Nucleotide and amino acid sequences of canine herpesvirus GD and uses therefor

FIELD OF THE INVENTION
This invention relates to canine herpesvirus (CHV), nucleotides or isolated nucleic acids encoding the CHV gB, gC and gD glycoproteins, and the amino acid sequences thereof, vectors, such as a recombinant poxvirus, e.g., vaccinia and avipox virus recombinants, containing the CHV gB, gC and/or gD coding or expressing the same, glycoproteins therefrom, vaccines, immunological or antigenic compositions from the nucleotide (such as from vectors, for instance, recombinant poxvirus, e.g., vaccinia or avipox virus recombinants containing the CHV, gB, gC and/or gD coding and expressing glycoprotein(s) therefrom), or, from the glycoproteins, for instance, from expression of the nucleotides in a vector system, and, to methods employing the nucleotides, glycoproteins, and compositions.
Several publications are cited in the following text, with full citation of each set forth in the section headed References. The publications cited throughout the text are hereby incorporated herein by reference.
BACKGROUND OF THE INVENTION
Canine herpesvirus (CHV) causes a fatal, hemorrhagic disease in neonatal puppies and a self-limiting, usually subclinical, upper respiratory tract infection in adult dogs (Appel, 1987). Little is known about the genomic structure of CHV. The genome has not been mapped and no nucleotide sequence has been published. In particular, genes encoding immunologically pertinent proteins have not been identified.
Herpesvirus glycoproteins mediate essential viral functions such as cellular attachment and penetration, cell to cell spread of the virus and, importantly, determine the pathogenicity profile of infection. Herpesvirus glycoproteins are critical components in the interaction with the host immune system (Spear, 1985a; Spear 1985b). Herpesvirus glycoproteins are antigens recognized by both the humoral and cellular immune systems and, have been shown to evoke protective immune responses in vaccinated hosts (Wachsman et al., 1987; Marchioli et al., 1987; Eberle et al., 1980; Papp-Vid et al., 1979).
During a herpesvirus infection, the majority of the immune response is directed against viral envelope glycoproteins. These antigens have been shown to elicit both humoral and cellular immune responses. Several reports have indicated that in other herpesvirus systems immunization with the herpesvirus gB, gC and/or gD glycoproteins can induce a protective immune response.
The well characterized glycoproteins of herpes simplex virus include gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL and gM (Spear, 1985a; Spear 1985b; Ackermann et al., 1986; Frink et al. 1983; Frame et al., 1986; Longnecker et al., 1987; Richman et al., 1986; Swain et al., 1985; Zezulak, 1984; Roizman and Sears, 1990; Hutchinson et al., 1992a; Hutchinson et al., 1992b; Baines and Roizman, 1993). A number of studies have indicated the importance of herpes simplex virus glycoproteins in eliciting immune responses. Hence, it has been reported that gB and gD can elicit important immune responses (Berman et al., 1983; Cantin et al., 1987; Cremer et al., 1985; Lasky et al., 1984; Martin et al., 1987a; Martin et al., 1987b; Paoletti et al., 1984; Perkus et al., 1985; Rooney et al., 1988; Wachsman et al., 1987; Zarling et al., 1986a; Zarling et al., 1986b). gC can stimulate class I restricted cytotoxic lymphocytes (Glorioso et al., 1985; Rosenthal et al., 1987) whereas gD can stimulate class II cytotoxic T cell responses (Martin et al., 1987a; Martin et al,. 1987b; Wachsman et al., 1987; Zarling et al., 1986a; Zarling 1986b). gG was shown to be a target for complement-dependent antibody directed virus neutralization (Sullivan et al., 1987; Sullivan et al., 1988). A number of glycoproteins from other herpesviruses have also been shown to elicit important immune responses.
Both subtypes of equine herpesvirus (EHV) express six abundant glycoproteins (Allen et al., 1986; Allen et al., 1987). The genomic portions of the DNA sequences encoding gp2, gp10, gp13, gp14, gp17/18, and gp21/22a have been determined using lambda gtll expression vectors and monoclonal antibodies (Allen et al., 1987). Glycoproteins gp13 and gp14 were located in the same locations within the L component of the genome to which the gC and gB homologs, respectively, of herpes simplex virus map (Allen et al., 1987). The envelope glycoproteins are the principal immunogens of herpesviruses involved in eliciting both humoral and cellular host immune responses (Ben-Porat et al., 1986; Cantin et al., 1987; Glorioso et al., 1984; Wachsman et al., 1988; Wachsman et al., 1989) and so are of the highest interest for those attempting to design vaccines.
Recently, the nucleotide sequence of the Kentucky T431 strain of the EHV-1 transcriptional unit encoding gp13 has been reported (Allen et al., 1988). The glycoprotein was shown to be homologous to the herpes simplex virus (HSV) gC-1 and gC-2, to the pseudorabies virus (PRV) gIII and the varicella-zoster virus (VZV) gpV (Allen et al., 1988). EHV-1 gp13 is thus the structural homolog of the herpesvirus gC-like glycoproteins.
The nucleotide sequence of EHV-1 gp14 (Whalley et al., 1989; Riggio et al., 1989) has recently been reported. Analysis of the predicted amino acid sequence of gp14 glycoprotein revealed significant homology to the corresponding glycoprotein of HSV, gB.
Monoclonal antibodies directed against some EHV-1 glycoproteins have been shown to be neutralizing (Sinclair et al., 1989). Passive immunization experiments demonstrated that monoclonal antibodies directed against gp13 or gp14 (Shimizu et al., 1989) or against gp13, gp14 or gp17/18 (Stokes et al., 1989) could protect hamsters against a lethal challenge. Other gB and gC glycoprotein analogs are also involved in protection against diseases caused by alphaherpesviruses (Cantin et al., 1987; Cranage et al., 1986; Glorioso et al., 1984).
Pseudorabies virus (PRV), an alphaherpesvirus, is the causative agent of Aujesky's disease. The PRV genome consists of a 90.times.10.sup.6 dalton double stranded DNA (Rubenstein et al., 1975) separated by inverted repeat sequences into unique long (U.sub.L) or unique short (U.sub.S) segments (Stevely, 1977; Ben-Porat et al., 1979). The PRV genome encodes approximately 100 polypeptides whose expression is regulated in a cascade-like fashion similar to other herpesviruses (Ben-Porat et al., 1985; Hampl et al., 1984).
PRV glycoprotein gp50 is the Herpes simplex virus type 1 (HSV-1) gD analog (Wathen et al., 1984). The DNA open reading frame encodes 402 amino acids (Petrovskis et al., 1986). The mature glycosylated form (50-60 kDa) contains O-linked carbohydrate without N-linked glycosylation (Petrovskis et al., 1986). Swine serum is highly reactive with PRV gp50, suggesting its importance as an immunogen. Monoclonal antibodies to gp50 neutralize PRV in vitro with or without complement (Wathen et al., 1984; Wathen 1985; Eloit et al., 1988) and passively protect mice (Marchioli et al., 1988; Wathen et al., 1985; Eloit et al., 1988) and swine (Marchioli et al., 1988). Vaccinia virus recombinants expressing PRV gp50 induced serum neutralizing antibodies and protected both mice and swine against lethal PRV challenge (Kost et al., 1989; Marchioli et al., 1987; Ishii et al., 1988).
PRV gIII is the HSV-1 gC analog (Robbins et al., 1986). Functional replacement of PRV gIII by HSVgC was not observed (Whealy et al., 1989). Although PRV gIII is nonessential for replication in vitro (Wathen et al., 1986; Robbins et al., 1986), the mature glycosylated form (98 kDa) is an abundant constituent of the PRV envelope. Anti-gpIII monoclonal antibodies neutralize the virus in vitro with or without complement (Hampl et al., 1984; Eloit et al., 1988; Wathen et al., 1986) and can passively protect mice and swine (Marchioli et al., 1988). The PRV glycoprotein gIII can protect mice and swine from lethal PRV challenge after immunization with a Cro/gIII fusion protein expressed in E. coli (Robbins, A., R. Watson, L. Enquist, European Patent application 0162738A1) or when expressed in a vaccinia recombinant (Panicali, D., L. Gritz, G. Mazzara, European Patent application 0261940A2).
PRV gpII is the HSV-1 gB homolog (Robbins et al., 1987). Monoclonal antibodies directed against PRV gpII have been shown to neutralize the virus in vitro (Ben-Porat et al., 1986) with or without complement (Wittmann et al., 1989). Moreover, passive immunization studies demonstrated that neutralizing monoclonal antibodies partially protected swine (Marchioli et al., 1988). Immunization with NYVAC (highly attenuated vaccinia virus)-based recombinants expressing pseudorabies virus (PRV) gII (gB) or gp50 (gD) has been shown to protect swine against a virulent PRV challenge (Brockmeier et al., 1993). Furthermore, vaccinia recombinants expressing PRV gII and gp50, or gII, gIII (gC) and gp50 have been shown to elicit a higher level of protection than recombinants expressing gII or gp50 alone, suggesting a potential synergistic effect with these glycoproteins (Riviere et al., 1992).
The herpes simplex virus type 1 (HSV1) genome encodes at least eleven antigenically distinct glycoproteins: gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL and gM (Roizman et al., 1990). Mice immunized with purified HSV1 gB, gC or gD are protected against lethal HSV1 challenge (Chan, 1983). Mice have also been protected against lethal HSV1 or HSV2 challenge by passive immunization with antibodies to total HSV1 (Davis et al., 1979) or HSV2 (Oakes et al., 1978) virus and with antibodies to the individual HSV2 gB, gC, gD or gE glycoproteins (Balachandran et al., 1982).
Vaccinia virus vectors expressing HSV1 gB (McLaughlin-Taylor et al., 1988) and HSV1 gC (Rosenthal et al., 1987) have been shown to induce cytotoxic T-cell responses. In addition, it has been shown that mice immunized with recombinant vaccinia virus expressing either HSV1 gB (Cantin et al., 1987), HSV1 gC (Weir et al., 1989) or HSV1 gD (Paoletti et al., 1984) are protected against a lethal challenge of HSV1. A recombinant vaccinia virus expressing HSV1 gD has also been shown to be protective against HSV2 in a guinea pig model system (Wachsman et al., 1987).
Bovine herpesvirus 1 (BHV1) specifies more than 30 structural polypeptides, 11 of which are glycosylated (Misra et al., 1981). Three of these glycoproteins, gI, gIII and gIV, have been characterized and found to be homologous to the herpes simplex virus (HSV) glycoproteins gB, gC and gD (Lawrence et al., 1986; Zamb, 1987). Immunization with purified bovine herpesvirus type 1 (BHV1) gI (gB), gIII (gC) and/or gIV (gD) has been shown to protect cattle against a BHV1/Pasteurella haemolytica challenge (Babiuk et al., 1987).
Feline herpesvirus type-1 (FHV-1) has been shown to contain at least 23 different proteins (Meas et al., 1984; Fargeaud et al., 1984). Of these, at least five are glycosylated (Fargeaud et al., 1984; Compton, 1989) with reported molecular masses ranging from 120 kDa to 60 kDa. The FHV-1 glycoproteins have been shown to be immunogenic (Meas et al., 1984; Compton, 1989). Like several other alphaherpesviruses, FHV-1 appears to have a homolog of glycoprotein B (gB) of HSV-1 (Maeda et al., 1992). The FHV-1 gB glycoprotein is a 134 kDa complex which is dissociated with B-mercaptoethanol into two glycoproteins of 66 kDa and 60 kDa. The FHV-1 DNA genome is approximately 134 Kb in size (Rota et al., 1986).
Epstein Barr Virus (EBV), a human B lymphotropic herpesvirus, is a member of the genus lymphocryptovirus which belongs to the subfamily gammaherpesvirus (Roizman et al., 1990). Since the EBV genome was completely sequenced (Baer et al., 1984) as the genomes of VZV (Davison et al., 1986), HSV1 (McGeoch et al., 1988), MCHV (Chee et al., 1990) and EHV1 (Telford et al., 1992) numerous homologies between these different herpesviruses have been described (Kieff et al., 1990).
Human cytomegalovirus (HCMV) is a member of the betaherpesvirinae subfamily (family Herpesviridae). Three immunologically distinct families of glycoproteins associated with the HCMV envelope have been described (Gretch et al., 1988): gCI (gp55 and gp93-130); gCII (gp47-52); and gCIII (gp85-p145). The gene coding for gCI is homologous to HSVI gB.
In addition, immunization with a fowlpox recombinant expressing Marek's disease virus (MDV) gB has been shown to protect chickens against a virulent MDV challenge (Nazarian et al., 1992).
The results of these studies indicate that an immune response against gB, gC and/or gD glycoproteins can protect target species animals against a herpesvirus challenge and, that the provision of nucleotides for CHV gB, gC and gD glycoproteins is a valuable advance over the current state of the art as it allows for the provision of the glycoproteins and, antigenic, immunological or vaccine compositions from the vector systems or from the glycoproteins. Further, the glycoproteins from expression of the nucleotides can be used to elicit antibodies which can be further used in antibody binding diagnostic assays, kits or tests for ascertaining the presence or absence in a sample such as sera of the glycoprotein(s) and therefore the presence or absence of CHV or of an immune or antigenic response (to either CHV or to the glycoproteins). Thus, many utilities flow from the provision of the nucleotides for CHV gB, gC and gD glycoproteins.
Various vector systems exist for the expression of exogenous DNA, such as the phage, e.g., lambda, and E. coli systems (Allen et al., 1987; Robbins, EPA 0162738A1; Panicali, EPA 0261940A2, each of which is expressly incorporated herein by reference).
Vaccinia virus and more recently other poxviruses have been used for the insertion and expression of foreign genes. The basic technique of inserting foreign genes into live infectious poxvirus involves recombination between pox DNA sequences flanking a foreign genetic element in a donor plasmid and homologous sequences present in the rescuing poxvirus (Piccini et al., 1987).
Specifically, the recombinant poxviruses are constructed in two steps known in the art and analogous to the methods for creating synthetic recombinants of poxviruses such as the vaccinia virus and avipox virus described in U.S. Pat. Nos. 4,769,330, 4,772,848, 4,603,112, 5,100,587, and 5,179,993, the disclosures of which are incorporated herein by reference.
First, the DNA gene sequence to be inserted into the virus, particularly an open reading frame from a non-pox source, is placed into an E. coli plasmid construct into which DNA homologous to a section of DNA of the poxvirus has been inserted. Separately, the DNA gene sequence to be inserted is ligated to a promoter. The promoter-gene linkage is positioned in the plasmid construct so that the promoter-gene linkage is flanked on both ends by DNA homologous to a DNA sequence flanking a region of pox DNA containing a nonessential locus. The resulting plasmid construct is then amplified by growth within E. coli bacteria (Clewell, 1972) and isolated (Clewell et al., 1969; Maniatis et al., 1982).
Second, the isolated plasmid containing the DNA gene sequence to be inserted is transfected into a cell culture, e.g. chick embryo fibroblasts, along with the poxvirus. Recombination between homologous pox DNA in the plasmid and the viral genome respectively gives a poxvirus modified by the presence, in a nonessential region of its genome, of foreign DNA sequences. The term "foreign" DNA designates exogenous DNA, particularly DNA from a non-pox source, that codes for gene products not ordinarily produced by the genome into which the exogenous DNA is placed.
Genetic recombination is in general the exchange of homologous sections of DNA between two strands of DNA. In certain viruses RNA may replace DNA. Homologous sections of nucleic acid are sections of nucleic acid (DNA or RNA) which have the same sequence of nucleotide bases.
Genetic recombination may take place naturally during the replication or manufacture of new viral genomes within the infected host cell. Thus, genetic recombination between viral genes may occur during the viral replication cycle that takes place in a host cell which is co-infected with two or more different viruses or other genetic constructs. A section of DNA from a first genome is used interchangeably in constructing the section of the genome of a second co-infecting virus in which the DNA is homologous with that of the first viral genome.
However, recombination can also take place between sections of DNA in different genomes that are not perfectly homologous. If one such section is from a first genome homologous with a section of another genome except for the presence within the first section of, for example, a genetic marker or a gene coding for an antigenic determinant inserted into a portion of the homologous DNA, recombination can still take place and the products of that recombination are then detectable by the presence of that genetic marker or gene in the recombinant viral genome. Additional strategies have recently been reported for generating recombinant vaccinia virus.
Successful expression of the inserted DNA genetic sequence by the modified infectious virus requires two conditions. First, the insertion must be into a nonessential region of the virus in order that the modified virus remain viable. The second condition for expression of inserted DNA is the presence of a promoter in the proper relationship to the inserted DNA. The promoter must be placed so that it is located upstream from the DNA sequence to be expressed.
Vaccinia virus has been used successfully to immunize against smallpox, culminating in the worldwide eradication of smallpox in 1980. In the course of its history, many strains of vaccinia have arisen. These different strains demonstrate varying immunogenicity and are implicated to varying degrees with potential complications, the most serious of which are post-vaccinial encephalitis and generalized vaccinia (Behbehani, 1983).
With the eradication of smallpox, a new role for vaccinia became important, that of a genetically engineered vector for the expression of foreign genes. Genes encoding a vast number of heterologous antigens have been expressed in vaccinia, often resulting in protective immunity against challenge by the corresponding pathogen (reviewed in Tartaglia et al., 1990a).
The genetic background of the vaccinia vector has been shown to affect the protective efficacy of the expressed foreign immunogen. For example, expression of Epstein Barr Virus (EBV) gp340 in the Wyeth vaccine strain of vaccinia virus did not protect cottontop tamarins against EBV virus induced lymphoma, while expression of the same gene in the WR laboratory strain of vaccinia virus was protective (Morgan et al., 1988).
A fine balance between the efficacy and the safety of a vaccinia virus-based recombinant vaccine candidate is extremely important. The recombinant virus must present the immunogen(s) in a manner that elicits a protective immune response in the vaccinated animal but lacks any significant pathogenic properties. Therefore attenuation of the vector strain would be a highly desirable advance over the current state of technology.
A number of vaccinia genes have been identified which are non-essential for growth of the virus in tissue culture and whose deletion or inactivation reduces virulence in a variety of animal systems.
The gene encoding the vaccinia virus thymidine kinase (TK) has been mapped (Hruby et al., 1982) and sequenced (Hruby et al., 1983; Weir et al., 1983). Inactivation or complete deletion of the thymidine kinase gene does not prevent growth of vaccinia virus in a wide variety of cells in tissue culture. TK.sup.- vaccinia virus is also capable of replication in vivo at the site of inoculation in a variety of hosts by a variety of routes.
It has been shown for herpes simplex virus type 2 that intravaginal inoculation of guinea pigs with TK.sup.- virus resulted in significantly lower virus titers in the spinal cord than did inoculation with TK.sup.+ virus (Stanberry et al., 1985). It has been demonstrated that herpesvirus encoded TK activity in vitro was not important for virus growth in actively metabolizing cells, but was required for virus growth in quiescent cells (Jamieson et al., 1974).
Attenuation of TK.sup.- vaccinia has been shown in mice inoculated by the intracerebral and intraperitoneal routes (Buller et al., 1985). Attenuation was observed both for the WR neurovirulent laboratory strain and for the Wyeth vaccine strain. In mice inoculated by the intradermal route, TK.sup.- recombinant vaccinia generated equivalent anti-vaccinia neutralizing antibodies as compared with the parental TK.sup.+ vaccinia virus, indicating that in this test system the loss of TK function does not significantly decrease immunogenicity of the vaccinia virus vector. Following intranasal inoculation of mice with TK.sup.- and TK.sup.+ recombinant vaccinia virus (WR strain), significantly less dissemination of virus to other locations, including the brain, has been found (Taylor et al., 1991a).
Another enzyme involved with nucleotide metabolism is ribonucleotide reductase. Loss of virally encoded ribonucleotide reductase activity in herpes simplex virus (HSV) by deletion of the gene encoding the large subunit was shown to have no effect on viral growth and DNA synthesis in dividing cells in vitro, but severely compromised the ability of the virus to grow on serum starved cells (Goldstein et al., 1988). Using a mouse model for acute HSV infection of the eye and reactivatable latent infection in the trigeminal ganglia, reduced virulence was demonstrated for HSV deleted of the large subunit of ribonucleotide reductase, compared to the virulence exhibited by wild type HSV (Jacobson et al., 1989).
Both the small (Slabaugh et al., 1988) and large (Schmitt et al., 1988) subunits of ribonucleotide reductase have been identified in vaccinia virus. Insertional inactivation of the large subunit of ribonucleotide reductase in the WR strain of vaccinia virus leads to attenuation of the virus as measured by intracranial inoculation of mice (Child et al., 1990).
The vaccinia virus hemagglutinin gene (HA) has been mapped and sequenced (Shida, 1986). The HA gene of vaccinia virus is nonessential for growth in tissue culture (Ichihashi et al., 1971). Inactivation of the HA gene of vaccinia virus results in reduced neurovirulence in rabbits inoculated by the intracranial route and smaller lesions in rabbits at the site of intradermal inoculation (Shida et al., 1988). The HA locus was used for the insertion of foreign genes in the WR strain (Shida et al., 1987), derivatives of the Lister strain (Shida et al., 1988) and the Copenhagen strain (Guo et al., 1989) of vaccinia virus. Recombinant HA.sup.- vaccinia virus expressing foreign genes have been shown to be immunogenic (Guo et al., 1989; Itamura et al., 1990; Shida et al., 1988; Shida et al., 1987) and protective against challenge by the relevant pathogen (Guo et al., 1989; Shida et al., 1987).
Cowpox virus (Brighton red strain) produces red (hemorrhagic) pocks on the chorioallantoic membrane of chicken eggs. Spontaneous deletions within the cowpox genome generate mutants which produce white pocks (Pickup et al., 1984). The hemorrhagic function (u) maps to a 38 kDa protein encoded by an early gene (Pickup et al., 1986). This gene, which has homology to serine protease inhibitors, has been shown to inhibit the host inflammatory response to cowpox virus (Palumbo et al., 1989) and is an inhibitor of blood coagulation.
The u gene is present in WR strain of vaccinia virus (Kotwal et al., 1989b). Mice inoculated with a WR vaccinia virus recombinant in which the u region has been inactivated by insertion of a foreign gene produce higher antibody levels to the foreign gene product compared to mice inoculated with a similar recombinant vaccinia virus in which the u gene is intact (Zhou et al., 1990). The u region is present in a defective nonfunctional form in Copenhagen strain of vaccinia virus (open reading frames B13 and B14 by the terminology reported in Goebel et al., 1990a,b).
Cowpox virus is localized in infected cells in cytoplasmic A type inclusion bodies (ATI) (Kato et al., 1959). The function of ATI is thought to be the protection of cowpox virus virions during dissemination from animal to animal (Bergoin et al., 1971). The ATI region of the cowpox genome encodes a 160 kDa protein which forms the matrix of the ATI bodies (Funahashi et al., 1988; Patel et al., 1987). Vaccinia virus, though containing a homologous region in its genome, generally does not produce ATI. In WR strain of vaccinia, the ATI region of the genome is translated as a 94 kDa protein (Patel et al., 1988). In Copenhagen strain of vaccinia virus, most of the DNA sequences corresponding to the ATI region are deleted, with the remaining 3' end of the region fused with sequences upstream from the ATI region to form open reading frame (ORF) A26L (Goebel et al., 1990a,b).
A variety of spontaneous (Altenburger et al., 1989; Drillien et al., 1981; Lai et al., 1989; Moss et al., 1981; Paez et al., 1985; Panicali et al., 1981) and engineered (Perkus et al., 1991; Perkus et al., 1989; Perkus et al., 1986) deletions have been reported near the left end of the vaccinia virus genome. A WR strain of vaccinia virus with a 10 kb spontaneous deletion (Moss et al., 1981; Panicali et al., 1981) was shown to be attenuated by intracranial inoculation in mice (Buller et al., 1985). This deletion was later shown to include 17 potential ORFs (Kotwal et al., 1988b). Specific genes within the deleted region include the virokine N1L and a 35 kDa protein (C3L, by the terminology reported in Goebel et al., 1990a,b). Insertional inactivation of N1L reduces virulence by intracranial inoculation for both normal and nude mice (Kotwal et al., 1989a). The 35 kDa protein is secreted like N1L into the medium of vaccinia virus infected cells. The protein contains homology to the family of complement control proteins, particularly the complement 4B binding protein (C4bp) (Kotwal et al., 1988a). Like the cellular C4bp, the vaccinia 35 kDa protein binds the fourth component of complement and inhibits the classical complement cascade (Kotwal et al., 1990). Thus the vaccinia 35 kDa protein appears to be involved in aiding the virus in evading host defense mechanisms.
The left end of the vaccinia genome includes two genes which have been identified as host range genes, K1L (Gillard et al., 1986) and C7L (Perkus et al., 1990). Deletion of both of these genes reduces the ability of vaccinia virus to grow on a variety of human cell lines (Perkus et al., 1990).
Two additional vaccine vector systems involve the use of naturally host-restricted poxviruses, avipoxviruses. Both fowlpoxvirus (FPV) and canarypoxvirus (CPV) have been engineered to express foreign gene products. Fowlpox virus (FPV) is the prototypic virus of the Avipox genus of the Poxvirus family. The virus causes an economically important disease of poultry which has been well controlled since the 1920's by the use of live attenuated vaccines. Replication of the avipox viruses is limited to avian species (Matthews, 1982b) and there are no reports in the literature of avipoxvirus causing a productive infection in any non-avian species including man. This host restriction provides an inherent safety barrier to transmission of the virus to other species and makes use of avipoxvirus based vaccine vectors in veterinary and human applications an attractive proposition.
FPV has been used advantageously as a vector expressing antigens from poultry pathogens. The hemagglutinin protein of a virulent avian influenza virus was expressed in an FPV recombinant (Taylor et al., 1988a). After inoculation of the recombinant into chickens and turkeys, an immune response was induced which was protective against either a homologous or a heterologous virulent influenza virus challenge (Taylor et al., 1988a). FPV recombinants expressing the surface glycoproteins of Newcastle Disease Virus have also been developed (Taylor et al., 1990; Edbauer et al., 1990).
Despite the host-restriction for replication of FPV and CPV to avian systems, recombinants derived from these viruses were found to express extrinsic proteins in cells of nonavian origin. Further, such recombinant viruses were shown to elicit immunological responses directed towards the foreign gene product and where appropriate were shown to afford protection from challenge against the corresponding pathogen (Tartaglia et al., 1993 a,b; Taylor et al., 1992; 1991b; 1988b).
Thus, heretofore, the nucleotide and amino acid sequences for the CHV gB, gC and gD glycoproteins, have not been taught or suggested and, providing these sequences would be of great value. Further, vaccine, antigenic or immunological compositions from the nucleotides for the CHV gB, gC and gD glycoproteins (such as from vector systems containing such nucleotides) as well as from the glycoproteins themselves (such as from expression by the vector systems) have not heretofore been taught or suggested and, these nucleotides, vector systems, glycoproteins and compositions would be of great value.
OBJECTS AND SUMMARY OF THE INVENTION
It is therefore an object of the invention to provide nucleotides or isolated nucleic acids coding for CHV gB, gC and gD.
It is a further object of the invention to provide vectors containing nucleotides or isolated nucleic acids coding for CHV gB, gC and/or gD.
It is another object of the invention to provide CHV gB, gC and/or gD glycoproteins, especially from expression of nucleotides or isolated nucleic acids therefor in a vector system.
It is an additional object of the invention to provide antigenic, vaccine or immunological compositions from the CHV gB, gC and/or gD nucleotides or isolated nucleic acids or a vector containing them or, from the glycoproteins themselves, such as by way of expression by the vector.
It is yet another object of this invention to provide modified recombinant viruses, which viruses have enhanced safety, and to provide a method of making such recombinant viruses.
It is an additional object of this invention to provide a recombinant poxvirus antigenic, vaccine or immunological composition having an increased level of safety compared to known recombinant poxvirus antigenic, vaccine or immunological compositions.
It is a further object of this invention to provide a modified vector for expressing a gene product in a host, wherein the vector is modified so that it has attenuated virulence in the host.
It is another object of this invention to provide a method for expressing a gene product, such as CHV gB, gC and/or gD, in a cell cultured in vitro using a modified recombinant virus or modified vector having an increased level of safety.
These and other objects and advantages of the present invention will become more readily apparent after consideration of the following.
The present invention involves the elucidation of the CHV gB, gC and gD nucleotides, glycoproteins therefrom and, antigenic, vaccine or immunological compositions employing the nucleotide sequences and the glycoproteins.
Accordingly, the present invention provides a nucleotide or isolated nucleic acid coding for canine herpesvirus gB glycoprotein.
The present invention provides a nucleotide or isolated nucleic acid coding for canine herpesvirus gC glycoprotein.
The present invention provides a nucleotide or isolated nucleic acid coding for canine herpesvirus gD glycoprotein.
The nucleotides are preferably DNA. The nucleotides or isolated nucleic acids preferably have the DNA sequences as set forth in FIGS. 1, 4 and 7.
The present invention also provides canine herpesvirus glycoprotein gB.
The present invention provides canine herpesvirus glycoprotein gC.
The present invention provides canine herpesvirus glycoprotein gD.
The present invention further provides a vector containing the nucleotide or isolated nucleic acid for canine herpesvirus gB, gC and/or gD. Preferably the vector is a recombinant poxvirus such as a recombinant vaccinia or avipox virus, more preferably the vaccinia or avipox virus is attenuated such as NYVAC, ALVAC or TROVAC.
Thus, in one preferred aspect, the present invention relates to a modified recombinant virus having inactivated virus-encoded genetic functions so that the recombinant virus has attenuated virulence and enhanced safety. The functions can be non-essential, or associated with virulence. The virus is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus and canarypox virus. The modified recombinant virus can include, within a non-essential region of the virus genome, a heterologous DNA sequence which encodes a CHV antigenic protein, e.g., CHV gC, gB, and gD or any combination thereof.
In a still further preferred aspect, the present invention relates to a modified recombinant virus having nonessential virus-encoded genetic functions inactivated therein so that the virus has attenuated virulence, and wherein the modified recombinant virus further contains DNA from a heterologous source in a nonessential region of the virus genome. The DNA can code for a CHV gB, gC and gD, or any combination thereof. In particular, the genetic functions are inactivated by deleting an open reading frame encoding a virulence factor or by utilizing naturally host restricted viruses. The virus used according to the present invention is advantageously a poxvirus, particularly a vaccinia virus or an avipox virus, such as fowlpox virus and canarypox virus. Advantageously, the open reading frame is selected from the group consisting of J2R, B13R+B14R, A26L, A56R, C7L-K1L, and I4L (by the terminology reported in Goebel et al., 1990a,b); and, the combination thereof. In this respect, the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, an A type inclusion body region, a hemagglutinin gene, a host range gene region or a large subunit, ribonucleotide reductase; or, the combination thereof. The modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992).
The present invention still further provides an antigenic, vaccine or immunological composition for inducing an antigenic or immunological response in a host, such as a canine, comprising a suitable vector containing the nucleotide(s) or isolated nucleic acid(s) for canine herpesvirus gB, gC and/or gD and a suitable carrier; or, canine herpesvirus gB, gC and/or gD glycoprotein(s), such as from expression thereof in a vector containing the nucleotide(s) of the invention, and a suitable carrier.
The present invention yet further provides methods employing the inventive nucleotide(s) or isolated nucleic acid(s), glycoprotein(s), composition(s).
Thus, the invention provides a method for preparing canine herpesvirus gB, gC and/or gD comprising inserting the nucleotide(s) or isolated nucleic acid(s) therefor into a suitable vector, cultivating the vector, and, collecting the glycoprotein from the vector. The vector can be a poxvirus, such as vaccinia or avipox virus, a phage such as lambda, or E. coli or any other suitable virus or bacterial vector. The cultivating can be infecting cells susceptible to viral infection by the virus vector or, growing colonies of the bacterial vector system, such as by plate or broth methods. And, collecting can be by separating the glycoprotein(s) from the viral-infected cells or from the bacterial cells.
Thus, in a preferred aspect, the present invention relates to a method for expressing a gene product in a cell cultured in vitro by introducing into the cell a modified recombinant virus having attenuated virulence and enhanced safety. The modified recombinant virus can include, within a non-essential region of the virus genome, a heterologous DNA sequence which encodes an antigenic protein, e.g., CHV gB, gC and gD, or any combination thereof.
Likewise, the invention provides a method for inoculating or for stimulating an antigenic or immunological response in a host such as a canine against canine herpesvirus comprising administering the inventive antigenic, vaccine or immunological composition to the host, e.g., canine. Additionally, the invention includes an antibody elicited by the expression of the inventive nucleotide(s). The antibody can be generated into a monoclonal antibody by known techniques and, the antibody or the monoclonal antibody can be employed in a binding diagnostic assay, test or kit to determine the presence or absence of CHV gB, gC and/or gD in a sample such as sera and therefore the presence or absence of CHV or, of an antibody or immune response to CHV or to glycoproteins thereof.
These and other embodiments within the present invention are described or are obvious from the following detailed description.

BRIEF DESCRIPTION OF DRAWINGS
The following detailed description, given by way of example, but not intended to limit the invention solely to the specific embodiments described, may best be understood in conjunction with the accompanying drawings, in which:
FIG. 1 shows the nucleotide sequence and predicted amino acid sequence of the CHV gB homologue (SEQ ID NOS:1, 2);
FIG. 2 shows the hydropathicity analysis of the CHV gB homologue;
FIGS. 3A and 3B show the amino acid homology of 8 gB homologues (SEQ ID NOS:3-10);
FIG. 4 shows the nucleotide sequence and predicted amino acid sequence of the CHV gC homologue and ORF2 (SEQ ID NOS:11-13);
FIG. 5 shows the hydropathicity analysis of the CHV gC homologue;
FIG. 6 shows the amino acid homology of 4 gC homologues (SEQ ID NOS:14-17);
FIG. 7 shows the nucleotide sequence and predicted amino acid sequence of the CHV gD homologue; SEQ ID NOS:18-20);
FIG. 8 shows the hydropathicity analysis of the CHV gD homologue;
FIG. 9 shows amino acid homology of 4 gD homologues (SEQ ID NOS:16-20);
FIG. 10 schematically shows a method for the construction of plasmid pSD460 for deletion of thymidine kinase gene and generation of recombinant vaccinia virus vP410;
FIG. 11 schematically shows a method for the construction of plasmid pSD486 for deletion of hemorrhagic region and generation of recombinant vaccinia virus vP553;
FIG. 12 schematically shows a method for the construction of plasmid pMP494.DELTA. for deletion of ATI region and generation of recombinant vaccinia virus vP618;
FIG. 13 schematically shows a method for the construction of plasmid pSD467 for deletion of hemagglutinin gene and generation of recombinant vaccinia virus vP723;
FIG. 14 schematically shows a method for the construction of plasmid pMPCK1.DELTA. for deletion of gene cluster [C7L-K1L] and generation of recombinant vaccinia virus vP804;
FIG. 15 schematically shows a method for the construction of plasmid pSD548 for deletion of large subunit, ribonucleotide reductase and generation of recombinant vaccinia virus vP866 (NYVAC);
FIG. 16 schematically shows a method for the construction of plasmid pRW842 for insertion of rabies glycoprotein G gene into the TK deletion locus and generation of recombinant vaccinia virus vP879;
FIG. 17 shows the DNA sequence (SEQ ID NO:62) of a canarypox PvuII fragment containing the C5 ORF.
FIGS. 18A and 18B schematically show a method for the construction of recombinant canarypox virus vCP65 (ALVAC-RG);
FIG. 19 shows schematically the ORFs deleted to generate NYVAC;
FIG. 20 shows the nucleotide sequence (SEQ ID NO:72) of a fragment of TROVAC DNA containing an F8 ORF;
FIG. 21 shows the DNA sequence (SEQ ID NO:75) of a 2356 base pair fragment of TROVAC DNA containing the F7 ORF;
FIGS. 22A to 22D show graphs of rabies neutralizing antibody titers (RFFIT, IU/ml), booster effect of HDC and vCP65 (10.sup.5.5 TCID50) in volunteers previously immunized with either the same or the alternate vaccine (vaccines given at days 0, 28 and 180, antibody titers measured at days 0, 7, 28, 35, 56, 173, 187 and 208);
FIG. 23 shows the nucleotide sequence of the I3L-promoted CHV gB gene contained in pCHV37 and vCP320;
FIG. 24 shows the nucleotide sequence of the ALVAC C6 flanking arms;
FIG. 25 shows the immunoprecipitation analysis of vCP320-infected cells (Lysates from .sup.35 S-labeled mock-infected cells (lane A), ALVAC-infected cells (lane B), vCP320-infected cells (lane C) and CHV-infected cells (lane D) were immunoprecipitated with a CHV gB-specific monoclonal antibody, 1125B2 (obtained from Rhone Merieux, Lyon, France), and resolved on an SDS-polyacrylamide gel. Molecular weight standards are resolved in lane E);
FIG. 26 shows the nucleotide sequence of the H6-promoted CHV gC gene contained in pCHV40 and vCP322;
FIG. 27 shows the immunoprecipitation analysis of vCP322-infected cells (Lysates from .sup.35 S-labeled mock-infected cells (lane A), ALVAC-infected cells (lane B), vCP322-infected cells (lane C) and CHV-infected cells (lane D) were immunoprecipitated with a CHV gC-specific monoclonal antibody, 2011A9 (obtained from Rhone Merieux, Lyon, France), and resolved on an SDS-polyacrylamide gel. Molecular weight standards are resolved in lane E);
FIG. 28 shows the nucleotide sequence of the H6-promoted CHV gD gene contained in pCHV26 and vCP294; and
FIG. 29 shows the immunoprecipitation analysis of vCP294-infected cells (Lysates from .sup.35 S-labeled mock-infected cells (lane A), ALVAC-infected cells (lane B), vCP294-infected cells (lane C) and CHV-infected cells (lane D) were immunoprecipitated with a CHV gD-specific monoclonal antibody, 208D11 (obtained from Rhone Merieux, Lyon, France), and resolved on an SDS-polyacrylamide gel. Molecular weight standards are resolved in lane E).

DETAILED DESCRIPTION
This invention provides nucleotides coding for the CHV gB, gC and gD genes. These genes encode polypeptides of 879, 459 and 345 amino acids, respectively. Comparison of the predicted amino acid sequence of these glycoproteins with the gB, gC and gD amino acid sequences of other herpesviruses indicates that CHV is an alpha-herpesvirus; a conclusion that is consistent with the previous classification of this virus according to biological properties. This analysis also revealed that the homology among gB homologues is greater than the homology among gC or gD homologues, suggesting that the structural and functional constraints on gB may be greater than those on gC or gD.
Alignment of homologous gB, gC and gD polypeptides revealed that the vast majority of cysteine residues are perfectly conserved. These results suggest that these cysteine residues, due to their ability to form disulfide bonds, are important in maintaining the structural and functional integrity of the gB, gC and gD glycoproteins. In fact, in HSV1 gD, it has been shown that cysteine 1 forms a disulfide bond with cysteine 5, cysteine 2 forms a disulfide bond with cysteine 6 and cysteine 3 forms a disulfide bond with cysteine 4 (Long et al., 1992). Furthermore, it has been shown that a mutation of any of these residues has a profound effect on the conformation, processing and function of the resulting glycoprotein (Wilcox et al., 1988; Long et al., 1990). Therefore, the conservation of cysteine residues in the glycoproteins of the invention may also have structural significance.
The high degree of homology among the gC, gD and, in particular, gB homologues also suggests that these glycoproteins have common functions. In fact, it has been shown that the BHV1 gB homologue can rescue a gB.sup.- PRV virus, indicating that these 2 glycoproteins are functionally equivalent (Kopp & Mettenleiter, 1992).
Alignment of the gB, gC and gD amino acid sequences also revealed that potential N-linked glycosylation sites are somewhat conserved. N-linked glycosylation is thought to play a role in a variety of functions, such as maintenance of protein conformation and protection against proteolytic degradation. The biological significance of N-linked carbohydrates on herpesvirus glycoproteins, however, is not completely understood. For example, tunicamycin treatment of HSV1 infected cells has been shown to inhibit the production of infectious virions (Pizer et al., 1980). In addition, endoglycosidase treatment of HSV1 virions has been shown to decrease infectivity (Kuhn et al., 1988). On the other hand, N-linked glycosylation of HSV1 gD does not appear to be absolutely essential, since mutagenesis of the glycosylation sites on this glycoprotein does not affect infectivity (Sodora et al., 1991). Therefore, although the glycosylation sites on the gB, gC and gD glycoproteins are relatively well conserved, proper glycosylation of each of these polypeptides may not be absolutely essential.
The G+C content of herpesviruses varies from 33%-75% (Roizman, 1982). It has been suggested that this extensive variability is due to a nonselective mutational bias based on the presence (or absence) of virally encoded or induced enzymes involved in nucleotide metabolism (Honess, 1984). For example, VZV and herpesvirus saimiri (HVS) both have relatively low G+C contents (46% and 46%, respectively) and both encode an enzyme, thymidylate synthetase, which is involved in TTP synthesis (Davison & Scott, 1986; Honess et al., 1986). HSV1, HCMV and EBV, on the other hand, have relatively high G+C contents (68%, 57% and 60%, respectively) and do not appear to encode a thymidylate synthetase (Honess et al., 1986). CHV has been determined by DNA density analysis to have the lowest G+C content of any herpesvirus, 33% (Plummer et al., 1969; Roizman, 1982); a value which is consistent with the relatively low G+C content of the nucleotides of the invention (29%). Without wishing it to be bound by the theory that CHV does not encode an enzyme involved in nucleotide metabolism, from the present invention the ORF located immediately downstream from the CHV gC gene is not homologous to VZV thymidylate synthetase. Therefore, if CHV contains a thymidylate synthetase gene, it is not found at the same genomic location as VZV.
Newborn pups exposed to CHV usually die without forming CHV-specific neutralizing antibodies. Also, the maternal antibodies or treatment with immune serum from seropositive dogs can protect pups from a fatal CHV infection (Carmichael, 1970). Therefore, serum neutralizing antibodies can protect pups against a fatal CHV infection. Likewise, serum neutralizing antibodies can protect adult dogs from the self-limiting subclinical, upper respiratory tract infection.
Three CHV glycoproteins, gp145/112, gp80 and gp47, are known to elicit CHV neutralizing antibodies (Xuan et al., 1991). The genes encoding these glycoproteins have not been identified. Without wishing to be bound by any one theory, it is possible, however, that these antigens are encoded by the gB, gC and gD genes of this invention. Since several reports have indicated that an immune response against gB, gC and/or gD can provide protection of target species animals against a herpesvirus challenge (Babiuk et al., 1987; Nazarian et al., 1992; Riviere et al., 1992; Brockmeier et al., 1993), the CHV gB, gC and gD genes of this invention provide efficacious CHV glycoproteins, immunological or vaccine compositions and methods of using the same.
In particular, the nucleotides of this invention can be inserted into any suitable vector system for expression. For instance, the nucleotide(s) can be inserted into any suitable bacterial vector system such as the E. coli system, employing known methods (see, e.g., Robbins, EPA 0162738A1; Panicali, EPA 0261940A2).
The nucleotide(s) can be inserted into any suitable phage or viral vector system such as lambda, poxvirus, herpesvirus (see Roizman, U.S. Pat. No. 4,769,331, incorporated herein by reference), baculovirus, polio virus (see Kitson et al., J. Virol. 65, 3068-3075, 1991, incorporated herein by reference), and adenovirus (see Grunhaus et al., 1992, "Adenovirus as cloning vectors," Seminars in Virology (Vol. 3) p. 237-52, 1993; Ballay et al., EMBO Journal, vol. 4, p. 3861-65; Graham, Tibtech 8, 85-87, April, 1990; Prevec et al., J. Gen. Virol. 70, 429-434, each of which is incorporated herein by reference) systems employing known methods.
The preferred vector system is a poxvirus vector system, especially an avipox vaccinia virus system wherein recombination is as in U.S. Pat. Nos. 4,769,330, 4,772,848, 4,603,112, 5,100,587 and 5,179,993. However, an attenuated poxvirus system is even more preferred.
To develop a new vaccinia vaccine strain, NYVAC (vP866), the Copenhagen vaccine strain of vaccinia virus was modified by the deletion of six nonessential regions of the genome encoding known or potential virulence factors. The sequential deletions are detailed below. All designations of vaccinia restriction fragments, open reading frames and nucleotide positions are based on the terminology reported in Goebel et al., 1990a,b.
The deletion loci were also engineered as recipient loci for the insertion of foreign genes.
The regions deleted in NYVAC are listed below. Also listed are the abbreviations and open reading frame designations for the deleted regions (Goebel et al., 1990a,b) and the designation of the vaccinia recombinant (vP) containing all deletions through the deletion specified:
(1) thymidine kinase gene (TK; J2R) vP410;
(2) hemorrhagic region (u; B13R+B14R) vP553;
(3) A type inclusion body region (ATI; A26L) vP618;
(4) hemagglutinin gene (HA; A56R) vP723;
(5) host range gene region (C7L-K1L) vP804; and
(6) large subunit, ribonucleotide reductase (I4L) vP866 (NYVAC).
NYVAC is a genetically engineered vaccinia virus strain that was generated by the specific deletion of eighteen open reading frames encoding gene products associated with virulence and host range. NYVAC is highly attenuated by a number of criteria including i) decreased virulence after intracerebral inoculation in newborn mice, ii) inocuity in genetically (nu.sup.+ /nu.sup.+) or chemically (cyclophosphamide) immunocompromised mice, iii) failure to cause disseminated infection in immunocompromised mice, iv) lack of significant induration and ulceration on rabbit skin, v) rapid clearance from the site of inoculation, and vi) greatly reduced replication competency on a number of tissue culture cell lines including those of human origin. Nevertheless, NYVAC based vectors induce excellent responses to extrinsic immunogens and provided protective immunity.
TROVAC refers to an attenuated fowlpox that was a plaque-cloned isolate derived from the FP-1 vaccine strain of fowlpoxvirus which is licensed for vaccination of 1 day old chicks. ALVAC is an attenuated canarypox virus-based vector that was a plaque-cloned derivative of the licensed canarypox vaccine, Kanapox (Tartaglia et al., 1992). ALVAC has some general properties which are the same as some general properties of Kanapox. ALVAC-based recombinant viruses expressing extrinsic immunogens have also been demonstrated efficacious as vaccine vectors (Tartaglia et al., 1993 a,b). This avipox vector is restricted to avian species for productive replication. On human cell cultures, canarypox virus replication is aborted early in the viral replication cycle prior to viral DNA synthesis. Nevertheless, when engineered to express extrinsic immunogens, authentic expression and processing is observed in vitro in mammalian cells and inoculation into numerous mammalian species induces antibody and cellular immune responses to the extrinsic immunogen and provides protection against challenge with the cognate pathogen (Taylor et al., 1992; Taylor et al., 1991). Recent Phase I clinical trials in both Europe and the United States of a canarypox/rabies glycoprotein recombinant (ALVAC-RG) demonstrated that the experimental vaccine was well tolerated and induced protective levels of rabiesvirus neutralizing antibody titers (Cadoz et al., 1992; Fries et al., 1992). Additionally, peripheral blood mononuclear cells (PBMCS) derived from the ALVAC-RG vaccinates demonstrated significant levels of lymphocyte proliferation when stimulated with purified rabies virus (Fries et al., 1992).
NYVAC, ALVAC and TROVAC have also been recognized as unique among all poxviruses in that the National Institutes of Health ("NIH") (U.S. Public Health Service), Recombinant DNA Advisory Committee, which issues guidelines for the physical containment of genetic material such as viruses and vectors, i.e., guidelines for safety procedures for the use of such viruses and vectors which are based upon the pathogenicity of the particular virus or vector, granted a reduction in physical containment level: from BSL2 to BSL1. No other poxvirus has a BSL1 physical containment level. Even the Copenhagen strain of vaccinia virus--the common smallpox vaccine--has a higher physical containment level; namely, BSL2. Accordingly, the art has recognized that NYVAC, ALVAC and TROVAC have a lower pathogenicity than any other poxvirus.
Clearly based on the attenuation profiles of the NYVAC, ALVAC, and TROVAC vectors and their demonstrated ability to elicit both humoral and cellular immunological responses to extrinsic immunogens (Tartaglia et al., 1993a,b; Taylor et al., 1992; Konishi et al., 1992) such recombinant viruses offer a distinct advantage over previously described vaccinia-based recombinant viruses.
After growing the bacteria or infecting cells with the recombinant virus, the glycoprotein(s) are collected by known techniques such as chromatography (see Robbins, EPA 0162738A1; Panicali, EPA 0261940A2).
The collected glycoprotein(s) can then be employed in a vaccine, antigenic or immunological composition which also contains a suitable carrier. Accordingly, the inventive nucleotides are quite useful.
Alternatively, the viral vector system, especially the preferred poxvirus vector system, can be employed in a vaccine, antigenic or immunological composition which also contains a suitable carrier. The CHV recombinant poxvirus in the composition expresses the CHV glycoprotein in vivo after administration or inoculation.
The antigenic, immunological or vaccine composition of the invention (either containing glycoprotein(s) expressed from a vector system containing the inventive nucleotide(s) or containing a suitable vector system such as the CHV recombinant poxvirus) is administered to pups in the same fashion as maternal antibodies or immune serum from seropositive dogs (Carmichael, 1970). Seronegative dogs are administered the composition in the same fashion as other antigenic, vaccine or immunological compositions are administered. One skilled in the veterinary arts can determine dosage from this disclosure without undue experimentation, taking into consideration such factors as the age, weight, breed, sex and general health of the particular dog or pup.
Additionally, the inventive recombinant poxvirus and the expression products therefrom stimulate an immune or antibody response in animals. From those antibodies, by techniques well-known in the art, monoclonal antibodies can be prepared and, those monoclonal antibodies or the antigens expressed from the inventive nucleotides, can be employed in well known antibody binding assays, diagnostic kits or tests to determine the presence or absence of particular CHV gB, gC and/or gD antigen(s) or antibodies thereto and therefrom the presence or absence of the virus or, to determine whether an immune response to the virus or antigen(s) has simply been stimulated.
Monoclonal antibodies are immunoglobulins produced by hybridoma cells. A monoclonal antibody reacts with a single antigenic determinant and provides greater specificity than a conventional, serum-derived antibody. Furthermore, screening a large number of monoclonal antibodies makes it possible to select an individual antibody with desired specificity, avidity and isotype. Hybridoma cell lines provide a constant, inexpensive source of chemically identical antibodies and preparations of such antibodies can be easily standardized. Methods for producing monoclonal antibodies are well known to those of ordinary skill in the art, e.g., Koprowski, H. et al., U.S. Pat. No. 4,196,265, issued Apr. 1, 1989, incorporated herein by reference.
Uses of monoclonal antibodies are known. One such use is in diagnostic methods, e.g., David, G. and Greene, H., U.S. Pat. No. 4,376,110, issued Mar. 8, 1983, incorporated herein by reference.
Monoclonal antibodies have also been used to recover materials by immunoadsorption chromatography, e.g. Milstein, C., 1980, Scientific American 243:66, 70, incorporated herein by reference.
Additionally, the inventive nucleotides can be used as probes to ascertain the presence of CHV DNA in samples, as well as in the generation of PCR primers for replicating or cloning CHV DNA. Methods for using DNA as probes or for preparing PCR primers are known in the art.
Thus, the inventive nucleotides and expression products of the inventive nucleotides (and therefore the nucleotides) are quite useful.
The following non-limiting Examples are given by way of illustration only and are not to be considered a limitation of this invention.
EXAMPLES
Methods and Materials
Preparation of genomic CHV DNA. CHV (obtained from L. Carmichael, Cornell University) was propagated on Madin-Darby canine kidney (MDCK) cells (ATCC CCL34). Viral DNA was isolated by standard methodology (Tartaglia et al., 1990).
DNA Hybridization.
CHV genomic DNA was digested with restriction enzymes, run on agarose gels and transferred to Gene-Screen membranes (New England Nuclear) under conditions recommended by the manufacturers. Hybridizations were performed at 44.degree. C., 53.degree. C. or 59.degree. C. in 1M NaCl, 1% SDS and 10% dextran sulfate. The hybridization probe included a 1800 bp BamHI-XbaI fragment, containing an internal segment of the feline herpesvirus (FHV) gB gene, a 950 bp BamHI-EcoRI fragment, containing the 3'-end of the FHV gC gene and a 970 bp BamHI-HindIII fragment, containing the 3'-end of the FHV gD gene (Audonnet, unpublished results).
Cloning and DNA Sequencing.
CHV genomic fragments were subcloned into pBluescriptSK (Stratagene). Plasmid DNA was prepared and manipulated using standard techniques. Nucleotide sequencing was performed on double-stranded plasmid templates, using the modified T7 enzyme, Sequenase (U.S. Biochemical Corporation), and standard protocols recommended by the manufacturer. M13 forward and reverse primers were used to obtain initial sequence, and custom primers, prepared with a Biosearch 8700 or an Applied Biosystems 380B oligonucleotide synthesizer, were used for subsequent reactions.
DNA and Amino Acid Sequence Analyses.
DNA and amino acid sequence analyses were performed with PC/GENE (IntelliGenetics, Incorporated), ALIGN Plus (Scientific and Educational Software) and IBI-Pustell (International Biotechnologies, Incorporated) software packages. Homology searches were conducted on the SWISS-PROT (Release 20 or 23) (IntelliGenetics, Incorporated) database, using the FASTA program (Pearson & Lipman, 1988).
DNA Cloning and Synthesis.
Plasmids were constructed, screened and grown by standard procedures (Maniatis et al., 1982; Perkus et al., 1985; Piccini et al., 1987). Restriction endonucleases were obtained from Bethesda Research Laboratories, Gaithersburg, Md., New England Biolabs, Beverly, Mass.; and Boehringer Mannheim Biochemicals, Indianapolis, Ind. Klenow fragment of E. coli polymerase was obtained from Boehringer Mannheim Biochemicals. BAL-31 exonuclease and phage T4 DNA ligase were obtained from New England Biolabs. The reagents were used as specified by the various suppliers.
Synthetic oligodeoxyribonucleotides were prepared on a Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as previously described (Perkus et al., 1989). DNA sequencing was performed by the dideoxy-chain termination method (Sanger et al., 1977) using Sequenase (Tabor et al., 1987) as previously described (Guo et al., 1989). DNA amplification by polymerase chain reaction (PCR) for sequence verification (Engelke et al., 1988) was performed using custom synthesized oligonucleotide primers and GeneAmp DNA amplification Reagent Kit (Perkin Elmer Cetus, Norwalk, Conn.) in an automated Perkin Elmer Cetus DNA Thermal Cycler. Excess DNA sequences were deleted from plasmids by restriction endonuclease digestion followed by limited digestion by BAL-31 exonuclease and mutagenesis (Mandecki, 1986) using synthetic oligonucleotides.
Cells, Virus, and Transfection.
The origins and conditions of cultivation of the Copenhagen strain of vaccinia virus has been previously described (Guo et al., 1989). Generation of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity are as previously described (Piccini et al., 1987).
The origins and conditions of cultivation of the Copenhagen strain of vaccinia virus and NYVAC has been previously described (Guo et al., 1989; Tartaglia et al., 1992). Generation of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity are as previously described (Panicali et al., 1982; Perkus et al., 1989).
The parental canarypox virus (Rentschler strain) is a vaccinal strain for canaries. The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts. A master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests. The plaque purified canarypox isolate is designated ALVAC.
The strain of fowlpox virus (FPV) designated FP-1 has been described previously (Taylor et al., 1988a). It is an attenuated vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scale from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells. The virus was subjected to four successive plaque purifications. One plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, established.
NYVAC, ALVAC and TROVAC viral vectors and their derivatives were propagated as described previously (Piccini et al., 1987; Taylor et al., 1988a,b). Vero cells and chick embryo fibroblasts (CEF) were propagated as described previously (Taylor et al., 1988a,b).
Example 1
Identification and Sequencing of the CHV gB Gene
Hybridization of CHV genomic DNA at relatively low stringency with a radiolabelled probe containing the feline herpesvirus (FHV) gB, gC and gD genes (Audonnet, unpublished results) identified one complimentary sequence. A 6 kb XbaI fragment containing this sequence was cloned and the nucleotide sequence of the hybridizing region was determined. The sequence of the nucleotide coding the CHV gB gene is shown in FIG. 1 together with the predicted amino acid expression (gB glycoprotein) therefrom. The putative transmembrane regions and potential TATA, CAAT and polyadenylation signal sequences are underlined. Nucleotides and predicted amino acid residues are numbered to the right of the sequence.
An open reading frame (ORF) starting at position 201 and ending at position 2840 was identified. The translation product (predicted) of this ORF is 879 amino acids long. Comparison of this amino acid sequence with the SWISS-PROT (Release 20) database revealed significant homology with the gB glycoprotein of numerous herpesviruses. Additional analyses revealed that the CHV gene product (predicted) was more homologous to the gB glycoprotein of alpha-herpesviruses, such as herpes simplex virus type 1 (HSV1), than beta- or gamma-herpesviruses, such as human cytomegalovirus (HCMV) or Epstein-Barr virus (EBV). These analyses and the results thereof are shown in Table 1 below. These results indicate that CHV should be classified as an alpha-herpesvirus; a conclusion that is consistent with the previous classification of this virus according to biological properties (Carmichael et al., 1965; Roizman, 1982).
TABLE 1__________________________________________________________________________HOMOLOGY BETWEEN THE PREDICTED AMINO ACIDSEQUENCES OF 10 HERPESVIRUS gB GLYCOPROTEINSFHV EHV1 PRV BHV1 VZV MDV HSV1 HCMV EBV__________________________________________________________________________CHV 78 61 61 59 55 52 50 29 27FHV 57 59 58 51 48 48 27 27EHV1 52 52 47 45 44 27 26PRV 63 52 48 50 29 29BHV1 52 46 48 28 28VZV 49 48 30 28MDV 48 30 29HSV1 28 29HCMV 32__________________________________________________________________________
Values in Table 1 were obtained using the ALIGN Plus program and are expressed as percent homology. The entire gB amino acid sequence was used. The alignment parameters were: mismatch penalty=2, open gap penalty=4, extended gap penalty=1. References: FHV (Maeda et al., 1992), EHV1 (Whalley et al., 1989), PRV (Robbins et al., 1987), BHV1 (Whitbeck et al., 1988), VZV (Keller et al., 1986), MDV (Ross et al., 1989), HSV1 (Bzik et al., 1984), HCMV (Kouzarides et al., 1987) and EBV (Pellett et al., 1985).
Example 2
Analysis of the CHV gB Nucleotide Sequence
The 5'- and 3'-noncoding regions of the CHV gB gene contain numerous RNA polymerase II regulatory sequence motifs, such as TATA box, CAAT box and polyadenylation signal sequences (Corden et al., 1980; Proudfoot & Brownlee, 1976) (FIG. 1). Potential TATA box sequences are found at positions 34, 36, 119 and 148, approximately 165 bp, 160 bp, 80 bp and 50 bp upstream from the CHV gB initiation codon. Potential CAAT box sequences (ATTG) are found at positions 89, 97 and 165, approximately 110 bp, 100 bp and 35 bp upstream from the gB initiation codon. Potential polyadenylation signal sequences (AATAAA) are found at positions 2839 and 2961, approximately 0 bp and 120 bp downstream from the CHV gB termination codon.
The nucleotide sequence surrounding the initiation codon has been shown to affect the efficiency of translation initiation (Kozak, 1986). In particular, the sequence, [A/G]NNATGG, has been found to be most efficient. Therefore, relative to Kozak's rules, the nucleotide sequence surrounding the CHV gB initiation codon (AGTATGT) is favorable at position -3, but not at position +4 (FIG. 1). The fact that the CHV gB gene does not follow Kozak's rules is not unusual. The FHV (Maeda et al., 1992), PRV (Robbins et al., 1987), varicella-zoster virus (VZV) (Keller et al., 1986), MDV (Ross et al., 1989) and HSV1 (Bzik et al., 1984) gB genes also contain a pyrimidine at position +4.
Example 3
Analysis of the Predicted CHV gB Amino Acid Sequence
The deduced amino acid sequence of the CHV gB homologue is presented in FIG. 1. Hydropathicity analysis of this amino acid sequence is shown in FIG. 2. The profile was obtained with the PC/GENE SOAP program, using the method of Kyte & Doolittle (1982) and an interval of 13 amino acids. The vertical axis represents relative hydropathicity, where positive values are hydrophobic and negative values are hydrophilic. The horizontal axis represents the amino acid number of the CHV gB homologue.
Hydropathicity analysis of this amino acid sequence revealed the presence of 2 prominent hydrophobic peaks. The first peak, located at the N-terminus, without wishing to be bound by any one theory, represents a potential signal sequence. N-terminal signal sequences initiate transport across the endoplasmic reticulum membrane and can be critical for the proper post-translational modification and targeting of glycoproteins (Blobel, 1980). Signal sequences vary in length from about 15-30 residues and usually consist of a basic N-terminal region, a central hydrophobic region and a short, relatively polar C-terminal region. In addition, the cleavage site usually conforms to the -3,-1 rule, where the residue at position -1 is small (Ala, Ser, Gly, Cys, Thr or Gln) and the residue at position -3 is not aromatic (Phe, His, Tyr or Trp), charged (Asp, Glu, Lys or Arg) or large and polar (Asn or Gln), and residues -3 through +1 are not Pro (von Heijne, 1986). Although analysis with PSIGNAL, a PC/GENE program designed to detect eukaryotic signal sequences, does not identify the N-terminal end of CHV gB as a potential signal sequence, this region does have elements consistent with typical signal sequences; namely a hydrophobic core (residues 2-17) and a relatively polar C-terminal region (FIG. 1). The fact that PSIGNAL does not detect a signal sequence in the N-terminal region of CHV gB is not unique. This algorithm also does not detect a signal sequence in the N-terminal region of the VZV gB homologue.
The second, very broad, hydrophobic peak(s) (FIG. 2), with predicted membrane-spanning segments between amino acid residues 725 and 741 and 746-750 and 766-772 (using the method of Klein et al. (1985)), without wishing to be bound by any one theory, functions as a membrane anchor region. It has been hypothesized that the transmembrane domain of HSV1 gB, as well as other gB homologues, transverses the membrane 3 times (Pellett et al., .1985). Hydropathicity analysis of CHV gB reveals the presence of at least 2 distinct hydrophobic peaks. Therefore, CHV gB and HSV1 gB have similar transmembrane structures.
Alignment of the CHV gB amino acid sequence with similar sequences from other herpesviruses revealed extensive homology throughout the entire sequence, with the exception of the N-terminus, a region surrounding the putative cleavage site (see below) and a region near the C-terminus. FIGS. 3A and 3B show the amino acid homology of 8 gB homologues. The amino acid sequences of the CHV, FHV, EHV1, PRV, HSV1, VZV, HCMV and EBV gB homologues (for references from which the sequences were obtained, see text below Table 1) were aligned using the PC/GENE CLUSTAL program. Gaps, indicated by dashes, were introduced to maximize homology. Aligned residues which are identical in all 8 sequences are indicated by an asterisk (*). Aligned residues which are identical in the majority of sequences are indicated by a period (.). Conserved cysteine residues are boxed. Potential N-linked glycosylation sites are shaded. Putative proteolytic cleavage sites are underlined.
This alignment also revealed that the vast majority of cysteine residues are perfectly conserved. For example, CHV gB contains 11 cysteine residues, 10 of which are perfectly conserved in all alpha-, beta- and gamma-herpesviruses. In fact, the only cysteine residue in CHV gB that is not conserved is found near the N-terminus and may be located in the putative signal sequence. These results show that the gB glycoproteins have relatively similar tertiary structures.
Alignment of the gB amino acid sequences also revealed that the potential N-linked glycosylation sites are relatively well conserved (FIGS. 3A and 3B). N-linked oligosaccharides can be added to Asn residues that have the sequence Asn-X-Ser or Asn-X-Thr, where X is not Pro (Bause, 1983). CHV gB contains 13 potential N-linked glycosylation sites. Three of these sites, however, are situated in the putative cytoplasmic domain and, therefore, may not be glycosylated. The location of the potential N-linked glycosylation sites is relatively well conserved in the majority of gB glycoproteins (FIGS. 3A and 3B).
The gB glycoprotein of most herpesviruses is cleaved internally during maturation, with the subsequent peptides being held together by disulfide bonds. The VZV gB homologue (gpII), for example, is cleaved between Arg and Ser residues, resulting in 2 glycoproteins of approximately 60 kd (Keller et al., 1986). The gB glycoproteins of FHV (Maeda et al., 1992), equine herpesvirus type 1 (EHV1) (Whalley et al., 19989), PRV (Robbins et al., 1987), BHV1 (Whitbeck et al., 1988), MDV (Ross et al., 1989) and HCMV (Kouzarides et al., 1987) are also cleaved. Furthermore, a sequence, Arg-X-Arg-Arg/Lys--Ser/Ala, similar to the sequence at the VZV cleavage site, Arg-Thr-Arg-Arg--Ser, is present at virtually the same location in each of these gB glycoptoteins. Conversely, this sequence is not found in the HSV1 (Bzik et al., 1984) and EBV (Pellett et al., 1985) gB glycoproteins, which are not cleaved. The significance of this cleavage event is unknown. It does not appear, however, to be essential for replication, in vitro, since strains of BHV1 (Blewett & Misra, 1991) and HCMV (Spaete et al., 1990) that have been mutated at the cleavage site, and therefore encode an uncleaved gB glycoprotein, are still infectious. Without wishing to be bound by the theory that CHV gB is cleaved internally, proteolytically, the sequence, Arg-Lys-Arg-Arg--Ser, is present at the same location in CHV as in VZV, FHV, EHV1, PRV, BHV1, MDV and HCMV.
Example 4
Identification and Sequencing of the CHV gC Gene
CHV genomic fragments were randomly cloned into pBluescriptSK. The nucleotide sequence of the termini of these fragments was determined and the predicted amino acid sequence of potential ORFs were analyzed for homology against the SWISS-PROT (Release 20) amino acid database. Using this methodology, a 12 kb XbaI fragment encoding an ORF with homology to herpesvirus gC glycoproteins was identified. The nucleotide sequence of this ORF is presented in FIG. 4. FIG. 4 shows the nucleotide sequence and predicted amino acid sequence of the CHV gC homologue and ORF2. The putative transmembrane region and potential TATA, CAAT and polyadenylation signal sequences are underlined. Nucleotides and predicted amino acid residues are numbered to the right of the sequence. The putative CHV gC gene starts at position 201 and ends at position 1580. The predicted translation product is 459 amino acids long. Comparison of this amino acid sequence with the sequence of gC glycoproteins from other herpesviruses is shown in Table 2, below, and revealed extensive homology, indicating that this ORF encodes the CHV gC homologue (Table 2).
TABLE 2__________________________________________________________________________HOMOLOGY BETWEEN THE PREDICTED AMINO ACIDSEQUENCES OF 9 HERPESVIRUS gC GLYCOPROTEINSFHV EHV1 EHV4 PRV BHV1 VZV MDV HSV1__________________________________________________________________________CHV 44 32 34 27 27 29 27 25FHV 32 33 29 31 28 25 23EHV1 81 31 32 30 27 27EHV4 32 31 31 25 27PRV 37 27 25 29BHV1 29 25 27VzV 22 22MDV 23__________________________________________________________________________
Values in Table 2 were obtained using the ALIGN Plus program and are expressed as percent homology. The entire gC amino acid sequence was used. See Table 1 for alignment parameters. References: FHV (Audonnet, unpublished results), EHV1 (Allen & Coogle, 1988), EHV4 (Nicolson & Onions, 1990), PRV (Robbins et al., 1986), BHV1 (Fitzpatrick et al., 1989), VZV (Davison & Scott, 1986), MDV (Ihara et al., 1989) and HSV1 (McGeoch et al., 1988).
Example 5
Analysis of the CHV gC Nucleotide Sequence
Potential TATA box sequences (TATA) are found at positions 22 and 81, approximately 180 bp and 120 bp upstream from the CHV gC initiation codon (FIG. 4). An additional TATA sequence is found at position 175. Due to its proximity to the gC initiation codon, however, this sequence may not be a potential TATA box sequence. Potential CAAT box sequences (CAAT and ATTG) are found at positions 13, 59 and 119, approximately 190 bp, 140 bp and 80 bp upstream from the gC initiation codon. A potential polyadenylation signal sequence (AATAAA) is found at position 1744, approximately 165 bp downstream from the CHV gC termination codon and 45 bp within ORF2 (see below). Other potential polyadenylation signal-like sequences are also found in the gC 3'-noncoding region.
Like the CHV gB gene, the nucleotide sequence surrounding the CHV gC initiation codon (AAAATGA) is favorable with respect to Kozak's rules at position -3, but not at position +4 (FIG. 4). The FHV (Audonnet, unpublished results), EHV1 (Allen & Coogle, 1988) and VZV (Davison & Scott, 1986) gC genes also contain an unfavorable nucleotide at position +4.
Example 6
Analysis of the CHV gC Amino Acid Sequence Predicted
The deduced amino acid sequence of the CHV gC homologue is presented in FIG. 4. FIG. 5 shows the hydropathicity analysis of the CHV gC homologue. The profile was obtained with the PC/GENE SOAP program, using the method of Kyte & Doolittle (1982) and an interval of 13 amino acids. The vertical axis represents relative hydropathicity, where positive values are hydrophobic and negative values are hydrophilic. The horizontal axis represents the amino acid number of the CHV gC homologue.
Hydropathicity analysis of the predicted CHV gC amino acid sequence revealed the presence of 2 prominent hydrophobic peaks (FIG. 5). The first peak, located at the N-terminus, without wishing to be bound by any one theory, represents a potential signal sequence. Although analysis with PSIGNAL does not identify the N-terminal end of this polypeptide as a potential signal sequence, this region does have a basic N-terminal region, a hydrophobic core (residues 6-20) and a relatively polar C-terminal region (FIG. 4). The second hydrophobic peak, with a predicted membrane-spanning segment between residues 424-433 and 449-456 (using the method of Klein et al. (1985)), without wishing to be bound by any one theory, functions as a membrane anchor region. FIG. 6 shows the amino acid homology of 4 gC homologues. The amino acid sequences of the CHV, FHV, EHV1 and HSV1 gC homologues (for references see Table 2) were aligned using the PC/GENE CLUSTAL program. Gaps, indicated by dashes, were introduced to maximize homology. Aligned residues which are identical in all 4 sequences are indicated by an asterisk (*). Aligned residues which are identical in the majority of sequences are indicated by a period (.). Conserved cysteine residues are boxed. Potential N-linked glycosylation sites are shaded.
Alignment of the CHV gC amino acid sequence with homologous sequences from other herpesviruses revealed a moderate level of homology throughout the entire sequence, with the exception of the N-terminus (FIG. 6). This alignment also revealed that the majority of cysteine residues are perfectly conserved. For example, CHV gC contains 10 cysteine residues, 8 of which are perfectly conserved in all alpha-herpesviruses. In fact, the only cysteine residues in CHV gC that are not conserved are located in the putative transmembrane or intracellular domains. These results show that the gC glycoproteins have relatively similar tertiary structures. Alignment with other gC sequences also revealed the relative conservation of potential N-linked glycosylation sites.
Example 7
Identification and Sequencing of ORF2
Nucleotide sequence analysis of the region downstream from the CHV gC gene revealed the presence of a second ORF (FIG. 4). This ORF (ORF2) starts at position 1699 and ends at position 2226. The predicted translation product is 175 amino acids long. Table 3, below, shows the comparison of this amino acid sequence with the SWISS-PROT (Release 23) database revealed significant homology with the ORFs located downstream from other alpha-herpesvirus gC genes, The homology scores for the ORF2 homologues shows that in CHV, FHV, EHV1, equine herpesvirus type 4 (EHV4), MDV, herpesvirus of turkey (HVT) and possibly HSV1, the ORF located downstream from the gC gene represents a highly divergent, but evolutionarily related, gene family. Conversely, the ORF (gene 13) located next to the VZV gC gene does not exhibit significant homology with any of the other comparably positioned ORFs. Furthermore, gene 13 is oriented on the genome in the opposite direction relative to all the other ORF2-like genes (Davison & Scott, 1986). These results are consistent with the proposed functions of the proteins encoded by these 2 groups of genes; VZV gene 13 encodes a thymidylate synthetase (Davison and Scott, 1986), whereas the HSV1 ORF2-like gene (UL45) encodes a putative virion protein (Telford et al., 1992). Therefore, the ORFs located next to the gC gene in CHV, FHV, EHV1, EHV4, MDV, HVT and possibly HSV1 encode proteins that are structurally and functionally unrelated to the protein encoded downstream from the VZV gC homologue.
TABLE 3______________________________________HOMOLOGY BETWEEN THE PREDICTED AMINO ACIDSEQUENCES OF THE ORFS LOCATED ADJACENT TO THE gCGENE IN 8 HERPESVIRUSESFHV EHV1 EHV4 MDV HTV HSV1 VZV______________________________________CHV 197(22) 211(22) 219(21) 62(4) 105(13) 53(4) 31(0)FHV 177(24) 167(18) 69(4) 66(4) 40(1) 52(1)EHV1 470(50) 95(8) 104(9) 79(7) 58(3)EHV4 132(8) 130(11) 60(5) 30(0)MDV 767(75) 83(6) 28(0)HTV 91(7) 33(0)HSV1 49(2)______________________________________
Values in Table 3 were obtained using the FASTA and RDF2 programs (Pearson & Lipman, 1988). A ktup of 1 was used. Values in parentheses represent the number of standard deviations between the FASTA score and the mean of the scores obtained from 100 randomly permutated versions of the potentially related sequence. References: FHV (Audonnet, unpublished results), EHV1 (Telford et al., 1992), EHV4 (Nicolson & Onions, 1990), MDV (Ihara et al., 1989), HVT (Kato et al., 1989), HSV1 (McGeoch et al., 1988) and VZV (Davison & Scott, 1986).
Example 8
Analysis of the CHV ORF2 Nucleotide Sequence
Potential TATA box sequences (TATA) are found at positions 1604, 1606, 1635 and 1662, approximately 95, 93, 65 and 35 bp upstream from the ORF2 initiation codon and approximately 24, 26, 55 and 80 bp downstream from the gC gene termination codon (FIG. 4). A potential CAAT box sequence (CAAT) is found at position 1584, approximately 115 bp upstream from the initiation codon. Potential polyadenylation signal sequences (AATAAA) are found at overlapping positions 2225, 2229, 2234 and 2238, approximately 0-15 bp downstream from the ORF2 termination codon. The nucleotide sequence surrounding the ORF2 initiation codon (AATATGG) is favorable with respect to Kozak's rules at positions -3 and +4.
Example 9
Identification and Sequencing of the CHV gD Gene
Employing the same methodology used to map the CHV gC homologue, a 7 kb PstI fragment encoding an ORF with homology to herpesvirus gD glycoproteins was identified. FIG. 7 shows the nucleotide sequence and predicted amino acid sequence of the CHV gD homologue. The putative signal sequence, transmembrane region and potential polyadenylation signal sequences are underlined. Nucleotides and predicted amino acid residues are numbered to the right of the sequence. The CHV gD gene starts at position 201 and ends at position 1238. The translation product (predicted) is 345 amino acids long. Table 4, below, provides comparison of this amino acid sequence with the sequence of other gD glycoproteins and, revealed extensive homology, indicating that this ORF encodes the CHV gD homologue.
TABLE 4______________________________________Homology between the predicted amino acidsequences of 6 herpesvirus gD glycoproteinsFHV EHV1 PRV BHV1 HSV1______________________________________CHV 45 35 27 34 21FHV 31 30 34 24EHV1 26 27 21PRV 37 27BHV1 24______________________________________
Values in Table 4 were obtained using the ALIGN Plus program and are expressed as percent homology. The entire gD amino acid sequence was used. See Table 1 for alignment parameters. References: FHV (Audonnet, unpublished results), EHV1 (Flowers et al., 1991), PRV (Petrovskis et al., 1986), BHV1 (Tikoo et al., 1990) and HSV1 (Lasky & Dowbenko, 1984).
Example 10
Analysis of the CHV gD Nucleotide Sequence
No TATA or CAAT/ATTG sequences were identified immediately upstream from the CHV gD gene (FIG. 7). Numerous potential TATA box-like sequences, however, were found. Potential polyadehylation signal sequences (AATAAA) were found at positions 1260 and 1287, approximately 25 bp and 50 bp downstream from the CHV gD termination codon. Like the CHV gB and gC genes, the nucleotide sequence surrounding the CHV gD initiation codon (AAAATGA) is favorable with respect to Kozak's rules at position -3, but not at position +4 (FIG. 7). The FHV (Audonnet, unpublished results), EHV1 (Audonnet et al., 1990; Flowers et al., 1991), PRV (Petrovskis et al., 1986) and BHV1 (Tikoo et al., 1990) gD genes also contain an unfavorable nucleotide at position +4.
Example 11
Analysis of the Predicted CHV gD Amino Acid Sequence
The deduced amino acid sequence of the CHV gD homologue is presented in FIG. 7. FIG. 8 shows the hydropathicity analysis of the CHV gD homologue. The profile was obtained with the PC/GENE SOAP program, using the method of Kyte & Doolittle (1982) and an interval of 11 amino acids. The vertical axis represents relative hydropathicity, where positive values are hydrophobic and negative values are hydrophilic. The horizontal axis represents the amino acid number of the CHV gD homologue.
Hydropathicity analysis of the predicted CHV gD amino acid sequence revealed the presence of 2 prominent hydrophobic peaks (FIG. 8). The first peak, located at the N-terminus, without wishing to be bound by any one theory, represents a potential signal sequence. In fact, PSIGNAL identified a potential cleavage site between positions 16 and 17. The second hydrophobic peak, with a predicted membrane-spanning segment between residues 304-311 and 327-332 (using the method of Klein et al. (1985)), without wishing to be bound by any one theory, functions as a membrane anchor region.
FIG. 9 shows amino acid homology of 4 gD homologues. The amino acid sequences of the CHV, FHV, EHV1 and HSV1 gD homologues (for references see Table 4) were aligned using the PC/GENE CLUSTAL program. Gaps, indicated by dashes, were introduced to maximize homology. Aligned residues which are identical in all 4 sequences are indicated by an asterisk (*). Aligned residues which are identical in the majority of sequences are indicated by a period (.). Conserved cysteine residues are boxed. Potential N-linked glycosylation sites are shaded. Alignment of the CHV gD amino acid sequence with homologous sequences from other herpesviruses revealed a moderate level of homology throughout the entire sequence, with the exception of the N-terminus (FIG. 9). This alignment also revealed that the vast majority of cysteine residues are perfectly conserved. For example, CHV gD contains 6 cysteine residues, all of which are perfectly conserved in all alpha-herpesviruses. These results show that the gD glycoproteins have relatively similar tertiary structures. This alignment also revealed that the potential N-linked glycosylation sites are well conserved. Without wishing to be bound by any theory that the CHV gD glycosylation sites are utilized, it is known that all of the potential HSV1 gD glycosylation sites are used (Sodora et al., 1991).
Example 12
Genomic Organization
The gB, gC and gD genes were not mapped to specific locations on the CHV genome. Nucleotide sequence analyses of the regions flanking these genes, however, indicates that the genomic organization of CHV is similar to other alpha-herpesviruses. For example, the ORF located immediately upstream from the CHV gB gene has homology with gene 30 of VZV (Davison & Scott, 1986) and UL28 of HSV1 (McGeoch et al., 1988), both of which are located immediately upstream from the gB homologue in those viruses. ORF2, located immediately downstream from the CHV gC gene, has homology with the ORFs located immediately downstream from the gC homologue in FHV (Audonnet, unpublished results), EHV1 (Telford et al., 1992), EHV4 (Nicolson & Onions, 1990), HVT (Kato et al., 1988) and perhaps HSV1 (McGeoch et al., 1988. Additionally, the ORF located immediately downstream from the CHV gD gene has homology to the gI gene of EHV1 (Audonnet et al., 1990) and the gp63 gene of PRV (Petrovskis et al., 1986), both of which are located immediately downstream from the gD homologue in those viruses (data not shown).
Example 13
Construction of Plasmid pSD460 for Deletion of Thymidine Kinase Gene (J2R)
Referring now to FIG. 10, plasmid pSD406 contains vaccinia HindIII J (pos. 83359-88377) cloned into pUC8. pSD406 was cut with HindIII and PvuII, and the 1.7 kb fragment from the left side of HindIII J cloned into PUC8 cut with HindIII/SmaI, forming pSD447. pSD447 contains the entire gene for J2R (pos. 83855-84385). The initiation codon is contained within an NlaIII site and the termination codon is contained within an SspI site. Direction of transcription is indicated by an arrow in FIG. 10.
To obtain a left flanking arm, a 0.8 kb HindIII/EcoRI fragment was isolated from pSD447, then digested with NlaIII and a 0.5 kb HindIII/NlaIII fragment isolated. Annealed synthetic oligonucleotides MPSYN43/MPSYN44 (SEQ ID NO:24/SEQ ID NO:25)
SmaIMPSYN43 5' TAATTAACTAGCTACCCGGG 3'MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5' NlaIII EcoRI
were ligated with the 0.5 kb HindIII/NlaIII fragment into pUC18 vector plasmid cut with HindIII/EcoRI, generating plasmid pSD449.
To obtain a restriction fragment containing a vaccinia right flanking arm and pUC vector sequences, pSD447 was cut with SspI (partial) within vaccinia sequences and HindIII at the pUC/vaccinia junction, and a 2.9 kb vector fragment isolated. This vector fragment was ligated with annealed synthetic oligonucleotides MPSYN45/MPSYN46 (SEQ ID NO:26/SEQ ID NO:27)
HindIII SmaIMPSYN45 5' AGCTTCCCGGGTAAGTAATACGTCAAGGAGAAAACGAAMPSYN46 3' AGGGCCCATTCATTATGCAGTTCCTCTTTTGCTT NotI SspI ACGATCTGTAGTTAGCGGCCGCCTAATTAACTAAT 3' MPSYN45 TGCTAGACATCAATCGCCGGCGGATTAATTGATTA 5' MPSYN46
generating pSD459.
To combine the left and right flanking arms into one plasmid, a 0.5 kb HindIII/SmaI fragment was isolated from pSD449 and ligated with pSD459 vector plasmid cut with HindIII/SmaI, generating plasmid pSD460. pSD460 was used as donor plasmid for recombination with wild type parental vaccinia virus Copenhagen strain VC-2. .sup.32 P labelled probe was synthesized by primer extension using MPSYN45 (SEQ ID NO:26) as template and the complementary 20 mer oligonucleotide MPSYN47 (SEQ ID NO:28) (5' TTAGTTAATTAGGCGGCCGC 3') as primer. Recombinant virus vP410 was identified by plaque hybridization.
Example 14
Construction of Plasmid pSD486 for Deletion of Hemorrhagic Region (B13R+B14R)
Referring now to FIG. 11, plasmid pSD419 contains vaccinia SalI G (pos. 160,744-173,351) cloned into pUC8. pSD422 contains the contiguous vaccinia SalI fragment to the right, SalI J (pos. 173,351-182,746) cloned into pUC8. To construct a plasmid deleted for the hemorrhagic region, u, B13R-B14R (pos. 172,549-173,552), pSD419 was used as the source for the left flanking arm and pSD422 was used as the source of the right flanking arm. The direction of transcription for the u region is indicated by an arrow in FIG. 11.
To remove unwanted sequences from pSD419, sequences to the left of the NcoI site (pos. 172,253) were removed by digestion of pSD419 with NcoI/SmaI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation generating plasmid pSD476. A vaccinia right flanking arm was obtained by digestion of pSD422 with HpaI at the termination codon of B14R and by digestion with NruI 0.3 kb to the right. This 0.3 kb fragment was isolated and ligated with a 3.4 kb HincII vector fragment isolated from pSD476, generating plasmid pSD477. The location of the partial deletion of the vaccinia u region in pSD477 is indicated by a triangle. The remaining B13R coding sequences in pSD477 were removed by digestion with ClaI/HpaI, and the resulting vector fragment was ligated with annealed synthetic oligonucleotides SD22mer/SD20mer (SEQ ID NO:29/SEQ ID NO:30)
ClaI BamHI HpaISD22mer 5' CGATTACTATGAAGGATCCGTT 3'SD20mer 3' TAATGATACTTCCTAGGCAA 5'
generating pSD479. pSD479 contains an initiation codon (underlined) followed by a BamHI site. To place E. coli Beta-galactosidase in the B13-B14 (u) deletion locus under the control of the u promoter, a 3.2 kb BamHI fragment containing the Beta-galactosidase gene (Shapira et al., 1983) was inserted into the BamHI site of pSD479, generating pSD479BG. pSD479BG was used as donor plasmid for recombination with vaccinia virus vP410. Recombinant vaccinia virus vP533 was isolated as a blue plaque in the presence of chromogenic substrate X-gal. In vP533 the B13R-B14R region is deleted and is replaced by Beta-galactosidase.
To remove Beta-galactosidase sequences from vP533, plasmid pSD486, a derivative of pSD477 containing a polylinker region but no initiation codon at the u deletion junction, was utilized. First the ClaI/HpaI vector fragment from pSD477 referred to above was ligated with annealed synthetic oligonucleotides SD42mer/SD40mer (SEQ ID NO:31/SEQ ID NO:32)
ClaI SacI XhoI HpaISD42mer 5' CGATTACTAGATCTGAGCTCCCCGGGCTCGAGGGATCCGTT 3'SD40mer 3' TAATGATCTAGACTCGAGGGGCCCGAGCTCCCTAGGCAA 5' BglII SmaI BamHI
generating plasmid pSD478. Next the EcoRI site at the pUC/vaccinia junction was destroyed by digestion of pSD478 with EcoRI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation, generating plasmid pSD478E.sup.- .pSD478E.sup.- was digested with BamHI and HpaI and ligated with annealed synthetic oligonucleotides HEM5/HEM6 (SEQ ID NO:33/SEQ ID NO:34)
BamHI EcoRI HpaIHEM5 5' GATCCGAATTCTAGCT 3'HEM6 3' GCTTAAGATCGA 5'
generating plasmid pSD486. pSD486 was used as donor plasmid for recombination with recombinant vaccinia virus vP533, generating vP553, which was isolated as a clear plaque in the presence of X-gal.
Example 15
Construction of Plasmid pMP494.DELTA. for Deletion of ATI Region (A26L)
Referring now to FIG. 12, pSD414 contains SalI B cloned into pUC8. To remove unwanted DNA sequences to the left of the A26L region, pSD414 was cut with XbaI within vaccinia sequences (pos. 137,079) and with HindIII at the pUC/vaccinia junction, then blunt ended with Klenow fragment of E. coli polymerase and ligated, resulting in plasmid pSD483. To remove unwanted vaccinia DNA sequences to the right of the A26L region, pSD483 was cut with EcoRI (pos. 140,665 and at the pUC/vaccinia junction) and ligated, forming plasmid pSD484. To remove the A26L coding region, pSD484 was cut with NdeI (partial) slightly upstream from the A26L ORF (pos. 139,004) and with HpaI (pos. 137,889) slightly downstream from the A26L ORF. The 5.2 kb vector fragment was isolated and ligated with annealed synthetic oligonucleotides ATI3/ATI4 (SEQ ID NO:35/SEQ ID NO:36)
NdeIATI3 5' TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTCAAAAAATAAGTATI4 3' ACTCATTGAATTGAGAAAACAATTAATTTTCATATAAgTTTTTTATTCA BglII EcoRI HpaI TATATAAATAGATCTGAATTCGTT 3' ATI3 ATATATTTATCTAGACTTAAGCAA 5' ATI4
reconstructing the region upstream from A26L and replacing the A26L ORF with a short polylinker region containing the restriction sites BglII, EcoRI and HpaI, as indicated above. The resulting plasmid was designated pSD485. Since the BglII and EcoRI sites in the polylinker region of pSD485 are not unique, unwanted BglII and EcoRI sites were removed from plasmid pSD483 (described above) by digestion with BglII (pos. 140,136) and with EcoRI at the pUC/vaccinia junction, followed by blunt ending with Klenow fragment of E. coli polymerase and ligation. The resulting plasmid was designated pSD489. The 1.8 kb ClaI (pos. 137,198)/EcoRV (pos. 139,048) fragment from pSD489 containing the A26L ORF was replaced with the corresponding 0.7 kb polylinker-containing ClaI/EcoRV fragment from pSD485, generating pSD492. The BglII and EcoRI sites in the polylinker region of pSD492 are unique.
A 3.3 kb BglII cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Perkus et al., 1990) was inserted into the BglII site of pSD492, forming pSD493KBG. Plasmid pSD493KBG was used in recombination with rescuing virus vP553. Recombinant vaccinia virus, vP581, containing Beta-galactosidase in the A26L deletion region, was isolated as a blue plaque in the presence of X-gal.
To generate a plasmid for the removal of Beta-galactosidase sequences from vaccinia recombinant virus vP581, the polylinker region of plasmid pSD492 was deleted by mutagenesis (Mandecki, 1986) using synthetic oligonucleotide MPSYN177 (SEQ ID NO:37) (5' AAAATGGGCGTGGATTGTTAACTTTATATAACTTATTTTTTGAATATAC 3'). In the resulting plasmid, pMP494.DELTA., vaccinia DNA encompassing positions [137,889-138,937], including the entire A26L ORF is deleted. Recombination between the pMP494.DELTA. and the Beta-galactosidase containing vaccinia recombinant, vP581, resulted in vaccinia deletion mutant vP618, which was isolated as a clear plaque in the presence of X-gal.
Example 16
Construction of Plasmid pSD467 for Deletion of Hemagglutinin Gene (A56R)
Referring now to FIG. 13, vaccinia SalI G restriction fragment (pos. 160,744-173,351) crosses the HindIII A/B junction (pos. 162,539). pSD419 contains vaccinia SalI G cloned into pUC8. The direction of transcription for the hemagglutinin (HA) gene is indicated by an arrow in FIG. 13. Vaccinia sequences derived from HindIII B were removed by digestion of pSD419 with HindIII within vaccinia sequences and at the pUC/vaccinia junction followed by ligation. The resulting plasmid, pSD456, contains the HA gene, A56R, flanked by 0.4 kb of vaccinia sequences to the left and 0.4 kb of vaccinia sequences to the right. A56R coding sequences were removed by cutting pSD456 with RsaI (partial; pos. 161,090) upstream from A56R coding sequences, and with EagI (pos. 162,054) near the end of the gene. The 3.6 kb RsaI/EagI vector fragment from pSD456 was isolated and ligated with annealed synthetic oligonucleotides MPSYN59 (SEQ ID NO:38), MPSYN62 (SEQ ID NO:39), MPSYN60 (SEQ ID NO:40), and MPSYN61 (SEQ ID NO:41)
RsaIMPSYN59 5' ACACGAATGATTTTCTAAAGTATTTGGAAAGTTTTATAGGT-MPSYN62 3' TGTGCTTACTAAAAGATTTCATAAACCTTTCAAAATATCCA-MPSYN59 AGTTGATAGAACAAAATACATAATTT 3'MPSYN62 TCAACTATCT 5'MPSYN60 5' TGTAAAAATAAATCACTTTTTATA-MPSYN61 3' TGTTTTATGTATTAAAACATTTTTATTTAGTGAAAAATAT- BglII SmaI PstI EagIMPSYN60 CTAAGATCTCCCGGGCTGCAGC 3'MPSYN61 GATTCTAGAGGGCCCGACGTCGCCGG 5'
reconstructing the DNA sequences upstream from the A56R ORF and replacing the A56R ORF with a polylinker region as indicated above. The resulting plasmid is pSD466. The vaccinia deletion in pSD466 encompasses positions [161,185-162,053]. The site of the deletion in pSD466 is indicated by a triangle in FIG. 13.
A 3.2 kb BglII/BamHI (partial) cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Guo et al., 1989) was inserted into the BglII site of pSD466, forming pSD466KBG. Plasmid pSD466KBG was used in recombination with rescuing virus vP618. Recombinant vaccinia virus, vP708, containing Beta-galactosidase in the A56R deletion, was isolated as a blue plaque in the presence of X-gal.
Beta-galactosidase sequences were deleted from vP708 using donor plasmid pSD467. pSD467 is identical to pSD466, except that EcoRI, SmaI and BamHI sites were removed from the pUC/vaccinia junction by digestion of pSD466 with EcoRI/BamHI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation. Recombination between vP708 and pSD467 resulted in recombinant vaccinia deletion mutant, vP723, which was isolated as a clear plaque in the presence of X-gal.
Example 17
Construction of Plasmid pMPCSK1.DELTA. for Deletion of Open Reading Frames [C7L-K1L]
Referring now to FIG. 14, the following vaccinia clones were utilized in the construction of pMPCSK1.DELTA.. pSD420 is SalI H cloned into pUC8. pSD435 is KpnI F cloned into pUC18. pSD435 was cut with SphI and religated, forming pSD451. In pSD451, DNA sequences to the left of the SphI site (pos. 27,416) in HindIII M are removed (Perkus et al., 1990). pSD409 is HindIII M cloned into pUC8.
To provide a substrate for the deletion of the [C7L-K1L] gene cluster from vaccinia, E. coli Beta-galactosidase was first inserted into the vaccinia M2L deletion locus (Guo et al., 1990) as follows. To eliminate the BglII site in pSD409, the plasmid was cut with BglII in vaccinia sequences (pos. 28,212) and with BamHI at the pUC/vaccinia junction, then ligated to form plasmid pMP409B. pMP409B was cut at the unique SphI site (pos. 27,416). M2L coding sequences were removed by mutagenesis (Guo et al., 1990; Mandecki, 1986) using synthetic oligonucleotide
BglIIMPSYN82 (SEQ ID NO:47) 5' TTTCTGTATATTTGCACCAATTTAGATCTT- ACTCAAAATATGTAACAATA 3'
The resulting plasmid, pMP409D, contains a unique BglII site inserted into the M2L deletion locus as indicated above. A 3.2 kb BamHI (partial)/BglII cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the 11 kDa promoter (Bertholet et al., 1985) was inserted into pMP409D cut with BglII. The resulting plasmid, pMP409DBG (Guo et al., 1990), was used as donor plasmid for recombination with rescuing vaccinia virus vP723. Recombinant vaccinia virus, vP784, containing Beta-galactosidase inserted into the M2L deletion locus, was isolated as a blue plaque in the presence of X-gal.
A plasmid deleted for vaccinia genes [C7L-K1L] was assembled in pUC8 cut with SmaI, HindIII and blunt ended with Klenow fragment of E. coli polymerase. The left flanking arm consisting of vaccinia HindIII C sequences was obtained by digestion of pSD420 with XbaI (pos. 18,628) followed by blunt ending with Klenow fragment of E. coli polymerase and digestion with BglII (pos. 19,706). The right flanking arm consisting of vaccinia HindIII K sequences was obtained by digestion of pSD451 with BglII (pos. 29,062) and EcoRV (pos. 29,778). The resulting plasmid, pMP581CK is deleted for vaccinia sequences between the BglII site (pos. 19,706) in HindIII C and the BglII site (pos. 29,062) in HindIII K. The site of the deletion of vaccinia sequences in plasmid pMP581CK is indicated by a triangle in FIG. 14.
To remove excess DNA at the vaccinia deletion junction, plasmid pMP581CK, was cut at the NcoI sites within vaccinia sequences (pos. 18,811; 19,655), treated with Bal-31 exonuclease and subjected to mutagenesis (Mandecki, 1986) using synthetic oligonucleotide MPSYN233 (SEQ ID NO:43) 5'-TGTCATTTAACACTATACTCATATTAATAAAAATAATATTTATT-3'. The resulting plasmid, pMPCSK1.DELTA., is deleted for vaccinia sequences positions 18,805-29,108, encompassing 12 vaccinia open reading frames [C7L-K1L]. Recombination between pMPCSK1.DELTA. and the Beta-galactosidase containing vaccinia recombinant, vP784, resulted in vaccinia deletion mutant, vP804, which was isolated as a clear plaque in the presence of X-gal.
Example 18
Construction of Plasmid pSD548 for Deletion of Large Subunit, Ribonucleotide Reductase (I4L)
Referring now to FIG. 15, plasmid pSD405 contains vaccinia HindIII I (pos. 63,875-70,367) cloned in pUC8. pSD405 was digested with EcoRV within vaccinia sequences (pos. 67,933) and with SmaI at the pUC/vaccinia junction, and ligated, forming plasmid pSD518. pSD518 was used as the source of all the vaccinia restriction fragments used in the construction of pSD548.
The vaccinia I4L gene extends from position 67,371-65,059. Direction of transcription for I4L is indicated by an arrow in FIG. 15. To obtain a vector plasmid fragment deleted for a portion of the I4L coding sequences, pSD518 was digested with BamHI (pos. 65,381) and HpaI (pos. 67,001) and blunt ended using Klenow fragment of E. coli polymerase. This 4.8 kb vector fragment was ligated with a 3.2 kb SmaI cassette containing the E. coli Beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Perkus et al., 1990), resulting in plasmid pSD524KBG. pSD524KBG was used as donor plasmid for recombination with vaccinia virus vP804. Recombinant vaccinia virus, vP855, containing Beta-galactosidase in a partial deletion of the I4L gene, was isolated as a blue plaque in the presence of X-gal.
To delete Beta-galactosidase and the remainder of the I4L ORF from vP855, deletion plasmid pSD548 was constructed. The left and right vaccinia flanking arms were assembled separately in pUC8 as detailed below and presented schematically in FIG. 15.
To construct a vector plasmid to accept the left vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and ligated with annealed synthetic oligonucleotides 518A1/518A2 (SEQ ID NO:44/SEQ ID NO:45)
BamHI RsaI518A1 5' GATCCTGAGTACTTTGTAATATAATGATATATATTTTCACTTTATCTCAT518A2 3' GACTCATGAAACATTATATTACTATATATAAAAGTGAAATAGAGTA BglII EcoRI TTGAGAATAAAAAGATCTTAGG 3' 518A1 AACTCTTATTTTTCTAGAATCCTTAA 5' 518A2
forming plasmid pSD531. pSD531 was cut with RsaI (partial) and BamHI and a 2.7 kb vector fragment isolated. pSD518 was cut with BglII (pos. 64,459)/RsaI (pos. 64,994) and a 0.5 kb fragment isolated. The two fragments were ligated together, forming pSD537, which contains the complete vaccinia flanking arm left of the I4L coding sequences.
To construct a vector plasmid to accept the right vaccinia flanking arm, pUC8 was cut with BamHI/EcoRI and ligated with annealed synthetic oligonucleotides 518B1/518B2 (SEQ ID NO:46/SEQ ID NO:47)
BamHI BglII SmaI518B1 5' GATCCAGATCTCCCGGGAAAAAAATTATTTAACTTTTCATTAATAG-518B2 3' GTCTAGAGGGCCCTTTTTTTAATAAATTGAAAAGTAATTATC- RsaI EcoRI GGATTTGACGTATGTAGCGTACTAGG 3' 518B1 CCTAAACTGCATACTACGCATGATCCTTAA 5' 518B2
forming plasmid pSD532. pSD532 was cut with RsaI (partial)/EcoRI and a 2.7 kb vector fragment isolated. pSD518 was cut with RsaI within vaccinia sequences (pos. 67,436) and EcoRI at the vaccinia/pUC junction, and a 0.6 kb fragment isolated. The two fragments were ligated together, forming pSD538, which contains the complete vaccinia flanking arm to the right of I4L coding sequences.
The right vaccinia flanking arm was isolated as a 0.6 kb EcoRI/BglII fragment from pSD538 and ligated into pSD537 vector plasmid cut with EcoRI/BglII. In the resulting plasmid, pSD539, the I4L ORF (pos. 65,047-67,386) is replaced by a polylinker region, which is flanked by 0.6 kb vaccinia DNA to the left and 0.6 kb vaccinia DNA to the right, all in a pUC background. The site of deletion within vaccinia sequences is indicated by a triangle in FIG. 15. To avoid possible recombination of Beta-galactosidase sequences in the pUC-derived portion of pSD539 with Beta-galactosidase sequences in recombinant vaccinia virus vP855, the vaccinia I4L deletion cassette was moved from pSD539 into pRC11, a pUC derivative from which all Beta-galactosidase sequences have been removed and replaced with a polylinker region (Colinas et al., 1990). pSD539 was cut with EcoRI/PstI and the 1.2 kb fragment isolated. This fragment was ligated into pRC11 cut with EcoRI/PstI (2.35 kb), forming pSD548. Recombination between pSD548 and the Beta-galactosidase containing vaccinia recombinant, vP855, resulted in vaccinia deletion mutant vP866, which was isolated as a clear plaque in the presence of X-gal.
DNA from recombinant vaccinia virus vP866 was analyzed by restriction digests followed by electrophoresis on an agarose gel. The restriction patterns were as expected. Polymerase chain reactions (PCR) (Engelke et al., 1988) using vP866 as template and primers flanking the six deletion loci detailed above produced DNA fragments of the expected sizes. Sequence analysis of the PCR generated fragments around the areas of the deletion junctions confirmed that the junctions were as expected. Recombinant vaccinia virus vP866, containing the six engineered deletions as described above, was designated vaccinia vaccine strain "NYVAC."
Example 19
Insertion of a Rabies Glycoprotein G Gene into NYVAC
The gene encoding rabies glycoprotein G under the control of the vaccinia H6 promoter (Taylor et al., 1988a,b) was inserted into TK deletion plasmid pSD513. pSD513 is identical to plasmid pSD460 (FIG. 10) except for the presence of a polylinker region.
Referring now to FIG. 16, the polylinker region was inserted by cutting pSD460 with SmaI and ligating the plasmid vector with annealed synthetic oligonucleotides VQ1A/VQ1B (SEQ ID NO:48/SEQ ID NO:49)
SmaI BglII XhoI PstI NarI BamHIVQ1A 5' GGGAGATCTCTCGAGCTGCAGGGCGCCGGATCCTTTTTCT 3'VQ1B 3' CCCTCTAGAGAGCTCGACGTCCCGCGGCCTAGGAAAAAGA 5'
to form vector plasmid pSD513. pSD513 was cut with SmaI and ligated with a SmaI ended 1.8 kb cassette containing the gene encoding the rabies glycoprotein G gene under the control of the vaccinia H6 promoter (Taylor et al., 1988a,b). The resulting plasmid was designated pRW842. pRW842 was used as donor plasmid for recombination with NYVAC rescuing virus (vP866). Recombinant vaccinia virus vP879 was identified by plaque hybridization using .sup.32 P-labelled DNA probe to rabies glycoprotein G coding sequences.
The modified recombinant viruses of the present invention provide advantages as recombinant vaccine vectors. The attenuated virulence of the vector advantageously reduces the opportunity for the possibility of a runaway infection due to vaccination in the vaccinated individual and also diminishes transmission from vaccinated to unvaccinated individuals or contamination of the environment.
The modified recombinant viruses are also advantageously used in a method for expressing a gene product in a cell cultured in vitro by producing into the cell the modified recombinant virus having foreign DNA which codes for and expresses gene products in the cell.
Example 20
Construction of TROVAC-NDV Expressing the Fusion and Hemagglutinin-neuraminidase Glycoproteins of Newcastle Disease Virus
This example describes the development of TROVAC, a fowlpox virus vector and, of a fowlpox Newcastle Disease Virus recombinant designated TROVAC-NDV and its safety and efficacy. A fowlpox virus (FPV) vector expressing both F and HN genes of the virulent NDV strain Texas was constructed. The recombinant produced was designated TROVAC-NDV. TROVAC-NDV expresses authentically processed NDV glycoproteins in avian cells infected with the recombinant virus and inoculation of day old chicks protects against subsequent virulent NDV challenge.
Cells and Viruses.
The Texas strain of NDV is a velogenic strain. Preparation of cDNA clones of the F and HN genes has been previously described (Taylor et al., 1990; Edbauer et al., 1990). The strain of FPV designated FP-1 has been described previously (Taylor et al., 1988a). It is a vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scab from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chicken embryo fibroblast cells. The virus was subjected to four successive plaque purifications. One plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, established. The stock virus used in the in vitro recombination test to produce TROVAC-NDV had been subjected to twelve passages in primary CEF cells from the plaque isolate.
Construction of a Cassette for NDV-F.
A 1.8 kbp BamHI fragment containing all but 22 nucleotides from the 5' end of the F protein coding sequence was excised from pNDV81 (Taylor et al., 1990) and inserted at the BamHI site of pUC18 to form pCE13. The vaccinia virus H6 promoter previously described (Taylor et al., 1988a,b; Guo et al., 1989; Perkus et al., 1989) was inserted into pCE13 by digesting pCE13 with SalI, filling in the sticky ends with Klenow fragment of E. coli DNA polymerase and digesting with HindIII. A HindIII - EcoRV fragment containing the H6 promoter sequence was then inserted into pCE13 to form pCE38. A perfect 5' end was generated by digesting pCE38 with KpnI and NruI and inserting the annealed and kinased oligonucleotides CE75 (SEQ ID NO:50) and CE76 (SEQ ID NO:51) to generate pCE47.
CE75: CGATATCCGTTAAGTTTGTATCGTAATGGGCTCCAGATCTTCTACCAGGATCCCGGTAC
CE76: CGGGATCCTGGTAGAAGATCTGGAGCCCATTACGATACAAACTTAACGGATATCG.
In order to remove non-coding sequence from the 3' end of the NDV-F a SmaI to PstI fragment from pCE13 was inserted into the SmaI and PstI sites of pUC18 to form pCE23. The non-coding sequences were removed by sequential digestion of pCE23 with SacI, BamHI, Exonuclease III, SI nuclease and EcoRI. The annealed and kinased oligonucleotides CE42 (SEQ ID NO:52) and CE43 (SEQ ID NO:53) were then inserted to form pCE29.
CE42: AATTCGAGCTCCCCGGG
CE43: CCCGGGGAGCTCG
The 3' end of the NDV-F sequence was then inserted into plasmid pCE20 already containing the 5' end of NDV-F by cloning a PstI - SacI fragment from pCE29 into the PstI and SacI sites of pCE20 to form pCE32. Generation of pCE20 has previously been described in Taylor et al., 1990.
In order to align the H6 promoter and NDV-F 5' sequences contained in pCE47 with the 3' NDV-F sequences contained in pCE32, a HindIII - PstI fragment of pCE47 was inserted into the HindIII and PstI sites of pCE32 to form pCE49. The H6 promoted NDV-F sequences were then transferred to the de-ORFed F8 locus (described below) by cloning a HindIII - NruI fragment from pCE49 into the HindIII and SmaI sites of pJCA002 (described below) to form pCE54. Transcription stop signals were inserted into pCE54 by digesting pCE54 with SacI, partially digesting with BamHI and inserting the annealed and kinased oligonucleotides CE166 (SEQ ID NO:54) and CE167 (SEQ ID NO:55) to generate pCE58.
CE166: CTTTTTATAAAAAGTTAACTACGTAG
CE167: GATCCTACGTAGTTAACTTTTTATAAAAAGAGCT
A perfect 3' end for NDV-F was obtained by using the polymerase chain reaction (PCR) with pCE54 as template and oligonucleotides CE182 (SEQ ID NO:56) and CE183 (SEQ ID NO:57) as primers.
CE182: CTTAACTCAGCTGACTATCC
CE183: TACGTAGTTAACTTTTTATAAAAATCATATTTTTGTAGTGGCTC
The PCR fragment was digested with PvuII and HpaI and cloned into pCE58 that had been digested with HpaI and partially digested with PvuII. The resulting plasmid was designated pCE64. Translation stop signals were inserted by cloning a HindIII - HpaI fragment which contains the complete H6 promoter and F coding sequence from pCE64 into the HindIII and HpaI sites of pRW846 to generate pCE71, the final cassette for NDV-F. Plasmid pRW846 is essentially equivalent to plasmid pJCA002 (described below) but containing the H6 promoter and transcription and translation stop signals. Digestion of pRW846 with HindIII and HpaI eliminates the H6 promoter but leaves the stop signals intact.
Construction of Cassette for NDV-HN.
Construction of plasmid pRW802 was previously described in Edbauer et al., 1990. This plasmid contains the NDV-HN sequences linked to the 3' end of the vaccinia virus H6 promoter in a pUC9 vector. A HindIII - EcoRV fragment encompassing the 5' end of the vaccinia virus H6 promoter was inserted into the HindIII and EcoRV sites of pRW802 to form pRW830. A perfect 3' end for NDV-HN was obtained by inserting the annealed and kinased oligonucleotides CE162 (SEQ ID NO:58) and CE163 (SEQ ID NO:59) into the EcoRI site of pRW830 to form pCE59, the final cassette for NDV-HN.
CE162: AATTCAGGATCGTTCCTTTACTAGTTGAGATTCTCAAGGATGATGGGATTTAATTTTTATAAGCTTGCE163: AATTCAAGCTTATAAAAATTAAATCCCATCATCCTTGAGAATCTCAACTAGTAAAGGAACGATCCTG
Construction of FPV Insertion Vector.
Plasmid pRW731-15 contains a 10 kb PvuII - PvuII fragment cloned from genomic DNA. The nucleotide sequence was determined on both strands for a 3660 bp PvuII - EcoRV fragment. The limits of an open reading frame designated here as F8 were determined. Plasmid pRW761 is a sub-clone of pRW731-15 containing a 2430 bp EcoRV - EcoRV fragment. The F8 ORF was entirely contained between an XbaI site and an SspI site in pRW761. In order to create an insertion plasmid which on recombination with TROVAC genomic DNA would eliminate the F8 ORF, the following steps were followed. Plasmid pRW761 was completely digested with XbaI and partially digested with SspI. A 3700 bp XbaI - SspI band was isolated from the gel and ligated with the annealed double-stranded oligonucleotides JCA017 (SEQ ID NO:60) and JCA018 (SEQ ID NO:61).
JCA017:5' CTAGACACTTTATGTTTTTTAATATCCGGTCTTAAAAGCTTCCCGGGGATCCTTATACGGGGAATAATJCA018:5' ATTATTCCCCGTATAAGGATCCCCCGGGAAGCTTTTAAGACCGGATATTAAAAAACATAAAGTG
The plasmid resulting from this ligation was designated pJCA002.
Construction of Double Insertion Vector for NDV F and Hn.
The H6 promoted NDV-HN sequence was inserted into the H6 promoted NDV-F cassette by cloning a HindIII fragment from pCE59 that had been filled in with Klenow fragment of E. coli DNA polymerase into the HpaI site of pCE71 to form pCE80. Plasmid pCE80 was completely digested with NdeI and partially digested with BglII to generate an NdeI - BglII 4760 bp fragment containing the NDV F and HN genes both driven by the H6 promoter and linked to F8 flanking arms. Plasmid pJCA021 was obtained by inserting a 4900 bp PvuII - HindII fragment from pRW731-15 into the SmaI and HindII sites of pBSSK+. Plasmid pJCA021 was then digested with NdeI and BglII and ligated to the 4760 bp NdeI - BglII fragment of pCE80 to form pJCA024. Plasmid pJCA024 therefore contains the NDV-F and HN genes inserted in opposite orientation with 3' ends adjacent between FPV flanking arms. Both genes are linked to the vaccinia virus H6 promoter. The right flanking arm adjacent to the NDV-F sequence consists of 2350 bp of FPV sequence. The left flanking arm adjacent to the NDV-HN sequence consists of 1700 bp of FPV sequence.
Development of TROVAC-NDV.
Plasmid pJCA024 was transfected into TROVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to specific NDV-F and HN radiolabelled probes and subjected to five sequential rounds of plaque purification until a pure population was achieved. One representative plaque was then amplified and the resulting TROVAC recombinant was designated TROVAC-NDV (vFP96).
Immunofluorescence.
Indirect immunofluorescence was performed as described (Taylor et al., 1990) using a polyclonal anti-NDV serum and, as mono-specific reagents, sera produced in rabbits against vaccinia virus recombinants expressing NDV-F or NDV-HN.
Immunoprecipitation.
Immunoprecipitation reactions were performed as described (Taylor et al., 1990) using a polyclonal anti-NDV serum obtained from SPAFAS Inc., Storrs, Conn.
The stock virus was screened by in situ plaque hybridization to confirm that the F8 ORF was deleted. The correct insertion of the NDV genes into the TROVAC genome and the deletion of the F8 ORF was also confirmed by Southern blot hybridization.
In NDV-infected cells, the F glycoprotein is anchored in the membrane via a hydrophobic transmembrane region near the carboxyl terminus and requires post-translational cleavage of a precursor, F.sub.0, into two disulfide linked polypeptides F.sub.1 and F.sub.2. Cleavage of F.sub.0 is important in determining the pathogenicity of a given NDV strain (Homma and Ohuchi, 1973; Nagai et al., 1976; Nagai et al., 1980), and the sequence of amino acids at the cleavage site is therefore critical in determining viral virulence. It has been determined that amino acids at the cleavage site in the NDV-F sequence inserted into FPV to form recombinant vFP29 had the sequence Arg - Arg - Gln - Arg - Arg (SEQ ID NO:42) (Taylor et al., 1990) which conforms to the sequence found to be a requirement for virulent NDV strains (Chambers et al., 1986; Espion et al., 1987; Le et al., 1988; McGinnes and Morrison, 1986; Toyoda et al., 1987). The HN glycoprotein synthesized in cells infected with virulent strains of NDV is an uncleaved glycoprotein of 74 kDa. Extremely avirulent strains such as Ulster and Queensland encode an HN precursor (HNo) which requires cleavage for activation (Garten et al., 1980).
The expression of F and HN genes in TROVAC-NDV was analyzed to confirm that the gene products were authentically processed and presented. Indirect-immunofluorescence using a polyclonal anti-NDV chicken serum confirmed that immunoreactive proteins were presented on the infected cell surface. To determine that both proteins were presented on the plasma membrane, mono-specific rabbit sera were produced against vaccinia recombinants expressing either the F or HN glycoproteins. Indirect immunofluorescence using these sera confirmed the surface presentation of both proteins.
Immunoprecipitation experiments were performed by using (.sup.35 S) methionine labeled lysates of CEF cells infected with parental and recombinant viruses. The expected values of apparent molecular weights of the glycosylated forms of F.sub.1 and F.sub.2 are 54.7 and 10.3 kDa respectively (Chambers et al., 1986). In the immunoprecipitation experiments using a polyclonal anti-NDV serum, fusion specific products of the appropriate size were detected from the NDV-F single recombinant vFP29 (Taylor et al., 1990) and the TROVAC-NDV double recombinant vFP96. The HN glycoprotein of appropriate size was also detected from the NDV-HN single recombinant VFP-47 (Edbauer et al., 1990) and TROVAC-NDV. No NDV specific products were detected from uninfected and parental TROVAC infected CEF cells.
In CEF cells, the F and HN glycoproteins are appropriately presented on the infected cell surface where they are recognized by NDV immune serum. Immunoprecipitation analysis indicated that the F.sub.0 protein is authentically cleaved to the F.sub.1 and F.sub.2 components required in virulent strains. Similarly, the HN glycoprotein was authentically processed in CEF cells infected with recombinant TROVAC-NDV.
Previous reports (Taylor et al., 1990; Edbauer et al., 1990; Boursnell et al., 1990a,b,c; Ogawa et al., 1990) would indicate that expression of either HN or F alone is sufficient to elicit protective immunity against NDV challenge. Work on other paramyxoviruses has indicated, however, that antibody to both proteins may be required for full protective immunity. It has been demonstrated that SV5 virus could spread in tissue culture in the presence of antibody to the HN glycoprotein but not to the F glycoprotein (Merz et al., 1980). In addition, it has been suggested that vaccine failures with killed measles virus vaccines were due to inactivation of the fusion component (Norrby et al., 1975). Since both NDV glycoproteins have been shown to be responsible for eliciting virus neutralizing antibody (Avery et al., 1979) and both glycoproteins, when expressed individually in a fowlpox vector are able to induce a protective immune response, it can be appreciated that the most efficacious NDV vaccine should express both glycoproteins.
Example 21
Construction of ALVAC Recombinants Expressing Rabies Virus Glycoprotein G
This example describes the development of ALVAC, a canarypox virus vector and, of a canarypox-rabies recombinant designated as ALVAC-RG (vCP65) and its safety and efficacy.
Cells and Viruses.
The parental canarypox virus (Rentschler strain) is a vaccinal strain for canaries. The vaccine strain was obtained from a wild type isolate and attenuated through more than 200 serial passages on chick embryo fibroblasts. A master viral seed was subjected to four successive plaque purifications under agar and one plaque clone was amplified through five additional passages after which the stock virus was used as the parental virus in in vitro recombination tests. The plaque purified canarypox isolate is designated ALVAC.
Construction of a Canarypox Insertion Vector.
An 880 bp canarypox PvuII fragment was cloned between the PvuII sites of pUC9 to form pRW764.5. The sequence of this fragment is shown in FIG. 17 (SEQ ID NO:62) between positions 1372 and 2251. The limits of an open reading frame designated as C5 were defined. It was determined that the open reading frame was initiated at position 166 within the fragment and terminated at position 487. The C5 deletion was made without interruption of open reading frames. Bases from position 167 through position 455 were replaced with the sequence (SEQ ID NO:63) GCTTCCCGGGAATTCTAGCTAGCTAGTTT. This replacement sequence contains HindIII, SmaI and EcoRI insertion sites followed by translation stops and a transcription termination signal recognized by vaccinia virus RNA polymerase (Yuen et al., 1987). Deletion of the C5 ORF was performed as described below. Plasmid pRW764.5 was partially cut with RsaI and the linear product was isolated. The RsaI linear fragment was recut with BglII and the pRW764.5 fragment now with a RsaI to BglII deletion from position 156 to position 462 was isolated and used as a vector for the following synthetic oligonucleotides:
RW145 (SEQ ID NO:64):
ACTCTCAAAAGCTTCCCGGGAATTCTAGCTAGCTAGTTTTTATAAA
RW146 (SEQ ID NO:65):
GATCTTTATAAAAACTAGCTAGCTAGAATTCCCGGGAAGCTTTTGAGAGT
Oligonucleotides RW145 and RW146 were annealed and inserted into the pRW 764.5 RsaI and BglII vector described above. The resulting plasmid is designated pRW831.
Construction of Insertion Vector Containing the Rabies G Gene.
Construction of pRW838 is illustrated below. Oligonucleotides A through E, which overlap the translation initiation codon of the H6 promoter with the ATG of rabies G, were cloned into pUC9 as pRW737. Oligonucleotides A through E contain the H6 promoter, starting at NruI, through the HindIII site of rabies G followed by BglII. Sequences of oligonucleotides A through E ((SEQ ID NO:66)-(SEQ ID NO:70)) are:
A (SEQ ID NO:66) CTGAAATTATTTCATTATCGCGATATCCGTTAA GTTTGTATCGTAATGGTTCCTCAGGCTCTCCTGTTTGTB (SEQ ID NO:67) CATTACGATACAAACTTAACGGATATCGCGATAA TGAAATAATTTCAGC (SEQ ID NO:68) ACCCCTTCTGGTTTTTCCGTTGTGTTTTGGGAAA TTCCCTATTTACACGATCCCAGACAAGCTTAGATCTCAGD (SEQ ID NO:69) CTGAGATCTAAGCTTGTCTGGGATCGTGTAAATA GGGAATTTCCCAAAACAE (SEQ ID NO:70) CAACGGAAAAACCAGAAGGGGTACAAACAGGACA GCCTGAGGAAC
The diagram of annealed oligonucleotides A through E is as follows:
A C----------------------------------------------------.linevert split.--------------------------------------------------------------------------------------.linevert split.--------------------------------------.linevert split.------------------------------ B E D
Oligonucleotides A through E were kinased, annealed (95.degree. C. for 5 minutes, then cooled to room temperature), and inserted between the PvuII sites of pUC9. The resulting plasmid, pRW737, was cut with HindIII and BglII and used as a vector for the 1.6 kbp HindIII-BglII fragment of ptg155PRO (Kieny et al., 1984) generating pRW739. The ptg155PRO HindIII site is 86 bp downstream of the rabies G translation initiation codon. BglII is downstream of the rabies G translation stop codon in ptg155PRO. pRW739 was partially cut with NruI, completely cut with BglII, and a 1.7 kbp NruI-BglII fragment, containing the 3' end of the H6 promoter previously described (Taylor et al., 1988a,b; Guo et al., 1989; Perkus et al., 1989) through the entire rabies G gene, was inserted between the NruI and BamHI sites of pRW824. The resulting plasmid is designated pRW832. Insertion into pRW824 added the H6 promoter 5' of NruI. The pRW824 sequence of BamHI followed by SmaI is (SEQ ID NO:71): GGATCCCCGGG. pRW824 is a plasmid that contains a nonpertinent gene linked precisely to the vaccinia virus H6 promoter. Digestion with NruI and BamHI completely excised this nonpertinent gene. The 1.8 kbp pRW832 SmaI fragment, containing H6 promoted rabies G, was inserted into the SmaI of pRW831, to form plasmid pRW838.
Development of ALVAC-RG.
Plasmid pRW838 was transfected into ALVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to a specific rabies G probe and subjected to 6 sequential rounds of plaque purification until a pure population was achieved. One representative plaque was then amplified and the resulting ALVAC recombinant was designated ALVAC-RG (vCP65) (see also FIGS. 18A and 18B). The correct insertion of the rabies G gene into the ALVAC genome without subsequent mutation was confirmed by sequence analysis.
Immunofluorescence.
During the final stages of assembly of mature rabies virus particles, the glycoprotein component is transported from the golgi apparatus to the plasma membrane where it accumulates with the carboxy terminus extending into the cytoplasm and the bulk of the protein on the external surface of the cell membrane. In order to confirm that the rabies glycoprotein expressed in ALVAC-RG was correctly presented, immunofluorescence was performed on primary CEF cells infected with ALVAC or ALVAC-RG. Immunofluorescence was performed as previously described (Taylor et al., 1990) using a rabies G monoclonal antibody. Strong surface fluorescence was detected on CEF cells infected with ALVAC-RG but not with the parental ALVAC.
Immunoprecipitation.
Preformed monolayers of primary CEF, Vero (a line of African Green monkey kidney cells ATCC # CCL81) and MRC-5 cells (a fibroblast-like cell line derived from normal human fetal lung tissue ATCC # CCL171) were inoculated at 10 pfu per cell with parental virus ALVAC and recombinant virus ALVAC-RG in the presence of radiolabelled .sup.35 S-methionine and treated as previously described (Taylor et al., 1990). Immunoprecipitation reactions were performed using a rabies G specific monoclonal antibody. Efficient expression of a rabies specific glycoprotein with a molecular weight of approximately 67 kDa was detected with the recombinant ALVAC-RG. No rabies specific products were detected in uninfected cells or cells infected with the parental ALVAC virus.
Sequential Passaging Experiment.
In studies with ALVAC virus in a range of non-avian species no proliferative infection or overt disease was observed (Taylor et al., 1991b). However, in order to establish that neither the parental nor recombinant virus could be adapted to grow in non-avian cells, a sequential passaging experiment was performed.
The two viruses, ALVAC and ALVAC-RG, were inoculated in 10 sequential blind passages in three cell lines:
(1) Primary chick embryo fibroblast (CEF) cells produced from 11 day old white leghorn embryos;
(2) Vero cells--a continuous line of African Green monkey kidney cells (ATCC # CCL81); and
(3) MRC-5 cells--a diploid cell line derived from human fetal lung tissue (ATCC # CCL171).
The initial inoculation was performed at an m.o.i. of 0.1 pfu per cell using three 60 mm dishes of each cell line containing 2.times.10.sup.6 cells per dish. One dish was inoculated in the presence of 40 .mu.g/ml of Cytosine arabinoside (Ara C), an inhibitor of DNA replication. After an absorption period of 1 hour at 37.degree. C., the inoculum was removed and the monolayer washed to remove unabsorbed virus. At this time the medium was replaced with 5 ml of EMEM+2% NBCS on two dishes (samples t0 and t7) and 5 ml of EMEM+2% NBCS containing 40 .mu.g/ml Ara C on the third (sample t7A). Sample t0 was frozen at -70.degree. C. to provide an indication of the residual input virus. Samples t7 and t7A were incubated at 37.degree. C. for 7 days, after which time the contents were harvested and the cells disrupted by indirect sonication.
One ml of sample t7 of each cell line was inoculated undiluted onto three dishes of the same cell line (to provide samples t0, t7 and t7A) and onto one dish of primary CEF cells. Samples t0, t7 and t7A were treated as for passage one. The additional inoculation on CEF cells was included to provide an amplification step for more sensitive detection of virus which might be present in the non-avian cells.
This procedure was repeated for 10 (CEF and MRC-5) or 8 (Vero) sequential blind passages. Samples were then frozen and thawed three times and assayed by titration on primary CEF monolayers.
Virus yield in each sample was then determined by plaque titration on CEF monolayers under agarose. Summarized results of the experiment are shown in Tables 5 and 6.
The results indicate that both the parental ALVAC and the recombinant ALVAC-RG are capable of sustained replication on CEF monolayers with no loss of titer. In Vero cells, levels of virus fell below the level of detection after 2 passages for ALVAC and 1 passage for ALVAC-RG. In MRC-5 cells, a similar result was evident, and no virus was detected after 1 passage. Although the results for only four passages are shown in Tables 5 and 6 the series was continued for 8 (Vero) and 10 (MRC-5) passages with no detectable adaptation of either virus to growth in the non-avian cells.
In passage 1 relatively high levels of virus were present in the t7 sample in MRC-5 and Vero cells. However this level of virus was equivalent to that seen in the t0 sample and the t7A sample incubated in the presence of Cytosine arabinoside in which no viral replication can occur. This demonstrated that the levels of virus seen at 7 days in non-avian cells represented residual virus and not newly replicated virus.
In order to make the assay more sensitive, a portion of the 7 day harvest from each cell line was inoculated onto a permissive CEF monolayer and harvested at cytopathic effect (CPE) or at 7 days if no CPE was evident. The results of this experiment are shown in Table 7. Even after amplification through a permissive cell line, virus was only detected in MRC-5 and Vero cells for two additional passages. These results indicated that under the conditions used, there was no adaptation of either virus to growth in Vero or MRC-5 cells.
Inoculation of Macaques.
Four HIV seropositive macaques were initially inoculated with ALVAC-RG as described in Table 8. After 100 days these animals were re-inoculated to determine a booster effect, and an additional seven animals were inoculated with a range of doses. Blood was drawn at appropriate intervals and sera analyzed, after heat inactivation at 56.degree. C. for 30 minutes, for the presence of anti-rabies antibody using the Rapid Fluorescent Focus Inhibition Assay (Smith et al., 1973).
Inoculation of Chimpanzees.
Two adult male chimpanzees (50 to 65 kg weight range) were inoculated intramuscularly or subcutaneously with 1.times.10.sup.7 pfu of vCP65. Animals were monitored for reactions and bled at regular intervals for analysis for the presence of anti-rabies antibody with the RFFI test (Smith et al., 1973). Animals were re-inoculated with an equivalent dose 13 weeks after the initial inoculation.
Inoculation of Mice.
Groups of mice were inoculated with 50 to 100 .mu.l of a range of dilutions of different batches of vCP65. Mice were inoculated in the footpad. On day 14, mice were challenged by intracranial inoculation of from 15 to 43 mouse LD.sub.50 of the virulent CVS strain of rabies virus. Survival of mice was monitored and a protective dose 50% (PD.sub.50) calculated at 28 days post-inoculation.
Inoculation of Dogs and Cats.
Ten beagle dogs, 5 months old, and 10 cats, 4 months old, were inoculated subcutaneously with either 6.7 or 7.7 log.sub.10 TCID.sub.50 of ALVAC-RG. Four dogs and four cats were not inoculated. Animals were bled at 14 and 28 days post-inoculation and anti-rabies antibody assessed in an RFFI test. The animals receiving 6.7 log.sub.10 TCID.sub.50 of ALVAC-RG were challenged at 29 days post-vaccination with 3.7 log.sub.10 mouse LD.sub.50 (dogs) or 4.3 log.sub.10 mouse LD.sub.50 (cats) of the NYGS rabies virus challenge strain.
Inoculation of Squirrel Monkeys.
Three groups of four squirrel monkeys (Saimiri sciureus) were inoculated with one of three viruses (a) ALVAC, the parental canarypox virus, (b) ALVAC-RG, the recombinant expressing the rabies G glycoprotein or (c) vCP37, a canarypox recombinant expressing the envelope glycoprotein of feline leukemia virus. Inoculations were performed under ketamine anaesthesia. Each animal received at the same time: (1) 20 .mu.l instilled on the surface of the right eye without scarification; (2) 100 .mu.l as several droplets in the mouth; (3) 100 .mu.l in each of two intradermal injection sites in the shaven skin of the external face of the right arm; and (4) 100 .mu.l in the anterior muscle of the right thigh.
Four monkeys were inoculated with each virus, two with a total of 5.0 log.sub.10 pfu and two with a total of 7.0 log.sub.10 pfu. Animals were bled at regular intervals and sera analyzed for the presence of antirabies antibody using an RFFI test (Smith et al., 1973). Animals were monitored daily for reactions to vaccination. Six months after the initial inoculation the four monkeys receiving ALVAC-RG, two monkeys initially receiving vCP37, and two monkeys initially receiving ALVAC, as well as one naive monkey were inoculated with 6.5 log.sub.10 pfu of ALVAC-RG subcutaneously. Sera were monitored for the presence of rabies neutralizing antibody in an RFFI test (Smith et al., 1973).
Inoculation of Human Cell Lines with ALVAC-RG.
In order to determine whether efficient expression of a foreign gene could be obtained in non-avian cells in which the virus does not productively replicate, five cell types, one avian and four non-avian, were analyzed for virus yield, expression of the foreign rabies G gene and viral specific DNA accumulation. The cells inoculated were:
(a) Vero, African Green monkey kidney cells, ATCC # CCL81;
(b) MRC-5, human embryonic lung, ATCC # CCL 171;
(c) WISH human amnion, ATCC # CCL 25;
(d) Detroit-532, human foreskin, Downs's syndrome, ATCC # CCL 54; and
(e) Primary CEF cells.
Chicken embryo fibroblast cells produced from 11 day old white leghorn embryos were included as a positive control. All inoculations were performed on preformed monolayers of 2.times.10.sup.6 cells as discussed below.
A. Methods for DNA Analysis.
Three dishes of each cell line were inoculated at 5 pfu/cell of the virus under test, allowing one extra dish of each cell line un-inoculated. One dish was incubated in the presence of 40 .mu.g/ml of cytosine arabinoside (Ara C). After an adsorption period of 60 minutes at 37.degree. C., the inoculum was removed and the monolayer washed twice to remove unadsorbed virus. Medium (with or without Ara C) was then replaced. Cells from one dish (without Ara C) were harvested as a time zero sample. The remaining dishes were incubated at 37.degree. C. for 72 hours, at which time the cells were harvested and used to analyze DNA accumulation. Each sample of 2.times.10.sup.6 cells was resuspended in 0.5 ml phosphate buffered saline (PBS) containing 40 mM EDTA and incubated for 5 minutes at 37.degree. C. An equal volume of 1.5% agarose prewarmed at 42.degree. C. and containing 120 mM EDTA was added to the cell suspension and gently mixed. The suspension was transferred to an agarose plug mold and allowed to harden for at least 15 min. The agarose plugs were then removed and incubated for 12-16 hours at 50.degree. C. in a volume of lysis buffer (1% sarkosyl, 100 .mu.g/ml proteinase K, 10 mM Tris HCl pH 7.5, 200 mM EDTA) that completely covers the plug. The lysis buffer was then replaced with 5.0 ml sterile 0.5.times.TBE (44.5 mM Tris-borate, 44.5 mM boric acid, 0.5 mM EDTA) and equilibrated at 4.degree. C. for 6 hours with 3 changes of TBE buffer. The viral DNA within the plug was fractionated from cellular RNA and DNA using a pulse field electrophoresis system. Electrophoresis was performed for 20 hours at 180 V with a ramp of 50-90 sec at 15.degree. C. in 0.5.times.TBE. The DNA was run with lambda DNA molecular weight standards. After electrophoresis the viral DNA band was visualized by staining with ethidium bromide. The DNA was then transferred to a nitrocellulose membrane and probed with a radiolabelled probe prepared from purified ALVAC genomic DNA.
B. Estimation of Virus Yield.
Dishes were inoculated exactly as described above, with the exception that input multiplicity was 0.1 pfu/cell. At 72 hours post infection, cells were lysed by three successive cycles of freezing and thawing. Virus yield was assessed by plaque titration on CEF monolayers.
C. Analysis of Expression of Rabies G Gene.
Dishes were inoculated with recombinant or parental virus at a multiplicity of 10 pfu/cell, allowing an additional dish as an uninfected virus control. After a one hour absorption period, the medium was removed and replaced with methionine free medium. After a 30 minute period, this medium was replaced with methionine-free medium containing 25 uCi/ml of .sup.35 S-Methionine. Infected cells were labelled overnight (approximately 16 hours), then lysed by the addition of buffer A lysis buffer. Immunoprecipitation was performed as previously described (Taylor et al., 1990) using a rabies G specific monoclonal antibody.
Results: Estimation of Viral Yield.
The results of titration for yield at 72 hours after inoculation at 0.1 pfu per cell are shown in Table 9. The results indicate that while a productive infection can be attained in the avian cells, no increase in virus yield can be detected by this method in the four non-avian cell systems.
Analysis of Viral DNA Accumulation.
In order to determine whether the block to productive viral replication in the non-avian cells occurred before or after DNA replication, DNA from the cell lysates was fractionated by electrophoresis, transferred to nitrocellulose and probed for the presence of viral specific DNA. DNA from uninfected CEF cells, ALVAC-RG infected CEF cells at time zero, ALVAC-RG infected CEF cells at 72 hours post-infection and ALVAC-RG infected CEF cells at 72 hours post-infection in the presence of 40 .mu.g/ml of cytosine arabinoside all showed some background activity, probably due to contaminating CEF cellular DNA in the radiolabelled ALVAC DNA probe preparation. However, ALVAC-RG infected CEF cells at 72 hours post-infection exhibited a strong band in the region of approximately 350 kbp representing ALVAC-specific viral DNA accumulation. No such band is detectable when the culture is incubated in the presence of the DNA synthesis inhibitor, cytosine arabinoside. Equivalent samples produced in Vero cells showed a very faint band at approximately 350 kbp in the ALVAC-RG infected Vero cells at time zero. This level represented residual virus. The intensity of the band was amplified at 72 hours post-infection indicating that some level of viral specific DNA replication had occurred in Vero cells which had not resulted in an increase in viral progeny. Equivalent samples produced in MRC-5 cells indicated that no viral specific DNA accumulation was detected under these conditions in this cell line. This experiment was then extended to include additional human cell lines, specifically WISH and Detroit-532 cells. ALVAC infected CEF cells served as a positive control. No viral specific DNA accumulation was detected in either WISH or Detroit cells inoculated with ALVAC-RG. It should be noted that the limits of detection of this method have not been fully ascertained and viral DNA accumulation may be occurring, but at a level below the sensitivity of the method. Other experiments in which viral DNA replication was measured by .sup.3 H-thymidine incorporation support the results obtained with Vero and MRC-5 cells.
Analysis of Rabies Gene Expression.
To determine if any viral gene expression, particularly that of the inserted foreign gene, was occurring in the human cell lines even in the absence of viral DNA replication, immunoprecipitation experiments were performed on .sup.35 S-methionine labelled lysates of avian and non-avian cells infected with ALVAC and ALVAC-RG. The results of immunoprecipitation using a rabies G specific monoclonal antibody illustrated specific immunoprecipitation of a 67 kDa glycoprotein in CEF, Vero and MRC-5, WISH and Detroit cells infected with ALVAC-RG. No such specific rabies gene products were detected in any of the uninfected and parentally infected cell lysates.
The results of this experiment indicated that in the human cell lines analyzed, although the ALVAC-RG recombinant was able to initiate an infection and express a foreign gene product under the transcriptional control of the H6 early/late vaccinia virus promoter, the replication did not proceed through DNA replication, nor was there any detectable viral progeny produced. In the Vero cells, although some level of ALVAC-RG specific DNA accumulation was observed, no viral progeny was detected by these methods. These results would indicate that in the human cell lines analyzed the block to viral replication occurs prior to the onset of DNA replication, while in Vero cells, the block occurs following the onset of viral DNA replication.
In order to determine whether the rabies glycoprotein expressed in ALVAC-RG was immunogenic, a number of animal species were tested by inoculation of the recombinant. The efficacy of current rabies vaccines is evaluated in a mouse model system. A similar test was therefore performed using ALVAC-RG. Nine different preparations of virus (including one vaccine batch (J) produced after 10 serial tissue culture passages of the seed virus) with infectious titers ranging from 6.7 to 8.4 log.sub.10 TCID.sub.50 per ml were serially diluted and 50 to 100 .mu.l of dilutions inoculated into the footpad of four to six week old mice. Mice were challenged 14 days later by the intracranial route with 300 .mu.l of the CVS strain of rabies virus containing from 15 to 43 mouse LD.sub.50 as determined by lethality titration in a control group of mice. Potency, expressed as the PD.sub.50 (Protective dose 50%), was calculated at 14 days post-challenge. The results of the experiment are shown in Table 10. The results indicated that ALVAC-RG was consistently able to protect mice against rabies virus challenge with a PD.sub.50 value ranging from 3.33 to 4.56 with a mean value of 3.73 (STD 0.48). As an extension of this study, male mice were inoculated intracranially with 50 .mu.l of virus containing 6.0 log.sub.10 TCID.sub.50 of ALVAC-RG or with an equivalent volume of an uninfected cell suspension. Mice were sacrificed on days 1, 3 and 6 post-inoculation and their brains removed, fixed and sectioned. Histopathological examination showed no evidence for neurovirulence of ALVAC-RG in mice.
In order to evaluate the safety and efficacy of ALVAC-RG for dogs and cats, a group of 14, 5 month old beagles and 14, 4 month old cats were analyzed. Four animals in each species were not vaccinated. Five animals received 6.7 log.sub.10 TCID.sub.50 subcutaneously and five animals received 7.7 log.sub.10 TCID.sub.50 by the same route. Animals were bled for analysis for anti-rabies antibody. Animals receiving no inoculation or 6.7 log.sub.10 TCID.sub.50 of ALVAC-RG were challenged at 29 days post-vaccination with 3.7 log.sub.10 mouse LD.sub.50 (dogs, in the temporal muscle) or 4.3 log.sub.10 mouse LD.sub.50 (cats, in the neck) of the NYGS rabies virus challenge strain. The results of the experiment are shown in Table 11.
No adverse reactions to inoculation were seen in either cats or dogs with either dose of inoculum virus. Four of 5 dogs immunized with 6.7 log.sub.10 TCID.sub.50 had antibody titers on day 14 post-vaccination and all dogs had titers at 29 days. All dogs were protected from a challenge which killed three out of four controls. In cats, three of five cats receiving 6.7 log.sub.10 TCID.sub.50 had specific antibody titers on day 14 and all cats were positive on day 29 although the mean antibody titer was low at 2.9 IU. Three of five cats survived a challenge which killed all controls. All cats immunized with 7.7 log.sub.10 TCID.sub.50 had antibody titers on day 14 and at day 29 the Geometric Mean Titer was calculated as 8.1 International Units.
The immune response of squirrel monkeys (Saimiri sciureus) to inoculation with ALVAC, ALVAC-RG and an unrelated canarypox virus recombinant was examined. Groups of monkeys were inoculated as described above and sera analyzed for the presence of rabies specific antibody. Apart from minor typical skin reactions to inoculation by the intradermal route, no adverse reactivity was seen in any of the monkeys. Small amounts of residual virus were isolated from skin lesions after intradermal inoculation on days two and four post-inoculation only. All specimens were negative on day seven and later. There was no local reaction to intra-muscular injection. All four monkeys inoculated with ALVAC-RG developed anti-rabies serum neutralizing antibodies as measured in an RFFI test. Approximately six months after the initial inoculation all monkeys and one additional naive monkey were re-inoculated by the subcutaneous route on the external face of the left thigh with 6.5 log.sub.10 TCID.sub.50 of ALVAC-RG. Sera were analyzed for the presence of anti-rabies antibody. The results are shown in Table 12.
Four of the five monkeys naive to rabies developed a serological response by seven days post-inoculation with ALVAC-RG. All five monkeys had detectable antibody by 11 days post-inoculation. Of the four monkeys with previous exposure to the rabies glycoprotein, all showed a significant increase in serum neutralization titer between days 3 and 7 post-vaccination. The results indicate that vaccination of squirrel monkeys with ALVAC-RG does not produce adverse side-effects and a primary neutralizing antibody response can be induced. An amnanestic response is also induced on re-vaccination. Prior exposure to ALVAC or to a canarypox recombinant expressing an unrelated foreign gene does not interfere with induction of an anti-rabies immune response upon re-vaccination.
The immunological response of HIV-2 seropositive macaques to inoculation with ALVAC-RG was assessed. Animals were inoculated as described above and the presence of anti-rabies serum neutralizing antibody assessed in an RFFI test. The results, shown in Table 13, indicated that HIV-2 positive animals inoculated by the subcutaneous route developed anti-rabies antibody by 11 days after one inoculation. An anamnestic response was detected after a booster inoculation given approximately three months after the first inoculation. No response was detected in animals receiving the recombinant by the oral route. In addition, a series of six animals were inoculated with decreasing doses of ALVAC-RG given by either the intra-muscular or subcutaneous routes. Five of the six animals inoculated responded by 14 days post-vaccination with no significant difference in antibody titer.
Two chimpanzees with prior exposure to HIV were inoculated with 7.0 log.sub.10 pfu of ALVAC-RG by the subcutaneous or intra-muscular route. At 3 months post-inoculations both animals were re-vaccinated in an identical fashion. The results are shown in Table 14.
No adverse reactivity to inoculation was noted by either intramuscular or subcutaneous routes. Both chimpanzees responded to primary inoculation by 14 days and a strongly rising response was detected following re-vaccination.
TABLE 5______________________________________Sequential Passage of ALVAC in Avian and non-Avian Cells. CEF Vero MRC-5______________________________________Pass 1Sample to.sup.a 2.4 3.0 2.6 t7.sup.b 7.0 1.4 0.4 t7A.sup.c 1.2 1.2 0.4Pass 2Sample to 5.0 0.4 N.D..sup.d t7 7.3 0.4 N.D. t7A 3.9 N.D. N.D.Pass 3Sample to 5.4 0.4 N.D. t7 7.4 N.D. N.D. t7A 3.8 N.D. N.D.Pass 4Sample to 5.2 N.D. N.D. t7 7.1 N.D. N.D. t7A 3.9 N.D. N.D.______________________________________ .sup.a This sample was harvested at zero time and represents the residual input virus. The titer is expressed as log.sub.10 pfu per ml. .sup.b This sample was harvested at 7 days postinfection. .sup.c This sample was inoculated in the presence of 40 .mu.g/ml of Cytosine arabinoside and harvested at 7 days post infection. .sup.d Not detectable
TABLE 6______________________________________Sequential Passage of ALVAC-RG in Avian and non-Avian Cells CEF Vero MRC-5______________________________________Pass 1Sample t0.sup.a 3.0 2.9 2.9 t7.sup.b 7.1 1.0 1.4 t7A.sup.c 1.8 1.4 1.2Pass 2Sample t0 5.1 0.4 0.4 t7 7.1 N.D..sup.d N.D. t7A 3.8 N.D. N.D.Pass 3Sample t0 5.1 0.4 N.D. t7 7.2 N.D. N.D. t7A 3.6 N.D. N.D.Pass 4Sample t0 5.1 N.D. N.D. t7 7.0 N.D. N.D. t7A 4.0 N.D. N.D______________________________________ .sup.a This sample was harvested at zero time and represents the residual input virus. The titer is expressed as log.sub.10 pfu per ml. .sup.b This sample was harvested at 7 days postinfection. .sup.c This sample was inoculated in the presence of 40 .mu.g/ml of Cytosine arabinoside and harvested at 7 days postinfection. .sup.d Not detectable.
TABLE 7______________________________________Amplification of residual virus by passage in CEF cells CEF Vero MRC-5______________________________________a) ALVACPass 2.sup.a 7.0.sup.b 6.0 5.2 3 7.5 4.1 4.9 4 7.5 N.D..sup.c N.D. 5 7.1 N.D. N.D.b) ALVAC-RGPass 2a 7.2 5.5 5.5 3 7.2 5.0 5.1 4 7.2 N.D. N.D. 5 7.2 N.D. N.D.______________________________________ .sup.a Pass 2 represents the amplification in CEF cells of the 7 day sample from Pass 1. .sup.b Titer expressed as log.sub.10 pfu per ml .sup.c Not Detectable
TABLE 8______________________________________Schedule of inoculation of rhesus macaques with ALVAC-RG (vCP65)Animal Inoculation______________________________________176L Primary: 1 .times. 10.sup.8 pfu of vCP65 orally in TANG Secondary: 1 .times. 10.sup.7 pfu of vCP65 plus 1 .times. 10.sup.7 pfu of VCP82.sup.a by SC route185L Primary: 1 .times. 10.sup.8 pfu of vCP65 orally in Tang Secondary: 1 .times. 10.sup.7 pfu of vCP65 plus 1 .times. 10.sup.7 pfu of vCP82 by SC route177L Primary: 5 .times. 10.sup.7 pfu SC of vCP65 by SC route Secondary: 1 .times. 10.sup.7 pfu of vCP65 plus 1 .times. 10.sup.7 pfu of vCP82 by SC route186L Primary: 5 .times. 10.sup.7 pfu of vCP65 by SC route Secondary: 1 .times. 10.sup.7 pfu of vCP65 plus 1 .times. 10.sup.7 pfu of vCP82 by SC route178L Primary: 1 .times. 10.sup.7 pfu of vCP65 by SC route182L Primary: 1 .times. 10.sup.7 pfu of vCP65 by IM route179L Primary: 1 .times. 10.sup.6 pfu of vCP65 by SC route183L Primary: 1 .times. 10.sup.6 pfu of vCP65 by IM route180L Primary: 1 .times. 10.sup.6 pfu of vCP65 by SC route184L Primary: 1 .times. 10.sup.5 pfu of vCP65 by IM route187L Primary 1 .times. 10.sup.7 pfu of vCP65 orally______________________________________ .sup.a vCP82 is a canarypox virus recombinant expressing the measles viru fusion and hemagglutinin genes.
TABLE 9______________________________________Analysis of yield in avian and non-avian cellsinoculated with ALVAC-RG Sample TimeCell Type t0 t72 t72A.sup.b______________________________________Expt 1CEF 3.3.sup.a 7.4 1.7Vero 3.0 1.4 1.7MRC-5 3.4 2.0 1.7Expt 2CEF 2.9 7.5 <1.7WISH 3.3 2.2 2.0Detroit-532 2.8 1.7 <1.7______________________________________ .sup.a Titer expressed as log.sub.10 pfu per ml .sup.b Culture incubated in the presence of 40 .mu.g/ml of Cytosine arabinoside
TABLE 10______________________________________Potency of ALVAC-RG as tested in miceTest Challenge Dose.sup.a PD.sub.50 .sup.b______________________________________Initial seed 43 4.56Primary seed 23 3.34Vaccine Batch H 23 4.52Vaccine Batch I 23 3.33Vaccine Batch K 15 3.64Vaccine Batch L 15 4.03Vaccine Batch M 15 3.32Vaccine Batch N 15 3.39Vaccine Batch J 23 3.42______________________________________ .sup.a Expressed as mouse LD.sub.50 .sup.b Expressed as log.sub.10 TCID.sub.50
TABLE 11______________________________________Efficacy of ALVAC-RG in dogs and cats Dogs CatsDose Antibody.sup.a Survival.sup.b Antibody Survival______________________________________6.7 11.9 5/5 2.9 3/57.7 10.1 N.T. 8.1N.T.______________________________________ .sup.a Antibody at day 29 post inoculation expressed as the geometric mea titer in International Units. .sup.b Expressed as a ratio of survivors over animals challenged
TABLE 12______________________________________Anti-rabies serological response of Squirrel monkeysinoculated with canarypox recombinantsMon-key Previous Rabies serum-neutralizing antibody.sup.a# Exposure -196.sup.b 0 3 7 11 21 28______________________________________22 ALVAC.sup.c NT.sup.g <1.2 <1.2 <1.2 2.1 2.3 2.251 ALVAC.sup.c NT <1.2 <1.2 1.7 2.2 2.2 2.239 vCP37.sup.d NT <1.2 <1.2 1.7 2.1 2.2 N.T..sup.g55 vCP37.sup.d NT <1.2 <1.2 1.7 2.2 2.1 N.T.37 ALVAC-RG.sup.e 2.2 <1.2 <1.2 3.2 3.5 3.5 3.253 ALVAC-RG.sup.e 2.2 <1.2 <1.2 3.6 3.6 3.6 3.438 ALVAC-RG.sup.f 2.7 <1.7 <1.7 3.2 3.8 3.6 N.T.54 ALVAC-RG.sup.f 3.2 <1.7 <1.5 3.6 4.2 4.0 3.657 None NT <1.2 <1.2 1.7 2.7 2.7 2.3______________________________________ .sup.a As determined by RFFI test on days indicated and expressed in International Units .sup.b Day196 represents serum from day 28 after primary vaccination .sup.c Animals received 5.0 log.sub.10 TCID.sub.50 of ALVAC .sup.d Animals received 5.0 log.sub.10 TCID.sub.50 of vCP37 .sup.e Animals received 5.0 log.sub.10 TCID.sub.50 of ALVACRG .sup.f Animals received 7.0 log.sub.10 TCID.sub.50 of ALVACRG .sup.g Not tested.
TABLE 13__________________________________________________________________________Inoculation of rhesus macaques with ALVAC-RG.sup.aRoute of Primary InoculationDays post- or/Tang SC SC SC IM SC IM SC IM ORInoculation 176L.sup.b 185L 177L 186L 178L 182L 179L 183L 180L 184L 187L.sup.b__________________________________________________________________________-84 -- -- ---9 -- -- -- -- -- -- 3 -- -- -- -- 6 -- -- .+-. .+-.11 -- -- 16.sup.d 12819 -- -- 32 128 -- --35 -- -- 32 51259 -- -- 64 25675 -- -- 64 128 -- -- 99.sup.c -- -- 64 256 -- -- -- -- -- -- 2 -- -- 32 256 -- -- -- -- -- -- -- 6 -- -- 512 512 -- -- -- -- -- -- --15 16 16 512 512 64 32 64 128 32 -- --29 16 32 256 256 64 64 32 128 32 -- --55 32 32 32 16 --57 16 128 128 16 16 --__________________________________________________________________________ .sup.a See Table 9 for schedule of inoculations. .sup.b Animals 176L and 185L received 8.0 log.sub.10 pfu by the oral route in 5 ml Tang. Animal 187L received 7.0 log.sub.10 pfu by oral rout not in Tang. .sup.c Day of revaccination for animals 176L, 185L, 177L and 186L by S.C. route, and primary vaccination for animals 178L, 182L, 179L, 183L, 180L, 184L and 187L. .sup.d Titers expressed as reciprocal of last dilution showing inhibition of fluorescence in an RFFI test.
TABLE 14______________________________________Inoculation of chimpanzees with ALVAC-RGWeeks post- Animal 431 Animal 457Inoculation I.M. S.C.______________________________________0 <8.sup.a <81 <8 <82 8 324 16 328 16 3212.sup.b /0 16 813/1 128 12815/3 256 51220/8 64 12826/12 32 128______________________________________ .sup.a Titer expressed as reciprocal of last dilution showing inhibition of fluorescence in an RFFI test .sup.b Day of reinoculation
Example 22
Immunization of Humans Using Canarypox Expressing Rabies Glycoprotein (ALVAC-RG; vCP65)
ALVAC-RG (vCP65) was generated as described in Example 21 and FIGS. 18A and 18B. For scaling-up and vaccine manufacturing ALVAC-RG (vCP65) was grown in primary CEF derived from specified pathogen free eggs. Cells were infected at a multiplicity of 0.01 and incubated at 37.degree. C. for three days.
The vaccine virus suspension was obtained by ultrasonic disruption in serum free medium of the infected cells; cell debris were then removed by centrifugation and filtration. The resulting clarified suspension was supplemented with lyophilization stabilizer (mixture of amino-acids), dispensed in single dose vials and freeze dried. Three batches of decreasing titer were prepared by ten-fold serial dilutions of the virus suspension in a mixture of serum free medium and lyophilization stabilizer, prior to lyophilization.
Quality control tests were applied to the cell substrates, media and virus seeds and final product with emphasis on the search for adventitious agents and innocuity in laboratory rodents. No undesirable trait was found.
Preclinical Data.
Studies in vitro indicated that VERO or MRC-5 cells do not support the growth of ALVAC-RG (vCP65); a series of eight (VERO) and 10 (MRC) blind serial passages caused no detectable adaptation of the virus to grow in these non avian lines. Analyses of human cell lines (MRC-5, WISH, Detroit 532, HEL, HNK or EBV-transformed lymphoblastoid cells) infected or inoculated with ALVAC-RG (vCP65) showed no accumulation of virus specific DNA suggesting that in these cells the block in replication occurs prior to DNA synthesis. Significantly, however, the expression of the rabies virus glycoprotein gene in all cell lines tested indicating that the abortive step in the canarypox replication cycle occurs prior to viral DNA replication.
The safety and efficacy of ALVAC-RG (vCP65) were documented in a series of experiments in animals. A number of species including canaries, chickens, ducks, geese, laboratory rodents (suckling and adult mice), hamsters, guinea-pigs, rabbits, cats and dogs, squirrel monkeys, rhesus macaques and chimpanzees, were inoculated with doses ranging from 10.sup.5 to 10.sup.8 pfu. A variety of routes were used, most commonly subcutaneous, intramuscular and intradermal but also oral (monkeys and mice) and intracerebral (mice).
In canaries, ALVAC-RG (vCP65) caused a "take" lesion at the site of scarification with no indication of disease or death. Intradermal inoculation of rabbits resulted in a typical poxvirus inoculation reaction which did not spread and healed in seven to ten days. There was no adverse side effects due to canarypox in any of the animal tests. Immunogenicity was documented by the development of anti-rabies antibodies following inoculation of ALVAC-RG (vCP65) in rodents, dogs, cats, and primates, as measured by Rapid Fluorescent Focus Inhibition Test (RFFIT). Protection was also demonstrated by rabies virus challenge experiments in mice, dogs, and cats immunized with ALVAC-RG (vCP65).
Volunteers.
Twenty-five healthy adults aged 20-45 with no previous history of rabies immunization were enrolled. Their health status was assessed by complete medical histories, physical examinations, hematological and blood chemistry analyses. Exclusion criteria included pregnancy, allergies, immune depression of any kind, chronic debilitating disease, cancer, injection of immune globins in the past three months, and seropositivity to human immunodeficiency virus (HIV) or to hepatitis B virus surface antigen.
Study Design.
Participants were randomly allocated to receive either standard Human Diploid Cell Rabies Vaccine (HDC) batch no E0751 (Pasteur Merieux Serums & Vaccine, Lyon, France) or the study vaccine ALVAC-RG (vCP65).
The trial was designated as a dose escalation study. Three batches of experimental ALVAC-RG (vCP65) vaccine were used sequentially in three groups of volunteers (Groups A, B and C) with two week intervals between each step. The concentration of the three batches was 10.sup.3.5, 10.sup.4.5, 10.sup.5.5 Tissue Culture Infectious Dose (TCID.sub.50) per dose, respectively.
Each volunteer received two doses of the same vaccine subcutaneously in the deltoid region at an interval of four weeks. The nature of the injected vaccine was not known by the participants at the time of the first injection but was known by the investigator.
In order to minimize the risk of immediate hypersensitivity at the time of the second injection, the volunteers of Group B allocated to the medium dose of experimental vaccine were injected 1 h previously with the lower dose and those allocated to the higher dose (Group C) received successively the lower and the medium dose at hourly intervals.
Six months later, the recipients of the highest dosage of ALVAC-RG (vCP65) (Group C) and HDC vaccine were offered a third dose of vaccine; they were then randomized to receive either the same vaccine as previously or the alternate vaccine. As a result, four groups were formed corresponding to the following immunization scheme: 1. HDC, HDC - HDC; 2. HDC, HDC - ALVAC-RG (vCP65); 3. ALVAC-RG (vCP65), ALVAC-RG (vCP65) - HDC; 4. ALVAC-RG (vCP65), ALVAC-RG (vCP65), ALVAC-RG (vCP65).
Monitoring of Side Effects.
All subjects were monitored for 1 h after injection and re-examined every day for the next five days. They were asked to record local and systemic reactions for the next three weeks and were questioned by telephone two times a week.
Laboratory Investigators.
Blood specimens were obtained before enrollment and two, four and six days after each injection. Analysis included complete blood cell count, liver enzymes and creatine kinase assays.
Antibody Assays.
Antibody assays were performed seven days prior to the first injection and at days 7, 28, 35, 56, 173, 187 and 208 of the study.
The levels of neutralizing antibodies to rabies were determined using the Rapid Fluorescent Focus Inhibition test (RFFIT) (Smith & Yaeger, In Laboratory Techniques on Rabies). Canarypox antibodies were measured by direct ELISA. The antigen, a suspension of purified canarypox virus disrupted with 0.1% Triton X100, was coated in microplates. Fixed dilutions of the sera were reacted for two hours at room temperature and reacting antibodies were revealed with a peroxidase labelled anti-human IgG goat serum. The results are expressed as the optical density read at 490 nm.
Analysis.
Twenty-five subjects were enrolled and completed the study. There were 10 males and 15 females and the mean age was 31.9 (21 to 48). All but three subjects had evidence of previous smallpox vaccination; the three remaining subjects had no typical scar and vaccination history. Three subjects received each of the lower doses of experimental vaccine (10.sup.3.5 and 10.sup.4.5 TCID.sub.50), nine subjects received 10.sup.5.5 TCID.sub.50 and ten received the HDC vaccine.
Safety (Table 14).
During the primary series of immunization, fever greater than 37.7.degree. C. was noted within 24 hours after injection in one HDC recipient (37.8.degree. C.) and in one vCP65 10.sup.5.5 TCID.sub.50 recipient (38.degree. C.). No other systemic reaction attributable to vaccination was observed in any participant.
Local reactions were noted in 9/10 recipients of HDC vaccine injected subcutaneously and in 0/3, 1/3 and 9/9 recipients of vCP65 10.sup.3.5, 10.sup.4.5, 10.sup.5.5 TCID.sub.50, respectively.
Tenderness was the most common symptoms and was always mild. Other local symptoms included redness and induration which were also mild and transient. All symptoms usually subsided within 24 hours and never lasted more than 72 hours.
There was no significant change in blood cell counts, liver enzymes or creatine kinase values.
Immune Responses; Neutralizing Antibodies to Rabies (Table 16).
Twenty eight days after the first injection all the HDC recipients had protective titers (.gtoreq.0.5 IU/ml). By contrast none in groups A and B (10.sup.3.5 and 10.sup.4.5 TCID.sub.50) and only 2/9 in group C (10.sup.5.5 TCID.sub.50) ALVAC-RG (vCP65) recipients reached this protective titer.
At day 56 (i.e. 28 days after the second injection) protective titers were achieved in 0/3 of Group A, 2/3 of Group B and 9/9 of Group C recipients of ALVAC-RG (vCP65) vaccine and persisted in all 10 HDC recipients.
At day 56 the geometric mean titers were 0.05, 0.47, 4.4 and 11.5 IU/ml in groups A, B, C and HDC respectively.
At day 180, the rabies antibody titers had substantially decreased in all subjects but remained above the minimum protective titer of 0.5 IU/ml in 5/10 HCD recipients and in 5/9 ALVAC-RG (vCP65) recipients; the geometric mean titers were 0.51 and 0.45 IU/ml in groups HCD and C, respectively.
Antibodies to the Canarypox Virus (Table 17).
The pre-immune titers observed varied widely with titers varying from 0.22 to 1.23 O.D. units despite the absence of any previous contact with canary birds in those subjects with the highest titers. When defined as a greater than two-fold increase between preimmunization and post second injection titers, a seroconversion was obtained in 1/3 subjects in group B and in 9/9 subjects in group C whereas no subject seroconverted in groups A or HDC.
Booster Injection.
The vaccine was similarly well tolerated six months later, at the time of the booster injection: fever was noted in 2/9 HDC booster recipients and in 1/10 ALVAC-RG (vCP65) booster recipients. Local reactions were present in 5/9 recipients of HDC booster and in 6/10 recipients of the ALVAC-RG (vCP65) booster.
Observations.
FIGS. 22A-22D shows graphs of rabies neutralizing antibody titers (Rapid Fluorescent Focus Inhibition Test or RFFIT, IU/ml): Booster effect of HDC and vCP65 (10.sup.5.5 TCID.sub.50) in volunteers previously immunized with either the same or the alternate vaccine. Vaccines were given at days 0, 28 and 180. Antibody titers were measured at days 0, 7, 28, 35, 56, 173, and 187 and 208.
As shown in FIGS. 22A-22D, the booster dose given resulted in a further increase in rabies antibody titers in every subject whatever the immunization scheme. However, the ALVAC-RG (vCP65) booster globally elicited lower immune responses than the HDC booster and the ALVAC-RG (vCP65), ALVAC-RG (vCP65) - ALVAC-RG (vCP65) group had significantly lower titers than the three other groups. Similarly, the ALVAC-RG (vCP65) booster injection resulted in an increase in canarypox antibody titers in 3/5 subjects who had previously received the HDC vaccine and in all five subjects previously immunized with ALVAC-RG (vCP65).
In general, none of the local side effects from administration of vCP65 was indicative of a local replication of the virus. In particular, lesions of the skin such as those observed after injection of vaccine were absent. In spite of the apparent absence of replication of the virus, the injection resulted in the volunteers generating significant amounts of antibodies to both the canarypox vector and to the expressed rabies glycoprotein.
Rabies neutralizing antibodies were assayed with the Rapid Fluorescent Focus Inhibition Test (RFFIT) which is known to correlate well with the sero neutralization test in mice. Of 9 recipients of 10.sup.5.5 TCID.sub.50, five had low level responses after the first dose. Protective titers of rabies antibodies were obtained after the second injection in all recipients of the highest dose tested and even in 2 of the 3 recipients of the medium dose. In this study, both vaccines were given subcutaneously as usually recommended for live vaccines, but not for the inactivated HDC vaccine. This route of injection was selected as it best allowed a careful examination of the injection site, but this could explain the late appearance of antibodies in HDC recipients: indeed, none of the HDC recipients had an antibody increase at day 7, whereas, in most studies where HDC vaccine is give intramuscularly a significant proportion of subjects do (Klietmann et al., Int'l Green Cross--Geneva, 1981; Kuwert et al., Int'l Green Cross--Geneva, 1981). However, this invention is not necessarily limited to the subcutaneous route of administration.
The GMT (geometric mean titers) of rabies neutralizing antibodies was lower with the investigational vaccine than with the HDC control vaccine, but still well above the minimum titer required for protection. The clear dose effect response obtained with the three dosages used in this study suggest that a higher dosage might induce a stronger response. Certainly from this disclosure the skilled artisan can select an appropriate dosage for a given patient.
The ability to boost the antibody response is another important result of this Example; indeed, an increase in rabies antibody titers was obtained in every subject after the 6 month dose whatever the immunization scheme, showing that preexisting immunity elicited by either the canarypox vector or the rabies glycoprotein had no blocking effect on the booster with the recombinant vaccine candidate or the conventional HDC rabies vaccine. This contrasts findings of others with vaccinia recombinants in humans that immune response may be blocked by pre-existing immunity (Cooney et al., Lancet 1991, 337:567-72; Etinger et al., Vaccine 9:470-72, 1991).
Thus, this Example clearly demonstrates that a non-replicating poxvirus can serve as an immunizing vector in animals or humans, with all of the advantages that replicating agents confer on the immune response, but without the safety problem created by a fully permissive virus.
TABLE 15______________________________________Reactions in the 5 days following vaccination vCP65 dosage (TCID50) HDC 10.sup.3.5 10.sup.4.5 10.sup.5.5 controlInjection lst 2nd 1st 2nd lst 2nd lst 2nd______________________________________No. vaccinees 3 3 3 3 9 9 10 10temp >37.7.degree. C. 0 0 0 0 0 1 1 0soreness 0 0 1 1 6 8 8 6redness 0 0 0 0 0 4 5 4induration 0 0 0 0 0 4 5 4______________________________________
TABLE 16______________________________________Rabies neutralizing antibodies (REFIT; IU/ml) Individualtiters and geometric mean titers GMT) DaysNo. TCID50/dose 0 7 28 35 56______________________________________ 1 10.sup.3.5 <0.1 <0.1 <0.1 <0.1 0.2 3 10.sup.3.5 <0.1 <0.1 <0.1 <0.1 <0.1 4 10.sup.3.5 <0.1 <0.1 <0.1 <0.1 <0.1 G.M.T. <0.1 <0.1 <0.1 <0.1 <0.1 6 10.sup.4.5 <0.1 <0.1 <0.1 <0.1 <0.1 7 10.sup.4.5 <0.1 <0.1 <0.1 2.4 1.910 10.sup.4.5 <0.1 <0.1 <0.1 1.6 1.1 G.M.T. <0.1 <0.1 0.1 0.58 0.4711 10.sup.5.5 <0.1 <0.1 1.0 3.2 4.313 10.sup.5.5 <0.1 <0.1 0.3 6.0 8.814 10.sup.5.5 <0.1 <0.1 0.2 2.1 9.417 10.sup.5.5 <0.1 <0.1 <0.1 1.2 2.518 10.sup.5.5 <0.1 <0.1 0.7 8.3 12.520 10.sup.5.5 <0.1 <0.1 <0.1 0.3 3.721 10.sup.5.5 <0.1 <0.1 0.2 2.6 3.923 10.sup.55 <0.1 <0.1 <0.1 1.7 4.225 10.sup.55 <0.1 <0.1 <0.1 0.6 0.9 G.M.T. <0.1 <0.1 0.16 1.9 4.4* 2 HDC <0.1 <0.1 0.8 7.1 7.2 5 HDC <0.1 <0.1 9.9 12.8 18.7 8 HDC <0.1 <0.1 12.7 21.1 16.5 9 HDC <0.1 <0.1 6.0 9.9 14.312 HDC <0.1 <0.1 5.0 9.2 25.315 HDC <0.1 <0.1 2.2 5.2 8.616 HDC <0.1 <0.1 2.7 7.7 20.719 HDC <0.1 <0.1 2.6 9.9 9.122 HDC <0.1 <0.1 1.4 8.6 6.624 HDC <0.1 <0.1 0.8 5.8 4.7 G.M.T. <0.1 <0.1 2.96 9.0 11.5*______________________________________ *p = 0.007 student t test
TABLE 17______________________________________Canarypox antibodies: ELISA Geometric Mean Titer*vCP65 dosage DaysTCID50/dose 0 7 28 35 56______________________________________10.sup.3.5 0.69 ND 0.76 ND 0.6810.sup.4.5 0.49 0.45 0.56 0.63 0.8710.sup.5.5 0.38 0.38 0.77 1.42 1.63HDC control 0.45 0.39 0.40 0.35 0.39______________________________________ *optical density at 1/25 dilution
Example 23
Comparison of the LD.sub.50 of ALVAC and NYVAC with Various Vaccinia Virus Strains
Mice.
Male outbred Swiss Webster mice were purchased from Taconic Farms (Germantown, N.Y.) and maintained on mouse chow and water ad libitum until use at 3 weeks of age ("normal" mice). Newborn outbred Swiss Webster mice were of both sexes and were obtained following timed pregnancies performed by Taconic Farms. All newborn mice used were delivered within a two day period.
Viruses.
ALVAC was derived by plaque purification of a canarypox virus population and was prepared in primary chick embryo fibroblast cells (CEF). Following purification by centrifugation over sucrose density gradients, ALVAC was enumerated for plaque forming units in CEF cells. The WR(L) variant of vaccinia virus was derived by selection of large plaque phenotypes of WR (Panicali et al., 1981). The Wyeth New York State Board of Health vaccine strain of vaccinia virus was obtained from Pharmaceuticals Calf Lymph Type vaccine Dryvax, control number 302001B. Copenhagen strain vaccinia virus VC-2 was obtained from Institut Merieux, France. Vaccinia virus strain NYVAC was derived from Copenhagen VC-2. All vaccinia virus strains except the Wyeth strain were cultivated in Vero African green monkey kidney cells, purified by sucrose gradient density centrifugation and enumerated for plaque forming units on Vero cells. The Wyeth strain was grown in CEF cells and enumerated in CEF cells.
Inoculations.
Groups of 10 normal mice were inoculated intracranially (ic) with 0.05 ml of one of several dilutions of virus prepared by 10-fold serially diluting the stock preparations in sterile phosphate-buffered saline. In some instances, undiluted stock virus preparation was used for inoculation.
Groups of 10 newborn mice, 1 to 2 days old, were inoculated ic similarly to the normal mice except that an injection volume of 0.03 ml was used.
All mice were observed daily for mortality for a period of 14 days (newborn mice) or 21 days (normal mice) after inoculation. Mice found dead the morning following inoculation were excluded due to potential death by trauma.
The lethal dose required to produce mortality for 50% of the experimental population (LD.sub.50) was determined by the proportional method of Reed and Muench.
Comparison of the LD.sub.50 of ALVAC and NYVAC with Various Vaccinia Virus Strains for Normal, Young Outbred Mice by the ic Route.
In young, normal mice, the virulence of NYVAC and ALVAC were several orders of magnitude lower than the other vaccinia virus strains tested (Table 18). NYVAC and ALVAC were found to be over 3,000 times less virulent in normal mice than the Wyeth strain; over 12,500 times less virulent than the parental VC-2 strain; and over 63,000,000 times less virulent than the WR(L) variant. These results would suggest that NYVAC is highly attenuated compared to other vaccinia strains, and that ALVAC is generally nonvirulent for young mice when administered intracranially, although both may cause mortality in mice at extremely high doses (3.85.times.10.sup.8 PFUs, ALVAC and 3.times.10.sup.8 PFUS, NYVAC) by an undetermined mechanism by this route of inoculation.
Comparison of the LD.sub.50 of ALVAC and NYVAC with Various Vaccinia Virus Strains for Newborn Outbred Mice by the ic Route.
The relative virulence of 5 poxvirus strains for normal, newborn mice was tested by titration in an intracranial (ic) challenge model system (Table 19). With mortality as the endpoint, LD.sub.50 values indicated that ALVAC is over 100,000 times less virulent than the Wyeth vaccine strain of vaccinia virus; over 200,000 times less virulent than the Copenhagen VC-2 strain of vaccinia virus; and over 25,000,000 times less virulent than the WR-L variant of vaccinia virus. Nonetheless, at the highest dose tested, 6.3.times.10.sup.7 PFUs, 100% mortality resulted. Mortality rates of 33.3% were observed at 6.3.times.10.sup.6 PFUs. The cause of death, while not actually determined, was not likely of toxicological or traumatic nature since the mean survival time (MST) of mice of the highest dosage group (approximately 6.3 LD.sub.50) was 6.7.+-.1.5 days. When compared to WR(L) at a challenge dose of 5 LD.sub.50, wherein MST is 4.8.+-.0.6 days, the MST of ALVAC challenged mice was significantly longer (P=0.001).
Relative to NYVAC, Wyeth was found to be over 15,000 times more virulent; VC-2, greater than 35,000 times more virulent; and WR(L), over 3,000,000 times more virulent. Similar to ALVAC, the two highest doses of NYVAC, 6.times.10.sup.8 and 6.times.10.sup.7 PFUs, caused 100% mortality. However, the MST of mice challenged with the highest dose, corresponding to 380 LD.sub.50, was only 2 days (9 deaths on day 2 and 1 on day 4). In contrast, all mice challenged with the highest dose of WR-L, equivalent to 500 LD.sub.50, survived to day 4.
TABLE 18______________________________________Calculated 50% Lethal Dose for mice by variousvaccinia virus strains and for canarypox virus(ALVAC) by the ic route.POXVIRUS CALCULATEDSTRAIN LD.sub.50 (PFUs)______________________________________WR(L) 2.5VC-2 1.26 .times. 10.sup.4WYETH 5.00 .times. 10.sup.4NYVAC 1.58 .times. 10.sup.8ALVAC 1.58 .times. 10.sup.8______________________________________
TABLE 19______________________________________Calculated 50% Lethal Dose for newborn mice byvarious vaccinia virus strains and for canarypoxvirus (ALVAC) by the ic route.POXVIRUS CALCULATEDSTRAIN LD.sub.50 (PFUs)______________________________________WR(L) 0.4VC-2 0.1WYETH 1.6NYVAC 1.58 .times. 10.sup.6ALVAC 1.00 .times. 10.sup.7______________________________________
Example 24
Evaluation of NYVAC (vP866) and NYVAC-RG (vP879)
Immunoprecipitations.
Preformed monolayers of avian or non-avian cells were inoculated with 10 pfu per cell of parental NYVAC (vP866) or NYVAC-RG (vP879) virus. The inoculation was performed in EMEM free of methionine and supplemented with 2% dialyzed fetal bovine serum. After a one hour incubation, the inoculum was removed and the medium replaced with EMEM (methionine free) containing 20 .mu.Ci/ml of .sup.35 S-methionine. After an overnight incubation of approximately 16 hours, cells were lysed by the addition of Buffer A (1% Nonidet P-40, 10 mM Tris pH7.4, 150 mM NaCl, 1 mM EDTA, 0.01% sodium azide, 500 units per ml of aprotinin, and 0.02% phenyl methyl sulfonyl fluoride). Immunoprecipitation was performed using a rabies glycoprotein specific monoclonal antibody designated 24-3F10 supplied by Dr. C. Trimarchi, Griffith Laboratories, New York State Department of Health, Albany, N.Y., and a rat anti-mouse conjugate obtained from Boehringer Mannheim Corporation (Cat. #605-500). Protein A Sepharose CL-48 obtained from Pharmacia LKB Biotechnology Inc., Piscataway, N.J., was used as a support matrix. Immunoprecipitates were fractionated on 10% polyacrylamide gels according to the method of Dreyfuss et. al. (1984). Gels were fixed, treated for fluorography with 1M Na-salicylate for one hour, and exposed to Kodak XAR-2 film to visualize the immunoprecipitated protein species.
Sources of Animals.
New Zealand White rabbits were obtained from Hare-Marland (Hewitt, N.J.). Three week old male Swiss Webster outbred mice, timed pregnant female Swiss Webster outbred mice, and four week old Swiss Webster nude (nu.sup.+ nu.sup.+) mice were obtained from Taconic Farms, Inc. (Germantown, N.Y.). All animals were maintained according to NIH guidelines. All animal protocols were approved by the institutional IACUC. When deemed necessary, mice which were obviously terminally ill were euthanized.
Evaluation of Lesions in Rabbits.
Each of two rabbits was inoculated intradermally at multiple sites with 0.1 ml of PBS containing 10.sup.4, 10.sup.5, 10.sup.6, 10.sup.7, or 10.sup.8 pfu of each test virus or with PBS alone. The rabbits were observed daily from day 4 until lesion resolution. Indurations and ulcerations were measured and recorded.
Virus Recovery from Inoculation Sites.
A single rabbit was inoculated intradermally at multiple sites of 0/1 ml of PBS containing 10.sup.6, 10.sup.7, or 10.sup.8 pfu of each test virus or with PBS alone. After 11 days, the rabbit was euthanized and skin biopsy specimens taken from each of the inoculation sites were aseptically prepared by mechanical disruption and indirect sonication for virus recovery. Infectious virus was assayed by plaque titration on CEF monolayers.
Virulence in Mice.
Groups of ten mice, or five in the nude mice experiment, were inoculated ip with one of several dilutions of virus in 0.5 ml of sterile PBS. Reference is also made to Example 23.
Cyclophosphamide (CY) Treatment.
Mice were injected by the ip route with 4 mg (0.02 ml) of CY (SIGMA) on day -2, followed by virus injection on day 0. On the following days post infection, mice were injected ip with CY: 4 mg on day 1; 2 mg on days 4, 7 and 11; 3 mg on days 14, 18, 21, 25 and 28. Immunosuppression was indirectly monitored by enumerating white blood cells with a Coulter Counter on day 11. The average white blood cell count was 13,500 cells per .mu.l for untreated mice (n=4) and 4,220 cells per .mu.l for CY-treated control mice (n=5).
Calculation of LD.sub.50.
The lethal dose required to produce 50% mortality (LD.sub.50) was determined by the proportional method of Reed and Muench (Reed and Muench 1938).
Potency Testing of NYVAC-RG in Mice.
Four to six week old mice were inoculated in the footpad with 50 to 100 .mu.l of a range of dilutions (2.0-8.0 log.sub.10 tissue culture infective dose 50% (TCID.sub.50)) of either VV-RG (Kieny et al., 1984), ALVAC-RG (Taylor et al., 1991b), or the NYVAC-RG. Each group consisted of eight mice. At 14 days post-vaccination, the mice were challenged by intracranial inoculation with 15 LD.sub.50 of the rabies virus CVS strain (0.03 ml). On day 28, surviving mice were counted and protective does 50% (PD.sub.50) calculated.
Derivation of NYVAC (vP866).
The NYVAC strain of vaccinia virus was generated from VC-2, a plaque cloned isolate of the COPENHAGEN vaccine strain. To generate NYVAC from VC-2, eighteen vaccinia ORFs, including a number of viral functions associated with virulence, were precisely deleted in a series of sequential manipulations as described earlier in this disclosure. These deletions were constructed in a manner designed to prevent the appearance of novel unwanted open reading frames. FIG. 19 schematically depicts the ORFs deleted to generate NYVAC. At the top of FIG. 19 is depicted the HindIII restriction map of the vaccinia virus genome (VC-2 plaque isolate, COPENHAGEN strain). Expanded are the six regions of VC-2 that were sequentially deleted in the generation of NYVAC. The deletions were described earlier in this disclosure (Examples 13 through 18). Below such deletion locus is listed the ORFs which were deleted from that locus, along with the functions or homologies and molecular weight of their gene products.
Replication Studies of NYVAC and ALVAC on Human Tissue Cell Lines.
In order to determine the level of replication of NYVAC strain of vaccinia virus (vP866) in cells of human origin, six cell lines were inoculated at an input multiplicity of 0.1 pfu per cell under liquid culture and incubated for 72 hours. The COPENHAGEN parental clone (VC-2) was inoculated in parallel. Primary chick embryo fibroblast (CEF) cells (obtained from 10-11 day old embryonated eggs of SPF origin, Spafas, Inc., Storrs, Conn.) were included to represent a permissive cell substrate for all viruses. Cultures were analyzed on the basis of two criteria: the occurrence of productive viral replication and expression of an extrinsic antigen.
The replication potential of NYVAC in a number of human derived cells are shown in Table 20. Both VC-2 and NYVAC are capable of productive replication in CEF cells, although NYVAC with slightly reduced yields. VC-2 is also capable of productive replication in the six human derived cell lines tested with comparable yields except in the EBV transformed lymphoblastoid cell line JT-1 (human lymphoblastoid cell line transformed with Epstein-Barr virus, see Rickinson et al., 1984). In contract, NYVAC is highly attenuated in its ability to productively replicate in any of the human derived cell lines tested. Small increases of infectious virus above residual virus levels were obtained from NYVAC-infected MRC-5 (ATCC #CCL171, human embryonic lung origin), DETROIT 532 (ATCC #CCL54, human foreskin, Downs Syndrome), HEL 299 (ATCC #CCL137, human embryonic lung cells) and HNK (human neonatal kidney cells, Whittiker Bioproducts, Inc. Walkersville, Md., Cat #70-151) cells. Replication on these cell lines was significantly reduced when compared to virus yields obtained from NYVAC-infected CEF cells or with parental VC-2 (Table 20). It should be noted that the yields at 24 hours in CEF cells for both NYVAC and VC-2 is equivalent to the 72-hour yield. Allowing the human cell line cultures to incubate an additional 48 hours (another two viral growth cycles) may, therefore, have amplified the relative virus yield obtained.
Consistent with the low levels of virus yields obtained in the human-derived cell lines, MRC-5 and DETROIT 532, detectable but reduced levels of NYVAC-specific DNA accumulation were noted. The level of DNA accumulation in the MRC-5 and DETROIT 532 NYVAC-infected cell lines relative to that observed in NYVAC-infected CEF cells paralleled the relative virus yields. NYVAC-specific viral DNA accumulation was not observed in any of the other human-derived cells.
An equivalent experiment was also performed using the avipox virus, ALVAC. The results of virus replication are also shown in Table 20. No progeny virus was detectable in any of the human cell lines consistent with the host range restriction of canarypox virus to avian species. Also consistent with a lack of productive replication of ALVAC in these human-derived cells is the observation that no ALVAC-specific DNA accumulation was detectable in any of the human-derived cell lines.
Expression of Rabies Glycoprotein by NYVAC-RG (vP879) in Human Cells.
In order to determine whether efficient expression of a foreign gene could be obtained in the absence of significant levels of productive viral replication, the same cell lines were inoculated with the NYVAC recombinant expressing the rabies virus glycoprotein (vP879, Example 19) in the presence of .sup.35 S-methionine. Immunoprecipitation of the rabies glycoprotein was performed from the radiolabelled culture lysate using a monoclonal antibody specific for the rabies glycoprotein. Immunoprecipitation of a 67 kDa protein was detected consistent with a fully glycosylated form of the rabies glycoprotein. No serologically crossreactive product was detected in uninfected or parental NYVAC infected cell lysates. Equivalent results were obtained with all other human cells analyzed.
Inoculations on the Rabbit Skin.
The induction and nature of skin lesions on rabbits following intradermal (id) inoculations has been previously used as a measure of pathogenicity of vaccinia virus strains (Buller et al., 1988; Child et al., 1990; Fenner, 1958, Flexner et al., 1987; Ghendon and Chernos 1964). Therefore, the nature of lesions associated with id inoculations with the vaccinia strains WR (ATCC #VR119 plaque purified on CV-1 cells, ATCC #CCL70, and a plaque isolate designated L variant, ATCC #VR2035 selected, as described in Panicali et al., 1981)), WYETH (ATCC #VR325 marketed as DRYVAC by Wyeth Laboratories, Marietta, Pa.), COPENHAGEN (VC-2), and NYVAC was evaluated by inoculation of two rabbits (A069 and A128). The two rabbits displayed different overall sensitivities to the viruses, with rabbit A128 displaying less severe reactions than rabbit A069. In rabbit A128, lesions were relatively small and resolved by 27 days post-inoculation. On rabbit A069, lesions were intense, especially for the WR inoculation sites, and resolved only after 49 days. Intensity of the lesions was also dependent on the location of the inoculation sites relative to the lymph drainage network. In particular, all sites located above the backspine displayed more intense lesions and required longer times to resolve the lesions located on the flanks. All lesions were measured daily from day 4 to the disappearance of the last lesion, and the means of maximum lesion size and days to resolution were calculated (Table 21). No local reactions were observed from sites injected with the control PBS. Ulcerative lesions were observed at sites injected with WR, VC-2 and WYETH vaccinia virus strains. Significantly, no induration or ulcerative lesions were observed at sites of inoculation with NYVAC.
Persistence of Infectious Virus at the Site of Inoculation.
To assess the relative persistence of these viruses at the site of inoculation, a rabbit was inoculated intradermally at multiple sites with 0.1 ml PBS containing 10.sup.6, 10.sup.7 or 10.sup.8 pfu of VC-2, WR, WYETH or NYVAC. For each virus, the 10.sup.7 pfu dose was located above the backspine, flanked by the 10.sup.6 and 10.sup.8 doses. Sites of inoculation were observed daily for 11 days. WR elicited the most intense response, followed by VC-2 and WYETH (Table 22). Ulceration was first observed at day 9 for WR and WYETH and day 10 for VC-2. Sites inoculated with NYVAC or control PBS displayed no induration or ulceration. At day 11 after inoculation, skin samples from the sites of inoculation were excised, mechanically disrupted, and virus was titrated on CEF cells. The results are shown in Table 22. In no case was more virus recovered at this timepoint than was administered. Recovery of vaccinia strain, WR, was approximately 10.sup.6 pfu of virus at each site irrespective of amount of virus administered. Recovery of vaccinia strains WYETH and VC-2 was 10.sup.3 to 10.sup.4 pfu regardless of amount administered. No infectious virus was recovered from sites inoculated with NYVAC.
Inoculation of Genetically or Chemically Immune Deficient Mice.
Intraperitoneal inoculation of high doses of NYVAC (5.times.10.sup.8 pfu) or ALVAC (10.sup.9 pfu) into nude mice caused no deaths, no lesions, and no apparent disease through the 100 day observation period. In contrast, mice inoculated with WR (10.sup.3 to 10.sup.4 pfu), WYETH (5.times.10.sup.7 or 5.times.10.sup.8 pfu) or VC-2 (10.sup.4 to 10.sup.9 pfu) displayed disseminated lesions typical of poxviruses first on the toes, then on the tail, followed by severe orchitis in some animals. In mice infected with WR or WYETH, the appearance of disseminated lesions generally led to eventual death, whereas most mice infected with VC-2 eventually recovered. Calculated LD.sub.50 values are given in Table 23.
In particular, mice inoculated with VC-2 began to display lesions on their toes (red papules) and 1 to 2 days later on the tail. These lesions occurred between 11 and 13 days post-inoculation (pi) in mice given the highest doses (10.sup.9, 10.sup.8, 10.sup.7 and 10.sup.6 pfu), on day 16 pi in mice given 10.sup.5 pfu and on day 21 pi in mice given 10.sup.4 pfu. No lesions were observed in mice inoculated with 10.sup.3 and 10.sup.2 pfu during the 100 day observation period. Orchitis was noticed on day 23 pi in mice given 10.sup.9 and 10.sup.8 pfu, and approximately 7 days later in the other groups (10.sup.7 to 10.sup.4 pfu). Orchitis was especially intense in the 10.sup.9 and 10.sup.8 pfu groups and, although receding, was observed until the end of the 100 day observation period. Some pox-like lesions were noticed on the skin of a few mice, occurring around 30-35 days pi. Most pox lesions healed normally between 60-90 days pi. Only one mouse died in the group inoculated with 10.sup.9 pfu (Day 34 pi) and one mouse died in the group inoculated with 10.sup.8 pfu (Day 94 pi). No other deaths were observed in the VC-2 inoculated mice.
Mice inoculated with 10.sup.4 pfu of the WR strain of vaccinia started to display pox lesions on Day 17 pi. These lesions appeared identical to the lesions displayed by the VC-2 injected mice (swollen toes, tail). Mice inoculated with 10.sup.3 pfu of the WR strain did not develop lesions until 34 days pi. Orchitis was noticed only in the mice inoculated with the highest dose of WR (10.sup.4 pfu). During the latter stages of the observation period, lesions appeared around the mouth and the mice stopped eating. All mice inoculated with 10.sup.4 pfu of WR died or were euthanized when deemed necessary between 21 days and 31 days pi. Four out of the 5 mice injected with 10.sup.3 pfu of WR died or were euthanized when deemed necessary between 35 days and 57 days pi. No deaths were observed in mice inoculated with lower doses of WR (1 to 100 pfu).
Mice inoculated with the WYETH strain of vaccinia virus at higher doses 5.times.10.sup.7 and 5.times.10.sup.8 pfu) showed lesions on toes and tails, developed orchitis, and died. Mice injected with 5.times.10.sup.6 pfu or less of WYETH showed no signs of disease or lesions.
As shown in Table 23, CY-treated mice provided a more sensitive model for assaying poxvirus virulence than did nude mice. LD.sub.50 values for the WR, WYETH, and VC-2 vaccinia virus strains were significantly lower in this model system than in the nude mouse model. Additionally, lesions developed in mice injected with WYETH, WR and VC-2 vaccinia viruses, as noted below, with higher doses of each virus resulting in more rapid formation of lesions. As was seen with nude mice, CY-treated mice injected with NYVAC or ALVAC did not develop lesions. However, unlike nude mice, some deaths were observed in CY-treated mice challenged with NYVAC or ALVAC, regardless of the dose. These random incidences are suspect as to the cause of death.
Mice injected with all doses of WYETH (9.5.times.10.sup.4 to 9.5.times.10.sup.8 pfu) displayed pox lesions on their tail and/or on their toes between 7 and 15 days pi. In addition, the tails and toes were swollen. Evolution of lesions on the tail was typical of pox lesions with formation of a papule, ulceration and finally formation of a scab. Mice inoculated with all doses of VC-2 (1.65.times.10.sup.5 to 1.65.times.10.sup.9) also developed pox lesions on their tails and/or their toes analogous to those of WYETH injected mice. These lesions were observed between 7-12 days post inoculation. No lesions were observed on mice injected with lower doses of WR virus, although deaths occurred in these groups.
Potency Testing of NYVAC-RG.
In order to determine that attenuation of the COPENHAGEN strain of vaccinia virus had been effected without significantly altering the ability of the resulting NYVAC strain to be a useful vector, comparative potency tests were performed. In order to monitor the immunogenic potential of the vector during the sequential genetic manipulations performed to attenuate the virus, a rabiesvirus glycoprotein was used as a reporter extrinsic antigen. The protective efficacy of the vectors expressing the rabies glycoprotein gene was evaluated in the standard NIH mouse potency test for rabies (Seligmann, 1973). Table 24 demonstrates that the PD.sub.50 values obtained with the highly attenuated NYVAC vector are identical to those obtained using a COPENHAGEN-based recombinant containing the rabies glycoprotein gene in the tk locus (Kieny et al., 1984) and similar to PD.sub.50 values obtained with ALVAC-RG, a canarypox based vector restricted to replication to avian species.
Observations.
NYVAC, deleted of known virulence genes and having restricted in vitro growth characteristics, was analyzed in animal model systems to assess its attenuation characteristics. These studies were performed in comparison with the neurovirulent vaccinia virus laboratory strain, WR, two vaccinia virus vaccine strains, WYETH (New York City Board of Health) and COPENHAGEN (VC-2), as well as with a canarypox virus strain, ALVAC (See also Example 23). Together, these viruses provided a spectrum of relative pathogenic potentials in the mouse challenge model and the rabbit skin model, with WR being the most virulent strain, WYETH and COPENHAGEN (VC-2) providing previously utilized attenuated vaccine strains with documented characteristics, and ALVAC providing an example of a poxvirus whose replication is restricted to avian species. Results from these in vivo analyses clearly demonstrate the highly attenuated properties of NYVAC relative to the vaccinia virus strains, WR, WYETH and COPENHAGEN (VC-2) (Tables 18-24). Significantly, the LD.sub.50 values for NYVAC were comparable to those observed with the avian host restricted avipoxvirus, ALVAC. Deaths due to NYVAC, as well as ALVAC, were observed only when extremely high doses of virus were administered via the intracranial route (Example 23, Tables 18, 19, 23). It has not yet been established whether these deaths were due to nonspecific consequences of inoculation of a high protein mass. Results from analyses in immunocompromised mouse models (nude and CY-treated) also demonstrate the relatively high attenuation characteristics of NYVAC, as compared to WR, WYETH and COPENHAGEN strains (Tables 21 and 22). Significantly, no evidence of disseminated vaccinia infection or vaccinial disease was observed in NYVAC-inoculated animals or ALVAC-inoculated animals over the observation period. The deletion of multiple virulence-associated genes in NYVAC shows a synergistic effect with respect to pathogenicity. Another measure of the innocuity of NYVAC was provided by the intradermal administration on rabbit skin (Tables 21 and 22). Considering the results with ALVAC, a virus unable to replicate in nonavian species, the ability to replicate at the site of inoculation is not the sole correlate with reactivity, since intradermal inoculation of ALVAC caused areas of induration in a dose dependent manner. Therefore, it is likely that factors other than the replicative capacity of the virus contribute to the formation of the lesions. Deletion of genes in NYVAC prevents lesion occurrence.
Together, the results in this Example and in foregoing Examples, including Example 23, demonstrate the highly attenuated nature of NYVAC relative to WR, and the previously utilized vaccinia virus vaccine strains, WYETH and COPENHAGEN. In fact, the pathogenic profile of NYVAC, in the animal model systems tested, was similar to that of ALVAC, a poxvirus known to productively replicate only in avian species. The apparently restricted capacity of NYVAC to productively replicate on cells derived from humans (Table 20) and other species, including the mouse, swine, dog and horse, provides a considerable barrier that limits or prevents potential transmission to unvaccinated contacts or to the general environment in addition to providing a vector with reduced probability of dissemination within the vaccinated individual.
Significantly, NYVAC-based vaccine candidates have been shown to be efficacious. NYVAC recombinants expressing foreign gene products from a number of pathogens have elicited immunological responses towards the foreign gene products in several animal species, including primates. In particular, a NYVAC-based recombinant expressing the rabies glycoprotein was able to protect mice against a lethal rabies challenge. The potency of the NYVAC-based rabies glycoprotein recombinant was comparable to the PD.sub.50 value for a COPENHAGEN-based recombinant containing the rabies glycoprotein in the tk locus (Table 24). NYVAC-based recombinants have also been shown to elicit measles virus neutralizing antibodies in rabbits and protection against pseudorabies virus and Japanese encephalitis virus challenge in swine. The highly attenuated NYVAC strain confers safety advantages with human and veterinary applications (Tartaglia et al., 1990). Furthermore, the use of NYVAC as a general laboratory expression vector system may greatly reduce the biological hazards associated with using vaccinia virus.
By the following criteria, the results of this Example and the Examples herein, including Example 23, show NYVAC to be highly attenuated: a) no detectable induration or ulceration at site of inoculation (rabbit skin); b) rapid clearance of infectious virus from intradermal site of inoculation (rabbit skin); c) absence of testicular inflammation (nude mice); d) greatly reduced virulence (intracranial challenge, both three-week old and newborn mice); e) greatly reduced pathogenicity and failure to disseminate in immunodeficient subjects (nude and cyclophosphamide treated mice); and f) dramatically reduced ability to replicate on a variety of human tissue culture cells. Yet, in spite of being highly attenuated, NYVAC, as a vector, retains the ability to induce strong immune responses to extrinsic antigens.
TABLE 20______________________________________Replication of COPENHAGEN (VC-2), NYVAC and ALVACin avian or human derived cell lines Hours post- Yield.sup.a %Cells infection VC-2 NYVAC ALVAC Yield______________________________________CEF 0 3.8.sup.b 3.7 4.5 24 8.3 7.8 6.6 48 8.6 7.9 7.7 72 8.3 7.7 7.5 25 72A.sup.c <1.4 1.8 3.1MRC-5 0 3.8 3.8 4.7 72 7.2 4.6 3.8 0.25 72A 2.2 2.2 3.7WISH* 0 3.4 3.4 4.3 72 7.6 2.2 3.1 0.000 4 72A --.sup.d 1.9 2.9DETROIT 0 3.8 3.7 4.4 72 7.2 5.4 3.4 1.6 72A 1.7 1.7 2.9HEL 0 3.8 3.5 4.3 72 7.5 4.6 3.3 0.125 72A 2.5 2.1 3.6JT-1 0 3.1 3.1 4.1 72 6.5 3.1 4.2 0.039 72A 2.4 2.1 4.4HNK 0 3.8 3.7 4.7 72 7.6 4.5 3.6 0.079 72A 3.1 2.7 3.7______________________________________ .sup.a Yield of NYVAC at 72 hours postinfection expressed as a percentage of yield of VAC2 after 72 hours on the same cell line. .sup.b Titer expressed as LOG.sub.50 pfu per ml. .sup.c Sample was incubated in the presence of 40 .mu.g/ml of cytosine arabinoside. .sup.d Not determined. *ATCC #CCL25 Human amnionic cells.
TABLE 21______________________________________Induration and ulceration at the site ofintradermal inoculation of the rabbit skinVIRUS INDURATION ULCERATIONSTRAIN DOSE.sup.a Size.sup.b Days.sup.c Size Days______________________________________WR 10.sup.4 386 30 88 30 10.sup.5 622 35 149 32 10.sup.6 1057 34 271 34 10.sup.7 877 35 204 35 10.sup.8 581 25 88 26WYETH 10.sup.4 32 5 --.sup.d -- 10.sup.5 116 15 -- -- 10.sup.6 267 17 3 15 10.sup.7 202 17 3 24 10.sup.8 240 29 12 31VC-2 10.sup.4 64 7 -- -- 10.sup.5 86 8 -- -- 10.sup.6 136 17 -- -- 10.sup.7 167 21 6 10 10.sup.8 155 32 6 8NYVAC 10.sup.4 -- -- -- -- 10.sup.5 -- -- -- -- 10.sup.6 -- -- -- -- 10.sup.7 -- -- -- -- 10.sup.8 -- -- -- --______________________________________ .sup.a pfu of indicated vaccinia virus in 0.1 ml PBS inoculated intradermally into one sight. .sup.b mean maximum size of lesions (mm.sup.2) .sup.c mean time after inoculation for complete healing of lesion. .sup.d no lesions discernable.
TABLE 22______________________________________Persistence of poxviruses at the site ofintradermal inoculation Total VirusVirus Inoculum Dose Recovered______________________________________WR 8.0.sup.a 6.14 7.0 6.26 6.0 6.21WYETH 8.0 3.66 7.0 4.10 6.0 3.59VC-2 8.0 4.47 7.0 4.74 6.0 3.97NYVAC 8.0 0 7.0 0 6.0 0______________________________________ .sup.a expressed as log.sub.10 pfu.
TABLE 23______________________________________Virulence studies in immunocompromised mice LD.sub.50 .sup.aPoxvirus CyclophosphamideStrain Nude mice treated mice______________________________________WR 422 42VC-2 >10.sup.9 <1.65 .times. 10.sup.5WYETW 1.58 .times. 10.sup.7 1.83 .times. 10.sup.6NYVAC >5.50 .times. 10.sup.8 7.23 .times. 10.sup.8ALVAC >10.sup.9 .gtoreq.5.00 .times. 10.sup.8b______________________________________ .sup.a Calculated 50% lethal dose (pfu) for nude or cyclophosphamide treated mice by the indicated vaccinia viruses and for ALVAC by intraperitoneal route. .sup.b 5 out of 10 mice died at the highest dose of 5 .times. 10.sup.8 pfu.
TABLE 24______________________________________Comparative efficacy of NYVAC-RG and ALVAC-RG in mice Recombinant PD.sub.50 .sup.a______________________________________ VV-RG 3.74 ALVAC-RG 3.86 NYVAC-RG 3.70______________________________________ .sup.a Four to six week old mice were inoculated in the footpad with 50-100 .mu.l of a range of dilutions (2.0-8.0 log.sub.10 tissue culture infection dose 50% (TCID.sub.50) of either the VVRG (Kieny et al., 1984), ALVACRG (vCP65) or NYVACRG (vP879). At day 14, mice of each group were challenged by intracranial inoculation of 30 .mu.l of a live CVS strain rabies virus corresponding to 15 lethal dose 50% (LD.sub.50) per mouse. A day 28, surviving mice were counted and a protective do # se 50% (PD.sub.50) was calculated.
Example 25
Construction of Trovac Recombinants Expressing the Hemagglutinin Glycoproteins of Avian Influenza Viruses
This Example describes the development of fowlpox virus recombinants expressing the hemagglutinin genes of three serotypes of avian influenza virus.
Cells and Viruses.
Plasmids containing cDNA clones of the H4, H5 and H7 hemagglutinin genes were obtained from Dr. Robert Webster, St. Jude Children's Research Hospital, Memphis, Tenn. The strain of FPV designated FP-1 has been described previously (Taylor et al., 1988a, b). It is a vaccine strain useful in vaccination of day old chickens. The parental virus strain Duvette was obtained in France as a fowlpox scab from a chicken. The virus was attenuated by approximately 50 serial passages in chicken embryonated eggs followed by 25 passages on chick embryo fibroblast (CEF) cells. This virus was obtained in September 1980 by Rhone Merieux, Lyon, France, and a master viral seed established. The virus was received by Virogenetics in September 1989, where it was subjected to four successive plaque purifications. One plaque isolate was further amplified in primary CEF cells and a stock virus, designated as TROVAC, was established. The stock virus used in the in vitro recombination test to produce TROVAC-AIH5 (vFP89) and TROVAC-AIH4 (vFP92) had been further amplified though 8 passages in primary CEF cells. The stock virus used to produce TROVAC-AIH7 (vFP100) had been further amplified through 12 passages in primary CEF cells.
Construction of Fowlpox Insertion Plasmid at F8 Locus.
Plasmid pRW731.15 contains a 10 kbp PvuII-PvuII fragment cloned from TROVAC genomic DNA. The nucleotide sequence was determined on both strands for a 3659 bp PvuII-EcoRV fragment. This sequence is shown in FIG. 20 (SEQ ID NO:72). The limits of an open reading frame designated in this laboratory as F8 were determined within this sequence. The open reading frame is initiated at position 495 and terminates at position 1887. A deletion was made from position 779 to position 1926, as described below.
Plasmid pRW761 is a sub-clone of pRW731.15 containing a 2430 bp EcoRV-EcoRV fragment. Plasmid pRW761 was completely digested with XbaI and partially digested with SspI. A 3700 bp XbaI-SspI band was isolated and ligated with the annealed double-stranded oligonucleotides JCA017 (SEQ ID NO:60) and JCA018 (SEQ ID NO:61).
JCA017 (SEQ ID NO:60): 5' CTAGACACTTTATGTTTTTTAATATCCGGTCTT AAAAGCTTCCCGGGGATCCTTATACGGGGAATAAT 3'JCA018 (SEQ ID NO:61): 5' ATTATTCCCCGTATAAGGATCCCCCGGGAA GCTTTTAAGACCGGATATTAAAAAACATAAAGTGT 3'
The plasmid resulting from this ligation was designated pJCA002. Plasmid pJCA004 contains a non-pertinent gene linked to the vaccinia virus H6 promoter in plasmid pJCA002. The sequence of the vaccinia virus H6 promoter has been previously described (Taylor et al., 1988a, b; Guo et al. 1989; Perkus et al., 1989). Plasmid pJCA004 was digested with EcoRV and BamHI which deletes the non-pertinent gene and a portion of the 3' end of the H6 promoter. Annealed oligonucleotides RW178 (SEQ ID NO:73) and RW179 (SEQ ID NO:74) were cut with EcoRV and BamHI and inserted between the EcoRV and BamHI sites of JCA004 to form pRW846.
RW178 (SEQ ID NO:73): 5' TCATTATCGCGATATCCGTGTTAACTAGCTA GCTAATTTTTATTTCCCGGGATCCTTATCA 3'RW179 (SEQ ID NO:74): 5' GTATAAGGATCCCGGGAATAAAAATTAGCT AGCTAGTTAACACGGATATCGCGATAATGA 3'
Plasmid pRW846 therefore contains the H6 promoter 5' of EcoRV in the de-ORFed F8 locus. The HincII site 3' of the H6 promoter in pRW846 is followed by translation stop codons, a transcriptional stop sequence recognized by vaccinia virus early promoters (Yuen et al., 1987) and a SmaI site.
Construction of Fowlpox Insertion Plasmid at F7 Locus.
The original F7 non-de-ORFed insertion plasmid, pRW731.13, contained a 5.5 kb FP genomic PvuII fragment in the PvuII site of pUC9. The insertion site was a unique HincII site within these sequences. The nucleotide sequence shown in FIG. 21 (SEQ ID NO:75) was determined for a 2356 bp region encompassing the unique HincII site. Analysis of this sequence revealed that the unique HincII site (FIG. 21, underlined) was situated within an ORF encoding a polypeptide of 90 amino acids. The ORF begins with an ATG at position 1531 and terminates at position 898 (positions marked by arrows in FIG. 21).
The arms for the de-ORFed insertion plasmid were derived by PCR using pRW731.13 as template. A 596 bp arm (designated as HB) corresponding to the region upstream from the ORF was amplified with oligonucleotides F73PH2 (SEQ ID NO:76) (5'-GACAATCTAAGTCCTATATTAGAC-3') and F73PB (SEQ ID NO:77) (5'-GGATTTTTAGGTAGACAC-3'). A 270 bp arm (designated as EH) corresponding to the region downstream from the ORF was amplified using oligonucleotides F75PE (SEQ ID NO:78) (5'-TCATCGTCTTCATCATCG-3') and F73PH1 (SEQ ID NO:79) (5'-GTCTTAAACTTATTGTAAGGGTATACCTG-3').
Fragment EH was digested with EcoRV to generate a 126 bp fragment. The EcoRV site is at the 3'-end and the 5'-end was formed, by PCR, to contain the 3' end of a HincII site. This fragment was inserted into pBS-SK (Stratagene, La Jolla, Calif.) digested with HincII to form plasmid pF7D1. The sequence was confirmed by dideoxynucleotide sequence analysis. The plasmid pF7D1 was linearized with ApaI, blunt-ended using T4 DNA polymerase, and ligated to the 596 bp HB fragment. The resultant plasmid was designated as pF7D2. The entire sequence and orientation were confirmed by nucleotide sequence analysis.
The plasmid pF7D2 was digested with EcoRV and BglII to generate a 600 bp fragment. This fragment was inserted into pBS-SK that was digested with ApaI, blunt-ended with T4 DNA polymerase, and subsequently digested with BamHI. The resultant plasmid was designated as pF7D3. This plasmid contains an HB arm of 404 bp and a EH arm of 126 bp.
The plasmid pF7D3 was linearized with XhoI and blunt-ended with the Klenow fragment of the E. coli DNA polymerase in the presence of 2 mM dNTPs. This linearized plasmid was ligated with annealed oligonucleotides F7MCSB (SEQ ID NO:80) (5'-AACGATTAGTTAGTTACTAAAAGCTTGCTGCAGCCCGGGTTTTTTATTAGTTTAGTTAGTC-3') and F7MCSA (SEQ ID NO:81) (5'-GACTAACTAACTAATAAAAAACCCGGGCTGCAGCAAGCTTTTTGTAACTAACTAATCGTT-3'). This was performed to insert a multiple cloning region containing the restriction sites for HindIII, PstI and SmaI between the EH and HB arms. The resultant plasmid was designated as pF7DO.
Construction of Insertion Plasmid for the H4 Hemagglutinin at the F8 Locus.
A cDNA copy encoding the avian influenza H4 derived from A/Ty/Min/833/80 was obtained from Dr. R. Webster in plasmid pTM4H833. The plasmid was digested with HindIII and NruI and blunt-ended using the Klenow fragment of DNA polymerase in the presence of dNTPs. The blunt-ended 2.5 kbp HindIII-NruI fragment containing the H4 coding region was inserted into the HincII site of pIBI25 (International Biotechnologies, Inc., New Haven, Conn.). The resulting plasmid pRW828 was partially cut with BanII, the linear product isolated and recut with HindIII. Plasmid pRW828 now with a 100 bp HindIII-BanII deletion was used as a vector for the synthetic oligonucleotides RW152 (SEQ ID NO:82) and RW153 (SEQ ID NO:83). These oligonucleotides represent the 3' portion of the H6 promoter from the EcoRV site and align the ATG of the promoter with the ATG of the H4 cDNA.
RW152 (SEQ ID NO:82): 5' GCACGGAACAAAGCTTATCGCGATATCCGTTA AGTTTGTATCGTAATGCTATCAATCACGATTCTGTTCCTGTTCCTGCTCATAGC AGAGGGCTCATCTCAGAAT 3'RW153 (SEQ ID NO:83): 5' ATTCTGAGATGAGCCCTCTGCTATGAGCAGGA ACAGAATCGTGATTGATAGCATTACGATACAAACTTAACGGATATCGC GATAAGCTTTGTTCCGTGC 3'
The oligonucleotides were annealed, cut with BanII and HindIII and inserted into the HindIII-BanII deleted pRW828 vector described above. The resulting plasmid pRW844 was cut with EcoRV and DraI and the 1.7 kbp fragment containing the 3' H6 promoted H4 coding sequence was inserted between the EcoRV and HincII sites of pRW846 (described previously) forming plasmid pRW848. Plasmid pRW848 therefore contains the H4 coding sequence linked to the vaccinia virus H6 promoter in the de-ORFed F8 locus of fowlpox virus.
Construction of Insertion Plasmid for H5 Hemagglutinin at the F8 Locus.
A cDNA clone of avian influenza H5 derived from A/Turkey/Ireland/1378/83 was received in plasmid pTH29 from Dr. R. Webster. Synthetic oligonucleotides RW10 (SEQ ID NO:84) through RW13 (SEQ ID NO:87) were designed to overlap the translation initiation codon of the previously described vaccinia virus H6 promoter with the ATG of the H5 gene. The sequence continues through the 5' SalI site of the H5 gene and begins again at the 3' H5 DraI site containing the H5 stop codon.
RW10 (SEQ ID NO:84): 5' GAAAAATTTAAAGTCGACCTGTTTTGTTGAGT TGTTTGCGTGGTAACCAATGCAAATCTGGTC ACT 3'RW11 (SEQ ID NO:85): 5' TCTAGCAAGACTGACTATTGCAAAAAGAAGCA CTATTTCCTCCATTACGATACAAACTTAACG GAT 3'R12 (SEQ ID NO:86): 5' ATCCGTTAAGTTTGTATCGTAATGGAGGAAA TAGTGCTTCTTTTTGCAATAGTCAGTCTTGCTAGAAGTGACCAGATTT GCATTGGT 3'R13 (SEQ ID NO:87): 5' TACCACGCAAACAACTCAACAAAACAGGTCG ACTTTAAATTTTTCTGCA 3'
The oligonucleotides were annealed at 95.degree. C. for three minutes followed by slow cooling at room temperature. This results in the following double strand structure with the indicated ends. ##STR1##
Cloning of oligonucleotides between the EcoRV and PstI sites of pRW742B resulted in pRW744. Plasmid pRW742B contains the vaccinia virus H6 promoter linked to a non-pertinent gene inserted at the HincII site of pRW731.15 described previously. Digestion with PstI and EcoRV eliminates the non-pertinent gene and the 3'-end of the H6 promoter. Plasmid pRW744 now contains the 3' portion of the H6 promoter overlapping the ATG of avian influenza H5. The plasmid also contains the H5 sequence through the 5' SalI site and the 3' sequence from the H5 stop codon (containing a DraI site). Use of the DraI site removes the H5 3' non-coding end. The oligonucleotides add a transcription termination signal recognized by early vaccinia virus RNA polymerase (Yuen et al., 1987). To complete the H6 promoted H5 construct, the H5 coding region was isolated as a 1.6 kpb SalI-DraI fragment from pTH29. Plasmid pRW744 was partially digested with DraI, the linear fragment isolated, recut with SalI and the plasmid now with eight bases deleted between SalI and DraI was used as a vector for the 1.6 kpb pTH29 SalI and DraI fragment. The resulting plasmid pRW759 was cut with EcoRV and DraI. The 1.7 kbp PRW759 EcoRV-DraI fragment containing the 3' H6 promoter and the H5 gene was inserted between the EcoRV and HincII sites of pRW846 (previously described). The resulting plasmid pRW849 contains the H6 promoted avian influenza virus H5 gene in the de-ORFed F8 locus.
Construction of Insertion Vector for H7 Hemagglutinin at the F7 Locus.
Plasmid pCVH71 containing the H7 hemagglutinin from A/CK/VIC/1/85 was received from Dr. R. Webster. An EcoRI-BamHI fragment containing the H7 gene was blunt-ended with the Klenow fragment of DNA polymerase and inserted into the HincII site of pIBI25 as PRW827. Synthetic oligonucleotides RW165 (SEQ ID NO:88) and RW166 (SEQ ID NO:89) were annealed, cut with HincII and StyI and inserted between the EcoRV and STyI sites of pRW827 to generate pRW845.
RW165 (SEQ ID NO:88): 5' GTACAGGTCGACAAGCTTCCCGGGTATCGCG ATATCCGTTAAGTTTGTATCGTAATGAATACTCAAATTCTAATACTCA CTCTTGTGGCAGCCATTCACACAAATGCAGACAAAATCTGCCTTGGAC ATCAT 3'RW166 (SEQ ID NO:89): 5' ATGATGTCCAAGGCAGATTTTGTCTGCATTTG TGTGAATGGCTGCCACAAGAGTGAGTATTAGAATTTGAGTATTCATTA CGATACAAACTTAACGGATATCGCGATACCCGGGAAGCTTGTCGACCT GTAC 3'
Oligonucleotides RW165 (SEQ ID NO:88) and RW166 (SEQ ID NO:89) link the 3' portion of the H6 promoter to the H7 gene. The 3' non-coding end of the H7 gene was removed by isolating the linear product of an ApaLI digestion of pRW845, recutting it with EcoRI, isolating the largest fragment and annealing with synthetic oligonucleotides RW227 (SEQ ID NO:90) and RW228 (SEQ ID NO:91). The resulting plasmid was pRW854.
RW227 (SEQ ID NO:90): 5' ATAACATGCGGTGCACCATTTGTATAT AAGTTAACGAATTCCAAGTCAAGC 3'RW228 (SEQ ID NO:91): 5' GCTTGACTTGGAATTCGTTAACTTATA TACAAATGGTGCACCGCATGTTAT 3'
The stop codon of H7 in PRW854 is followed by an HpaI site. The intermediate H6 promoted H7 construct in the de-ORFed F7 locus (described below) was generated by moving the pRW854 EcoRV-HpaI fragment into pRW858 which had been cut with EcoRV and blunt-ended at its PstI site. Plasmid pRW858 (described below) contains the H6 promoter in an F7 de-ORFed insertion plasmid.
The plasmid pRW858 was constructed by insertion of an 850 bp SmaI/HpaI fragment, containing the H6 promoter linked to a non-pertinent gene, into the SmaI site of pF7DO described previously. The non-pertinent sequences were excised by digestion of pRW858 with EcoRV (site 24 bp upstream of the 3'-end of the H6 promoter) and PstI. The 3.5 kb resultant fragment was isolated and blunt-ended using the Klenow fragment of the E. coli DNA polymerase in the presence of 2 mM dNTPs. This blunt-ended fragment was ligated to a 1700 bp EcoRV/HpaI fragment derived from pRW854 (described previously). This EcoRV/HpaI fragment contains the entire AIV HA (H7) gene juxtaposed 3' to the 3'-most 24 bp of the VV H6 promoter. The resultant plasmid was designated pRW861.
The 126 bp EH arm (defined previously) was lengthened in pRW861 to increase the recombination frequency with genomic TROVAC DNA. To accomplish this, a 575 bp AccI/SnaBI fragment was derived from pRW 731.13 (defined previously). The fragment was isolated and inserted between the AccI and NaeI sites of pRW861. The resultant plasmid, containing an EH arm of 725 bp and a HB arm of 404 bp flanking the AIV H7 gene, was designated as pRW869. Plasmid pRW869 therefore consists of the H7 coding sequence linked at its 5' end to the vaccinia virus H6 promoter. The left flanking arm consists of 404 bp of TROVAC sequence and the right flanking arm of 725 bp of TROVAC sequence which directs insertion to the de-ORFed F7 locus.
Development of TROVAC-Avian Influenza Virus Recombinants.
Insertion plasmids containing the avian influenza virus HA coding sequences were individually transfected into TROVAC infected primary CEF cells by using the calcium phosphate precipitation method previously described (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were selected on the basis of hybridization to HA specific radiolabelled probes and subjected to sequential rounds of plaque purification until a pure population was achieved. One representative plaque was then amplified to produce a stock virus. Plasmid pRW849 was used in an in vitro recombination test to produce recombinant TROVAC-AIH5 (vFP89) expressing the H5 hemagglutinin. Plasmid pRW848 was used to produce recombinant TROVAC-AIH4 (vFP92) expressing the H4 hemagglutinin. Plasmid pRW869 was used to produce recombinant TROVAC-AIH7 (vFP100) expressing the H7 hemagglutinin.
Immunofluorescence.
In influenza virus infected cells, the HA molecule is synthesized and glycosylated as a precursor molecule at the rough endoplasmic reticulum. During passage to the plasma membrane it undergoes extensive post-translational modification culminating in proteolytic cleavage into the disulphide linked HA.sub.1 and HA.sub.2 subunits and insertion into the host cell membrane where it is subsequently incorporated into mature viral envelopes. To determine whether the HA molecules produced in cells infected with the TROVAC-AIV recombinant viruses were expressed on the cell surface, immunofluorescence studies were performed. Indirect immunofluorescence was performed as described (Taylor et al., 1990). Surface expression of the H5 hemagglutinin in TROVAC-AIH5, H4 hemagglutinin in TROVAC-AIH4 and H7 hemagglutinin in TROVAC-AIH7 was confirmed by indirect immunofluorescence. Expression of the H5 hemagglutinin was detected using a pool of monoclonal antibodies specific for the H5HA. Expression of the H4HA was analyzed using a goat monospecific anti-H4 serum. Expression of the H7HA was analyzed using a H7 specific monoclonal antibody preparation.
Immunoprecipitation. It has been determined that the sequence at and around the cleavage site of the hemagglutinin molecule plays an important role in determining viral virulence since cleavage of the hemagglutinin polypeptide is necessary for virus particles to be infectious. The hemagglutinin proteins of the virulent H5 and H7 viruses possess more than one basic amino acid at the carboxy terminus of HA1. It is thought that this allows cellular proteases which recognize a series of basic amino acids to cleave the hemagglutinin and allow the infectious virus to spread both in vitro and in vivo. The hemagglutinin molecules of H4 avirulent strains are not cleaved in tissue culture unless exogenous trypsin is added.
In order to determine that the hemagglutinin molecules expressed by the TROVAC recombinants were authentically processed, immunoprecipitation experiments were performed as described (Taylor et al., 1990) using the specific reagents described above.
Immunoprecipitation analysis of the H5 hemagglutinin expressed by TROVAC-AIH5 (vFP89) showed that the glycoprotein is evident as the two cleavage products HA.sub.1 and HA.sub.2 with approximate molecular weights of 44 and 23 kDa, respectively. No such proteins were precipitated from uninfected cells or cells infected with parental TROVAC. Similarly immunoprecipitation analysis of the hemagglutinin expressed by TROVAC-AIH7 (vFP100) showed specific precipitation of the HA.sub.2 cleavage product. The HA.sub.1 cleavage product was not recognized. No proteins were specifically precipitated from uninfected CEF cells or TROVAC infected CEF cells. In contrast, immunoprecipitation analysis of the expression product of TROVAC-AIH4 (vFP92) showed expression of only the precursor protein HA.sub.0. This is in agreement with the lack of cleavage of the hemagglutinins of avirulent subtypes in tissue culture. No H4 specific proteins were detected in uninfected CEF cells or cells infected with TROVAC. Generation of recombinant virus by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity are as previously described (Panicali et al., 1982; Perkus et al., 1989).
Example 26
CHV gB, gC and gD Nucleotides in Vector System, Expression Therefrom and Use of Vector System and Expression Product
Expression of the CHV gB glycoprotein is accomplished by putting the CHV gB homolog gene under the control of the vaccinia virus I3L promoter. Expression of the CHV gc glycoprotein is accomplished by putting the CHV gC homolog gene under the control of the vaccinia virus H6 promoter. Expression of the CHV gD glycoprotein is accomplished by putting the CHV gD homolog gene under the control of the entomopox virus 42K gene promoter. The gB and gC coding is in the ATI locus and, the gD coding is in the HA locus.
Generation of Donor Plasmid.
The CHV gB coding sequence is PCR-derived. The CHV gB fragment is fused to a PCR-derived fragment containing the I3L promoter element in a plasmid containing the cassette I3L-CHV gB in the ATI deorfed locus. The CHV gC coding is PCR-derived and is fused in the HA deorfed locus in a plasmid.
A donor plasmid is used to insert the I3L-CHV gB--H6-CHV gC double construction in the NYVAC ATI deorfed locus.
In vitro recombination is performed on Vero cells using the donor plasmid and vP866 (NYVAC) as the rescuing virus. Standard protocols were used to identify and purify the recombinant virus (Piccini et al., 1987). The NYVAC-based recombinant containing the CHV gB and gC genes in the ATI deorfed locus is designated NYVAC-CHVgBgC.
Generation of Donor Plasmid.
The CHV gD coding sequence is fused to the 42K promoter and a resulting plasmid therefrom generated for insertion with the NYVAC HA deorfed locus.
In vitro recombination is performed on Vero cells using the CHV gD-42K donor plasmid and recombinant vaccinia virus NYVAC-CHVgBgC (NYVAC background) as the rescuing virus. This is performed with standard procedures (Piccini et al., 1987). The NYVAC-based recombinant containing the CHV gB and gC genes in the ATI deorfed locus and the CHV gD gene in the HA deorfed locus is designated NYVAC-CHVgBgCgD.
Generation of ALVAC donor plasmid.
A plasmid donor plasmid to insert the I3L-CHV gB--H6-CHV gC--42K-CHV gD triple construction in the ALVAC C3 deorfed locus is constructed from the above plasmids.
In vitro recombination is performed on primary chick embryo fibroblasts using the donor plasmid and CPpp (ALVAC) as the rescuing virus. Standard procedures are followed to identify and purify the generated recombinant (Piccini et al., 1987). The ALVAC-based recombinant contains the CHV gB, gC and gD genes in the C3 deorfed locus and is designated ALVAC-CHVgBgCgD.
Analysis confirms expression of the glycoproteins by the recombinants and, the glycoproteins are substantially within the predicted sequences.
Example 27
Generation of vCP320; an Alvac Recombinant Expressing CHV gB EXPRESSING CHV gB
vCP320, an ALVAC recombinant expressing CHV gB, was generated by the following procedure. A 6 kb XbaI fragment, containing the CHV gB gene, was isolated from genomic CHV DNA and cloned into the XbaI site of pBSK+. The plasmid generated by this manipulation is called pCHV2.
The CHV gB gene was then cloned between canarypox flanking arms. This was accomplished by cloning the 3,700 bp SacI-EcoRV fragment of pCHV2, containing the CHV gB gene, into the 5,800 bp SacI-NaeI fragment of pBHVC16. (pBHVC16 contains a copy of the BHV1 gC gene cloned between C5 flanking arms.) The plasmid generated by this manipulation is called pCHV14.
Extraneous 3'-noncoding sequence was then eliminated. This was accomplished by cloning a 210 bp SmaI-ClaI-digested PCR fragment, containing the 3'-end of the gB gene, into the 5,500 bp partial SmaI-ClaI fragment of pCHV14. (This PCR fragment was generated from the plasmid, pCHV2, with the primers, CHVP39 (SEQ ID NO: 92; 5'-TAAGAATGGTAATTCT-3') and CHVP40 (SEQ ID NO: 93; 5'-TTCCCGGGTTAAACTTTACTTTCATTTTC-3').) The plasmid generated by this manipulation is called pCHV15.
The I3L promoter was then cloned upstream from the gB initiation codon. In addition, 3 T.sub.5 NT early transcription termination signal sequences located in the 5'-end of the gB gene were modified. This was accomplished by cloning a 140 bp ScaI-SalI-digested PCR fragment, containing the I3L promoter and the T.sub.5 NT-modified 5'-end of the gB gene, into the 6,300 bp ScaI-SalI fragment of pCHV15. (This PCR fragment was generated from the plasmid, pCHV2, with the primers,
CHVP42 (SEQ ID NO: 94; 5'-TTGTCGACTGAGATAAAGTGAAAATATATCATTATATTACAAAGTACAATTATTTAG G TTTAATCATGTTTTCATTGTATCTATAT-3')andCHVP78 (SEQ ID NO: 95; 5'-TTAGTACTTTCCGGTGTTGTTGGATCACATATTATTAAAGTATAAATAATAAAGAA- 3').)
The plasmid generated by this manipulation is called pCHV27.
An error in the sequence flanking the ScaI-SalI fragment of pCHV27 was then corrected. This was accomplished by cloning the 180 bp ScaI-SalI fragment of pCHV27, containing the I3L promoter and the T.sub.5 NT-modified 5'-end of the gB gene, into the 6,300 bp ScaI-SalI fragment of pCHV15. The plasmid generated by this manipulation is called pCHV28.
An early transcription termination signal sequence near the 3'-end of the CHV gB gene was then modified. This was accomplished by cloning a 330 bp SpeI-Asp718-digested PCR fragment, containing the T.sub.5 NT-modified region of the CHV gB gene, into the 5,450 bp SpeI-Asp718 fragment of pCHV28. (This PCR fragment was generated from a 150 bp PCR fragment, a 280 bp PCR fragment and the primers, CHVP89 (SEQ ID NO: 96; 5'-TGGAATGAAGTTATGAAACT-3') and CHVP92 (SEQ ID NO: 97; 5'-TGCACTGATCATTTCAATTTC-3'). The 150 bp PCR fragment was generated from the plasmid, pCHV2, with the primers, CHVP89 (SEQ ID NO: 96; 5'-TGGAATGAAGTTATGAAACT-3') and CHVP90 (SEQ IS NO: 98; 5'-TGGAATTTTGAATGAAAACACTAGAACC-3'). The 280 bp PCR fragment was generated from the plasmid, pCHV2, with the primers, CHVP91 (SEQ ID NO: 99; 5'-TTCTAGTGTTTTCATTCAAAATTCCAT-3') and CHVP92 (SEQ ID NO: 97; 5'-TGCACTGATCATTTCAATTTC-3').) The plasmid generated by this manipulation is called pCHV31.
An early transcription termination signal sequence in the middle of the CHV gB gene was then modified. This was accomplished by cloning a 480 bp BamHI-BsaBI-digested PCR fragment, containing the T.sub.5 NT-modified region of the gB gene, into the 5,000 bp BamHI-BsaBI fragment of pCHV31. (This PCR fragment was generated from a 380 bp PCR fragment, a 210 bp PCR fragment and the primers, CHVP87 (SEQ ID NO: 100; 5'-CCTTCAAAGTTTAATACACC-3') and CHVP94 (SEQ ID NO: 101; 5'-TATGGCTTCACGTTTGGCAC-3'). The 380 bp PCR fragment was generated from the plasmid, pCHV2, with the primers, CHVP93 (SEQ ID NO: 102; 5'-CACCGGGGATATAATTCATATGTCCCCTTTCTTTGGATTACGAGATGGT-3') and CHVP94 (SEQ ID NO: 101; 5'-TATGGCTTCACGTTTGGCAC-3'). The 210 bp PCR fragment was generated from the plasmid, pCHV2, with the primers, CHVP87 (SEQ ID NO: 100; 5'-CCTTCAAAGTTTAATACACC-3') and CHVP88 (SEQ ID NO: 103; 5'-CCATCTCGTAATCCAAAGAAAGGGGACATATGAAT-3').) The plasmid generated by this manipulation is called pCHV32.
A portion of the gB gene removed in the previous manipulation was then cloned back into pCHV32. This was accomplished by cloning the 2,000 bp partial BsaBI-PstI fragment of pCHV31, containing the 3'-end of the gB gene removed in the previous manipulation, into the 5,450 bp BsaBI-PstI fragment of pCHV32. The plasmid generated by this manipulation is called pCHV36.
The I3L-promoted gB gene was then cloned between C6 flanking arms. This was accomplished by cloning the 2,750 bp SalI-SmaI fragment of pCHV36, containing the I3L-promoted gB gene, into the 4,350 bp SalI-SmaI fragment of pHIV34. (pHIV34 contains a copy of the H6-promoted HIV2 gp120 (+TM) gene cloned between C6 flanking arms.) The plasmid generated by this manipulation is called pCHV37. The DNA sequence of the I3L-promoted gB gene in pCHV37 (SEQ ID NOS:104, 105, 106) is shown in FIG. 23. The DNA sequence of the ALVAC C6 flanking arms (SEQ ID NOS: 107, 108) is shown in FIG. 24.
pCHV37 was used in in vitro recombination experiments with ALVAC as the rescuing virus to yield vCP320.
Immunoprecipitation analysis was performed to determine whether vCP320 expresses CHV gB. MDCK cell monolayers were either mock infected or infected with the parental virus (ALVAC) (m.o.i.=15 PFU/cell), vCP320 (m.o.i.=15 PFU/cell) or CHV (m.o.i.=10 PFU/cell). Following an hour adsorption period, the inoculum was removed and the cells were overlayed with 2 mls of modified Eagle's medium (minus cysteine) containing 2% dialyzed fetal bovine serum and [.sup.35 S]-cysteine (50 .mu.Ci/ml). The lysates were harvested at 18 hrs post-infection in 1 ml 3.times.buffer A (450 mM NaCl, 3% NP-40, 30 mM Tris (pH=7.4), 3 mM EDTA, 0.03% Na-Azide and 0.6 mg/ml PMSF) and analyzed for CHV gB expression using a 1:100 dilution of a gB-specific monoclonal antibody, 1125B2 (obtained from Dr. Michel Riviere, Rhone Merieux, Lyon, France). Lysates, precleared with normal mouse sera and a goat anti-mouse-protein A-sepharose complex, were incubated overnight at 4.degree. C. with a monoclonal antibody-goat anti-mouse-protein A-sepharose complex and washed 4.times. with 1.times.buffer A and 2.times. with a LiCl.sub.2 /urea buffer. Precipitated proteins were dissociated from the immune complexes by the addition of 2.times.Laemmli's buffer (125 mM Tris (pH=6.8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5 min. Proteins were fractionated on an SDS-polyacrylamide gel, fixed and treated with 1 M Na-salicylate for fluorography. Proteins of the appropriate size were precipitated from CHV-infected cells (lane D) and vCP320-infected cells (lane C), but were not precipitated from mock-infected cells (lane A) or ALVAC-infected cells (lane B) (FIG. 25). These results indicate that vCP320 expresses CHV gB.
Example 28
Generation of vCP322; an Alvac Recombinant Expressing CHV gC EXPRESSING CHV gC
vCP322, an ALVAC recombinant expressing CHV gC, was generated by the following procedure. A 2.2 kb EcoRI fragment, containing the CHV gC gene, was isolated from genomic CHV DNA and cloned into the EcoRI site of pVQH6CP3LSA. (pVQH6CP3LSA contains a copy of the H6 promoter cloned between C3 flanking arms.) This manipulation positions the gC gene downstream from the H6 promoter and between C3 flanking arms. The plasmid generated by this manipulation is called pCHV17.
Extraneous 3'-noncoding sequence was then eliminated and 3 T.sub.5 NT early transcription termination signal sequences located near the 3'-end of the gC gene were modified. This was accomplished by cloning the oligonucleotides,
CHVL66 (SEQ ID NO: 109: 5'-CGATGTTAATAAGTATTACCACAATAATTGGTGGAGCCATTTTCGTTATAGTATTGA TTT TCATAACAGCTTTATGTTTCTATTGTTCAAAAAATAATAAGATCTAACTGCA-3')andCHVL67 (SEQ ID NO: 110; 5'-GTTAGATCTTATTATTTTTTGAACAATAGAAACATAAAGCTGTTATGAAAATCAATA CTA TAACGAAAATGGCTCCACCAATTATTGTGGTAATACTTATTAACAT-3'),
into the 8,400 bp partial ClaI-PstI fragment of pCHV17. The plasmid generated by this manipulation is called pCHV20.
The initiation codon of the gC gene was then aligned with the initiation codon of the H6 promoter. In addition, 2 early transcription termination signal sequences were modified. This was accomplished by cloning a 740 bp NruI-BsrGI-digested PCR fragment, containing the 3'-end of the H6 promoter and the 5'-end of the T.sub.5 NT-modified gC gene, into the 7,900 bp NruI-BsrGI fragment of pCHV20. (This PCR fragment was generated from a 500 bp PCR fragment, a 300 bp PCR fragment and the oligonucleotides, CHVP96 (SEQ ID NO: 111; 5'-CGTAGATTCCAATGGAAAGT-3') and CHVP97 (SEQ ID NO: 112; 5'-TTTTCGCGATATCCGTTAAGT-3'). The 500 bp PCR fragment was generated from the plasmid, pCHV13, with the oligonucleotides, CHVP68 (SEQ ID NO: 113; 5'-TTTTCGCGATATCCGTTAAGTTTGTATCGTAATGAGTTTTAAAAATTTCTATCTAATATA TGTAATTATAATTTTCATAAACTCGATAATAAC-3') and CHVP69 (SEQ ID NO: 114; 5'-TTTGTATACCTAATAAGAAATCATTATAAAAGT-3'). The 300 bp PCR fragment was generated from the plasmid, pCHV13, with the oligonucleotides, CHVP95 (SEQ ID NO: 115; 5'-CTTTTATAATGATTTCTTATTAGGTATACAAAATC-3') and CHVP96 (SEQ ID NO: 111; 5'-CGTAGATTCCAATGGAAAGT-3'). pCHV13 was obtained by cloning the 2.2 kb EcoRI CHV genomic fragment, containing the gC gene, into the EcoRI site of pBSK+.) The plasmid generated by this manipulation is called pCHV38.
The H6-promoted gC gene was then cloned between C6 flanking arms. This was accomplished by cloning the 1,400 bp NruI-PstI fragment of pCHV38, containing the H6-promoted gC gene, and the oligonucleotide, CHVL98 (SEQ ID NO:116; 5'-AATTTGCA-3'), into the 4,500 bp NruI-EcoRI fragment of pHIV34. (pHIV34 contains a copy of the H6-promoted HIV2 gp120 (+TM) gene cloned between C6 flanking arms.) The plasmid generated by this manipulation is called pCHV40. The DNA sequence of the H6-promoted gC gene in pCHV40 (SEQ ID NOS: 117, 118, 119) is shown in FIG. 26. The DNA sequence of the ALVAC C6 flanking arms (SEQ ID NOS: 107, 108) is shown in FIG. 24.
pCHV40 was used in in vitro recombination experiments with ALVAC as the rescuing virus to yield vCP322.
Immunoprecipitation analysis was performed to determine whether vCP322 expresses CHV gC. MDCK cell monolayers were either mock infected or infected with the parental virus (ALVAC) (m.o.i.=15 PFU/cell), vCP322 (m.o.i.=15 PFU/cell) or CHV (m.o.i.=10 PFU/cell). Following an hour adsorption period, the inoculum was removed and the cells were overlayed with 2 mls of modified Eagle's medium (minus cysteine) containing 2% dialyzed fetal bovine serum and [.sup.35 S]-cysteine (50 .mu.Ci/ml). The lysates were harvested at 18 hrs post-infection in 1 ml 3.times.buffer A (450 mM NaCl, 3% NP-40, 30 mM Tris (pH=7.4), 3 mM EDTA, 0.03% Na-Azide and 0.6 mg/ml PMSF) and analyzed for CHV gC expression using a 1:100 dilution of a gC-specific monoclonal antibody, 2011A9 (obtained from Dr. Michel Riviere, Rhone Merieux, Lyon, France). Lysates, precleared with normal mouse sera and a goat anti-mouse-protein A-sepharose complex, were incubated overnight at 4.degree. C. with a monoclonal antibody-goat anti-mouse-protein A-sepharose complex and washed 4.times. with 1.times.buffer A and 2.times. with a LiCl.sub.2 /urea buffer. Precipitated proteins were dissociated from the immune complexes by the addition of 2.times.Laemmli's buffer (125 mM Tris (pH=6.8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5 min. Proteins were fractionated on an SDS-polyacrylamide gel, fixed and treated with 1 M Na-salicylate for fluorography. Proteins of the appropriate size were precipitated from CHV-infected cells (lane D) and vCP322-infected cells (lane C), but were not precipitated from mock-infected cells (lane A) or ALVAC-infected cells (lane B) (FIG. 27). These results indicate that vCP322 expresses CHV gC.
Example 29
Generation of VCP294; An Alvac Recombinant Expressing CHV gD
vCP294, an ALVAC recombinant expressing CHV gD, was generated by the following procedure. A 7 kb PstI fragment, containing the CHV gD gene, was isolated from genomic CHV DNA and cloned into the PstI site of pBSK+. The plasmid generated by this manipulation is called pCHV11.
The CHV gD gene was then cloned between canarypox flanking arms. This was accomplished by cloning the 1,475 bp PstI-SnaBI fragment of pCHV11, containing the CHV gD gene, into the 5,600 bp PstI-SmaI fragment of pHIV34. (pHIV34 contains a copy of the H6-promoted HIV2 gp120 (+TM) gene cloned between C6 flanking arms.) This places the CHV gD gene between C6 flanking arms and downstream from the H6 promoter. The plasmid generated by this manipulation is called pCHV18.
The initiation codon of the H6 promoter was then aligned with the initiation codon of the CHV gD gene. This was accomplished by cloning the oligonucleotides,
CHVL81 (SEQ ID NO: 120; 5'-CGATATCCGTTAAGTTTGTATCGTAATGATTAAACTTCTATTTATCTTATTTTATTT TAA CCCAATAA-3')andCHVL82 (SEQ ID NO: 121; 5'-TTGGGTTAAAATAAAATAAGATAAATAGAAGTTTAATCATTACGATACAAACTTAAC GGA TATCG-3'),
into the 5,600 bp NruI-PflMI fragment of pCHV18. The plasmid generated by this manipulation is called pCHV21.
Three early transcription termination signal sequences at the 3'-end of the CHVgD gene were then modified. This was accomplished by cloning the 1,400 bp BglII-Asp718 fragment of pCHV22, containing the "T.sub.5 NT-modified" 3'-end of the CHV gD gene and C3 flanking arm, into the 3,700 bp BglII-Asp718 fragment of pCHV21. (pCHV22 was generated by cloning a 430 bp BglII-EcoRI-digested PCR fragment, containing the "T.sub.5 NT-modified" 3'-end of the CHV gD gene, into the 3,900 bp BglII-EcoRI fragment of pHIV43 (pHIV43 contains a copy of the H6-promoted HIV1 gp120-murine IL-2 fusion gene cloned between C3 flanking arms). (This PCR fragment was generated from the plasmid, pCHV18, with the oligonucleotides,
CHVP79 (SEQ ID NO: 122; 5'-TTGAATTCCTAAACATTTGTTGTTAATTTTTTATAATTAATTATATATTTTTTGTC TTTTATAAACAAAGAAT-3')andCHVP80 (SEQ ID NO:123; 5'-TTAGATCTGTAGGAGCATCAAAAGTTGACGATGAACTTTTGTATCTAAATAGAGC TGGTCCCCAAACCCTGCTTAAATATTATGTTATTAAAGATTTCTAT-3').))
The plasmid generated by this manipulation is called pCHV24.
The "T.sub.5 NT-modified" central region of the CHV gD gene was then cloned into pCHV24. This was accomplished by cloning a 240 bp BglII-digested PCR fragment, containing the "T.sub.5 NT-modified" central region of the CHV gD gene, into the BglII site of pCHV24. (This PCR fragment was generated from the plasmid, pCHV18, with the oligonucleotides,
CHVP83 (SEQ ID NO: 124; 5'-TTAGATCTAGATTCCTTACACCATTCCATAAAAGTTGGTTCAAATTTATCTTCTTTA GAG AAATAACAAGTTTCTCGTGGTAATTGAACCATAAAATCAGTATAGAAAAC-3')andCHVP84 (SEQ ID NO: 125; 5'-TATTTTGATTGTGATCC-3').)
The plasmid generated by this manipulation is called pCHV25.
The C3 flanking arm was then replaced with the C6 flanking arm. This was accomplished by cloning the 1,160 bp EcoRI-Asp718 fragment of pCHV21, containing the C6 flanking arm, into the 4,100 bp EcoRI-Asp718 fragment of pCHV25. The plasmid generated by this manipulation is called pCHV26. The DNA sequence of the H6-promoted gD gene in pCHV26 (SEQ ID NOS: 107, 108) is shown in FIG. 28. The DNA sequence of the ALVAC C6 flanking arms (SEQ ID NOS: 107, 105) is shown in FIG. 24.
pCHV26 was used in in vitro recombination experiments with ALVAC as the rescuing virus to yield vCP294.
Immunoprecipitation analysis was performed to determine whether vCP294 expresses CHV gD. MDCK cell monolayers were either mock infected or infected with the parental virus (ALVAC) (m.o.i.=15 PFU/cell), vCP294 (m.o.i.=15 PFU/cell) or CHV (m.o.i.=10 PFU/cell). Following an hour adsorption period, the inoculum was removed and the cells were overlayed with 2 mls of modified Eagle's medium (minus cysteine) containing 2% dialyzed fetal bovine serum and [.sup.35 S]-cysteine (50 .mu.Ci/ml). The lysates were harvested at 18 hrs post-infection in 1 ml 3.times.buffer A (450 mM NaCl, 3% NP-40, 30 mM Tris (pH=7.4), 3 mM EDTA, 0.03% Na-Azide and 0.6 mg/ml PMSF) and analyzed for CHV gD expression using a 1:100 dilution of a gD-specific monoclonal antibody, 208D11 (obtained from Dr. Michel Riviere, Rhone Merieux, Lyon, France). Lysates, precleared with normal mouse sera and a goat anti-mouse-protein A-sepharose complex, were incubated overnight at 4.degree. C. with a monoclonal antibody-goat anti-mouse-protein A-sepharose complex and washed 4.times. with 1.times.buffer A and 2.times. with a LiCl.sub.2 /urea buffer. Precipitated proteins were dissociated from the immune complexes by the addition of 2.times.Laemmli's buffer (125 mM Tris (pH=6.8), 4% SDS, 20% glycerol, 10% 2-mercaptoethanol) and boiling for 5 min. Proteins were fractionated on an SDS-polyacrylamide gel, fixed and treated with 1 M Na-salicylate for fluorography. Proteins of similar size were precipitated from CHV-infected cells (lane D) and vCP294-infected cells (lane C), but were not precipitated from mock-infected cells (lane A) or ALVAC-infected cells (lane B) (FIG. 29). These results indicate that vCP294 expresses CHV gD.
Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the appended claims is not to be limited by particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope thereof.
The recombinants can be used to stimulate an antibody or immune response in pups and adult dogs against CHV and, so too can the expression products which can be isolated from cells infected by the recombinants. Further, the recombinants or the expression products therefrom can be used to generate antibodies in an animal administered the recombinants or the expression products therefrom and, the antibodies can be further used as described herein.
REFERENCES
1. Ackermann, M., R. Longnecker, B. Roizman, and L. Pereira, Virology 150, 207-220 (1986).
2. Allen, G. P. and M. R. Yeargan, J. Virol. 61, 2454-2461 (1987).
3. Allen, G. P. and J. T. Bryans, In: Progress in Veterinary Microbiology and Immunology, Vol. 2, ed. R. Pandey (Basel), pp. 78-144 (1986).
4. Allen, G. P., and L. D. Coogle, J. Virol. 62, 2850-2858 (1988).
5. Altenburger, W., C- P. Suter and J. Altenburger, Archives Virol. 105, 15-27 (1989).
6. Appel, M., In Virus Infections of Vertebrates, vol. 1, pp. 5-15. Edited by M. Appel. Amsterdam-Oxford-New York-Tokyo: Elsevier Science Publishers (1987).
7. Audonnet, J. -C., Winslow, J., Allen, G. & Paoletti, E., Journal of General Virology 71, 2969-2978 (1990).
8. Avery, R. J., and J. Niven., Infect. and Immun. 26, 795-801 (1979).
9. Babiuk, L. A., J. L'Italien, S. van Drunen Littel-van den Hurk, T. Zamb, M. J. P. Lawman, G. Hughes, and G. A. Gifford, J. Virol. 159, 57-66 (1987).
10. Baer, R., A. T. Bankier, M. D. Biggin, P. L. Deininger, P. J. Farrell, T. J. Gibson, G. Hatfull, G. S. Hudson, S. C. Satchwell, C. Seguin, P. S. Tuffnell, and B. G. Barrell, Nature 310, 207-211 (1984).
11. Baines, J., and B. Roizman, J. Virol. 67, 1441-1452 (1993).
12. Balachandran, N., S. Bacchetti, and W. E. Rawls, Infect. Immun. 37, 1132-1137 (1982).
13. Bause, E., Biochemical Journal 209, 331-336 (1983).
14. Behbehani, A. M., Microbiological Reviews 47, 455-509 (1983).
15. Ben-Porat, T., J. DeMarchi, J. Pendrys, R. A. Veach, and A. S. Kaplan, J. Virol. 57, 191-196 (1986).
16. Ben-Porat, T. and A. S. Kaplan, In: The Herpesviruses, vol. 3, ed. B. Roizman (Plenum Publishing Corp., New York) pp. 105-173 (1985).
17. Ben-Porat, T., F. J. Rixon, and M. L. Blankenship, Virology 95, 285-294 (1979).
18. Bergoin, M., and Dales, S., In Comparative Virology, eds. K. Maramorosch and E. Kurstak, (Academic Press, NY) pp. 169-205 (1971).
19. Berman, P. W., D. Dowbenko, L. A. Lasky, and C. C. Simonsen, Science 222, 524-527 (1983).
20. Bertholet, C., Drillien, R., and Wittek, R., Proc. Natl. Acad. Sci. USA 82, 2096-2100 (1985).
21. Blewett, E. & Misra, V., Journal of General Virology 72, 2083-2090 (1991).
22. Blobel, G., Proceedings of the National Academy of Sciences, U.S.A. 77, 1496-1500 (1980).
23. Boursnell, M. E. G., P. F. Green, J. I. A. Campbell, A. Deuter, R. W. Peters., F. M. Tomley, A. C. R. Samson, P. Chambers, P. T. Emmerson, and M. M. Binns, J. Gen. Virol. 71, 621-628 (1990a).
24. Boursnell, M. E. G., P. F. Green, J. I. A. Campbell, A. Deuter, R. W. Peters, F. M. Tomley, A. C. R. Samson, P. T. Emmerson, and M. M. Binns, Veterinary Microbiology 23, 305-316 (1990b).
25. Boursnell, M. E. G., P. F. Green, A. C. R. Samson, J. I. A. Campbell, A. Deuter, R. W. Peters, N. S. Millar, P. T. Emmerson, and M. M. Binns, Virology 178, 297-300. (1990c).
26. Brockmeier, S., Lager, K., Tartaglia, J., Riviere, M., Paoletti, E. & Mengeling, W., Veterinary Microbiology 38, 41-58 (1993).
27. Buller, R. M. L., G. L. Smith, Cremer, K., Notkins, A. L., and Moss, B., Nature 317, 813-815 (1985).
28. Buller, R. M. L., Chakrabarti, S., Cooper, J. A., Twardzik, D. R., and Moss, B., J.Virol. 62, 866-874 (1988).
29. Bzik, D. J., B. A. Fox, N. A. DeLuca, and S. Person, Virology 133, 301-307 (1984).
30. Cadoz, M., A. Strady, B. Meignier, J. Taylor, J. Tartaglia, E. Paoletti and S. Plotkin, The Lancet, 339, 1429 (1992).
31. Cantin, E. M., R. Eberle, J. L. Baldick, B. Moss, D. E. Willey, A. L. Notkins, and H. Openshaw, Proc. Natl. Acad. Sci. USA 84, 5908-5912 (1987).
32. Carmichael, L., Strandberg, J. & Barnes, F., Proceedings of the Society for Experimental Biology and Medicine, 120, 644-650 (1965).
33. Carmichael, L., Journal of the American Veterinary Medical Association 156, 1714-1721 (1970).
34. Chambers, P., N. S. Millar, and P. T. Emmerson, J. Gen. Virol. 67, 2685-2694 (1986).
35. Chan, W., Immunol. 49, 343-352 (1983).
36. Child, S. J., Palumbo, G. J., Buller, R. M. L., and Hruby, D. E. Virology 174, 625-629 (1990).
37. Clewell, D. B., J. Bacteriol. 110, 667-676 (1972).
38. Clewell, D. B. and D. R. Helinski, Proc. Natl. Acad. Sci. USA 62, 1159-1166 (1969).
39. Colinas, R. J., R. C. Condit and E. Paoletti, Virus Research 18, 49-70 (1990).
40. Compton, T., In: Cell Biology of Virus Entry, Replication, and Pathogenesis, eds. Compans, R. W., A. Helenius, and M. B. A. Oldstone (Alan R. Liss, Inc.) pp. 45-56 (1989).
41. Cooney E. L., Corrier A. C., Greenberg P. D., et al., Lancet 337, 567-572 (1991).
42. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C. & Chambon, P., Science 209, 1406-1414 (1980).
43. Cranage, M. P., T. Kouzarides, A. T. Bankier, S. Satchwell, K. Weston, P. Tomlinson, B. Barrell, H. Hart, S. E. Bell, A. C. Minson, and G. L. Smith, EMBO J. 5, 3057-3063 (1986).
44. Cremer, K. J., M. Mackett, C. Wohlenberg, A. L. Notkins, and B. Moss, Science 228, 737-740 (1985).
45. Davis, W. B., J. A. Taylor, and J. E. Oakes, J. Infect. Dis. 140, 534-540 (1979).
46. Davison, A. J., and J. E. Scott, J. gen. Virol. 67, 1759-1816 (1986).
47. Drillien, R., F. Koehren and A. Kirn, Virology 111, 488-499 (1981).
48. Eberle, R., and R. J. Courtney, J. Virol. 35, 902-917 (1980).
49. Edbauer, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, J. F. Bouquet, P. Desmettre, and E. Paoletti, Virology 179, 901-904 (1990).
50. Engelke, D. R., Hoener, P. A., and Collins, F. S., Proc. Natl. Acad. Sci. USA 85, 544-548 (1988).
51. Espion, D., S. de Henau, C. Letellier, C. -D. Wemers, R. Brasseur, J. F. Young, M. Gross, M. Rosenberg, G. Meulemans and A. Burny, Arch. Virol. 95, 79-95 (1987).
52. Etinger H. M., Altenburger W., Vaccine 9, 470-472 (1991).
53. Fargeaud, D., C. Benoit Jeannin, F. Kato, and G. Chappuis, Arch. Virol. 80, 69-82 (1984).
54. Fenner, F., Virology 5, 502-529 (1958).
55. Fitzpatrick, D. R., Babiuk, L. A. & Zamb, T. J., Virology 173, 46-57 (1989).
56. Flexner, C., Hugen, A., and Moss, B., Nature 330, 259-262 (1987).
57. Flowers, C., Eastman, E. & O'Callaghan, D., Virology 180, 175-184 (1991).
58. Frame, M. C., H. S. Marsden, and D. J. McGeoch, J. gen. Virol. 67, 745-751 (1986).
59. Fries et al., 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, Calif. (October 1992).
60. Frink, R. J., M. R. Eisenberg, G. Cohen, and E. K. Wagner, J. Virol. 45, 634-647 (1983).
61. Funahashi, S., T. Sato and H. Shida, J. Gen. Virol. 69, 35-47 (1988).
62. Garten, W., Kohama, T., and H- D. Klenk. J. Gen. Virol. 51, 207-211 (1980).
63. Ghendon, Y. Z., and Chernos, V. I., Acta Virol. 8, 359-368 (1964).
64. Gillard, S., Spehner, D., Drillien, R., and Kirn, A., Proc. Natl. Acad. Sci. USA 83, 5573-5577 (1986).
65. Glorioso, J., C. H. Schroder, G. Kumel, M. Szczesiul, and M. Levine, J. Virol. 50, 805-812 (1984).
66. Glorioso, J., U. Kees, G. Kumel, H. Kirchner, and P. Krammer, J. Immunol. 135, 575-582 (1985).
67. Goebel, S. J., Johnson, G. P., Perkus, M. E., Davis, S. W., Winslow, J. P., Paoletti, E., Virology 179, 247-266 (1990a).
68. Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow and E. Paoletti, Virology 179, 517-563 (1990b).
69. Goldstein, D. J. and S. K. Weller, Virology 166, 41-51 (1988).
70. Gretch, D. R., B. Kari, L. Rasmussen, R. C. Gehrz, and M. F. Stinski, J. Virol. 62, 875-881 (1988).
71. Guo, P., Goebel, S., Davis, S., Perkus, M. E., Languet, B., Desmettre, P., Allen, G., and Paoletti, E., J. Virol. 63, 4189-4198 (1989).
72. Guo et al., J. Virol. 64, 2399-2406 (1990).
73. Hampl, H., T. Ben-Porat, L. Ehrlicher, K -O. Habermehl, and A. S. Kaplan, J. Virol. 52, 583-590 (1984).
74. Homma, M., and M. Ohuchi, J. Virol. 12, 1457-1465 (1973).
75. Honess, R. W., Journal of General Virology 65, 2077-2107 (1984).
76. Honess, R. W., Bodemer, W., Cameron, K. R., Niller, H.- H. & Fleckenstein, B., Proceedings of the National Academy of Sciences, U.S.A. 83, 3604-3608 (1986).
77. Hruby, D. E., R. A. Maki, D. B. Miller and L. A. Ball, Proc. Natl. Acad. Sci. USA 80, 3411-3415 (1983).
78. Hutchinson, L., Browne, H., Wargents, V., Doris-Poynter, N., Primorac, S., Goldsmith, K., Minson, A., and D. C. Johnson. J. Virol. 66, 2240-2250 (1992).
79. Hutchinson, L., Goldsmith, K., Snoddy, A., Ghash, H., Graham, F. and D. Johnson. J. Virol. 66, 5603-5609 (1992b).
80. Hruby, D. E. and L. A. Ball, J. Virol. 43, 403-409 (1982).
81. Ichihashi, Y. and Dales, S., Virology 46, 533-543 (1971).
82. Ihara, T., Kato, A., Ueda, S., Ishihama, A. & Hirai, K., Virus Genes 3, 127-140 (1989).
83. Ishii, H., Y. Kobayashi, M. Kuroki and Y. Kodama, J. gen. Virol. 69, 1411-1414 (1988).
84. Jacobson, J. G., D. A. Leib, D. J. Goldstein, C. L. Bogard, P. A. Schaffer, S. K. Weller and D. M. Coen, Virology 173, 276-283 (1989).
85. Jamieson, A. T., G. A. Gentry and J. H. Subak-Sharpe, J. Gen. Virol. 24, 465-480 (1974).
86. Kato, A., Sato, I., Ihara, T., Ueda, S., Ishihama, A. & Hirai, K., Gene 84, 399-405 (1989).
87. Kato, S., M. Takahashi, S. Kameyama and J. Kamahora, Biken's 2, 353-363 (1959).
88. Keller, P. M., A. J. Davison, R. S. Lowe, C. D. Bennett, and R. W. Ellis, Virology 152, 181-191 (1986).
89. Kieff, E., and D. Liebowitz, In: Virology, Second Edition, eds. Fields, B. N. et al. (Raven Press, Ltd., New York) pp. 1889-1920 (1990).
90. Kieny, M. P., Lathe, R., Drillien, R., Spehner, D., Skory, S., Schmitt, D., Wiktor, T., Koprowski, H., and Lecocq, J. P., Nature (London) 312, 163-166 (1984).
91. Klein, P., Kanehisa, M. & DeLisi, C., Biochimica Biophysica Acta 815, 468-476 (1985).
92. Konishi et al., Virology 190, 454-458 (1992).
93. Kopp, A. & Mettenleiter, T., Journal of Virology 66, 2754-2762 (1992).
94. Kost, T. A., E. V. Jones, K. M. Smith, A. P Reed, A. L. Brown, and T. J. Miller, Virology 171, 365-376 (1989).
95. Kotwal, G. J., A. W. Hugin and B. Moss, Virology 171, 579-587 (1989a).
96. Kotwal, G. J. and B. Moss, J. Virol. 63, 600-606 (1989b).
97. Kotwal, G. J., S. N. Isaacs, R. McKenzie, M. M. Frank and B. Moss, Science 250, 827-830 (1990).
98. Kotwal, G. J. and Moss, B., Nature (Lond.) 335, 176-178 (1988).
99. Kouzarides, T., Bankier, A. T., Satchwell, S. C., Weston, K., Tomlinson, P. & Barrell, B. G., Virology 157, 397-413 (1987).
100. Kozak, M., Cell 44, 283-292 (1986).
101. Kuhn, J., Eing, B., Brossmer, R., Munk, K. & Braun, R., Journal of General Virology 69, 2847-2858 (1988).
102. Lai, A. C. -K. and B. G. -T. Pogo, Virus Res. 12, 239-250 (1989).
103. Lasky, L. A., D. Dowbenko, C. C. Simonsen, and P. W. Berman, Bio-Technology 2, 527-532 (1984).
104. Lawrence, W. C., R. C. D'Urso, C. A. Kundel, J. C. Whitbeck and L. J. Bello, J. Virol. 60, 405-414 (1986).
105. Le, L., R. Brasseur, C. Wemers, G. Meulemans, and A. Burny, Virus Genes 1, 333-350 (1988).
106. Long, D., Cohen, G., Muggeridge, M. & Eisenberg, R., Journal of Virology 64, 5542-5552 (1990).
107. Long, D., Wilcox, W., Abrams, W., Cohen, G. & Eisenberg, R., Journal of Virology 66, 6668-6685 (1992).
108. Longnecker, R., S. Chatterjee, R. Whitley, and B. Roizman, Proc. Natl. Acad. Sci. USA 84, 4303-4307 (1987).
109. Maeda, K., Horimoto, T., Norimine, J., Kawaguchi, Y., Tomonaga, K., Niikura, M., Kai, C., Takahashi, E. & Mikami, T., Archives of Virology 127, 387-397.
110. Mandecki, W., Proc. Natl. Acad. Sci. USA 83, 7177-7182 (1986).
111. Maniatis, T., E. F. Fritsch, and J. Sambrook, Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory, New York) (1982).
112. Marchioli, C. C., R. J. Yancey, Jr., R. C. Wardley, D. R. Thomsen and L. E. Post, Am. J. Vet. Res. 48, 1577-1583 (1987).
113. Marchioli, C., R. J. Yancey, Jr., J. G. Timmins, L. E. Post, B. R. Young, and D. A. Povendo, Am. J. Vet. Res. 49, 860-864 (1988).
114. Marchioli, C. C., R. J. Yancey, Jr., E. A. Petrovskis, J. G. Timmins, and L. E. Post, J. Virol. 61, 3977-3982 (1987).
115. Matthews, R. E. F., Intervirology 17, 42-44 (1982).
116. McGeoch, D. J., M. A. Dalrymple, A. J. Davison, A. Dolan, M. C. Frame, D. McNab, L. J. Perry, J. E. Scott, and P. Taylor, J. gen. Virol. 69, 1531-1574 (1988).
117. McGinnes, L. W., and T. G. Morrison, Virus Research 5, 343-356 (1986).
118. McLaughlin-Taylor, E., D. E. Willey, E. M. Cantin, R. Eberle, B. Moss, and H. Openshaw, J. gen. Virol. 69, 1731-1734 (1988).
119. Meas, R. K., S. L. Fritsch, L. L. Herr, and P. A. Rota, J. Virol. 51, 259-262 (1984).
120. Merz, D. C., A. Scheid, and P. Choppin, J. Exper. Med. 151, 275-288 (1980).
121. Misra, V., R. M. Blumenthal and L. A. Babiuk, J. Virol. 40, 367-378 (1981).
122. Morgan, A. J., M. Mackett, S. Finerty, J. R. Arrand, F. T. Scullion and M. A. Epstein, J. Med. Virol. 25, 189-195 (1988).
123. Moss, B., E. Winters and J. A. Cooper, J. Virol. 40, 387-395 (1981).
124. Nagai, Y., H. D. Klenk, and R. Rott, Virology 72, 494-508 (1976).
125. Nagai, Y., T. Yoshida, M. Hamaguchi, H. Naruse, M. Iinuma, K. Maeno, and T. Matsumoto, Microbiol. Immunol. 24, 173-177 (1980).
126. Nazerian, K., Lee, L., Yanagida, N. & Ogawa, R., Journal of Virology 66, 1409-1413 (1992).
127. Nicolson, L. & Onions, D. E., Virology 179, 378-387 (1990).
128. Norrby, E., and Y. Gollmar, Infect. and Immun. 11, 231-239 (1975).
129. Oakes, J. E., and H. Rosemond-Hornbeak, Infect. Immun. 21, 489-495 (1978).
130. Ogawa, R., N. Yanagida, S. Saeki, S. Saito, S. Ohkawa, H. Gotoh, K. Kodama, K. Kamogawa, K. Sawaguchi and Y. Iritani, Vaccine 8, 486-490 (1990).
131. Paez, E., S. Dallo and M. Esteban, Proc. Natl. Acad. Sci. USA 82, 3365-3369 (1985).
132. Palumbo, G. J., Pickup, D. J., Fredrickson, T. N., Mcintyre, L. J., and Buller, R. M. L., Virology 172, 262-273 (1989).
133. Panicali, D., S. W. Davis, S. R. Mercer, and E. Paoletti, J. Virol. 37, 1000-1010 (1981).
134. Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci. USA 79, 4927-4931 (1982).
135. Panicali, D., Davis, S. W., Mercer, S. R., and Paoletti, E., J. Virol. 37, 1000-1010 (1981).
136. Paoletti, E., B. R. Lipinskas, C. Samsonoff, S. Mercer, and D. Panicali, Proc. Natl. Acad. Sci. USA 81, 193-197 (1984).
137. Papp-Vid, G., and J. B. Derbyshire, Can. J. Comp. Med. 43, 231-233 (1979).
138. Patel, D. D. and Pickup, D. J., EMBO 6, 3787-3794 (1987).
139. Patel, D. D., Ray, C. A., Drucker, R. P., and Pickup, D. J., Proc. Natl. Acad. Sci. USA 85, 9431-9435 (1988).
140. Pearson, W. R. & Lipman, D. J., Proceedings of the National Academy of Sciences 85, 2444-2448 (1988).
141. Pellett, P. E., M. D. Biggin, B. L. Barrell, and B. Roizman, J. Virol. 56, 807-813 (1985).
142. Perkus M. E., Piccini A., Lipinskas B. R., et al., Science 229, 981-984 (1985).
143. Perkus, M. E., K. Limbach, and E. Paoletti, J. Virol. 63, 3829-3836 (1989).
144. Perkus, M. E., A. Piccini, B. R. Lipinskas, and E. Paoletti, Science 229, 981-984 (1985).
145. Perkus, M. E., Goebel, S. J., Davis, S. W., Johnson, G. P., Limbach, K., Norton, E. K., and Paoletti, E., Virology 179, 276-286 (1990).
146. Perkus, M. E., D. Panicali, S. Mercer and E. Paoletti, Virology 152, 285-297 (1986).
147. Perkus, M. E., Limbach, K., and Paoletti, E., J. Virol. 63, 3829-3836 (1989).
148. Perkus, M. E., S. J. Goebel, S. W. Davis, G. P. Johnson, E. K. Norton and E. Paoletti, Virology 180, 406-410 (1991).
149. Petrovskis, E. A., J. G. Timmins, M. A. Armentrout, C. C. Marchioli, R. J. Yancey, Jr., and L. E. Post, J. Virol. 59, 216-223 (1986).
150. Petrovskis, E. A., J. G. Timmins, and L. E. Post, J. Virol. 60, 185-193 (1986).
151. Piccini, A., M. E. Perkus, and E. Paoletti, Methods in Enzymology 153, 545-563 (1987).
152. Piccini, A., M. E. Perkus, and E. Paoletti, In: Methods in Enzymology, Vol. 153, eds. Wu, R., and L. Grossman (Academic Press) pp. 545-563 (1987).
153. Pickup, D. J., B. S. Ink, W. Hu, C. A. Ray and W. K. Joklik, Proc. Natl. Acad. Sci. USA 83, 7698-7702 (1986).
154. Pickup, D. J., B. S. Ink, B. L. Parsons, W. Hu and W. K. Joklik, Proc. Natl. Acad. Sci. USA 81, 6817-6821 (1984).
155. Pizer, L., Cohen, G. & Eisenberg, R., Journal of Virology 34, 142-153 (1980).
156. Plummer, G., Goodheart, C., Henson, D. & Bowling, C., Virology 39, 134-137 (1969).
157. Proudfoot, N. J. & Brownlee, G. G., Nature 163, 211-214 (1976).
158. Reed, L. J. and Muench, H., Am. J. Hyg. 27, 493-497 (1938).
159. Richman, D. D., A. Buckmaster, S. Bell, C. Hodgman and A. C. Minson, J. Virol. 57, 647-655 (1986).
160. Riggio, M. P., A. A. Cullinane, and D. E. Onions, J. Virol. 63, 1123-1133 (1989).
161. Riviere, M., Tartaglia, J., Perkus, M. E., Norton, E. K., Bongermino, C. M., Lacoste, F., Duret, C., Desmettre, P. & Paoletti, E., Journal of Virology 66, 3424-3434 (1992).
162. Robbins, A. K., R. J. Watson, M. E. Whealy, W. W. Hays, and L. W. Enquist, J. Virol. 58, 339-347 (1986).
163. Robbins, A. K., D. J. Dorney, M. W. Wathen, M. E. Whealey, C. Gold, R. J. Watson, L. E. Holland, S. D. Weed, M. Levine, J. C. Glorioso, and L. W. Enquist, J. Virol. 61, 2691-2701 (1987).
164. Roizman, B. and A. E. Sears, In: Virology, eds. Fields, B. N. and D. M. Knipe (Raven Press, Ltd., New York) pp. 1795-1841 (1990).
165. Roizman, B., In The Herpesviruses, vol. 1, pp. 1-23, Ed. B. Roizman, New York & London: Plenum Press (1982).
166. Rooney, J. F., C. Wohlenberg, K. J. Cremer, B. Moss, and A. L. Notkins, J. Virol. 62, 1530-1534 (1988).
167. Rosenthal, K. L., J. R. Smiley, S. South, and D. C. Johnson, J. Virol. 61, 2438-2447 (1987).
168. Ross, L., Sanderson, M., Scott, S., Binns, M., Doel, T. & Milne, B., Journal of General Virology 70, 1789-1804 (1989).
169. Rota, P. A., R. K. Maes, and W. T. Ruyechan, Virology 154, 168-179 (1986).
170. Rubenstein, A. S. and A. S. Kaplan, Virology 66, 385-392 (1975).
171. Sanger, F., S. Nicklen, and A. Coulson, Proc. Natl. Acad. Sci. USA 74, 5463-5467 (1977).
172. Schmidtt, J. F. C. and H. G. Stunnenberg, J. Virol. 62, 1889-1897 (1988).
173. Seligmann, E. B., In Laboratory Techniques in Rabies, eds. M. M. Kaplan and H. Koprowski, (World Health Organization, Geneva) pp. 279-285 (1973).
174. Shapira, S. K., Chou, J., Richaud, F. V. and Casadaban, M. J., Gene 25, 71-82 (1983).
175. Shida, H., Virology 150, 451-462 (1986).
176. Shida, H., T. Tochikura, T. Sato, T. Konno, K. Hirayoshi, M. Seki, Y. Ito, M. Hatanaka, Y. Hinuma, M. Sugimoto, F. Takahashi-Nishimaki, T. Maruyama, K. Miki, K. Suzuki, M. Morita, H. Sashiyama and M. Hayami, EMBO 6, 3379-3384 (1987).
177. Shida, H., Hinuma, Y., Hatanaka, M., Morita, M., Kidokoro, M., Suzuki, K., Maruyzam, T., Takahashi-Nishimaki, F., Sugimoto, M., Kitamura, R., Miyazawa, T., and Hayami, M., J. Virol. 62, 4474-4480 (1988).
178. Shimizu, M., K. Satou, and N. Nishioka, Arch. Virol. 104, 169-174 (1989).
179. Sinclair, R., R. F. Cook, and J. A. Mumford, J. gen. Virol. 70, 455-459 (1989).
180. Slabaugh, M., N. Roseman, R. Davis and C. Mathews, J. Virol. 62, 519-527 (1988).
181. Smith, J. S., P. A. Yager and G. M. Baer, In Laboratory Techniques in Rabies, eds. M. M. Kaplan and H. Koprowski (WHO Geneva) pp. 354-357 (1973).
182. Sodora, D., Cohen, G., Muggeridge, M. & Eisenberg, R., Journal of Virology 65, 4424-4431 (1991).
183. Spaete, R., Saxena, A., Scott, P., Long, G., Probert, W., Britt, W., Gibson W., Rasmussen, L. & Pachl, C., Journal of Virology 64, 2922-2931 (1990).
184. Spear, P. G., In: The Basis for Serodiagnosis and Vaccines, Immunochemistry of Viruses, Vol. 2, eds. M. H. V. Van Regenmortel and A. R. Neurath (New York), pp. 425-443 (1985a).
185. Spear, P. G., In: The Herpesvirus, Vol. 3, ed. B. Roizman (New York), pp. 315-356 (1985b).
186. Stanberry, L. R., S. Kit and M. G. Myers, J. Virol. 55, 322-328 (1985).
187. Stevely, W. S., J. Virol. 22, 232-234 (1977).
188. Stokes, A., G. P. Allen, L. A. Pullen, and P. K. Murray, J. gen. Virol. 70, 1173-1183 (1989).
189. Sullivan, V. and G. L. Smith, J. gen. Virol. 68, 2587-2598 (1987).
190. Sullivan, V. and G. L. Smith, J. gen. Virol. 69, 859-867 (1988).
191. Swain, M. A., R. W. Peet, and D. A. Galloway, J. Virol, 53, 561-569 (1985).
192. Tabor, S., and C. C. Richardson, Proc. Natl. Acad. Sci. USA 84, 4767-4771 (1987).
193. Tartaglia, J. & E. Paoletti, In Immunochemistry of Viruses, II. The Basis for Serodiagnosis and Vaccines. M. H. V. van Regenmortel & A. R. Neurath, Eds. 125-151. Elsevier Science Publishers, Amsterdam (1990).
194. Tartaglia, J., J. Taylor, W. I. Cox, J. -C. Audonnet, M. E. Perkus, A. Radaelli, C. de Giuli Morghen, B. Meignier, M. Riviere, K. Weinhold & E. Paoletti, In AIDS Research Reviews, W. Koff, F. Wong-Staal & R. C. Kenedy, Eds., Vol. 3, Marcel Dekker, NY (In press) (1993a).
195. Tartaglia, J., Perkus, M. E., Taylor, J., Norton, E. K., Audonnet, J. -C., Cox, W. I., Davis, S. W., Van Der Hoeven, J., Meignier, B., Riviere, M., Languet, B., Paoletti, E., Virology 188, 217-232 (1992).
196. Tartaglia, J., Jarrett, O., Desmettre, P., Paoletti, E. (1993b) J. Virol., in press.
197. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F. Guillemin, P. Desmettre and E. Paoletti, Vaccine 9, 190-193 (1991b).
198. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F. Guillemin, P. Desmettre & E. Paoletti, Vaccine 9, 190 (1991).
199. Taylor, J., Weinberg, R., Kawaoka, Y., Webster, R. G., and Paoletti, E., Vaccine 6, 504-508 (1988a).
200. Taylor, J., R. Weinberg, B. Lanquet, P. Desmettre, and E. Paoletti, Vaccine 6, 497-503 (1988b).
201. Taylor, J., R. Weinberg, J. Tartaglia, C. Richardson, G. Alkhatib, D. Briedis, M. Appel, E. Norton & E. Paoletti, Virology 187, 321-328 (1992).
202. Taylor, G., E. J. Stott, G. Wertz and A. Ball, J. Gen. Virol. 72, 125-130 (1991a).
203. Taylor, J., Edbauer, C., Rey-Senelonge, A., Bouquet, J. -F., Norton, E., Goebel, S., Desmettre, P., Paoletti, E., J. Virol. 64, 1441-1450 (1990).
204. Telford, E. A., Watson, M. S., McBride, K. & Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189, 304-316.
205. Tikoo, S. K., Fitzpatrick, D. R., Babiuk, L. A. & Zamb, T. J., Journal of Virology 64, 5132-5142 (1990).
206. Toyoda, T., T. Sakaguchi, K. Imai, N. M. Inocencio, B. Gotoh, M. Hamaguchi, and Y. Nagai, Virology 158, 242-247 (1987).
207. Wachsman, M., L. Aurelian, J. C. R. Hunter, M. E. Perkus, and E. Paoletti, Bioscience Reports 8, 323-334 (1988).
208. Wachsman, M., J. H. Luo, L. Aurelian, M. E. Perkus, and E. Paoletti, J. gen. Virol. 70, 2513-2520 (1989).
209. Wachsman, M., L. Aurelian, C. C. Smith, B. R. Lipinskas, M. E. Perkus, and E. Paoletti, J. Infect. Dis. 155, 1188-1197 (1987).
210. Wathen, M. W. and L. M. K. Wathen, J. Virol. 58, 173-178 (1986).
211. Wathen, M. W. and L. M. K. Wathen, J. Virol. 51, 57-62 (1984).
212. Wathen, L. M. K., K. B. Platt, M. W. Wathen, R. A. Van Deusen, C. A. Whetstone, and E. C. Pirtle, Virus Res. 4, 19-29 (1985).
213. Weir, J. P., M. Bennett, E. M. Allen, K. L. Elkins, S. Martin, and B. T. Rouse, J. gen. Virol. 70, 2587-2594 (1989).
214. Weir, J. P. and B. Moss, J. Virol. 46, 530-537 (1983).
215. Whalley, J. M., G. R. Robertson, N. A. Scott, G. C. Hudson, C. W. Bell, and L. M. Woodworth, J. gen. Virol. 70, 383-394 (1989).
216. Whealy, M. E., A. K. Robbins and L. W. Enquist, J. Virol. 63, 4055-4059 (1989).
217. Whitbeck, J. C., L. Z. Bello, and W. C. Lawrence, J. Virol. 62, 3319-3327 (1988).
218. Wilcox, W. C., Long, D., Sodora, D. L., Eisenberg, R. J. & Cohen, G. H., Journal of Virology 62, 1941-1947 (1988).
219. Wittmann, G. and H. -J. Rziha, In: Herpesvirus Diseases of Cattle, Horses and Pigs, ed. G. Wittmann (Kluwer Academic Publishers) pp. 230-325 (1989).
220. Xuan, X., Horimoto, T., Limcumpao, J. A., Takumi, A., Tohya, Y., Takahashi, E. & Mikami, T., Archives of Virology 116, 185-195 (1991).
221. Zamb, T., Abstract No. 330, 68th Annual Meeting of Conference of Research Workers in Animal Disease, Nov. 16, and 17, 1987, Chicago, Ill., USA (1987).
222. Zarling, J. M., P. A. Moran, R. L. Burke, C. Pachl, P. W. Berman, and L. A. Lasky, J. Immunol. 136, 4669-4673 (1986a).
223. Zarling, J. M., P. A. Moran, L. A. Lasky, and B. Moss, J. Virol. 59, 506-509 (1986b).
224. Zezulak, K. M., and P. G. Spear, J. Virol. 49, 741-747 (1984).
225. Zhou, J., L. Crawford, L. McLean, X. Sun, M. Stanley, N. Almond and G. L. Smith, J. Gen. Virol. 71, 2185-2190 (1990).
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 128- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3000 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:- TTTTCTGGAT TTCAGCTATG TCCTTCGGGA GTTTATATAA CTTATGAAGA AA - #ACTGTCCT 60- TTGGTAGCAG TTTTACAAAG CGGTGTAAAT TGCGAAATTG GACCAACTAC AA - #CTGTAATA 120- TACGACAGTG ATATTTTTTC TCTTCTTTAT ACCGTTCTTC AAAAATTGGC TC - #CTGGTGTT 180- AATATAGAAA TTTGATAAGT ATGTTTTCAT TGTATCTATA TATTTTTTTT AT - #TATTTATA 240- CTTTAATAAT ATGTGATCCA ACAACACCGG AAAGTACTAT TAATCCATTA AA - #TCATCACA 300- ATTTATCAAC ACCTAAACCT ACTTCGGATG ATATTCGTGA AATTTTACGT GA - #ATCCCAAA 360- TTGAATCTGA TGATACATCA ACATTTTACA TGTGCCCACC ACCATCGGGA TC - #AACATTGG 420- TGCGTTTGGA GCCACCTAGA GCATGTCCTA ACTATAAACT TGGTAAAAAT TT - #TACAGAAG 480- GAATTGCTGT AATATTTAAG GAAAATATTT CTCCTTATAA ATTTAAAGCT AA - #TATATACT 540- ACAAAAATAT TATTATCACC ACTGTATGGT CTGGAAGCAC ATATGCAGTA AT - #TACTAATA 600- GATATACAGA TCGTGTACCT ATAGGTGTTC CTGAAATTAC AGAGTTGATT GA - #TAGAAGAG 660- GTATGTGTTT ATCAAAAGCT GATTATATTC GTAATAATTA TGAATTTACC GC - #ATTTGATA 720- AGGATGAAGA CCCCAGAGAA GTTCATTTAA AGCCTTCAAA GTTTAATACA CC - #AGGATCCC 780- GTGGATGGCA TACAGTTAAT GATACTTACA CAAAAATTGG GGGTTCTGGA TT - #TTATCATT 840- CTGGAACATC TGTAAATTGT ATAGTTGAAG AAGTTGATGC CAGATCTGTT TA - #TCCATATG 900- ATTCATTTGC TATCTCCACC GGGGATATAA TTCATATGTC CCCTTTTTTT GG - #ATTACGAG 960- ATGGTGCTCA TACTGAATAT ATTAGTTATT CAACTGATAG ATTTCAACAA AT - #AGAAGGTT1020- ATTATCCTAT CGACTTAGAT ACTAGACTAC AGCTTGGTGC ACCAGTTTCT AG - #GAATTTTT1080- TAACAACACA ACACGTTACT GTTGCTTGGA ATTGGGTTCC AAAAATTCGT GA - #AGTGTGTA1140- CTTTGGCTAA ATGGCGTGAA ATTGATGAAA TTATTCGTGA TGAGTATAAG GG - #ATCTTACA1200- GATTTACAGC AAAATCAATA TCTGCAACAT TTATTTCTGA TACTACTCAA TT - #TGATATTG1260- ATCGTGTAAA GTTAAGTGAT TGTGCCAAAC GTGAAGCCAT AGAAGCTATT GA - #TAAGATCT1320- ACAAAAAAAA ATATAATAAA ACTCATATTC AAACAGGAGA ATTGGAAACA TA - #CTTGGCTA1380- GAGGGGGATT TATTATAGCA TTTAGACCAA TGATTAGTAA TGAGTTAGCA AA - #ATTGTATA1440- TAAATGAGTT AGTAAGATCT AATCGTACGG TTGATTTGAA ATCTCTTTTA AA - #TCCATCTG1500- TAAGAGGGGG GGCTAGAAAG AGAAGATCAG TAGAGGAAAA TAAAAGATCA AA - #ACGTAATA1560- TTGAAGGTGG TATTGAAAAT GTAAATAATT CAACAATAAT TAAGACAACT TC - #ATCTGTTC1620- ATTTTGCTAT GCTTCAGTTT GCCTATGATC ATATTCAATC ACATGTTAAT GA - #AATGCTTA1680- GTAGAATTGC AACTGCATGG TGTAATCTTC AAAATAAAGA GAGAACCCTT TG - #GAATGAAG1740- TTATGAAACT TAATCCAACT AGTGTGGCTT CGGTTGCTAT GGATCAAAGA GT - #TTCAGCAC1800- GAATGTTAGG GGATGTTCTT GCAGTTACTC AATGTGTTAA TATATCAGGT TC - #TAGTGTTT1860- TTATTCAAAA TTCCATGCGT GTTTTAGGGT CAACAACTAC ATGTTACAGT CG - #TCCTCTTA1920- TATCATTTAA AGCACTAGAA AACTCAACTA ACTATATTGA AGGACAACTT GG - #GGAAAATA1980- ATGAACTATT AGTAGAACGA AAGCTAATTG AACCATGTAC AGCTAACCAT AA - #AAGATATT2040- TTAAATTTGG TGCAGATTAT GTATATTTTG AAAACTATGC ATATGTTCGA AA - #GGTACCTC2100- TTAATGAAAT TGAAATGATC AGTGCATATG TAGATCTTAA TATTACATTA CT - #TGAGGATC2160- GTGAATTTTT ACCACTAGAG GTATATACTC GAGCAGAGTT AGAAGATACA GG - #ACTATTGG2220- ACTATAGTGA GATTCAACGT AGAAATCAAC TACATGCACT TAAGTTTTAT GA - #TATTGACA2280- GTGTTGTAAA AGTTGATAAT AATGTTGTAA TTATGAGGGG CATTGCAAAT TT - #TTTCCAAG2340- GACTTGGAGA TGTTGGAGCG GGATTTGGAA AAGTTGTTTT GGGTGCTGCA AA - #TGCTGTTA2400- TTGCAACTGT TTCTGGAGTG TCCTCGTTTC TTAATAACCC ATTTGGGGCG CT - #AGCCGTTG2460- GATTGCTGAT TTTAGCTGGA CTATTTGCAG CGTTTTTGGC TTATAGATAT GT - #TTCTAAAC2520- TTAAGTCAAA TCCAATGAAA GCACTATACC CAGTAACTAC AAAAAATTTA AA - #AGAAAGTG2580- TTAAGAATGG TAATTCTGGA AATAATAGTG ATGGAGAAGA AAATGATGAT AA - #TATCGATG2640- AAGAAAAGCT TCAACAAGCT AAAGAAATGA TTAAATATAT GTCTCTAGTT TC - #TGCTATGG2700- AACAGCAGGA ACATAAAGCT ATTAAAAAAA ATAGTGGCCC TGCCCTTCTA GC - #AAGTCACA2760- TTACAAACCT ATCTCTTAAA CATCGTGGTC CAAAATACAA ACGTTTGAAA AA - #TGTAAATG2820- AAAATGAAAG TAAAGTTTAA TAAAAAATTT AAATATTACG TAAAATTTTC TG - #ACTCTGCC2880- CACTTTTTTT ATAATATAAA TTTTAGAAAA TTTTACTCAT TTTATTATCT TT - #TATAAACC2940- TCCAACTATT TATAAAGGAT AATAAATGGA CATTTCTGCG GTGCCTGTAT AT - #CCTACTAA3000- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 879 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:- Met Phe Ser Leu Tyr Leu Tyr Ile Phe Phe Il - #e Ile Tyr Thr Leu Ile# 15- Ile Cys Asp Pro Thr Thr Pro Glu Ser Thr Il - #e Asn Pro Leu Asn His# 30- His Asn Leu Ser Thr Pro Lys Pro Thr Ser As - #p Asp Ile Arg Glu Ile# 45- Leu Arg Glu Ser Gln Ile Glu Ser Asp Asp Th - #r Ser Thr Phe Tyr Met# 60- Cys Pro Pro Pro Ser Gly Ser Thr Leu Val Ar - #g Leu Glu Pro Pro Arg#80- Ala Cys Pro Asn Tyr Lys Leu Gly Lys Asn Ph - #e Thr Glu Gly Ile Ala# 95- Val Ile Phe Lys Glu Asn Ile Ser Pro Tyr Ly - #s Phe Lys Ala Asn Ile# 110- Tyr Tyr Lys Asn Ile Ile Ile Thr Thr Val Tr - #p Ser Gly Ser Thr Tyr# 125- Ala Val Ile Thr Asn Arg Tyr Thr Asp Arg Va - #l Pro Ile Gly Val Pro# 140- Glu Ile Thr Glu Leu Ile Asp Arg Arg Gly Me - #t Cys Leu Ser Lys Ala145 1 - #50 1 - #55 1 -#60- Asp Tyr Ile Arg Asn Asn Tyr Glu Phe Thr Al - #a Phe Asp Lys Asp Glu# 175- Asp Pro Arg Glu Val His Leu Lys Pro Ser Ly - #s Phe Asn Thr Pro Gly# 190- Ser Arg Gly Trp His Thr Val Asn Asp Thr Ty - #r Thr Lys Ile Gly Gly# 205- Ser Gly Phe Tyr His Ser Gly Thr Ser Val As - #n Cys Ile Val Glu Glu# 220- Val Asp Ala Arg Ser Val Tyr Pro Tyr Asp Se - #r Phe Ala Ile Ser Thr225 2 - #30 2 - #35 2 -#40- Gly Asp Ile Ile His Met Ser Pro Phe Phe Gl - #y Leu Arg Asp Gly Ala# 255- His Thr Glu Tyr Ile Ser Tyr Ser Thr Asp Ar - #g Phe Gln Gln Ile Glu# 270- Gly Tyr Tyr Pro Ile Asp Leu Asp Thr Arg Le - #u Gln Leu Gly Ala Pro# 285- Val Ser Arg Asn Phe Leu Thr Thr Gln His Va - #l Thr Val Ala Trp Asn# 300- Trp Val Pro Lys Ile Arg Glu Val Cys Thr Le - #u Ala Lys Trp Arg Glu305 3 - #10 3 - #15 3 -#20- Ile Asp Glu Ile Ile Arg Asp Glu Tyr Lys Gl - #y Ser Tyr Arg Phe Thr# 335- Ala Lys Ser Ile Ser Ala Thr Phe Ile Ser As - #p Thr Thr Gln Phe Asp# 350- Ile Asp Arg Val Lys Leu Ser Asp Cys Ala Ly - #s Arg Glu Ala Ile Glu# 365- Ala Ile Asp Lys Ile Tyr Lys Lys Lys Tyr As - #n Lys Thr His Ile Gln# 380- Thr Gly Glu Leu Glu Thr Tyr Leu Ala Arg Gl - #y Gly Phe Ile Ile Ala385 3 - #90 3 - #95 4 -#00- Phe Arg Pro Met Ile Ser Asn Glu Leu Ala Ly - #s Leu Tyr Ile Asn Glu# 415- Leu Val Arg Ser Asn Arg Thr Val Asp Leu Ly - #s Ser Leu Leu Asn Pro# 430- Ser Val Arg Gly Gly Ala Arg Lys Arg Arg Se - #r Val Glu Glu Asn Lys# 445- Arg Ser Lys Arg Asn Ile Glu Gly Gly Ile Gl - #u Asn Val Asn Asn Ser# 460- Thr Ile Ile Lys Thr Thr Ser Ser Val His Ph - #e Ala Met Leu Gln Phe465 4 - #70 4 - #75 4 -#80- Ala Tyr Asp His Ile Gln Ser His Val Asn Gl - #u Met Leu Ser Arg Ile# 495- Ala Thr Ala Trp Cys Asn Leu Gln Asn Lys Gl - #u Arg Thr Leu Trp Asn# 510- Glu Val Met Lys Leu Asn Pro Thr Ser Val Al - #a Ser Val Ala Met Asp# 525- Gln Arg Val Ser Ala Arg Met Leu Gly Asp Va - #l Leu Ala Val Thr Gln# 540- Cys Val Asn Ile Ser Gly Ser Ser Val Phe Il - #e Gln Asn Ser Met Arg545 5 - #50 5 - #55 5 -#60- Val Leu Gly Ser Thr Thr Thr Cys Tyr Ser Ar - #g Pro Leu Ile Ser Phe# 575- Lys Ala Leu Glu Asn Ser Thr Asn Tyr Ile Gl - #u Gly Gln Leu Gly Glu# 590- Asn Asn Glu Leu Leu Val Glu Arg Lys Leu Il - #e Glu Pro Cys Thr Ala# 605- Asn His Lys Arg Tyr Phe Lys Phe Gly Ala As - #p Tyr Val Tyr Phe Glu# 620- Asn Tyr Ala Tyr Val Arg Lys Val Pro Leu As - #n Glu Ile Glu Met Ile625 6 - #30 6 - #35 6 -#40- Ser Ala Tyr Val Asp Leu Asn Ile Thr Leu Le - #u Glu Asp Arg Glu Phe# 655- Leu Pro Leu Glu Val Tyr Thr Arg Ala Glu Le - #u Glu Asp Thr Gly Leu# 670- Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gl - #n Leu His Ala Leu Lys# 685- Phe Tyr Asp Ile Asp Ser Val Val Lys Val As - #p Asn Asn Val Val Ile# 700- Met Arg Gly Ile Ala Asn Phe Phe Gln Gly Le - #u Gly Asp Val Gly Ala705 7 - #10 7 - #15 7 -#20- Gly Phe Gly Lys Val Val Leu Gly Ala Ala As - #n Ala Val Ile Ala Thr# 735- Val Ser Gly Val Ser Ser Phe Leu Asn Asn Pr - #o Phe Gly Ala Leu Ala# 750- Val Gly Leu Leu Ile Leu Ala Gly Leu Phe Al - #a Ala Phe Leu Ala Tyr# 765- Arg Tyr Val Ser Lys Leu Lys Ser Asn Pro Me - #t Lys Ala Leu Tyr Pro# 780- Val Thr Thr Lys Asn Leu Lys Glu Ser Val Ly - #s Asn Gly Asn Ser Gly785 7 - #90 7 - #95 8 -#00- Asn Asn Ser Asp Gly Glu Glu Asn Asp Asp As - #n Ile Asp Glu Glu Lys# 815- Leu Gln Gln Ala Lys Glu Met Ile Lys Tyr Me - #t Ser Leu Val Ser Ala# 830- Met Glu Gln Gln Glu His Lys Ala Ile Lys Ly - #s Asn Ser Gly Pro Ala# 845- Leu Leu Ala Ser His Ile Thr Asn Leu Ser Le - #u Lys His Arg Gly Pro# 860- Lys Tyr Lys Arg Leu Lys Asn Val Asn Glu As - #n Glu Ser Lys Val865 8 - #70 8 - #75- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 879 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:- Met Phe Ser Leu Tyr Leu Tyr Ile Phe Phe Il - #e Ile Tyr Thr Leu Ile# 15- Ile Cys Asp Pro Thr Thr Pro Glu Ser Thr Il - #e Asn Pro Leu Asn His# 30- His Asn Leu Ser Thr Pro Lys Pro Thr Ser As - #p Asp Ile Arg Glu Ile# 45- Leu Arg Glu Ser Gln Ile Glu Ser Asp Asp Th - #r Ser Thr Phe Tyr Met# 60- Cys Pro Pro Pro Ser Gly Ser Thr Leu Val Ar - #g Leu Glu Pro Pro Arg#80- Ala Cys Pro Asn Tyr Lys Leu Gly Lys Asn Ph - #e Thr Glu Gly Ile Ala# 95- Val Ile Phe Lys Glu Asn Ile Ser Pro Tyr Ly - #s Phe Lys Ala Asn Ile# 110- Tyr Tyr Lys Asn Ile Ile Ile Thr Thr Val Tr - #p Ser Gly Ser Thr Tyr# 125- Ala Val Ile Thr Asn Arg Tyr Thr Asp Arg Va - #l Pro Ile Gly Val Pro# 140- Glu Ile Thr Glu Leu Ile Asp Arg Arg Gly Me - #t Cys Leu Ser Lys Ala145 1 - #50 1 - #55 1 -#60- Asp Tyr Ile Arg Asn Asn Tyr Glu Phe Thr Al - #a Phe Asp Lys Asp Glu# 175- Asp Pro Arg Glu Val His Leu Lys Pro Ser Ly - #s Phe Asn Thr Pro Gly# 190- Ser Arg Gly Trp His Thr Val Asn Asp Thr Ty - #r Thr Lys Ile Gly Gly# 205- Ser Gly Phe Tyr His Ser Gly Thr Ser Val As - #n Cys Ile Val Glu Glu# 220- Val Asp Ala Arg Ser Val Tyr Pro Tyr Asp Se - #r Phe Ala Ile Ser Thr225 2 - #30 2 - #35 2 -#40- Gly Asp Ile Ile His Met Ser Pro Phe Phe Gl - #y Leu Arg Asp Gly Ala# 255- His Thr Glu Tyr Ile Ser Tyr Ser Thr Asp Ar - #g Phe Gln Gln Ile Glu# 270- Gly Tyr Tyr Pro Ile Asp Leu Asp Thr Arg Le - #u Gln Leu Gly Ala Pro# 285- Val Ser Arg Asn Phe Leu Thr Thr Gln His Va - #l Thr Val Ala Trp Asn# 300- Trp Val Pro Lys Ile Arg Glu Val Cys Thr Le - #u Ala Lys Trp Arg Glu305 3 - #10 3 - #15 3 -#20- Ile Asp Glu Ile Ile Arg Asp Glu Tyr Lys Gl - #y Ser Tyr Arg Phe Thr# 335- Ala Lys Ser Ile Ser Ala Thr Phe Ile Ser As - #p Thr Thr Gln Phe Asp# 350- Ile Asp Arg Val Lys Leu Ser Asp Cys Ala Ly - #s Arg Glu Ala Ile Glu# 365- Ala Ile Asp Lys Ile Tyr Lys Lys Lys Tyr As - #n Lys Thr His Ile Gln# 380- Thr Gly Glu Leu Glu Thr Tyr Leu Ala Arg Gl - #y Gly Phe Ile Ile Ala385 3 - #90 3 - #95 4 -#00- Phe Arg Pro Met Ile Ser Asn Glu Leu Ala Ly - #s Leu Tyr Ile Asn Glu# 415- Leu Val Arg Ser Asn Arg Thr Val Asp Leu Ly - #s Ser Leu Leu Asn Pro# 430- Ser Val Arg Gly Gly Ala Arg Lys Arg Arg Se - #r Val Glu Glu Asn Lys# 445- Arg Ser Lys Arg Asn Ile Glu Gly Gly Ile Gl - #u Asn Val Asn Asn Ser# 460- Thr Ile Ile Lys Thr Thr Ser Ser Val His Ph - #e Ala Met Leu Gln Phe465 4 - #70 4 - #75 4 -#80- Ala Tyr Asp His Ile Gln Ser His Val Asn Gl - #u Met Leu Ser Arg Ile# 495- Ala Thr Ala Trp Cys Asn Leu Gln Asn Lys Gl - #u Arg Thr Leu Trp Asn# 510- Glu Val Met Lys Leu Asn Pro Thr Ser Val Al - #a Ser Val Ala Met Asp# 525- Gln Arg Val Ser Ala Arg Met Leu Gly Asp Va - #l Leu Ala Val Thr Gln# 540- Cys Val Asn Ile Ser Gly Ser Ser Val Phe Il - #e Gln Asn Ser Met Arg545 5 - #50 5 - #55 5 -#60- Val Leu Gly Ser Thr Thr Thr Cys Tyr Ser Ar - #g Pro Leu Ile Ser Phe# 575- Lys Ala Leu Glu Asn Ser Thr Asn Tyr Ile Gl - #u Gly Gln Leu Gly Glu# 590- Asn Asn Glu Leu Leu Val Glu Arg Lys Leu Il - #e Glu Pro Cys Thr Ala# 605- Asn His Lys Arg Tyr Phe Lys Phe Gly Ala As - #p Tyr Val Tyr Phe Glu# 620- Asn Tyr Ala Tyr Val Arg Lys Val Pro Leu As - #n Glu Ile Glu Met Ile625 6 - #30 6 - #35 6 -#40- Ser Ala Tyr Val Asp Leu Asn Ile Thr Leu Le - #u Glu Asp Arg Glu Phe# 655- Leu Pro Leu Glu Val Tyr Thr Arg Ala Glu Le - #u Glu Asp Thr Gly Leu# 670- Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gl - #n Leu His Ala Leu Lys# 685- Phe Tyr Asp Ile Asp Ser Val Val Lys Val As - #p Asn Asn Val Val Ile# 700- Met Arg Gly Ile Ala Asn Phe Phe Gln Gly Le - #u Gly Asp Val Gly Ala705 7 - #10 7 - #15 7 -#20- Gly Phe Gly Lys Val Val Leu Gly Ala Ala As - #n Ala Val Ile Ala Thr# 735- Val Ser Gly Val Ser Ser Phe Leu Asn Asn Pr - #o Phe Gly Ala Leu Ala# 750- Val Gly Leu Leu Ile Leu Ala Gly Leu Phe Al - #a Ala Phe Leu Ala Tyr# 765- Arg Tyr Val Ser Lys Leu Lys Ser Asn Pro Me - #t Lys Ala Leu Tyr Pro# 780- Val Thr Thr Lys Asn Leu Lys Glu Ser Val Ly - #s Asn Gly Asn Ser Gly785 7 - #90 7 - #95 8 -#00- Asn Asn Ser Asp Gly Glu Glu Asn Asp Asp As - #n Ile Asp Glu Glu Lys# 815- Leu Gln Gln Ala Lys Glu Met Ile Lys Tyr Me - #t Ser Leu Val Ser Ala# 830- Met Glu Gln Gln Glu His Lys Ala Ile Lys Ly - #s Asn Ser Gly Pro Ala# 845- Leu Leu Ala Ser His Ile Thr Asn Leu Ser Le - #u Lys His Arg Gly Pro# 860- Lys Tyr Lys Arg Leu Lys Asn Val Asn Glu As - #n Glu Ser Lys Val865 8 - #70 8 - #75- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1041 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:- Met Ser Thr Arg Gly Asp Leu Gly Lys Arg Ar - #g Arg Gly Ser Arg Trp# 15- Gln Gly His Ser Gly Tyr Phe Arg Gln Arg Cy - #s Phe Phe Pro Ser Leu# 30- Leu Gly Ile Ala Ala Thr Gly Ser Arg His Gl - #y Asn Gly Ser Ser Gly# 45- Leu Thr Arg Leu Ala Arg Tyr Val Ser Phe Il - #e Trp Ile Val Leu Phe# 60- Leu Val Gly Pro Arg Pro Val Glu Gly Gln Se - #r Gly Ser Thr Ser Glu#80- Gln Pro Arg Arg Thr Val Ala Thr Pro Glu Va - #l Gly Gly Thr Pro Pro# 95- Lys Pro Thr Thr Asp Pro Thr Asp Met Ser As - #p Met Arg Glu Ala Leu# 110- Arg Ala Ser Gln Ile Glu Ala Asn Gly Pro Se - #r Thr Phe Tyr Met Cys# 125- Pro Pro Pro Ser Gly Ser Thr Val Val Arg Le - #u Glu Pro Pro Arg Ala# 140- Cys Pro Asp Tyr Lys Leu Gly Lys Asn Phe Th - #r Glu Gly Ile Ala Val145 1 - #50 1 - #55 1 -#60- Ile Phe Lys Glu Asn Ile Ala Pro Tyr Lys Ph - #e Lys Ala Asn Ile Tyr# 175- Tyr Lys Asn Ile Ile Met Thr Thr Val Trp Se - #r Gly Ser Ser Tyr Ala# 190- Val Thr Thr Asn Arg Tyr Thr Asp Arg Val Pr - #o Val Lys Val Gln Glu# 205- Ile Thr Asp Leu Ile Asp Arg Arg Gly Met Cy - #s Leu Ser Lys Ala Asp# 220- Tyr Val Arg Asn Asn Tyr Gln Phe Thr Ala Ph - #e Asp Arg Asp Glu Asp225 2 - #30 2 - #35 2 -#40- Pro Arg Glu Leu Pro Leu Lys Pro Ser Lys Ph - #e Asn Thr Pro Gln Ser# 255- Arg Gly Trp His Thr Tyr Lys Phe Lys Ala Th - #r Val Tyr Tyr Lys Asp# 270- Val Ile Val Ser Thr Ala Trp Ala Gly Ser Se - #r Tyr Thr Gln Ile Thr# 285- Asn Arg Tyr Ala Asp Arg Val Pro Ile Pro Va - #l Ser Glu Ile Thr Asp# 300- Thr Ile Asp Lys Phe Gly Lys Cys Ser Ser Ly - #s Ala Thr Tyr Val Arg305 3 - #10 3 - #15 3 -#20- Asn Asn His Lys Val Glu Ala Phe Asn Glu As - #p Lys Asn Pro Gln Asp# 335- Met Pro Leu Ile Ala Ser Lys Tyr Asn Ser Va - #l Gly Ser Lys Ala Trp# 350- His Thr Thr Asn Glu Thr Tyr Thr Lys Ile Gl - #y Ala Ala Gly Phe His# 365- His Ser Gly Thr Ser Val Asn Cys Ile Val Gl - #u Glu Val Asp Ala Arg# 380- Ser Val Tyr Pro Tyr Asp Ser Phe Ala Ile Se - #r Thr Gly Asp Val Ile385 3 - #90 3 - #95 4 -#00- His Met Ser Pro Phe Phe Gly Leu Arg Asp Gl - #y Ala His Val Glu His# 415- Thr Ser Tyr Ser Ser Asp Arg Phe Gln Gln Il - #e Glu Gly Tyr Tyr Pro# 430- Ile Asp Leu Asp Thr Arg Leu Gln Leu Gly Al - #a Pro Val Ser Arg Asn# 445- Phe Leu Glu Thr Pro His Val Thr Val Ala Tr - #p Asn Trp Thr Pro Lys# 460- Cys Gly Arg Val Cys Thr Leu Ala Lys Trp Ar - #g Glu Ile Asp Glu Met465 4 - #70 4 - #75 4 -#80- Leu Arg Asp Glu Tyr Gln Gly Ser Tyr Arg Ph - #e Thr Val Lys Thr Ile# 495- Ser Ala Thr Phe Ile Ser Asn Thr Ser Gln Ph - #e Glu Ile Asn Arg Ile# 510- Arg Leu Gly Asp Cys Ala Thr Lys Glu Ala Al - #a Glu Ala Ile Asp Arg# 525- Ile Tyr Lys Ser Lys Tyr Ser Lys Thr His Il - #e Gln Thr Gly Thr Leu# 540- Glu Thr Tyr Leu Ala Arg Gly Gly Phe Leu Il - #e Ala Phe Arg Pro Met545 5 - #50 5 - #55 5 -#60- Ile Ser Asn Glu Leu Ala Lys Leu Tyr Ile As - #n Glu Leu Ala Arg Ser# 575- Asn Arg Thr Val Asp Leu Ser Ala Leu Leu As - #n Pro Ser Gly Glu Thr# 590- Val Gln Arg Thr Arg Gly Ser Val Pro Ser As - #n Gln His His Arg Ser# 605- Arg Arg Ser Thr Ile Glu Gly Gly Ile Glu Th - #r Val Asn Asn Ala Ser# 620- Leu Leu Lys Thr Thr Ser Ser Val Glu Phe Al - #a Met Ile Gln Phe Ala625 6 - #30 6 - #35 6 -#40- Tyr Asp Tyr Ile Gln Ala His Val Asn Glu Me - #t Leu Ser Arg Ile Ala# 655- Thr Ala Trp Cys Thr Leu Gln Asn Arg Glu Hi - #s Val Leu Trp Thr Glu# 670- Thr Leu Lys Leu Asn Pro Gly Gly Val Val Se - #r Met Ala Leu Glu Arg# 685- Arg Val Ser Ala Arg Leu Leu Gly Asp Ala Va - #l Ala Val Thr Gln Cys# 700- Val Asn Ile Ser Ser Gly His Val Tyr Ile Gl - #n Asn Ser Met Arg Val705 7 - #10 7 - #15 7 -#20- Thr Gly Ser Ser Thr Thr Cys Tyr Ser Arg Pr - #o Leu Val Ser Phe Arg# 735- Ala Leu Asn Asp Ser Glu Tyr Ile Glu Gly Gl - #n Leu Gly Glu Asn Asn# 750- Asp Leu Leu Val Glu Arg Lys Leu Ile Glu Pr - #o Cys Thr Val Asn Asn# 765- Lys Arg Tyr Phe Lys Phe Gly Ala Asp Tyr Va - #l Tyr Phe Glu Asp Tyr# 780- Ala Tyr Val Arg Lys Val Pro Leu Ser Glu Il - #e Glu Leu Ile Ser Ala785 7 - #90 7 - #95 8 -#00- Tyr Val Asp Leu Asn Leu Thr Leu Leu Glu As - #p Arg Glu Phe Leu Pro# 815- Leu Glu Val Tyr Thr Arg Ala Glu Leu Glu As - #p Thr Gly Leu Leu Asp# 830- Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu Hi - #s Ala Leu Lys Phe Tyr# 845- Asp Ile Asp Ser Ile Val Arg Val Asp Asn As - #n Leu Val Ile Met Arg# 860- Gly Met Ala Asn Phe Phe Gln Gly Leu Gly As - #p Val Gly Ala Gly Phe865 8 - #70 8 - #75 8 -#80- Gly Lys Val Val Leu Gly Ala Ala Ser Ala Va - #l Ile Ser Thr Val Ser# 895- Gly Val Ser Ser Phe Leu Asn Asn Pro Phe Gl - #y Ala Leu Ala Val Gly# 910- Leu Leu Ile Leu Ala Gly Ile Val Ala Ala Ph - #e Leu Ala Tyr Arg Tyr# 925- Ile Ser Arg Leu Arg Ala Asn Pro Met Lys Al - #a Leu Tyr Pro Val Thr# 940- Thr Arg Asn Leu Lys Gln Thr Ala Lys Ser Pr - #o Ala Ser Thr Ala Gly945 9 - #50 9 - #55 9 -#60- Gly Asp Ser Asp Pro Gly Val Asp Asp Phe As - #p Glu Glu Lys Leu Met# 975- Gln Ala Arg Glu Met Ile Lys Tyr Met Ser Le - #u Val Ser Ala Met Glu# 990- Gln Gln Glu His Lys Ala Met Lys Lys Asn Ly - #s Gly Pro Ala Ile Leu# 10050- Thr Ser His Leu Thr Asn Met Ala Leu Arg Ar - #g Arg Gly Pro Lys Tyr# 10205- Gln Arg Leu Asn Asn Leu Asp Ser Gly Asp As - #p Thr Glu Thr Asn Leu# 10401030 - # 1035- Val- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 980 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- Met Ser Ser Gly Cys Arg Ser Val Gly Gly Se - #r Thr Trp Gly Asn Trp# 15- Arg Gly Asp Gly Gly Asp Leu Arg Gln Arg Ar - #g Val Leu Ser Pro Val# 30- Cys Ser Ala Pro Ala Ala Gly Ser Trp Ile Gl - #y Ser Gln Leu Gly Asn# 45- Val Gly Asn Leu Leu Ala Thr Pro His Pro Le - #u Gly Lys Pro Ala Ser# 60- Ser Arg Val Gly Thr Ile Val Leu Ala Cys Le - #u Leu Leu Phe Gly Ser#80- Cys Val Val Arg Ala Val Pro Thr Thr Pro Se - #r Pro Pro Thr Ser Thr# 95- Pro Thr Ser Met Ser Thr His Ser His Gly Th - #r Val Asp Pro Thr Leu# 110- Leu Pro Thr Glu Thr Pro Asp Pro Leu Arg Le - #u Ala Val Arg Glu Ser# 125- Gly Ile Leu Ala Glu Asp Gly Asp Phe Tyr Th - #r Cys Pro Pro Pro Thr# 140- Gly Ser Thr Val Val Arg Ile Glu Pro Pro Ar - #g Thr Cys Pro Lys Phe145 1 - #50 1 - #55 1 -#60- Asp Leu Gly Arg Asn Phe Thr Glu Gly Ile Al - #a Val Ile Phe Lys Glu# 175- Asn Ile Ala Pro Tyr Lys Phe Arg Ala Asn Va - #l Tyr Tyr Lys Asp Ile# 190- Val Val Thr Arg Val Trp Lys Gly Tyr Ser Hi - #s Thr Ser Leu Ser Asp# 205- Arg Tyr Asn Asp Arg Val Pro Val Ser Val Gl - #u Glu Ile Phe Gly Leu# 220- Ile Asp Ser Lys Gly Lys Cys Ser Ser Lys Al - #a Glu Tyr Leu Arg Asp225 2 - #30 2 - #35 2 -#40- Asn Ile Met His His Ala Tyr His Asp Asp Gl - #u Asp Glu Val Glu Leu# 255- Asp Leu Cys Arg Pro Ser Leu Gln Leu Arg Gl - #y Ala Arg Ala Trp Gln# 270- Thr Thr Asn Asp Thr Thr Ser Tyr Val Gly Tr - #p Met Pro Trp Arg His# 285- Tyr Thr Ser Thr Ser Val Asn Cys Ile Val Gl - #u Glu Val Glu Ala Arg# 300- Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Se - #r Thr Gly Asp Ile Val305 3 - #10 3 - #15 3 -#20- Tyr Ala Ser Pro Phe Tyr Gly Leu Arg Ala Al - #a Ala Arg Ile Glu His# 335- Asn Ser Tyr Ala Gln Glu Arg Phe Arg Gln Va - #l Glu Gly Tyr Arg Pro# 350- Arg Asp Leu Asp Ser Lys Leu Gln Ala Glu Gl - #u Pro Val Thr Lys Asn# 365- Phe Ile Thr Thr Pro His Val Thr Val Ser Tr - #p Asn Trp Thr Glu Lys# 380- Lys Val Glu Ala Cys Thr Leu Thr Lys Trp Ly - #s Glu Val Asp Glu Leu385 3 - #90 3 - #95 4 -#00- Val Arg Asp Glu Phe Arg Gly Ser Tyr Arg Ph - #e Thr Ile Arg Ser Ile# 415- Ser Ser Thr Phe Ile Ser Asn Thr Thr Gln Ph - #e Lys Leu Glu Ser Ala# 430- Pro Leu Thr Glu Cys Val Ser Lys Glu Ala Ly - #s Glu Ala Ile Asp Ser# 445- Ile Tyr Lys Lys Gln Tyr Glu Ser Thr His Va - #l Phe Ser Gly Asp Val# 460- Glu Tyr Tyr Leu Ala Arg Gly Gly Phe Leu Il - #e Ala Phe Arg Pro Met465 4 - #70 4 - #75 4 -#80- Leu Ser Asn Glu Leu Ala Arg Leu Tyr Leu As - #n Glu Leu Val Arg Ser# 495- Asn Arg Thr Tyr Asp Leu Lys Asn Leu Leu As - #n Pro Asn Ala Asn Asn# 510- Asn Asn Asn Thr Thr Arg Arg Arg Arg Ser Le - #u Leu Ser Val Pro Glu# 525- Pro Gln Pro Thr Gln Asp Gly Val His Arg Gl - #u Gln Ile Leu His Arg# 540- Leu His Lys Arg Ala Val Glu Ala Thr Ala Gl - #y Thr Asp Ser Ser Asn545 5 - #50 5 - #55 5 -#60- Val Thr Ala Lys Gln Leu Glu Leu Ile Lys Th - #r Thr Ser Ser Ile Glu# 575- Phe Ala Met Leu Gln Phe Ala Tyr Asp His Il - #e Gln Ser His Val Asn# 590- Glu Met Leu Ser Arg Ile Ala Thr Ala Trp Cy - #s Thr Leu Gln Asn Lys# 605- Glu Arg Thr Leu Trp Asn Glu Met Val Lys Il - #e Asn Pro Ser Ala Ile# 620- Val Ser Ala Thr Leu Asp Glu Arg Val Ala Al - #a Arg Val Leu Gly Asp625 6 - #30 6 - #35 6 -#40- Val Ile Ala Ile Thr His Cys Ala Lys Ile Gl - #u Gly Asn Val Tyr Leu# 655- Gln Asn Ser Met Arg Ser Met Asp Ser Asn Th - #r Cys Tyr Ser Arg Pro# 670- Pro Val Thr Phe Thr Ile Thr Lys Asn Ala As - #n Asn Arg Gly Ser Ile# 685- Glu Gly Gln Leu Gly Glu Glu Asn Glu Ile Ph - #e Thr Glu Arg Lys Leu# 700- Ile Glu Pro Cys Ala Leu Asn Gln Lys Arg Ty - #r Phe Lys Phe Gly Lys705 7 - #10 7 - #15 7 -#20- Glu Tyr Val Tyr Tyr Glu Asn Tyr Thr Phe Va - #l Arg Lys Val Pro Pro# 735- Thr Glu Ile Glu Val Ile Ser Thr Tyr Val Gl - #u Leu Asn Leu Thr Leu# 750- Leu Glu Asp Arg Glu Phe Leu Pro Leu Glu Va - #l Tyr Thr Arg Ala Glu# 765- Leu Glu Asp Thr Gly Leu Leu Asp Tyr Ser Gl - #u Ile Gln Arg Arg Asn# 780- Gln Leu His Ala Leu Arg Phe Tyr Asp Ile As - #p Ser Val Val Asn Val785 7 - #90 7 - #95 8 -#00- Asp Asn Thr Ala Val Ile Met Gln Gly Ile Al - #a Ser Phe Phe Lys Gly# 815- Leu Gly Lys Val Gly Glu Ala Val Gly Thr Le - #u Val Leu Gly Ala Ala# 830- Gly Ala Val Val Ser Thr Val Ser Gly Ile Al - #a Ser Phe Leu Asn Asn# 845- Pro Phe Gly Gly Leu Ala Ile Gly Leu Leu Va - #l Ile Ala Gly Leu Val# 860- Ala Ala Phe Phe Ala Tyr Arg Tyr Val Met Gl - #n Ile Arg Ser Asn Pro865 8 - #70 8 - #75 8 -#80- Met Lys Ala Leu Tyr Pro Ile Thr Thr Lys Al - #a Leu Lys Asn Lys Ala# 895- Lys Thr Ser Tyr Gly Gln Asn Glu Glu Asp As - #p Gly Ser Asp Phe Asp# 910- Glu Ala Lys Leu Glu Glu Ala Arg Glu Met Il - #e Lys Tyr Met Ser Met# 925- Val Ser Ala Leu Glu Lys Gln Glu Lys Lys Al - #a Ile Lys Lys Asn Ser# 940- Gly Val Gly Leu Ile Ala Ser Asn Val Ser Ly - #s Leu Ala Leu Arg Arg945 9 - #50 9 - #55 9 -#60- Arg Gly Pro Lys Tyr Thr Arg Leu Gln Gln As - #n Asp Thr Met Glu Asn# 975- Glu Lys Met Val 980- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 913 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pr - #o Arg Gly His Arg Pro# 15- Gly His His Gly Gly Ala Gly Leu Gly Arg Le - #u Trp Pro Ala Pro His# 30- His Ala Ala Ala Ala Arg Gly Ala Val Ala Le - #u Ala Leu Leu Leu Leu# 45- Ala Leu Ala Ala Ala Pro Pro Cys Gly Ala Al - #a Ala Val Thr Arg Ala# 60- Ala Ser Ala Ser Pro Thr Pro Gly Thr Gly Al - #a Thr Pro Asn Asp Val#80- Ser Ala Glu Ala Ser Leu Glu Glu Ile Glu Al - #a Phe Ser Pro Gly Pro# 95- Ser Glu Ala Pro Asp Gly Glu Tyr Gly Asp Le - #u Asp Ala Arg Thr Ala# 110- Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Ph - #e Tyr Val Cys Pro Pro# 125- Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pr - #o Glu Gln Ala Cys Pro# 140- Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gl - #y Ile Ala Val Leu Phe145 1 - #50 1 - #55 1 -#60- Lys Glu Asn Ile Ala Pro His Lys Phe Lys Al - #a His Ile Tyr Tyr Lys# 175- Asn Val Ile Val Thr Thr Val Trp Ser Gly Se - #r Thr Tyr Ala Ala Ile# 190- Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pr - #o Val Gln Glu Ile Thr# 205- Asp Val Ile Asp Arg Arg Gly Lys Cys Val Se - #r Lys Ala Glu Tyr Val# 220- Arg Asn Asn His Lys Val Thr Ala Phe Asp Ar - #g Asp Glu Asn Pro Val225 2 - #30 2 - #35 2 -#40- Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Al - #a Leu Gly Thr Arg Gly# 255- Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Il - #e Gly Ala Ala Gly Phe# 270- Tyr His Thr Gly Thr Ser Val Asn Cys Ile Va - #l Glu Glu Val Glu Ala# 285- Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Le - #u Ser Thr Gly Asp Ile# 300- Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Gl - #u Gly Ala His Gly Glu305 3 - #10 3 - #15 3 -#20- His Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gl - #n Val Glu His Tyr Tyr# 335- Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Se - #r Glu Ser Val Thr Arg# 350- Asn Phe Leu Arg Thr Pro His Phe Thr Val Al - #a Trp Asp Trp Ala Pro# 365- Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Tr - #p Arg Glu Ala Glu Glu# 380- Met Thr Arg Asp Glu Thr Arg Asp Gly Ser Ph - #e Arg Phe Thr Ser Arg385 3 - #90 3 - #95 4 -#00- Ala Leu Gly Ala Ser Phe Val Ser Asp Val Th - #r Gln Leu Asp Leu Gln# 415- Arg Val His Leu Gly Asp Cys Val Leu Arg Gl - #u Ala Ser Glu Ala Ile# 430- Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Ser Th - #r His Val Leu Ala Gly# 445- Asp Arg Pro Glu Val Tyr Leu Ala Arg Gly Gl - #y Phe Val Val Ala Phe# 460- Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Le - #u Tyr Ala Arg Glu Leu465 4 - #70 4 - #75 4 -#80- Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pr - #o Ala Ala Pro Ala Ala# 495- Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Al - #a Gly Thr Pro Glu Pro# 510- Pro Ala Val Asn Gly Thr Gly His Leu Arg Il - #e Thr Thr Gly Ser Ala# 525- Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp Hi - #s Ile Gln Ala His Val# 540- Asn Asp Met Leu Gly Arg Ile Ala Ala Ala Tr - #p Cys Glu Leu Gln Asn545 5 - #50 5 - #55 5 -#60- Lys Asp Arg Thr Leu Trp Ser Glu Met Ser Ar - #g Leu Asn Pro Ser Ala# 575- Val Ala Thr Ala Ala Leu Gly Gln Arg Val Se - #r Ala Arg Met Leu Gly# 590- Asp Val Met Ala Ile Ser Arg Cys Val Glu Va - #l Arg Gly Gly Val Tyr# 605- Val Gln Asn Ser Met Arg Val Pro Gly Glu Ar - #g Gly Thr Cys Tyr Ser# 620- Arg Pro Leu Val Thr Phe Glu His Asn Gly Th - #r Gly Val Ile Glu Gly625 6 - #30 6 - #35 6 -#40- Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Se - #r Arg Asp Leu Ile Glu# 655- Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Ly - #s Leu Gly Ser Gly Tyr# 670- Val Tyr Tyr Glu Asp Tyr Asn Tyr Val Arg Me - #t Val Glu Val Pro Glu# 685- Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Th - #r Leu Leu Glu Asp Arg# 700- Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Gl - #u Glu Leu Ala Asp Thr705 7 - #10 7 - #15 7 -#20- Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Ar - #g Asn Gln Leu His Ala# 735- Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Ly - #s Val Asp His Asn Val# 750- Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gl - #n Gly Leu Gly Asp Val# 765- Gly Ala Ala Val Gly Lys Val Val Leu Gly Al - #a Thr Gly Ala Val Ile# 780- Ser Ala Val Gly Gly Met Val Ser Phe Leu Se - #r Asn Pro Phe Gly Ala785 7 - #90 7 - #95 8 -#00- Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Le - #u Val Ala Ala Phe Leu# 815- Ala Tyr Arg His Ile Ser Arg Leu Arg Arg As - #n Pro Met Lys Ala Leu# 830- Tyr Pro Val Thr Thr Lys Thr Leu Lys Glu As - #p Gly Val Asp Glu Gly# 845- Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Ar - #g Asp Met Ile Arg Tyr# 860- Met Ser Ile Val Ser Ala Leu Glu Gln Gln Gl - #u His Lys Ala Arg Lys865 8 - #70 8 - #75 8 -#80- Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Ar - #g Val Gly Ala Met Ala# 895- Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Se - #r Glu Asp Pro Asp Ala# 910- Leu- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 868 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Met Phe Val Thr Ala Val Val Ser Val Ser Pr - #o Ser Ser Phe Tyr Glu# 15- Ser Leu Gln Val Glu Pro Thr Gln Ser Glu As - #p Ile Thr Arg Ser Ala# 30- His Leu Gly Asp Gly Asp Glu Ile Arg Glu Al - #a Ile His Lys Ser Gln# 45- Asp Ala Glu Thr Lys Pro Thr Phe Tyr Val Cy - #s Pro Pro Pro Thr Gly# 60- Ser Thr Ile Val Arg Leu Glu Pro Thr Arg Th - #r Cys Pro Asp Tyr His#80- Leu Gly Lys Asn Phe Thr Glu Gly Ile Ala Va - #l Val Tyr Lys Glu Asn# 95- Ile Ala Ala Tyr Lys Phe Lys Ala Thr Val Ty - #r Tyr Lys Asp Val Ile# 110- Val Ser Thr Ala Trp Ala Gly Ser Ser Tyr Th - #r Gln Ile Thr Asn Arg# 125- Tyr Ala Asp Arg Val Pro Ile Pro Val Ser Gl - #u Ile Thr Asp Thr Ile# 140- Asp Lys Phe Gly Lys Cys Ser Ser Lys Ala Th - #r Tyr Val Arg Asn Asn145 1 - #50 1 - #55 1 -#60- His Lys Val Glu Ala Phe Asn Glu Asp Lys As - #n Pro Gln Asp Met Pro# 175- Leu Ile Ala Ser Lys Tyr Asn Ser Val Gly Se - #r Lys Ala Trp His Thr# 190- Thr Asn Asp Thr Tyr Met Val Ala Gly Thr Pr - #o Gly Thr Tyr Arg Thr# 205- Gly Thr Ser Val Asn Cys Ile Ile Glu Glu Va - #l Glu Ala Arg Ser Ile# 220- Phe Pro Tyr Asp Ser Phe Gly Leu Ser Thr Gl - #y Asp Ile Ile Tyr Met225 2 - #30 2 - #35 2 -#40- Ser Pro Phe Phe Gly Leu Arg Asp Gly Ala Ty - #r Arg Glu His Ser Asn# 255- Tyr Ala Met Asp Arg Phe His Gln Phe Glu Gl - #y Tyr Arg Gln Arg Asp# 270- Leu Asp Thr Arg Ala Leu Leu Glu Pro Ala Al - #a Arg Asn Phe Leu Val# 285- Thr Pro His Leu Thr Val Gly Trp Asn Trp Ly - #s Pro Lys Arg Thr Glu# 300- Val Cys Ser Leu Val Lys Trp Arg Glu Val Gl - #u Asp Val Val Arg Asp305 3 - #10 3 - #15 3 -#20- Glu Tyr Ala His Asn Phe Arg Phe Thr Met Ly - #s Thr Leu Ser Thr Thr# 335- Phe Ile Ser Glu Thr Asn Glu Phe Asn Leu As - #n Gln Ile His Leu Ser# 350- Gln Cys Val Lys Glu Glu Ala Arg Ala Ile Il - #e Asn Arg Ile Tyr Thr# 365- Thr Arg Tyr Asn Ser Ser His Val Arg Thr Gl - #y Asp Ile Gln Thr Tyr# 380- Leu Ala Arg Gly Gly Phe Val Val Val Phe Gl - #n Pro Leu Leu Ser Asn385 3 - #90 3 - #95 4 -#00- Ser Leu Ala Arg Leu Tyr Leu Gln Glu Leu Va - #l Arg Glu Asn Thr Asn# 415- His Ser Pro Gln Lys His Pro Thr Arg Asn Th - #r Arg Ser Arg Arg Ser# 430- Val Pro Val Glu Leu Arg Ala Asn Arg Thr Il - #e Thr Thr Thr Ser Ser# 445- Val Glu Phe Ala Met Leu Gln Phe Thr Tyr As - #p His Ile Gln Glu His# 460- Val Asn Glu Met Leu Ala Arg Ile Ser Ser Se - #r Trp Cys Gln Leu Gln465 4 - #70 4 - #75 4 -#80- Asn Arg Glu Arg Ala Leu Trp Ser Gly Leu Ph - #e Pro Ile Asn Pro Ser# 495- Ala Leu Ala Ser Thr Ile Leu Asp Gln Arg Va - #l Lys Ala Arg Ile Leu# 510- Gly Asp Val Ile Ser Val Ser Asn Cys Pro Gl - #u Leu Gly Ser Asp Thr# 525- Arg Ile Ile Leu Gln Asn Ser Met Arg Val Se - #r Gly Ser Thr Thr Arg# 540- Cys Tyr Ser Arg Pro Leu Ile Ser Ile Val Se - #r Leu Asn Gly Ser Gly545 5 - #50 5 - #55 5 -#60- Thr Val Glu Gly Gln Leu Gly Thr Asp Asn Gl - #u Leu Ile Met Ser Arg# 575- Asp Leu Leu Glu Pro Cys Val Ala Asn His Ly - #s Arg Tyr Phe Leu Phe# 590- Gly His His Tyr Val Tyr Tyr Glu Asp Tyr Ar - #g Tyr Val Arg Glu Ile# 605- Ala Val His Asp Val Gly Met Ile Ser Thr Ty - #r Val Asp Leu Asn Leu# 620- Thr Leu Leu Lys Asp Arg Glu Phe Met Pro Le - #u Gln Val Tyr Thr Arg625 6 - #30 6 - #35 6 -#40- Asp Glu Leu Arg Asp Thr Gly Leu Leu Asp Ty - #r Ser Glu Ile Gln Arg# 655- Arg Asn Gln Met His Ser Leu Arg Phe Tyr As - #p Ile Asp Lys Val Val# 670- Gln Tyr Asp Ser Gly Thr Ala Ile Met Gln Gl - #y Met Ala Gln Phe Phe# 685- Gln Gly Leu Gly Thr Ala Gly Gln Ala Val Gl - #y His Val Val Leu Gly# 700- Ala Thr Gly Ala Leu Leu Ser Thr Val His Gl - #y Phe Thr Thr Phe Leu705 7 - #10 7 - #15 7 -#20- Ser Asn Pro Phe Gly Ala Leu Ala Val Gly Le - #u Leu Val Leu Ala Gly# 735- Leu Val Ala Ala Phe Phe Ala Tyr Arg Tyr Va - #l Leu Lys Leu Lys Thr# 750- Ser Pro Met Lys Ala Leu Tyr Pro Leu Thr Th - #r Lys Gly Leu Lys Gln# 765- Leu Pro Glu Gly Met Asp Pro Phe Ala Glu Ly - #s Pro Asn Ala Thr Asp# 780- Thr Pro Ile Glu Glu Ile Gly Asp Ser Gln As - #n Thr Glu Pro Ser Val785 7 - #90 7 - #95 8 -#00- Asn Ser Gly Phe Asp Pro Asp Lys Phe Arg Gl - #u Ala Gln Glu Met Ile# 815- Lys Tyr Met Thr Leu Val Ser Ala Ala Glu Ar - #g Gln Glu Ser Lys Ala# 830- Arg Lys Lys Asn Lys Thr Ser Ala Leu Leu Th - #r Ser Arg Leu Thr Gly# 845- Leu Ala Leu Arg Asn Arg Arg Gly Tyr Ser Ar - #g Val Arg Thr Glu Asn# 860- Val Thr Gly Val865- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 903 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Met His Gln Gly Ala Pro Ser Trp Gly Arg Ar - #g Trp Phe Val Val Trp# 15- Ala Leu Leu Gly Leu Thr Leu Gly Val Leu Va - #l Ala Ser Ala Ala Pro# 30- Ser Ser Pro Gly Thr Pro Gly Val Ala Arg As - #p Pro Gly Gly Glu Arg# 45- Gly Pro Cys His Ser Gly Ala Ala Ala Leu Gl - #y Ala Ala Pro Thr Gly# 60- Asp Pro Lys Pro Lys Lys Asn Lys Lys Pro Ly - #s Asn Pro Thr Pro Pro#80- Arg Pro Ala Gly Asp Asn Ala Thr Val Ala Al - #a Gly His Ala Thr Leu# 95- Arg Glu His Leu Arg Asp Ile Lys Ala Glu As - #n Thr Asp Ala Asn Phe# 110- Tyr Val Cys Pro Pro Pro Thr Gly Ala Thr Va - #l Val Gln Phe Glu Gln# 125- Pro Arg Arg Cys Pro Thr Arg Pro Glu Gly Gl - #n Asn Tyr Thr Glu Gly# 140- Ile Ala Val Val Phe Lys Glu Asn Ile Ala Pr - #o Tyr Lys Phe Lys Ala145 1 - #50 1 - #55 1 -#60- Thr Met Tyr Tyr Lys Asp Val Thr Val Ser Gl - #n Val Trp Phe Gly His# 175- Arg Tyr Ser Gln Phe Met Gly Ile Phe Glu As - #p Arg Ala Pro Val Pro# 190- Phe Glu Glu Val Ile Asp Lys Ile Asn Ala Ly - #s Gly Val Cys Arg Ser# 205- Thr Ala Lys Tyr Val Arg Asn Asn Leu Glu Th - #r Thr Ala Phe His Arg# 220- Asp Asp His Glu Thr Asp Met Glu Leu Lys Pr - #o Ala Asn Ala Ala Thr225 2 - #30 2 - #35 2 -#40- Arg Thr Ser Arg Gly Trp His Thr Thr Asp Le - #u Lys Tyr Asn Pro Ser# 255- Arg Val Glu Ala Phe His Arg Tyr Gly Thr Th - #r Val Asn Cys Ile Val# 270- Glu Glu Val Asp Ala Arg Ser Val Tyr Pro Ty - #r Asp Glu Phe Val Leu# 285- Ala Thr Gly Asp Phe Val Tyr Met Ser Pro Ph - #e Tyr Gly Tyr Arg Glu# 300- Gly Ser His Thr Glu His Thr Thr Tyr Ala Al - #a Asp Arg Phe Lys Gln305 3 - #10 3 - #15 3 -#20- Val Asp Gly Phe Tyr Ala Arg Asp Leu Thr Th - #r Lys Ala Arg Ala Thr# 335- Ala Pro Thr Thr Arg Asn Leu Leu Thr Thr Pr - #o Lys Phe Thr Val Ala# 350- Trp Asp Trp Val Pro Lys Arg Pro Ser Val Cy - #s Thr Met Thr Lys Trp# 365- Gln Glu Val Asp Glu Met Leu Arg Ser Glu Ty - #r Gly Gly Ser Phe Arg# 380- Phe Ser Ser Asp Ala Ile Ser Thr Thr Phe Th - #r Thr Asn Leu Thr Glu385 3 - #90 3 - #95 4 -#00- Tyr Pro Leu Ser Arg Val Asp Leu Gly Asp Cy - #s Ile Gly Lys Asp Ala# 415- Arg Asp Ala Met Asp Arg Ile Phe Ala Arg Ar - #g Tyr Asn Ala Thr His# 430- Ile Lys Val Gly Gln Pro Gln Tyr Tyr Leu Al - #a Asn Gly Gly Phe Leu# 445- Ile Ala Tyr Gln Pro Leu Leu Ser Asn Thr Le - #u Ala Glu Leu Tyr Val# 460- Arg Glu His Leu Arg Glu Gln Ser Arg Lys Pr - #o Pro Asn Pro Thr Pro465 4 - #70 4 - #75 4 -#80- Pro Pro Pro Gly Ala Ser Ala Asn Ala Ser Va - #l Glu Arg Ile Lys Thr# 495- Thr Ser Ser Ile Glu Phe Ala Arg Leu Gln Ph - #e Thr Tyr Asn His Ile# 510- Gln Arg His Val Asn Asp Met Leu Gly Arg Va - #l Ala Ile Ala Trp Cys# 525- Glu Leu Gln Asn His Glu Leu Thr Leu Trp As - #n Glu Ala Arg Lys Leu# 540- Asn Pro Asn Ala Ile Ala Ser Val Thr Val Gl - #y Arg Arg Val Ser Ala545 5 - #50 5 - #55 5 -#60- Arg Met Leu Gly Asp Val Met Ala Val Ser Th - #r Cys Val Pro Val Ala# 575- Ala Asp Asn Val Ile Val Gln Asn Ser Met Ar - #g Ile Ser Ser Arg Pro# 590- Gly Ala Cys Tyr Ser Arg Pro Leu Val Ser Ph - #e Arg Tyr Glu Asp Gln# 605- Gly Pro Leu Val Glu Gly Gln Leu Gly Glu As - #n Asn Glu Leu Arg Leu# 620- Thr Arg Asp Ala Ile Glu Pro Cys Thr Val Gl - #y His Arg Arg Tyr Phe625 6 - #30 6 - #35 6 -#40- Thr Phe Gly Gly Gly Tyr Val Tyr Phe Glu Gl - #u Tyr Ala Tyr Ser His# 655- Gln Leu Ser Arg Ala Asp Ile Thr Thr Val Se - #r Thr Phe Ile Asp Leu# 670- Asn Ile Thr Met Leu Glu Asp His Glu Phe Va - #l Pro Leu Glu Val Tyr# 685- Thr Arg His Glu Ile Lys Asp Ser Gly Leu Le - #u Asp Tyr Thr Glu Val# 700- Gln Arg Arg Asn Gln Leu His Asp Leu Arg Ph - #e Ala Asp Ile Asp Thr705 7 - #10 7 - #15 7 -#20- Val Ile His Ala Asp Ala Asn Ala Ala Met Ph - #e Ala Gly Leu Gly Ala# 735- Phe Phe Glu Gly Met Gly Asp Leu Gly Arg Al - #a Val Gly Lys Val Val# 750- Met Gly Leu Val Gly Gly Val Val Ser Ala Va - #l Ser Gly Val Ser Ser# 765- Phe Met Ser Asn Pro Phe Gly Ala Leu Ala Va - #l Gly Leu Leu Val Leu# 780- Ala Gly Leu Ala Ala Ala Phe Phe Ala Phe Ar - #g Tyr Val Met Arg Leu785 7 - #90 7 - #95 8 -#00- Gln Ser Asn Pro Met Lys Ala Leu Tyr Pro Le - #u Thr Thr Lys Glu Leu# 815- Lys Asn Pro Thr Asn Pro Asp Ala Ser Gly Gl - #u Gly Glu Glu Gly Gly# 830- Asp Phe Asp Glu Ala Lys Leu Ala Glu Ala Ar - #g Glu Met Ile Arg Tyr# 845- Met Ala Leu Val Ser Ala Met Glu Arg Thr Gl - #u His Lys Ala Lys Lys# 860- Lys Gly Thr Ser Arg Leu Leu Ser Ala Lys Va - #l Thr Asp Met Val Met865 8 - #70 8 - #75 8 -#80- Arg Lys Arg Arg Asn Thr Asn Tyr Thr Gln Va - #l Pro Asn Lys Asp Gly# 895- Asp Ala Asp Glu Asp Asp Leu 900- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 906 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:- Met Glu Ser Arg Ile Trp Cys Leu Val Val Cy - #s Val Asn Leu Cys Ile# 15- Val Cys Leu Gly Ala Ala Val Ser Ser Ser Se - #r Thr Ser His Ala Thr# 30- Ser Ser Thr His Asn Gly Ser His Thr Ser Ar - #g Thr Thr Ser Ala Gln# 45- Thr Arg Ser Val Tyr Ser Gln His Val Thr Se - #r Ser Glu Ala Val Ser# 60- His Arg Ala Asn Glu Thr Ile Tyr Asn Thr Th - #r Leu Lys Tyr Gly Asp#80- Val Val Gly Val Asn Thr Thr Lys Tyr Pro Ty - #r Arg Val Cys Ser Met# 95- Ala Gln Gly Thr Asp Leu Ile Arg Phe Glu Ar - #g Asn Ile Ile Cys Thr# 110- Ser Met Lys Pro Ile Asn Glu Asp Leu Asp Gl - #u Gly Ile Met Val Val# 125- Tyr Lys Arg Asn Ile Val Ala His Thr Phe Ly - #s Val Arg Val Tyr Gln# 140- Lys Val Leu Thr Phe Arg Arg Ser Tyr Ala Ty - #r Ile Tyr Thr Thr Tyr145 1 - #50 1 - #55 1 -#60- Leu Leu Gly Ser Asn Thr Glu Tyr Val Ala Pr - #o Pro Met Trp Glu Ile# 175- His His Ile Asn Lys Phe Ala Gln Cys Tyr Se - #r Ser Tyr Ser Arg Val# 190- Ile Gly Gly Thr Val Phe Val Ala Tyr His Ar - #g Asp Ser Tyr Glu Asn# 205- Lys Thr Met Gln Leu Ile Pro Asp Asp Tyr Se - #r Asn Thr His Ser Thr# 220- Arg Tyr Val Thr Val Lys Asp Gln Trp His Se - #r Arg Gly Ser Thr Trp225 2 - #30 2 - #35 2 -#40- Leu Tyr Arg Glu Thr Cys Asn Leu Asn Cys Me - #t Leu Thr Ile Thr Thr# 255- Ala Arg Ser Lys Tyr Pro Tyr His Phe Phe Al - #a Thr Ser Thr Gly Asp# 270- Val Val Tyr Ile Ser Pro Phe Tyr Asn Gly Th - #r Asn Arg Asn Ala Ser# 285- Tyr Phe Gly Glu Asn Ala Asp Lys Phe Phe Il - #e Phe Pro Asn Tyr Thr# 300- Ile Val Ser Asp Phe Gly Arg Pro Asn Ala Al - #a Pro Glu Thr His Arg305 3 - #10 3 - #15 3 -#20- Leu Val Ala Phe Leu Glu Arg Ala Asp Ser Va - #l Ile Ser Trp Asp Ile# 335- Gln Asp Glu Lys Asn Val Thr Cys Gln Leu Th - #r Phe Trp Glu Ala Ser# 350- Glu Arg Thr Ile Arg Ser Glu Ala Glu Asp Se - #r Tyr His Phe Ser Ser# 365- Ala Lys Met Thr Ala Thr Phe Leu Ser Lys Ly - #s Gln Glu Val Asn Met# 380- Ser Asp Ser Ala Leu Asp Cys Val Arg Asp Gl - #u Ala Ile Asn Lys Leu385 3 - #90 3 - #95 4 -#00- Gln Gln Ile Phe Asn Thr Ser Tyr Asn Gln Th - #r Tyr Glu Lys Tyr Gly# 415- Asn Val Ser Val Phe Glu Thr Ser Gly Gly Le - #u Val Val Phe Trp Gln# 430- Gly Ile Lys Gln Lys Ser Leu Val Glu Leu Gl - #u Arg Leu Ala Asn Arg# 445- Ser Ser Leu Asn Ile Thr His Arg Thr Arg Ar - #g Ser Thr Ser Asp Asn# 460- Asn Thr Thr His Leu Ser Ser Met Glu Ser Va - #l His Asn Leu Val Tyr465 4 - #70 4 - #75 4 -#80- Ala Gln Leu Gln Phe Thr Tyr Asp Thr Leu Ar - #g Gly Tyr Ile Asn Arg# 495- Ala Leu Ala Gln Ile Ala Glu Ala Trp Cys Va - #l Asp Gln Arg Arg Thr# 510- Leu Glu Val Phe Lys Glu Leu Ser Lys Ile As - #n Pro Ser Ala Ile Leu# 525- Ser Ala Ile Tyr Asn Lys Pro Ile Ala Ala Ar - #g Phe Met Gly Asp Val# 540- Leu Gly Leu Ala Ser Cys Val Thr Ile Asn Gl - #n Thr Ser Val Lys Val545 5 - #50 5 - #55 5 -#60- Leu Arg Asp Met Asn Val Lys Glu Ser Pro Gl - #y Arg Cys Tyr Ser Arg# 575- Pro Val Val Ile Phe Asn Phe Ala Asn Ser Se - #r Tyr Val Gln Tyr Gly# 590- Gln Leu Gly Glu Asp Asn Glu Ile Leu Leu Gl - #y Asn His Arg Thr Glu# 605- Glu Cys Gln Leu Pro Ser Leu Lys Ile Phe Il - #e Ala Gly Asn Ser Ala# 620- Tyr Glu Tyr Val Asp Tyr Leu Phe Lys Arg Me - #t Ile Asp Leu Ser Ser625 6 - #30 6 - #35 6 -#40- Ile Ser Thr Val Asp Ser Met Ile Ala Leu As - #p Ile Asp Pro Leu Glu# 655- Asn Thr Asp Phe Arg Val Leu Glu Leu Tyr Se - #r Gln Lys Glu Leu Arg# 670- Ser Ser Asn Val Phe Asp Leu Glu Glu Ile Me - #t Arg Glu Phe Asn Ser# 685- Tyr Lys Gln Arg Val Lys Tyr Val Glu Asp Ly - #s Val Val Asp Pro Leu# 700- Pro Pro Tyr Leu Lys Gly Leu Asp Asp Leu Me - #t Ser Gly Leu Gly Ala705 7 - #10 7 - #15 7 -#20- Ala Gly Lys Ala Val Gly Val Ala Ile Gly Al - #a Val Gly Gly Ala Val# 735- Ala Ser Val Val Glu Gly Val Ala Thr Phe Le - #u Lys Asn Pro Phe Gly# 750- Ala Phe Thr Ile Ile Leu Val Ala Ile Ala Va - #l Val Ile Ile Thr Tyr# 765- Leu Ile Tyr Thr Arg Gln Arg Arg Leu Cys Th - #r Gln Pro Leu Gln Asn# 780- Leu Phe Pro Tyr Leu Val Ser Ala Asp Gly Th - #r Thr Val Thr Ser Gly785 7 - #90 7 - #95 8 -#00- Ser Thr Lys Asp Thr Ser Leu Gln Ala Pro Pr - #o Ser Tyr Glu Glu Ser# 815- Val Tyr Asn Ser Gly Arg Lys Gly Pro Gly Pr - #o Pro Ser Ser Asp Ala# 830- Ser Thr Ala Ala Pro Pro Tyr Thr Asn Glu Gl - #n Ala Tyr Gln Met Leu# 845- Leu Ala Leu Ala Arg Leu Asp Ala Glu Gln Ar - #g Ala Gln Gln Asn Gly# 860- Thr Asp Ser Leu Asp Gly Gln Thr Gly Thr Gl - #n Asp Lys Gly Gln Lys865 8 - #70 8 - #75 8 -#80- Pro Asn Leu Leu Asp Arg Leu Arg His Arg Ly - #s Asn Gly Tyr Arg His# 895- Leu Lys Asp Ser Asp Glu Glu Glu Asn Val# 905- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 857 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:- Met Thr Arg Arg Arg Val Leu Ser Val Val Va - #l Leu Leu Ala Ala Leu# 15- Ala Cys Arg Leu Gly Ala Gln Thr Pro Glu Gl - #n Pro Ala Pro Pro Ala# 30- Thr Thr Val Gln Pro Thr Ala Thr Arg Gln Gl - #n Thr Ser Phe Pro Phe# 45- Arg Val Cys Glu Leu Ser Ser His Gly Asp Le - #u Phe Arg Phe Ser Ser# 60- Asp Ile Gln Cys Pro Ser Phe Gly Thr Arg Gl - #u Asn His Thr Glu Gly#80- Leu Leu Met Val Phe Lys Asp Asn Ile Ile Pr - #o Tyr Ser Phe Lys Val# 95- Arg Ser Tyr Thr Lys Ile Val Thr Asn Ile Le - #u Ile Tyr Asn Gly Trp# 110- Tyr Ala Asp Ser Val Thr Asn Arg His Glu Gl - #u Lys Phe Ser Val Asp# 125- Ser Tyr Glu Thr Asp Gln Met Asp Thr Ile Ty - #r Gln Cys Tyr Asn Ala# 140- Val Lys Met Thr Lys Asp Gly Leu Thr Arg Va - #l Tyr Val Asp Arg Asp145 1 - #50 1 - #55 1 -#60- Gly Val Asn Ile Thr Val Asn Leu Lys Pro Th - #r Gly Gly Leu Ala Asn# 175- Gly Val Arg Arg Tyr Ala Ser Gln Thr Glu Le - #u Tyr Asp Ala Pro Gly# 190- Trp Leu Ile Trp Thr Tyr Arg Thr Arg Thr Th - #r Val Asn Cys Leu Ile# 205- Thr Asp Met Met Ala Lys Ser Asn Ser Pro Ph - #e Asp Phe Phe Val Thr# 220- Thr Thr Gly Gln Thr Val Glu Met Ser Pro Ph - #e Tyr Asp Gly Lys Asn225 2 - #30 2 - #35 2 -#40- Lys Glu Thr Phe His Glu Arg Ala Asp Ser Ph - #e His Val Arg Thr Asn# 255- Tyr Lys Ile Val Asp Tyr Asp Asn Arg Gly Th - #r Asn Pro Gln Gly Glu# 270- Arg Arg Ala Phe Leu Asp Lys Gly Thr Tyr Th - #r Leu Ser Trp Lys Leu# 285- Glu Asn Arg Thr Ala Tyr Cys Pro Leu Gln Hi - #s Trp Gln Thr Phe Asp# 300- Ser Thr Ile Ala Thr Glu Thr Gly Lys Ser Il - #e His Phe Val Thr Asp305 3 - #10 3 - #15 3 -#20- Glu Gly Thr Ser Ser Phe Val Thr Asn Thr Th - #r Val Gly Ile Glu Leu# 335- Pro Asp Ala Phe Lys Cys Ile Glu Glu Gln Va - #l Asn Lys Thr Met His# 350- Glu Lys Tyr Glu Ala Val Gln Asp Arg Tyr Th - #r Lys Gly Gln Glu Ala# 365- Ile Thr Tyr Phe Ile Thr Ser Gly Gly Leu Le - #u Leu Ala Trp Leu Pro# 380- Leu Thr Pro Arg Ser Leu Ala Thr Val Lys As - #n Leu Thr Glu Leu Thr385 3 - #90 3 - #95 4 -#00- Thr Pro Thr Ser Ser Pro Pro Ser Ser Pro Se - #r Pro Pro Ala Pro Ser# 415- Ala Ala Arg Gly Ser Thr Pro Ala Ala Val Le - #u Arg Arg Arg Arg Arg# 430- Asp Ala Gly Asn Ala Thr Thr Pro Val Pro Pr - #o Thr Ala Pro Gly Lys# 445- Ser Leu Gly Thr Leu Asn Asn Pro Ala Thr Va - #l Gln Ile Gln Phe Ala# 460- Tyr Asp Ser Leu Arg Arg Gln Ile Asn Arg Me - #t Leu Gly Asp Leu Ala465 4 - #70 4 - #75 4 -#80- Arg Ala Trp Cys Leu Glu Gln Lys Arg Gln As - #n Met Val Leu Arg Glu# 495- Leu Thr Lys Ile Asn Pro Thr Thr Val Met Se - #r Ser Ile Tyr Gly Lys# 510- Ala Val Ala Ala Lys Arg Leu Gly Asp Val Il - #e Ser Val Ser Gln Cys# 525- Val Pro Val Asn Gln Ala Thr Val Thr Leu Ar - #g Lys Ser Met Arg Val# 540- Pro Gly Ser Glu Thr Met Cys Tyr Ser Arg Pr - #o Leu Val Ser Phe Ser545 5 - #50 5 - #55 5 -#60- Phe Ile Asn Asp Thr Lys Thr Tyr Glu Gly Gl - #n Leu Gly Thr Asp Asn# 575- Glu Ile Phe Leu Thr Lys Lys Met Thr Glu Va - #l Cys Gln Ala Thr Ser# 590- Gln Tyr Tyr Phe Gln Ser Gly Asn Glu Ile Hi - #s Val Tyr Asn Asp Tyr# 605- His His Phe Lys Thr Ile Glu Leu Asp Gly Il - #e Ala Thr Leu Gln Thr# 620- Phe Ile Ser Leu Asn Thr Ser Leu Ile Glu As - #n Ile Asp Phe Ala Ser625 6 - #30 6 - #35 6 -#40- Leu Glu Leu Tyr Ser Arg Asp Glu Gln Arg Al - #a Ser Asn Val Phe Asp# 655- Leu Glu Gly Ile Phe Arg Glu Tyr Asn Phe Gl - #n Ala Gln Asn Ile Ala# 670- Gly Leu Arg Lys Asp Leu Asp Asn Ala Val Se - #r Asn Gly Arg Asn Gln# 685- Phe Val Asp Gly Leu Gly Glu Leu Met Asp Se - #r Leu Gly Ser Val Gly# 700- Gln Ser Ile Thr Asn Leu Val Ser Thr Val Gl - #y Gly Leu Phe Ser Ser705 7 - #10 7 - #15 7 -#20- Leu Val Ser Gly Phe Ile Ser Phe Phe Lys As - #n Pro Phe Gly Gly Met# 735- Leu Ile Leu Val Leu Val Ala Gly Val Val Il - #e Leu Val Ile Ser Leu# 750- Thr Arg Arg Thr Arg Gln Met Ser Gln Gln Pr - #o Val Gln Met Leu Tyr# 765- Pro Gly Ile Asp Glu Leu Ala Gln Gln His Al - #a Ser Gly Glu Gly Pro# 780- Gly Ile Asn Pro Ile Ser Lys Thr Glu Leu Gl - #n Ala Ile Met Leu Ala785 7 - #90 7 - #95 8 -#00- Leu His Glu Gln Asn Gln Glu Gln Lys Arg Al - #a Ala Gln Arg Ala Ala# 815- Gly Pro Ser Val Ala Ser Arg Ala Leu Gln Al - #a Ala Arg Asp Arg Phe# 830- Pro Gly Leu Arg Arg Arg Arg Tyr His Asp Pr - #o Glu Thr Ala Ala Ala# 845- Leu Leu Gly Glu Ala Glu Thr Glu Phe# 855- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2280 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:- CGAGCCCTAA TTATTGGTTT GTATATGACT GTTGGAATTT GTTACATTTT TA - #TTAAAACA 60- ATAAATTAAA TTTTTTAAAC TATATTACGG TTGTGTGTGT TTTAAGTTTT AA - #ATAAAGCA 120- ATATTTCGAA TTCACATTTA TCAAAAACAT TAAAACCCAA CACAAAAAAA TT - #TCTATAAT 180- CATTAAGGTA ATAAGTCAAA ATGAGTTTTA AAAATTTTTA TCTAATATAT GT - #AATTATAA 240- TTTTTATAAA CTCGATAATA ACTTCGGCAT CTACATCCAA ACCTTCAACA CC - #TACCATAA 300- TTCCAACTTC AGCAAATGAA TCACCTGCTT CCATAGATAC AACTATAACA AA - #ACCTATAT 360- CTACAGAGGC AAATAATTTA AAATCAGTAA GTACCTCAAT TAAACCACCT AA - #AAACTTAA 420- AAAAAAAATT ACTTAAATCT AAATGTAGAG ATAATGTTAT TTATAGGCCA TA - #TTTTAGTC 480- AATTAGAAAT TAACTGTACT ATAACTAAAA AGCAAAATTT AAGTAATCCT TT - #AATTGAGT 540- TATGGTTTAA AGAACTTTCT ACATATAATA AAACCAATGA AAATGTTGAA AG - #TTTAAAAA 600- CAGATATATC AAAAAATATT TTATTATTTT CGACAAAAAA TAATAGTGAT AA - #CTTTTATA 660- ATGATTTTTT ATTAGGTATA CAAAATCAAC CAGTAAATTA TAAACTTTAC GG - #TTCCCAAT 720- TTTATGATAA TGGAAACATA TTACTAAATA TAAAGTCGGT TGACTTTAAA AC - #CTCTGGAA 780- TATATACTTG GAAACTATAT AATTCAAATA ATGAAAGTAT TTTTGAAACT TT - #TAAAATTC 840- AAGTATATGC ATATCATTCC CCAAATGTAA ACTTAAAATC AAACCCAAGT TT - #ATATAATG 900- AAAACTACAG CGCTATTTGT ACAATAGCAA ATTACTTTCC ATTGGAATCT AC - #GGAAATAT 960- TTTGGTTTAA CGATGGACAA CCTATTGATA AAAAATATAT AGATGAAACT TA - #TAGTGTAT1020- GGATTGACGG TCTTATAACA CGCACTTCAA TATTATCCCT TCCCTTTTCC GA - #AGCCATGG1080- AAAGCCCCCC CAATTTGCGA TGTAATGTTG AATGGTATAA AAATTCAAAG GC - #ATCAAAAA1140- AATTTTCAAA TACCGTTATT CCAAAAGTTT ACTATAAACC TTTTATATCT AT - #AAAATTTG1200- ATAATGGTTT AGCTATTTGT GATGCTAAAT GTGTTTCCCG TGAAAATAAT AA - #ATTACAAT1260- GGTTAGTTAA AGATATACCT ATAAATGGTG ATGATATTAT AAGCGGCCCC TG - #TTTAAACC1320- ACCCTGGTTT GGTCAATATT CAAAATAAAA TAGATATATC GGATTATGAT GA - #ACCTGTTA1380- CCTATAAATG TTCAATTATT GGTTATCCAA TAATTTTTCC CAACTTTTAT GA - #TGAAAAGG1440- TGTTTGATGC ATCGGATGAA AATGTTAGTA AATCGATGTT AATAAGTATT AC - #CACAATAA1500- TTGGTGGAGC CATTTTTGTT ATAGTATTGA TTTTTATAAC AGCTTTATGT TT - #TTATTGTT1560- CAAAAAATAA TAAGATCTAA TATCAATATT TACGTAAATG GATTATATAA TG - #TTATATTC1620- GTGTTATTAT GATTTATAAG TTCATCAAAT TTAAAAATTT GTATAGTATT AA - #GATTTTTA1680- ATAGGGGTAT CGTTTAATAT GGCTCAGTTA GTTTTAACTG ATATTCCCCT CG - #AAGATGTG1740- GAAAATAAAA ATACTTCATC CGACGAAGAA ACAACTAACT TAAACCAGAA AA - #AATCAACA1800- TGTCAATGTT TATGTGTTAC CCTTGGATTT TTTGCAGCTG GAATTTTATT AA - #CCATAGCT1860- GCAATAATTT TTACTTTTAT TTTTACAGTA CCATTAGAAA TGCTTGGATC TA - #TTAATTGT1920- CCTCCATCTA CATTTGGTAT TGATAATGTT TGTATCGAAC CAATAAAAAA AT - #CTATTAAT1980- TCTTATTCAG AATTATCTAA AATATGTTAT GATAGATTGT CAAATCCGAT AA - #ATCAGAGT2040- ACTATTAACT CCTTATTAAC TGTTTTAAAT ATGTTTGCAG ATAAAAACTA TG - #AAAATGTT2100- TATAATTGTA ATACAATGAG TGAAAAAACA TGTAATTCAT CAATAGCTAT TT - #GTCAAACT2160- AATCATCCAC TAAGTTCATT GGGAAATTTT GTTATTAAAA TTAGAAAAAT TT - #TTGGGTTT2220- AAATAATAAA TAAAATAAAT AAACATTACT TTTTGTTTTT GTCTTTATTA AA - #CAGTTGTA2280- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 459 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Met Ser Phe Lys Asn Phe Tyr Leu Ile Tyr Va - #l Ile Ile Ile Phe Ile# 15- Asn Ser Ile Ile Thr Ser Ala Ser Thr Ser Ly - #s Pro Ser Thr Pro Thr# 30- Ile Ile Pro Thr Ser Ala Asn Glu Ser Pro Al - #a Ser Ile Asp Thr Thr# 45- Ile Thr Lys Pro Ile Ser Thr Glu Ala Asn As - #n Leu Lys Ser Val Ser# 60- Thr Ser Ile Lys Pro Pro Lys Asn Leu Lys Ly - #s Lys Leu Leu Lys Ser#80- Lys Cys Arg Asp Asn Val Ile Tyr Arg Pro Ty - #r Phe Ser Gln Leu Glu# 95- Ile Asn Cys Thr Ile Thr Lys Lys Gln Asn Le - #u Ser Asn Pro Leu Ile# 110- Glu Leu Trp Phe Lys Glu Leu Ser Thr Tyr As - #n Lys Thr Asn Glu Asn# 125- Val Glu Ser Leu Lys Thr Asp Ile Ser Lys As - #n Ile Leu Leu Phe Ser# 140- Thr Lys Asn Asn Ser Asp Asn Phe Tyr Asn As - #p Phe Leu Leu Gly Ile145 1 - #50 1 - #55 1 -#60- Gln Asn Gln Pro Val Asn Tyr Lys Leu Tyr Gl - #y Ser Gln Phe Tyr Asp# 175- Asn Gly Asn Ile Leu Leu Asn Ile Lys Ser Va - #l Asp Phe Lys Thr Ser# 190- Gly Ile Tyr Thr Trp Lys Leu Tyr Asn Ser As - #n Asn Glu Ser Ile Phe# 205- Glu Thr Phe Lys Ile Gln Val Tyr Ala Tyr Hi - #s Ser Pro Asn Val Asn# 220- Leu Lys Ser Asn Pro Ser Leu Tyr Asn Glu As - #n Tyr Ser Ala Ile Cys225 2 - #30 2 - #35 2 -#40- Thr Ile Ala Asn Tyr Phe Pro Leu Glu Ser Th - #r Glu Ile Phe Trp Phe# 255- Asn Asp Gly Gln Pro Ile Asp Lys Lys Tyr Il - #e Asp Glu Thr Tyr Ser# 270- Val Trp Ile Asp Gly Leu Ile Thr Arg Thr Se - #r Ile Leu Ser Leu Pro# 285- Phe Ser Glu Ala Met Glu Ser Pro Pro Asn Le - #u Arg Cys Asn Val Glu# 300- Trp Tyr Lys Asn Ser Lys Ala Ser Lys Lys Ph - #e Ser Asn Thr Val Ile305 3 - #10 3 - #15 3 -#20- Pro Lys Val Tyr Tyr Lys Pro Phe Ile Ser Il - #e Lys Phe Asp Asn Gly# 335- Leu Ala Ile Cys Asp Ala Lys Cys Val Ser Ar - #g Glu Asn Asn Lys Leu# 350- Gln Trp Leu Val Lys Asp Ile Pro Ile Asn Gl - #y Asp Asp Ile Ile Ser# 365- Gly Pro Cys Leu Asn His Pro Gly Leu Val As - #n Ile Gln Asn Lys Ile# 380- Asp Ile Ser Asp Tyr Asp Glu Pro Val Thr Ty - #r Lys Cys Ser Ile Ile385 3 - #90 3 - #95 4 -#00- Gly Tyr Pro Ile Ile Phe Pro Asn Phe Tyr As - #p Glu Lys Val Phe Asp# 415- Ala Ser Asp Glu Asn Val Ser Lys Ser Met Le - #u Ile Ser Ile Thr Thr# 430- Ile Ile Gly Gly Ala Ile Phe Val Ile Val Le - #u Ile Phe Ile Thr Ala# 445- Leu Cys Phe Tyr Cys Ser Lys Asn Asn Lys Il - #e# 455- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 175 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met Ala Gln Leu Val Leu Thr Asp Ile Pro Le - #u Glu Asp Val Glu Asn# 15- Lys Asn Thr Ser Ser Asp Glu Glu Thr Thr As - #n Leu Asn Gln Lys Lys# 30- Ser Thr Cys Gln Cys Leu Cys Val Thr Leu Gl - #y Phe Phe Ala Ala Gly# 45- Ile Leu Leu Thr Ile Ala Ala Ile Ile Phe Th - #r Phe Ile Phe Thr Val# 60- Pro Leu Glu Met Leu Gly Ser Ile Asn Cys Pr - #o Pro Ser Thr Phe Gly#80- Ile Asp Asn Val Cys Ile Glu Pro Ile Lys Ly - #s Ser Ile Asn Ser Tyr# 95- Ser Glu Leu Ser Lys Ile Cys Tyr Asp Arg Le - #u Ser Asn Pro Ile Asn# 110- Gln Ser Thr Ile Asn Ser Leu Leu Thr Val Le - #u Asn Met Phe Ala Asp# 125- Lys Asn Tyr Glu Asn Val Tyr Asn Cys Asn Th - #r Met Ser Glu Lys Thr# 140- Cys Asn Ser Ser Ile Ala Ile Cys Gln Thr As - #n His Pro Leu Ser Ser145 1 - #50 1 - #55 1 -#60- Leu Gly Asn Phe Val Ile Lys Ile Arg Lys Il - #e Phe Gly Phe Lys# 175- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 459 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Met Ser Phe Lys Asn Phe Tyr Leu Ile Tyr Va - #l Ile Ile Ile Phe Ile# 15- Asn Ser Ile Ile Thr Ser Ala Ser Thr Ser Ly - #s Pro Ser Thr Pro Thr# 30- Ile Ile Pro Thr Ser Ala Asn Glu Ser Pro Al - #a Ser Ile Asp Thr Thr# 45- Ile Thr Lys Pro Ile Ser Thr Glu Ala Asn As - #n Leu Lys Ser Val Ser# 60- Thr Ser Ile Lys Pro Pro Lys Asn Leu Lys Ly - #s Lys Leu Leu Lys Ser#80- Lys Cys Arg Asp Asn Val Ile Tyr Arg Pro Ty - #r Phe Ser Gln Leu Glu# 95- Ile Asn Cys Thr Ile Thr Lys Lys Gln Asn Le - #u Ser Asn Pro Leu Ile# 110- Glu Leu Trp Phe Lys Glu Leu Ser Thr Tyr As - #n Lys Thr Asn Glu Asn# 125- Val Glu Ser Leu Lys Thr Asp Ile Ser Lys As - #n Ile Leu Leu Phe Ser# 140- Thr Lys Asn Asn Ser Asp Asn Phe Tyr Asn As - #p Phe Leu Leu Gly Ile145 1 - #50 1 - #55 1 -#60- Gln Asn Gln Pro Val Asn Tyr Lys Leu Tyr Gl - #y Ser Gln Phe Tyr Asp# 175- Asn Gly Asn Ile Leu Leu Asn Ile Lys Ser Va - #l Asp Phe Lys Thr Ser# 190- Gly Ile Tyr Thr Trp Lys Leu Tyr Asn Ser As - #n Asn Glu Ser Ile Phe# 205- Glu Thr Phe Lys Ile Gln Val Tyr Ala Tyr Hi - #s Ser Pro Asn Val Asn# 220- Leu Lys Ser Asn Pro Ser Leu Tyr Asn Glu As - #n Tyr Ser Ala Ile Cys225 2 - #30 2 - #35 2 -#40- Thr Ile Ala Asn Tyr Phe Pro Leu Glu Ser Th - #r Glu Ile Phe Trp Phe# 255- Asn Asp Gly Gln Pro Ile Asp Lys Lys Tyr Il - #e Asp Glu Thr Tyr Ser# 270- Val Trp Ile Asp Gly Leu Ile Thr Arg Thr Se - #r Ile Leu Ser Leu Pro# 285- Phe Ser Glu Ala Met Glu Ser Pro Pro Asn Le - #u Arg Cys Asn Val Glu# 300- Trp Tyr Lys Asn Ser Lys Ala Ser Lys Lys Ph - #e Ser Asn Thr Val Ile305 3 - #10 3 - #15 3 -#20- Pro Lys Val Tyr Tyr Lys Pro Phe Ile Ser Il - #e Lys Phe Asp Asn Gly# 335- Leu Ala Ile Cys Asp Ala Lys Cys Val Ser Ar - #g Glu Asn Asn Lys Leu# 350- Gln Trp Leu Val Lys Asp Ile Pro Ile Asn Gl - #y Asp Asp Ile Ile Ser# 365- Gly Pro Cys Leu Asn His Pro Gly Leu Val As - #n Ile Gln Asn Lys Ile# 380- Asp Ile Ser Asp Tyr Asp Glu Pro Val Thr Ty - #r Lys Cys Ser Ile Ile385 3 - #90 3 - #95 4 -#00- Gly Tyr Pro Ile Ile Phe Pro Asn Phe Tyr As - #p Glu Lys Val Phe Asp# 415- Ala Ser Asp Glu Asn Val Ser Lys Ser Met Le - #u Ile Ser Ile Thr Thr# 430- Ile Ile Gly Gly Ala Ile Phe Val Ile Val Le - #u Ile Phe Ile Thr Ala# 445- Leu Cys Phe Tyr Cys Ser Lys Asn Asn Lys Il - #e# 455- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 533 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Met Arg Arg Tyr Arg Met Gly Arg Gly Ile Ty - #r Leu Leu Tyr Ile Cys# 15- Leu Leu Tyr Thr Tyr Leu Gln Phe Gly Thr Se - #r Ser Thr Thr Ala Val# 30- Ser Ile Glu Asn Ser Asp Asn Ser Thr Ala Gl - #u Met Leu Ser Ser Thr# 45- Ser Met Ser Ala Thr Thr Pro Ile Ser Gln Pr - #o Thr Ser Pro Phe Thr# 60- Thr Pro Thr Arg Arg Ser Thr Asn Ile Ala Th - #r Ser Ser Ser Thr Thr#80- Gln Ala Ser Gln Pro Thr Ser Thr Leu Thr Th - #r Leu Thr Arg Ser Ser# 95- Thr Thr Ile Ala Thr Ser Pro Ser Thr Thr Gl - #n Ala Ala Thr Phe Ile# 110- Gly Ser Ser Thr Asp Ser Asn Thr Thr Leu Le - #u Lys Thr Thr Lys Lys# 125- Pro Lys Arg Lys Lys Asn Lys Asn Asn Gly Al - #a Arg Phe Lys Leu Asp# 140- Cys Gly Tyr Lys Gly Val Ile Tyr Arg Pro Ty - #r Phe Ser Pro Leu Gln145 1 - #50 1 - #55 1 -#60- Leu Asn Cys Thr Leu Pro Thr Glu Pro His Il - #e Thr Asn Pro Ile Asp# 175- Phe Glu Ile Trp Phe Lys Pro Arg Thr Arg Ph - #e Gly Asp Phe Leu Gly# 190- Asp Lys Glu Asp Phe Val Gly Asn His Thr Ar - #g Thr Ser Ile Leu Leu# 205- Phe Ser Ser Arg Asn Gly Ser Val Asn Ser Me - #t Asp Leu Gly Asp Ala# 220- Thr Leu Gly Ile Leu Gln Ser Arg Ile Pro As - #p Tyr Thr Leu Tyr Asn225 2 - #30 2 - #35 2 -#40- Ile Pro Ile Gln His Thr Glu Ala Met Ser Le - #u Gly Ile Lys Ser Val# 255- Glu Ser Ala Thr Ser Gly Val Tyr Thr Trp Ar - #g Val Tyr Gly Gly Asp# 270- Gly Leu Asn Lys Thr Val Leu Gly Gln Val As - #n Val Ser Val Val Ala# 285- Tyr His Pro Pro Ser Val Asn Leu Thr Pro Ar - #g Ala Ser Leu Phe Asn# 300- Lys Thr Phe Glu Ala Val Cys Ala Val Ala As - #n Tyr Phe Pro Arg Ser305 3 - #10 3 - #15 3 -#20- Thr Lys Leu Thr Trp Tyr Leu Asp Gly Lys Pr - #o Ile Glu Arg Gln Tyr# 335- Ile Ser Asp Thr Ala Ser Val Trp Ile Asp Gl - #y Leu Ile Thr Arg Ser# 350- Ser Val Leu Ala Ile Pro Thr Thr Glu Thr As - #p Ser Glu Lys Pro Asp# 365- Ile Arg Cys Asp Leu Glu Trp His Glu Ser Pr - #o Val Ser Tyr Lys Arg# 380- Phe Thr Lys Ser Val Ala Pro Asp Val Tyr Ty - #r Pro Pro Thr Val Ser385 3 - #90 3 - #95 4 -#00- Val Thr Phe Ala Asp Thr Arg Ala Ile Cys As - #p Val Lys Cys Val Pro# 415- Arg Asp Gly Ile Ser Leu Met Trp Lys Ile Gl - #y Asn Tyr His Leu Pro# 430- Lys Ala Met Ser Ala Asp Ile Leu Ile Thr Gl - #y Pro Cys Ile Glu Arg# 445- Pro Gly Leu Val Asn Ile Gln Ser Met Cys As - #p Ile Ser Glu Thr Asp# 460- Gly Pro Val Ser Tyr Thr Cys Gln Thr Ile Gl - #y Tyr Pro Pro Ile Leu465 4 - #70 4 - #75 4 -#80- Pro Gly Phe Tyr Asp Thr Gln Val Tyr Asp Al - #a Ser Pro Glu Ile Val# 495- Ser Glu Ser Met Leu Val Ser Val Val Ala Va - #l Ile Leu Gly Ala Val# 510- Leu Ile Thr Val Phe Ile Phe Ile Thr Ala Le - #u Cys Leu Tyr Tyr Ser# 525- His Pro Arg Arg Leu 530- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 468 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Met Trp Leu Pro Asn Leu Val Arg Phe Val Al - #a Val Ala Tyr Leu Ile# 15- Cys Ala Gly Ala Ile Leu Thr Tyr Ala Ser Gl - #y Ala Ser Ala Ser Ser# 30- Ser Gln Ser Thr Pro Ala Thr Pro Thr His Th - #r Thr Pro Asn Leu Thr# 45- Thr Ala His Gly Ala Gly Ser Asp Asn Thr Th - #r Asn Ala Asn Gly Thr# 60- Glu Ser Thr His Ser His Glu Thr Thr Ile Th - #r Cys Thr Lys Ser Leu#80- Ile Ser Val Pro Tyr Tyr Lys Ser Val Asp Me - #t Asn Cys Thr Thr Ser# 95- Val Gly Val Asn Tyr Ser Glu Tyr Arg Leu Gl - #u Ile Tyr Leu Asn Gln# 110- Arg Thr Pro Phe Ser Gly Thr Pro Pro Gly As - #p Glu Glu Asn Tyr Ile# 125- Asn His Asn Ala Thr Lys Asp Gln Thr Leu Le - #u Leu Phe Ser Thr Ala# 140- Glu Arg Lys Lys Ser Arg Arg Gly Asp Leu Se - #r Val His Pro Ser Leu145 1 - #50 1 - #55 1 -#60- Lys Gly Glu Asn Tyr Arg Ala Thr Cys Val Va - #l Ala Ser Tyr Phe Pro# 175- His Ser Ser Val Lys Leu Arg Trp Tyr Lys As - #n Ala Arg Glu Val Asp# 190- Phe Thr Lys Tyr Val Thr Asn Ala Ser Ser Va - #l Trp Val Asp Gly Leu# 205- Ile Thr Arg Ile Ser Thr Val Ser Ile Pro Va - #l Asp Pro Glu Glu Glu# 220- Tyr Thr Gly Gln Leu Gly Val Ile Pro Asp Ar - #g Leu Pro Lys Arg Gln225 2 - #30 2 - #35 2 -#40- Leu Phe Asn Leu Pro Leu His Thr Glu Gly Gl - #y Thr Lys Phe Pro Leu# 255- Thr Ile Lys Ser Val Asp Trp Arg Thr Ala Gl - #y Ile Tyr Val Trp Ser# 270- Leu Tyr Ala Lys Asn Gly Thr Leu Val Asn Se - #r Thr Ser Val Thr Val# 285- Ser Thr Tyr Asn Ala Pro Leu Leu Pro Ser Le - #u Arg Cys Ser Ile Asp# 300- Trp Tyr Arg Asp Glu Val Ser Phe Ala Arg Il - #e Ala Lys Ala Gly Thr305 3 - #10 3 - #15 3 -#20- Pro Ser Val Phe Val Ala Pro Thr Val Ser Va - #l Ser Val Glu Asp Gly# 335- Asp Ala Val Cys Thr Ala Lys Cys Val Pro Se - #r Thr Gly Val Phe Val# 350- Ser Trp Ser Val Asn Asp His Leu Pro Gly Va - #l Pro Ser Gln Asp Met# 365- Thr Thr Gly Val Cys Pro Ser His Ser Gly Le - #u Val Asn Met Gln Ser# 380- Arg Arg Pro Leu Ser Glu Glu Asn Gly Glu Ar - #g Glu Tyr Ser Cys Ile385 3 - #90 3 - #95 4 -#00- Ile Glu Gly Tyr Pro Asp Gly Leu Pro Met Ph - #e Ser Asp Thr Val Val# 415- Tyr Asp Ala Ser Pro Ile Val Glu Asp Arg Pr - #o Val Leu Thr Ser Ile# 430- Ile Ala Val Thr Cys Gly Ala Ala Ala Leu Al - #a Leu Val Val Leu Ile# 445- Thr Ala Val Cys Phe Tyr Cys Ser Lys Pro Se - #r Gln Ala Pro Tyr Lys# 460- Lys Ser Asp Phe465- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 511 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Met Ala Pro Gly Arg Val Gly Leu Ala Val Va - #l Leu Trp Ser Leu Leu# 15- Trp Leu Gly Ala Gly Val Ser Gly Gly Ser Gl - #u Thr Ala Ser Thr Gly# 30- Pro Thr Ile Thr Ala Gly Ala Val Thr Asn Al - #a Ser Glu Ala Pro Thr# 45- Ser Gly Ser Pro Gly Ser Ala Ala Ser Pro Gl - #u Val Thr Pro Thr Ser# 60- Thr Pro Asn Pro Asn Asn Val Thr Gln Asn Ly - #s Thr Thr Pro Thr Glu#80- Pro Ala Ser Pro Pro Thr Thr Pro Lys Pro Th - #r Ser Thr Pro Lys Ser# 95- Pro Pro Thr Ser Thr Pro Asp Pro Lys Pro Ly - #s Asn Asn Thr Thr Pro# 110- Ala Lys Ser Gly Arg Pro Thr Lys Pro Pro Gl - #y Pro Val Trp Cys Asp# 125- Arg Arg Asp Pro Leu Ala Arg Tyr Gly Ser Ar - #g Val Gln Ile Arg Cys# 140- Arg Phe Arg Asn Ser Thr Arg Met Glu Phe Ar - #g Leu Gln Ile Trp Arg145 1 - #50 1 - #55 1 -#60- Tyr Ser Met Gly Pro Ser Pro Pro Ile Ala Pr - #o Ala Pro Asp Leu Glu# 175- Glu Val Leu Thr Asn Ile Thr Ala Pro Pro Gl - #y Gly Leu Leu Val Tyr# 190- Asp Ser Ala Pro Asn Leu Thr Asp Pro His Va - #l Leu Trp Ala Glu Gly# 205- Ala Gly Pro Gly Ala Asp Pro Pro Leu Tyr Se - #r Val Thr Gly Pro Leu# 220- Pro Thr Gln Arg Leu Ile Ile Gly Glu Val Th - #r Pro Ala Thr Gln Gly225 2 - #30 2 - #35 2 -#40- Met Tyr Tyr Leu Ala Trp Gly Arg Met Asp Se - #r Pro His Glu Tyr Gly# 255- Thr Trp Val Arg Val Arg Met Phe Arg Pro Pr - #o Ser Leu Thr Leu Gln# 270- Pro His Ala Val Met Glu Gly Gln Pro Phe Ly - #s Ala Thr Cys Thr Ala# 285- Ala Ala Tyr Tyr Pro Arg Asn Pro Val Glu Ph - #e Val Trp Phe Glu Asp# 300- Asp His Gln Val Phe Asn Pro Gly Gln Ile As - #p Thr Gln Thr His Glu305 3 - #10 3 - #15 3 -#20- His Pro Asp Gly Phe Thr Thr Val Ser Thr Va - #l Thr Ser Glu Ala Val# 335- Gly Gly Gln Val Pro Pro Arg Thr Phe Thr Cy - #s Gln Met Thr Trp His# 350- Arg Asp Ser Val Thr Phe Ser Arg Arg Asn Al - #a Thr Gly Leu Ala Leu# 365- Val Leu Pro Arg Pro Thr Ile Thr Met Glu Ph - #e Gly Val Arg Ile Val# 380- Val Cys Thr Ala Gly Cys Val Pro Glu Gly Va - #l Thr Phe Ala Trp Phe385 3 - #90 3 - #95 4 -#00- Leu Gly Asp Asp Pro Ser Pro Ala Ala Lys Se - #r Ala Val Thr Ala Gln# 415- Glu Ser Cys Asp His Pro Gly Leu Ala Thr Va - #l Arg Ser Thr Leu Pro# 430- Ile Ser Tyr Asp Tyr Ser Glu Tyr Ile Cys Ar - #g Leu Thr Gly Tyr Pro# 445- Ala Gly Ile Pro Val Leu Glu His His Gly Se - #r His Gln Pro Pro Pro# 460- Arg Asp Pro Thr Glu Arg Gln Val Ile Glu Al - #a Ile Glu Trp Val Gly465 4 - #70 4 - #75 4 -#80- Ile Gly Ile Gly Val Leu Ala Ala Gly Val Le - #u Val Val Thr Ala Ile# 495- Val Tyr Val Val Arg Thr Ser Gln Ser Arg Gl - #n Arg His Arg Arg# 510- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1320 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- GATATTTAAT AAAACTATTA TGAAACTTCT TATAACTTAT TTGTTTTTAT TA - #AATGGGTT 60- GGGTTGGTTT TAAAATTACA TACGTGTATT AAGAATTAAC ATCATAAAGG AC - #ACACCCAT 120- GAAAAACATT TAAATTCTAT TAATTTGAAC GGATTAAACA TTTTCTCATT TT - #AAGAGTTG 180- CTACGACTTT TGATAGTAAA ATGATTAAAC TTCTATTTAT CTTATTTTAT TT - #TAACCCAA 240- TAACTGGATA TAAATGGGTA GACCCTCCTC GTAGGTATAA TTACACCGTT TT - #AAGAATGA 300- TTCCAGATAT TCCAAATCCA ATGGATCCTT CTAAAAACGC TGAAGTTCGG TA - #TGTAACTT 360- CTACTGACCC ATGTGATATG GTTGCTTTGA TTTCTAATCC AAATATAGAA TC - #TACAATTA 420- AAACGATTCA ATTTGTGCAA AAGAAAAAAT TTTACAATGC ATCTCTTAGT TG - #GTTTAAAG 480- TTGGAGATGA TTGTACATAT CCAATATATT TAATTCAATA TTTTGATTGT GA - #TCCTCAAA 540- GAGAATTTGG CATATGTTTA AAAAGATCTC CAGATTTTTG GAAACCATCG TT - #AGTTGGTT 600- ACACATTTTT AACTGATGAT GAATTGGGAT TAGTTTTAGC TGCCCCCGCT CC - #ATTTAATC 660- AAGGTCAATA TAGACGGGTT ATTCAAATTG AAAATGAAGT TTTTTATACT GA - #TTTTATGG 720- TTCAATTACC ACGAGAAACT TGTTATTTTT CTAAAGAAGA TAAATTTGAA CC - #AACTTTTA 780- TGGAATGGTG TAAGGAATCT AGATCTGTAG GAGCATCAAA AGTTGACGAT GA - #ACTTTTTT 840- ATCTAAATAG AGCTGGTCCC CAAACCCTGC TTAAATATTA TGTTATTAAA GA - #TTTTTATA 900- GACTTAACGG TAGAGAACCT CCAATAAAAT TTAAAGAAGC TCTTAGATAC GA - #TATACCAT 960- ATAAAGTGAA TGATAAATTT GATGATGAAT TACCATCGAG GCCACATATT AG - #TAATACTA1020- TTAATAAAAC TATTAAAGAA ATTGTAAATC TTGAAGATTA TTTTAAAAAT AC - #AAATGTTA1080- TAGATACTAC TACCCCAACA CCAATAAATA ATACCCCAAA AAATATAACC GT - #GGGAATTG1140- TTATAATTAT ATTAATAATA CTATTTATAA TTGGATTTTT TGTTTATAAA AG - #ACAAAAAA1200- TATATAATAA TTATAAAAAA TTAACAACAA ATGTTTAGCC TTTATAAATT AA - #TTTACAGA1260- ATAAACAACT GGGCGGTCTT TTGTTTAATA AAAATTCATG TACCTACAAC TT - #TTATTCAC1320- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 345 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- Met Ile Lys Leu Leu Phe Ile Leu Phe Tyr Ph - #e Asn Pro Ile Thr Gly# 15- Tyr Lys Trp Val Asp Pro Pro Arg Arg Tyr As - #n Tyr Thr Val Leu Arg# 30- Met Ile Pro Asp Ile Pro Asn Pro Met Asp Pr - #o Ser Lys Asn Ala Glu# 45- Val Arg Tyr Val Thr Ser Thr Asp Pro Cys As - #p Met Val Ala Leu Ile# 60- Ser Asn Pro Asn Ile Glu Ser Thr Ile Lys Th - #r Ile Gln Phe Val Gln#80- Lys Lys Lys Phe Tyr Asn Ala Ser Leu Ser Tr - #p Phe Lys Val Gly Asp# 95- Asp Cys Thr Tyr Pro Ile Tyr Leu Ile Gln Ty - #r Phe Asp Cys Asp Pro# 110- Gln Arg Glu Phe Gly Ile Cys Leu Lys Arg Se - #r Pro Asp Phe Trp Lys# 125- Pro Ser Leu Val Gly Tyr Thr Phe Leu Thr As - #p Asp Glu Leu Gly Leu# 140- Val Leu Ala Ala Pro Ala Pro Phe Asn Gln Gl - #y Gln Tyr Arg Arg Val145 1 - #50 1 - #55 1 -#60- Ile Gln Ile Glu Asn Glu Val Phe Tyr Thr As - #p Phe Met Val Gln Leu# 175- Pro Arg Glu Thr Cys Tyr Phe Ser Lys Glu As - #p Lys Phe Glu Pro Thr# 190- Phe Met Glu Trp Cys Lys Glu Ser Arg Ser Va - #l Gly Ala Ser Lys Val# 205- Asp Asp Glu Leu Phe Tyr Leu Asn Arg Ala Gl - #y Pro Gln Thr Leu Leu# 220- Lys Tyr Tyr Val Ile Lys Asp Phe Tyr Arg Le - #u Asn Gly Arg Glu Pro225 2 - #30 2 - #35 2 -#40- Pro Ile Lys Phe Lys Glu Ala Leu Arg Tyr As - #p Ile Pro Tyr Lys Val# 255- Asn Asp Lys Phe Asp Asp Glu Leu Pro Ser Ar - #g Pro His Ile Ser Asn# 270- Thr Ile Asn Lys Thr Ile Lys Glu Ile Val As - #n Leu Glu Asp Tyr Phe# 285- Lys Asn Thr Asn Val Ile Asp Thr Thr Thr Pr - #o Thr Pro Ile Asn Asn# 300- Thr Pro Lys Asn Ile Thr Val Gly Ile Val Il - #e Ile Ile Leu Ile Ile305 3 - #10 3 - #15 3 -#20- Leu Phe Ile Ile Gly Phe Phe Val Tyr Lys Ar - #g Gln Lys Ile Tyr Asn# 335- Asn Tyr Lys Lys Leu Thr Thr Asn Val# 345- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 345 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Met Ile Lys Leu Leu Phe Ile Leu Phe Tyr Ph - #e Asn Pro Ile Thr Gly# 15- Tyr Lys Trp Val Asp Pro Pro Arg Arg Tyr As - #n Tyr Thr Val Leu Arg# 30- Met Ile Pro Asp Ile Pro Asn Pro Met Asp Pr - #o Ser Lys Asn Ala Glu# 45- Val Arg Tyr Val Thr Ser Thr Asp Pro Cys As - #p Met Val Ala Leu Ile# 60- Ser Asn Pro Asn Ile Glu Ser Thr Ile Lys Th - #r Ile Gln Phe Val Gln#80- Lys Lys Lys Phe Tyr Asn Ala Ser Leu Ser Tr - #p Phe Lys Val Gly Asp# 95- Asp Cys Thr Tyr Pro Ile Tyr Leu Ile Gln Ty - #r Phe Asp Cys Asp Pro# 110- Gln Arg Glu Phe Gly Ile Cys Leu Lys Arg Se - #r Pro Asp Phe Trp Lys# 125- Pro Ser Leu Val Gly Tyr Thr Phe Leu Thr As - #p Asp Glu Leu Gly Leu# 140- Val Leu Ala Ala Pro Ala Pro Phe Asn Gln Gl - #y Gln Tyr Arg Arg Val145 1 - #50 1 - #55 1 -#60- Ile Gln Ile Glu Asn Glu Val Phe Tyr Thr As - #p Phe Met Val Gln Leu# 175- Pro Arg Glu Thr Cys Tyr Phe Ser Lys Glu As - #p Lys Phe Glu Pro Thr# 190- Phe Met Glu Trp Cys Lys Glu Ser Arg Ser Va - #l Gly Ala Ser Lys Val# 205- Asp Asp Glu Leu Phe Tyr Leu Asn Arg Ala Gl - #y Pro Gln Thr Leu Leu# 220- Lys Tyr Tyr Val Ile Lys Asp Phe Tyr Arg Le - #u Asn Gly Arg Glu Pro225 2 - #30 2 - #35 2 -#40- Pro Ile Lys Phe Lys Glu Ala Leu Arg Tyr As - #p Ile Pro Tyr Lys Val# 255- Asn Asp Lys Phe Asp Asp Glu Leu Pro Ser Ar - #g Pro His Ile Ser Asn# 270- Thr Ile Asn Lys Thr Ile Lys Glu Ile Val As - #n Leu Glu Asp Tyr Phe# 285- Lys Asn Thr Asn Val Ile Asp Thr Thr Thr Pr - #o Thr Pro Ile Asn Asn# 300- Thr Pro Lys Asn Ile Thr Val Gly Ile Val Il - #e Ile Ile Leu Ile Ile305 3 - #10 3 - #15 3 -#20- Leu Phe Ile Ile Gly Phe Phe Val Tyr Lys Ar - #g Gln Lys Ile Tyr Asn# 335- Asn Tyr Lys Lys Leu Thr Thr Asn Val# 345- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 374 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Met Met Thr Arg Leu His Phe Trp Trp Cys Gl - #y Ile Phe Ala Val Leu# 15- Lys Tyr Leu Val Cys Thr Ser Ser Leu Thr Th - #r Thr Pro Lys Thr Thr# 30- Thr Val Tyr Val Lys Gly Phe Asn Ile Pro Pr - #o Leu Arg Tyr Asn Tyr# 45- Thr Gln Ala Arg Ile Val Pro Lys Ile Pro Gl - #n Ala Met Asp Pro Lys# 60- Ile Thr Ala Glu Val Arg Tyr Val Thr Ser Me - #t Asp Ser Cys Gly Met#80- Val Ala Leu Ile Ser Glu Pro Asp Ile Asp Al - #a Thr Ile Arg Thr Ile# 95- Gln Leu Ser Gln Lys Lys Thr Tyr Asn Ala Th - #r Ile Ser Trp Phe Lys# 110- Val Thr Gln Gly Cys Glu Tyr Pro Met Phe Le - #u Met Asp Met Arg Leu# 125- Cys Asp Pro Lys Arg Glu Phe Gly Ile Cys Al - #a Leu Arg Ser Pro Ser# 140- Tyr Trp Leu Glu Pro Leu Thr Lys Tyr Met Ph - #e Leu Thr Asp Asp Glu145 1 - #50 1 - #55 1 -#60- Leu Gly Leu Ile Met Met Ala Pro Ala Gln Ph - #e Asn Gln Gly Gln Tyr# 175- Arg Arg Val Ile Thr Ile Asp Gly Ser Met Ph - #e Tyr Thr Asp Phe Met# 190- Val Gln Leu Ser Pro Thr Pro Cys Trp Phe Al - #a Lys Pro Asp Arg Tyr# 205- Glu Glu Ile Leu His Glu Trp Cys Arg Asn Va - #l Lys Thr Ile Gly Leu# 220- Asp Gly Ala Arg Asp Tyr His Tyr Tyr Trp Va - #l Pro Tyr Asn Pro Gln225 2 - #30 2 - #35 2 -#40- Pro His His Lys Ala Val Leu Leu Tyr Trp Ty - #r Arg Thr His Gly Arg# 255- Glu Pro Pro Val Arg Phe Gln Glu Ala Ile Ar - #g Tyr Asp Arg Pro Ala# 270- Ile Pro Ser Gly Ser Glu Asp Ser Lys Arg Se - #r Asn Asp Ser Arg Gly# 285- Glu Ser Ser Gly Pro Asn Trp Ile Asp Ile Gl - #u Asn Tyr Thr Pro Lys# 300- Asn Asn Val Pro Ile Ile Ile Ser Asp Asp As - #p Val Pro Thr Ala Pro305 3 - #10 3 - #15 3 -#20- Pro Lys Gly Met Asn Asn Gln Ser Val Val Il - #e Pro Ala Ile Val Leu# 335- Ser Cys Leu Ile Ile Ala Leu Ile Leu Gly Va - #l Ile Tyr Tyr Ile Leu# 350- Arg Val Lys Arg Ser Arg Ser Thr Ala Tyr Gl - #n Gln Leu Pro Ile Ile# 365- His Thr Thr His His Pro 370- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 442 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Met Pro Ala Val Leu Leu Val Leu Tyr Val As - #n Pro Pro Pro Ser Val# 15- Cys Ile Leu Thr Gln Lys Leu Ser Leu Gly Le - #u Tyr Asn Gln Trp Trp# 30- Arg Val Cys Arg Ser Val Pro Pro Pro Trp Ty - #r Val Phe Phe Asn Lys# 45- Arg Ser Met Ser Thr Phe Lys Leu Met Met As - #p Gly Arg Leu Val Phe# 60- Ala Met Ala Ile Ala Ile Leu Ser Val Val Le - #u Ser Cys Gly Thr Cys#80- Glu Lys Ala Lys Arg Ala Val Arg Gly Arg Gl - #n Asp Arg Pro Lys Glu# 95- Phe Pro Pro Pro Arg Tyr Asn Tyr Thr Ile Le - #u Thr Arg Tyr Asn Ala# 110- Thr Ala Leu Ala Ser Pro Phe Ile Asn Asp Gl - #n Val Lys Asn Val Asp# 125- Leu Arg Ile Val Thr Ala Thr Arg Pro Cys Gl - #u Met Ile Ala Leu Ile# 140- Ala Lys Thr Asn Ile Asp Ser Ile Leu Lys Gl - #u Leu Ala Ala Ala Gln145 1 - #50 1 - #55 1 -#60- Lys Thr Tyr Ser Ala Arg Leu Thr Trp Phe Ly - #s Ile Met Pro Thr Cys# 175- Ala Thr Pro Ile His Asp Val Ser Tyr Met Ly - #s Cys Asn Pro Lys Leu# 190- Ser Phe Ala Met Cys Asp Glu Arg Ser Asp Il - #e Leu Trp Gln Ala Ser# 205- Leu Ile Thr Met Ala Ala Glu Thr Asp Asp Gl - #u Leu Gly Leu Val Leu# 220- Ala Ala Pro Ala His Ser Ala Ser Gly Leu Ty - #r Arg Arg Val Ile Glu225 2 - #30 2 - #35 2 -#40- Ile Asp Gly Arg Arg Ile Tyr Thr Asp Phe Se - #r Val Thr Ile Pro Ser# 255- Glu Arg Cys Pro Ile Ala Phe Glu Leu Asn Ph - #e Gly Asn Pro Asp Arg# 270- Cys Lys Thr Pro Glu Gln Tyr Ser Arg Gly Gl - #u Val Phe Thr Arg Arg# 285- Phe Leu Gly Glu Phe Asn Phe Pro Gln Gly Gl - #u His Met Thr Trp Val# 300- Lys Phe Trp Phe Val Tyr Asp Gly Gly Asn Le - #u Pro Val Gln Phe Tyr305 3 - #10 3 - #15 3 -#20- Glu Ala Gln Ala Phe Ala Arg Pro Val Pro Pr - #o Asp Asn His Pro Gly# 335- Phe Asp Ser Val Glu Ser Glu Ile Thr Gln As - #n Lys Thr Asp Pro Lys# 350- Pro Gly Gln Ala Asp Pro Lys Pro Asn Gln Pr - #o Phe Lys Trp Pro Ser# 365- Ile Lys His Leu Val Pro Arg Leu Asp Glu Va - #l Asp Glu Val Ile Glu# 380- Pro Val Thr Lys Pro Pro Lys Thr Ser Lys Se - #r Asn Ser Thr Phe Val385 3 - #90 3 - #95 4 -#00- Gly Ile Ser Val Gly Leu Gly Ile Ala Gly Le - #u Val Leu Val Gly Val# 415- Ile Leu Tyr Val Cys Leu Arg Arg Lys Lys Gl - #u Leu Lys Val Cys Thr# 430- Glu Arg Leu Asp Ser Pro Thr Leu Asp Leu# 440- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 393 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: N-terminal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- Met Gly Gly Ala Ala Ala Arg Leu Gly Ala Va - #l Ile Leu Phe Val Val# 15- Ile Val Gly Leu His Gly Val Arg Gly Lys Ty - #r Ala Leu Ala Asp Ala# 30- Ser Leu Lys Met Ala Asp Pro Asn Arg Phe Ar - #g Gly Lys Asp Leu Pro# 45- Val Leu Asp Gln Leu Thr Asp Pro Pro Gly Va - #l Arg Arg Val Tyr His# 60- Ile Gln Ala Gly Leu Pro Asn Pro Phe Gln Pr - #o Pro Ser Leu Pro Ile#80- Thr Val Tyr Arg Arg Val Glu Arg Ala Cys Ar - #g Ser Val Leu Leu Asn# 95- Ala Pro Ser Glu Ala Pro Gln Ile Val Arg Gl - #y Ala Ser Glu Asp Val# 110- Arg Lys Gln Pro Tyr Asn Leu Thr Ile Ala Tr - #p Phe Arg Met Gly Gly# 125- Asn Cys Ala Ile Pro Ile Thr Val Met Glu Ty - #r Thr Glu Cys Ser Tyr# 140- Asn Lys Ser Leu Gly Ala Cys Pro Ile Arg Th - #r Gln Pro Arg Trp Asn145 1 - #50 1 - #55 1 -#60- Tyr Tyr Asp Ser Phe Ser Ala Val Ser Glu As - #p Asn Leu Gly Phe Leu# 175- Met His Ala Pro Ala Phe Glu Thr Ala Gly Th - #r Tyr Leu Arg Leu Val# 190- Lys Ile Asn Asp Trp Thr Glu Ile Thr Gln Ph - #e Ile Leu Glu His Arg# 205- Ala Lys Gly Ser Cys Lys Tyr Thr Leu Pro Le - #u Arg Ile Pro Pro Ser# 220- Ala Cys Leu Ser Pro Gln Ala Tyr Gln Gln Gl - #y Val Thr Val Asp Ser225 2 - #30 2 - #35 2 -#40- Ile Gly Met Leu Pro Arg Phe Ile Pro Glu As - #n Gln Arg Thr Val Ala# 255- Val Tyr Ser Leu Lys Ile Ala Gly Trp His Gl - #y Pro Arg Ala Pro Tyr# 270- Thr Ser Thr Leu Leu Pro Pro Glu Leu Pro Gl - #u Thr Pro Asn Ala Thr# 285- Gln Pro Glu Leu Ala Pro Glu Asp Pro Glu As - #p Ser Ala Leu Leu Glu# 300- Asp Pro Val Gly Thr Val Ala Pro Gln Ile Pr - #o Pro Asn Trp His Ile305 3 - #10 3 - #15 3 -#20- Pro Ser Ile Gln Asp Ala Ala Thr Pro Tyr Hi - #s Pro Pro Ala Thr Pro# 335- Asn Asn Met Gly Leu Ile Ala Gly Ala Val Gl - #y Gly Ser Leu Leu Ala# 350- Ala Leu Val Ile Cys Gly Ile Val Tyr Trp Me - #t Arg Arg Arg Thr Arg# 365- Lys Ala Pro Lys Arg Ile Arg Leu Pro His Il - #e Arg Glu Asp Asp Gln# 380- Pro Ser Ser His Gln Pro Leu Phe Tyr385 3 - #90- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:# 20 CGGG- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:# 28 ATGG GCCCTTAA- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 73 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- AGCTTCCCGG GTAAGTAATA CGTCAAGGAG AAAACGAAAC GATCTGTAGT TA - #GCGGCCGC 60# 73- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 69 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- AGGGCCCATT CATTATGCAG TTCCTCTTTT GCTTTGCTAG ACATCAATCG CC - #GGCGGATT 60# 69- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:# 20 CCGC- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:# 22CCG TT- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:# 20 GCAA- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 41 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:# 41 GCTC CCCGGGCTCG AGGGATCCGT T- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 39 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:# 39 AGGG GCCCGAGCTC CCTAGGCAA- (2) INFORMATION FOR SEQ ID NO:33:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:# 16- (2) INFORMATION FOR SEQ ID NO:34:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 12 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:# 12- (2) INFORMATION FOR SEQ ID NO:35:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 75 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:- TATGAGTAAC TTAACTCTTT TGTTAATTAA AAGTATATTC AAAAAATAAG TT - #ATATAAAT 60# 75- (2) INFORMATION FOR SEQ ID NO:36:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 73 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:- ACTCATTGAA TTGAGAAAAC AATTAATTTT CATATAAGTT TTTTATTCAA TA - #TATTTATC 60# 73- (2) INFORMATION FOR SEQ ID NO:37:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 49 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:# 49TGTTA ACTTTATATA ACTTATTTTT TGAATATAC- (2) INFORMATION FOR SEQ ID NO:38:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 67 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:- ACACGAATGA TTTTCTAAAG TATTTGGAAA GTTTTATAGG TAGTTGATAG AA - #CAAAATAC 60# 67- (2) INFORMATION FOR SEQ ID NO:39:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:# 51AGATTTC ATAAACCTTT CAAAATATCC ATCAACTATC T- (2) INFORMATION FOR SEQ ID NO:40:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 46 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:# 46TTT TATACTAAGA TCTCCCGGGC TGCAGC- (2) INFORMATION FOR SEQ ID NO:41:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 66 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:- TGTTTTATGT ATTAAAACAT TTTTATTTAG TGAAAAATAT GATTCTAGAG GG - #CCCGACGT 60# 66- (2) INFORMATION FOR SEQ ID NO:42:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 50 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:# 50CACCAA TTTAGATCTT ACTCAAAATA TGTAACAATA- (2) INFORMATION FOR SEQ ID NO:43:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 44 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:# 44 ACTC ATATTAATAA AAATAATATT TATT- (2) INFORMATION FOR SEQ ID NO:44:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 72 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:- GATCCTGAGT ACTTTGTAAT ATAATGATAT ATATTTTCAC TTTATCTCAT TT - #GAGAATAA 60# 72- (2) INFORMATION FOR SEQ ID NO:45:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 72 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:- GACTCATGAA ACATTATATT ACTATATATA AAAGTGAAAT AGAGTAAACT CT - #TATTTTTC 60# 72- (2) INFORMATION FOR SEQ ID NO:46:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 72 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:- GATCCAGATC TCCCGGGAAA AAAATTATTT AACTTTTCAT TAATAGGGAT TT - #GACGTATG 60# 72- (2) INFORMATION FOR SEQ ID NO:47:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 72 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:- GTCTAGAGGG CCCTTTTTTT AATAAATTGA AAAGTAATTA TCCCTAAACT GC - #ATACTACG 60# 72- (2) INFORMATION FOR SEQ ID NO:48:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:# 40 TGCA GGGCGCCGGA TCCTTTTTCT- (2) INFORMATION FOR SEQ ID NO:49:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:# 40 ACGT CCCGCGGCCT AGGAAAAAGA- (2) INFORMATION FOR SEQ ID NO:50:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 59 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:- CGATATCCGT TAAGTTTGTA TCGTAATGGG CTCCAGATCT TCTACCAGGA TC - #CCGGTAC 59- (2) INFORMATION FOR SEQ ID NO:51:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 55 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:- CGGGATCCTG GTAGAAGATC TGGAGCCCAT TACGATACAA ACTTAACGGA TA - #TCG 55- (2) INFORMATION FOR SEQ ID NO:52:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:# 17 G- (2) INFORMATION FOR SEQ ID NO:53:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 13 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:# 13- (2) INFORMATION FOR SEQ ID NO:54:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 26 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:# 26 AACT ACGTAG- (2) INFORMATION FOR SEQ ID NO:55:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 34 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:# 34 CTTT TTATAAAAAG AGCT- (2) INFORMATION FOR SEQ ID NO:56:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:# 20 ATCC- (2) INFORMATION FOR SEQ ID NO:57:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 44 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:# 44 TATA AAAATCATAT TTTTGTAGTG GCTC- (2) INFORMATION FOR SEQ ID NO:58:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 67 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:- AATTCAGGAT CGTTCCTTTA CTAGTTGAGA TTCTCAAGGA TGATGGGATT TA - #ATTTTTAT 60# 67- (2) INFORMATION FOR SEQ ID NO:59:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 67 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:- AATTCAAGCT TATAAAAATT AAATCCCATC ATCCTTGAGA ATCTCAACTA GT - #AAAGGAAC 60# 67- (2) INFORMATION FOR SEQ ID NO:60:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 68 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:- CTAGACACTT TATGTTTTTT AATATCCGGT CTTAAAAGCT TCCCGGGGAT CC - #TTATACGG 60# 68- (2) INFORMATION FOR SEQ ID NO:61:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 65 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:- ATTATTCCCC GTATAAGGAT CCCCCGGGAA GCTTTTAAGA CCGGATATTA AA - #AAACATAA 60# 65- (2) INFORMATION FOR SEQ ID NO:62:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3209 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:- TGAATGTTAA ATGTTATACT TTGGATGAAG CTATAAATAT GCATTGGAAA AA - #TAATCCAT 60- TTAAAGAAAG GATTCAAATA CTACAAAACC TAAGCGATAA TATGTTAACT AA - #GCTTATTC 120- TTAACGACGC TTTAAATATA CACAAATAAA CATAATTTTT GTATAACCTA AC - #AAATAACT 180- AAAACATAAA AATAATAAAA GGAAATGTAA TATCGTAATT ATTTTACTCA GG - #AATGGGGT 240- TAAATATTTA TATCACGTGT ATATCTATAC TGTTATCGTA TACTCTTTAC AA - #TTACTATT 300- ACGAATATGC AAGAGATAAT AAGATTACGT ATTTAAGAGA ATCTTGTCAT GA - #TAATTGGG 360- TACGACATAG TGATAAATGC TATTTCGCAT CGTTACATAA AGTCAGTTGG AA - #AGATGGAT 420- TTGACAGATG TAACTTAATA GGTGCAAAAA TGTTAAATAA CAGCATTCTA TC - #GGAAGATA 480- GGATACCAGT TATATTATAC AAAAATCACT GGTTGGATAA AACAGATTCT GC - #AATATTCG 540- TAAAAGATGA AGATTACTGC GAATTTGTAA ACTATGACAA TAAAAAGCCA TT - #TATCTCAA 600- CGACATCGTG TAATTCTTCC ATGTTTTATG TATGTGTTTC AGATATTATG AG - #ATTACTAT 660- AAACTTTTTG TATACTTATA TTCCGTAAAC TATATTAATC ATGAAGAAAA TG - #AAAAAGTA 720- TAGAAGCTGT TCACGAGCGG TTGTTGAAAA CAACAAAATT ATACATTCAA GA - #TGGCTTAC 780- ATATACGTCT GTGAGGCTAT CATGGATAAT GACAATGCAT CTCTAAATAG GT - #TTTTGGAC 840- AATGGATTCG ACCCTAACAC GGAATATGGT ACTCTACAAT CTCCTCTTGA AA - #TGGCTGTA 900- ATGTTCAAGA ATACCGAGGC TATAAAAATC TTGATGAGGT ATGGAGCTAA AC - #CTGTAGTT 960- ACTGAATGCA CAACTTCTTG TCTGCATGAT GCGGTGTTGA GAGACGACTA CA - #AAATAGTG1020- AAAGATCTGT TGAAGAATAA CTATGTAAAC AATGTTCTTT ACAGCGGAGG CT - #TTACTCCT1080- TTGTGTTTGG CAGCTTACCT TAACAAAGTT AATTTGGTTA AACTTCTATT GG - #CTCATTCG1140- GCGGATGTAG ATATTTCAAA CACGGATCGG TTAACTCCTC TACATATAGC CG - #TATCAAAT1200- AAAAATTTAA CAATGGTTAA ACTTCTATTG AACAAAGGTG CTGATACTGA CT - #TGCTGGAT1260- AACATGGGAC GTACTCCTTT AATGATCGCT GTACAATCTG GAAATATTGA AA - #TATGTAGC1320- ACACTACTTA AAAAAAATAA AATGTCCAGA ACTGGGAAAA ATTGATCTTG CC - #AGCTGTAA1380- TTCATGGTAG AAAAGAAGTG CTCAGGCTAC TTTTCAACAA AGGAGCAGAT GT - #AAACTACA1440- TCTTTGAAAG AAATGGAAAA TCATATACTG TTTTGGAATT GATTAAAGAA AG - #TTACTCTG1500- AGACACAAAA GAGGTAGCTG AAGTGGTACT CTCAAAATGC AGAACGATGA CT - #GCGAAGCA1560- AGAAGTAGAG AAATAACACT TTATGACTTT CTTAGTTGTA GAAAAGATAG AG - #ATATAATG1620- ATGGTCATAA ATAACTCTGA TATTGCAAGT AAATGCAATA ATAAGTTAGA TT - #TATTTAAA1680- AGGATAGTTA AAAATAGAAA AAAAGAGTTA ATTTGTAGGG TTAAAATAAT AC - #ATAAGATC1740- TTAAAATTTA TAAATACGCA TAATAATAAA AATAGATTAT ACTTATTACC TT - #CAGAGATA1800- AAATTTAAGA TATTTACTTA TTTAACTTAT AAAGATCTAA AATGCATAAT TT - #CTAAATAA1860- TGAAAAAAAA GTACATCATG AGCAACGCGT TAGTATATTT TACAATGGAG AT - #TAACGCTC1920- TATACCGTTC TATGTTTATT GATTCAGATG ATGTTTTAGA AAAGAAAGTT AT - #TGAATATG1980- AAAACTTTAA TGAAGATGAA GATGACGACG ATGATTATTG TTGTAAATCT GT - #TTTAGATG2040- AAGAAGATGA CGCGCTAAAG TATACTATGG TTACAAAGTA TAAGTCTATA CT - #ACTAATGG2100- CGACTTGTGC AAGAAGGTAT AGTATAGTGA AAATGTTGTT AGATTATGAT TA - #TGAAAAAC2160- CAAATAAATC AGATCCATAT CTAAAGGTAT CTCCTTTGCA CATAATTTCA TC - #TATTCCTA2220- GTTTAGAATA CTTTTCATTA TATTTGTTTA CAGCTGAAGA CGAAAAAAAT AT - #ATCGATAA2280- TAGAAGATTA TGTTAACTCT GCTAATAAGA TGAAATTGAA TGAGTCTGTG AT - #AATAGCTA2340- TAATCAGAGA AGTTCTAAAA GGAAATAAAA ATCTAACTGA TCAGGATATA AA - #AACATTGG2400- CTGATGAAAT CAACAAGGAG GAACTGAATA TAGCTAAACT ATTGTTAGAT AG - #AGGGGCCA2460- AAGTAAATTA CAAGGATGTT TACGGTTCTT CAGCTCTCCA TAGAGCTGCT AT - #TGGTAGGA2520- AACAGGATAT GATAAAGCTG TTAATCGATC ATGGAGCTGA TGTAAACTCT TT - #AACTATTG2580- CTAAAGATAA TCTTATTAAA AAAAAATAAT ATCACGTTTA GTAATATTAA AA - #TATATTAA2640- TAACTCTATT ACTAATAACT CCAGTGGATA TGAACATAAT ACGAAGTTTA TA - #CATTCTCA2700- TCAAAATCTT ATTGACATCA AGTTAGATTG TGAAAATGAG ATTATGAAAT TA - #AGGAATAC2760- AAAAATAGGA TGTAAGAACT TACTAGAATG TTTTATCAAT AATGATATGA AT - #ACAGTATC2820- TAGGGCTATA AACAATGAAA CGATTAAAAA TTATAAAAAT CATTTCCCTA TA - #TATAATAC2880- GCTCATAGAA AAATTCATTT CTGAAAGTAT ACTAAGACAC GAATTATTGG AT - #GGAGTTAT2940- AAATTCTTTT CAAGGATTCA ATAATAAATT GCCTTACGAG ATTCAGTACA TT - #ATACTGGA3000- GAATCTTAAT AACCATGAAC TAAAAAAAAT TTTAGATAAT ATACATTAAA AA - #GGTAAATA3060- GATCATCTGT TATTATAAGC AAAGATGCTT GTTGCCAATA ATATACAACA GG - #TATTTGTT3120- TTTATTTTTA ACTACATATT TGATGTTCAT TCTCTTTATA TAGTATACAC AG - #AAAATTCA3180# 3209 TCTA GTTATCTAG- (2) INFORMATION FOR SEQ ID NO:63:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:63:# 29 AGCT AGCTAGTTT- (2) INFORMATION FOR SEQ ID NO:64:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 46 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64:# 46GGG AATTCTAGCT AGCTAGTTTT TATAAA- (2) INFORMATION FOR SEQ ID NO:65:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 50 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65:# 50CTAGCT AGCTAGAATT CCCGGGAAGC TTTTGAGAGT- (2) INFORMATION FOR SEQ ID NO:66:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 71 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:- CTGAAATTAT TTCATTATCG CGATATCCGT TAAGTTTGTA TCGTAATGGT TC - #CTCAGGCT 60# 71- (2) INFORMATION FOR SEQ ID NO:67:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 48 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:67:# 48TAAC GGATATCGCG ATAATGAAAT AATTTCAG- (2) INFORMATION FOR SEQ ID NO:68:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 73 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:- ACCCCTTCTG GTTTTTCCGT TGTGTTTTGG GAAATTCCCT ATTTACACGA TC - #CCAGACAA 60# 73- (2) INFORMATION FOR SEQ ID NO:69:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:# 51TTGTCTG GGATCGTGTA AATAGGGAAT TTCCCAAAAC A- (2) INFORMATION FOR SEQ ID NO:70:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70:#45 AGGG GTACAAACAG GAGAGCCTGA GGAAC- (2) INFORMATION FOR SEQ ID NO:71:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 11 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:# 11- (2) INFORMATION FOR SEQ ID NO:72:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 3659 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72:- GATATCTGTG GTCTATATAT ACTACACCCT ACCGATATTA ACCAACGAGT TT - #CTCACAAG 60- AAAACTTGTT TAGTAGATAG AGATTCTTTG ATTGTGTTTA AAAGAAGTAC CA - #GTAAAAAG 120- TGTGGCATAT GCATAGAAGA AATAAACAAA AAACATATTT CCGAACAGTA TT - #TTGGAATT 180- CTCCCAAGTT GTAAACATAT TTTTTGCCTA TCATGTATAA GACGTTGGGC AG - #ATACTACC 240- AGAAATACAG ATACTGAAAA TACGTGTCCT GAATGTAGAA TAGTTTTTCC TT - #TCATAATA 300- CCCAGTAGGT ATTGGATAGA TAATAAATAT GATAAAAAAA TATTATATAA TA - #GATATAAG 360- AAAATGATTT TTACAAAAAT ACCTATAAGA ACAATAAAAA TATAATTACA TT - #TACGGAAA 420- ATAGCTGGTT TTAGTTTACC AACTTAGAGT AATTATCATA TTGAATCTAT AT - #TGTTTTTT 480- AGTTATATAA AAACATGATT AGCCCCCAAT CGGATGAAAA TATAAAAGAT GT - #TGAGAATT 540- TCGAATACAA CAAAAAGAGG AATCGTACGT TGTCCATATC CAAACATATA AA - #TAAAAATT 600- CAAAAGTAGT ATTATACTGG ATGTTTAGAG ATCAACGTGT ACAAGATAAT TG - #GGCTTTAA 660- TTTACGCACA ACGATTAGCG TTAAAACTCA AAATACCTCT AAGAATATGC TT - #TTGTGTCG 720- TGCCAAAATT TCACACTACT ACTTCTAGAC ACTTTATGTT TTTAATATCC GG - #TCTTAAAG 780- AAGTCGCGGA AGAATGTAAA AGACTATGTA TAGGGTTTTC ATTGATATAT GG - #CGTACCAA 840- AAGTAATAAT TCCGTGTATA GTAAAAAAAT ACAGAGTCGG AGTAATCATA AC - #GGATTTCT 900- TTCCATTACG TGTTCCCGAA AGATTAATGA AACAGACTGT AATATCTCTT CC - #AGATAACA 960- TACCTTTTAT ACAAGTAGAC GCTCATAATA TAGTACCTTG TTGGGAAGCT TC - #TGATAAAG1020- AAGAATACGG TGCACGAACT TTAAGAAAAA AGATATTTGA TAAATTATAT GA - #ATATATGA1080- CAGAATTTCC TGTTGTTCGT AAACATCCAT ACGGTCCATT TTCTATATCT AT - #TGCAAAAC1140- CCAAAAATAT ATCATTAGAC AAGACGGTAT TACCCGTAAA ATGGGCAACG CC - #TGGAACAA1200- AAGCTGGAAT AATTGTTTTA AAAGAATTTA TAAAAAACAG ATTACCGTCA TA - #CGACGCGG1260- ATCATAACAA TCCTACGTGT GACGCTTTGA GTAACTTATC TCCGTGGCTA CA - #TTTTGGTC1320- ATGTATCCGC ACAACGTGTT GCCTTAGAAG TATTAAAATG TATACGAGAA AG - #CAAAAAAA1380- ACGTTGAAAC GTTTATAGAT GAAATAATTG TAAGAAGAGA ACTATCGGAT AA - #TTTTTGTT1440- ACTATAACAA ACATTATGAT AGTATCCAGT CTACTCATTC ATGGGTTAGA AA - #AACATTAG1500- AAGATCACAT TAATGATCCT AGAAAGTATA TATATTCCAT TAAACAACTC GA - #AAAAGCGG1560- AAACTCATGA TCCTCTATGG AACGCGTCAC AAATGCAGAT GGTGAGAGAA GG - #AAAAATGC1620- ATAGTTTTTT ACGAATGTAT TGGGCTAAGA AGATACTTGA ATGGACTAGA AC - #ACCTGAAG1680- ACGCTTTGAG TTATAGTATC TATTTGAACA ACAAGTACGA ACTAGACGGC AC - #GGATCCTA1740- ACGGATACGT AGGTTGTATG TGGTCTATTT GCGGATTACA CGATAGAGCG TG - #GAAAGCAA1800- GACCGATATT TGGAAAGATA AGATATATGA ATTATGAGAG TTCTAAGAAG AA - #ATTTGATG1860- TTGCTGTATT TATACAGAAA TACAATTAAG ATAAATAATA TACAGCATTG TA - #ACCATCGT1920- CATCCGTTAT ACGGGGAATA ATATTACCAT ACAGTATTAT TAAATTTTCT TA - #CGAAGAAT1980- ATAGATCGGT ATTTATCGTT AGTTTATTTT ACATTTATTA ATTAAACATG TC - #TACTATTA2040- CCTGTTATGG AAATGACAAA TTTAGTTATA TAATTTATGA TAAAATTAAG AT - #AATAATAA2100- TGAAATCAAA TAATTATGTA AATGCTACTA GATTATGTGA ATTACGAGGA AG - #AAAGTTTA2160- CGAACTGGAA AAAATTAAGT GAATCTAAAA TATTAGTCGA TAATGTAAAA AA - #AATAAATG2220- ATAAAACTAA CCAGTTAAAA ACGGATATGA TTATATACGT TAAGGATATT GA - #TCATAAAG2280- GAAGAGATAC TTGCGGTTAC TATGTACACC AAGATCTGGT ATCTTCTATA TC - #AAATTGGA2340- TATCTCCGTT ATTCGCCGTT AAGGTAAATA AAATTATTAA CTATTATATA TG - #TAATGAAT2400- ATGATATACG ACTTAGCGAA ATGGAATCTG ATATGACAGA AGTAATAGAT GT - #AGTTGATA2460- AATTAGTAGG AGGATACAAT GATGAAATAG CAGAAATAAT ATATTTGTTT AA - #TAAATTTA2520- TAGAAAAATA TATTGCTAAC ATATCGTTAT CAACTGAATT ATCTAGTATA TT - #AAATAATT2580- TTATAAATTT TATAAATTTT AATAAAAAAT ACAATAACGA CATAAAGATA TT - #TAATCTTT2640- AATTCTTGAT CTGAAAAACA CATCTATAAA ACTAGATAAA AAGTTATTCG AT - #AAAGATAA2700- TAATGAATCG AACGATGAAA AATTGGAAAC AGAAGTTGAT AAGCTAATTT TT - #TTCATCTA2760- AATAGTATTA TTTTATTGAA GTACGAAGTT TTACGTTAGA TAAATAATAA AG - #GTCGATTT2820- TTACTTTGTT AAATATCAAA TATGTCATTA TCTGATAAAG ATACAAAAAC AC - #ACGGTGAT2880- TATCAACCAT CTAACGAACA GATATTACAA AAAATACGTC GGACTATGGA AA - #ACGAAGCT2940- GATAGCCTCA ATAGAAGAAG CATTAAAGAA ATTGTTGTAG ATGTTATGAA GA - #ATTGGGAT3000- CATCCTCAAC GAAGAAATAG ATAAAGTTCT AAACTGGAAA AATGATACAT TA - #AACGATTT3060- AGATCATCTA AATACAGATG ATAATATTAA GGAAATCATA CAATGTCTGA TT - #AGAGAATT3120- TGCGTTTAAA AAGATCAATT CTATTATGTA TAGTTATGCT ATGGTAAAAC TC - #AATTCAGA3180- TAACGAACAT TGAAAGATAA AATTAAGGAT TATTTTATAG AAACTATTCT TA - #AAGACAAA3240- CGTGGTTATA AACAAAAGCC ATTACCCGGA TTGGAAACTA AAATACTAGA TA - #GTATTATA3300- AGATTTTAAA AACATAAAAT TAATAGGTTT TTATAGATTG ACTTATTATA TA - #CAATATGG3360- ATAAAAGATA TATATCAACT AGAAAGTTGA ATGACGGATT CTTAATTTTA TA - #TTATGATT3420- CAATAGAAAT TATTGTCATG TCGTGTAATC ATTTTATAAA TATATCAGCG TT - #ACTAGCTA3480- AGAAAAACAA GGACTTTAAT GAATGGCTAA AGATAGAATC ATTTAGAGAA AT - #AATAGATA3540- CTTTAGATAA AATTAATTAC GATCTAGGAC AACGATATTG TGAAGAACTT AC - #GGCGCATC3600- ACATTCCAGT GTAATTATTG AGGTCAAAGC TAGTAACTTA ATAGATGACA GG - #ACAGCTG3659- (2) INFORMATION FOR SEQ ID NO:73:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73:- TCATTATCGC GATATCCGTG TTAACTAGCT AGCTAATTTT TATTCCCGGG AT - #CCTTATCA 60- (2) INFORMATION FOR SEQ ID NO:74:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74:- GTATAAGGAT CCCGGGAATA AAAATTAGCT AGCTAGTTAA CACGGATATC GC - #GATAATGA 60- (2) INFORMATION FOR SEQ ID NO:75:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2356 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75:- TGTCTGGACT AACTGATTTC ATGGAACAAT TTTCATCAAA AATATCAGTT AT - #ACCTAGTT 60- CTACAAAGAC AGAACTTTGA TGTTATGTTT GTGTTTGTAT AGAAAATTTT GG - #GATACTAA 120- CTGATATTTC TGAATATTTC TGAATATTTC ATGTTACTTA CTTACTCCTA TC - #TTAGACGA 180- TAATAAAATT CGAGGCGTAA TATGTTTTTC CAAATATTTG AAATTCTTAT AC - #GTATCGGC 240- GAAGAAAAGT AACATACTAT AAGTGTTATG CAAGTAAGGT ATGTTAATGA TA - #TTGGATTT 300- AATTTCATTG ACAATACATA TGTCCAAACA TTCCACTCGT AATTATGTAC GG - #AACGACTT 360- TAGTTAAATA CTTAGTCACA AAAAACTTAT GACTGTCATT ATCTGAAAAC GG - #TGATTCCC 420- ATAAATCAGA ATACTTAATA TTAAATAGAA TGCTCGCTTC TGGAGGTTTC CG - #GATACTAG 480- ATAACATATC TTCTGTATTA TAGTTTAATT CACTCATTTT ATTACATAAT AC - #AGTAACAT 540- CTCCCGAAAC CAATGATGTT ATATTAGATT TACTTACATA CTTCTTGTAA CT - #ATCATGAA 600- TACGTTTGTT ATGATCTATA AAGAAGATGG ATGTATATTC TGTTCTAGAT AG - #CAAGTTCT 660- TTAAGTTATT CTTTGTCTGT ATTACTATCA TCGTCTTCAT CATCGTCTAA AG - #GTAGCATT 720- ATATAATAAA TCTAATAGTT GATTTCTCGA TCTATCAGTA CTCGCTTTCA AT - #AACATTTT 780- TACTATAAGC ATAATAGAAG GCGGTGATAT CACTATATTT TTATCGGGTA TT - #CTTTTAGT 840- AATTAGTTAG TTCGTAGAAT TTCGTAGAGA TAAAAGCCAA TTTGTTGTTG AT - #ACTGCTTA 900- CGTTACTCAT GTTTCTTGTT TCTGTTAATT AACAGGTATA CCCTTACAAT AA - #GTTTAATT 960- AACTTTTAGG TTTTTGTGAA GAACTTTTAG CTTCTAGTTC CCTTATCCAT AA - #TTGGGTCT1020- TAGATCTAGA TTCTTCCCAT GTATAAAGGG GGACATACCC AAAATCTTTA AA - #TGCTTTGT1080- CCGTTTCTAT AGTAAATGTC GTACATTCCT TAATCAAAGT ATAAGGATTT AG - #TAAAGGCG1140- TGTAAGAACA AATAGGTGAT AGTAATACTC TTAAACCTTT ATTAATATTA GC - #GATAAACC1200- TTAAACACCA TAAAGGAAGA CATGTATTCC GTAGATCCAT CCCTAATTGA TT - #AAAGAAAT1260- GCATGTTAAA ATCATGATAA TGTTCAGTAG GAGAGGTATC GTAACAGTAA TA - #CACGTTAT1320- TGCAGAGAGG ACTATGTTGA CCATTTTCTA TCATATTTCT TGCTGCTAAA AT - #ATGCATCC1380- AAGCTACGTT TCCTGCATAG ACTCTGCTAT GAAATACTTT ATCATCCGCA TA - #TTTATACA1440- TTTTCCTGCT TTTATACGAT CTTCTGTATA AAGTTTCTAG TACTGGACAG TA - #TTCTCCGA1500- AAACACCTAA TGGGCGTAGC GACAAGTGCA TAATCTAAGT CCTATATTAG AC - #ATAGTACC1560- GTTAGCTTCT AGTATATATT TCTCAGATAA CTTGTTTACT AAGAGGATAA GC - #CTCTTTAT1620- GGTTAGATTG ATAATACGTA TTCTCGTTTC CTCTTATCAT CGCATCTCCG GA - #GAAAGTTA1680- GGACCTACCG CAGAATAACT ACTCGTATAT ACTAAGACTC TTACGCCGTT AT - #ACAGACAA1740- GAATCTACTA CGTTCTTCGT TCCGTTGATA TTAACGTCCA TTATAGAGTC GT - #TAGTAAAC1800- TTACCCGCTA CATCATTTAT CGAAGCAATA TGAATGACCA CATCTGCTGA TC - #TAAGCGCT1860- TCGTCCAAAG TACTTTTATT TCTAACATCT CCAATCACGG GAACTATCTT TA - #TTATATTA1920- CATTTTTCTA CAAGATCTAG TAACCATTGG TCGATTCTAA TATCGTAAAC AC - #GAACTTCT1980- TTTTAAAGAG GATTCGAACA AGATAAGATT ATTTATAATG TGTCTACCTA AA - #AATCCACA2040- CCCTCCGGTT ACCACGTATA CTAGTGTACG CATTTTGAGT ATTAACTATA TA - #AGACCAAA2100- ATTATATTTT CATTTTCTGT TATATTATAC TATATAATAA AAACAAATAA AT - #ATACGAAT2160- ATTATAAGAA ATTTAGAACA CGTTATTAAA GTATTGCCTT TTTTATTAAC GG - #CGTGTTCT2220- TGTAATTGCC GTTTAGAATA GTCTTTATTT ACTTTAGATA ACTCTTCTAT CA - #TAACCGTC2280- TCCTTATTCC AATCTTCTTC AGAAGTACAT GAGTACTTAC CGAAGTTTAT CA - #TCATAGAG2340# 2356- (2) INFORMATION FOR SEQ ID NO:76:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 24 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:# 24TATT AGAC- (2) INFORMATION FOR SEQ ID NO:77:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:77:# 18 AC- (2) INFORMATION FOR SEQ ID NO:78:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 18 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78:# 18 CG- (2) INFORMATION FOR SEQ ID NO:79:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79:# 29 AAGG GTATACCTG- (2) INFORMATION FOR SEQ ID NO:80:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 61 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:- AACGATTAGT TAGTTACTAA AAGCTTGCTG CAGCCCGGGT TTTTTATTAG TT - #TAGTTAGT 60# 61- (2) INFORMATION FOR SEQ ID NO:81:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 60 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:81:- GACTAACTAA CTAATAAAAA ACCCGGGCTG CAGCAAGCTT TTTGTAACTA AC - #TAATCGTT 60- (2) INFORMATION FOR SEQ ID NO:82:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 99 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82:- GCACGGAACA AAGCTTATCG CGATATCCGT TAAGTTTGTA TCGTAATGCT AT - #CAATCACG 60# 99 TAGC AGAGGGCTCA TCTCAGAAT- (2) INFORMATION FOR SEQ ID NO:83:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 99 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:- ATTCTGAGAT GAGCCCTCTG CTATGAGCAG GAACAGAATC GTGATTGATA GC - #ATTACGAT 60# 99 TCGC GATAAGCTTT GTTCCGTGC- (2) INFORMATION FOR SEQ ID NO:84:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 66 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:84:- GAAAAATTTA AAGTCGACCT GTTTTGTTGA GTTGTTTGCG TGGTAACCAA TG - #CAAATCTG 60# 66- (2) INFORMATION FOR SEQ ID NO:85:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 66 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:- TCTAGCAAGA CTGACTATTG CAAAAAGAAG CACTATTTCC TCCATTACGA TA - #CAAACTTA 60# 66- (2) INFORMATION FOR SEQ ID NO:86:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 87 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86:- ATCCGTTAAG TTTGTATCGT AATGGAGGAA ATAGTGCTTC TTTTTGCAAT AG - #TCAGTCTT 60# 87 TTTG CATTGGT- (2) INFORMATION FOR SEQ ID NO:87:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 49 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87:# 49TCAAC AAAACAGGTC GACTTTAAAT TTTTCTGCA- (2) INFORMATION FOR SEQ ID NO:88:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 132 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:88:- GTACAGGTCG ACAAGCTTCC CGGGTATCGC GATATCCGTT AAGTTTGTAT CG - #TAATGAAT 60- ACTCAAATTC TAATACTCAC TCTTGTGGCA GCCATTCACA CAAATGCAGA CA - #AAATCTGC 120# 132- (2) INFORMATION FOR SEQ ID NO:89:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 132 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:- ATGATGTCCA AGGCAGATTT TGTCTGCATT TGTGTGAATG GCTGCCACAA GA - #GTGAGTAT 60- TAGAATTTGA GTATTCATTA CGATACAAAC TTAACGGATA TCGCGATACC CG - #GGAAGCTT 120# 132- (2) INFORMATION FOR SEQ ID NO:90:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90:# 51CACCATT TGTATATAAG TTAACGAATT CCAAGTCAAG C- (2) INFORMATION FOR SEQ ID NO:91:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 51 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:91:# 51TTCGTTA ACTTATATAC AAATGGTGCA CCGCATGTTA T- (2) INFORMATION FOR SEQ ID NO:92:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 16 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92:# 16- (2) INFORMATION FOR SEQ ID NO:93:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 29 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:# 29 TACT TTCATTTTC- (2) INFORMATION FOR SEQ ID NO:94:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 88 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94:- TTGTCGACTG AGATAAAGTG AAAATATATA TCATTATATT ACAAAGTACA AT - #TATTTAGG 60# 88 TTGT ATCTATAT- (2) INFORMATION FOR SEQ ID NO:95:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 56 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:95:- TTAGTACTTT CCGGTGTTGT TGGATCACAT ATTATTAAAG TATAAATAAT AA - #AGAA 56- (2) INFORMATION FOR SEQ ID NO:96:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:96:# 20 AACT- (2) INFORMATION FOR SEQ ID NO:97:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97:#21 ATTT C- (2) INFORMATION FOR SEQ ID NO:98:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 28 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:# 28 AACA CTAGAACC- (2) INFORMATION FOR SEQ ID NO:99:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 27 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:# 27 CAAA ATTCCAT- (2) INFORMATION FOR SEQ ID NO:100:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:100:# 20 CACC- (2) INFORMATION FOR SEQ ID NO:101:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:101:# 20 GCAC- (2) INFORMATION FOR SEQ ID NO:102:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 49 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:102:# 49TCATA TGTCCCCTTT CTTTGGATTA CGAGATGGT- (2) INFORMATION FOR SEQ ID NO:103:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 35 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:103:# 35 AGAA AGGGGACATA TGAAT- (2) INFORMATION FOR SEQ ID NO:104:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2951 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:104:- AGTACAATAA AAAGTATTAA ATAAAAATAC TTACTTACGA AAAAATGACT AA - #TTAGCTAT 60- AAAAACCCGG GAAAGGATCC TGATCCTTTT TCTGGGTAAG TAATACGTCA AG - #GAGAAAAC 120- GAAACGATCT GTAGTTAGCG GCCAAACTCG AGGTCGACTG AGATAAAGTG AA - #AATATATA 180- TCATTATATT ACAAAGTACA ATTATTTAGG TTTAATCATG TTTTCATTGT AT - #CTATATAT 240- TTTTTTTATT ATTTATACTT TAATAATATG TGATCCAACA ACACCGGAAA GT - #ACTATTAA 300- TCCATTAAAT CATCACAATT TATCAACACC TAAACCTACT TCGGATGATA TT - #CGTGAAAT 360- TTTACGTGAA TCCCAAATTG AATCTGATGA TACATCAACA TTTTACATGT GC - #CCACCACC 420- ATCGGGATCA ACATTGGTGC GTTTGGAGCC ACCTAGAGCA TGTCCTAACT AT - #AAACTTGG 480- TAAAAATTTT ACAGAAGGAA TTGCTGTAAT ATTTAAGGAA AATATTTCTC CT - #TATAAATT 540- TAAAGCTAAT ATATACTACA AAAATATTAT TATCACCACT GTATGGTCTG GA - #AGCACATA 600- TGCAGTAATT ACTAATAGAT ATACAGATCG TGTACCTATA GGTGTTCCTG AA - #ATTACAGA 660- GTTGATTGAT AGAAGAGGTA TGTGTTTATC AAAAGCTGAT TATATTCGTA AT - #AATTATGA 720- ATTTACCGCA TTTGATAAGG ATGAAGACCC CAGAGAAGTT CATTTAAAGC CT - #TCAAAGTT 780- TAATACACCA GGATCCCGTG GATGGCATAC AGTTAATGAT ACTTACACAA AA - #ATTGGGGG 840- TTCTGGATTT TATCATTCTG GAACATCTGT AAATTGTATA GTTGAAGAAG TT - #GATGCCAG 900- ATCTGTTTAT CCATATGATT CATTTGCTAT CTCCACCGGG GATATAATTC AT - #ATGTCCCC 960- TTTTTTTGGA TTACGAGATG GTGCTCATAC TGAATATATT AGTTATTCAA CT - #GATAGATT1020- TCAACAAATA GAAGGTTATT ATCCTATCGA CTTAGATACT AGACTACAGC TT - #GGTGCACC1080- AGTTTCTAGG AATTTTTTAA CAACACAACA CGTTACTGTT GCTTGGAATT GG - #GTTCCAAA1140- AATTCGTGAA GTGTGTACTT TGGCTAAATG GCGTGAAATT GATGAAATTA TT - #CGTGATGA1200- GTATAAGGGA TCTTACAGAT TTACAGCAAA ATCAATATCT GCAACATTTA TT - #TCTGATAC1260- TACTCAATTT GATATTGATC GTGTAAAGTT AAGTGATTGT GCCAAACGTG AA - #GCCATAGA1320- AGCTATTGAT AAGATCTACA AAAAAAAATA TAATAAAACT CATATTCAAA CA - #GGAGAATT1380- GGAAACATAC TTGGCTAGAG GGGGATTTAT TATAGCATTT AGACCAATGA TT - #AGTAATGA1440- GTTAGCAAAA TTGTATATAA ATGAGTTAGT AAGATCTAAT CGTACGGTTG AT - #TTGAAATC1500- TCTTTTAAAT CCATCTGTAA GAGGGGGGGC TAGAAAGAGA AGATCAGTAG AG - #GAAAATAA1560- AAGATCAAAA CGTAATATTG AAGGTGGTAT TGAAAATGTA AATAATTCAA CA - #ATAATTAA1620- GACAACTTCA TCTGTTCATT TTGCTATGCT TCAGTTTGCC TATGATCATA TT - #CAATCACA1680- TGTTAATGAA ATGCTTAGTA GAATTGCAAC TGCATGGTGT AATCTTCAAA AT - #AAAGAGAG1740- AACCCTTTGG AATGAAGTTA TGAAACTTAA TCCAACTAGT GTGGCTTCGG TT - #GCTATGGA1800- TCAAAGAGTT TCAGCACGAA TGTTAGGGGA TGTTCTTGCA GTTACTCAAT GT - #GTTAATAT1860- ATCAGGTTCT AGTGTTTTTA TTCAAAATTC CATGCGTGTT TTAGGGTCAA CA - #ACTACATG1920- TTACAGTCGT CCTCTTATAT CATTTAAAGC ACTAGAAAAC TCAACTAACT AT - #ATTGAAGG1980- ACAACTTGGG GAAAATAATG AACTATTAGT AGAACGAAAG CTAATTGAAC CA - #TGTACAGC2040- TAACCATAAA AGATATTTTA AATTTGGTGC AGATTATGTA TATTTTGAAA AC - #TATGCATA2100- TGTTCGAAAG GTACCTCTTA ATGAAATTGA AATGATCAGT GCATATGTAG AT - #CTTAATAT2160- TACATTACTT GAGGATCGTG AATTTTTACC ACTAGAGGTA TATACTCGAG CA - #GAGTTAGA2220- AGATACAGGA CTATTGGACT ATAGTGAGAT TCAACGTAGA AATCAACTAC AT - #GCACTTAA2280- GTTTTATGAT ATTGACAGTG TTGTAAAAGT TGATAATAAT GTTGTAATTA TG - #AGGGGCAT2340- TGCAAATTTT TTCCAAGGAC TTGGAGATGT TGGAGCGGGA TTTGGAAAAG TT - #GTTTTGGG2400- TGCTGCAAAT GCTGTTATTG CAACTGTTTC TGGAGTGTCC TCGTTTCTTA AT - #AACCCATT2460- TGGGGCGCTA GCCGTTGGAT TGCTGATTTT AGCTGGACTA TTTGCAGCGT TT - #TTGGCTTA2520- TAGATATGTT TCTAAACTTA AGTCAAATCC AATGAAAGCA CTATACCCAG TA - #ACTACAAA2580- AAATTTAAAA GAAAGTGTTA AGAATGGTAA TTCTGGAAAT AATAGTGATG GA - #GAAGAAAA2640- TGATGATAAT ATCGATGAAG AAAAGCTTCA ACAAGCTAAA GAAATGATTA AA - #TATATGTC2700- TCTAGTTTCT GCTATGGAAC AGCAGGAACA TAAAGCTATT AAAAAAAATA GT - #GGCCCTGC2760- CCTTCTAGCA AGTCACATTA CAAACCTATC TCTTAAACAT CGTGGTCCAA AA - #TACAAACG2820- TTTGAAAAAT GTAAATGAAA ATGAAAGTAA AGTTTAACCC GGGTACCGAG CT - #CGAATTCT2880- TTTTATTGAT TAACTAGTCA AATGAGTATA TATAATTGAA AAAGTAAAAT AT - #AAATCATA2940# 2951- (2) INFORMATION FOR SEQ ID NO:105:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 2951 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:105:- TCATGTTATT TTTCATAATT TATTTTTATG AATGAATGCT TTTTTACTGA TT - #AATCGATA 60- TTTTTGGGCC CTTTCCTAGG ACTAGGAAAA AGACCCATTC ATTATGCAGT TC - #CTCTTTTG 120- CTTTGCTAGA CATCAATCGC CGGTTTGAGC TCCAGCTGAC TCTATTTCAC TT - #TTATATAT 180- AGTAATATAA TGTTTCATGT TAATAAATCC AAATTAGTAC AAAAGTAACA TA - #GATATATA 240- AAAAAAATAA TAAATATGAA ATTATTATAC ACTAGGTTGT TGTGGCCTTT CA - #TGATAATT 300- AGGTAATTTA GTAGTGTTAA ATAGTTGTGG ATTTGGATGA AGCCTACTAT AA - #GCACTTTA 360- AAATGCACTT AGGGTTTAAC TTAGACTACT ATGTAGTTGT AAAATGTACA CG - #GGTGGTGG 420- TAGCCCTAGT TGTAACCACG CAAACCTCGG TGGATCTCGT ACAGGATTGA TA - #TTTGAACC 480- ATTTTTAAAA TGTCTTCCTT AACGACATTA TAAATTCCTT TTATAAAGAG GA - #ATATTTAA 540- ATTTCGATTA TATATGATGT TTTTATAATA ATAGTGGTGA CATACCAGAC CT - #TCGTGTAT 600- ACGTCATTAA TGATTATCTA TATGTCTAGC ACATGGATAT CCACAAGGAC TT - #TAATGTCT 660- CAACTAACTA TCTTCTCCAT ACACAAATAG TTTTCGACTA ATATAAGCAT TA - #TTAATACT 720- TAAATGGCGT AAACTATTCC TACTTCTGGG GTCTCTTCAA GTAAATTTCG GA - #AGTTTCAA 780- ATTATGTGGT CCTAGGGCAC CTACCGTATG TCAATTACTA TGAATGTGTT TT - #TAACCCCC 840- AAGACCTAAA ATAGTAAGAC CTTGTAGACA TTTAACATAT CAACTTCTTC AA - #CTACGGTC 900- TAGACAAATA GGTATACTAA GTAAACGATA GAGGTGGCCC CTATATTAAG TA - #TACAGGGG 960- AAAAAAACCT AATGCTCTAC CACGAGTATG ACTTATATAA TCAATAAGTT GA - #CTATCTAA1020- AGTTGTTTAT CTTCCAATAA TAGGATAGCT GAATCTATGA TCTGATGTCG AA - #CCACGTGG1080- TCAAAGATCC TTAAAAAATT GTTGTGTTGT GCAATGACAA CGAACCTTAA CC - #CAAGGTTT1140- TTAAGCACTT CACACATGAA ACCGATTTAC CGCACTTTAA CTACTTTAAT AA - #GCACTACT1200- CATATTCCCT AGAATGTCTA AATGTCGTTT TAGTTATAGA CGTTGTAAAT AA - #AGACTATG1260- ATGAGTTAAA CTATAACTAG CACATTTCAA TTCACTAACA CGGTTTGCAC TT - #CGGTATCT1320- TCGATAACTA TTCTAGATGT TTTTTTTTAT ATTATTTTGA GTATAAGTTT GT - #CCTCTTAA1380- CCTTTGTATG AACCGATCTC CCCCTAAATA ATATCGTAAA TCTGGTTACT AA - #TCATTACT1440- CAATCGTTTT AACATATATT TACTCAATCA TTCTAGATTA GCATGCCAAC TA - #AACTTTAG1500- AGAAAATTTA GGTAGACATT CTCCCCCCCG ATCTTTCTCT TCTAGTCATC TC - #CTTTTATT1560- TTCTAGTTTT GCATTATAAC TTCCACCATA ACTTTTACAT TTATTAAGTT GT - #TATTAATT1620- CTGTTGAAGT AGACAAGTAA AACGATACGA AGTCAAACGG ATACTAGTAT AA - #GTTAGTGT1680- ACAATTACTT TACGAATCAT CTTAACGTTG ACGTACCACA TTAGAAGTTT TA - #TTTCTCTC1740- TTGGGAAACC TTACTTCAAT ACTTTGAATT AGGTTGATCA CACCGAAGCC AA - #CGATACCT1800- AGTTTCTCAA AGTCGTGCTT ACAATCCCCT ACAAGAACGT CAATGAGTTA CA - #CAATTATA1860- TAGTCCAAGA TCACAAAAAT AAGTTTTAAG GTACGCACAA AATCCCAGTT GT - #TGATGTAC1920- AATGTCAGCA GGAGAATATA GTAAATTTCG TGATCTTTTG AGTTGATTGA TA - #TAACTTCC1980- TGTTGAACCC CTTTTATTAC TTGATAATCA TCTTGCTTTC GATTAACTTG GT - #ACATGTCG2040- ATTGGTATTT TCTATAAAAT TTAAACCACG TCTAATACAT ATAAAACTTT TG - #ATACGTAT2100- ACAAGCTTTC CATGGAGAAT TACTTTAACT TTACTAGTCA CGTATACATC TA - #GAATTATA2160- ATGTAATGAA CTCCTAGCAC TTAAAAATGG TGATCTCCAT ATATGAGCTC GT - #CTCAATCT2220- TCTATGTCCT GATAACCTGA TATCACTCTA AGTTGCATCT TTAGTTGATG TA - #CGTGAATT2280- CAAAATACTA TAACTGTCAC AACATTTTCA ACTATTATTA CAACATTAAT AC - #TCCCCGTA2340- ACGTTTAAAA AAGGTTCCTG AACCTCTACA ACCTCGCCCT AAACCTTTTC AA - #CAAAACCC2400- ACGACGTTTA CGACAATAAC GTTGACAAAG ACCTCACAGG AGCAAAGAAT TA - #TTGGGTAA2460- ACCCCGCGAT CGGCAACCTA ACGACTAAAA TCGACCTGAT AAACGTCGCA AA - #AACCGAAT2520- ATCTATACAA AGATTTGAAT TCAGTTTAGG TTACTTTCGT GATATGGGTC AT - #TGATGTTT2580- TTTAAATTTT CTTTCACAAT TCTTACCATT AAGACCTTTA TTATCACTAC CT - #CTTCTTTT2640- ACTACTATTA TAGCTACTTC TTTTCGAAGT TGTTCGATTT CTTTACTAAT TT - #ATATACAG2700- AGATCAAAGA CGATACCTTG TCGTCCTTGT ATTTCGATAA TTTTTTTTAT CA - #CCGGGACG2760- GGAAGATCGT TCAGTGTAAT GTTTGGATAG AGAATTTGTA GCACCAGGTT TT - #ATGTTTGC2820- AAACTTTTTA CATTTACTTT TACTTTCATT TCAAATTGGG CCCATGGCTC GA - #GCTTAAGA2880- AAAATAACTA ATTGATCAGT TTACTCATAT ATATTAACTT TTTCATTTTA TA - #TTTAGTAT2940# 2951- (2) INFORMATION FOR SEQ ID NO:106:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 879 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:106:- Met Phe Ser Leu Tyr Leu Tyr Ile Phe Phe Il - #e Ile Tyr Thr Leu Ile# 15- Ile Cys Asp Pro Thr Thr Pro Glu Ser Thr Il - #e Asn Pro Leu Asn His# 30- His Asn Leu Ser Thr Pro Lys Pro Thr Ser As - #p Asp Ile Arg Glu Ile# 45- Leu Arg Glu Ser Gln Ile Glu Ser Asp Asp Th - #r Ser Thr Phe Tyr Met# 60- Cys Pro Pro Pro Ser Gly Ser Thr Leu Val Ar - #g Leu Glu Pro Pro Arg#80- Ala Cys Pro Asn Tyr Lys Leu Gly Lys Asn Ph - #e Thr Glu Gly Ile Ala# 95- Val Ile Phe Lys Glu Asn Ile Ser Pro Tyr Ly - #s Phe Lys Ala Asn Ile# 110- Tyr Tyr Lys Asn Ile Ile Ile Thr Thr Val Tr - #p Ser Gly Ser Thr Tyr# 125- Ala Val Ile Thr Asn Arg Tyr Thr Asp Arg Va - #l Pro Ile Gly Val Pro# 140- Glu Ile Thr Glu Leu Ile Asp Arg Arg Gly Me - #t Cys Leu Ser Lys Ala145 1 - #50 1 - #55 1 -#60- Asp Tyr Ile Arg Asn Asn Tyr Glu Phe Thr Al - #a Phe Asp Lys Asp Glu# 175- Asp Pro Arg Glu Val His Leu Lys Pro Ser Ly - #s Phe Asn Thr Pro Gly# 190- Ser Arg Gly Trp His Thr Val Asn Asp Thr Ty - #r Thr Lys Ile Gly Gly# 205- Ser Gly Phe Tyr His Ser Gly Thr Ser Val As - #n Cys Ile Val Glu Glu# 220- Val Asp Ala Arg Ser Val Tyr Pro Tyr Asp Se - #r Phe Ala Ile Ser Thr225 2 - #30 2 - #35 2 -#40- Gly Asp Ile Ile His Met Ser Pro Phe Phe Gl - #y Leu Arg Asp Gly Ala# 255- His Thr Glu Tyr Ile Ser Tyr Ser Thr Asp Ar - #g Phe Gln Gln Ile Glu# 270- Gly Tyr Tyr Pro Ile Asp Leu Asp Thr Arg Le - #u Gln Leu Gly Ala Pro# 285- Val Ser Arg Asn Phe Leu Thr Thr Gln His Va - #l Thr Val Ala Trp Asn# 300- Trp Val Pro Lys Ile Arg Glu Val Cys Thr Le - #u Ala Lys Trp Arg Glu305 3 - #10 3 - #15 3 -#20- Ile Asp Glu Ile Ile Arg Asp Glu Tyr Lys Gl - #y Ser Tyr Arg Phe Thr# 335- Ala Lys Ser Ile Ser Ala Thr Phe Ile Ser As - #p Thr Thr Gln Phe Asp# 350- Ile Asp Arg Val Lys Leu Ser Asp Cys Ala Ly - #s Arg Glu Ala Ile Glu# 365- Ala Ile Asp Lys Ile Tyr Lys Lys Lys Tyr As - #n Lys Thr His Ile Gln# 380- Thr Gly Glu Leu Glu Thr Tyr Leu Ala Arg Gl - #y Gly Phe Ile Ile Ala385 3 - #90 3 - #95 4 -#00- Phe Arg Pro Met Ile Ser Asn Glu Leu Ala Ly - #s Leu Tyr Ile Asn Glu# 415- Leu Val Arg Ser Asn Arg Thr Val Asp Leu Ly - #s Ser Leu Leu Asn Pro# 430- Ser Val Arg Gly Gly Ala Arg Lys Arg Arg Se - #r Val Glu Glu Asn Lys# 445- Arg Ser Lys Arg Asn Ile Glu Gly Gly Ile Gl - #u Asn Val Asn Asn Ser# 460- Thr Ile Ile Lys Thr Thr Ser Ser Val His Ph - #e Ala Met Leu Gln Phe465 4 - #70 4 - #75 4 -#80- Ala Tyr Asp His Ile Gln Ser His Val Asn Gl - #u Met Leu Ser Arg Ile# 495- Ala Thr Ala Trp Cys Asn Leu Gln Asn Lys Gl - #u Arg Thr Leu Trp Asn# 510- Glu Val Met Lys Leu Asn Pro Thr Ser Val Al - #a Ser Val Ala Met Asp# 525- Gln Arg Val Ser Ala Arg Met Leu Gly Asp Va - #l Leu Ala Val Thr Gln# 540- Cys Val Asn Ile Ser Gly Ser Ser Val Phe Il - #e Gln Asn Ser Met Arg545 5 - #50 5 - #55 5 -#60- Val Leu Gly Ser Thr Thr Thr Cys Tyr Ser Ar - #g Pro Leu Ile Ser Phe# 575- Lys Ala Leu Glu Asn Ser Thr Asn Tyr Ile Gl - #u Gly Gln Leu Gly Glu# 590- Asn Asn Glu Leu Leu Val Glu Arg Lys Leu Il - #e Glu Pro Cys Thr Ala# 605- Asn His Lys Arg Tyr Phe Lys Phe Gly Ala As - #p Tyr Val Tyr Phe Glu# 620- Asn Tyr Ala Tyr Val Arg Lys Val Pro Leu As - #n Glu Ile Glu Met Ile625 6 - #30 6 - #35 6 -#40- Ser Ala Tyr Val Asp Leu Asn Ile Thr Leu Le - #u Glu Asp Arg Glu Phe# 655- Leu Pro Leu Glu Val Tyr Thr Arg Ala Glu Le - #u Glu Asp Thr Gly Leu# 670- Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gl - #n Leu His Ala Leu Lys# 685- Phe Tyr Asp Ile Asp Ser Val Val Lys Val As - #p Asn Asn Val Val Ile# 700- Met Arg Gly Ile Ala Asn Phe Phe Gln Gly Le - #u Gly Asp Val Gly Ala705 7 - #10 7 - #15 7 -#20- Gly Phe Gly Lys Val Val Leu Gly Ala Ala As - #n Ala Val Ile Ala Thr# 735- Val Ser Gly Val Ser Ser Phe Leu Asn Asn Pr - #o Phe Gly Ala Leu Ala# 750- Val Gly Leu Leu Ile Leu Ala Gly Leu Phe Al - #a Ala Phe Leu Ala Tyr# 765- Arg Tyr Val Ser Lys Leu Lys Ser Asn Pro Me - #t Lys Ala Leu Tyr Pro# 780- Val Thr Thr Lys Asn Leu Lys Glu Ser Val Ly - #s Asn Gly Asn Ser Gly785 7 - #90 7 - #95 8 -#00- Asn Asn Ser Asp Gly Glu Glu Asn Asp Asp As - #n Ile Asp Glu Glu Lys# 815- Leu Gln Gln Ala Lys Glu Met Ile Lys Tyr Me - #t Ser Leu Val Ser Ala# 830- Met Glu Gln Gln Glu His Lys Ala Ile Lys Ly - #s Asn Ser Gly Pro Ala# 845- Leu Leu Ala Ser His Ile Thr Asn Leu Ser Le - #u Lys His Arg Gly Pro# 860- Lys Tyr Lys Arg Leu Lys Asn Val Asn Glu As - #n Glu Ser Lys Val865 8 - #70 8 - #75- (2) INFORMATION FOR SEQ ID NO:107:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1615 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:107:- GAGCTCGCGG CCGCCTATCA AAAGTCTTAA TGAGTTAGGT GTAGATAGTA TA - #GATATTAC 60- TACAAAGGTA TTCATATTTC CTATCAATTC TAAAGTAGAT GATATTAATA AC - #TCAAAGAT 120- GATGATAGTA GATAATAGAT ACGCTCATAT AATGACTGCA AATTTGGACG GT - #TCACATTT 180- TAATCATCAC GCGTTCATAA GTTTCAACTG CATAGATCAA AATCTCACTA AA - #AAGATAGC 240- CGATGTATTT GAGAGAGATT GGACATCTAA CTACGCTAAA GAAATTACAG TT - #ATAAATAA 300- TACATAATGG ATTTTGTTAT CATCAGTTAT ATTTAACATA AGTACAATAA AA - #AGTATTAA 360- ATAAAAATAC TTACTTACGA AAAAATGACT AATTAGCTAT AAAAACCCGG GC - #TGCAGCTC 420- GAGGAATTCT TTTTATTGAT TAACTAGTCA AATGAGTATA TATAATTGAA AA - #AGTAAAAT 480- ATAAATCATA TAATAATGAA ACGAAATATC AGTAATAGAC AGGAACTGGC AG - #ATTCTTCT 540- TCTAATGAAG TAAGTACTGC TAAATCTCCA AAATTAGATA AAAATGATAC AG - #CAAATACA 600- GCTTCATTCA ACGAATTACC TTTTAATTTT TTCAGACACA CCTTATTACA AA - #CTAACTAA 660- GTCAGATGAT GAGAAAGTAA ATATAAATTT AACTTATGGG TATAATATAA TA - #AAGATTCA 720- TGATATTAAT AATTTACTTA ACGATGTTAA TAGACTTATT CCATCAACCC CT - #TCAAACCT 780- TTCTGGATAT TATAAAATAC CAGTTAATGA TATTAAAATA GATTGTTTAA GA - #GATGTAAA 840- TAATTATTTG GAGGTAAAGG ATATAAAATT AGTCTATCTT TCACATGGAA AT - #GAATTACC 900- TAATATTAAT AATTATGATA GGAATTTTTT AGGATTTACA GCTGTTATAT GT - #ATCAACAA 960- TACAGGCAGA TCTATGGTTA TGGTAAAACA CTGTAACGGG AAGCAGCATT CT - #ATGGTAAC1020- TGGCCTATGT TTAATAGCCA GATCATTTTA CTCTATAAAC ATTTTACCAC AA - #ATAATAGG1080- ATCCTCTAGA TATTTAATAT TATATCTAAC AACAACAAAA AAATTTAACG AT - #GTATGGCC1140- AGAAGTATTT TCTACTAATA AAGATAAAGA TAGTCTATCT TATCTACAAG AT - #ATGAAAGA1200- AGATAATCAT TTAGTAGTAG CTACTAATAT GGAAAGAAAT GTATACAAAA AC - #GTGGAAGC1260- TTTTATATTA AATAGCATAT TACTAGAAGA TTTAAAATCT AGACTTAGTA TA - #ACAAAACA1320- GTTAAATGCC AATATCGATT CTATATTTCA TCATAACAGT AGTACATTAA TC - #AGTGATAT1380- ACTGAAACGA TCTACAGACT CAACTATGCA AGGAATAAGC AATATGCCAA TT - #ATGTCTAA1440- TATTTTAACT TTAGAACTAA AACGTTCTAC CAATACTAAA AATAGGATAC GT - #GATAGGCT1500- GTTAAAAGCT GCAATAAATA GTAAGGATGT AGAAGAAATA CTTTGTTCTA TA - #CCTTCGGA1560- GGAAAGAACT TTAGAACAAC TTAAGTTTAA TCAAACTTGT ATTTATGAAG GT - #ACC1615- (2) INFORMATION FOR SEQ ID NO:108:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1615 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:108:- CTCGAGCGCC GGCGGATAGT TTTCAGAATT ACTCAATCCA CATCTATCAT AT - #CTATAATG 60- ATGTTTCCAT AAGTATAAAG GATAGTTAAG ATTTCATCTA CTATAATTAT TG - #AGTTTCTA 120- CTACTATCAT CTATTATCTA TGCGAGTATA TTACTGACGT TTAAACCTGC CA - #AGTGTAAA 180- ATTAGTAGTG CGCAAGTATT CAAAGTTGAC GTATCTAGTT TTAGAGTGAT TT - #TTCTATCG 240- GCTACATAAA CTCTCTCTAA CCTGTAGATT GATGCGATTT CTTTAATGTC AA - #TATTTATT 300- ATGTATTACC TAAAACAATA GTAGTCAATA TAAATTGTAT TCATGTTATT TT - #TCATAATT 360- TATTTTTATG AATGAATGCT TTTTTACTGA TTAATCGATA TTTTTGGGCC CG - #ACGTCGAG 420- CTCCTTAAGA AAAATAACTA ATTGATCAGT TTACTCATAT ATATTAACTT TT - #TCATTTTA 480- TATTTAGTAT ATTATTACTT TGCTTTATAG TCATTATCTG TCCTTGACCG TC - #TAAGAAGA 540- AGATTACTTC ATTCATGACG ATTTAGAGGT TTTAATCTAT TTTTACTATG TC - #GTTTATGT 600- CGAAGTAAGT TGCTTAATGG AAAATTAAAA AAGTCTGTGT GGAATAATGT TT - #GATTGATT 660- CAGTCTACTA CTCTTTCATT TATATTTAAA TTGAATACCC ATATTATATT AT - #TTCTAAGT 720- ACTATAATTA TTAAATGAAT TGCTACAATT ATCTGAATAA GGTAGTTGGG GA - #AGTTTGGA 780- AAGACCTATA ATATTTTATG GTCAATTACT ATAATTTTAT CTAACAAATT CT - #CTACATTT 840- ATTAATAAAC CTCCATTTCC TATATTTTAA TCAGATAGAA AGTGTACCTT TA - #CTTAATGG 900- ATTATAATTA TTAATACTAT CCTTAAAAAA TCCTAAATGT CGACAATATA CA - #TAGTTGTT 960- ATGTCCGTCT AGATACCAAT ACCATTTTGT GACATTGCCC TTCGTCGTAA GA - #TACCATTG1020- ACCGGATACA AATTATCGGT CTAGTAAAAT GAGATATTTG TAAAATGGTG TT - #TATTATCC1080- TAGGAGATCT ATAAATTATA ATATAGATTG TTGTTGTTTT TTTAAATTGC TA - #CATACCGG1140- TCTTCATAAA AGATGATTAT TTCTATTTCT ATCAGATAGA ATAGATGTTC TA - #TACTTTCT1200- TCTATTAGTA AATCATCATC GATGATTATA CCTTTCTTTA CATATGTTTT TG - #CACCTTCG1260- AAAATATAAT TTATCGTATA ATGATCTTCT AAATTTTAGA TCTGAATCAT AT - #TGTTTTGT1320- CAATTTACGG TTATAGCTAA GATATAAAGT AGTATTGTCA TCATGTAATT AG - #TCACTATA1380- TGACTTTGCT AGATGTCTGA GTTGATACGT TCCTTATTCG TTATACGGTT AA - #TACAGATT1440- ATAAAATTGA AATCTTGATT TTGCAAGATG GTTATGATTT TTATCCTATG CA - #CTATCCGA1500- CAATTTTCGA CGTTATTTAT CATTCCTACA TCTTCTTTAT GAAACAAGAT AT - #GGAAGCCT1560- CCTTTCTTGA AATCTTGTTG AATTCAAATT AGTTTGAACA TAAATACTTC CA - #TGG1615- (2) INFORMATION FOR SEQ ID NO:109:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 112 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:109:- CGATGTTAAT AAGTATTACC ACAATAATTG GTGGAGCCAT TTTCGTTATA GT - #ATTGATTT 60- TCATAACAGC TTTATGTTTC TATTGTTCAA AAAATAATAA GATCTAACTG CA - # 112- (2) INFORMATION FOR SEQ ID NO:110:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 106 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:110:- GTTAGATCTT ATTATTTTTT GAACAATAGA AACATAAAGC TGTTATGAAA AT - #CAATACTA 60# 106CCA ATTATTGTGG TAATACTTAT TAACAT- (2) INFORMATION FOR SEQ ID NO:111:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 20 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:111:# 20 AAGT- (2) INFORMATION FOR SEQ ID NO:112:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 21 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:112:#21 TAAG T- (2) INFORMATION FOR SEQ ID NO:113:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 93 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:113:- TTTTCGCGAT ATCCGTTAAG TTTGTATCGT AATGAGTTTT AAAAATTTCT AT - #CTAATATA 60# 93 ATAA ACTCGATAAT AAC- (2) INFORMATION FOR SEQ ID NO:114:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 33 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:114:# 33 GAAA TCATTATAAA AGT- (2) INFORMATION FOR SEQ ID NO:115:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 35 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:115:# 35 TTAT TAGGTATACA AAATC- (2) INFORMATION FOR SEQ ID NO:116:- (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 base p - #airs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:116:# 8- (2) INFORMATION FOR SEQ ID NO:117:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1760 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:117:- AGTACAATAA AAAGTATTAA ATAAAAATAC TTACTTACGA AAAAATGACT AA - #TTAGCTAT 60- AAAAACCCGG GAAAGGATCC TGATCCTTTT TCTGGGTAAG TAATACGTCA AG - #GAGAAAAC 120- GAAACGATCT GTAGTTAGCG GCCAAACTCG AGGTCGACGG TATCGATAAG CT - #TGATTCTT 180- TATTCTATAC TTAAAAAGTG AAAATAAATA CAAAGGTTCT TGAGGGTTGT GT - #TAAATTGA 240- AAGCGAGAAA TAATCATAAA TTATTTCATT ATCGCGATAT CCGTTAAGTT TG - #TATCGTAA 300- TGAGTTTTAA AAATTTTTAT CTAATATATG TAATTATAAT TTTTATAAAC TC - #GATAATAA 360- CTTCGGCATC TACATCCAAA CCTTCAACAC CTACCATAAT TCCAACTTCA GC - #AAATGAAT 420- CACCTGCTTC CATAGATACA ACTATAACAA AACCTATATC TACAGAGGCA AA - #TAATTTAA 480- AATCAGTAAG TACCTCAATT AAACCACCTA AAAACTTAAA AAAAAAATTA CT - #TAAATCTA 540- AATGTAGAGA TAATGTTATT TATAGGCCAT ATTTTAGTCA ATTAGAAATT AA - #CTGTACTA 600- TAACTAAAAA GCAAAATTTA AGTAATCCTT TAATTGAGTT ATGGTTTAAA GA - #ACTTTCTA 660- CATATAATAA AACCAATGAA AATGTTGAAA GTTTAAAAAC AGATATATCA AA - #AAATATTT 720- TATTATTTTC GACAAAAAAT AATAGTGATA ACTTTTATAA TGATTTTTTA TT - #AGGTATAC 780- AAAATCAACC AGTAAATTAT AAACTTTACG GTTCCCAATT TTATGATAAT GG - #AAACATAT 840- TACTAAATAT AAAGTCGGTT GACTTTAAAA CCTCTGGAAT ATATACTTGG AA - #ACTATATA 900- ATTCAAATAA TGAAAGTATT TTTGAAACTT TTAAAATTCA AGTATATGCA TA - #TCATTCCC 960- CAAATGTAAA CTTAAAATCA AACCCAAGTT TATATAATGA AAACTACAGC GC - #TATTTGTA1020- CAATAGCAAA TTACTTTCCA TTGGAATCTA CGGAAATATT TTGGTTTAAC GA - #TGGACAAC1080- CTATTGATAA AAAATATATA GATGAAACTT ATAGTGTATG GATTGACGGT CT - #TATAACAC1140- GCACTTCAAT ATTATCCCTT CCCTTTTCCG AAGCCATGGA AAGCCCCCCC AA - #TTTGCGAT1200- GTAATGTTGA ATGGTATAAA AATTCAAAGG CATCAAAAAA ATTTTCAAAT AC - #CGTTATTC1260- CAAAAGTTTA CTATAAACCT TTTATATCTA TAAAATTTGA TAATGGTTTA GC - #TATTTGTG1320- ATGCTAAATG TGTTTCCCGT GAAAATAATA AATTACAATG GTTAGTTAAA GA - #TATACCTA1380- TAAATGGTGA TGATATTATA AGCGGCCCCT GTTTAAACCA CCCTGGTTTG GT - #CAATATTC1440- AAAATAAAAT AGATATATCG GATTATGATG AACCTGTTAC CTATAAATGT TC - #AATTATTG1500- GTTATCCAAT AATTTTTCCC AACTTTTATG ATGAAAAGGT GTTTGATGCA TC - #GGATGAAA1560- ATGTTAGTAA ATCGATGTTA ATAAGTATTA CCACAATAAT TGGTGGAGCC AT - #TTTTGTTA1620- TAGTATTGAT TTTTATAACA GCTTTATGTT TTTATTGTTC AAAAAATAAT AA - #GATCTAAC1680- TGCAAATTCT TTTTATTGAT TAACTAGTCA AATGAGTATA TATAATTGAA AA - #AGTAAAAT1740# 176 - #0- (2) INFORMATION FOR SEQ ID NO:118:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1760 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:118:- TCATGTTATT TTTCATAATT TATTTTTATG AATGAATGCT TTTTTACTGA TT - #AATCGATA 60- TTTTTGGGCC CTTTCCTAGG ACTAGGAAAA AGACCCATTC ATTATGCAGT TC - #CTCTTTTG 120- CTTTGCTAGA CATCAATCGC CGGTTTGAGC TCCAGCTGCC ATAGCTATTC GA - #ACTAAGAA 180- ATAAGATATG AATTTTTCAC TTTTATTTAT GTTTCCAAGA ACTCCCAACA CA - #ATTTAACT 240- TTCGCTCTTT ATTAGTATTT AATAAAGTAA TAGCGCTATA GGCAATTCAA AC - #ATAGCATT 300- ACTCAAAATT TTTAAAAATA GATTATATAC ATTAATATTA AAAATATTTG AG - #CTATTATT 360- GAAGCCGTAG ATGTAGGTTT GGAAGTTGTG GATGGTATTA AGGTTGAAGT CG - #TTTACTTA 420- GTGGACGAAG GTATCTATGT TGATATTGTT TTGGATATAG ATGTCTCCGT TT - #ATTAAATT 480- TTAGTCATTC ATGGAGTTAA TTTGGTGGAT TTTTGAATTT TTTTTTTAAT GA - #ATTTAGAT 540- TTACATCTCT ATTACAATAA ATATCCGGTA TAAAATCAGT TAATCTTTAA TT - #GACATGAT 600- ATTGATTTTT CGTTTTAAAT TCATTAGGAA ATTAACTCAA TACCAAATTT CT - #TGAAAGAT 660- GTATATTATT TTGGTTACTT TTACAACTTT CAAATTTTTG TCTATATAGT TT - #TTTATAAA 720- ATAATAAAAG CTGTTTTTTA TTATCACTAT TGAAAATATT ACTAAAAAAT AA - #TCCATATG 780- TTTTAGTTGG TCATTTAATA TTTGAAATGC CAAGGGTTAA AATACTATTA CC - #TTTGTATA 840- ATGATTTATA TTTCAGCCAA CTGAAATTTT GGAGACCTTA TATATGAACC TT - #TGATATAT 900- TAAGTTTATT ACTTTCATAA AAACTTTGAA AATTTTAAGT TCATATACGT AT - #AGTAAGGG 960- GTTTACATTT GAATTTTAGT TTGGGTTCAA ATATATTACT TTTGATGTCG CG - #ATAAACAT1020- GTTATCGTTT AATGAAAGGT AACCTTAGAT GCCTTTATAA AACCAAATTG CT - #ACCTGTTG1080- GATAACTATT TTTTATATAT CTACTTTGAA TATCACATAC CTAACTGCCA GA - #ATATTGTG1140- CGTGAAGTTA TAATAGGGAA GGGAAAAGGC TTCGGTACCT TTCGGGGGGG TT - #AAACGCTA1200- CATTACAACT TACCATATTT TTAAGTTTCC GTAGTTTTTT TAAAAGTTTA TG - #GCAATAAG1260- GTTTTCAAAT GATATTTGGA AAATATAGAT ATTTTAAACT ATTACCAAAT CG - #ATAAACAC1320- TACGATTTAC ACAAAGGGCA CTTTTATTAT TTAATGTTAC CAATCAATTT CT - #ATATGGAT1380- ATTTACCACT ACTATAATAT TCGCCGGGGA CAAATTTGGT GGGACCAAAC CA - #GTTATAAG1440- TTTTATTTTA TCTATATAGC CTAATACTAC TTGGACAATG GATATTTACA AG - #TTAATAAC1500- CAATAGGTTA TTAAAAAGGG TTGAAAATAC TACTTTTCCA CAAACTACGT AG - #CCTACTTT1560- TACAATCATT TAGCTACAAT TATTCATAAT GGTGTTATTA ACCACCTCGG TA - #AAAACAAT1620- ATCATAACTA AAAATATTGT CGAAATACAA AAATAACAAG TTTTTTATTA TT - #CTAGATTG1680- ACGTTTAAGA AAAATAACTA ATTGATCAGT TTACTCATAT ATATTAACTT TT - #TCATTTTA1740# 176 - #0- (2) INFORMATION FOR SEQ ID NO:119:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 319 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:119:- Leu Leu Phe Ser Thr Lys Asn Asn Ser Asp As - #n Phe Tyr Asn Asp Phe# 15- Leu Leu Gly Ile Gln Asn Gln Pro Val Asn Ty - #r Lys Leu Tyr Gly Ser# 30- Gln Phe Tyr Asp Asn Gly Asn Ile Leu Leu As - #n Ile Lys Ser Val Asp# 45- Phe Lys Thr Ser Gly Ile Tyr Thr Trp Lys Le - #u Tyr Asn Ser Asn Asn# 60- Glu Ser Ile Phe Glu Thr Phe Lys Ile Gln Va - #l Tyr Ala Tyr His Ser#80- Pro Asn Val Asn Leu Lys Ser Asn Pro Ser Le - #u Tyr Asn Glu Asn Tyr# 95- Ser Ala Ile Cys Thr Ile Ala Asn Tyr Phe Pr - #o Leu Glu Ser Thr Glu# 110- Ile Phe Trp Phe Asn Asp Gly Gln Pro Ile As - #p Lys Lys Tyr Ile Asp# 125- Glu Thr Tyr Ser Val Trp Ile Asp Gly Leu Il - #e Thr Arg Thr Ser Ile# 140- Leu Ser Leu Pro Phe Ser Glu Ala Met Glu Se - #r Pro Pro Asn Leu Arg145 1 - #50 1 - #55 1 -#60- Cys Asn Val Glu Trp Tyr Lys Asn Ser Lys Al - #a Ser Lys Lys Phe Ser# 175- Asn Thr Val Ile Pro Lys Val Tyr Tyr Lys Pr - #o Phe Ile Ser Ile Lys# 190- Phe Asp Asn Gly Leu Ala Ile Cys Asp Ala Ly - #s Cys Val Ser Arg Glu# 205- Asn Asn Lys Leu Gln Trp Leu Val Lys Asp Il - #e Pro Ile Asn Gly Asp# 220- Asp Ile Ile Ser Gly Pro Cys Leu Asn His Pr - #o Gly Leu Val Asn Ile225 2 - #30 2 - #35 2 -#40- Gln Asn Lys Ile Asp Ile Ser Asp Tyr Asp Gl - #u Pro Val Thr Tyr Lys# 255- Cys Ser Ile Ile Gly Tyr Pro Ile Ile Phe Pr - #o Asn Phe Tyr Asp Glu# 270- Lys Val Phe Asp Ala Ser Asp Glu Asn Val Se - #r Lys Ser Met Leu Ile# 285- Ser Ile Thr Thr Ile Ile Gly Gly Ala Ile Ph - #e Val Ile Val Leu Ile# 300- Phe Ile Thr Ala Leu Cys Phe Tyr Cys Ser Ly - #s Asn Asn Lys Ile305 3 - #10 3 - #15- (2) INFORMATION FOR SEQ ID NO:120:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 68 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:120:- CGATATCCGT TAAGTTTGTA TCGTAATGAT TAAACTTCTA TTTATCTTAT TT - #TATTTTAA 60# 68- (2) INFORMATION FOR SEQ ID NO:121:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 65 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:121:- TTGGGTTAAA ATAAAATAAG ATAAATAGAA GTTTAATCAT TACGATACAA AC - #TTAACGGA 60# 65- (2) INFORMATION FOR SEQ ID NO:122:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 72 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:122:- TTGAATTCCT AAACATTTGT TGTTAATTTT TTATAATTAT TATATATTTT TT - #GTCTTTTA 60# 72- (2) INFORMATION FOR SEQ ID NO:123:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 101 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:123:- TTAGATCTGT AGGAGCATCA AAAGTTGACG ATGAACTTTT CTATCTAAAT AG - #AGCTGGTC 60# 101 ATAT TATGTTATTA AAGATTTCTA T- (2) INFORMATION FOR SEQ ID NO:124:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 110 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:124:- TTAGATCTAG ATTCCTTACA CCATTCCATA AAAGTTGGTT CAAATTTATC TT - #CTTTAGAG 60# 110TCGTGG TAATTGAACC ATAAAATCAG TATAGAAAAC- (2) INFORMATION FOR SEQ ID NO:125:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:125:# 17 C- (2) INFORMATION FOR SEQ ID NO:126:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:126:- AGTACAATAA AAAGTATTAA ATAAAAATAC TTACTTACGA AAAAATGACT AA - #TTAGCTAT 60- AAAAACCCGG GAAAGGATCC TGATCCTTTT TCTGGGTAAG TAATACGTCA AG - #GAGAAAAC 120- GAAACGATCT GTAGTTAGCG GCCAAACTCG AGGTCGACGG TATCGATAAG CT - #TGATTCTT 180- TATTCTATAC TTAAAAAGTG AAAATAAATA CAAAGGTTCT TGAGGGTTGT GT - #TAAATTGA 240- AAGCGAGAAA TAATCATAAA TTATTTCATT ATCGCGATAT CCGTTAAGTT TG - #TATCGTAA 300- TGATTAAACT TCTATTTATC TTATTTTATT TTAACCCAAT AACTGGATAT AA - #ATGGGTAG 360- ACCCTCCTCG TAGGTATAAT TACACCGTTT TAAGAATGAT TCCAGATATT CC - #AAATCCAA 420- TGGATCCTTC TAAAAACGCT GAAGTTCGGT ATGTAACTTC TACTGACCCA TG - #TGATATGG 480- TTGCTTTGAT TTCTAATCCA AATATAGAAT CTACAATTAA AACGATTCAA TT - #TGTGCAAA 540- AGAAAAAATT TTACAATGCA TCTCTTAGTT GGTTTAAAGT TGGAGATGAT TG - #TACATATC 600- CAATATATTT AATTCAATAT TTTGATTGTG ATCCTCAAAG AGAATTTGGC AT - #ATGTTTAA 660- AAAGATCTCC AGATTTTTGG AAACCATCGT TAGTTGGTTA CACATTTTTA AC - #TGATGATG 720- AATTGGGATT AGTTTTAGCT GCCCCCGCTC CATTTAATCA AGGTCAATAT AG - #ACGGGTTA 780- TTCAAATTGA AAATGAAGTT TTTTATACTG ATTTTATGGT TCAATTACCA CG - #AGAAACTT 840- GTTATTTTTC TAAAGAAGAT AAATTTGAAC CAACTTTTAT GGAATGGTGT AA - #GGAATCTA 900- GATCTGTAGG AGCATCAAAA GTTGACGATG AACTTTTTTA TCTAAATAGA GC - #TGGTCCCC 960- AAACCCTGCT TAAATATTAT GTTATTAAAG ATTTTTATAG ACTTAACGGT AG - #AGAACCTC1020- CAATAAAATT TAAAGAAGCT CTTAGATACG ATATACCATA TAAAGTGAAT GA - #TAAATTTG1080- ATGATGAATT ACCATCGAGG CCACATATTA GTAATACTAT TAATAAAACT AT - #TAAAGAAA1140- TTGTAAATCT TGAAGATTAT TTTAAAAATA CAAATGTTAT AGATACTACT AC - #CCCAACAC1200- CAATAAATAA TACCCCAAAA AATATAACCG TGGGAATTGT TATAATTATA TT - #AATAATAC1260- TATTTATAAT TGGATTTTTT GTTTATAAAA GACAAAAAAT ATATAATAAT TA - #TAAAAAAT1320- TAACAACAAA TGTTTAGGAA TTCTTTTTAT TGATTAACTA GTCAAATGAG TA - #TATATAAT1380# 1415 AAAT CATATAATAA TGAAA- (2) INFORMATION FOR SEQ ID NO:127:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 1415 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: cDNA- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:127:- TCATGTTATT TTTCATAATT TATTTTTATG AATGAATGCT TTTTTACTGA TT - #AATCGATA 60- TTTTTGGGCC CTTTCCTAGG ACTAGGAAAA AGACCCATTC ATTATGCAGT TC - #CTCTTTTG 120- CTTTGCTAGA CATCAATCGC CGGTTTGAGC TCCAGCTGCC ATAGCTATTC GA - #ACTAAGAA 180- ATAAGATATG AATTTTTCAC TTTTATTTAT GTTTCCAAGA ACTCCCAACA CA - #ATTTAACT 240- TTCGCTCTTT ATTAGTATTT AATAAAGTAA TAGCGCTATA GGCAATTCAA AC - #ATAGCATT 300- ACTAATTTGA AGATAAATAG AATAAAATAA AATTGGGTTA TTGACCTATA TT - #TACCCATC 360- TGGGAGGAGC ATCCATATTA ATGTGGCAAA ATTCTTACTA AGGTCTATAA GG - #TTTAGGTT 420- ACCTAGGAAG ATTTTTGCGA CTTCAAGCCA TACATTGAAG ATGACTGGGT AC - #ACTATACC 480- AACGAAACTA AAGATTAGGT TTATATCTTA GATGTTAATT TTGCTAAGTT AA - #ACACGTTT 540- TCTTTTTTAA AATGTTACGT AGAGAATCAA CCAAATTTCA ACCTCTACTA AC - #ATGTATAG 600- GTTATATAAA TTAAGTTATA AAACTAACAC TAGGAGTTTC TCTTAAACCG TA - #TACAAATT 660- TTTCTAGAGG TCTAAAAACC TTTGGTAGCA ATCAACCAAT GTGTAAAAAT TG - #ACTACTAC 720- TTAACCCTAA TCAAAATCGA CGGGGGCGAG GTAAATTAGT TCCAGTTATA TC - #TGCCCAAT 780- AAGTTTAACT TTTACTTCAA AAAATATGAC TAAAATACCA AGTTAATGGT GC - #TCTTTGAA 840- CAATAAAAAG ATTTCTTCTA TTTAAACTTG GTTGAAAATA CCTTACCACA TT - #CCTTAGAT 900- CTAGACATCC TCGTAGTTTT CAACTGCTAC TTGAAAAAAT AGATTTATCT CG - #ACCAGGGG 960- TTTGGGACGA ATTTATAATA CAATAATTTC TAAAAATATC TGAATTGCCA TC - #TCTTGGAG1020- GTTATTTTAA ATTTCTTCGA GAATCTATGC TATATGGTAT ATTTCACTTA CT - #ATTTAAAC1080- TACTACTTAA TGGTAGCTCC GGTGTATAAT CATTATGATA ATTATTTTGA TA - #ATTTCTTT1140- AACATTTAGA ACTTCTAATA AAATTTTTAT GTTTACAATA TCTATGATGA TG - #GGGTTGTG1200- GTTATTTATT ATGGGGTTTT TTATATTGGC ACCCTTAACA ATATTAATAT AA - #TTATTATG1260- ATAAATATTA ACCTAAAAAA CAAATATTTT CTGTTTTTTA TATATTATTA AT - #ATTTTTTA1320- ATTGTTGTTT ACAAATCCTT AAGAAAAATA ACTAATTGAT CAGTTTACTC AT - #ATATATTA1380# 1415 TTTA GTATATTATT ACTTT- (2) INFORMATION FOR SEQ ID NO:128:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 345 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (v) FRAGMENT TYPE: internal- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:128:- Met Ile Lys Leu Leu Phe Ile Leu Phe Tyr Ph - #e Asn Pro Ile Thr Gly# 15- Tyr Lys Trp Val Asp Pro Pro Arg Arg Tyr As - #n Tyr Thr Val Leu Arg# 30- Met Ile Pro Asp Ile Pro Asn Pro Met Asp Pr - #o Ser Lys Asn Ala Glu# 45- Val Arg Tyr Val Thr Ser Thr Asp Pro Cys As - #p Met Val Ala Leu Ile# 60- Ser Asn Pro Asn Ile Glu Ser Thr Ile Lys Th - #r Ile Gln Phe Val Gln#80- Lys Lys Lys Phe Tyr Asn Ala Ser Leu Ser Tr - #p Phe Lys Val Gly Asp# 95- Asp Cys Thr Tyr Pro Ile Tyr Leu Ile Gln Ty - #r Phe Asp Cys Asp Pro# 110- Gln Arg Glu Phe Gly Ile Cys Leu Lys Arg Se - #r Pro Asp Phe Trp Lys# 125- Pro Ser Leu Val Gly Tyr Thr Phe Leu Thr As - #p Asp Glu Leu Gly Leu# 140- Val Leu Ala Ala Pro Ala Pro Phe Asn Gln Gl - #y Gln Tyr Arg Arg Val145 1 - #50 1 - #55 1 -#60- Ile Gln Ile Glu Asn Glu Val Phe Tyr Thr As - #p Phe Met Val Gln Leu# 175- Pro Arg Glu Thr Cys Tyr Phe Ser Lys Glu As - #p Lys Phe Glu Pro Thr# 190- Phe Met Glu Trp Cys Lys Glu Ser Arg Ser Va - #l Gly Ala Ser Lys Val# 205- Asp Asp Glu Leu Phe Tyr Leu Asn Arg Ala Gl - #y Pro Gln Thr Leu Leu# 220- Lys Tyr Tyr Val Ile Lys Asp Phe Tyr Arg Le - #u Asn Gly Arg Glu Pro225 2 - #30 2 - #35 2 -#40- Pro Ile Lys Phe Lys Glu Ala Leu Arg Tyr As - #p Ile Pro Tyr Lys Val# 255- Asn Asp Lys Phe Asp Asp Glu Leu Pro Ser Ar - #g Pro His Ile Ser Asn# 270- Thr Ile Asn Lys Thr Ile Lys Glu Ile Val As - #n Leu Glu Asp Tyr Phe# 285- Lys Asn Thr Asn Val Ile Asp Thr Thr Thr Pr - #o Thr Pro Ile Asn Asn# 300- Thr Pro Lys Asn Ile Thr Val Gly Ile Val Il - #e Ile Ile Leu Ile Ile305 3 - #10 3 - #15 3 -#20- Leu Phe Ile Ile Gly Phe Phe Val Tyr Lys Ar - #g Gln Lys Ile Tyr Asn# 335- Asn Tyr Lys Lys Leu Thr Thr Asn Val# 345__________________________________________________________________________

Nucleotide and amino acid sequences of canine herpesvirus GD and uses therefor

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

RELATED APPLICATIONS

Non-Patent Literature Citations (216)

Divisions (1)

Continuation in Parts (1)