents that may be administered in combination with the Therapeutics of the invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells. Other immunosuppressive agents that may be administered in combination with the Therapeutics of the invention include, but are not limited to, prednisolone, methotrexate, thalidomide, methoxsalen, rapamycin, leflunomide, mizoribine (BREDININ™), brequinar, deoxyspergualin, and azaspirane (SKF 105685), ORTHOCLONE OKT® 3 (muromonab-CD3), SANDIMMUNE™, NEORAL™, SANGDYA™ (cyclosporine), PROGRAF® (FK506, tacrolimus), CELLCEPT® (mycophenolate motefil, of which the active metabolite is mycophenolic acid), IMURAN™ (azathioprine), glucocorticosteroids, adrenocortical steroids such as DELTASONE™ (prednisone) and HYDELTRASOL™ (prednisolone), FOLEX™ and MEXATE™ (methotrxate), OXSORALEN-ULTRA™ (methoxsalen) and RAPAMUNE™ (sirolimus). In a specific embodiment, immunosuppressants may be used to prevent rejection of organ or bone marrow transplantation.

[1050] In an additional embodiment, Therapeutics of the invention are administered alone or in combination with one or more intravenous immune globulin preparations. Intravenous immune globulin preparations that may be administered with the Therapeutics of the invention include, but not limited to, GAMMAR™, IVEEGAM™, SANDOGLOBULIN™, GAMMAGARD S/D™, ATGAM™ (antithymocyte glubulin), and GAMIMUNE™. In a specific embodiment, Therapeutics of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).

[1051] In certain embodiments, the Therapeutics of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that may be administered with the Therapeutics of the invention include, but are not limited to, corticosteroids (e.g. betamethasone, budesonide, cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, prednisone, and triamcinolone), nonsteroidal anti-inflammatory drugs (e.g., diclofenac, diflunisal, etodolac, fenoprofen, floctafenine, flurbiprofen, ibuprofen, indomethacin, ketoprofen, meclofenamate, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, phenylbutazone, piroxicam, sulindac, tenoxicam, tiaprofenic acid, and tolmetin.), as well as antihistamines, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, cinorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole, and tenidap.

[1052] In an additional embodiment, the compositions of the invention are administered alone or in combination with an anti-angiogenic agent. Anti-angiogenic agents that may be administered with the compositions of the invention include, but are not limited to, Angiostatin (Entremed, Rockville, Md.), Troponin-1 (Boston Life Sciences, Boston, Mass.), anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel (Taxol), Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, VEGI, Plasminogen Activator Inhibitor-1, Plasminogen Activator Inhibitor-2, and various forms of the lighter “d group” transition metals.

[1053] Lighter “d group” transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes.

[1054] Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates.

[1055] Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI) oxide. Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.

[1056] A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include, but are not limited to, platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res. 51:22-26-, (1991)); Sulphated Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326, (1992)); Chymostatin (Tomkinson et al., Biochem J. 286:475-480, (1992)); Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, (1990)); Gold Sodium Thiomalate (“GST”; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, (1987)); anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4): 1659-1664, (1987)); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or “CCA”; (Takeuchi et al., Agents Actions 36:312-316, (1992)); and metalloproteinase inhibitors such as BB94.

[1057] Additional anti-angiogenic factors that may also be utilized within the context of the present invention include Thalidomide, (Celgene, Warren, N.J.); Angiostatic steroid; AGM-1470 (H. Brem and J. Folkman J Pediatr. Surg. 28:445-51 (1993)); an integrin alpha v beta 3 antagonist (C. Storgard et al., J. Clin. Invest. 103:47-54 (1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI) (National Cancer Institute, Bethesda, Md.); Conbretastatin A-4 (CA4P) (OXiGENE, Boston, Mass.); Squalamine (Magainin Pharmaceuticals, Plymouth Meeting, Pa.); TNP-470, (Tap complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.

[1058] A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include, but are not limited to, platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res. 51:22-26, (1991)); Sulphated Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminoprop ionitrile fumarate; 4-propyl-5-(4-pyridinyl)-2(3H)-oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326, (1992)); Chymostatin (Tomkinson et al., Biochem J. 286:475-480, (1992)); Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, (1990)); Gold Sodium Thiomalate (“GST”; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, (1987)); anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4): 1659-1664, (1987)); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)-carboxyphenyl-4-chloroanthronilic acid disodium or “CCA”; (Takeuchi et al., Agents Actions 36:312-316, (1992)); and metalloproteinase inhibitors such as BB94.

[1059] Additional anti-angiogenic factors that may also be utilized within the context of the present invention include Thalidomide, (Celgene, Warren, N.J.); Angiostatic steroid; AGM-1470 (H. Brem and J. Folkman J Pediatr. Surg. 28:445-51 (1993)); an integrin alpha v beta 3 antagonist (C. Storgard et al., J. Clin. Invest. 103:47-54 (1999)); carboxynaminolmidazole; Carboxyamidotriazole (CAI) (National Cancer Institute, Bethesda, Md.); Conbretastatin A-4 (CA4P) (OXiGENE, Boston, Mass.); Squalamine (Magainin Pharmaceuticals, Plymouth Meeting, Pa.); TNP-470, (Tap Pharmaceuticals, Deerfield, Ill.); ZD-0101 AstraZeneca (London, UK); APRA (CT2584); Benefin, Byrostatin-1 (SC339555); CGP-41251 (PKC 412); CMIOI; Dexrazoxane (ICRF187); DMXAA; Endostatin; Flavopridiol; Genestein; GTE; ImmTher; Iressa (ZDI839); Octreotide (Somatostatin); Panretin; Penacillamine; Photopoint; PI-88; Prinomastat (AG-3340) Purlytin; Suradista (FCE26644); Tamoxifen (Nolvadex); Tazarotene; Tetrathiomolybdate; Xeloda (Capecitabine); and 5-Fluorouracil.

[1060] Anti-angiogenic agents that may be administed in combination with the compounds of the invention may work through a variety of mechanisms including, but not limited to, inhibiting proteolysis of the extracellular matrix, blocking the function of endothelial cell-extracellular matrix adhesion molecules, by antagonizing the function of angiogenesis inducers such as growth factors, and inhibiting integrin receptors expressed on proliferating endothelial cells. Examples of anti-angiogenic inhibitors that interfere with extracellular matrix proteolysis and which may be administered in combination with the compositons of the invention include, but are not lmited to, AG-3340 (Agouron, La Jolla, Calif.), BAY-12-9566 (Bayer, West Haven, Conn.), BMS-275291 (Bristol Myers Squibb, Princeton, N.J.), CGS-27032A (Novartis, East Hanover, N.J.), Marimastat (British Biotech, Oxford, UK), and Metastat (Aetema, St-Foy, Quebec). Examples of anti-angiogenic inhibitors that act by blocking the function of endothelial cell-extracellular matrix adhesion molecules and which may be administered in combination with the compositons of the invention include, but are not Imited to, EMD-121974 (Merck KcgaA Darmstadt, Germany) and Vitaxin (Ixsys, La Jolla, Calif./Medimmune, Gaithersburg, Md.). Examples of anti-angiogenic agents that act by directly antagonizing or inhibiting angiogenesis inducers and which may be administered in combination with the compositons of the invention include, but are not lmited to, Angiozyme (Ribozyme, Boulder, Colo.), Anti-VEGF antibody (Genentech, S. San Francisco, Calif.), PTK-787/ZK-225846 (Novartis, Basel, Switzerland), SU-101 (Sugen, S. San Francisco, Calif.), SU-5416 (Sugen/Pharmacia Upjohn, Bridgewater, N.J.), and SU-6668 (Sugen). Other anti-angiogenic agents act to indirectly inhibit angiogenesis. Examples of indirect inhibitors of angiogenesis which may be administered in combination with the compositons of the invention include, but are not limited to, IM-862 (Cytran, Kirkland, Wash.), Interferon-alpha, IL-12 (Roche, Nutley, N.J.), and Pentosan polysulfate (Georgetown University, Washington, D.C.).

[1061] In particular embodiments, the use of compositions of the invention in combination with anti-angiogenic agents is contemplated for the treatment, prevention, and/or amelioration of an autoimmune disease, such as for example, an autoimmune disease described herein.

[1062] In a particular embodiment, the use of compositions of the invention in combination with anti-angiogenic agents is contemplated for the treatment, prevention, and/or amelioration of arthritis. In a more particular embodiment, the use of compositions of the invention in combination with anti-angiogenic agents is contemplated for the treatment, prevention, and/or amelioration of rheumatoid arthritis.

[1063] In another embodiment, the polynucleotides, encoding a polypeptide of the present invention are administered in combination with an angiogenic protein, or polynucleotides encoding an angiogenic protein. Examples of angiogenic proteins that may be administered with the compositions of the invention include, but are not limited to, acidic and basic fibroblast growth factors, VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and beta, platelet-derived endothelial cell growth factor, platelet-derived growth factor, tumor necrosis factor alpha, hepatocyte growth factor, insulin-like growth factor, colony stimulating factor, macrophage colony stimulating factor, granulocyte/macrophage colony stimulating factor, and nitric oxide synthase.

[1064] In additional embodiments, compostions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that may be administered with the Therapeutics of the invention include, but are not limited to alkylating agents such as nitrogen mustards (for example, Mechlorethamine, cyclophosphamide, Cyclophosphamide Ifosfamide, Metphalan (L-sarcolysin), and Chlorambucil), ethylenimines and methylmelamines (for example, Hexamethylmelamine and Thiotepa), alkyl sulfonates (for example, Busulfan), nitrosoureas (for example, Carmustine (BCNU), Lomustine (CCNU), Semustine (methyl-CCNU), and Streptozocin (streptozotocin)), triazenes (for example, Dacarbazine (DTIC; dimethyltriazenoimidazolecarboxamide)), folic acid analogs (for example, Methotrexate (amethopterin)), pyrimidine analogs (for example, Fluorouacil (5-fluorouracil; 5-FU), Floxuridine (fluorodeoxyuridine; FudR), and Cytarabine (cytosine arabinoside)), purine analogs and related inhibitors (for example, Mercaptopurine (6-mercaptopurine; 6-MP), Thioguanine (6-thioguanine; TG), and Pentostatin (2′-deoxycoformycin)), vinca alkaloids (for example, Vinblastine (VLB, vinblastine sulfate) and Vincristine (vincristine sulfate)), epipodophyllotoxins (for example, Etoposide and Teniposide), antibiotics (for example, Dactinomycin (actinomycin D), Daunorubicin (daunomycin; rubidomycin), Doxorubicin, Bleomycin, Plicamycin (mithramycin), and Mitomycin (mitomycin C), enzymes (for example, L-Asparaginase), biological response modifiers (for example, Interferon-alpha and interferon-alpha-2b), platinum coordination compounds (for example, Cisplatin (cis-DDP) and Carboplatin), anthracenedione (Mitoxantrone), substituted ureas (for example, Hydroxyurea), methylhydrazine derivatives (for example, Procarbazine (N-methylhydrazine; MIH), adrenocorticosteroids (for example, Prednis one), progestins (for example, Hydroxyprogesterone caproate, Medroxyprogesterone, Medroxyprogesterone acetate, and Megestrol acetate), estrogens (for example, Diethylstilbestrol (DES), Diethylstilbestrol diphosphate, Estradiol, and Ethinyl estradiol), antiestrogens (for example, Tamoxifen), androgens (Testosterone proprionate, and Fluoxymesterone), antiandrogens (for example, Flutamide), gonadotropin-releasing horomone analogs (for example, Leuprolide), other hormones and hormone analogs (for example, methyltestosterone, estramustine, estramustine phosphate sodium, chlorotrianisene, and testolactone), and others (for example, dicarbazine, glutamic acid, and mitotane).

[1065] In one embodiment, the compositions of the invention are administered in combination with one or more of the following drugs: infliximab (also known as Remicade™ Centocor, Inc.), Trocade (Roche, RO-32-3555), Leflunomide (also known as Arava™ from Hoechst Marion Roussel), Kineret™ (an IL-1 Receptor antagonist also known as Anakinra from Amgen, Inc.).

[1066] In a specific embodiment, compositions of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or combination of one or more of the components of CHOP. In one embodiment, the compositions of the invention are administered in combination with anti-CD20 antibodies, human monoclonal anti-CD20 antibodies. In another embodiment, the compositions of the invention are administered in combination with anti-CD20 antibodies and CHOP, or anti-CD20 antibodies and any combination of one or more of the components of CHOP, particularly cyclophosphamide and/or prednisone. In a specific embodiment, compositions of the invention are administered in combination with Rituximab. In a further embodiment, compositions of the invention are administered with Rituximab and CHOP, or Rituximab and any combination of one or more of the components of CHOP, particularly cyclophosphamide and/or prednisone. In a specific embodiment, compositions of the invention are administered in combination with tositumomab. In a further embodiment, compositions of the invention are administered with tositumomab and CHOP, or tositumomab and any combination of one or more of the components of CHOP, particularly cyclophosphamide and/or prednisone. The anti-CD20 antibodies may optionally be associated with radioisotopes, toxins or cytotoxic prodrugs.

[1067] In another specific embodiment, the compositions of the invention are administered in combination Zevalin™. In a further embodiment, compositions of the invention are administered with Zevalin™ and CHOP, or Zevalin™ and any combination of one or more of the components of CHOP, particularly cyclophosphamide and/or prednisone. Zevalin™ may be associated with one or more radisotopes. Particularly preferred isotopes are 90Y and 111In.

[1068] In an additional embodiment, the Therapeutics of the invention are administered in combination with cytokines. Cytokines that may be administered with the Therapeutics of the invention include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha. In another embodiment, Therapeutics of the invention may be administered with any interleukin, including, but not limited to, IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, and IL-21.

[1069] In one embodiment, the Therapeutics of the invention are administered in combination with members of the TNF family. TNF, TNF-related or TNF-like molecules that may be administered with the Therapeutics of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I (International Publication No. WO 97/33899), endokine-alpha (International Publication No. WO 98/07880), OPG, and neutrokine-alpha (International Publication No. WO 98/18921, OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TRANK, TR9 (International Publication No. WO 98/56892), TR10 (International Publication No. WO 98/54202), 312C2 (International Publication No. WO 98/06842), and TR12, and soluble forms CD154, CD70, and CD153.

[1070] In an additional embodiment, the Therapeutics of the invention are administered in combination with angiogenic proteins. Angiogenic proteins that may be administered with the Therapeutics of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317; Placental Growth Factor (PlGF), as disclosed in International Publication Number WO 92/06194; Placental Growth Factor-2 (PlGF-2), as disclosed in Hauser et al., Growth Factors, 4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in International Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF-A), as disclosed in European Patent Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2), as disclosed in International Publication Number WO 96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in International Publication Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in German Patent Number DE19639601. The above mentioned references are herein incorporated by reference in their entireties.

[1071] In an additional embodiment, the Therapeutics of the invention are administered in combination with Fibroblast Growth Factors. Fibroblast Growth Factors that may be administered with the Therapeutics of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.

[1072] In an additional embodiment, the Therapeutics of the invention are administered in combination with hematopoietic growth factors. Hematopoietic growth factors that may be administered with the Therapeutics of the invention include, but are not limited to, granulocyte macrophage colony stimulating factor (GM-CSF) (sargramostim, LEUKINE™, PROKINE™), granulocyte colony stimulating factor (G-CSF) (filgrastim, NEUPOGEN™), macrophage colony stimulating factor (M-CSF, CSF-1) erythropoietin (epoetin alfa, EPOGEN™, PROCRIT™), stem cell factor (SCF, c-kit ligand, steel factor), megakaryocyte colony stimulating factor, PIXY321 (a GMCSF/IL-3 fusion protein), interleukins, especially any one or more of IL-1 through IL-12, interferon-gamma, or thrombopoietin.

[1073] In certain embodiments, Therapeutics of the present invention are administered in combination with adrenergic blockers, such as, for example, acebutolol, atenolol, betaxolol, bisoprolol, carteolol, labetalol, metoprolol, nadolol, oxprenolol, penbutolol, pindolol, propranolol, sotalol, and timolol.

[1074] In another embodiment, the Therapeutics of the invention are administered in combination with an antiarrhythmic drug (e.g., adenosine, amidoarone, bretylium, digitalis, digoxin, digitoxin, diliazem, disopyramide, esmolol, flecainide, lidocaine, mexiletine, moricizine, phenytoin, procainamide, N-acetyl procainamide, propafenone, propranolol, quinidine, sotalol, tocainide, and verapamil).

[1075] In another embodiment, the Therapeutics of the invention are administered in combination with diuretic agents, such as carbonic anhydrase-inhibiting agents (e.g., acetazolamide, dichlorphenamide, and methazolamide), osmotic diuretics (e.g., glycerin, isosorbide, mannitol, and urea), diuretics that inhibit Na+—K+-2Cl− symport (e.g., furosemide, bumetamide, azosemide, piretamide, tripamide, ethacrynic acid, muzolimine, and torsemide), thiazide and thiazide-like diuretics (e.g., bendoflumethiazide, benzthiazide, chlorothiazide, hydrochlorothiazide, hydroflumethiazide, methyclothiazide, polythiazide, trichormethiazide, chlorthalidone, indapamide, metolazone, and quinethazone), potassium sparing diuretics (e.g., amiloride and triamterene), and mineralcorticoid receptor antagonists (e.g., spironolactone, canrenone, and potassium canrenoate).

[1076] In one embodiment, the Therapeutics of the invention are administered in combination with treatments for endocrine and/or hormone imbalance disorders. Treatments for endocrine and/or hormone imbalance disorders include, but are not limited to, 127I, radioactive isotopes of iodine such as 131I and 123I; recombinant growth hormone, such as HUMATROPE™ (recombinant somatropin); growth hormone analogs such as PROTROPIN™ (somatrem); dopamine agonists such as PARLODEL™ (bromocriptine); somatostatin analogs such as SANDOSTATIN™ (octreotide); gonadotropin preparations such as PREGNYL™, A.P.L.™ and PROFASI™ (chorionic gonadotropin (CG)), PERGONAL™ (menotropins), and METRODIN™ (urofollitropin (uFSH)); synthetic human gonadotropin releasing hormone preparations such as FACTREL™ and LUTREPULSE™ (gonadorelin hydrochloride); synthetic gonadotropin agonists such as LUPRON™ (leuprolide acetate), SUPPRELIN™ (histrelin acetate), SYNAREL™ (nafarelin acetate), and ZOLADEX™ (goserelin acetate); synthetic preparations of thyrotropin-releasing hormone such as RELEFACT TRH™ and THYPINONE™ (protirelin); recombinant human TSH such as THYROGEN™; synthetic preparations of the sodium salts of the natural isomers of thyroid hormones such as L-T4™, SYNTHROID™ and LEVOTHROID™ (levothyroxine sodium), L-T3™, CYTOMEL™ and TRIOSTAT™ (liothyroine sodium), and THYROLAR™ (liotrix); antithyroid compounds such as 6-n-propylthiouracil (propylthiouracil), 1-methyl-2-mercaptoimidazole and TAPAZOLE™ (methimazole), NEO-MERCAZOLE™ (carbimazole); beta-adrenergic receptor antagonists such as propranolol and esmolol; Ca2+ channel blockers; dexamethasone and iodinated radiological contrast agents such as TELEPAQUE™ (iopanoic acid) and ORAGRAFIN™ (sodium ipodate); estrogens or congugated estrogens such as ESTRACE™ (estradiol), ESTINYL™ (ethinyl estradiol), PREMARIN™, ESTRATAB™, ORTHO-EST™, OGEN™ and estropipate (estrone), ESTROVIS™ (quinestrol), ESTRADERM™ (estradiol), DELESTROGEN™ and VALERGEN™ (estradiol valerate), DEPO-ESTRADIOL CYPIONATE™ and ESTROJECT LA™ (estradiol cypionate); antiestrogens such as NOLVADEX™ (tamoxifen), SEROPHENE™ and CLOMID™ (clomiphene); progestins such as DURALUTIN™ (hydroxyprogesterone caproate), MPA™ and DEPO-PROVERA™ (medroxyprogesterone acetate), PROVERA™ and CYCRIN™ (MPA), MEGACE™ (megestrol acetate), NORLUTIN™ (norethindrone), and NORLUTATE™ and AYGESTIN™ (norethindrone acetate); progesterone implants such as NORPLANT SYSTEM™ (subdermal implants of norgestrel); antiprogestins such as RU 486™ (mifepristone); hormonal contraceptives such as ENOVID™ (norethynodrel plus mestranol), PROGESTASERT™ (intrauterine device that releases progesterone), LOESTRIN™, BREVICON™, MODICON™, GENORA™, NELONA™, NORINYL™, OVACON-35™ and OVACON-50™ (ethinyl estradiol/norethindrone), LEVLEN™, NORDETTE™, TRI-LEVLEN™ and TRIPHASIL-21™ (ethinyl estradiol/levonorgestrel) LO/OVRAL™ and OVRAL™ (ethinyl estradiol/norgestrel), DEMULEN™ (ethinyl estradiol/ethynodiol diacetate), NORINYL™, ORTHO-NOVUM™, NORETHIN™, GENORA™, and NELOVA™ (norethindrone/mestranol), DESOGEN™ and ORTHO-CEPT™ (ethinyl estradiol/desogestrel), ORTHO-CYCLEN™ and ORTHO-TRICYCLEN™ (ethinyl estradiol/norgestimate), MICRONOR™ and NOR-QD™ (norethindrone), and OVRETTE™ (norgestrel); testosterone esters such as methenolone acetate and testosterone undecanoate; parenteral and oral androgens such as TESTOJECT-5 OT (testosterone), TESTEX™ (testosterone propionate), DELATESTRYL™ (testosterone enanthate), DEPO-TESTOSTERONE™ (testosterone cypionate), DANOCRINE™ (danazol), HALOTESTIN™ (fluoxymesterone), ORETON METHYL™, TESTRED™ and VIRILON™ (methyltestosterone), and OXANDRIN™ (oxandrolone); testosterone transdermal systems such as TESTODERM™; androgen receptor antagonist and 5-alpha-reductase inhibitors such as ANDROCUR™ (cyproterone acetate), EULEXIN™ (flutamide), and PROSCAR™ (finasteride); adrenocorticotropic hormone preparations such as CORTROSYN™ (cosyntropin); adrenocortical steroids and their synthetic analogs such as ACLOVATE™ (alclometasone dipropionate), CYCLOCORT™ (amcinonide), BECLOVENT™ and VANCERIL™ (beclomethasone dipropionate), CELESTONE™ (betamethasone), BENISONE™ and UTICORT™ (betamethasone benzoate), DIPROSONE™ (betamethasone dipropionate), CELESTONE PHOSPHATE™ (betamethasone sodium phosphate), CELESTONE SOLUSPAN™ (betamethasone sodium phosphate and acetate), BETA-VAL™ and VALISONE™ (betamethasone valerate), TEMOVATE™ (clobetasol propionate), CLODERM™ (clocortolone pivalate), CORTEF™ and HYDROCORTONE™ (cortisol (hydrocortisone)), HYDROCORTONE ACETATE™ (cortisol (hydrocortisone) acetate), LOCOID™ (cortisol (hydrocortisone) butyrate), HYDROCORTONE PHOSPHATE™ (cortisol (hydrocortisone) sodium phosphate), A-HYDROCORT™ and SOLU CORTEF™ (cortisol (hydrocortisone) sodium succinate), WESTCORT™ (cortisol (hydrocortisone) valerate), CORTISONE ACETATE™ (cortisone acetate), DESOWEN™ and TRIDESILON™ (desonide), TOPICORT™ (desoximetasone), DECADRON™ (dexamethasone), DECADRON LA™ (dexamethasone acetate), DECADRON PHOSPHATE™ and HEXADROL PHOSPHATE™ (dexamethasone sodium phosphate), FLORONE™ and MAXIFLOR™ (diflorasone diacetate), FLORINEF ACETATE™ (fludrocortisone acetate), AEROBID™ and NASALIDE™ (flunisolide), FLUONID™ and SYNALAR™ (fluocinolone acetonide), LIDEX™ (fluocinonide), FLUOR-OP™ and FML™ (fluorometholone), CORDRAN™ (flurandrenolide), HALOG™ (halcinonide), HMS LIZUIFILM™ (medrysone), MEDROL™ (methylprednisolone), DEPO-MEDROL™ and MEDROL ACETATE™ (methylprednisone acetate), A-METHAPRED™ and SOLUMEDROL™ (methylprednisolone sodium succinate), ELOCON™, (mometasone furoate), HALDRONE™ (paramethasone acetate), DELTA-CORTEF™ (prednisolone), ECONOPRED™ (prednisolone acetate), HYDELTRASOL™ (prednisolone sodium phosphate), HYDELTRA-T.B.A” (prednisolone tebutate), DELTASONE™ (prednisone), ARISTOCORT™ and KENACORT™ (triamcinolone), KENALOG™ (triamcinolone acetonide), ARISTOCORT™ and KENACORT DIACETATE™ (triamcinolone diacetate), and ARISTOSPAN™ (triamcinolone hexacetonide); inhibitors of biosynthesis and action of adrenocortical steroids such as CYTADREN™ (aminoglutethimide), NIZORAL™ (ketoconazole), MODRASTANE™ (trilostane), and METOPIRONE™ (metyrapone); bovine, porcine or human insulin or mixtures thereof; insulin analogs; recombinant human insulin such as HUMULIN™ and NOVOLIN™; oral hypoglycemic agents such as ORAMIDE™ and ORINASE™ (tolbutamide), DIABINESE™ (chlorpropamide), TOLAMIDE™ and TOLINASE™ (tolazamide), DYMELOR™ (acetohexamide), glibenclamide, MICRONASE™, DIBETA™ and GLYNASE™ (glyburide), GLUCOTROL™ (glipizide), and DIAMICRON™ (gliclazide), GLUCOPHAGE™ (metformin), ciglitazone, pioglitazone, and alpha-glucosidase inhibitors; bovine or porcine glucagon; somatostatins such as SANDOSTATIN™ (octreotide); and diazoxides such as PROGLYCEM™ (diazoxide).

[1077] In one embodiment, the Therapeutics of the invention are administered in combination with treatments for uterine motility disorders. Treatments for uterine motility disorders include, but are not limited to, estrogen drugs such as conjugated estrogens (e.g., PREMARIN® and ESTRATAB®), estradiols (e.g., CLIMARA® and ALORA®), estropipate, and chlorotrianisene; progestin drugs (e.g., AMEN® (medroxyprogesterone), MICRONOR® (norethidrone acetate), PROMETRIUM® progesterone, and megestrol acetate); and estrogen/progesterone combination therapies such as, for example, conjugated estrogens/medroxyprogesterone (e.g., PREMPRO™ and PREMPHASE®) and norethindrone acetate/ethinyl estsradiol (e.g., FEMHRT™).

[1078] In an additional embodiment, the Therapeutics of the invention are administered in combination with drugs effective in treating iron deficiency and hypochromic anemias, including but not limited to, ferrous sulfate (iron sulfate, FEOSOL™), ferrous fumarate (e.g., FEOSTAT™), ferrous gluconate (e.g., FERGON™), polysaccharide-iron complex (e.g., NIFEREX™), iron dextran injection (e.g., INFED™), cupric sulfate, pyroxidine, riboflavin, Vitamin B12, cyancobalamin injection (e.g., REDISOL™, RUBRAMIN PC™), hydroxocobalamin, folic acid (e.g., FOLVITE™), leucovorin (folinic acid, 5-CHOH4PteGlu, citrovorum factor) or WELLCOVORIN (Calcium salt of leucovorin), transferrin or ferritin.

[1079] In certain embodiments, the Therapeutics of the invention are administered in combination with agents used to treat psychiatric disorders. Psychiatric drugs that may be administered with the Therapeutics of the invention include, but are not limited to, antipsychotic agents (e.g., chlorpromazine, chlorprothixene, clozapine, fluphenazine, haloperidol, loxapine, mesoridazine, molindone, olanzapine, perphenazine, pimozide, quetiapine, risperidone, thioridazine, thiothixene, trifluoperazine, and triflupromazine), antimanic agents (e.g., carbamazepine, divalproex sodium, lithium carbonate, and lithium citrate), antidepressants (e.g., amitriptyline, amoxapine, bupropion, citalopram, clomipramine, desipramine, doxepin, fluvoxamine, fluoxetine, imipramine, isocarboxazid, maprotiline, mirtazapine, nefazodone, nortriptyline, paroxetine, phenelzine, protriptyline, sertraline, tranylcypromine, trazodone, trimipramine, and venlafaxine), antianxiety agents (e.g., alprazolam, buspirone, chlordiazepoxide, clorazepate, diazepam, halazepam, lorazepam, oxazepam, and prazepam), and stimulants (e.g., d-amphetamine, methylphenidate, and pemoline).

[1080] In other embodiments, the Therapeutics of the invention are administered in combination with agents used to treat neurological disorders. Neurological agents that may be administered with the Therapeutics of the invention include, but are not limited to, antiepileptic agents (e.g., carbamazepine, clonazepam, ethosuximide, phenobarbital, phenytoin, primidone, valproic acid, divalproex sodium, felbamate, gabapentin, lamotrigine, levetiracetam, oxcarbazepine, tiagabine, topiramate, zonisamide, diazepam, lorazepam, and clonazepam), antiparkinsonian agents (e.g., levodopa/carbidopa, selegiline, amantidine, bromocriptine, pergolide, ropinirole, pramipexole, benztropine; biperiden; ethopropazine; procyclidine; trihexyphenidyl, tolcapone), and ALS therapeutics (e.g. riluzole).

[1081] In another embodiment, Therapeutics of the invention are administered in combination with vasodilating agents and/or calcium channel blocking agents. Vasodilating agents that may be administered with the Therapeutics of the invention include, but are not limited to, Angiotensin Converting Enzyme (ACE) inhibitors (e.g., papaverine, isoxsuprine, benazepril, captopril, cilazapril, enalapril, enalaprilat, fosinopril, lisinopril, moexipril, perindopril, quinapril, ramipril, spirapril, trandolapril, and nylidrin), and nitrates (e.g., isosorbide dinitrate, isosorbide mononitrate, and nitroglycerin). Examples of calcium channel blocking agents that may be administered in combination with the Therapeutics of the invention include, but are not limited to amlodipine, bepridil, diltiazem, felodipine, flunarizine, isradipine, nicardipine, nifedipine, nimodipine, and verapamil.

[1082] In additional embodiments, the Therapeutics of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.

Example 14

Method of Treating Decreased Levels of the Polypeptide

[1083] The present invention relates to a method for treating an individual in need of an increased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an agonist of the invention (including polypeptides of the invention). Moreover, it will be appreciated that conditions caused by a decrease in the standard or normal expression level of a polypeptide of the present invention in an individual can be treated by administering the agonist or antagonist of the present invention. Thus, the invention also provides a method of treatment of an individual in need of an increased level of the polypeptide comprising administering to such an individual a Therapeutic comprising an amount of the agonist or antagonist to increase the activity level of the polypeptide in such an individual.

[1084] For example, a patient with decreased levels of a polypeptide receives a daily dose 0.1-100 ug/kg of the agonist or antagonist for six consecutive days. The exact details of the dosing scheme, based on administration and formulation, are provided in Example 13.

Example 15

Method of Treating Increased Levels of the Polypeptide

[1085] The present invention also relates to a method of treating an individual in need of a decreased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including polypeptides and antibodies of the invention).

[1086] In one example, antisense technology is used to inhibit production of a polypeptide of the present invention. This technology is one example of a method of decreasing levels of a polypeptide, due to a variety of etiologies, such as cancer.

[1087] For example, a patient diagnosed with abnormally increased levels of a polypeptide is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day rest period if the treatment was well tolerated. The formulation of the antisense polynucleotide is provided in Example 13.

Example 16

Method of Treatment Using Gene Therapy-Ex Vivo

[1088] One method of gene therapy transplants fibroblasts, which are capable of expressing a polypeptide, onto a patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) is added. The flasks are then incubated at 37 degree C. for approximately one week.

[1089] At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

[1090] pMV-7 (Kirschmeier, P. T. et al., DNA, 7:219-25 (1988)), flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

[1091] The cDNA encoding a polypeptide of the present invention can be amplified using PCR primers which correspond to the 5′ and 3′ end sequences respectively as set forth in Example 1 using primers and having appropriate restriction sites and initiation/stop codons, if necessary. Preferably, the 5′ primer contains an EcoRI site and the 3′ primer includes a HindIII site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is then used to transform bacteria HB101, which are then plated onto agar containing kanamycin for the purpose of confirming that the vector has the gene of interest properly inserted.

[1092] The amphotropic pA317 or GP+am12 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).

[1093] Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. Once the fibroblasts have been efficiently infected, the fibroblasts are analyzed to determine whether protein is produced.

[1094] The engineered fibroblasts are then transplanted onto the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.

Example 17

Gene Therapy Using Endogenous Genes Corresponding To Polynucleotides of the Invention

[1095] Another method of gene therapy according to the present invention involves operably associating the endogenous polynucleotide sequence of the invention with a promoter via homologous recombination as described, for example, in U.S. Pat. No. 5,641,670, issued Jun. 24, 1997; International Publication NO: WO 96/29411, published Sep. 26, 1996; International Publication NO: WO 94/12650, published Aug. 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA, 86:8932-8935 (1989); and Zijlstra et al., Nature, 342:435-438 (1989). This method involves the activation of a gene which is present in the target cells, but which is not expressed in the cells, or is expressed at a lower level than desired.

[1096] Polynucleotide constructs are made which contain a promoter and targeting sequences, which are homologous to the 5′ non-coding sequence of endogenous polynucleotide sequence, flanking the promoter. The targeting sequence will be sufficiently near the 5′ end of the polynucleotide sequence so the promoter will be operably linked to the endogenous sequence upon homologous recombination. The promoter and the targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5′ and 3′ ends. Preferably, the 3′ end of the first targeting sequence contains the same restriction enzyme site as the 5′ end of the amplified promoter and the 5′ end of the second targeting sequence contains the same restriction site as the 3′ end of the amplified promoter.

[1097] The amplified promoter and the amplified targeting sequences are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter and digested targeting sequences are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The construct is size fractionated on an agarose gel, then purified by phenol extraction and ethanol precipitation.

[1098] In this Example, the polynucleotide constructs are administered as naked polynucleotides via electroporation. However, the polynucleotide constructs may also be administered with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, precipitating agents, etc. Such methods of delivery are known in the art.

[1099] Once the cells are transfected, homologous recombination will take place which results in the promoter being operably linked to the endogenous polynucleotide sequence. This results in the expression of polynucleotide corresponding to the polynucleotide in the cell. Expression may be detected by immunological staining, or any other method known in the art.

[1100] Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM+10% fetal calf serum. Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg/ml acetylated bovine serum albumin. The final cell suspension contains approximately 3×106 cells/ml. Electroporation should be performed immediately following resuspension.

[1101] Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting to the locus corresponding to the polynucleotide of the invention, plasmid pUC18 (MBI Fermentas, Amherst, N.Y.) is digested with HindIII. The CMV promoter is amplified by PCR with an XbaI site on the 5′ end and a BamHI site on the 3′ end. Two non-coding sequences are amplified via PCR: one non-coding sequence (fragment 1) is amplified with a HindIII site at the 5′ end and an Xba site at the 3′end; the other non-coding sequence (fragment 2) is amplified with a BamHI site at the 5′end and a HindIII site at the 3′end. The CMV promoter and the fragments (1 and 2) are digested with the appropriate enzymes (CMV promoter—XbaI and BamHI; fragment 1—XbaI; fragment 2—BamHI) and ligated together. The resulting ligation product is digested with HindIII, and ligated with the HindIII-digested pUC18 plasmid.

[1102] Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 μg/ml. 0.5 ml of the cell suspension (containing approximately 1.5×106 cells) is then added to the cuvette, and the cell suspension and DNA solutions are gently mixed. Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 μF and 250-300 V, respectively. As voltage increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 mSec should be observed.

[1103] Electroporated cells are maintained at room temperature for approximately 5 min, and the contents of the cuvette are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf serum) in a 10 cm dish and incubated at 37 degree C. The following day, the media is aspirated and replaced with 10 ml of fresh media and incubated for a further 16-24 hours.

[1104] The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product. The fibroblasts can then be introduced into a patient as described above.

Example 18

Method of Treatment Using Gene Therapy—in vivo

[1105] Another aspect of the present invention is using in vivo gene therapy methods to treat disorders, diseases and conditions. The gene therapy method relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) sequences into an animal to increase or decrease the expression of the polypeptide. The polynucleotide of the present invention may be operatively linked to (i.e., associated with) a promoter or any other genetic elements necessary for the expression of the polypeptide by the target tissue. Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90/11092, WO98/11779; U.S. Pat. Nos. 5,693,622, 5,705,151, 5,580,859; Tabata et al., Cardiovasc. Res. 35(3):470-479 (1997); Chao et al., Pharmacol. Res. 35(6):517-522 (1997); Wolff, Neuromuscul. Disord. 7(5):314-318 (1997); Schwartz et al., Gene Ther. 3(5):405-411 (1996); Tsurumi et al., Circulation 94(12):3281-3290 (1996) (incorporated herein by reference).

[1106] The polynucleotide constructs may be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like). The polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.

[1107] The term “naked” polynucleotide, DNA or RNA, refers to sequences that are free from any delivery vehicle that acts to assist, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, the polynucleotides of the present invention may also be delivered in liposome formulations (such as those taught in Feigner P. L. et al. (1995) Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1):1-7) which can be prepared by methods well known to those skilled in the art.

[1108] The polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Any strong promoter known to those skilled in the art can be used for driving the expression of DNA. Unlike other gene therapy techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.

[1109] The polynucleotide construct can be delivered to the interstitial space of tissues within an animal, including muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue. Interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.

[1110] For the naked polynucleotide injection, an effective dosage amount of DNA or RNA will be in the range of from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in the procedure.

[1111] The dose response effects of injected polynucleotide in muscle in vivo is determined as follows. Suitable template DNA for production of mRNA coding for polypeptide of the present invention is prepared in accordance with a standard recombinant DNA methodology. The template DNA, which may be either circular or linear, is either used as naked DNA or complexed with liposomes. The quadriceps muscles of mice are then injected with various amounts of the template DNA.

[1112] Five to six week old female and male Balb/C mice are anesthetized by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the anterior thigh, and the quadriceps muscle is directly visualized. The template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute, approximately 0.5 cm from the distal insertion site of the muscle into the knee and about 0.2 cm deep. A suture is placed over the injection site for future localization, and the skin is closed with stainless steel clips.

[1113] After an appropriate incubation time (e.g., 7 days) muscle extracts are prepared by excising the entire quadriceps. Every fifth 15 um cross-section of the individual quadriceps muscles is histochemically stained for protein expression. A time course for protein expression may be done in a similar fashion except that quadriceps from different mice are harvested at different times. Persistence of DNA in muscle following injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experimentation in mice can be used to extrapolate proper dosages and other treatment parameters in humans and other animals using naked DNA.

Example 19

Transgenic Animals

[1114] The polypeptides of the invention can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate transgenic animals. In a specific embodiment, techniques described herein or otherwise known in the art, are used to express polypeptides of the invention in humans, as part of a gene therapy protocol.

[1115] Any technique known in the art may be used to introduce the transgene (i.e., polynucleotides of the invention) into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994); Carver et al., Biotechnology (NY) 11: 1263-1270 (1993); Wright et al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S. Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts or embryos; gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)); electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3:1803-1814 (1983)); introduction of the polynucleotides of the invention using a gene gun (see, e.g., Ulmer et al., Science 259:1745 (1993); introducing nucleic acid constructs into embryonic pleuripotent stem cells and transferring the stem cells back into the blastocyst; and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-723 (1989); etc. For a review of such techniques, see Gordon, “Transgenic Animals,” Intl. Rev. Cytol. 115:171-229 (1989), which is incorporated by reference herein in its entirety.

[1116] Any technique known in the art may be used to produce transgenic clones containing polynucleotides of the invention, for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells induced to quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature 385:810-813 (1997)).

[1117] The present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i.e., mosaic animals or chimeric. The transgene may be integrated as a single transgene or as multiple copies such as in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. When it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred. Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous gene are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous gene. The transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous gene in only that cell type, by following, for example, the teaching of Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.

[1118] Once transgenic animals have been generated, the expression of the recombinant gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-expressing tissue may also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgene product.

[1119] Once the founder animals are produced, they may be bred, inbred, outbred, or crossbred to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic animals to produce animals homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; and breeding to place the transgene on a distinct background that is appropriate for an experimental model of interest.

[1120] Transgenic animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of polypeptides of the present invention, studying conditions and/or disorders associated with aberrant expression, and in screening for compounds effective in ameliorating such conditions and/or disorders.

Example 20

Knock-Out Animals

[1121] Endogenous gene expression can also be reduced by inactivating or “knocking out” the gene and/or its promoter using targeted homologous recombination. (See e.g., Smithies et al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each of which is incorporated by reference herein in its entirety.) For example, a mutant, non-functional polynucleotide of the invention (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or regulatory regions of the gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo. In another embodiment, techniques known in the art are used to generate knockouts in cells that contain, but do not express the gene of interest. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the targeted gene. Such approaches are particularly suited in research and agricultural fields where modifications to embryonic stem cells can be used to generate animal offspring with an inactive targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). However this approach can be routinely adapted for use in humans provided the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors that will be apparent to those of skill in the art.

[1122] In further embodiments of the invention, cells that are genetically engineered to express the polypeptides of the invention, or alternatively, that are genetically engineered not to express the polypeptides of the invention (e.g., knockouts) are administered to a patient in vivo. Such cells may be obtained from the patient (i.e., animal, including human) or an MHC compatible donor and can include, but are not limited to fibroblasts, bone marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle cells, endothelial cells etc. The cells are genetically engineered in vitro using recombinant DNA techniques to introduce the coding sequence of polypeptides of the invention into the cells, or alternatively, to disrupt the coding sequence and/or endogenous regulatory sequence associated with the polypeptides of the invention, e.g., by transduction (using viral vectors, and preferably vectors that integrate the transgene into the cell genome) or transfection procedures, including, but not limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The coding sequence of the polypeptides of the invention can be placed under the control of a strong constitutive or inducible promoter or promoter/enhancer to achieve expression, and preferably secretion, of the polypeptides of the invention. The engineered cells which express and preferably secrete the polypeptides of the invention can be introduced into the patient systemically, e.g., in the circulation, or intraperitoneally.

[1123] Alternatively, the cells can be incorporated into a matrix and implanted in the body, e.g., genetically engineered fibroblasts can be implanted as part of a skin graft; genetically engineered endothelial cells can be implanted as part of a lymphatic or vascular graft. (See, for example, Anderson et al. U.S. Pat. No. 5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each of which is incorporated by reference herein in its entirety).

[1124] When the cells to be administered are non-autologous or non-MHC compatible cells, they can be administered using well known techniques which prevent the development of a host immune response against the introduced cells. For example, the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system.

[1125] Transgenic and “knock-out” animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of polypeptides of the present invention, studying conditions and/or disorders associated with aberrant expression, and in screening for compounds effective in ameliorating such conditions and/or disorders.

Example 21

Assays Detecting Stimulation or Inhibition of B Cell Proliferation and Differentiation

[1126] Generation of functional humoral immune responses requires both soluble and cognate signaling between B-lineage cells and their microenvironment. Signals may impart a positive stimulus that allows a B-lineage cell to continue its programmed development, or a negative stimulus that instructs the cell to arrest its current developmental pathway. To date, numerous stimulatory and inhibitory signals have been found to influence B cell responsiveness including IL-2, IL-4, IL-5, IL-6, IL-7, IL10, IL-13, IL-14 and IL-15. Interestingly, these signals are by themselves weak effectors but can, in combination with various co-stimulatory proteins, induce activation, proliferation, differentiation, homing, tolerance and death among B cell populations.

[1127] One of the best studied classes of B-cell co-stimulatory proteins is the TNF-superfamily. Within this family CD40, CD27, and CD30 along with their respective ligands CD154, CD70, and CD153 have been found to regulate a variety of immune responses. Assays which allow for the detection and/or observation of the proliferation and differentiation of these B-cell populations and their precursors are valuable tools in determining the effects various proteins may have on these B-cell populations in terms of proliferation and differentiation. Listed below are two assays designed to allow for the detection of the differentiation, proliferation, or inhibition of B-cell populations and their precursors.

[1128] In vitro Assay—Agonists or antagonists of the invention can be assessed for its ability to induce activation, proliferation, differentiation or inhibition and/or death in B-cell populations and their precursors. The activity of the agonists or antagonists of the invention on purified human tonsillar B cells, measured qualitatively over the dose range from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte co-stimulation assay in which purified tonsillar B cells are cultured in the presence of either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti-human IgM antibody as the priming agent. Second signals such as IL-2 and IL-15 synergize with SAC and IgM crosslinking to elicit B cell proliferation as measured by tritiated-thymidine incorporation. Novel synergizing agents can be readily identified using this assay. The assay involves isolating human tonsillar B cells by magnetic bead (MACS) depletion of CD3-positive cells. The resulting cell population is greater than 95% B cells as assessed by expression of CD45R(B220).

[1129] Various dilutions of each sample are placed into individual wells of a 96-well plate to which are added 105 B-cells suspended in culture medium (RPMI 1640 containing 10% FBS, 5×10−5M 2ME, 100U/ml penicillin, 10 ug/ml streptomycin, and 10−5 dilution of SAC) in a total volume of 150 ul. Proliferation or inhibition is quantitated by a 20 h pulse (1 uCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72 h post factor addition. The positive and negative controls are IL2 and medium respectively.

[1130] In Vivo Assay—BALB/c mice are injected (i.p.) twice per day with buffer only, or 2 mg/Kg of agonists or antagonists of the invention, or truncated forms thereof. Mice receive this treatment for 4 consecutive days, at which time they are sacrificed and various tissues and serum collected for analyses. Comparison of H&E sections from normal spleens and spleens treated with agonists or antagonists of the invention identify the results of the activity of the agonists or antagonists on spleen cells, such as the diffusion of peri-arterial lymphatic sheaths, and/or significant increases in the nucleated cellularity of the red pulp regions, which may indicate the activation of the differentiation and proliferation of B-cell populations. Immunohistochemical studies using a B cell marker, anti-CD45R(B220), are used to determine whether any physiological changes to splenic cells, such as splenic disorganization, are due to increased B-cell representation within loosely defined B-cell zones that infiltrate established T-cell regions.

[1131] Flow cytometric analyses of the spleens from mice treated with agonist or antagonist is used to indicate whether the agonists or antagonists specifically increases the proportion of ThB+, CD45R(B220)dull B cells over that which is observed in control mice.

[1132] Likewise, a predicted consequence of increased mature B-cell representation in vivo is a relative increase in serum Ig titers. Accordingly, serum IgM and IgA levels are compared between buffer and agonists or antagonists-treated mice.

[1133] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 22

T Cell Proliferation Assay

[1134] A CD3-induced proliferation assay is performed on PBMCs and is measured by the uptake of 3H-thymidine. The assay is performed as follows. Ninety-six well plates are coated with 100 μl/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched control mAb (B33.1) overnight at 4 degrees C. (1 μg/ml in 0.05M bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMC are isolated by F/H gradient centrifugation from human peripheral blood and added to quadruplicate wells (5×104/well) of mAb coated plates in RPMI containing 10% FCS and P/S in the presence of varying concentrations of agonists or antagonists of the invention (total volume 200 ul). Relevant protein buffer and medium alone are controls. After 48 hr. culture at 37 degrees C., plates are spun for 2 min. at 1000 rpm and 100 μl of supernatant is removed and stored −20 degrees C. for measurement of IL-2 (or other cytokines) if effect on proliferation is observed. Wells are supplemented with 100 ul of medium containing 0.5 uCi of 3H-thymidine and cultured at 37 degrees C. for 18-24 hr. Wells are harvested and incorporation of 3H-thymidine used as a measure of proliferation. Anti-CD3 alone is the positive control for proliferation. IL-2 (100 U/ml) is also used as a control which enhances proliferation. Control antibody which does not induce proliferation of T cells is used as the negative control for the effects of agonists or antagonists of the invention.

[1135] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 23

Effect of Agonists or Antagonists of the Invention on the Expression of MHC Class II, Costimulatory and Adhesion Molecules and Cell Differentiation of Monocytes and Monocyte-Derived Human Dendritic Cells

[1136] Dendritic cells are generated by the expansion of proliferating precursors found in the peripheral blood: adherent PBMC or elutriated monocytic fractions are cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells have the characteristic phenotype of immature cells (expression of CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating factors, such as TNF-α, causes a rapid change in surface phenotype (increased expression of MHC class I and II, costimulatory and adhesion molecules, downregulation of FCγR11, upregulation of CD83). These changes correlate with increased antigen-presenting capacity and with functional maturation of the dendritic cells.

[1137] FACS analysis of surface antigens is performed as follows. Cells are treated 1-3 days with increasing concentrations of agonist or antagonist of the invention or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1:20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4 degrees C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).

[1138] Effect on the production of cytokines. Cytokines generated by dendritic cells, in particular IL-12, are important in the initiation of T-cell dependent immune responses. IL-12 strongly influences the development of Th1 helper T-cell immune response, and induces cytotoxic T and NK cell function. An ELISA is used to measure the IL-12 release as follows. Dendritic cells (106/ml) are treated with increasing concentrations of agonists or antagonists of the invention for 24 hours. LPS (100 ng/ml) is added to the cell culture as positive control. Supernatants from the cell cultures are then collected and analyzed for IL-12 content using commercial ELISA kit (e.g., R & D Systems (Minneapolis, Minn.)). The standard protocols provided with the kits are used.

[1139] Effect on the expression of MHC Class II, costimulatory and adhesion molecules. Three major families of cell surface antigens can be identified on monocytes: adhesion molecules, molecules involved in antigen presentation, and Fc receptor. Modulation of the expression of MHC class II antigens and other costimulatory molecules, such as B7 and ICAM-1, may result in changes in the antigen presenting capacity of monocytes and ability to induce T cell activation. Increased expression of Fc receptors may correlate with improved monocyte cytotoxic activity, cytokine release and phagocytosis.

[1140] FACS analysis is used to examine the surface antigens as follows. Monocytes are treated 1-5 days with increasing concentrations of agonists or antagonists of the invention or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1:20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4 degrees C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).

[1141] Monocyte activation and/or increased survival. Assays for molecules that activate (or alternatively, inactivate) monocytes and/or increase monocyte survival (or alternatively, decrease monocyte survival) are known in the art and may routinely be applied to determine whether a molecule of the invention functions as an inhibitor or activator of monocytes. Agonists or antagonists of the invention can be screened using the three assays described below. For each of these assays, Peripheral blood mononuclear cells (PBMC) are purified from single donor leukopacks (American Red Cross, Baltimore, Md.) by centrifugation through a Histopaque gradient (Sigma). Monocytes are isolated from PBMC by counterflow centrifugal elutriation.

[1142] Monocyte Survival Assay. Human peripheral blood monocytes progressively lose viability when cultured in absence of serum or other stimuli. Their death results from internally regulated processes (apoptosis). Addition to the culture of activating factors, such as TNF-alpha dramatically improves cell survival and prevents DNA fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-free medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative control), and in the presence of varying concentrations of the compound to be tested. Cells are suspended at a concentration of 2×106/ml in PBS containing PI at a final concentration of 5 μg/ml, and then incubated at room temperature for 5 minutes before FACScan analysis. PI uptake has been demonstrated to correlate with DNA fragmentation in this experimental paradigm.

[1143] Effect on cytokine release. An important function of monocytes/macrophages is their regulatory activity on other cellular populations of the immune system through the release of cytokines after stimulation. An ELISA to measure cytokine release is performed as follows. Human monocytes are incubated at a density of 5×105 cells/ml with increasing concentrations of agonists or antagonists of the invention and under the same conditions, but in the absence of agonists or antagonists. For IL-12 production, the cells are primed overnight with IFN (100 U/ml) in the presence of agonist or antagonist of the invention. LPS (10 ng/ml) is then added. Conditioned media are collected after 24 h and kept frozen until use. Measurement of TNF-alpha, IL-10, MCP-1 and IL-8 is then performed using a commercially available ELISA kit (e.g., R & D Systems (Minneapolis, Minn.)) and applying the standard protocols provided with the kit.

[1144] Oxidative burst. Purified monocytes are plated in 96-w plate at 2-1×105 cell/well. Increasing concentrations of agonists or antagonists of the invention are added to the wells in a total volume of 0.2 ml culture medium (RPMI 1640+10% FCS, glutamine and antibiotics). After 3 days incubation, the plates are centrifuged and the medium is removed from the wells. To the macrophage monolayers, 0.2 ml per well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the stimulant (200 nM PMA). The plates are incubated at 37° C. for 2 hours and the reaction is stopped by adding 20 μl 1N NaOH per well: The absorbance is read at 610 nm. To calculate the amount of H2O2 produced by the macrophages, a standard curve of a H2O2 solution of known molarity is performed for each experiment.

[1145] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 24

Biological Effects of Agonists or Antagonists of the Invention

[1146] Astrocyte and Neuronal Assays

[1147] Agonists or antagonists of the invention, expressed in Escherichia coli and purified as described above, can be tested for activity in promoting the survival, neurite outgrowth, or phenotypic differentiation of cortical neuronal cells and for inducing the proliferation of glial fibrillary acidic protein immunopositive cells, astrocytes. The selection of cortical cells for the bioassay is based on the prevalent expression of FGF-I and FGF-2 in cortical structures and on the previously reported enhancement of cortical neuronal survival resulting from FGF-2 treatment. A thymidine incorporation assay, for example, can be used to elucidate an agonist or antagonist of the invention's activity on these cells.

[1148] Moreover, previous reports describing the biological effects of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro have demonstrated increases in both neuron survival and neurite outgrowth (Walicke et al., “Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhances neurite extension.” Proc. Natl. Acad. Sci. USA 83:3012-3016. (1986), assay herein incorporated by reference in its entirety). However, reports from experiments done on PC-12 cells suggest that these two responses are not necessarily synonymous and may depend on not only which FGF is being tested but also on which receptor(s) are expressed on the target cells. Using the primary cortical neuronal culture paradigm, the ability of an agonist or antagonist of the invention to induce neurite outgrowth can be compared to the response achieved with FGF-2 using, for example, a thymidine incorporation assay.

[1149] Fibroblast and Endothelial Cell Assays

[1150] Human lung fibroblasts are obtained from Clonetics (San Diego, Calif.) and maintained in growth media from Clonetics. Dermal microvascular endothelial cells are obtained from Cell Applications (San Diego, Calif.). For proliferation assays, the human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells/well in a 96-well plate for one day in growth medium. The cells are then incubated for one day in 0.1% BSA basal medium. After replacing the medium with fresh 0.1% BSA medium, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, Calif.) is added to each well to a final concentration of 10%. The cells are incubated for 4 hr. Cell viability is measured by reading in a CytoFluor fluorescence reader. For the PGE2 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or agonists or antagonists of the invention with or without IL-1a for 24 hours. The supernatants are collected and assayed for PGE2 by EIA kit (Cayman, Ann Arbor, Mich.). For the IL-6 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or with or without agonists or antagonists of the invention IL-1a for 24 hours. The supernatants are collected and assayed for IL-6 by ELISA kit (Endogen, Cambridge, Mass.).

[1151] Human lung fibroblasts are cultured with FGF-2 or agonists or antagonists of the invention for 3 days in basal medium before the addition of Alamar Blue to assess effects on growth of the fibroblasts. FGF-2 should show a stimulation at 10-2500 ng/ml which can be used to compare stimulation with agonists or antagonists of the invention.

[1152] Parkinson Models.

[1153] The loss of motor function in Parkinson's disease is attributed to a deficiency of striatal dopamine resulting from the degeneration of the nigrostriatal dopaminergic projection neurons. An animal model for Parkinson's that has been extensively characterized involves the systemic administration of 1-methyl-4 phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the CNS, MPTP is taken-up by astrocytes and catabolized by monoamine oxidase B to 1-methyl-4-phenyl pyridine (MPP+) and released. Subsequently, MPP+ is actively accumulated in dopaminergic neurons by the high-affinity reuptake transporter for dopamine. MPP+ is then concentrated in mitochondria by the electrochemical gradient and selectively inhibits nicotidamide adenine disphosphate: ubiquinone oxidoreductionase (complex I), thereby interfering with electron transport and eventually generating oxygen radicals.

[1154] It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF) has trophic activity towards nigral dopaminergic neurons (Ferrari et al., Dev. Biol. 1989). Recently, Dr. Unsicker's group has demonstrated that administering FGF-2 in gel foam implants in the striatum results in the near complete protection of nigral dopaminergic neurons from the toxicity associated with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).

[1155] Based on the data with FGF-2, agonists or antagonists of the invention can be evaluated to determine whether it has an action similar to that of FGF-2 in enhancing dopaminergic neuronal survival in vitro and it can also be tested in vivo for protection of dopaminergic neurons in the striatum from the damage associated with MPTP treatment. The potential effect of an agonist or antagonist of the invention is first examined in vitro in a dopaminergic neuronal cell culture paradigm. The cultures are prepared by dissecting the midbrain floor plate from gestation day 14 Wistar rat embryos. The tissue is dissociated with trypsin and seeded at a density of 200,000 cells/cm2 on polyorthinine-laminin coated glass coverslips. The cells are maintained in Dulbecco's Modified Eagle's medium and F12 medium containing hormonal supplements (N1). The cultures are fixed with paraformaldehyde after 8 days in vitro and are processed for tyrosine hydroxylase, a specific marker for dopaminergic neurons, immunohistochemical staining. Dissociated cell cultures are prepared from embryonic rats. The culture medium is changed every third day and the factors are also added at that time.

[1156] Since the dopaminergic neurons are isolated from animals at gestation day 14, a developmental time which is past the stage when the dopaminergic precursor cells are proliferating, an increase in the number of tyrosine hydroxylase immunopositive neurons would represent an increase in the number of dopaminergic neurons surviving in vitro. Therefore, if an agonist or antagonist of the invention acts to prolong the survival of dopaminergic neurons, it would suggest that the agonist or antagonist may be involved in Parkinson's Disease.

[1157] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 25

The Effect of Agonists or Antagonists of the Invention on the Growth of Vascular Endothelial Cells

[1158] On day 1, human umbilical vein endothelial cells (HUVEC) are seeded at 2-5×104 cells/35 mm dish density in M199 medium containing 4% fetal bovine serum (FBS), 16 units/ml heparin, and 50 units/ml endothelial cell growth supplements (ECGS, Biotechnique, Inc.). On day 2, the medium is replaced with M199 containing 10% FBS, 8 units/ml heparin. An agonist or antagonist of the invention, and positive controls, such as VEGF and basic FGF (bFGF) are added, at varying concentrations. On days 4 and 6, the medium is replaced. On day 8, cell number is determined with a Coulter Counter.

[1159] An increase in the number of HUVEC cells indicates that the compound of the invention may proliferate vascular endothelial cells, while a decrease in the number of HUVEC cells indicates that the compound of the invention inhibits vascular endothelial cells.

[1160] The studies described in this example tested activity of a polypeptide of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides (e.g., gene therapy), agonists, and/or antagonists of the invention.

Example 26

Rat Corneal Wound Healing Model

[1161] This animal model shows the effect of an agonist or antagonist of the invention on neovascularization. The experimental protocol includes:

[1162] Making a 1-1.5 mm long incision from the center of cornea into the stromal layer.

[1163] Inserting a spatula below the lip of the incision facing the outer corner of the eye.

[1164] Making a pocket (its base is 1-1.5 mm form the edge of the eye).

[1165] Positioning a pellet, containing 50 ng-5 ug of an agonist or antagonist of the invention, within the pocket.

[1166] Treatment with an agonist or antagonist of the invention can also be applied topically to the corneal wounds in a dosage range of 20 mg-500 mg (daily treatment for five days).

[1167] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 27

Diabetic Mouse and Glucocorticoid-Impaired Wound Healing Models

[1168] Diabetic db+/db+ Mouse Model.

[1169] To demonstrate that an agonist or antagonist of the invention accelerates the healing process, the genetically diabetic mouse model of wound healing is used. The full thickness wound healing model in the db+/db+ mouse is a well characterized, clinically relevant and reproducible model of impaired wound healing. Healing of the diabetic wound is dependent on formation of granulation tissue and re-epithelialization rather than contraction (Gartner, M. H. et al., J. Surg. Res. 52:389 (1992); Greenhalgh, D. G. et al., Am. J. Pathol. 136:1235 (1990)).

[1170] The diabetic animals have many of the characteristic features observed in Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison to their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single autosomal recessive mutation on chromosome 4 (db+) (Coleman et al. Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mandel et al., J. Immunol. 120:1375 (1978); Debray-Sachs, M. et al., Clin. Exp. Immunol. 51(1):1-7 (1983); Leiter et al., Am. J. of Pathol. 114:46-55 (1985)). Peripheral neuropathy, myocardial complications, and microvascular lesions, basement membrane thickening and glomerular filtration abnormalities have been described in these animals (Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984); Robertson et al., Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest. 40(4):460-473 (1979); Coleman, D. L., Diabetes 31 (Suppl): 1-6 (1982)). These homozygous diabetic mice develop hyperglycemia that is resistant to insulin analogous to human type II diabetes (Mandel et al., J. Immunol. 120:1375-1377 (1978)).

[1171] The characteristics observed in these animals suggests that healing in this model may be similar to the healing observed in human diabetes (Greenhalgh, et al., Am. J. of Pathol. 136:1235-1246 (1990)).

[1172] Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic (db+/+m) heterozygous littermates are used in this study (Jackson Laboratories). The animals are purchased at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. The experiments are conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.

[1173] Wounding protocol is performed according to previously reported methods (Tsuboi, R. and Rifkin, D. B., J. Exp. Med. 172:245-251 (1990)). Briefly, on the day of wounding, animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. The dorsal region of the animal is shaved and the skin washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is then created using a Keyes tissue punch. Immediately following wounding, the surrounding skin is gently stretched to eliminate wound expansion. The wounds are left open for the duration of the experiment. Application of the treatment is given topically for 5 consecutive days commencing on the day of wounding. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges.

[1174] Wounds are visually examined and photographed at a fixed distance at the day of surgery and at two day intervals thereafter. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

[1175] An agonist or antagonist of the invention is administered using at a range different doses, from 4 mg to 500 mg per wound per day for 8 days in vehicle. Vehicle control groups received 50 mL of vehicle solution.

[1176] Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg/kg). The wounds and surrounding skin are then harvested for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.

[1177] Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are evaluated: 1) Vehicle placebo control, 2) untreated group, and 3) treated group.

[1178] Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total square area of the wound. Contraction is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64 mm2, the corresponding size of the dermal punch. Calculations are made using the following formula:

[Open area on day 8]−[Open area on day 1]/[Open area on day 1]

[1179] Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5 mm) and cut using a Reichert-Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected wounds. Histologic examination of the wounds are used to assess whether the healing process and the morphologic appearance of the repaired skin is altered by treatment with an agonist or antagonist of the invention. This assessment included verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, re-epithelialization and epidermal maturity (Greenhalgh, D. G. et al., Am. J. Pathol. 136:1235 (1990). A calibrated lens micrometer is used by a blinded observer.

[1180] Tissue sections are also stained immunohistochemically with a polyclonal rabbit anti-human keratin antibody using ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control. Keratinocyte growth is determined by evaluating the extent of reepithelialization of the wound using a calibrated lens micrometer.

[1181] Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is demonstrated by using anti-PCNA antibody (1:50) with an ABC Elite detection system. Human colon cancer served as a positive tissue control and human brain tissue is used as a negative tissue control. Each specimen included a section with omission of the primary antibody and substitution with non-immune mouse IgG. Ranking of these sections is based on the extent of proliferation on a scale of 0-8, the lower side of the scale reflecting slight proliferation to the higher side reflecting intense proliferation.

[1182] Experimental data are analyzed using an unpaired t test. A p value of <0.05 is considered significant.

[1183] Steroid Impaired Rat Model

[1184] The inhibition of wound healing by steroids has been well documented in various in vitro and in vivo systems (Wahl, Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahlet al., J. Immunol. 115: 476-481 (1975); Werb et al., J. Exp. Med. 147:1684-1694 (1978)). Glucocorticoids retard wound healing by inhibiting angiogenesis, decreasing vascular permeability (Ebert et al., An. Intern. Med. 37:701-705 (1952)), fibroblast proliferation, and collagen synthesis (Beck et al., Growth Factors. 5: 295-304 (1991); Haynes et al., J. Clin. Invest. 61: 703-797 (1978)) and producing a transient reduction of circulating monocytes (Haynes et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, “Glucocorticoids and wound healing”, In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989)). The systemic administration of steroids to impaired wound healing is a well establish phenomenon in rats (Beck et al., Growth Factors. 5. 295-304 (1991); Haynes et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, “Glucocorticoids and wound healing”, In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989); Pierce et al., Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).

[1185] To demonstrate that an agonist or antagonist of the invention can accelerate the healing process, the effects of multiple topical applications of the agonist or antagonist on full thickness excisional skin wounds in rats in which healing has been impaired by the systemic administration of methylprednisolone is assessed.

[1186] Young adult male Sprague Dawley rats weighing 250-300 g (Charles River Laboratories) are used in this example. The animals are purchased at 8 weeks of age and are 9 weeks old at the beginning of the study. The healing response of rats is impaired by the systemic administration of methylprednisolone (17 mg/kg/rat intramuscularly) at the time of wounding. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. This study is conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.

[1187] The wounding protocol is followed according to section A, above. On the day of wounding, animals are anesthetized with an intramuscular injection of ketamine (50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal is shaved and the skin washed with 70% ethanol and iodine solutions. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is created using a Keyes tissue punch. The wounds are left open for the duration of the experiment. Applications of the testing materials are given topically once a day for 7 consecutive days commencing on the day of wounding and subsequent to methylprednisolone administration. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges.

[1188] Wounds are visually examined and photographed at a fixed distance at the day of wounding and at the end of treatment. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

[1189] The agonist or antagonist of the invention is administered using at a range different doses, from 4 mg to 500 mg per wound per day for 8 days in vehicle. Vehicle control groups received 50 mL of vehicle solution.

[1190] Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg/kg). The wounds and surrounding skin are then harvested for histology. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.

[1191] Three groups of 10 animals each (5 with methylprednisolone and 5 without glucocorticoid) are evaluated: 1) Untreated group 2) Vehicle placebo control 3) treated groups.

[1192] Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total area of the wound. Closure is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64 mm2, the corresponding size of the dermal punch. Calculations are made using the following formula:

[Open area on day 8]−[Open area on day 1]/[Open area on day 1]

[1193] Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5 mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected wounds. Histologic examination of the wounds allows assessment of whether the healing process and the morphologic appearance of the repaired skin is improved by treatment with an agonist or antagonist of the invention. A calibrated lens micrometer is used by a blinded observer to determine the distance of the wound gap.

[1194] Experimental data are analyzed using an unpaired t test. A p value of <0.05 is considered significant.

[1195] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 28

Lymphadema Animal Model

[1196] The purpose of this experimental approach is to create an appropriate and consistent lymphedema model for testing the therapeutic effects of an agonist or antagonist of the invention in lymphangiogenesis and re-establishment of the lymphatic circulatory system in the rat hind limb. Effectiveness is measured by swelling volume of the affected limb, quantification of the amount of lymphatic vasculature, total blood plasma protein, and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more importantly, the chronic progress of the edema is followed for up to 3-4 weeks.

[1197] Prior to beginning surgery, blood sample is drawn for protein concentration analysis. Male rats weighing approximately ˜350 g are dosed with Pentobarbital. Subsequently, the right legs are shaved from knee to hip. The shaved area is swabbed with gauze soaked in 70% EtOH. Blood is drawn for serum total protein testing. Circumference and volumetric measurements are made prior to injecting dye into paws after marking 2 measurement levels (0.5 cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of both right and left paws are injected with 0.05 ml of 1% Evan's Blue. Circumference and volumetric measurements are then made following injection of dye into paws.

[1198] Using the knee joint as a landmark, a mid-leg inguinal incision is made circumferentially allowing the femoral vessels to be located. Forceps and hemostats are used to dissect and separate the skin flaps. After locating the femoral vessels, the lymphatic vessel that runs along side and underneath the vessel(s) is located. The main lymphatic vessels in this area are then electrically coagulated or suture ligated.

[1199] Using a microscope, muscles in back of the leg (near the semitendinosis and adductors) are bluntly dissected. The popliteal lymph node is then located. The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the popliteal node are then ligated by suturing. The popliteal lymph node, and any accompanying adipose tissue, is then removed by cutting connective tissues.

[1200] Care is taken to control any mild bleeding resulting from this procedure. After lymphatics are occluded, the skin flaps are sealed by using liquid skin (Vetbond) (AJ Buck). The separated skin edges are sealed to the underlying muscle tissue while leaving a gap of ˜0.5 cm around the leg. Skin also may be anchored by suturing to underlying muscle when necessary.

[1201] To avoid infection, animals are housed individually with mesh (no bedding). Recovering animals are checked daily through the optimal edematous peak, which typically occurred by day 5-7. The plateau edematous peak are then observed. To evaluate the intensity of the lymphedema, the circumference and volumes of 2 designated places on each paw before operation and daily for 7 days are measured. The effect of plasma proteins on lymphedema is determined and whether protein analysis is a useful testing perimeter is also investigated. The weights of both control and edematous limbs are evaluated at 2 places. Analysis is performed in a blind manner.

[1202] Circumference Measurements: Under brief gas anesthetic to prevent limb movement, a cloth tape is used to measure limb circumference. Measurements are done at the ankle bone and dorsal paw by 2 different people and those 2 readings are averaged. Readings are taken from both control and edematous limbs.

[1203] Volumetric Measurements: On the day of surgery, animals are anesthetized with Pentobarbital and are tested prior to surgery. For daily volumetrics animals are under brief halothane anesthetic (rapid immobilization and quick recovery), and both legs are shaved and equally marked using waterproof marker on legs. Legs are first dipped in water, then dipped into instrument to each marked level, then measured by Buxco edema software(Chen/Victor). Data is recorded by one person, while the other is dipping the limb to marked area.

[1204] Blood-plasma protein measurements: Blood is drawn, spun, and serum separated prior to surgery and then at conclusion for total protein and Ca2+ comparison.

[1205] Limb Weight Comparison: After drawing blood, the animal is prepared for tissue collection. The limbs are amputated using a quillitine, then both experimental and control legs are cut at the ligature and weighed. A second weighing is done as the tibio-cacaneal joint is disarticulated and the foot is weighed.

[1206] Histological Preparations: The transverse muscle located behind the knee (popliteal) area is dissected and arranged in a metal mold, filled with freezegel, dipped into cold methylbutane, placed into labeled sample bags at −80EC until sectioning. Upon sectioning, the muscle is observed under fluorescent microscopy for lymphatics.

[1207] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 29

Suppression of TNF Alpha-Induced Adhesion Molecule Expression by a Agonist or Antagonist of the Invention

[1208] The recruitment of lymphocytes to areas of inflammation and angiogenesis involves specific receptor-ligand interactions between cell surface adhesion molecules (CAMs) on lymphocytes and the vascular endothelium. The adhesion process, in both normal and pathological settings, follows a multi-step cascade that involves intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and endothelial leukocyte adhesion molecule-1 (E-selectin) expression on endothelial cells (EC.) The expression of these molecules and others on the vascular endothelium determines the efficiency with which leukocytes may adhere to the local vasculature and extravasate into the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participate in the modulation of the expression of these CAMs.

[1209] Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytokine, is a stimulator of all three CAMs on endothelial cells and may be involved in a wide variety of innflammatory responses, often resulting in a pathological outcome.

[1210] The potential of an agonist or antagonist of the invention to mediate a suppression of TNF-a induced CAM expression can be examined. A modified ELISA assay which uses ECs as a solid phase absorbent is employed to measure the amount of CAM expression on TNF-a treated ECs when co-stimulated with a member of the FGF family of proteins.

[1211] To perform the experiment, human umbilical vein endothelial cell (HUVEC) cultures are obtained from pooled cord harvests and maintained in growth medium (EGM-1; Clonetics, San Diego, Calif.) supplemented with 10% FCS and 1% penicillin/streptomycin in a 37 degree C. humidified incubator containing 5% CO2. HUVECs are seeded in 96-plates at concentrations of 1×104 cells/well in EGM medium at 37 degree C. for 18-24 hrs or until confluent. The monolayers are subsequently washed 3 times with a serum-free solution of RPMI-1640 supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, and treated with a given cytokine and/or growth factor(s) for 24 h at 37 degree C. Following incubation, the cells are then evaluated for CAM expression.

[1212] Human Umbilical Vein Endothelial cells (HUVECs) are grown in a standard 96 well plate to confluence. Growth medium is removed from the cells and replaced with 90 ul of 199 Medium (10% FBS). Samples for testing and positive or negative controls are added to the plate in triplicate (in 10 ul volumes). Plates are incubated at 37 degree C. for either 5 h (selectin and integrin expression) or 24 h (integrin expression only). Plates are aspirated to remove medium and 100 μl of 0.1% paraformaldehyde-PBS(with Ca++ and Mg−+) is added to each well. Plates are held at 4° C. for 30 min.

[1213] Fixative is then removed from the wells and wells are washed 1× with PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the wells to dry. Add 10 μl of diluted primary antibody to the test and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 μg/ml (1:10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at 37° C. for 30 min. in a humidified environment. Wells are washed ×3 with PBS(+Ca,Mg)+0.5% BSA.

[1214] Then add 20 μl of diluted ExtrAvidin-Alkaline Phosphotase (1:5,000 dilution) to each well and incubated at 37° C. for 30 min. Wells are washed ×3 with PBS(+Ca,Mg)+0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Standard wells in triplicate are prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1:5,000 (100)>10−0.5>10−1>10−1.5. 5 μl of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 μl of pNNP reagent must then be added to each of the standard wells. The plate must be incubated at 37° C. for 4 h. A volume of 50 μl of 3M NaOH is added to all wells. The results are quantified on a plate reader at 405 nm. The background subtraction option is used on blank wells filled with glycine buffer only. The template is set up to indicate the concentration of AP-conjugate in each standard well [5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. Results are indicated as amount of bound AP-conjugate in each sample.

[1215] The studies described in this example tested activity of agonists or antagonists of the invention. However, one skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides or polypeptides of the invention (e.g., gene therapy).

Example 30

Production of Polypeptide of the Invention for High-Throughput Screening Assays

[1216] The following protocol produces a supernatant containing polypeptide of the present invention to be tested. This supernatant can then be used in the Screening Assays described in Examples 32-41.

[1217] First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution (1 mg/ml in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a working solution of 50 ug/ml. Add 200 ul of this solution to each well (24 well plates) and incubate at RT for 20 minutes. Be sure to distribute the solution over each well (note: a 12-channel pipetter may be used with tips on every other channel). Aspirate off the Poly-D-Lysine solution and rinse with 1 ml PBS (Phosphate Buffered Saline). The PBS should remain in the well until just prior to plating the cells and plates may be poly-lysine coated in advance for up to two weeks.

[1218] Plate 293T cells (do not carry cells past P+20) at 2×105 cells/well in 0.5 ml DMEM (Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine (12-604F Biowhittaker))/10% heat inactivated FBS (14-503F Biowhittaker)/1×Penstrep (17-602E Biowhittaker). Let the cells grow overnight.

[1219] The next day, mix together in a sterile solution basin: 300 ul Lipofectamine (18324-012 Gibco/BRL) and 5 ml Optimem 1 (31985070 Gibco/BRL)/96-well plate. With a small volume multi-channel pipetter, aliquot approximately 2 ug of an expression vector containing a polynucleotide insert, produced by the methods described in Examples 8-10, into an appropriately labeled 96-well round bottom plate. With a multi-channel pipetter, add 50 ul of the Lipofectamine/Optimem I mixture to each well. Pipette up and down gently to mix. Incubate at RT 15-45 minutes. After about 20 minutes, use a multi-channel pipetter to add 150 ul Optimem I to each well. As a control, one plate of vector DNA lacking an insert should be transfected with each set of transfections.

[1220] Preferably, the transfection should be performed by tag-teaming the following tasks. By tag-teaming, hands on time is cut in half, and the cells do not spend too much time on PBS. First, person A aspirates off the media from four 24-well plates of cells, and then person B rinses each well with 0.5-1 ml PBS. Person A then aspirates off PBS rinse, and person B, using a12-channel pipetter with tips on every other channel, adds the 200 ul of DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even wells, to each row on the 24-well plates. Incubate at 37 degree C. for 6 hours.

[1221] While cells are incubating, prepare appropriate media, either 1%BSA in DMEM with 1×penstrep, or HGS CHO-5 media (116.6 mg/L of CaCl2 (anhyd); 0.00130 mg/L CuSO4-5H2O; 0.050 mg/L of Fe(NO3)3-9H2O; 0.417 mg/L of FeSO4-7H2O; 311.80 mg/L of Kcl; 28.64 mg/L of MgCl2; 48.84 mg/L of MgSO4; 6995.50 mg/L of NaCl; 2400.0 mg/L of NaHCO3; 62.50 mg/L of NaH2PO4-H2O; 71.02 mg/L of Na2HPO4; 0.4320 mg/L of ZnSO4.7H2O; 0.002 mg/L of Arachidonic Acid; 1.022 mg/L of Cholesterol; 0.070 mg/L of DL-alpha-Tocopherol-Acetate; 0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic Acid; 0.010 mg/L of Myristic Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of Palmitric Acid; 0.010 mg/L of Palmitic Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20 mg/L of Tween 80; 4551 mg/L of D-Glucose; 130.85 mg/ml of L-Alanine; 147.50 mg/ml of L-Arginine-HCL; 7.50 mg/ml of L-Asparagine-H2O; 6.65 mg/ml of L-Aspartic Acid; 29.56 mg/ml of L-Cystine-2HCL-H2O; 31.29 mg/ml of L-Cystine-2HCL; 7.35 mg/ml of L-Glutamic Acid; 365.0 mg/ml of L-Glutamine; 18.75 mg/ml of Glycine; 52.48 mg/ml of L-Histidine-HCL-H2O; 106.97 mg/ml of L-Isoleucine; 111.45 mg/ml of L-Leucine; 163.75 mg/ml of L-Lysine HCL; 32.34 mg/ml of L-Methionine; 68.48 mg/ml of L-Phenylalainine; 40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine; 101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan; 91.79 mg/ml of L-Tryrosine-2Na-2H2O; and 99.65 mg/ml of L-Valine; 0.0035 mg/L of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L of Choline Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL; 0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L of Thiamine HCL; 0.365 mg/L of Thymidine; 0.680 mg/L of Vitamin B12; 25 mM of HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mg/L of Lipoic Acid; 0.081 mg/L of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium Pyruvate; 0.0067 mg/L of Sodium Selenite; 20 uM of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70 mg/L of Methyl-B-Cyclodextrin complexed with Linoleic Acid; 33.33 mg/L of Methyl-B-Cyclodextrin complexed with Oleic Acid; 10 mg/L of Methyl-B-Cyclodextrin complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with 2 mm glutamine and 1×penstrep. (BSA (81-068-3 Bayer) 100 gm dissolved in IL DMEM for a 10% BSA stock solution). Filter the media and collect 50 ul for endotoxin assay in 15 ml polystyrene conical.

[1222] The transfection reaction is terminated, preferably by tag-teaming, at the end of the incubation period. Person A aspirates off the transfection media, while person B adds 1.5 ml appropriate media to each well. Incubate at 37 degree C. for 45 or 72 hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.

[1223] On day four, using a 300 ul multichannel pipetter, aliquot 600 ul in one 1 ml deep well plate and the remaining supernatant into a 2 ml deep well. The supernatants from each well can then be used in the assays described in Examples 32-39.

[1224] It is specifically understood that when activity is obtained in any of the assays described below using a supernatant, the activity originates from either the polypeptide of the present invention directly (e.g., as a secreted protein) or by polypeptide of the present invention inducing expression of other proteins, which are then secreted into the supernatant. Thus, the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay.

Example 31

Construction of GAS Reporter Construct

[1225] One signal transduction pathway involved in the differentiation and proliferation of cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs pathway bind to gamma activation site “GAS” elements or interferon-sensitive responsive element (“ISRE”), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene.

[1226] GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or “STATs.” There are six members of the STATs family. Stat1 and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread). Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL-12. Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines.

[1227] The STATs are activated to translocate from the cytoplasm to the nucleus upori tyrosine phosphorylation by a set of kinases known as the Janus Kinase (“Jaks”) family. Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jak1, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells.

[1228] The Jaks are activated by a wide range of receptors summarized in the Table below. (Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621-51 (1995).) A cytokine receptor family, capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g, and IL-10. The Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one typtophan) and a WSXWS motif (a membrane proximal region encoding Trp-Ser-Xaa-Trp-Ser (SEQ ID NO:2)).

[1229] Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway.

[1230] Therefore, activation of the Jaks-STATs pathway, reflected by the binding of the GAS or the ISRE element, can be used to indicate proteins involved in the proliferation and differentiation of cells. For example, growth factors and cytokines are known to activate the Jaks-STATs pathway. (See Table below.) Thus, by using GAS elements linked to reporter molecules, activators of the Jaks-STATs pathway can be identified.

	JAKs
Ligand	tyk2	Jak1	Jak2	Jak3	STATS	GAS(elements) or ISRE
IFN family
IFN-a/B	+	+	−	−	1, 2, 3	ISRE
IFN-g		+	+	−	1	GAS (IRF1 > Lys6 > IFP)
Il-10	+	?	?	−	1, 3
gp130 family
IL-6 (Pleiotropic)	+	+	+	?	1, 3	GAS (IRF1 > Lys6 > IFP)
Il-11(Pleiotropic)	?	+	?	?	1, 3
OnM(Pleiotropic)	?	+	+	?	1, 3
LIF(Pleiotropic)	?	+	+	?	1, 3
CNTF(Pleiotropic)	−/+	+	+	?	1, 3
G-CSF(Pleiotropic)	?	+	?	?	1, 3
IL-12(Pleiotropic)	+	−	+	+	1, 3
g-C family
IL-2 (lymphocytes)	−	+	−	+	1, 3, 5	GAS
IL-4 (lymph/myeloid)	−	+	−	+	6	GAS (IRF1 = IFP >> Ly6)(IgH)
IL-7 (lymphocytes)	−	+	−	+	5	GAS
IL-9 (lymphocytes)	−	+	−	+	5	GAS
IL-13 (lymphocyte)	−	+	?	?	6	GAS
IL-15	?	+	?	+	5	GAS
gp140 family
IL-3 (myeloid)	−	−	+	−	5	GAS (IRF1 > IFP >> Ly6)
IL-5 (myeloid)	−	−	+	−	5	GAS
GM-CSF (myeloid)	−	−	+	−	5	GAS
Growth hormone family
GH	?	−	+	−	5
PRL	?	+/−	+	−	1, 3, 5
EPO	?	−	+	−	5	GAS (B-CAS > IRF1 = IFP >> Ly6)
Receptor Tyrosine Kinases
EGF	?	+	+	−	1, 3	GAS (IRF1)
PDGF	?	+	+	−	1, 3
CSF-1	?	+	+	−	1, 3	GAS (not IRF1)

[1231] To construct a synthetic GAS containing promoter element, which is used in the Biological Assays described in Examples 32-33, a PCR based strategy is employed to generate a GAS-SV40 promoter sequence. The 5′ primer contains four tandem copies of the GAS binding site found in the IRFI promoter and previously demonstrated to bind STATs upon induction with a range of cytokines (Rothman et al., Immunity 1:457-468 (1994).), although other GAS or ISRE elements can be used instead. The 5′ primer also contains 18 bp of sequence complementary to the SV40 early promoter sequence and is flanked with an XhoI site. The sequence of the 5′ primer is:

5′:GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCG (SEQ ID NO: 3)
AAATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3′

[1232] The downstream primer is complementary to the SV40 promoter and is flanked with a Hind III site: 5′:GCGGCAAGCTTTTTGCAAAGCCTAGGC:3′ (SEQ ID NO: 4)

[1233] PCR amplification is performed using the SV40 promoter template present in the B-gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is digested with XhoI/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward and reverse primers confirms that the insert contains the following sequence:

5′:CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAAT (SEQ ID NO: 5)
GATTTCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGC
CCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCC
GCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTC
GGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGG
CTTTTGCAAAAAGCTT:3′

[1234] With this GAS promoter element linked to the SV40 promoter, a GAS:SEAP2 reporter construct is next engineered. Here, the reporter molecule is a secreted alkaline phosphatase, or “SEAP.” Clearly, however, any reporter molecule can be used instead of SEAP, in this or in any of the other Examples. Well known reporter molecules that can be used instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, B-galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.

[1235] The above sequence confirmed synthetic GAS-SV40 promoter element is subcloned into the pSEAP-Promoter vector obtained from Clontech using HindIII and XhoI, effectively replacing the SV40 promoter with the amplified GAS:SV40 promoter element, to create the GAS-SEAP vector. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.

[1236] Thus, in order to generate mammalian stable cell lines expressing the GAS-SEAP reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using SalI and NotI, and inserted into a backbone vector containing the neomycin resistance gene, such as pGFP-1 (Clontech), using these restriction sites in the multiple cloning site, to create the GAS-SEAP/Neo vector. Once this vector is transfected into mammalian cells, this vector can then be used as a reporter molecule for GAS binding as described in Examples 32-33.

[1237] Other constructs can be made using the above description and replacing GAS with a different promoter sequence. For example, construction of reporter molecules containing NFK-B and EGR promoter sequences are described in Examples 34 and 35. However, many other promoters can be substituted using the protocols described in these Examples. For instance, SRE, IL-2, NFAT, or Osteocalcin promoters can be substituted, alone or in combination (e.g., GASINF-KB/EGR, GAS/NF-KB, Il-2/NFAT, or NF-KB/GAS). Similarly, other cell lines can be used to test reporter construct activity, such as HELA (epithelial), HUVEC (endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or Cardiomyocyte.

Example 32

High-Throughput Screening Assay for T-Cell Activity

[1238] The following protocol is used to assess T-cell activity by identifying factors, and determining whether supernate containing a polypeptide of the invention proliferates and/or differentiates T-cells. T-cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 31. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The T-cell used in this assay is Jurkat T-cells (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.

[1239] Jurkat T-cells are lymphoblastic CD4+ Th1 helper cells. In order to generate stable cell lines, approximately 2 million Jurkat cells are transfected with the GAS-SEAP/neo vector using DMRIE-C (Life Technologies)(transfection procedure described below). The transfected cells are seeded to a density of approximately 20,000 cells per well and transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are expanded and then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.

[1240] Specifically, the following protocol will yield sufficient cells for 75 wells containing 200 ul of cells. Thus, it is either scaled up, or performed in multiple to generate sufficient cells for multiple 96 well plates. Jurkat cells are maintained in RPMI+10% serum with 1%Pen-Strep. Combine 2.5 mls of OPTI-MEM (Life Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml OPTI-MEM containing 50 ul of DMRIE-C and incubate at room temperature for 15-45 mins.

[1241] During the incubation period, count cell concentration, spin down the required number of cells (107 per transfection), and resuspend in OPTI-MEM to a final concentration of 107 cells/ml. Then add 1 ml of 1×107 cells' in OPTI-MEM to T25 flask and incubate at 37 degree C. for 6 hrs. After the incubation, add 10 ml of RPMI+15% serum.

[1242] The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI+10% serum, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are treated with supernatants containing polypeptide of the present invention or polypeptide of the present invention induced polypeptides as produced by the protocol described in Example 30.

[1243] On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI+10% serum to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants being screened. For one 96 well plate, approximately 10 million cells (for 10 plates, 100 million cells) are required.

[1244] Transfer the cells to a triangular reservoir boat, in order to dispense the cells into a 96 well dish, using a 12 channel pipette. Using a 12 channel pipette, transfer 200 ul of cells into each well (therefore adding 100, 000 cells per well).

[1245] After all the plates have been seeded, 50 ul of the supernatants are transferred directly from the 96 well plate containing the supernatants into each well using a 12 channel pipette. In addition, a dose of exogenous interferon gamma (0.1, 1.0, 10 ng) is added to wells H9, H10, and H11 to serve as additional positive controls for the assay.

[1246] The 96 well dishes containing Jurkat cells treated with supernatants are placed in an incubator for 48 hrs (note: this time is variable between 48-72 hrs). 35 ul samples from each well are then transferred to an opaque 96 well plate using a 12 channel pipette. The opaque plates should be covered (using sellophene covers) and stored at −20 degree C. until SEAP assays' are performed according to Example 36. The plates containing the remaining treated cells are placed at 4 degree C. and serve as a source of material for repeating the assay on a specific well if desired.

[1247] As a positive control, 100 Unit/ml interferon gamma can be used which is known to activate Jurkat T cells. Over 30 fold induction is typically observed in the positive control wells.

[1248] The above protocol may be used in the generation of both transient, as well as stable, transfected cells, which would be apparent to those of skill in the art.

Example 33

High-Throughput Screening Assay Identifying Myeloid Activity

[1249] The following protocol is used to assess myeloid activity of polypeptide of the present invention by determining whether polypeptide of the present invention proliferates and/or differentiates myeloid cells. Myeloid cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 31. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The myeloid cell used in this assay is U937, a pre-monocyte cell line, although TF-1, HL60, or KG 1 can be used.

[1250] To transiently transfect U937 cells with the GAS/SEAP/Neo construct produced in Example 31, a DEAE-Dextran method (Kharbanda et. al., 1994, Cell Growth & Differentiation, 5:259-265) is used. First, harvest 2×10 U937 cells and wash with PBS. The U937 cells are usually grown in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin.

[1251] Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing 0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCl, 5 mM KCl, 375 uM Na2HPO4.7H2O, 1 mM MgCl2, and 675 uM CaCl2. Incubate at 37 degrees C. for 45 min.

[1252] Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in 10 ml complete medium and incubate at 37 degree C. for 36 hr.

[1253] The GAS-SEAP/U937 stable cells are obtained by growing the cells in 400 μg/ml G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 400 ug/ml G418 for couple of passages.

[1254] These cells are tested by harvesting 1×108 cells (this is enough for ten 96-well -well plates assay) and wash with PBS. Suspend the cells in 200 ml above described growth medium, with a final density of 5×105 cells/ml. Plate 200 ul cells per well in the 96-well plate (or 1×105 cells/well).

[1255] Add 50 ul of the supernatant prepared by the protocol described in Example 30. Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100 Unit/ml interferon gamma can be used which is known to activate U937 cells. Over 30 fold induction is typically observed in the positive control wells. SEAP assay the supernatant according to the protocol described in Example 36.

Example 34

High-Throughput Screening Assay Identifying Neuronal Activity

[1256] When cells undergo differentiation and proliferation, a group of genes are activated through many different signal transduction pathways. One of these genes, EGR1 (early growth response gene 1), is induced in various tissues and cell types upon activation. The promoter of EGR1 is responsible for such induction. Using the EGR1 promoter linked to reporter molecules, activation of cells can be assessed by polypeptide of the present invention.

[1257] Particularly, the following protocol is used to assess neuronal activity in PC12 cell lines. PC12 cells (rat phenochromocytoma cells) are known to proliferate and/or differentiate by activation with a number of mitogens, such as TPA (tetradecanoyl phorbol acetate), NGF (nerve growth factor), and EGF (epidermal growth factor). The EGR1 gene expression is activated during this treatment. Thus, by stably transfecting PC12 cells with a construct containing an EGR promoter linked to SEAP reporter, activation of PC12 cells by polypeptide of the present invention can be assessed.

[1258] The EGR/SEAP reporter construct can be assembled by the following protocol. The EGR-1 promoter sequence (−633 to +1)(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR amplified from human genomic DNA using the following primers:

(SEQ ID NO: 6)
5′ GCGCTCGAGGGATGACAGCGATAGAACCCCGG-3′
(SEQ ID NO: 7)
5′ GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3′

[1259] Using the GAS:SEAP/Neo vector produced in Example 31, EGR1 amplified product can then be inserted into this vector. Linearize the GAS:SEAP/Neo vector using restriction enzymes XhoI/HindIII, removing the GAS/SV40 stuffer. Restrict the EGR1 amplified product with these same enzymes. Ligate the vector and the EGR1 promoter.

[1260] To prepare 96 well-plates for cell culture, two mls of a coating solution (1:30 dilution of collagen type I (Upstate Biotech Inc. Cat#08-115) in 30% ethanol (filter sterilized)) is added per one 10 cm plate or 50 ml per well of the 96-well plate, and allowed to air dry for 2 hr.

[1261] PC12 cells are routinely grown in RPMI-1640 medium (Bio Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat-inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml streptomycin on a precoated 10 cm tissue culture dish. One to four split is done every three to four days. Cells are removed from the plates by scraping and resuspended with pipetting up and down for more than 15 times.

[1262] Transfect the EGR/SEAP/Neo construct into PC12 using the Lipofectamine protocol described in Example 30. EGR-SEAP/PC12 stable cells are obtained by growing the cells in 300 ug/ml G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 300 ug/ml G418 for couple of passages.

[1263] To assay for neuronal activity, a 10 cm plate with cells around 70 to 80% confluent is screened by removing the old medium. Wash the cells once with PBS (Phosphate buffered saline). Then starve the cells in low serum medium (RPMI-1640 containing 1% horse serum and 0.5% FBS with antibiotics) overnight.

[1264] The next morning, remove the medium and wash the cells with PBS. Scrape off the cells from the plate, suspend the cells well in 2 ml low serum medium. Count the cell number and add more low serum medium to reach final cell density as 5×105 cells/ml.

[1265] Add 200 ul of the cell suspension to each well of 96-well plate (equivalent to 1×105 cells/well). Add 50 ul supernatant produced by Example 30, 37 degree C. for 48 to 72 hr. As a positive control, a growth factor known to activate PC12 cells through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of SEAP is typically seen in the positive control wells. SEAP assay the supernatant according to Example 36.

Example 35

High-Throughput Screening Assay for T-Cell Activity

[1266] NF-KB (Nuclear Factor KB) is a transcription factor activated by a wide variety of agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression of certain viral gene products. As a transcription factor, NF-KB regulates the expression of genes involved in immune cell activation, control of apoptosis (NF-KB appears to shield cells from apoptosis), B and T-cell development, anti-viral and antimicrobial responses, and multiple stress responses.

[1267] In non-stimulated conditions, NF-KB is retained in the cytoplasm with I-KB (Inhibitor KB). However, upon stimulation, I-KB is phosphorylated and degraded, causing NF-KB to shuttle to the nucleus, thereby activating transcription of target genes. Target genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1 MHC.

[1268] Due to its central role and ability to respond to a range of stimuli, reporter constructs utilizing the NF-KB promoter element are used to screen the supernatants produced in Example 30. Activators or inhibitors of NF-KB would be useful in treating, preventing, and/or diagnosing diseases. For example, inhibitors of NF-KB could be used to treat those diseases related to the acute or chronic activation of NF-KB, such as rheumatoid arthritis.

[1269] To construct a vector containing the NF-KB promoter element, a PCR based strategy is employed. The upstream primer contains four tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID NO: 8), 18 bp of sequence complementary to the 5′ end of the SV40 early promoter sequence, and is flanked with an XhoI site:

(SEQ ID NO: 9)
5′:GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGA
CTTTCCATCCTGCCATCTCAATTAG:3′

[1270] The downstream primer is complementary to the 3′ end of the SV40 promoter and is flanked with a Hind III site:

[1271] 5′:GCGGCAAGCTTTTTGCAAAGCCTAGGC:3′ (SEQ ID NO: 4)

[1272] PCR amplification is performed using the SV40 promoter template present in the pB-gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is digested with XhoI and Hind III and subcloned into BLSK2-. (Stratagene) Sequencing with the T7 and T3 primers confirms the insert contains the following sequence:

(SEQ ID NO: 10)
5′:CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTC
CATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCC
CATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTG
ACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCT
ATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAA
GCTT:3′

[1273] Next, replace the SV40 minimal promoter element present in the pSEAP2-promoter plasmid (Clontech) with this NF-KB/SV40 fragment using XhoI and HindIII. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.

[1274] In order to generate stable mammalian cell lines, the NF-KB/SV40/SEAP cassette is removed from the above NF-KB/SEAP vector using restriction enzymes SalI and NotI, and inserted into a vector containing neomycin resistance. Particularly, the NF-KB/SV40/SEAP cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with SalI and NotI.

[1275] Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created and maintained according to the protocol described in Example 32. Similarly, the method for assaying supernatants with these stable Jurkat T-cells is also described in Example 32. As a positive control, exogenous TNF alpha (0.1,1, 10 ng) is added to wells H9, H10, and H11, with a 5-10 fold activation typically observed.

Example 36

Assay for SEAP Activity

[1276] As a reporter molecule for the assays described in Examples 32-35, SEAP activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure. The Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction Buffers used below.

[1277] Prime a dispenser with the 2.5×Dilution Buffer and dispense 15 ul of 2.5×dilution buffer into Optiplates containing 35 ul of a supernatant. Seal the plates with a plastic sealer and incubate at 65 degree C. for 30 min. Separate the Optiplates to avoid uneven heating.

[1278] Cool the samples to room temperature for 15 minutes. Empty the dispenser and prime with the Assay Buffer. Add 50 ml Assay Buffer and incubate at room temperature 5 min. Empty the dispenser and prime with the Reaction Buffer (see the Table below). Add 50 ul Reaction Buffer and incubate at room temperature for 20 minutes. Since the intensity of the chemiluminescent signal is time dependent, and it takes about 10 minutes to read 5 plates on a luminometer, thus one should treat 5 plates at each time and start the second set 10 minutes later.

[1279] Read the relative light unit in the luminometer. Set H12 as blank, and print the results. An increase in chemiluminescence indicates reporter activity.

Reaction Buffer Formulation:
# of plates	Rxn buffer diluent (ml)	CSPD (ml)
10	60	3
11	65	3.25
12	70	3.5
13	75	3.75
14	80	4
15	85	4.25
16	90	4.5
17	95	4.75
18	100	5
19	105	5.25
20	110	5.5
21	115	5.75
22	120	6
23	125	6.25
24	130	6.5
25	135	6.75
26	140	7
27	145	7.25
28	150	7.5
29	155	7.75
30	160	8
31	165	8.25
32	170	8.5
33	175	8.75
34	180	9
35	185	9.25
36	190	9.5
37	195	9.75
38	200	10
39	205	10.25
40	210	10.5
41	215	10.75
42	220	11
43	225	11.25
44	230	11.5
45	235	11.75
46	240	12
47	245	12.25
48	250	12.5
49	255	12.75
50	260	13

Example 37

High-Throughput Screening Assay Identifying Changes in Small Molecule Concentration and Membrane Permeability

[1280] Binding of a ligand to a receptor is known to alter intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alter membrane potential. These alterations can be measured in an assay to identify supernatants which bind to receptors of a particular cell. Although the following protocol describes an assay for calcium, this protocol can easily be modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule which is detectable by a fluorescent probe.

[1281] The following assay uses Fluorometric Imaging Plate Reader (“FLIPR”) to measure changes in fluorescent molecules (Molecular Probes) that bind small molecules. Clearly, any fluorescent molecule detecting a small molecule can be used instead of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F-14202), used here.

[1282] For adherent cells, seed the cells at 10,000-20,000 cells/well in a Co-star black 96-well plate with clear bottom. The plate is incubated in a CO2 incubator for 20 hours. The adherent cells are washed two times in Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash.

[1283] A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load the cells with fluo-4, 50 ul of 12 ug/ml fluo-4 is added to each well. The plate is incubated at 37 degrees C. in a CO2 incubator for 60 min. The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer.

[1284] For non-adherent cells, the cells are spun down from culture media. Cells are re-suspended to 2-5×106 cells/ml with HBSS in a 50-ml conical tube. 4 ul of 1 mg/ml fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The tube is then placed in a 37 degrees C. water bath for 30-60 min. The cells are washed twice with HBSS, resuspended to 1×106 cells/ml, and dispensed into a microplate, 100 ul/well. The plate is centrifuged at 1000 rpm for 5 min. The plate is then washed once in Denley Cell Wash with 200 ul, followed by an aspiration step to 100 ul final volume.

[1285] For a non-cell based assay, each well contains a fluorescent molecule, such as fluo-4. The supernatant is added to the well, and a change in fluorescence is detected.

[1286] To measure the fluorescence of intracellular calcium, the FLIPR is set for the following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6) Sample addition is 50 ul. Increased emission at 530 nm indicates an extracellular signaling event caused by the a molecule, either polypeptide of the present invention or a molecule induced by polypeptide of the present invention, which has resulted in an increase in the intracellular Ca++ concentration.

Example 38

High-Throughput Screening Assay Identifying Tyrosine Kinase Activity

[1287] The Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane and cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth factors including the PDGF, FGF, EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large family of RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also membrane-bound and extracellular matrix proteins.

[1288] Activation of RPTK by ligands involves ligand-mediated receptor dimerization, resulting in transphosphorylation of the receptor subunits and activation of the cytoplasmic tyrosine kinases. The cytoplasmic tyrosine kinases include receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).

[1289] Because of the wide range of known factors capable of stimulating tyrosine kinase activity, identifying whether polypeptide of the present invention or a molecule induced by polypeptide of the present invention is capable of activating tyrosine kinase signal transduction pathways is of interest. Therefore, the following protocol is designed to identify such molecules capable of activating the tyrosine kinase signal transduction pathways.

[1290] Seed target cells (e.g., primary keratinocytes) at a density of approximately 25,000 cells per well in a 96 well Loprodyne Silent Screen Plates purchased from Nalge Nunc (Naperville, Ill.). The plates are sterilized with two 30 minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hr with 100 ml of cell culture grade type I collagen (50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can be purchased from Sigma Chemicals (St. Louis, Mo.) or 10% Matrigel purchased from Becton Dickinson (Bedford, Mass.), or calf serum, rinsed with PBS and stored at 4 degree C. Cell growth on these plates is assayed by seeding 5,000 cells/well in growth medium and indirect quantitation of cell number through use of alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, Calif.) after 48 hr. Falcon plate covers #3071 from Becton Dickinson (Bedford, Mass.) are used to cover the Loprodyne Silent Screen Plates. Falcon Microtest III cell culture plates can also be used in some proliferation experiments.

[1291] To prepare extracts, A431 cells are seeded onto the nylon membranes of Loprodyne plates (20,000/200 ml/well) and cultured overnight in complete medium. Cells are quiesced by incubation in serum-free basal medium for 24 hr. After 5-20 minutes treatment with EGF (60 ng/ml) or 50 ul of the supernatant produced in Example 30, the medium was removed and 100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P207 and a cocktail of protease inhibitors (# 1836170) obtained from Boeheringer Mannheim (Indianapolis, Ind.)) is added to each well and the plate is shaken on a rotating shaker for 5 minutes at 4° C. The plate is then placed in a vacuum transfer manifold and the extract filtered through the 0.45 mm membrane bottoms of each well using house vacuum. Extracts are collected in a 96-well catch/assay plate in the bottom of the vacuum manifold and immediately placed on ice. To obtain extracts clarified by centrifugation, the content of each well, after detergent solubilization for 5 minutes, is removed and centrifuged for 15 minutes at 4 degree C. at 16,000×g.

[1292] Test the filtered extracts for levels of tyrosine kinase activity. Although many methods of detecting tyrosine kinase activity are known, one method is described here.

[1293] Generally, the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine residue on a specific substrate (a biotinylated peptide). Biotinylated peptides that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine kinases and are available from Boehringer Mannheim.

[1294] The tyrosine kinase reaction is set up by adding the following components in order. First, add 10 ul of 5uM Biotinylated Peptide, then 10 ul ATP/Mg2+(5 mM ATP/50 mM MgCl2), then 10 ul of 5×Assay Buffer (40 mM imidazole hydrochloride, pH 7.3, 40 mM beta-glycerophosphate, 1 mM EGTA, 100 mM MgCl2, 5 mM MnCl2, 0.5 mg/ml BSA), then 5 ul of Sodium Vanadate (1 mM), and then 5 ul of water. Mix the components gently and preincubate the reaction mix at 30 degree C. for 2 min. Initial the reaction by adding 10 ul of the control enzyme or the filtered supernatant.

[1295] The tyrosine kinase assay reaction is then terminated by adding 10 ul of 120 mm EDTA and place the reactions on ice.

[1296] Tyrosine kinase activity is determined by transferring 50 ul aliquot of reaction mixture to a microtiter plate (MTP) module and incubating at 37 degree C. for 20 min. This allows the streptavidin coated 96 well plate to associate with the biotinylated peptide. Wash the MTP module with 300 ul/well of PBS four times. Next add 75 ul of anti-phospolyrosine antibody conjugated to horse radish peroxidase (anti-P-Tyr-POD (0.5 u/ml)) to each well and incubate at 37 degree C. for one hour. Wash the well as above.

[1297] Next add 100 ul of peroxidase substrate solution (Boehringer Mannheim) and incubate at room temperature for at least 5 mins (up to 30 min). Measure the absorbance of the sample at 405 nm by using ELISA reader. The level of bound peroxidase activity is quantitated using an ELISA reader and reflects the level of tyrosine kinase activity.

Example 39

High-Throughput Screening Assay Identifying Phosphorylation Activity

[1298] As a potential alternative and/or complement to the assay of protein tyrosine kinase activity described in Example 38, an assay which detects activation (phosphorylation) of major intracellular signal transduction intermediates can also be used. For example, as described below one particular assay can detect tyrosine phosphorylation of the Erk-1 and Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected by substituting these molecules for Erk-1 or Erk-2 in the following assay.

[1299] Specifically, assay plates are made by coating the wells of a 96-well ELISA plate with 0.1 ml of protein G (1 ug/ml) for 2 hr at room temp, (RT). The plates are then rinsed with PBS and blocked with 3% BSA/PBS for 1 hr at RT. The protein G plates are then treated with 2 commercial monoclonal antibodies (100 ng/well) against Erk-1 and Erk-2 (1 hr at RT) (Santa Cruz Biotechnology). (To detect other molecules, this step can easily be modified by substituting a monoclonal antibody detecting any of the above described molecules.) After 3-5 rinses with PBS, the plates are stored at 4 degree C. until use.

[1300] A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and cultured overnight in growth medium. The cells are then starved for 48 hr in basal medium (DMEM) and then treated with EGF (6 ng/well) or 50 ul of the supernatants obtained in Example 30 for 5-20 minutes. The cells are then solubilized and extracts filtered directly into the assay plate.

[1301] After incubation with the extract for 1 hr at RT, the wells are again rinsed. As a positive control, a commercial preparation of MAP kinase (10 ng/well) is used in place of A431 extract. Plates are then treated with a commercial polyclonal (rabbit) antibody (1 ug/ml) which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is biotinylated by standard procedures. The bound polyclonal antibody is then quantitated by successive incubations with Europium-streptavidin and Europium fluorescence enhancing reagent in the Wallac DELFIA instrument (time-resolved fluorescence). An increased fluorescent signal over background indicates a phosphorylation by polypeptide of the present invention or a molecule induced by polypeptide of the present invention.

Example 40

Assay for the Stimulation of Bone Marrow CD34+Cell Proliferation

[1302] This assay is based on the ability of human CD34+ to proliferate in the presence of hematopoietic growth factors and evaluates the ability of isolated polypeptides expressed in mammalian cells to stimulate proliferation of CD34+ cells.

[1303] It has been previously shown that most mature precursors will respond to only a single signal. More immature precursors require at least two signals to respond. Therefore, to test the effect of polypeptides on hematopoietic activity of a wide range of progenitor cells, the assay contains a given polypeptide in the presence or absence of other hematopoietic growth factors. Isolated cells are cultured for 5 days in the presence of Stem Cell Factor (SCF) in combination with tested sample. SCF alone has a very limited effect on the proliferation of bone marrow (BM) cells, acting in such conditions only as a “survival” factor. However, combined with any factor exhibiting stimulatory effect on these cells (e.g., IL-3), SCF will cause a synergistic effect. Therefore, if the tested polypeptide has a stimulatory effect on hematopoietic progenitors, such activity can be easily detected. Since normal BM cells have a low level of cycling cells, it is likely that any inhibitory effect of a given polypeptide, or agonists or antagonists thereof, might not be detected. Accordingly, assays for an inhibitory effect on progenitors is preferably tested in cells that are first subjected to in vitro stimulation with SCF+IL+3, and then contacted with the compound that is being evaluated for inhibition of such induced proliferation.

[1304] Briefly, CD34+ cells are isolated using methods known in the art. The cells are thawed and resuspended in medium (QBSF 60 serum-free medium with 1% L-glutamine (500 ml) Quality Biological, Inc., Gaithersburg, Md. Cat# 160-204-101). After several gentle centrifugation steps at 200×g, cells are allowed to rest for one hour. The cell count is adjusted to 2.5×105 cells/ml. During this time, 100 μl of sterile water is added to the peripheral wells of a 96-well plate. The cytokines that can be tested with a given polypeptide in this assay is rhSCF (R&D Systems, Minneapolis, Minn., Cat# 255-SC) at 50 ng/ml alone and in combination with rhSCF and rhIL-3 (R&D Systems, Minneapolis, Minn., Cat# 203-ML) at 30 ng/ml. After one hour, 10 μL of prepared cytokines, 50 μl of the supernatants prepared in Example 30 (supernatants at 1:2 dilution=50 μl) and 20 μl of diluted cells are added to the media which is already present in the wells to allow for a final total volume of 100 μL. The plates are then placed in a 37° C./5% CO2 incubator for five days.

[1305] Eighteen hours before the assay is harvested, 0.5 μCi/well of [3H] Thymidine is added in a 10 μl volume to each well to determine the proliferation rate. The experiment is terminated by harvesting the cells from each 96-well plate to a filtermat using the Tomtec Harvester 96. After harvesting, the filtermats are dried, trimmed and placed into OmniFilter assemblies consisting of one OmniFilter plate and one OmniFilter Tray. 60 μl Microscint is added to each well and the plate sealed with TopSeal-A press-on sealing film A bar code 15 sticker is affixed to the first plate for counting. The sealed plates are then loaded and the level of radioactivity determined via the Packard Top Count and the printed data collected for analysis. The level of radioactivity reflects the amount of cell proliferation.

[1306] The studies described in this example test the activity of a given polypeptide to stimulate bone marrow CD34+ cell proliferation. One skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides (e.g., gene therapy), antibodies, agonists, and/or antagonists and fragments and variants thereof. As a nonlimiting example, potential antagonists tested in this assay would be expected to inhibit cell proliferation in the presence of cytokines and/or to increase the inhibition of cell proliferation in the presence of cytokines and a given polypeptide. In contrast, potential agonists tested in this assay would be expected to enhance cell proliferation and/or to decrease the inhibition of cell proliferation in the presence of cytokines and a given polypeptide.

[1307] The ability of a gene to stimulate the proliferation of bone marrow CD34+ cells indicates that polynucleotides and polypeptides corresponding to the gene are useful for the diagnosis and treatment of disorders affecting the immune system and hematopoiesis. Representative uses are described in the “Immune Activity” and “Infectious Disease” sections above, and elsewhere herein.

Example 41

Assay for Extracellular Matrix Enhanced Cell Response (EMECR)

[1308] The objective of the Extracellular Matrix Enhanced Cell Response (EMECR) assay is to identify gene products (e.g., isolated polypeptides) that act on the hematopoietic stem cells in the context of the extracellular matrix (ECM) induced signal.

[1309] Cells respond to the regulatory factors in the context of signal(s) received from the surrounding microenvironment. For example, fibroblasts, and endothelial and epithelial stem cells fail to replicate in the absence of signals from the ECM. Hematopoietic stem cells can undergo self-renewal in the bone marrow, but not in in vitro suspension culture. The ability of stem cells to undergo self-renewal in vitro is dependent upon their interaction with the stromal cells and the ECM protein fibronectin (fn). Adhesion of cells to fn is mediated by the α5.β1 and α4.β1 integrin receptors, which are expressed by human and mouse hematopoietic stem cells. The factor(s) which integrate with the ECM environment and are responsible for stimulating stem cell self-renewal have not yet been identified. Discovery of such factors should be of great interest in gene therapy and bone marrow transplant applications

[1310] Briefly, polystyrene, non tissue culture treated, 96-well plates are coated with fn fragment at a coating concentration of 0.2 μg/cm2. Mouse bone marrow cells are plated (1,000 cells/well) in 0.2 ml of serum-free medium. Cells cultured in the presence of IL-3 (5 ng/ml)+SCF (50 ng/ml) would serve as the positive control, conditions under which little self-renewal but pronounced differentiation of the stem cells is to be expected. Gene products of the invention (e.g., including, but not limited to, polynucleotides and polypeptides of the present invention, and supernatants produced in Example 30), are tested with appropriate negative controls in the presence and absence of SCF (5.0 ng/ml), where test factor supernatants represent 10% of the total assay volume. The plated cells are then allowed to grow by incubating in a low oxygen environment (5% CO2, 7% O2, and 88% N2) tissue culture incubator for 7 days. The number of proliferating cells within the wells is then quantitated by measuring thymidine incorporation into cellular DNA. Verification of the positive hits in the assay will require phenotypic characterization of the cells, which can be accomplished by scaling up of the culture system and using appropriate antibody reagents against cell surface antigens and FACScan.

[1311] One skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides (e.g., gene therapy), antibodies, agonists, and/or antagonists and fragments and variants thereof.

[1312] If a particular polypeptide of the present invention is found to be a stimulator of hematopoietic progenitors, polynucleotides and polypeptides corresponding to the gene encoding said polypeptide may be useful for the diagnosis and treatment of disorders affecting the immune system and hematopoiesis. Representative uses are described in the “Immune Activity” and “Infectious Disease” sections above, and elsewhere herein. The gene product may also be useful in the expansion of stem cells and committed progenitors of various blood lineages, and in the differentiation and/or proliferation of various cell types.

[1313] Additionally, the polynucleotides and/or polypeptides of the gene of interest and/or agonists and/or antagonists thereof, may also be employed to inhibit the proliferation and differentiation of hematopoietic cells and therefore may be employed to protect bone marrow stem cells from chemotherapeutic agents during chemotherapy. This antiproliferative effect may allow administration of higher doses of chemotherapeutic agents and, therefore, more effective chemotherapeutic treatment.

[1314] Moreover, polynucleotides and polypeptides corresponding to the gene of interest may also be useful for the treatment and diagnosis of hematopoietic related disorders such as, for example, anemia, pancytopenia, leukopenia, thrombocytopenia or leukemia since stromal cells are important in the production of cells of hematopoietic lineages. The uses include bone marrow cell ex-vivo culture, bone marrow transplantation, bone marrow reconstitution, radiotherapy or chemotherapy of neoplasia.

Example 42

Human Dermal Fibroblast and Aortic Smooth Muscle Cell Proliferation

[1315] The polypeptide of interest is added to cultures of normal human dermal fibroblasts (NHDF) and human aortic smooth muscle cells (AoSMC) and two co-assays are performed with each sample. The first assay examines the effect of the polypeptide of interest on the proliferation of normal human dermal fibroblasts (NHDF) or aortic smooth muscle cells (AoSMC). Aberrant growth of fibroblasts or smooth muscle cells is a part of several pathological processes, including fibrosis, and restenosis. The second assay examines IL6 production by both NHDF and SMC. IL6 production is an indication of functional activation. Activated cells will have increased production of a number of cytokines and other factors, which can result in a proinflammatory or immunomodulatory outcome. Assays are run with and without co-TNFa stimulation, in order to check for costimulatory or inhibitory activity.

[1316] Briefly, on day 1, 96-well black plates are set up with 1000 cells/well (NHDF) or 2000 cells/well (AoSMC) in 100 μl culture media. NHDF culture media contains: Clonetics FB basal media, 1 mg/ml hFGF, 5 mg/ml insulin, 50 mg/ml gentamycin, 2%FBS, while AoSMC culture media contains Clonetics SM basal media, 0.5 μg/ml hEGF, 5 mg/ml insulin, 1 μg/ml hFGF, 50 mg/ml gentamycin, 50 μg/ml Amphotericin B, 5%FBS. After incubation at 37° C. for at least 4-5 hours culture media is aspirated and replaced with growth arrest media. Growth arrest media for NHDF contains fibroblast basal media, 50 mg/ml gentamycin, 2% FBS, while growth arrest media for AoSMC contains SM basal media, 50 mg/ml gentamycin, 50 μg/ml Amphotericin B, 0.4% FBS. Incubate at 37° C. until day 2.

[1317] On day 2, serial dilutions and templates of the polypeptide of interest are designed such that they always include media controls and known-protein controls. For both stimulation and inhibition experiments, proteins are diluted in growth arrest media. For inhibition experiments, TNFa is added to a final concentration of 2 ng/ml (NHDF) or 5 ng/ml (AoSMC). Add ⅓ vol media containing controls or polypeptides of the present invention and incubate at 37 degrees C./5% CO2 until day 5.

[1318] Transfer 60 μl from each well to another labeled 96-well plate, cover with a plate-sealer, and store at 4 degrees C. until Day 6 (for IL6 ELISA). To the remaining 100 μl in the cell culture plate, aseptically add Alamar Blue in an amount equal to 10% of the culture volume (10 μl). Return plates to incubator for 3 to 4 hours. Then measure fluorescence with excitation at 530 nm and emission at 590 nm using the CytoFluor. This yields the growth stimulation/inhibition data.

[1319] On day 5, the IL6 ELISA is performed by coating a 96 well plate with 50-100 ul/well of Anti-Human IL6 Monoclonal antibody diluted in PBS, pH 7.4, incubate ON at room temperature.

[1320] On day 6, empty the plates into the sink and blot on paper towels. Prepare Assay Buffer containing PBS with 4% BSA. Block the plates with 200 μl/well of Pierce Super Block blocking buffer in PBS for 1-2 hr and then wash plates with wash buffer (PBS, 0.05% Tween-20). Blot plates on paper towels. Then add 50 μl/well of diluted Anti-Human IL-6 Monoclonal, Biotin-labeled antibody at 0.50 mg/ml. Make dilutions of IL-6 stock in media (30, 10, 3, 1, 0.3, 0 ng/ml). Add duplicate samples to top row of plate. Cover the plates and incubate for 2 hours at RT on shaker.

[1321] Plates are washed with wash buffer and blotted on paper towels. Dilute EU-labeled Streptavidin 1:1000 in Assay buffer, and add 100 μl/well. Cover the plate and incubate 1 h at RT. Plates are again washed with wash buffer and blotted on paper towels.

[1322] Add 100 μl/well of Enhancement Solution. Shake for 5 minutes. Read the plate on the Wallac DELFIA Fluorometer. Readings from triplicate samples in each assay were tabulated and averaged.

[1323] A positive result in this assay suggests AoSMC cell proliferation and that the polypeptide of the present invention may be involved in dermal fibroblast proliferation and/or smooth muscle cell proliferation. A positive result also suggests many potential uses of polypeptides, polynucleotides, agonists and/or antagonists of the polynucleotide/polypeptide of the present invention which gives a positive result. For example, inflammation and immune responses, wound healing, and angiogenesis, as detailed throughout this specification. Particularly, polypeptides of the present invention and polynucleotides of the present invention may be used in wound healing and dermal regeneration, as well as the promotion of vasculogenesis, both of the blood vessels and lymphatics. The growth of vessels can be used in the treatment of, for example, cardiovascular diseases. Additionally, antagonists of polypeptides and polynucleotides of the invention may be useful in treating diseases, disorders, and/or conditions which involve angiogenesis by acting as an anti-vascular agent (e.g., anti-angiogenesis). These diseases, disorders, and/or conditions are known in the art and/or are described herein, such as, for example, malignancies, solid tumors, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids); nonunion fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis; coronary collaterals; cerebral collaterals; arterioyenous malformations; ischemic limb angiogenesis; Osler-Webber Syndrome; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis. Moreover, antagonists of polypeptides and polynucleotides of the invention may be useful in treating anti-hyperproliferative diseases and/or anti-inflammatory known in the art and/or described herein.

[1324] One skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides (e.g., gene therapy), antibodies, agonists, and/or antagonists and fragments and variants thereof.

Example 43

Cellular Adhesion Molecule (CAM) Expression on Endothelial Cells

[1325] The recruitment of lymphocytes to areas of inflammation and angiogenesis involves specific receptor-ligand interactions between cell surface adhesion molecules (CAMs) on lymphocytes and the vascular endothelium. The adhesion process, in both normal and pathological settings, follows a multi-step cascade that involves intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and endothelial leukocyte adhesion molecule-1 (E-selectin) expression on endothelial cells (EC). The expression of these molecules and others on the vascular endothelium determines the efficiency with which leukocytes may adhere to the local vasculature and extravasate into the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participate in the modulation of the expression of these CAMs.

[1326] Briefly, endothelial cells (e.g., Human Umbilical Vein Endothelial cells (HUVECs)) are grown in a standard 96 well plate to confluence, growth medium is removed from the cells and replaced with 100 μl of 199 Medium (10% fetal bovine serum (FBS)). Samples for testing and positive or negative controls are added to the plate in triplicate (in 10 μl volumes). Plates are then incubated at 37° C. for either 5 h (selectin and integrin expression) or 24 h (integrin expression only). Plates are aspirated to remove medium and 100 μl of 0.1% paraformaldehyde-PBS(with Ca++ and Mg++) is added to each well. Plates are held at 4° C. for 30 min. Fixative is removed from the wells and wells are washed 1× with PBS(+Ca,Mg)+0.5% BSA and drained. 10 μl of diluted primary antibody is added to the test and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 μg/ml (1:10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at 37° C. for 30 min. in a humidified environment. Wells are washed three times with PBS(+Ca,Mg)+0.5% BSA. 20 μl of diluted ExtrAvidin-Alkaline Phosphatase (1:5,000 dilution, referred to herein as the working dilution) are added to each well and incubated at 37° C. for 30 min. Wells are washed three times with PBS(+Ca,Mg)+0.5% BSA. Dissolve 1 tablet of p-Nitrophenol Phosphate pNPP per 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Standard wells in triplicate are prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1:5,000 (100)>10−0.5>10−1>10−15. 5 μl of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 μl of pNNP reagent is then added to each of the standard wells. The plate is incubated at 37° C. for 4 h. A volume of 50 μl of 3M NaOH is added to all wells. The plate is read on a plate reader at 405 nm using the background subtraction option on blank wells filled with glycine buffer only. Additionally, the template is set up to indicate the concentration of AP-conjugate in each standard well [5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. Results are indicated as amount of bound AP-conjugate in each sample.

Example 44

Alamar Blue Endothelial Cells Proliferation Assay

[1327] This assay may be used to quantitatively determine protein mediated inhibition of bFGF-induced proliferation of Bovine Lymphatic Endothelial Cells (LECs), Bovine Aortic Endothelial Cells (BAECs) or Human Microvascular Uterine Myometrial Cells (UTMECs). This assay incorporates a fluorometric growth indicator based on detection of metabolic activity. A standard Alamar Blue Proliferation Assay is prepared in EGM-2MV with 10 ng/ml of bFGF added as a source of endothelial cell stimulation. This assay may be used with a variety of endothelial cells with slight changes in growth medium and cell concentration. Dilutions of the protein batches to be tested are diluted as appropriate. Serum-free medium (GIBCO SFM) without bFGF is used as a non-stimulated control and Angiostatin or TSP-1 are included as a known inhibitory controls.

[1328] Briefly, LEC, BAECs or UTMECs are seeded in growth media at a density of 5000 to 2000 cells/well in a 96 well plate and placed at 37degrees C. overnight. After the overnight incubation of the cells, the growth media is removed and replaced with GIBCO EC-SFM. The cells are treated with the appropriate dilutions of the protein of interest or control protein sample(s) (prepared in SFM) in triplicate wells with additional bFGF to a concentration of 10 ng/ml. Once the cells have been treated with the samples, the plate(s) is/are placed back in the 37° C. incubator for three days. After three days 10 ml of stock alamar blue (Biosource Cat# DAL 1100) is added to each well and the plate(s) is/are placed back in the 37° C. incubator for four hours. The plate(s) are then read at 530 nm excitation and 590 nm emission using the CytoFluor fluorescence reader. Direct output is recorded in relative fluorescence units.

[1329] Alamar blue is an oxidation-reduction indicator that both fluoresces and changes color in response to chemical reduction of growth medium resulting from cell growth. As cells grow in culture, innate metabolic activity results in a chemical reduction of the immediate surrounding environment. Reduction related to growth causes the indicator to change from oxidized (non-fluorescent blue) form to reduced (fluorescent red) form (i.e., stimulated proliferation will produce a stronger signal and inhibited proliferation will produce a weaker signal and the total signal is proportional to the total number of cells as well as their metabolic activity). The background level of activity is observed with the starvation medium alone. This is compared to the output observed from the positive control samples (bFGF in growth medium) and protein dilutions.

Example 45

Detection of Inhibition of a Mixed Lymphocyte Reaction

[1330] This assay can be used to detect and evaluate inhibition of a Mixed Lymphocyte Reaction (MLR) by gene products (e.g., isolated polypeptides). Inhibition of a MLR may be due to a direct effect on cell proliferation and viability, modulation of costimulatory molecules on interacting cells, modulation of adhesiveness between lymphocytes and accessory cells, or modulation of cytokine production by accessory cells. Multiple cells may be targeted by these polypeptides since the peripheral blood mononuclear fraction used in this assay includes T, B and natural killer lymphocytes, as well as monocytes and dendritic cells.

[1331] Polypeptides of interest found to inhibit the MLR may find application in diseases associated with lymphocyte and monocyte activation or proliferation. These include, but are not limited to, diseases such as asthma, arthritis, diabetes, inflammatory skin conditions, psoriasis, eczema, systemic lupus erythematosus, multiple sclerosis, glomerulonephritis, inflammatory bowel disease, crohn's disease, ulcerative colitis, arteriosclerosis, cirrhosis, graft vs. host disease, host vs. graft disease, hepatitis, leukemia and lymphoma.

[1332] Briefly, PBMCs from human donors are purified by density gradient centrifugation using Lymphocyte Separation Medium (LSM®, density 1.0770 g/ml, Organon Teknika Corporation, West Chester, Pa.). PBMCs from two donors are adjusted to 2×106 cells/ml in RPMI-1640 (Life Technologies, Grand Island, N.Y.) supplemented with 10% FCS and 2 mM glutamine. PBMCs from a third donor is adjusted to 2×105 cells/ml. Fifty microliters of PBMCs from each donor is added to wells of a 96-well round bottom microtiter plate. Dilutions of test materials (50 μl) is added in triplicate to microtiter wells. Test samples (of the protein of interest) are added for final dilution of 1:4; rhuIL-2 (R&D Systems, Minneapolis, Minn., catalog number 202-IL) is added to a final concentration of 1 μg/ml; anti-CD4 mAb (R&D Systems, clone 34930.11, catalog number MAB379) is added to a final concentration of 10 μg/ml. Cells are cultured for 7-8 days at 37° C. in 5% CO2, and 1 μC of [3H] thymidine is added to wells for the last 16 hrs of culture. Cells are harvested and thymidine incorporation determined using a Packard TopCount. Data is expressed as the mean and standard deviation of triplicate determinations.

[1333] Samples of the protein of interest are screened in separate experiments and compared to the negative control treatment, anti-CD4 mAb, which inhibits proliferation of lymphocytes and the positive control treatment, IL-2 (either as recombinant material or supernatant), which enhances proliferation of lymphocytes.

[1334] One skilled in the art could easily modify the exemplified studies to test the activity of polynucleotides (e.g., gene therapy), antibodies, agonists, and/or antagonists and fragments and variants thereof.

Example 46

Assays for Protease Activity

[1335] The following assay may be used to assess protease activity of the polypeptides of the invention.

[1336] Gelatin and casein zymography are performed essentially as described (Heusen et al., Anal. Biochem., 102:196-202 (1980); Wilson et al., Journal of Urology, 149:653-658 (1993)). Samples are run on 10% polyacryamide/0.1% SDS gels containing 1% gelain orcasein, soaked in 2.5% triton at room temperature for 1 hour, and in 0.1M glycine, pH 8.3 at 37° C. 5 to 16 hours. After staining in amido black areas of proteolysis apear as clear areas agains the blue-black background. Trypsin (Sigma T8642) is used as a positive control.

[1337] Protease activity is also determined by monitoring the cleavage of n-a-benzoyl-L-arginine ethyl ester (BAEE) (Sigma B-4500. Reactions are set up in (25 mMNaPO4, 1 mM EDTA, and 1 mM BAEE), pH 7.5. Samples are added and the change in adsorbance at 260 nm is monitored on the Beckman DU-6 spectrophotometer in the time-drive mode. Trypsin is used as a positive control.

[1338] Additional assays based upon the release of acid-soluble peptides from casein or hemoglobin measured as adsorbance at 280 nm or colorimetrically using the Folin method are performed as described in Bergmeyer, et al., Methods of Enzymatic Analysis, 5 (1984). Other assays involve the solubilization of chromogenic substrates (Ward, Applied Science, 251-317 (1983).

Example 47

Identifying Serine Protease Substrate Specificity

[1339] Methods known in the art or described herein may be used to determine the substrate specificity of the polypeptides of the present invention having serine protease activity. A preferred method of determining substrate specificity is by the use of positional scanning synthetic combinatorial libraries as described in GB 2 324 529 (incorporated herein in its entirety).

Example 48

Ligand Binding Assays

[1340] The following assay may be used to assess ligand binding activity of the polypeptides of the invention.

[1341] Ligand binding assays provide a direct method for ascertaining receptor pharmacology and are adaptable to a high throughput format. The purified ligand for a polypeptide is radiolabeled to high specific activity (50-2000 Ci/mmol) for binding studies. A determination is then made that the process of radiolabeling does not diminish the activity of the ligand towards its polypeptide. Assay conditions for buffers, ions, pH and other modulators such as nucleotides are optimized to establish a workable signal to noise ratio for both membrane and whole cell polypeptide sources. For these assays, specific polypeptide binding is defined as total associated radioactivity minus the radioactivity measured in the presence of an excess of unlabeled competing ligand. Where possible, more than one competing ligand is used to define residual nonspecific binding.

Example 49

Functional Assay in Xenopus Oocytes

[1342] Capped RNA transcripts from linearized plasmid templates encoding the polypeptides of the invention are synthesized in vitro with RNA polymerases in accordance with standard procedures. In vitro transcripts are suspended in water at a final concentration of 0.2 mg/mi. Ovarian lobes are removed from adult female toads, Stage V defolliculated oocytes are obtained, and RNA transcripts (10 ng/oocytc) are injected in a 50 nl bolus using a microinjection apparatus. Two electrode voltage clamps are used to measure the currents from individual Xenopus oocytes in response polypeptides and polypeptide agonist exposure. Recordings are made in Ca2+ free Barth's medium at room temperature. The Xenopus system can be used to screen known ligands and tissue/cell extracts for activating ligands.

Example 50

Microphysiometric Assays

[1343] Activation of a wide variety of secondary messenger systems results in extrusion of small amounts of acid from a cell. The acid formed is largely as a result of the increased metabolic activity required to fuel the intracellular signaling process. The pH changes in the media surrounding the cell are very small but are detectable by the CYTOSENSOR microphysiometer (Molecular Devices Ltd., Menlo Park, Calif.). The CYTOSENSOR is thus capable of detecting the activation of polypeptide which is coupled to an energy utilizing intracellular signaling pathway.

Example 51

Extract/Cell Supernatant Screening

[1344] A large number of mammalian receptors exist for which there remains, as yet, no cognate activating ligand (agonist). Thus, active ligands for these receptors may not be included within the ligands banks as identified to date. Accordingly, the polypeptides of the invention can also be functionally screened (using calcium, cAMP, microphysiometer, oocyte electrophysiology, etc., functional screens) against tissue extracts to identify its natural ligands. Extracts that produce positive functional responses can be sequentially subfractionated until an activating ligand is isolated and identified.

Example 52

Calcium and cAMP Functional Assays

[1345] Seven transmembrane receptors which are expressed in HEK 293 cells have been shown to be coupled functionally to activation of PLC and calcium mobilization and/or cAMP stimulation or inhibition. Basal calcium levels in the HEK 293 cells in receptor-transfected or vector control cells were observed to be in the normal, 100 nM to 200 nM, range. HEK 293 cells expressing recombinant receptors are loaded with fura 2 and in a single day >150 selected ligands or tissue/cell extracts are evaluated for agonist induced calcium mobilization. Similarly, HEK 293 cells expressing recombinant receptors are evaluated for the stimulation or inhibition of cAMP production using standard cAMP quantitation assays. Agonists presenting a calcium transient or cAMP fluctuation are tested in vector control cells to determine if the response is unique to the transfected cells expressing receptor.

Example 53

ATP-Binding Assay

[1346] The following assay may be used to assess ATP-binding activity of polypeptides of the invention.

[1347] ATP-binding activity of the polypeptides of the invention may be detected using the ATP-binding assay described in U.S. Pat. No. 5,858,719, which is herein incorporated by reference in its entirety. Briefly, ATP-binding to polypeptides of the invention is measured via photoaffinity labeling with 8-azido-ATP in a competition assay. Reaction mixtures containing 1 mg/ml of the ABC transport protein of the present invention are incubated with varying concentrations of ATP, or the non-hydrolyzable ATP analog adenyl-5′-imidodiphosphate for 10 minutes at 4° C. A mixture of 8-azido-ATP (Sigma Chem. Corp., St. Louis, Mo.) plus 8-azido-ATP (32P-ATP) (5 mCi/μmol, ICN, Irvine Calif.) is added to a final concentration of 100 μM and 0.5 ml aliquots are placed in the wells of a porcelain spot plate on ice. The plate is irradiated using a short wave 254 nm UV lamp at a distance of 2.5 cm from the plate for two one-minute intervals with a one-minute cooling interval in between. The reaction is stopped by addition of dithiothreitol to a final concentration of 2 mM. The incubations are subjected to SDS-PAGE electrophoresis, dried, and autoradiographed. Protein bands corresponding to the particular polypeptides of the invention are excised, and the radioactivity quantified. A decrease in radioactivity with increasing ATP or adenly-5′-imidodiphosphate provides a measure of ATP affinity to the polypeptides.

Example 54

Small Molecule Screening

[1348] This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the invention, or binding fragments thereof, in any of a variety of drug screening techniques. The polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and polypeptide of the invention.

[1349] Thus, the present invention provides methods of screening for drugs or any other agents which affect activities mediated by the polypeptides of the invention. These methods comprise contacting such an agent with a polypeptide of the invention or fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or fragment thereof, by methods well known in the art. In such a competitive binding assay, the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the invention.

[1350] Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the invention, and is described in great detail in European Patent Application 84/03564, published on Sep. 13, 1984, which is herein incorporated by reference in its entirety. Briefly stated, large numbers of different small molecule test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The test compounds are reacted with polypeptides of the invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.

[1351] This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.

Example 55

Phosphorylation Assay

[1352] In order to assay for phosphorylation activity of the polypeptides of the invention, a phosphorylation assay as described in U.S. Pat. No. 5,958,405 (which is herein incorporated by reference) is utilized. Briefly, phosphorylation activity may be measured by phosphorylation of a protein substrate using gamma-labeled 32P-ATP and quantitation of the incorporated radioactivity using a gamma radioisotope counter. The polypeptides of the invention are incubated with the protein substrate, 32P-ATP, and a kinase buffer. The 32P incorporated into the substrate is then separated from free 32P-ATP by electrophoresis, and the incorporated 32P is counted and compared to a negative control. Radioactivity counts above the negative control are indicative of phosphorylation activity of the polypeptides of the invention.

Example 56

Detection of Phosphorylation Activity (Activation) of the Polypeptides of the Invention in the Presence of Polypeptide Ligands

[1353] Methods known in the art or described herein may be used to determine the phosphorylation activity of the polypeptides of the invention. A preferred method of determining phosphorylation activity is by the use of the tyrosine phosphorylation assay as described in U.S. Pat. No. 5,817,471 (incorporated herein by reference).

Example 57

Identification of Signal Transduction Proteins that Interact with Polypeptides of the Present Invention

[1354] The purified polypeptides of the invention are research tools for the identification, characterization and purification of additional signal transduction pathway proteins or receptor proteins. Briefly, labeled receptor PTK polypeptide is useful as a reagent for the purification of molecules with which it interacts. In one embodiment of affinity purification, receptor PTK polypeptide is covalently coupled to a chromatography column. Cell-free extract derived from putative target cells, such as carcinoma tissues, is passed over the column, and molecules with appropriate affinity bind to the receptor PTK polypeptides, or specific phosphotyrosine-recognition domains thereof. The receptor PTK polypeptide interacting protein-complex is recovered from the column, dissociated, and the recovered molecule subjected to N-terminal protein sequencing. This amino acid sequence is then used to identify the captured molecule or to design degenerate oligonucleotide probes for cloning the relevant gene from an appropriate cDNA library.

Example 58

IL-6 Bioassay

[1355] To test the proliferative effects of the polypeptides of the invention, the IL-6 Bioassay as described by Marz et al. is utilized (Proc. Natl. Acad. Sci., U.S.A., 95:3251-56 (1998), which is herein incorporated by reference). Briefly, IL-6 dependent B9 murine cells are washed three times in IL-6 free medium and plated at a concentration of 5,000 cells per well in 50 μl, and 50 μl of the IL-6-like polypeptide is added. After 68 hrs. at 37° C., the number of viable cells is measured by adding the tetrazolium salt thiazolyl blue (MTT) and incubating for a further 4 hrs. at 37° C. B9 cells are lysed by SDS and optical density is measured at 570 nm. Controls containing IL-6 (positive) and no cytokine (negative) are utilized. Enhanced proliferation in the test sample(s) relative to the negative control is indicative of proliferative effects mediated by polypeptides of the invention.

Example 59

Support of Chicken Embryo Neuron Survival

[1356] To test whether sympathetic neuronal cell viability is supported by polypeptides of the invention, the chicken embryo neuronal survival assay of Senaldi et al is utilized (Proc. Natl. Acad. Sci., U.S.A., 96:11458-63 (1998), which is herein incorporated by reference). Briefly, motor and sympathetic neurons are isolated from chicken embryos, resuspended in L15 medium (with 10% FCS, glucose, sodium selenite, progesterone, conalbumin, putrescine, and insulin; Life Technologies, Rockville, Md.) and Dulbecco's modified Eagles medium [with 10% FCS, glutamine, penicillin, and 25 mM Hepes buffer (pH 7.2); Life Technologies, Rockville, Md.], respectively, and incubated at 37° C. in 5% CO2 in the presence of different concentrations of the purified IL-6-like polypeptide, as well as a negative control lacking any cytokine. After 3 days, neuron survival is determined by evaluation of cellular morphology, and through the use of the colorimetric assay of Mosmann (Mossman, T., J. Immunol. Methods, 65:55-63 (1983)). Enhanced neuronal cell viability as compared to the controls lacking cytokine is indicative of the ability of the inventive purified IL-6-like polypeptide(s) to enhance the survival of neuronal cells.

Example 60

Assay for Phosphatase Activity

[1357] The following assay may be used to assess serine/threonine phosphatase (PTPase) activity of the polypeptides of the invention.

[1358] In order to assay for serine/threonine phosphatase (PTPase) activity, assays can be utilized which are widely known to those skilled in the art. For example, the serine/threonine phosphatase (PSPase) activity is measured using a PSPase assay kit from New England Biolabs, Inc. Myelin basic protein (MyBP), a substrate for PSPase, is phosphorylated on serine and threonine residues with cAMP-dependent Protein Kinase in the presence of [32P]ATP. Protein serine/threonine phosphatase activity is then determined by measuring the release of inorganic phosphate from 32P-labeled MyBP.

Example 61

Interaction of Serine/Threonine Phosphatases with other Proteins

[1359] The polypeptides of the invention with serine/threonine phosphatase activity as determined in Example 60 are research tools for the identification, characterization and purification of additional interacting proteins or receptor proteins, or other signal transduction pathway proteins. Briefly, labeled polypeptide(s) of the invention is useful as a reagent for the purification of molecules with which it interacts. In one embodiment of affinity purification, polypeptide of the invention is covalently coupled to a chromatography column. Cell-free extract derived from putative target cells, such as neural or liver cells, is passed over the column, and molecules with appropriate affinity bind to the polypeptides of the invention. The polypeptides of the invention complex is recovered from the column, dissociated, and the recovered molecule subjected to N-terminal protein sequencing. This amino acid sequence is then used to identify the captured molecule or to design degenerate oligonucleotide probes for cloning the relevant gene from an appropriate cDNA library.

Example 62

Assaying for Heparanase Activity

[1360] In order to assay for heparanase activity of the polypeptides of the invention, the heparanase assay described by Vlodavsky et al is utilized (Vlodavsky, I., et al., Nat. Med., 5:793-802 (1999)). Briefly, cell lysates, conditioned media or intact cells (1×106 cells per 35-mm dish) are incubated for 18 hrs at 37° C., pH 6.2-6.6, with 35S-labeled ECM or soluble ECM derived peak I proteoglycans. The incubation medium is centrifuged and the supernatant is analyzed by gel filtration on a Sepharose CL-6B column (0.9×30 cm). Fractions are eluted with PBS and their radioactivity is measured. Degradation fragments of heparan sulfate side chains are eluted from Sepharose 6B at 0.5<Kav<0.8 (peak II). Each experiment is done at least three times. Degradation fragments corresponding to “peak II,” as described by Vlodavsky et al., is indicative of the activity of the polypeptides of the invention in cleaving heparan sulfate.

Example 63

Immobilization of Biomolecules

[1361] This example provides a method for the stabilization of polypeptides of the invention in non-host cell lipid bilayer constucts (see, e.g., Bieri et al., Nature Biotech 17:1105-1108 (1999), hereby incorporated by reference in its entirety herein) which can be adapted for the study of polypeptides of the invention in the various functional assays described above. Briefly, carbohydrate-specific chemistry for biotinylation is used to confine a biotin tag to the extracellular domain of the polypeptides of the invention, thus allowing uniform orientation upon immobilization. A 50 uM solution of polypeptides of the invention in washed membranes is incubated with 20 mM NaIO4 and 1.5 mg/ml (4 mM) BACH or 2 mg/ml (7.5 mM) biotin-hydrazide for 1 hr at room temperature (reaction volume, 150 ul). Then the sample is dialyzed (Pierce Slidealizer Cassett, 10 kDa cutoff; Pierce Chemical Co., Rockford Ill.) at 4C first for 5 h, exchanging the buffer after each hour, and finally for 12 h against 500 ml buffer R (0.15 M NaCl, 1 mM MgCl2, 10 mM sodium phosphate, pH 7). Just before addition into a cuvette, the sample is diluted 1:5 in buffer ROG50 (Buffer R supplemented with 50 mM octylglucoside).

Example 64

TAQMAN

[1362] Quantitative PCR (QPCR). Total RNA from cells in culture are extracted by Trizol separation as recommended by the supplier (LifeTechnologies). (Total RNA is treated with DNase I (Life Technologies) to remove any contaminating genomic DNA before reverse transcription.) Total RNA (50 ng) is used in a one-step, 50 ul, RT-QPCR, consisting of Taqman Buffer A (Perkin-Elmer; 50 mM KCl/10 mM Tris, pH 8.3), 5.5 mM MgCl2, 240 μM each dNTP, 0.4 units RNase inhibitor (Promega), 8%glycerol, 0.012% Tween-20, 0.05% gelatin, 0.3 uM primers, 0.1 uM probe, 0.025units Amplitaq Gold (Perkin-Elmer) and 2.5 units Superscript II reverse transcriptase (Life Technologies). As a control for genomic contamination, parallel reactions are setup without reverse transcriptase. The relative abundance of (unknown) and 18S RNAs are assessed by using the Applied Biosystems Prism 7700 Sequence Detection System (Livak, K. J., Flood, S. J., Marmaro, J., Giusti, W. & Deetz, K. (1995) PCR Methods Appl. 4, 357-362). Reactions are carried out at 48° C. for 30 min, 95° C. for 10 min, followed by 40 cycles of 95° C. for 15s, 60° C. for 1 min. Reactions are performed in triplicate.

[1363] Primers (f & r) and FRET probes sets are designed using Primer Express Software (Perkin-Elmer). Probes are labeled at the 5′-end with the reporter dye 6-FAM and on the 3′-end with the quencher dye TAMRA (Biosource International, Camarillo, Calif. or Perkin-Elmer).

Example 65

Assays for Metalloproteinase Activity

[1364] Metalloproteinases (EC 3.4.24.-) are peptide hydrolases which use metal ions, such as Zn2+, as the catalytic mechanism. Metalloproteinase activity of polypeptides of the present invention can be assayed according to the following methods.

[1365] Proteolysis of Alpha-2-Macroglobulin

[1366] To confirm protease activity, purified polypeptides of the invention are mixed with the substrate alpha-2-macroglobulin (0.2 unit/ml; Boehringer Mannheim, Germany) in 1×assay buffer (50 mM HEPES, pH 7.5, 0.2 M NaCl, 10 mM CaCl2, 25 μM ZnCl2 and 0.05% Brij-35) and incubated at 37° C. for 1-5 days. Trypsin is used as positive control. Negative controls contain only alpha-2-macroglobulin in assay buffer. The samples are collected and boiled in SDS-PAGE sample buffer containing 5% 2-mercaptoethanol for 5-min, then loaded onto 8% SDS-polyacrylamide gel. After electrophoresis the proteins are visualized by silver staining. Proteolysis is evident by the appearance of lower molecular weight bands as compared to the negative control.

[1367] Inhibition of Alpha-2-Macroglobulin Proteolysis by Inhibitors of Metalloproteinases

[1368] Known metalloproteinase inhibitors (metal chelators (EDTA, EGTA, AND HgCl2), peptide metalloproteinase inhibitors (TIMP-1 and TIMP-2), and commercial small molecule MMP inhibitors) are used to characterize the proteolytic activity of polypeptides of the invention. The three synthetic MMP inhibitors used are: MMP inhibitor I, [IC50=1.0 μM against MMP-1 and MMP-8; IC50=30 μM against MMP-9; IC50=150 μM against MMP-3]; MMP-3 (stromelysin-1) inhibitor I [IC50=5 μM against MMP-3], and MMP-3 inhibitor II [Kl=130 nM against MMP-3]; inhibitors available through Calbiochem, catalog # 444250, 444218, and 444225, respectively). Briefly, different concentrations of the small molecule MMP inhibitors are mixed with purified polypeptides of the invention (50 μg/ml) in 22.9 μL of 1×HEPES buffer (50 mM HEPES, pH 7.5, 0.2 M NaCl, 10 mM CaCl2, 25 μM ZnCl2 and 0.05%Brij-35) and incubated at room temperature (24° C.) for 2-hr, then 7.1 μl of substrate alpha-2-macroglobulin (0.2 unit/ml) is added and incubated at 37° C. for 20-hr. The reactions are stopped by adding 4×sample buffer and boiled immediately for 5 minutes. After SDS-PAGE, the protein bands are visualized by silver stain.

[1369] Synthetic Fluorogenic Peptide Substrates Cleavage Assay

[1370] The substrate specificity for polypeptides of the invention with demonstrated metalloproteinase activity can be determined using synthetic fluorogenic peptide substrates (purchased from BACHEM Bioscience Inc). Test substrates include, M-1985, M-2225, M-2105, M-2110, and M-2255. The first four are MMP substrates and the last one is a substrate of tumor necrosis factor-α (TNF-α) converting enzyme (TACE). All the substrates are prepared in-1:1 dimethyl sulfoxide (DMSO) and water. The stock solutions are 50-500 μM. Fluorescent assays are performed by using a Perkin Elmer LS 50B luminescence spectrometer equipped with a constant temperature water bath. The excitation λ is 328 nm and the emission λ is 393 nm. Briefly, the assay is carried out by incubating 176 μl 1×HEPES buffer (0.2 M NaCl, 10 mM CaCl2, 0.05% Brij-35 and 50 mM HEPES, pH 7.5) with 4 μl of substrate solution (50 μM) at 25° C. for 15 minutes, and then adding 20 μL of a purified polypeptide of the invention into the assay cuvett. The final concentration of substrate is 1 μM. Initial hydrolysis rates are monitored for 30-min.

Example 66

Characterization of the cDNA Contained in a Deposited Plasmid

[1371] The size of the cDNA insert contained in a deposited plasmid may be routinely determined using techniques known in the art, such as PCR amplification using synthetic primers hybridizable to the 3′ and 5′ ends of the cDNA sequence. For example, two primers of 17-30 nucleotides derived from each end of the cDNA (i.e., hybridizable to the absolute 5′ nucleotide or the 3′ nucleotide end of the sequence of SEQ ID NO:X, respectively) are synthesized and used to amplify the cDNA using the deposited cDNA plasmid as a template. The polymerase chain reaction is carried out under routine conditions, for instance, in 25 ul of reaction mixture with 0.5 ug of the above cDNA template. A convenient reaction mixture is 1.5-5 mM MgCl2, 0.01% (w/v) gelatin, 20 uM each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase. Thirty five cycles of PCR (denaturation at 94 degree C. for 1 min; annealing at 55 degree C. for 1 min; elongation at 72 degree C. for 1 min) are performed with a Perkin-Elmer Cetus automated thermal cycler. The amplified product is analyzed by agarose gel electrophoresis. The PCR product is verified to be the selected sequence by subcloning and sequencing the DNA product.

[1372] Use of the above methodologies and/or other methodologies known in the art generates fragments from the clone corresponding to the approximate fragments described in Table 8, below. Accordingly, Table 8 provides a physical characterization of certain clones encompassed by the invention. The first column provides the unique clone identifier, “Clone ID NO:Z”, for cDNA clones of the invention, as described in Table 1A. The second column provides the approximate size of the cDNA insert contained in the corresponding cDNA clone.

TABLE 8
         cDNA
Clone ID Insert
NO: Z    Size:
HFOXC35  600
HSSGD56  500
HSSCC14  900
HSSAP68  1200
HSLKB62  1800
HSLJD02  1000
HSLHV27  1000
HSLGA24  900
HSLDT25  1600
HSLCF96  1600
HSKEH21  900
HSHCL04  1500
HRDFA03  1000
HFIIJ14  700
HBSAP57  700

[1373] It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.

[1374] The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background of the Invention, Detailed Description, and Examples is hereby incorporated herein by reference. In addition, the CD-R copy of the sequence listing submitted herewith and the corresponding computer readable form are both incorporated herein by reference in their entireties. The specification and Sequence Listing of each of the following U.S. applications are herein incorporated by reference in their entirety: Application No. 60/179,065, filed on Jan. 31, 2000; Application No. 60/180,628, filed on Feb. 4, 2000; Application No. 60/214,886, filed on Jun. 28, 2000; Application No. 60/217,487, filed on Jul. 11, 2000; Application No. 60/225,758, filed on Aug. 14, 2000; application Ser. No. 60/220,963, filed on Jul. 26, 2000; application Ser. No. 60/217,496, filed on Jul. 11, 2000; application Ser. No. 60/225,447, filed on Aug. 14, 2000; application Ser. No. 60/218,290, filed on Jul. 14, 2000; application Ser. No. 60/225,757, filed on Aug. 14, 2000; application Ser. No. 60/226,868, filed on Aug. 22, 2000; application Ser. No. 60/216,647, filed on Jul. 7, 2000; application Ser. No. 60/225,267, filed on Aug. 14, 2000; application Ser. No. 60/216,880, filed on Jul. 7, 2000; application Ser. No. 60/225,270, filed on Aug. 14, 2000; application Ser. No. 60/251,869, filed on Dec. 8, 2000; application Ser. No. 60/235,834, filed on Sep. 27, 2000; application Ser. No. 60/234,274, filed on Sep. 21, 2000; application Ser. No. 60/234,223, filed on Sep. 21, 2000; application Ser. No. 60/228,924, filed on Aug. 30, 2000; application Ser. No. 60/224,518, filed on Aug. 14, 2000; application Ser. No. 60/236,369, filed on Sep. 29, 2000; application Ser. No. 60/224,519, filed on Aug. 14, 2000; application Ser. No. 60/220,964, filed on Jul. 26, 2000; application Ser. No. 60/241,809, filed on Oct. 20, 2000; application Ser. No. 60/249,299, filed on Nov. 17, 2000; application Ser. No. 60/236,327, filed on Sep. 29, 2000; application Ser. No. 60/241,785, filed on Oct. 20, 2000; application Ser. No. 60/244,617, filed on Nov. 1, 2000; application Ser. No. 60/225,268, filed on Aug. 14, 2000; application Ser. No. 60/236,368, filed on Sep. 29, 2000; application Ser. No. 60/251,856, filed on Dec. 8, 2000; application Ser. No. 60/251,868, filed on Dec. 8, 2000; application Ser. No. 60/229,344, filed on Sep. 1, 2000; application Ser. No. 60/234,997, filed on Sep. 25, 2000; application Ser. No. 60/229,343, filed on Sep. 1, 2000; application Ser. No. 60/229,345, filed on Sep. 1, 2000; application Ser. No. 60/229,287, filed on Sep. 1, 2000; application Ser. No. 60/229,513, filed on Sep. 5, 2000; application Ser. No. 60/231,413, filed on Sep. 8, 2000; application Ser. No. 60/229,509, filed on Sep. 5, 2000; application Ser. No. 60/236,367, filed on Sep. 29, 2000; application Ser. No. 60/237,039, filed on Oct. 2, 2000; application Ser. No. 60/237,038, filed on Oct. 2, 2000; application Ser. No. 60/236,370, filed on Sep. 29, 2000; application Ser. No. 60/236,802, filed on Oct. 2, 2000; application Ser. No. 60/237,037, filed on Oct. 2, 2000; application Ser. No. 60/237,040, filed on Oct. 2, 2000; application Ser. No. 60/240,960, filed on Oct. 20, 2000; application Ser. No. 60/239,935, filed on Oct. 13, 2000; application Ser. No. 60/239,937, filed on Oct. 13, 2000; application Ser. No. 60/241,787, filed on Oct. 20, 2000; application Ser. No. 60/246,474, filed on Nov. 8, 2000; application Ser. No. 60/246,532, filed on Nov. 8, 2000; application Ser. No. 60/249,216, filed on Nov. 17, 2000; application Ser. No. 60/249,210, filed on Nov. 17, 2000; application Ser. No. 60/226,681, filed on Aug. 22, 2000; application Ser. No. 60/225,759, filed on Aug. 14, 2000; application Ser. No. 60/225,213, filed on Aug. 14, 2000; application Ser. No. 60/227,182, filed on Aug. 22, 2000; application Ser. No. 60/225,214, filed on Aug. 14, 2000; application Ser. No. 60/235,836, filed on Sep. 27, 2000; application Ser. No. 60/230,438, filed on Sep. 6, 2000; application Ser. No. 60/215,135, filed on Jun. 30, 2000; Application No. 60/225,266, filed on Aug. 14, 2000; application Ser. No. 60/249,218, filed on Nov. 17, 2000; application Ser. No. 60/249,208, filed on Nov. 17, 2000; application Ser. No. 60/249,213, filed on Nov. 17, 2000; application Ser. No. 60/249,212, filed on Nov. 17, 2000; application Ser. No. 60/249,207, filed on Nov. 17, 2000; application Ser. No. 60/249,245, filed on Nov. 17, 2000; application Ser. No. 60/249,244, filed on Nov. 17, 2000; application Ser. No. 60/249,217, filed on Nov. 17, 2000; application Ser. No. 60/249,211, filed on Nov. 17, 2000; application Ser. No. 60/249,215, filed on Nov. 17, 2000; application Ser. No. 60/249,264, filed on Nov. 17, 2000; application Ser. No. 60/249,214, filed on Nov. 17, 2000; application Ser. No. 60/249,297, filed on Nov. 17, 2000; application Ser. No. 60/232,400, filed on Sep. 14, 2000; application Ser. No. 60/231,242, filed on Sep. 8, 2000; application Ser. No. 60/232,081, filed on Sep. 8, 2000; Application No. 60/232,080, filed on Sep. 8, 2000; application Ser. No. 60/231,414, filed on Sep. 8, 2000; application Ser. No. 60/231,244, filed on Sep. 8, 2000; application Ser. No. 60/233,064, filed on Sep. 14, 2000; application Ser. No. 60/233,063, filed on Sep. 14, 2000; Application No. 60/232,397, filed on Sep. 14, 2000; application Ser. No. 60/232,399, filed on Sep. 14, 2000; application Ser. No. 60/232,401, filed on Sep. 14, 2000; application Ser. No. 60/241,808, filed on Oct. 20, 2000; application Ser. No. 60/241,826, filed on Oct. 20, 2000; Application No. 60/241,786, filed on Oct. 20, 2000; application Ser. No. 60/241,221, filed on Oct. 20, 2000; application Ser. No. 60/246,475, filed on Nov. 8, 2000; application Ser. No. 60/231,243, filed on Sep. 8, 2000; application Ser. No. 60/233,065, filed on Sep. 14, 2000; application Ser. No. 60/232,398, filed on Sep. 14, 2000; application Ser. No. 60/234,998, filed on Sep. 25, 2000; application Ser. No. 60/246,477, filed on Nov. 8, 2000; application Ser. No. 60/246,528, filed on Nov. 8, 2000; application Ser. No. 60/246,525, filed on Nov. 8, 2000; application Ser. No. 60/246,476, filed on Nov. 8, 2000; application Ser. No. 60/246,526, filed on Nov. 8, 2000; application Ser. No. 60/249,209, filed on Nov. 17, 2000; application Ser. No. 60/246,527, filed on Nov. 8, 2000; application Ser. No. 60/246,523, filed on Nov. 8, 2000; application Ser. No. 60/246,524, filed on Nov. 8, 2000; application Ser. No. 60/246,478, filed on Nov. 8, 2000; application Ser. No. 60/246,609, filed on Nov. 8, 2000; application Ser. No. 60/246,613, filed on Nov. 8, 2000; application Ser. No. 60/249,300, filed on Nov. 17, 2000; application Ser. No. 60/249,265, filed on Nov. 17, 2000; application Ser. No. 60/246,610, filed on Nov. 8, 2000; application Ser. No. 60/246,611, filed on Nov. 8, 2000; application Ser. No. 60/230,437, filed on Sep. 6, 2000; application Ser. No. 60/251,990, filed on Dec. 8, 2000; application Ser. No. 60/251,988, filed on Dec. 5, 2000; application Ser. No. 60/251,030, filed on Dec. 5, 2000; application Ser. No. 60/251,479, filed on Dec. 6, 2000; application Ser. No. 60/256,719, filed on Dec. 5, 2000; application Ser. No. 60/250,160, filed on Dec. 1, 2000; application Ser. No. 60/251,989, filed on Dec. 8, 2000; application Ser. No. 60/250,391, filed on Dec. 1, 2000; application Ser. No. 60/254,097, filed on Dec. 11, 2000; and application Ser. No. 09/764,877, filed on Jan. 17, 2001.

[1375] Moreover, the microfiche copy and the corresponding computer readable form of the Sequence Listing of U.S. Application Serial No. 60/179,065, and the hard copy of and the corresponding computer readable form of the Sequence Listing of U.S. Application Serial No. 60/180,628 are also incorporated herein by reference in their entireties.

Claims

1. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of: (a) a polynucleotide fragment of SEQ ID NO:X or a polynucleotide fragment of the cDNA sequence contained in Clone ID NO:Z, which is hybridizable to SEQ ID NO:X; (b) a polynucleotide encoding a polypeptide fragment of SEQ ID NO:Y or a polypeptide fragment encoded by the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X; (c) a polynucleotide encoding a polypeptide fragment of a polypeptide encoded by SEQ ID NO:X or a polypeptide fragment encoded by the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X; (d) a polynucleotide encoding a polypeptide domain of SEQ ID NO:Y or a polypeptide domain encoded by the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X; (e) a polynucleotide encoding a polypeptide epitope of SEQ ID NO:Y or a polypeptide epitope encoded by the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X; (f) a polynucleotide encoding a polypeptide of SEQ ID NO:Y or the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X, having biological activity; (g) a polynucleotide which is a variant of SEQ ID NO:X; (h) a polynucleotide which is an allelic variant of SEQ ID NO:X; (i) a polynucleotide which encodes a species homologue of the SEQ ID NO:Y; (j) a polynucleotide capable of hybridizing under stringent conditions to any one of the polynucleotides specified in (a)-(i), wherein said polynucleotide does not hybridize under stringent conditions to a nucleic acid molecule having a nucleotide sequence of only A residues or of only T residues.

2. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide fragment comprises a nucleotide sequence encoding a protein.

3. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide fragment comprises a nucleotide sequence encoding the sequence identified as SEQ ID NO:Y or the polypeptide encoded by the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X.

4. The isolated nucleic acid molecule of claim 1, wherein the polynucleotide fragment comprises the entire nucleotide sequence of SEQ ID NO:X or the cDNA sequence contained in cDNA Clone ID NO:Z, which is hybridizable to SEQ ID NO:X.

5. The isolated nucleic acid molecule of claim 2, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus.

6. The isolated nucleic acid molecule of claim 3, wherein the nucleotide sequence comprises sequential nucleotide deletions from either the C-terminus or the N-terminus.

7. A recombinant vector comprising the isolated nucleic acid molecule of claim 1.

8. A method of making a recombinant host cell comprising the isolated nucleic acid molecule of claim 1.

9. A recombinant host cell produced by the method of claim 8.

10. The recombinant host cell of claim 9 comprising vector sequences.

11. An isolated polypeptide comprising an amino acid sequence at least 90% identical to a sequence selected from the group consisting of: (a) a polypeptide fragment of SEQ ID NO:Y or the encoded sequence contained in cDNA Clone ID NO:Z; (b) a polypeptide fragment of SEQ ID NO:Y or the encoded sequence contained in cDNA Clone ID NO:Z, having biological activity; (c) a polypeptide domain of SEQ ID NO:Y or the encoded sequence contained in cDNA Clone ID NO:Z; (d) a polypeptide epitope of SEQ ID NO:Y or the encoded sequence contained in cDNA Clone ID NO:Z; (e) a full length protein of SEQ ID NO:Y or the encoded sequence contained in cDNA Clone ID NO:Z; (f) a variant of SEQ ID NO:Y; (g) an allelic variant of SEQ ID NO:Y; or (h) a species homologue of the SEQ ID NO:Y.

12. The isolated polypeptide of claim 11, wherein the full length protein comprises sequential amino acid deletions from either the C-terminus or the N-terminus.

13. An isolated antibody that binds specifically to the isolated polypeptide of claim 11.

14. A recombinant host cell that expresses the isolated polypeptide of claim 11.

15. A method of making an isolated polypeptide comprising: (a) culturing the recombinant host cell of claim 14 under conditions such that said polypeptide is expressed; and (b) recovering said polypeptide.

16. The polypeptide produced by claim 15.

17. A method for preventing, treating, or ameliorating a medical condition, comprising administering to a mammalian subject a therapeutically effective amount of the polynucleotide of claim 1.

18. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject comprising: (a) determining the presence or absence of a mutation in the polynucleotide of claim 1; and (b) diagnosing a pathological condition or a susceptibility to a pathological condition based on the presence or absence of said mutation.

19. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject comprising: (a) determining the presence or amount of expression of the polypeptide of claim 11 in a biological sample; and (b) diagnosing a pathological condition or a susceptibility to a pathological condition based on the presence or amount of expression of the polypeptide.

20. A method for identifying a binding partner to the polypeptide of claim 11 comprising: (a) contacting the polypeptide of claim 11 with a binding partner; and (b) determining whether the binding partner effects an activity of the polypeptide.

21. The gene corresponding to the cDNA sequence of SEQ ID NO:Y.

22. A method of identifying an activity in a biological assay, wherein the method comprises: (a) expressing SEQ ID NO:X in a cell; (b) isolating the supernatant; a) (c) detecting an activity in a biological assay; and (d) identifying the protein in the supernatant having the activity.

23. The product produced by the method of claim 20.

24. A method for preventing, treating, or ameliorating a medical condition, comprising administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 11.