Nucleotide and peptide sequences of an isolate of the hepatitis C virus, diagnostic and therapeutic applications thereof

Abstract

This invention relates to oligonucleotides encoding HCV E1 peptides, labeled oligonucleotide probes, recombinant DNA molecules comprising HCV E1 nucleotides, plasmid, expression vectors and transformed hosts.

Description

The present invention relates to nucleotide and peptide sequences of a European, more particularly French, strain of the hepatitis C virus, as well as to the diagnostic and therapeutic applications of these sequences.

The hepatitis C virus is a major causative agent of infections by viruses previously called “Non-A Non-B” viruses. Infections by the C virus in fact now represent the most frequent forms of acute hepatitides and chronic Non-A Non-B hepatitides (Alter et al. (1), Choo et al., (3); Hopf et al., (5); Kuo et al., (8); Miyamura et al., (11). Furthermore, there is a relationship (the significance of which is still poorly understood) between the presence of anti-HCV antibodies and the development of primary liver cancers. It has also been shown that the hepatitis C virus is involved in both chronic or acute Non-A Non-B hepatitides linked to transfusions of blood products or of sporadic origin.

The genome of the hepatitis C virus has been cloned and the nucleotide sequence of an American isolate has been described in EP-A-0 318 216, EP-A-0 363 025, EP-A-0 388 232 and WO-A-90/14436. Moreover, data is currently available on the nucleotide sequences of several Japanese isolates relating both to the structural region and the nonstructural region of the virus (Okamoto et al., (12), Enomoto et al., (4), Kato et al., (6); Takeuchi et al., (15 and 16)). The virus exhibits some similarities with the group comprising Flavi- and Pestiviruses; however, it appears to form a distinct class, different from viruses known up until now (Miller and Purcell, (10)).

In spite of the breakthrough which the cloning of HCV represented, several problems persist:

a substantial genetic variability exists in certain regions of the virus which has made it possible to describe the existence of two groups of viruses,

diagnosis of the viral infection remains difficult in spite of the possibility of detecting anti-HCV antibodies in the serum of patients. This is due to the existence of false positive results and to a delayed seroconversion following acute infection. Finally there are clearly cases where only the detection of the virus RNA makes it possible to detect the HCV infection while the serology remains negative.

These problems have important implications both with respect to diagnosis and protection against the virus.

The authors of the present invention have carried out the cloning and obtained the partial nucleotide sequence of a French isolate of HCV (called hereinafter HCV E1) from a blood donor who transmitted an active chronic hepatitis to a recipient. Comparison of the nucleotide sequences and the peptide sequences obtained with the respective sequences of the American and Japanese isolates showed that there was

a high conservation of nucleic acids in the noncoding region of HCV E1,

a high genetic variability in the structural regions called E1 and E2/NS1,

a smaller genetic variability in the nonstructural region.

The present invention is based on new nucleotide and polypeptide sequences of the hepatitis C virus which have not been described in the abovementioned state of the art.

The subject of the present invention is thus a DNA sequence of HCV E1 comprising a DNA sequence chosen from the nucleotide sequences of at least 10 nucleotides between the following nucleotides (n); n 118 to n 138 ; n 177 to n 202 ; n 233 to n 247 ; n 254 to n 272 and n 272 to n 288 represented in the sequence ID SEQ No.2, and, n 156 to n 170 ; n 170 to n 217 ; n 267 to n 283 and n 310 to n 334 represented in the sequence ID SEQ No.3; as well as analogous nucleotide sequences resulting from degeneracy of the genetic code.

The subject of the invention is in particular the following nucleotide sequences: ID SEQ No.2, ID SEQ No.3 and ID SEQ No.4.

The oligonucleotide sequences may be advantageously synthesised by the Applied Bio System technique.

The subject of the invention is also a peptide sequence of HCV E1 comprising a peptide sequence chosen from the sequences of at least 7 amino acids between the following amino acids (aa): aa 58 to aa 66 ; aa 76 to aa 101 represented in the peptide sequence ID SEQ No.2; aa 49 to aa 78 ; aa 98 to aa 111 ; aa 123 to aa 133 ; aa 140 to aa 149 represented in the peptide sequence ID SEQ No.3; as well as homologous peptide sequences which do not induce modification of biological and immunological properties.

Preferably, the peptide sequence is chosen from the following amino acid sequences: aa 58 to aa 66 ; aa 76 to aa 101 represented in the peptide sequence ID SEQ No.2, aa 49 to aa 78 ; aa 98 to aa 111 ; aa 123 to aa 133 and aa 140 to aa 149 represented in the peptide sequence ID SEQ No.3.

Moreover, the peptide sequence is advantageously chosen from the peptide sequences ID SEQ No.2, ID SEQ No.3 and ID SEQ No.4.

The subject of the invention is also a nucleotide sequence encoding a peptide sequence as defined above.

Moreover, the subject of the invention is a polynucleotide probe comprising a DNA sequence as defined above.

The subject of the invention is also an immunogenic peptide comprising a peptide sequence as defined above.

The peptide sequences according to the invention can be obtained by conventional methods of synthesis or by the application of genetic engineering techniques comprising the insertion of a DNA sequence, encoding a peptide sequence according to the invention, into an expression vector such as a plasmid and the transformation of cells using this expression vector and the culture of these cells.

The subject of the invention is also plasmids or expression vectors comprising a DNA sequence encoding a peptide sequence as defined above as well as hosts transformed using this vector.

The preferred plasmids are those deposited with CNCM on Jun. 5, 1991 under the numbers I-1105, I-1106 and I-1107.

The subject of the invention is also monoclonal antibodies directed against a peptide sequence according to the invention or an immunogenic sequence of such a polypeptide.

The monoclonal antibodies according to the invention can be prepared according to a conventional technique. For this purpose, the polypeptides may be coupled, if necessary, to an immunogenic agent such as tetanus anatoxin using a coupling agent such as glutaraldehyde, a carbodiimide or a bisdiazotised benzidine.

The present invention also encompasses the fragments and the derivatives of monoclonal antibodies according to the invention. These fragments are especially F(ab′) 2 fragments which can be obtained by enzymatic cleavage of the antibody molecules with pepsin, the Fab′ fragments which can be obtained by reducing the disulphide bridges of the F(ab′) 2 fragments, and the Fab fragments which can be obtained by enzymatic cleavage of the antibody molecules with papain in the presence of a reducing agent. These fragments, as well as the Fc fragments, can also be obtained by genetic engineering.

The derivatives of monoclonal antibodies are for example antibodies or fragments of these antibodies to which markers, such as a radioisotopes, are attached. The derivatives of monoclonal antibodies are also antibodies or fragments of these antibodies to which therapeutically active molecules are attached.

The subject of the invention is also an analytical kit for the detection of nucleotide sequences specific to the HVC E1 strain, comprising one or more probes as defined above.

The subject of the present invention is also an in vitro diagnostic process involving the detection of antigens specific to HCV E1, in a biological sample possibly containing the said antigens, in which, the biological sample is exposed to an antibody or an antibody fragment, as defined above; as well as a diagnostic kit for carrying out the process.

The subject of the invention is also an in vitro diagnostic process involving the detection of antibodies specific to HCV E1 in a biological sample possibly containing the said antibodies, in which a biological sample is exposed to an antigen containing an epitope corresponding to a peptide sequence, as well as a diagnostic kit for the detection of specific antibodies, comprising an antigen containing an epitope corresponding to a peptide sequence as defined above.

These procedures may be based on a radioimmunological method of the RIA, RIPA or IRMA type or an immunoenzymatic method of the WESTERN-BLOT type carried out on strips or of the ELISA type.

The subject of the invention is also a therapeutic composition comprising monoclonal antibodies or fragments of monoclonal antibodies or derivatives of monoclonal antibodies as defined above.

Advantageously, the monoclonal antibody derivatives are monoclonal antibodies or fragments of these antibodies attached to a therapeutically active molecule.

The subject of the invention is also an immunogenic composition containing an immunogenic sequence as defined above, optionally attached to a carrier protein, the said immunogenic sequence being capable of inducing protective antibodies or cytotoxic T lymphocytes. Anatoxins such as tetanus anatoxin may be used as carrier protein. Alternatively, immunogens produced according to the MAP (Multiple Antigenic Peptide) technique may also be used.

In addition to the immunogenic peptide sequence, the immunogenic composition may contain an adjuvant possessing immunostimulant properties.

The following are among the adjuvants which may be used: inorganic salts such as aluminium hydroxide, hydrophobic compounds or surface-active agents such as incomplete Freund's adjuvant, squalene or liposomes, synthetic polynucleotides, microorganisms or microbial components such as murabutide, synthetic artificial molecules such as imuthiol or levamisole, or alternatively cytokines such as interferons α, β, γ or interleukins.

The subject of the invention is also a process for assaying a peptide sequence as defined above, comprising the use of monoclonal antibodies directed against this peptide sequence.

The subject of the invention is also a process for preparing a peptide sequence as defined above, comprising the insertion of a DNA sequence, encoding the peptide sequence, into an expression vector, the transformation of cells using this expression vector and the culture of the cells.

The production of the DNA of the sequences of the HCV E1 strain will be described below in greater detail with reference to the accompanying figures in which:

FIG. 1 represents the location of the amplified and sequenced HCV E1 regions;

FIG. 2 represents the comparison of the nucleotide sequence of HCV E1 (1), in the non-coding region, with the sequences of an American isolate (2) and two Japanese isolates: HCJ1 (3) and HCJ4 (4) respectively described in WO-A-90/14436 and by Okamoto et al. (12);

FIG. 3 represents the comparison of the nucleotide sequence of HCV E1 (1), in the region E1, with the sequences of an American isolate (HCVpt) (2) described in WO 90/14436 and three Japanese isolates: HCVJ-1 (3), HCJ1 (4) and HCJ4 (5) described in Takeuchi et al. (15); Okamoto et al. (12);

FIG. 4 represents the comparison of the aminoacid sequence, in the region E1, of HCV E1 (1) with the American isolate HCVpt (2) and the Japanese isolates: HCVJ1 (3), HCJ1 (4) and HCJ4 (5); the variable regions are boxed;

FIG. 5 represents the comparison of the nucleotide sequence, in the region E2/NS1, of HCV E1 (1) with the American isolate HCVpt (2) described in WO-A-90/14436 and the Japanese isolates HCJ1 (3), HCJ4 (4) and HCVJ1 (5) described by Okamoto et al. (12); Takeuchi et al. (15);

FIG. 6 represents a comparison of the aminoacid sequence, in the region E2/NS1, of HCV E1 (1) with the American isolate HCVpt (2) and the Japanese isolates HCJ1 (3), HCJ4 (4) and HCVJ1 (5); the variable regions are boxed;

FIG. 7 represents the hydrophilicity profile of HCV E1 in the region E2/NS1; the hydrophobic regions are located under the middle line;

FIG. 8 represents the comparison of the nucleotide sequence, in the region NS3/NS4, of HCV E1 (1) with the American isolate HCVpt (2) described in WO-A-90/14436 and the Japanese isolate HCVJ1 (3) described by Kubo et al. (7);

FIG. 9 represents the comparison of the aminoacid sequence, in the region NS3/NS4, of HCV E1 (1) with the American isolate HCVpt (2) and the Japanese isolate HCVJ1 (3).

I—PREPARATION OF THE NUCLEOTIDE SEQUENCES

1) Preparation of the HCV E1 RNA

The HCV E1 RNA was prepared as previously described in EP-A-0,318,216 from the serum of a French blood donor suffering from a chronic hepatitis, anti-HCV positive (anti-C100) (Kubo et al. (7)).

100 μl of serum were diluted in a final volume of 1 ml, in the following extraction buffer: 50 mM tris-HCl, pH.8, 1 mM EDTA, 100 mM NaCl, 1 mg/ml of proteinase K, and 0.5% SDS. After digestion with proteinase K for 1 h at 37° C., the proteins were extracted with one volume of TE-saturated phenol (10 mM Tris-HCl, pH.8, 1 mM EDTA). The aqueous phase was then extracted twice with one volume of phenol/chloroform (1:1) and once with one volume of chloroform. The aqueous phase was then adjusted to a final concentration of 0.2 M sodium acetate and the nucleic acids were precipitated by the addition of two volumes of ethanol. After centrifugation, the nucleic acids were suspended in 30 μl of DEPC-treated sterile distilled water.

2) Reverse Transcription and Amplification

A complementary DNA (cDNA) was synthesised using as primer either oligonucleotides specific to HCV, represented in Table I below, or a mixture of hexanucleotides not specific to HCV, and murine reverse transcriptase. A PCR (Polymerase Chain Reaction) was carried out over 40 cycles at the following temperatures: 94° C. (1 min), 55° C. (1 min), 72° C. (1 min), on the cDNA thus obtained, using pairs of primers specific to HCV (Table I below). Various HCV primers were made from the sequence of HCV prototype (HCVpt), isolated from a chronically infected chimpanzee (Bradley et al. (2); Alter et al. (1), EP-A-0,318,216). The nucleotide sequence of the 5′ region of the E2/NS1 gene was obtained using a strategy derived from the sequence-independent single primer amplification technique (SISPA) described by Reyes et al. (13). It consists in ligating double-stranded adaptors to the ends of the DNA synthesised using an HCV-specific primer localised in 5′ of the HCVpt sequence (primer NS1A in Table I). A semi-specific amplification is then carried out using an HCV-specific primer as well as a primer corresponding to the adaptor. This approach makes it possible to obtain amplification products spanning the 5′ region of the primer used for the synthesis of the cDNA.

TABLE I
Sequence of the primers and probes.
a) Primers                                                                        a                                                                    :
NS3     (+) 5′ ACAATACGTGTGTCACC (3013-3029)
NS4     (−) 5′ AAGTTCCACATATGCTTCGC (3955-3935)
NS1A    (−) 5′ TCCGTTGGCATAACTGATAG (83-64)
NS1B    (+) 5′ CTATCAGTTATGCCAACGGA (64-83)
NS1C    (−) 5′ GTTGCCCGCCCCTCCGATGT (380-361)
NS1D    (+) 5′ CCCAGCCCCGTGGTGGTGGG (183-202)
NS1E    (−) 5′ CCACAAGCAGGAGCAGACGC (860-841)
NCA     (+) 5′ CCATGGCGTTAGTATGAGT (−259-−239)
NCB     (−) 5′ GCAGGTCTACGAGACCTC (−4-−23)
E1A     (+) 5′ TTCTGGAAGACGGCGTGAAC (470-489)
E1B     (−) 5′ TCATCATATCCCATGCCATG (973-954)
b) probes                                                                        a                                                                    :
NS3/NS4 (+) 5′ CCTTCACCATTGAGACAATCACGCTCCCCCAGGATGCTGT (3058-3097)
NS1     (+) 5′ CTGTCCTGAGAGGCTAGCCAGCTGCCGACCCCTTACCGAT (5-44)
NS1B/C  (+) 5′ AGGTCGGGCGCGCCCACCTACAGCTGGGGTGAAAATGATA (210-248)
NC      (+) 5′ GTGCAGCCTCCAGGACCCCC (235-−216)
E1      (−) 5′ CTCGTACACAATACTCGAGT (646-627)
a                                                                                The nucleotide sequences and their locations correspond to the HCV prototype (HCVpt) (EP-A-0, 318, 216 and WO-A-90/14436).

3) Cloning and Sequencing

The amplification products were cloned into M13 mp19 or into the bacteriophage lambda gt 10 as described by Thiers et al. (17). The probes used for screening the DNA sequences are represented in Table I above. The nucleotide sequence of the inserts was determined by the dideoxynucleotide-based method described by Sanger et al., (14).

II—STUDY OF THE NUCLEOTIDE SEQUENCES OF THE FRENCH isolate (HCV E1)

The location of the various amplification products which made it possible to obtain the nucleotide sequence of the HCV E1 isolate in nonstructural and structural regions as well as in the noncoding region of the virus, is schematically represented in FIG. 1 .

1) Nucleotide Sequence of HCV E1 in the Noncoding 5′ Region

The amplified and sequenced noncoding 5′ region of HCV E1 is called ID SEQ No.1. It corresponds to a 256-base pair (bp) fragment located in position −259 to −4 in HCVpt as described in WO-A-90/14436. Comparison of the HCV E1 sequence with those previously published shows a very high nucleic acid conservation (FIG. 2 ).

2) Nucleotide and Peptide Sequences of HCV E1 in the Structural Region

The nucleotide sequences probably correspond to two regions encoding the virus envelope proteins (currently designated as the E1 and E2/NS1 regions).

For the E1 region, the sequence obtained for HCV E1 corresponds to the 3′ moiety of the gene. It has been called ID SEQ No.2. This 501-bp sequence is located in position 470 and 973 in the HCVpt sequence as described in WO-A-90/14436. Comparison of this sequence with those previously described shows a high genetic variability (FIG. 3 ). Indeed, depending on the isolates studied, a difference of 10 to 27% in nucleic acid composition and 7 to 20% in amino acid composition may be observed as shown in Table II below. Furthermore, comparison of the peptide sequence reveals the existence of two hypervariable regions which are boxed in FIG. 4 .

For the E2/NS1 region, the HVC E1 sequence data were obtained from three overlapping amplification products (FIG. 1 ). The consensus sequence thus obtained (1210 bp) contains the entire E2/NS1 gene and was called ID SEQ No.3. The sequence of the E2/NS1 region of HCV E1 is situated in position 999 and 2209 compared with the HCVpt sequence described in WO-A-90/14436. Comparison of the HCV E1 sequences with the isolates previously described shows a difference of 13 to 33% in the case of nucleic acids and 11 to 30% in the case of amino acids ( FIG. 5 and 6 , Table II). The highest variability is observed in 5′ of the E2/NS1 gene (FIG. 5 ). Comparison of amino acids shows the existence of four hypervariable regions which are boxed in FIG. 6 . The hydrophilicity profile of the E2/NS1 region (Kyte and Dolittle, (9)) is given in FIG. 7. A hydrophilic region flanked by two hydrophobic regions are observed. Both hydrophobic regions probably correspond to the signal sequence as well as to the transmembrane segment. Finally, the central region has ten potential glycolisation [sic] sites (N-X-T/S), which are conserved in the various isolates (FIG. 6 ).

3) Nucelotide and Peptide Sequence of HCV E1 in the Nonstructural Region

The sequence data for HCV E1 in the nonstructural region correspond to the 3′ and 5′ terminal parts of the NS3 and NS4 genes respectively (FIG. 1 ). The sequence obtained for HCV E1 (943 bp) is located in position 4361 to 5303 in the HCVpt sequence and was called ID SEQ No.4. The sequence homology is 95% with the HCVpt isolate and 78.6% with a Japanese isolate ( FIG. 8 , Table II above). In the case of the comparison of amino acids, a homology of 98% and 93% was observed with the HCVpt and Japanese isolates respectively ( FIG. 8 , Table II above).

Thus, comparison of the nucleotide sequence of the HCV E1 isolate with that of the American and Japanese isolates shows that the French isolate is different from the isolates described above. It reveals the existence of highly variable regions in the envelope proteins. The variability of the nonstructural region studied is lower. Finally, the noncoding 5′ region shows a high conservation.

These results have implications both for diagnosis and prevention of HVC.

As far as diagnosis is concerned, definition of the hypervariable regions and of the conserved regions can lead to:

the definition of synthetic peptides which allow the expression of epitopes specific to the various HCV groups.

For the envelope protein E1, peptides for the determination of type-specific epitopes are advantageously defined in a region between amino acids 75 to 100 (FIG. 4 ). Likewise, for the protein E2/NS1, peptides allow [sic] characterisation of specific epitopes are synthesised in regions preferably between amino acids 50 and 149, (FIG. 6 ).

The expression of all or part of the cloned sequences, in particular clones corresponding to the envelope regions of the virus, make it possible to obtain new antigens for the development of diagnostic reagents and for the production of immunogenic compositions. Finally, the preparation of a substantial part of the nucleotide sequence of this isolate allows the production of the entire length of complementary DNA which can be used for a better understanding of the mechanisms of the viral infection and also for diagnostic and preventive purposes.

TABLE II
Difference in nucleic acids (n.a.) and amino
acids (a.a.) between the French isolate
(HCV E1) and the American (HCVpt) and japanese
(HCVJ1, HCJ1, HCJ4) isolates.
	HCVpt	HCVJ1	HCJ1	HCJ4
HCVE1 E1	n.a.	10.6	27.3	10.4	26.5
	a.a.	7.2	19.9	8.4	20.5
HCVE1 E2/NS1	n.a.	12.8%	33.2%	14.5%	29.8%
	a.a	12.2%	29.7%	15.6%	26.1%
HCVE1 NS3/NS4	n.a.	5.2%	21.4%
	a.a.	2.2%	6.9%

REFERENCES

1. Alter, H. J., Purcell, R. H., Shib, J. W., Melpolder, J. C., Houghton, M., Choo, Q. -L. & Kuo, G. (1989). Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic Non-A, Non-B hepatitis. New England Journal of Medicine 321, 1494-1500.

2. Bradley, D. W., Cook, E. H., Maynard, J. E., McCaustland, K. A., Ebert, J. W., Dolana, G. H., Petzel, R. A., Kantor, R. J., Heilbrunn, A., Fields, H. A. & Murphy, B. L. (1979). Experimental infection of chimpanzees with antihemophilic (factor VIII) materials: recovery of virus-like particles associated with Non-A, Non-B hepatitis. Journal of Medical Virology 3, 253-269.

3. Choo, Q. -L., Kuo, G., Weiner, A. J., Overby, L. R., Bradley, D. W. & Houghton, M. (1989). Isolation of a cDNA clone derived from a blood-borne Non-A, Non-B viral hepatitis genome. Science 244, 359-362.

4. Enomoto, N., Takada, A., Nakao, T. & Date, T. (1990). There are two major types of hepatitis C virus in Japan. Biochemical and Biophysical Research Communications 170, 1021-1025.

5. Hopf, U., Möbller, B., Kuther, D., Stemerowicz, R., Lobeck, H., Lüdtke-Handjery, A., Walter, E., Blum, H. E., Roggendorf, M. & Deinhardt, F. (1990). Long-term follow-up of post transfusion and sporadic chronic hepatitis Non-A, Non-B and frequency of circulating antibodies to hepatitis C virus (HCV). Journal of Hepatology 10, 69-76.

6. Kato, N., Hijakata, M., Ootsuyama, Y., Nakagawa, M., Ohkoshi, S., Sugimura, T. & Shimotohno, K. (1990). Molecular cloning of the human hepatitis C virus genome from Japanese patients with Non-A, Non-B hepatitis. Proceedings of the National Academy of Sciences, U.S.A. 87, 9524-9528.

7. Kubo, Y., Takeuchi, K., Boonmar, S., Katayama, T., Choo, Q. -L., Kuo, G., Weiner, A.J., Bradley D. W., Houghton, M., Saito, I. & Miyamura, T. (1989). A cDNA fragment of hepatitis C virus isolated from an implicated donor of post-transfusion Non-A, Non-B hepatitis in Japan. Nucleic Acids Research 17, 10367-10372.

8. Kuo, G., Choo, Q. -L., Alter, H. J., Gitnick, G. L., Redeker, A. G., Purcell, R. H., Miyamura, T., Dienstag, J. L., Alter, M. J., Stevens, C. E., Tegtmeier, G. E., Bonino, F., Colombo, M., Lee, W. S., Kuo, C., Berger, K., Shuster, J. R., Overby, L. R., Bradley, D. W. & Houghton, M. (1989). An assay for circulating antibodies to a major etiologic virus of human Non-A, Non-B hepatitis. Science 244, 362-364.

9. Kyte, W. & Doolittle, R. F. (1982). A simple method for displaying the hydropathic of a protein. Journal of Molecular Biology 157, 105-132.

10. Miller, R. H. & Purcell, R. H. (1990). Hepatitis C virus shares amino acid sequence similarity with pestiviruses and flaviviruses as well as members of two plant virus super groups. Proceedings of the National Academy of Sciences, U.S.A. 87, 2057-2061.

11. Miyamura, T., Saito, T., Katayama, T., Kikuchi, S., Tateda, A., Houghton, M., Choo, Q. -L. & Kuo, G. (1990). Detection of antibody against antigen expressed by molecularly cloned hepatitis C virus cDNA: application to diagnosis and blood screening for posttransfusion hepatitis. Proceedings of the National Academy of Sciences, U.S.A. 87, 983-987.

12. Okamoto, H., Okada, S., Sugiyama, Y., Yotsumoto, S., Tanaka, T., Yoshizawa, H., Tsuda, F., Miyakawa, Y. & Mayumi, M. (1990). The 5′ terminal sequence of the hepatitis C virus genome. Japanese Journal of Experimental Medicine 60, 167-177.

13. Reyes, G. R., Purdy, M. A., Kim, J. P., Luk, K. -C., Young, L. M., Fry, K. E. & Bradley, D. W. (1990). Isolation of a cDNA from the virus responsible for enterically transmitted Non-A, Non-B hepatitis. Science 247, 1335-1339.

14. Sanger, F. S., Nicklen, S. & Coulsen, A. R. (1977). DNA sequencing with chain terminating inhibition. Proceedings of the National Academy of Sciences, U.S.A. 74, 5463-5467.

15. Takeuchi, K., Boonmar, S., Kubo, Y., Katayama, T., Harada, H., Ohbayashi, A., Choo, Q., -L., Houghton, M., Saito, I. & Miyamura, T. (1990a). Hepatitis C viral cDNA clones isolated from a healthy carrier donor implicated in post-transfusion Non-A, Non-B hepatitis. Gene 91 (2), 287-291.

16. Takeuchi, K., Kubo, Y., Boonmar, S., Watanabe, Y., Katayama, T., Choo, Q. -L., Kuo, G., Houghton, M., Saito, I. & Miyamura, T. (1990b). Nucleotide sequence of core and envelope genes of the hepatitis C virus genome derived directly from human healthy carriers. Nucleic Acids Research 18, 4626.

17. Thiers, V., Nakajima, E. N., Kremsdorf, D., Mack, D., Schellekens, H., Driss, F., Goude, A., Wands, J., Sninsky, J., Tiollais, P. & Brechot, C. (1988). Transmission of hepatitis B from hepatitis B seronegative subjects. Lancet ii, 1273-1276

Symbols for the amino acids
	A	Ala	alanine
	C	Cys	cysteine
	D	Asp	aspartic acid
	E	Glu	glutamic acid
	F	Phe	phenylalanine
	G	Gly	glycine
	H	His	histidine
	I	Ile	isoleucine
	K	Lys	lysine
	L	Leu	leucine
	M	Met	methionine
	N	Asn	asparagine
	P	Pro	proline
	Q	Gln	glutamine
	R	Arg	arginine
	S	Ser	serine
	T	Thr	threonine
	V	Val	valine
	W	Trp	tryptophan
	Y	Tyr	tyrosine

46 256 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 1CCATGGCGTT AGTATGAGTG TCGTACAGCC TCCAGGACCC CCCCTCCCGG GAGAGCCATA 60GTGGTCTGCG GAGCCGGTGA GTACACCGGA ATTGCCAGGA CGACCGGGTC CTTTCTTGGA 120TCAACCCGCT CAATGCCTGG AGATTTGGGC GTGCCCCCGC AAGACTGCTA GCCGAGTAGT 180GTTGGGTCGC GAAAGGCCTT GTGGTACTGC CTGATAGGGT GCTTGCGAGT GCCCCGGGAG 240GTCTCGTAGA CCGTGC 256 501 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 2TTCTGGAAGA CGGCGTGAAC TATGCAACAG GGAACCTTCC TGGTTGCTCT TTCTCTATCC 60TCCTCCTGGC CCTGCTCTCT TGCCTGACTG TGCCCGCGTC AGCCTACCAA GTACGCAATT 120CTCGCGGCCT TTACCATGTC ACCAATGATT GCCCTAACTC GAGTATTGTG TACGAGACGG 180CCGATAGCAT TCTACACTCT CCGGGGTGTG TCCCTTGCGT TCGCGAGGGT AACACCTCGA 240AATGTTGGGT GGCGGTGGCC CCTACAGTCG CCACCAGAGA CGGCAGACTC CCCACAACGC 300AGCTTCGACG TCATATCGAT CTGCTCGTCG GGAGCGCCAC CCTCTGCTCG GCCCTCTATG 360TGGGGGACTT GTGCGGGTCC GTCTTCCTCG TCGGTCAATT GTTCACCTTC TCCCCCAGGC 420GCCACTGGAC AACGCAAGAC TGCAACTGTT CCATCTACCC CGGCCACGTA ACGGGTCACC 480GCATGGCATG GGATATGATG A 501 166 amino acids amino acid linear peptide unknown 3Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser1 5 10 15Phe Ser Ile Leu Leu Leu Ala Leu Leu Ser Cys Leu Thr Val Pro Ala 20 25 30Ser Ala Tyr Gln Val Arg Asn Ser Arg Gly Leu Tyr His Val Thr Asn 35 40 45Asp Cys Pro Asn Ser Ser Ile Val Tyr Glu Thr Ala Asp Ser Ile Leu 50 55 60His Ser Pro Gly Cys Val Pro Cys Val Arg Glu Gly Asn Thr Ser Lys65 70 75 80Cys Trp Val Ala Val Ala Pro Thr Val Ala Thr Arg Asp Gly Arg Leu 85 90 95Pro Thr Thr Gln Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala 100 105 110Thr Leu Cys Ser Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe 115 120 125Leu Val Gly Gln Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr Thr 130 135 140Gln Asp Cys Asn Cys Ser Ile Tyr Pro Gly His Val Thr Gly His Arg145 150 155 160Met Ala Trp Asp Met Met 165 1210 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 4AATGGCTCAA CTGCTCAGGG TCCCGCAAGC CATCTTGGAC ATGATCGCTG GTGCCCACTG 60GGGAGTCCTA GCGGGCATAG CGTATTTCTC CATGGTGGGG AACTGGGCGA AGGTCCTGCT 120AGTGCTGTTG CTGTTCGCCG GCGTCGATGC GGAAACCTAC ACCACCGGGG GGAGTACTGC 180CAGGACCACG CAAGGACTCG TCAGCCTTTT CAGTCGAGGC GCCAAGCAGG ACATCCAGCT 240GATCAACACC AACGGCAGCT GGCACATTAA TCGCACAGCT TTGAACTGTA ATGAGAGCCT 300CGACACCGGC TGGGTAGCGG GGCTCTTCTA TTACCACAAA TTCAACTCTT CAGGCTGCCC 360CGAGAGGATG GCCAGCTGCA GACCCCTTGC CGATTTCGAC CAGGGCTGGG GCCCTATCAG 420TTATGCCAAC GGAACCGGCC CTGAACACCG CCCCTACTGC TGGCACTACC CCCCAAAGCC 480TTGTGGTATC GTGCCAGCAC AGACCGTATG TGGCCCAGTG TATTGCTTCA CTCCTAGCCC 540CGTGGTGGTG GGGACGACCA ATAAGTTGGG CGCACCCACT TACAACTGGG GTTGTAATGA 600TACGGACGTC TTCGTCCTTA ATAACACCAG GCCACCGCTG GGCAATTGGT TCGGCTGCAC 660CTGGGTGAAC TCATCTGGAT TTACTAAAGT GTGCGGAGCG CCTCCCTGTG TCATCGGAGG 720AGCGGGCAAT AACACCTTGT ACTGCCCCAC TGACTGTTTC CGCAAGCATC CGGAAGCTAC 780ATACTCCCGA TGTGGCTCCG GTCCTTGGAT CACGCCCAGG TGCCTGGTTG GCTATCCTTA 840TAGGCTCTGG CATTATCCCT GTACTGTCAA CTACACCCTG TTCAAGGTCA GGATGTACGT 900GGGAGGGGTC GAGCACAGGC TGCAAGTCGC TTGCAACTGG ACGCGGGGCG AGCGTTGTAA 960TCTGGACGAC AGGGACAGGT CCGAGCTCAG TCCGCTGCTG CTGTCTACCA CACAGTGGCA 1020GGTCCTCCCG TGTTCCTTTA CGACCTTGCC AGCCTTGACT ACCGGCCTCA TCCACCTCCA 1080CCAGAACATC GTGGACGTGC AATATTTGTA CGGGGTGGGG TCAAGCATTG TGTCCTGGGC 1140CATCAAGTGG GAGTACGTCA TTCTCCTGTT TCTCCTGCTT GCAGACGCGC GCGTCTGCTC 1200CTGCTTGTGG 1210 403 amino acids amino acid single linear peptide unknown 5Met Ala Gln Leu Leu Arg Val Pro Gln Ala Ile Leu Asp Met Ile Ala1 5 10 15Gly Ala His Trp Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val 20 25 30Gly Asn Trp Ala Lys Val Leu Leu Val Leu Leu Leu Phe Ala Gly Val 35 40 45Asp Ala Glu Thr Tyr Thr Thr Gly Gly Ser Thr Ala Arg Thr Thr Gln 50 55 60Gly Leu Val Ser Leu Phe Ser Arg Gly Ala Lys Gln Asp Ile Gln Leu65 70 75 80Ile Asn Thr Asn Gly Ser Trp His Ile Asn Arg Thr Ala Leu Asn Cys 85 90 95Asn Glu Ser Leu Asp Thr Gly Trp Val Ala Gly Leu Phe Tyr Tyr His 100 105 110Lys Phe Asn Ser Ser Gly Cys Pro Glu Arg Met Ala Ser Cys Arg Pro 115 120 125Leu Ala Asp Phe Asp Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly 130 135 140Thr Gly Pro Glu His Arg Pro Tyr Cys Trp His Tyr Pro Pro Lys Pro145 150 155 160Cys Gly Ile Val Pro Ala Gln Thr Val Cys Gly Pro Val Tyr Cys Phe 165 170 175Thr Pro Ser Pro Val Val Val Gly Thr Thr Asn Lys Leu Gly Ala Pro 180 185 190Thr Tyr Asn Trp Gly Cys Asn Asp Thr Asp Val Phe Val Leu Asn Asn 195 200 205Thr Arg Pro Pro Leu Gly Asn Trp Phe Gly Cys Thr Trp Val Asn Ser 210 215 220Ser Gly Phe Thr Lys Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly225 230 235 240Ala Gly Asn Asn Thr Leu Tyr Cys Pro Thr Asp Cys Phe Arg Lys His 245 250 255Pro Glu Ala Thr Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro 260 265 270Arg Cys Leu Val Gly Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr 275 280 285Val Asn Tyr Thr Leu Phe Lys Val Arg Met Tyr Val Gly Gly Val Glu 290 295 300His Arg Leu Gln Val Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asn305 310 315 320Leu Asp Asp Arg Asp Arg Ser Glu Leu Ser Pro Leu Leu Leu Ser Thr 325 330 335Thr Gln Trp Gln Val Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu 340 345 350Thr Thr Gly Leu Ile His Leu His Gln Asn Ile Val Asp Val Gln Tyr 355 360 365Leu Tyr Gly Val Gly Ser Ser Ile Val Ser Trp Ala Ile Lys Trp Glu 370 375 380Tyr Val Ile Leu Leu Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser385 390 395 400Cys Leu Trp 943 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 6ACAATACGTG TGTCACCCAG ACAGTCGACT TCAGCCTTGA CCCTACCTTC ACCATTGAAA 60CAACAACGCT TCCCCAGGAT GCTGTCTCCC GCACTCAACG TCGGGGCAGG ACTGGCAGGG 120GGAAGCCAGG CATTTACAGA TTTGTGGCAC CTGGAGAGCG CCCCTCCGGC ATGTTCGACT 180CGTCCGTCCT CTGCGAGTGC TATGACGCAG GCTGTGCTTG GTATGAGCTC ACGCCCGCCG 240AGACCACAGT CAGGCTACGA GCATACATGA ACACCCCGGG ACTTCCCGTG TGCCAAGACC 300ATCTTGAGTT TTGGGAGGGC GTCTTCACGG GTCTCACCCA TATAGACGCC CACTTCCTAT 360CCCAGACAAA GCAGAGTGGG GAAAACCTTC CTTACCTGGT AGCGTACCAA GCCACCGTGT 420GCGCTAGGGC CCAAGCCCCT CCCCCGTCGT GGGACCAGAT GTGGAAGTGC TTGATTCGTC 480TCAAGCCCAC CCTCCATGGG CCAACACCCC TGCTATACCG ACTGGGCGCT GTTCAGAATG 540AAGTCACCCT GACGCACCCA ATCACCAAAT ATATCATGAC ATGCATGTCG GCTGACCTGG 600AGGTCGTCAC GAGTACCTGG GTGCTCGTGG GCGGCGTTCT GGCTGCTTTG GCCGCGTATT 660GCCTATCCAC AGGCTGCGTG GTCATAGTAG GCAGGGTCAT TTTGTCCGGG AAGCCGGCAA 720TCATACCCGA CAGGGAAGTC CTCTACCGGG AGTTCGATGA GATGGAAGAG TGCTCTCAGC 780ACTTGCCATA CATCGAGCAA GGGATGATGC TCGCCGAGCA GTTCAAGCAG AAGGCCCTCG 840GCCTCCTGCA AACACGGTCC CGCCAGGCAG AGGTCATCAC CCCTGCTGTC CAGACCAACT 900GGCAGAGACT CGAGGCCTTC TGGGCGAAGC ATATGTGGAA CTT 943 313 amino acids amino acid linear peptide unknown 7Asn Thr Cys Val Thr Gln Thr Val Asp Phe Ser Leu Asp Pro Thr Phe1 5 10 15Thr Ile Glu Thr Thr Thr Leu Pro Gln Asp Ala Val Ser Arg Thr Gln 20 25 30Arg Arg Gly Arg Thr Gly Arg Gly Lys Pro Gly Ile Tyr Arg Phe Val 35 40 45Ala Pro Gly Glu Arg Pro Ser Gly Met Phe Asp Ser Ser Val Leu Cys 50 55 60Glu Cys Tyr Asp Ala Gly Cys Ala Trp Tyr Glu Leu Thr Pro Ala Glu65 70 75 80Thr Thr Val Arg Leu Arg Ala Tyr Met Asn Thr Pro Gly Leu Pro Val 85 90 95Cys Gln Asp His Leu Glu Phe Trp Glu Gly Val Phe Thr Gly Leu Thr 100 105 110His Ile Asp Ala His Phe Leu Ser Gln Thr Lys Gln Ser Gly Glu Asn 115 120 125Leu Pro Tyr Leu Val Ala Tyr Gln Ala Thr Val Cys Ala Arg Ala Gln 130 135 140Ala Pro Pro Pro Ser Trp Asp Gln Met Trp Lys Cys Leu Ile Arg Leu145 150 155 160Lys Pro Thr Leu His Gly Pro Thr Pro Leu Leu Tyr Arg Leu Gly Ala 165 170 175Val Gln Asn Glu Val Thr Leu Thr His Pro Ile Thr Lys Tyr Ile Met 180 185 190Thr Cys Met Ser Ala Asp Leu Glu Val Val Thr Ser Thr Trp Val Leu 195 200 205Val Gly Gly Val Leu Ala Ala Leu Ala Ala Tyr Cys Leu Ser Thr Gly 210 215 220Cys Val Val Ile Val Gly Arg Val Ile Leu Ser Gly Lys Pro Ala Ile225 230 235 240Ile Pro Asp Arg Glu Val Leu Tyr Arg Glu Phe Asp Glu Met Glu Glu 245 250 255Cys Ser Gln His Leu Pro Tyr Ile Glu Gln Gly Met Met Leu Ala Glu 260 265 270Gln Phe Lys Gln Lys Ala Leu Gly Leu Leu Gln Thr Arg Ser Arg Gln 275 280 285Ala Glu Val Ile Thr Pro Ala Val Gln Thr Asn Trp Gln Arg Leu Glu 290 295 300Ala Phe Trp Ala Lys His Met Trp Asn305 310 17 base pairs nucleic acid single linear Other DNA primer unknown 8ACAATACGTG TGTCACC 17 20 base pairs nucleic acid single linear Other DNA primer unknown 9AAGTTCCACA TATGCTTCGC 20 20 base pairs nucleic acid single linear Other DNA primer unknown 10TCCGTTGGCA TAACTGATAG 20 20 base pairs nucleic acid single linear Other DNA primer unknown 11CTATCAGTTA TGCCAACGGA 20 20 base pairs nucleic acid single linear Other DNA primer unknown 12GTTGCCCGCC CCTCCGATGT 20 20 base pairs nucleic acid single linear Other DNA primer unknown 13CCCAGCCCCG TGGTGGTGGG 20 20 base pairs nucleic acid single linear Other DNA primer unknown 14CCACAAGCAG GAGCAGACGC 20 19 base pairs nucleic acid single linear Other DNA primer unknown 15CCATGGCGTT AGTATGAGT 19 18 base pairs nucleic acid single linear Other DNA primer unknown 16GCAGGTCTAC GAGACCTC 18 20 base pairs nucleic acid single linear Other DNA primer unknown 17TTCTGGAAGA CGGCGTGAAC 20 20 base pairs nucleic acid single linear Other DNA primer unknown 18TCATCATATC CCATGCCATG 20 40 base pairs nucleic acid single linear Other DNA probe unknown 19CCTTCACCAT TGAGACAATC ACGCTCCCCC AGGATGCTGT 40 40 base pairs nucleic acid single linear Other DNA probe unknown 20CTGTCCTGAG AGGCTAGCCA GCTGCCGACC CCTTACCGAT 40 40 base pairs nucleic acid single linear Other DNA probe unknown 21AGGTCGGGCG CGCCCACCTA CAGCTGGGGT GAAAATGATA 40 20 base pairs nucleic acid single linear Other DNA probe unknown 22GTGCAGCCTC CAGGACCCCC 20 20 base pairs nucleic acid single linear Other DNA probe unknown 23CTCGTACACA ATACTCGAGT 20 256 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 24CCATGGCGTT AGTATGAGTG TCGTGCAGCC TCCAGGACCC CCCCTCCCGG GAGAGCCATA 60GTGGTCTGCG GAACCGGTGA GTACACCGGA ATTGCCAGGA CGACCGGGTC CTTTCTTGGA 120TAAACCCGCT CAATGCCTGG AGATTTGGGC GCGCCCCCGC GAGACTGCTA GCCGAGTAGT 180GTTGGGTCGC GAAAGGCCTT GTGGTACTGC CTGATAGGGT GCTTGCGAGT GCCCCGGGAG 240GTCTCGTAGA CCGTGC 256 256 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 25CCATGGCGTT AGTATGAGTG TCGTGCAGCC TCCAGGACCC CCCCTCCCGG GAGAGCCATA 60GTGGTCTGCG GAGCCGGTGA GTACACCGGA ATTGCCAGGA CGACCGGGTC CTTTCTTGGA 120TAAACCCGCT CAATGCCTGG AGATTTGGGC GCGCCCCCGC AAGACTGCTA GCCGAGTAGT 180GTTGGGTCGC GAAAGGCCTT GTGGTACTGC CTGATAGGGT GCTTGCGAGT GCCCCGGGAG 240GTCTCGTAGA CCGTGC 256 256 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 26CCATGGCGTT AGTATGAGTG TCGTGCAGCC TCCAGGACCC CCCCTCCCGG GAGAGCCATA 60GTGGTCTGCG GAACCGGTGA GTACACCGGA ATTGCCAGGA CGACCGGGTC CTTTCTTGGA 120TAAACCCGCT CAATGCCTGG AGATTTGGGC GCGCCCCCGC GAGACTGCTA GCCGAGTAGT 180GTTGGGTCGC GAAAGGCCTT GTGGTACTGC CTGATAGGGT GCTTGCGAGT GCCCCGGGAG 240GTCTCGTAGA CCGTGC 256 501 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 27TTCTGGAAGA CGGCGTGAAC TATGCAACAG GGAACCTTCC TGGTTGCTCT TTCTCTATCT 60TCCTTCTGGC CCTGCTCTCT TGCTTGACTG TGCCCGCTTC GGCCTACCAA GTGCGCAATT 120CCACGGGGCT TTACCACGTC ACCAATGATT GCCCTAACTC GAGTATTGTG TACGAGGCGG 180CCGATGCCAT CCTGCACACT CCGGGGTGCG TCCCTTGCGT TCGTGAGGGC AACGCCTCGA 240GGTGTTGGGT GGCGATGACC CCTACGGTGG CCACCAGGGA TGGAAGACTC CCCGCGACGC 300AGCTTCGACG TCACATCGAT CTGCTTGTCG GGAGCGCCAC CCTCTGTTCG GCCCTCTACG 360TGGGGGACCT ATGCGGGTCT GTCTTTCTTG TCGGCCAATT GTTCACCTTC TCTCCCAGGC 420GCCACTGGAC GACGCAAGGT TGCAATTGCT CTATCTATCC CGGCCATATA ACGGGTCACC 480GCATGGCATG GGATATGATG A 501 501 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 28TTCTGGAGGA CGGCGTGAAC TATGCAACAG GGAATTTGCC CGGTTGCTCT TTCTCTATCT 60TCCTCTTGGC TCTGCTGTCC TGTTTGACCA TCCCAGCTTC CGCTTATGAA GTGCGCAACG 120TGTCCGGGAT ATACCATGTC ACAAACGACT GCTCCAACTC AAGCATTGTG TATGAGGCGG 180CGGACGTGAT CATGCATGCC CCCGGGTGCG TGCCCTGCGT TCGGGAGAAC AATTCCTCCC 240GTTGCTGGGT AGCGCTCACT CCCACGCTCG CGGCCAGGAA TGCCAGCGTC CCCACTACGA 300CATTACGACG CCACGTCGAC TTGCTCGTTG GGACGGCTGC TTTCTGCTCC GCTATGTACG 360TGGGGGATCT CTGCGGATCT GTTTTCCTCA TCTCCCAGCT GTTCACCTTC TCGCCTCGCC 420GGCATGAGAC AGTACAGGAC TGCAACTGCT CAATCTATCC CGGCCACGTA TCAGGCCATC 480GCATGGCTTG GGATATGATG A 501 501 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 29TTCTGGAAGA CGGCGTGAAC TATGCAACAG GGAACCTTCC TGGTTGCTCT TTCTCTATCT 60TCCTTCTGGC CCTGCTCTCT TGCCTGACTG TGCCCGCTTC AGCCTACCAA GTGCGCAACT 120CCACAGGGCT TTATCATGTC ACCAATGATT GCCCTAACTC GAGTATTGTG TACGAGGCGC 180ACGATGCCAT CCTGCATACT CCGGGGTGTG TCCCTTGCGT TCGCGAGGGC AACGTCTCGA 240GGTGTTGGGT GGCGATGACC CCCACGGTAG CCACCAGGGA CGGAAGACTC CCCGCGACGC 300AGCTTCGACG TCACATCGAT CTGCTTGTCG GGAGCGCCAC CCTCTGTTCG GCCCTCTACG 360TGGGGGATCT GTGCGGGTCC GTCTTCCTTA TTGGTCAACT GTTTACCTTC TCTCCCAGGC 420GCCACTGGAC AACGCAAGGC TGCAATTGTT CTATCTACCC CGGCCATATA ACGGGTCATC 480GCATGGCATG GGATATGATG A 501 501 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 30TTCTGGAGGA CGGCGTGAAC TATGCAACAG GGAACTTGCC CGGTTGCTCT TTCTCTATCT 60TCCTCTTGGC TTTGCTGTCC TGTTTGACCA TCCCAGCTTC CGCTTATGAA GTGCGCAACG 120TGTCCGGGAT ATACCATGTC ACGAACGACT GCTCCAACTC AAGCATTGTG TATGAGGCAG 180CGGACATGAT CATGCATACT CCCGGGTGCG TGCCCTGCGT TCGGGAGGAC AACAGCTCCC 240GTTGCTGGGT AGCGCTCACT CCCACGCTCG CGGCCAGGAA TGCCAGCGTC CCCACTACGA 300CAATACGACG CCACGTCGAC TTGCTCGTTG GGGCGGCTGC TTTCTGCTCC GCTATGTACG 360TGGGGGATCT CTGCGGATCT GTTTTCCTCG TCTCCCAGCT GTTCACCTTC TCGCCTCGCC 420GGCATGAGAC AGTGCAGGAC TGCAACTGCT CAATCTATCC CGGCCATTTA TCAGGTCACC 480GCATGGCTTG GGATATGATG A 501 166 amino acids amino acid linear peptide unknown 31Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser1 5 10 15Phe Ser Ile Phe Leu Leu Ala Leu Leu Ser Cys Leu Thr Val Pro Ala 20 25 30Ser Ala Tyr Gln Val Arg Asn Ser Thr Gly Leu Tyr His Val Thr Asn 35 40 45Asp Cys Pro Asn Ser Ser Ile Val Tyr Glu Ala Ala Asp Ala Ile Leu 50 55 60His Thr Pro Gly Cys Val Pro Cys Val Arg Glu Gly Asn Ala Ser Arg65 70 75 80Cys Trp Val Ala Met Thr Pro Thr Val Ala Thr Arg Asp Gly Arg Leu 85 90 95Pro Ala Thr Gln Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala 100 105 110Thr Leu Cys Ser Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe 115 120 125Leu Val Gly Gln Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr Thr 130 135 140Gln Gly Cys Asn Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg145 150 155 160Met Ala Trp Asp Met Met 165 166 amino acids amino acid linear peptide unknown 32Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser1 5 10 15Phe Ser Ile Phe Leu Leu Ala Leu Leu Ser Cys Leu Thr Ile Pro Ala 20 25 30Ser Ala Tyr Glu Val Arg Asn Val Ser Gly Ile Tyr His Val Thr Asn 35 40 45Asp Cys Ser Asn Ser Ser Ile Val Tyr Glu Ala Ala Asp Val Ile Met 50 55 60His Ala Pro Gly Cys Val Pro Cys Val Arg Glu Asn Asn Ser Ser Arg65 70 75 80Cys Trp Val Ala Leu Thr Pro Thr Leu Ala Ala Arg Asn Ala Ser Val 85 90 95Pro Thr Thr Thr Leu Arg Arg His Val Asp Leu Leu Val Gly Thr Ala 100 105 110Ala Phe Cys Ser Ala Met Tyr Val Gly Asp Leu Cys Gly Ser Val Phe 115 120 125Leu Ile Ser Gln Leu Phe Thr Phe Ser Pro Arg Arg His Glu Thr Val 130 135 140Gln Asp Cys Asn Cys Ser Ile Tyr Pro Gly His Val Ser Gly His Arg145 150 155 160Met Ala Trp Asp Met Met 165 166 amino acids amino acid linear peptide unknown 33Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser1 5 10 15Phe Ser Ile Phe Leu Leu Ala Leu Leu Ser Cys Leu Thr Val Pro Ala 20 25 30Ser Ala Tyr Gln Val Arg Asn Ser Thr Gly Leu Tyr His Val Thr Asn 35 40 45Asp Cys Pro Asn Ser Ser Ile Val Tyr Glu Ala His Asp Ala Ile Leu 50 55 60His Thr Pro Gly Cys Val Pro Cys Val Arg Glu Gly Asn Val Ser Arg65 70 75 80Cys Trp Val Ala Met Thr Pro Thr Val Ala Thr Arg Asp Gly Arg Leu 85 90 95Pro Ala Thr Gln Leu Arg Arg His Ile Asp Leu Leu Val Gly Ser Ala 100 105 110Thr Leu Cys Ser Ala Leu Tyr Val Gly Asp Leu Cys Gly Ser Val Phe 115 120 125Leu Ile Gly Gln Leu Phe Thr Phe Ser Pro Arg Arg His Trp Thr Thr 130 135 140Gln Gly Cys Asn Cys Ser Ile Tyr Pro Gly His Ile Thr Gly His Arg145 150 155 160Met Ala Trp Asp Met Met 165 166 amino acids amino acid linear peptide unknown 34Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser1 5 10 15Phe Ser Ile Phe Leu Leu Ala Leu Leu Ser Cys Leu Thr Ile Pro Ala 20 25 30Ser Ala Tyr Glu Val Arg Asn Val Ser Gly Ile Tyr His Val Thr Asn 35 40 45Asp Cys Ser Asn Ser Ser Ile Val Tyr Glu Ala Ala Asp Met Ile Met 50 55 60His Thr Pro Gly Cys Val Pro Cys Val Arg Glu Asp Asn Ser Ser Arg65 70 75 80Cys Trp Val Ala Leu Thr Pro Thr Leu Ala Ala Arg Asn Ala Ser Val 85 90 95Pro Thr Thr Thr Ile Arg Arg His Val Asp Leu Leu Val Gly Ala Ala 100 105 110Ala Phe Cys Ser Ala Met Tyr Val Gly Asp Leu Cys Gly Ser Val Phe 115 120 125Leu Val Ser Gln Leu Phe Thr Phe Ser Pro Arg Arg His Glu Thr Val 130 135 140Gln Asp Cys Asn Cys Ser Ile Tyr Pro Gly His Leu Ser Gly His Arg145 150 155 160Met Ala Trp Asp Met Met 165 1210 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 35AATGGCTCAG CTGCTCCGGA TCCCACAAGC CATCTTGGAC ATGATCGCTG GTGCTCACTG 60GGGAGTCCTG GCGGGCATAG CGTATTTCTC CATGGTGGGG AACTGGGCGA AGGTCCTGGT 120AGTGCTGCTG CTATTTGCCG GCGTCGACGC GGAAACCCAC GTCACCGGGG GAAGTGCCGG 180CCACACTGTG TCTGGATTTG TTAGCCTCCT CGCACCAGGC GCCAAGCAGA ACGTCCAGCT 240GATCAACACC AACGGCAGTT GGCACCTCAA TAGCACGGCT CTGAACTGCA ATGATAGCCT 300TAACACCGGC TGGTTGGCAG GGCTTTTCTA TCACCACAAG TTCAACTCTT CAGGCTGTCC 360TGAGAGGCTA GCCAGCTGCC GACCCCTTAC CGATTTTGAC CAGGGCTGGG GCCCTATCAG 420TTATGCCAAC GGAAGCGGCC CCGACCAGCG CCCCTACTGC TGGCACTACC CCCCAAAACC 480TTGCGGTATT GTGCCCGCGA AGAGTGTGTG TGGTCCGGTA TATTGCTTCA CTCCCAGCCC 540CGTGGTGGTG GGAACGACCG ACAGGTCGGG CGCGCCCACC TACAGCTGGG GTGAAAATGA 600TACGGACGTC TTCGTCCTTA ACAATACCAG GCCACCGCTG GGCAATTGGT TCGGTTGTAC 660CTGGATGAAC TCAACTGGAT TCACCAAAGT GTGCGGAGCG CCTCCTTGTG TCATCGGAGG 720GGCGGGCAAC AACACCCTGC ACTGCCCCAC TGATTGCTTC CGCAAGCATC CGGACGCCAC 780ATACTCTCGG TGCGGCTCCG GTCCCTGGAT CACACCCAGG TGCCTGGTCG ACTACCCGTA 840TAGGCTTTGG CATTATCCTT GTACCATCAA CTACACCATA TTTAAAATCA GGATGTACGT 900GGGAGGGGTC GAACACAGGC TGGAAGCTGC CTGCAACTGG ACGCGGGGCG AACGTTGCGA 960TCTGGAAGAC AGGGACAGGT CCGAGCTCAG CCCGTTACTG CTGACCACTA CACAGTGGCA 1020GGTCCTCCCG TGTTCCTTCA CAACCCTACC AGCCTTGTCC ACCGGCCTCA TCCACCTCCA 1080CCAGAACATT GTGGACGTGC AGTACTTGTA CGGGGTGGGG TCAAGCATCG CGTCCTGGGC 1140CATTAAGTGG GAGTACGTCG TTCTCCTGTT CCTTCTGCTT GCAGACGCGC GCGTCTGCTC 1200CTGCTTGTGG 1210 541 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 36AATGGCTCAG CTGCTCCGCA TCCCACAAGC CATCTTGGAT ATGATCGCTG GTGCTCACTG 60GGGAGTCCTG GCGGGCATAG CGTATTTCTC CATGGTGGGG AACTGGGCGA AGGTCCTGGT 120AGTGCTGTTG CTGTTTGCCG GCGTCGACGC GGAAACCATC GTCTCCGGGG GACAAGCCGC 180CCGCGCCATG TCTGGACTTG TTAGTCTCTT CACACCAGGC GCTAAGCAGA ACATCCAGCT 240GATCAACACC AACGGCAGTT GGCACATCAA TAGCACGGCC TTGAACTGCA ATGAAAGCCT 300TAACACCGGC TGGTTAGCAG GGCTTATCTA TCAACACAAA TTCAACTCTT CGGGCTGTCC 360CGAGAGGTTG GCCAGCTGCC GACGCCTTAC CGATTTTGAC CAGGGCTGGG GCCCTATCAG 420TCATGCCAAC GGAAGCGGCC CCGACCAACG CCCCTATTGT TGGCACTACC CCCCAAAACC 480TTGCGGTATC GTGCCCGCAA AGAGCGTATG TGGCCCGGTA TATTGCTTCA CTCCCAGCCC 540C 541 541 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 37GGTGTCGCAG TTGCTCCGGA TCCCACAAGC TGTCGTGGAC ATGGTGGCGG GGGCCCACTG 60GGGAGTCCTG GCGGGCCTTG CCTACTATTC CATGGTAGGG AACTGGGCTA AGGTCCTGAT 120TGTGGCGCTA CTCTTCGCCG GCGTTGACGG GGAGACCTAC ACGTCGGGGG GGGCGGCCAG 180CCACACCACC TCCACGCTCG CGTCCCTCTT CTCACCTGGG GCGTCTCAGA GAATCCAGCT 240TGTGAATACC AACGGCAGCT GGCACATCAA CAGGACTGCC CTAAACTGCA ATGACTCCCT 300CCACACTGGG TTCCTTGCCG CGCTGTTCTA CACACACAGG TTCAACTCGT CCGGGTGCCC 360GGAGCGCATG GCCAGCTGCC GCCCCATTGA CTGGTTCGCC CAGGGATGGG GCCCCATCAC 420CTATACTGAG CCTGACAGCC CGGATCAGAG GCCTTATTGC TGGCATTACG CGCCTCGACC 480GTGTGGTATC GTACCCGCGT CGCAGGTGTG TGGTCCAGTG TATTGCTTCA CCCCAAGCCC 540T 541 325 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 38GGTGTCGCAG TTACTCCGGA TCCCACAAGC TGTCATGGAC ATGGTGGCGG GGGCCCACTG 60GGGAGTCCTA GCGGGCCTTG CCTACTATTC CATGGTGGGG AACTGGGCTA AGGTTTTGAT 120TGTGATGCTA CTCTTTGCCG GCGTTGACGG GCATACCCGC GTGACGGGGG GGGTGCAAGG 180CCACGTCACC TCTACACTCA CGTCCCTCTT TAGACCTGGG GCGTCCCAGA AAATTCAGCT 240TGTAAACACC AATGGCAGTT GGCATATCAA CAGGACTGCC CTGAACTGCA ATGACTCCCT 300CCAAACTGGG TTCCTTGCCG CGCTG 325 403 amino acids amino acid linear peptide unknown 39Met Ala Gln Leu Leu Arg Ile Pro Gln Ala Ile Leu Asp Met Ile Ala1 5 10 15Gly Ala His Trp Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val 20 25 30Gly Asn Trp Ala Lys Val Leu Val Val Leu Leu Leu Phe Ala Gly Val 35 40 45Asp Ala Glu Thr His Val Thr Gly Gly Ser Ala Gly His Thr Val Ser 50 55 60Gly Phe Val Ser Leu Leu Ala Pro Gly Ala Lys Gln Asn Val Gln Leu65 70 75 80Ile Asn Thr Asn Gly Ser Trp His Leu Asn Ser Thr Ala Leu Asn Cys 85 90 95Asn Asp Ser Leu Asn Thr Gly Trp Leu Ala Gly Leu Phe Tyr His His 100 105 110Lys Phe Asn Ser Ser Gly Cys Pro Glu Arg Leu Ala Ser Cys Arg Pro 115 120 125Leu Thr Asp Phe Asp Gln Gly Trp Gly Pro Ile Ser Tyr Ala Asn Gly 130 135 140Ser Gly Pro Asp Gln Arg Pro Tyr Cys Trp His Tyr Pro Pro Lys Pro145 150 155 160Cys Gly Ile Val Pro Ala Lys Ser Val Cys Gly Pro Val Tyr Cys Phe 165 170 175Thr Pro Ser Pro Val Val Val Gly Thr Thr Asp Arg Ser Gly Ala Pro 180 185 190Thr Tyr Ser Trp Gly Glu Asn Asp Thr Asp Val Phe Val Leu Asn Asn 195 200 205Thr Arg Pro Pro Leu Gly Asn Trp Phe Gly Cys Thr Trp Met Asn Ser 210 215 220Thr Gly Phe Thr Lys Val Cys Gly Ala Pro Pro Cys Val Ile Gly Gly225 230 235 240Ala Gly Asn Asn Thr Leu His Cys Pro Thr Asp Cys Phe Arg Lys His 245 250 255Pro Asp Ala Thr Tyr Ser Arg Cys Gly Ser Gly Pro Trp Ile Thr Pro 260 265 270Arg Cys Leu Val Asp Tyr Pro Tyr Arg Leu Trp His Tyr Pro Cys Thr 275 280 285Ile Asn Tyr Thr Ile Phe Lys Ile Arg Met Tyr Val Gly Gly Val Glu 290 295 300His Arg Leu Glu Ala Ala Cys Asn Trp Thr Arg Gly Glu Arg Cys Asp305 310 315 320Leu Glu Asp Arg Asp Arg Ser Glu Leu Ser Pro Leu Leu Leu Thr Thr 325 330 335Thr Gln Trp Gln Val Leu Pro Cys Ser Phe Thr Thr Leu Pro Ala Leu 340 345 350Ser Thr Gly Leu Ile His Leu His Gln Asn Ile Val Asp Val Gln Tyr 355 360 365Leu Tyr Gly Val Gly Ser Ser Ile Ala Ser Trp Ala Ile Lys Trp Glu 370 375 380Tyr Val Val Leu Leu Phe Leu Leu Leu Ala Asp Ala Arg Val Cys Ser385 390 395 400Cys Leu Trp 180 amino acids amino acid linear peptide unknown 40Met Ala Gln Leu Leu Arg Ile Pro Gln Ala Ile Leu Asp Met Ile Ala1 5 10 15Gly Ala His Trp Gly Val Leu Ala Gly Ile Ala Tyr Phe Ser Met Val 20 25 30Gly Asn Trp Ala Lys Val Leu Val Val Leu Leu Leu Phe Ala Gly Val 35 40 45Asp Ala Glu Thr Ile Val Ser Gly Gly Gln Ala Ala Arg Ala Met Ser 50 55 60Gly Leu Val Ser Leu Phe Thr Pro Gly Ala Lys Gln Asn Ile Gln Leu65 70 75 80Ile Asn Thr Asn Gly Ser Trp His Ile Asn Ser Thr Ala Leu Asn Cys 85 90 95Asn Glu Ser Leu Asn Thr Gly Trp Leu Ala Gly Leu Ile Tyr Gln His 100 105 110Lys Phe Asn Ser Ser Gly Cys Pro Glu Arg Leu Ala Ser Cys Arg Arg 115 120 125Leu Thr Asp Phe Asp Gln Gly Trp Gly Pro Ile Ser His Ala Asn Gly 130 135 140Ser Ala Pro Asp Gln Arg Pro Tyr Cys Trp His Tyr Pro Pro Lys Pro145 150 155 160Cys Gly Ile Val Pro Ala Lys Ser Val Cys Gly Pro Val Tyr Cys Phe 165 170 175Thr Pro Ser Pro 180 180 amino acids amino acid linear peptide unknown 41Val Ser Gln Leu Leu Arg Ile Pro Gln Ala Val Val Asp Met Val Ala1 5 10 15Gly Ala His Trp Gly Val Leu Ala Gly Leu Ala Tyr Tyr Ser Met Val 20 25 30Gly Asn Trp Ala Lys Val Leu Ile Val Ala Leu Leu Phe Ala Gly Val 35 40 45Asp Gly Glu Thr Tyr Thr Ser Gly Gly Ala Ala Ser His Thr Thr Ser 50 55 60Thr Leu Ala Ser Leu Phe Ser Pro Gly Ala Ser Gln Arg Ile Gln Leu65 70 75 80Val Asn Thr Asn Gly Ser Trp His Ile Asn Arg Thr Ala Leu Asn Cys 85 90 95Asn Asp Ser Leu His Thr Gly Phe Leu Ala Ala Leu Phe Tyr Thr His 100 105 110Arg Phe Asn Ser Ser Gly Cys Pro Glu Arg Met Ala Ser Cys Arg Pro 115 120 125Ile Asp Trp Phe Ala Gln Gly Trp Gly Pro Ile Thr Tyr Thr Glu Pro 130 135 140Asp Ser Pro Asp Gln Arg Pro Tyr Cys Trp His Tyr Ala Pro Arg Pro145 150 155 160Cys Gly Ile Val Pro Ala Ser Gln Val Cys Gly Pro Val Tyr Cys Phe 165 170 175Thr Pro Ser Pro 180 108 amino acids amino acid linear peptide unknown 42Val Ser Gln Leu Leu Arg Ile Pro Gln Ala Val Met Asp Met Val Ala1 5 10 15Gly Ala His Trp Gly Val Leu Ala Gly Leu Ala Tyr Tyr Ser Met Val 20 25 30Gly Asn Trp Ala Lys Val Leu Ile Val Met Leu Leu Phe Ala Gly Val 35 40 45Asp Gly His Thr Arg Val Thr Gly Gly Val Gln Gly His Val Thr Ser 50 55 60Thr Leu Thr Ser Leu Phe Arg Pro Gly Ala Ser Gln Lys Ile Gln Leu65 70 75 80Val Asn Thr Asn Gly Ser Trp His Ile Asn Arg Thr Ala Leu Asn Cys 85 90 95Asn Asp Ser Leu Gln Thr Gly Phe Leu Ala Ala Leu 100 105 943 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 43ACAATACGTG TGTCACCCAG ACAGTCGATT TCAGCCTTGA CCCTACCTTC ACCATTGAGA 60CAATCACGCT CCCCCAGGAT GCTGTCTCCC GCACTCAACG TCGGGGCAGG ACTGGCAGGG 120GGAAGCCAGG CATCTACAGA TTTGTGGCAC CGGGGGAGCG CCCCTCCGGC ATGTTCGACT 180CGTCCGTCCT CTGTGAGTGC TATGACGCAG GCTGTGCTTG GTATGAGCTC ACGCCCGCCG 240AGACTACAGT TAGGCTACGA GCGTACATGA ACACCCCGGG GCTTCCCGTG TGCCAGGACC 300ATCTTGAATT TTGGGAGGGC GTCTTTACAG GCCTCACTCA TATAGATGCC CACTTTCTAT 360CCCAGACAAA GCAGAGTGGG GAGAACCTTC CTTACCTGGT AGCGTACCAA GCCACCGTGT 420GCGCTAGGGC TCAAGCCCCT CCCCCATCGT GGGACCAGAT GTGGAAGTGT TTGATTCGCC 480TCAAGCCCAC CCTCCATGGG CCAACACCCC TGCTATACAG ACTGGGCGCT GTTCAGAATG 540AAATCACCCT GACGCACCCA GTCACCAAAT ACATCATGAC ATGCATGTCG GCCGACCTGG 600AGGTCGTCAC GAGCACCTGG GTGCTCGTTG GCGGCGTCCT GGCTGCTTTG GCCGCGTATT 660GCCTGTCAAC AGGCTGCGTG GTCATAGTGG GCAGGGTCGT CTTGTCCGGG AAGCCGGCAA 720TCATACCTGA CAGGGAAGTC CTCTACCGAG AGTTCGATGA GATGGAAGAG TGCTCTCAGC 780ACTTACCGTA CATCGAGCAA GGGATGATGC TCGCCGAGCA GTTCAAGCAG AAGGCCCTCG 840GCCTCCTGCA GACCGCGTCC CGTCAGGCAG AGGTTATCGC CCCTGCTGTC CAGACCAACT 900GGCAAAAACT CGAGACCTTC TGGGCGAAGC ATATGTGGAA CTT 943 569 base pairs nucleic acid single linear Other cDNA to genomic RNA unknown 44GTAACACATG TGTCACTCAG ACGGTCGATT TCAGCTTGGA TCCCACTCTC ACCATCGAGA 60CGACGACCGT GCCCCAAGAT GCGGTTTCGC GCACGCAGCG GCGAGGTAGG ACTGGCAGGG 120GCAGGAGAGG CATCTATAGG TTTGTGACTC CAGGAGAACG GCCCTCGGCG ATGTTCGATT 180CTTCGGTCCT ATGTGAGTGT TATGACGCGG GCTGTGCTTG GTATGAGCTC ACGCCCGCTG 240AGACCTCGGT TAGGTTGCGG GCTTACCTAA ATACACCAGG GTTGCCCGTC TGCCAGGACC 300ATCTGGAGTT CTGGGAGAGC GTCTTCACAG GCCTCACCCA CATAGACGCC CACTTCTTGT 360CCCAGACTAA GCAGGCAGGA GACAACTTCC CCTACCTGGT AGCATACCAA GCCACAGTGT 420GCGCCAGGGC TAAGGCTCCA CCTCCATCGT GGGATCAAAT GTGGAAGTGT CTCATACGGC 480TAAAGCCTAC GCTGCACGGG CCAACGCCCC TGCTGTATAG GCTAGGAGCC GTCCAGAATG 540AGGTCACCCT CACACACCCT ATAACCAAA 569 313 amino acids amino acid linear peptide unknown 45Asn Thr Cys Val Thr Gln Thr Val Asp Phe Ser Leu Asp Pro Thr Phe1 5 10 15Thr Ile Glu Thr Ile Thr Leu Pro Gln Asp Ala Val Ser Arg Thr Gln 20 25 30Arg Arg Gly Arg Thr Gly Arg Gly Lys Pro Gly Ile Tyr Arg Phe Val 35 40 45Ala Pro Gly Glu Arg Pro Ser Gly Met Phe Asp Ser Ser Val Leu Cys 50 55 60Glu Cys Tyr Asp Ala Gly Cys Ala Trp Tyr Glu Leu Thr Pro Ala Glu65 70 75 80Thr Thr Val Arg Leu Arg Ala Tyr Met Asn Thr Pro Gly Leu Pro Val 85 90 95Cys Gln Asp His Leu Glu Phe Trp Glu Gly Val Phe Thr Gly Leu Thr 100 105 110His Ile Asp Ala His Phe Leu Ser Gln Thr Lys Gln Ser Gly Glu Asn 115 120 125Leu Pro Tyr Leu Val Ala Tyr Gln Ala Thr Val Cys Ala Arg Ala Gln 130 135 140Ala Pro Pro Pro Ser Trp Asp Gln Met Trp Lys Cys Leu Ile Arg Leu145 150 155 160Lys Pro Thr Leu His Gly Pro Thr Pro Leu Leu Tyr Arg Leu Gly Ala 165 170 175Val Gln Asn Glu Ile Thr Leu Thr His Pro Val Thr Lys Tyr Ile Met 180 185 190Thr Cys Met Ser Ala Asp Leu Glu Val Val Thr Ser Thr Trp Val Leu 195 200 205Val Gly Gly Val Leu Ala Ala Leu Ala Ala Tyr Cys Leu Ser Thr Gly 210 215 220Cys Val Val Ile Val Gly Arg Val Val Leu Ser Gly Lys Pro Ala Ile225 230 235 240Ile Pro Asp Arg Glu Val Leu Tyr Arg Glu Phe Asp Glu Met Glu Glu 245 250 255Cys Ser Gln His Leu Pro Tyr Ile Glu Gln Gly Met Met Leu Ala Glu 260 265 270Gln Phe Lys Gln Lys Ala Leu Gly Leu Leu Gln Thr Ala Ser Arg Gln 275 280 285Ala Glu Val Ile Ala Pro Ala Val Glu Thr Asn Trp Gln Lys Leu Glu 290 295 300Thr Phe Trp Ala Lys His Met Trp Asn305 310 189 amino acids amino acid linear peptide unknown 46Asn Thr Cys Val Thr Gln Thr Val Asp Phe Ser Leu Asp Pro Thr Leu1 5 10 15Thr Ile Glu Thr Thr Thr Val Pro Gln Asp Ala Val Ser Arg Thr Gln 20 25 30Arg Arg Gly Arg Thr Gly Arg Gly Arg Arg Gly Ile Tyr Arg Phe Val 35 40 45Thr Pro Gly Glu Arg Pro Ser Ala Met Phe Asp Ser Ser Val Leu Cys 50 55 60Glu Cys Tyr Asp Ala Gly Cys Ala Trp Tyr Glu Leu Thr Pro Ala Glu65 70 75 80Thr Ser Val Arg Leu Arg Ala Tyr Leu Asn Thr Pro Gly Leu Pro Val 85 90 95Cys Gln Asp His Leu Glu Phe Trp Glu Ser Val Phe Thr Gly Leu Thr 100 105 110His Ile Asp Ala His Phe Leu Ser Gln Thr Lys Gln Ala Gly Asp Asn 115 120 125Phe Pro Tyr Leu Val Ala Tyr Gln Ala Thr Val Cys Ala Arg Ala Lys 130 135 140Ala Pro Pro Pro Ser Trp Asp Gln Met Trp Lys Cys Leu Ile Arg Leu145 150 155 160Lys Pro Thr Leu His Gly Pro Thr Pro Leu Leu Tyr Arg Leu Gly Ala 165 170 175Val Gln Asn Glu Val Thr Leu Thr His Pro Ile Thr Lys 180 185

Claims

1. A plasmid selected from the group consisting of plasmids deposited at C.N.C.M. under accession numbers I-1105, I-1106, and I-1107.

2. A recombinant DNA molecule comprisinga nucleotide sequence of HCV E1 contained in a plasmid selected from the group consisting of plasmids deposited at C.N.C.M. under accession numbers I-1105, I-1106, and I-1107, and a nucleotide sequence encoding a peptide, wherein said peptide is an amino acid (aa) sequence selected from the group consisting of: aa58 to aa66 of SEQ ID NO:3; aa49 to aa78 of SEQ ID NO:5; aa123 to aa133 of SEQ ID NO:5; SEQ ID NO:3; SEQ ID NO:5; and SEQ ID NO:7.

3. A purified form of the genome of HCV E1 contained in a plasmid selected from the group consisting of plasmids deposited at C.N.C.M. under accession numbers I-1105, I-1106, and I-1107.