The present invention concerns a nucleotide sequence expressing an exosome-anchoring protein for use as vaccine. Particularly, the present invention concerns a nucleotide sequence expressing a fusion protein, said fusion protein comprising or consisting of an exosome-anchoring protein fused at its C-terminus with an antigen, or a DNA expression vector comprising said nucleotide sequence, for use as vaccine.
It is known that immune response protects from both external and internal health threats. In many cases, when the natural immunity cannot contain the development of the pathology, the immune response elicited by inoculation of immunogens can block the pathogenic process, as occurs, for instance, through the induction of neutralizing antibodies against several infective pathogens.
Differently, the identification, production, and marketing of CTL-based vaccines is much more restricted although there is a wide consensus about its potential usefulness against the development of chronic infections and tumor diseases.
Eliciting a strong and broad CTL immune response is expected to be of therapeutic relevance for the treatment of several pathologies. For instance, several lines of evidence suggest that cell-mediated immune responses are important in controlling HPV infection and, by consequence, the virus-associated neoplasia. In fact, either general immunosuppression, or poor anti-HPV CTL response associate with viral persistence and disease progression.
The most commonly used experimental techniques for the induction of antigen-specific CTL immunity are based on the use of viral vectors, peptides and inactivated pathogens. To date, however, no CTL immunogenic drug is available on the market.
DNA vaccination for the production of immunogenic proteins recognized successes. For instance, a DNA vaccine against Japanese encephalitis has been released in 2010 for human use (1). In addition, a veterinary DNA vaccine to protect horses from West Nile virus has been approved (2, 3). Also, a preliminary study in DNA vaccination against multiple sclerosis was reported as being effective (4). Altogether, these evidences support the idea that, in principle, DNA vaccination can have a perspective of applicability in humans. Among the advantages of DNA vaccination, ease of development and production, stability for storage, cost-effectiveness, and persistence of the immunogen should be mentioned. Theoretical disadvantages would be represented by the possible production of anti-DNA antibodies, and interference on the genetically-controlled mechanisms of cell growth. However, the major limitation is represented by the not adequate potency of the evoked immune response. For this reason, many vaccination protocols including the use of DNA for priming the immune response are followed by the inoculation of the immunogen under alternative formulations to boost the immunity.
Exosomes are vesicles of 50-100 nanometers released constitutively by all cell types. They are generated by the inward invagination of endosome membranes. These intraluminal vesicles form the multivesicular bodies (MVBs) which can traffic to the plasma membrane, to which they fuse thereby releasing their vesicular contents in the extra-cellular milieu. Nanovesicles showing both physical and biochemical features resembling exosomes but generated through direct extrusion of plasma membrane have been described in muscle cells (5, 6). While exosomes were previously thought to be exclusively devoted to secretion of waste cell material, it is now accepted that exosomes are part of the intercellular communication network. They incorporate messenger RNAs, microRNAs, DNA, and proteins which can be functional in target cells.
Their immunogenicity is basically a consequence of the amounts and quality of antigens they incorporate. Exosomes were investigated in terms of anti-tumor immunostimulatory agents, and in some cases they reach the approval for clinical trials (7-9). Exosomes spontaneously uploading tumor antigens, mainly trans-membrane proteins like gp100, TRP-1, Her2/neu, and CEA, have been found inducing activation of specific anti-tumor T cell immunity (10, 11). Clinical trials demonstrated both feasibility and good tolerance of exosomes as cell-free vaccines in tumor patients. However, their therapeutic efficacy appeared quite limited, posing the need of new methods to increase their immunogenicity. This issue has been faced by engineering foreign antigens to increase their display on the exosome membrane. In this regard, two strategies have been described so far. The first one exploits the binding of C1 C2 domains of lactadherin to exosome lipids resulting in the association of the heterologous antigen with the external side of exosome membranes. The other one relies on coating exosomes with Staphylococcus aureus enterotoxin A tailed with a highly hydrophobic trans-membrane domain.
The budding of HIV requires the interaction with a number of cell factors also involved in exosome biogenesis, i.e., Alix, Tsg101, and several other components of the endosomal sorting complex required for transport (ESCRT). Also the envelope membranes of HIV and exosomes share many components, including lipid rafts, i.e., cell membrane microdomains enriched in cholesterol, phospholipids with saturated side chains, and sphingolipids. The convergence of exosome and HIV biogenesis implies the possibility that viral products incorporate in exosomes. It is the case of HIV-1 Nef which associates through anchoring its N-terminal myristoylation to lipid raft microdomains at the limiting membrane of MVB. Nef is a 27 kilodalton (kDa) protein lacking enzymatic activities, however acting as a scaffold/adaptor element in triggering activation of signal transducing molecules, in most cases upon association with lipid raft microdomains.
A V153L E177G Nef mutant incorporating at quite high levels in HIV-1 particles, HIV-1-based virus-like particles (VLPs) (12), and exosomes (13) has been previously identified. The efficiency of exosome incorporation still increases when this mutant was engineered with an N-terminal palmitoylation through G3C mutation, expectedly consequence of an improved association with lipid rafts. This Nef mutant (referred to as Nefmut) is defective for basically all Nef functions, and its efficiency of incorporation in nanovesicles does not change significantly when fused at its C-terminus with foreign proteins. Manipulating Nefmut allows the incorporation of high amounts of antigens of choice into exosomes which thus remain protected from external neutralization/degradation factors. It has been recently reported that Nefmut-engineered exosomes produced in vitro induce an effective antigen-specific CTL response (14). Particularly, quite promising results using in vitro produced exosomes carrying HPV-E7 protein as immunogen (14) have been already obtained.
However, in view of a potential clinic application of these findings, this strategy would face with possible technical difficulties including standardization of industrial manufacturing, high cost-effectiveness, and storage of the immunogen. In addition, in vitro produced exosomes are expected to have a limited half-life upon injection, being also prone to clearance from the reticulum-endothelial system of the host through the recognition of the “non-self” molecules associated to the exosome membrane. On this subject, it has been documented that the half-life of either ex vivo isolated or in vitro produced exosomes lasts around 2 minutes after injection, showing a prompt accumulation in liver and spleen, and only small amounts of exosomes remain detectable after 4 hours.
In the light of above it is therefore apparent the need to provide for new immunotherapies able to overcome the disadvantages of the known therapies.
On this technical background, the present invention provides a new vaccine strategy based on the production of endogenous engineered exosomes which is able to overcome the disadvantages of known therapeutic strategies inducing CTL immune response for the treatment of infective and tumor diseases.
According to the present invention, it has been found that the administration of DNA vectors expressing Nefmut-based fusion proteins into the host animal by intramuscular (i.m.) inoculation elicits a potent CTL immune response strongly inhibiting the growth of already implanted tumor cells. Several lines of evidence indicate that the production of endogenous engineered exosomes was on the basis of the observed anti-tumor effect.
Particularly, the results according to the present invention show: i) the ability of muscle cells to produce engineered exosomes after DNA transfection; ii) the reproducible induction of antigen-specific CTL immunity after inoculation of a vector expressing Nefmut/E7 showing a strong anti-tumor effect in a therapeutic setting, and iii) the immunogenicity of exosomes isolated from plasma of DNA-inoculated mice reinfused in recipient mice.
In addition, whether and how efficiently the ectopic expression of Nefmut leads to the release of engineered exosomes have been investigated. Data obtained with C2C12 cells supported the idea that Nefmut accumulates into exosome-like nanovesicles released by murine muscle cells at levels similar to those detectable in human cells. The investigations did not include terminally differentiated muscle cells, i.e., the cell type most likely targeted by i.m. inoculation in mice. It has been assumed that in these cells the mechanisms underlying the vesicle intracellular trafficking do not change, at least qualitatively.
On this subject, the detection of engineered exosomes in plasma from mice inoculated i.m. with Nefmut-based DNA vectors supported the idea that Nefmut can accumulate in exosomes released by differentiated muscle cells also. Theoretically, it cannot be excluded that at least part of injected DNA could target other cell types by means, for instance, of the diffusion of DNA in draining lymph nodes where it can be captured and internalized by dendritic cells(DCs). However, it is plausible that the DNA uptake by DCs was not relevant part of the mechanism of the here described CD8+ T cell activation events considering that the sub-cute inoculation of Nefmut/E7 expressing DNA, which is expected to preferentially target DCs, gave rise to a significantly fainter E7-specific CD8+ T cell immune response (not shown).
The extents of CD8+ T cell activation detected in DNA inoculated mice appeared much stronger that those which has been observed in mice injected with in vitro produced engineered exosomes (14). Even though direct comparative experiments cannot be run in view of the impossibility to compare the amounts of the two different immunogens, the DNA inoculation elicited an E7-specific CD8+ T cell activation strong enough to be clearly detected without the in vitro stimulation/expansion of splenocytes, needed when mice were inoculated with exosomes produced in vitro by human cells (14). The apparently superior outcomes obtained with DNA injection was likely the consequence of the fact that cells expressing the inoculated DNA can establish a continuous source of immunogenic exosomes ready to be internalized by both local and distal APCs.
According to the present invention, several experimental evidences have been provided concerning the mechanism underlying the CTL immune response observed after DNA injection. In particular, the detection of fluorescent exosomes in plasma of mice inoculated with a vector expressing GFP fused with Nefmut proved that engineered exosomes were indeed produced upon DNA vector injection. In addition, Nefmut activities other than its accumulation in exosomes seemed unimportant for the CD8+ T cell activation since it was detected in mice injected with vector expressing Nefmut but not with wild-type Nef. Consistently, it has been observed that the CTL response did not rely on the release of free antigens from DNA-targeted cells, as indicated by the lack of E7-specific CD8+ T cell response in mice injected with E7-expressing vectors where the E7 extra-cellular shedding was witnessed by the anti-E7 antibody response. In addition, it has been proved that exosomes isolated from plasma of mice injected with vector expressing Nefmut/E7, but not E7 alone, were immunogenic when injected in naïve, recipient mice.
Taken together, these experimental evidences were consistent with the idea that the production of immunogenic endogenous engineered exosomes was on the basis of the CD8+ T cell activation. Notably, this immune response appeared both fast and strong enough to efficiently counteract the growth of syngeneic tumor cells implanted before the immunizations.
On the basis of the here presented experimental evidences, the most likely mechanism underlying the CD8+ T cell activation induced by inoculation of DNA vectors expressing Nefmut-based vectors can be summarized as reported on
Finally, in view of a possible application of this findings to human breast cancer, the following aspects were also investigated: i) whether the immunogenic stimulus induced by the engineered exosomes can break immune tolerance, and ii) their effectiveness when applied in human system. In particular, to test whether the immune activation induced by in vivo engineered exosomes can be strong enough to break tolerance, the widely investigated model of HER2/neu transgenic mice has been considered (15). Here, the rHER2/neu transgene is expressed in thymus, leading to a tolerance severely impairing the CD8+ T branch, as proven by the fact that CD8+ T lymphocytes escaping the tolerance are very poorly represented (16). Through IFN-γ Elispot assay, we reproducibly assessed that two injections of DNA vector expressing Nefmut fused with the extracellular domain of HER2 (HER2-ECD) were sufficient to break the CD8+ T tolerance towards HER2/neu. These results were relevant since a significant HER2/neu-specific CTL response was never found in these transgenic mice upon injection of HER2/neu-expressing DNA vectors (17-19).
Interestingly, it was found that this immune activation correlated with a delay in tumor development. This is the first time that a CTL-related but antibody-independent inhibition of tumor development has been observed in HER2/neu transgenic mice. On the other hand, the fact that the immunologic pressure generated by the HER2-ECD-specific CTL immune response was not sufficient to cure the tumor disease was not surprising for at least two reasons. First, in HER2/neu transgenic mice all mammary epithelial cells simultaneously express the oncogene, resulting in a synchronous development of multiple neoplastic lesions. Hence, the anti-tumor immunity can be overwhelmed by the multiplicity of transformation events. In addition, the intrinsic genetic instability of tumor cells can lead to escaping from the immune pressure through the so-called immune-editing mechanism summarized by the three “Es”, i.e., elimination, equilibrium, and escape (20). In this way, the anti-tumor immune response selects for alterations in cancer cells able to evade the immune control. Of course, the effectiveness of such a mechanism is expected to increase with the number of concurrent tumor lesions.
To open the possibility to exploit the tool of the present invention in clinic, its effectiveness in human system was also demonstrated. To this end, experiments were set up using conditions reproducing the mechanism underlying the induction of antigen-specific CD8+ T lymphocyte immune response previously described in mice (21). The outcome from a confocal microscope analysis was consistent with the idea that the product of DNA vector transfected in human primary muscle cells can be internalized by DCs through formation of engineered exosomes. Furthermore, data from cross-priming assays indicate that the production by transfected muscle cells of exosomes engineered for the incorporation of Nefmut or derivatives thereof is sufficient to generate a well-detectable antigen-specific CTL activity. The fact that the antigen-specific cross-priming was severely impaired when inhibitors of exosome biosynthesis were used was consistent with the idea that the delivery of engineered exosomes to DCs was a key step for the generation of the antigen-specific CTL activation. Overall, the results obtained with ex vivo cells indicate the absence of obvious restrictions in the use of the Nefmut-based CTL vaccine platform in humans.
On the basis of the above, the CTL vaccine platform according to the present invention represents a novel therapy against solid tumors. Breaking tolerance towards tumor-associated self-antigens as well as improving the response against tumor-associated antigens represent the next frontier in terms of anti-tumor immunotherapy (22). CTL vaccine platform based on engineering endogenous exosomes according to the present invention has the potential to meet both end-points, hence representing a truly novel concept in terms of CTL immunization.
The here proposed strategy to induce CTL immunity based on engineered endogenous exosomes exploits the ease of production, storage, and delivery typical of DNA vaccines combined with the potent immunogenicity of antigens uploaded in exosomes upon fusion with Nefmut as well as its intrinsic great flexibility in terms of the choice of the immunogen.
According to the present invention, it has been provided a DNA vector called “Nefmut shuttle” conceived to easily insert and express the sequences of the antigen of choice.
From the structural point of view, the DNA vector according to the present invention may undergo improvements both in terms of transcriptional efficiency, for example by replacing the CMV-IE promoter with other promoters even more powerful, and/or inserting stabilizing sequences of the transcript (eg., Woodchuck Hepatitis Virus posttranscriptional Regulatory Elements, WPRE), and reducing to the minimum size the “exosome-anchoring protein” thus favoring the incorporation of the antigen fused to it.
Since according to the present invention, exosomes/nanovesicles can be engineered “in vivo” to incorporate large amounts of any antigen, the present biotechnology platform can be of therapeutic benefit against any disease susceptible to the attack of specific CTL.
The use for therapeutic purposes of vaccination based on DNA vectors expressing fusion products with the “exosome-anchoring protein” Nefmut according to the present invention is applicable to all pathologies that may benefit from an effective CTL immune response. Clearly, the number and origin of the antigens which can be engineered can be expanded in relation to the therapeutic strategies to deal with.
It is therefore specific object of the present invention a nucleotide sequence expressing a fusion protein, said fusion protein comprising or consisting of the exosome-anchoring protein of sequence SEQ ID NO:1 fused at its C-terminus with an antigen, or a DNA expression vector comprising said nucleotide sequence, for use in vaccine prevention and therapy, wherein SEQ ID NO:1 is the following sequence:
The nucleotide sequence or DNA expression vector according to the present invention can be administered preferably intramuscularly; other routes of administration can be aerosol administration (i.e. administration to the upper airway), intradermal, mucosal, sub-cute administration.
The antigen can be chosen from the group consisting of Human Papilloma virus antigen such as E6 and E7, HIV antigen such as Gag and Tat, Ebola virus antigen such as VP24, VP40, NP, and GP, West Nile virus antigen such as NS3, HBV antigen such as Core, HCV antigen such as Core, NS3, E1 and E2, Crimean-Congo virus antigen such as GP and NP, Influenza A virus antigen such as NP and M1, human melanoma antigen such as MAGE-A3 and MART-1, human tumor-associated antigens such as Her2/Neu, Hox B7.
As mentioned above, the nucleotide sequence expressing the exosome-anchoring protein of sequence SEQ ID NO:1 can be the following nucleotide sequence SEQ ID NO:2 (Nefmut nucleotide sequence): atg ggt tgc aag tgg tca aaa agt agt gtg gtt gga tgg cct gct gta agg gaa aga atg aga cga gct gag cca gca gca gat ggg gtg gga gca gca tct cga gac cta gaa aaa cat gga gca atc aca agt agc aat aca gca gct acc aat gct gat tgt gcc tgg cta gaa gca caa gag gag gag gag gtg ggt ttt cca gtc aca cct cag gta cct tta aga cca atg act tac aag gca get gta gat ctt agc cac ttt tta aaa gaa aag ggg gga ctg gaa ggg cta att cac tcc caa cga aga caa gat atc ctt gat ctg tgg atc tac cac aca caa ggc tac ttc cct gat tgg cag aac tac aca cca gga cca ggg gtt aga tat cca ctg acc ttt gga tgg tgc tac aag cta gta cca gtt gag cca gag aag tta gaa gaa gcc aac aaa gga gag aac acc agc ttg tta cac cct gtg agc ctg cat gga atg gat gac ccg gcg aga gaa gtg tta gag tgg agg ttt gac agc cgc cta gca ttt cat cac gtg gcc cga gag ctg cat ccg gag tac ttc aag aac tgc tga.
The nucleotide sequence or DNA expression vector according to the present invention can be used for the prevention and treatment of diseases chosen from the group consisting of chronic infective diseases such as HBV, HCV and HIV, tuberculosis and malaria, acute infective diseases such as influenza, West Nile, Crimean-Congo hemorrhagic fever and Ebola diseases, tumors such as breast, pulmonary, prostate or bladder tumor.
The present invention concerns also a pharmaceutical composition comprising or consisting of a nucleotide sequence expressing a fusion protein, said fusion protein comprising or consisting of the exosome-anchoring protein of sequence SEQ ID NO:1 fused at its C-terminus with an antigen or a DNA expression vector comprising said nucleotide sequence, in association with one or more pharmaceutically acceptable excipients and/or adjuvants, such as an adjuvant of CD8+ T cells response (for instance Iscomatrix™ adjuvant), wherein SEQ ID NO:1 is the following sequence:
As mentioned above, the antigen can be chosen from the group consisting of Human Papilloma virus antigen such as E6 and E7, HIV antigen such as Gag and Tat, Ebola virus antigen such as VP24, VP40, NP and GP, West Nile virus antigen such as NS3, HBV antigen such as Core, HCV antigen such as Core, NS3, E1 and E2; Crimean-Congo virus antigen such as NP and GP; Influenza A virus antigen such as NP and M1; human melanoma antigen such as MAGE-A3 and MART-1; human tumor-associated antigens such as Her2/Neu, HoxB7.
According to an embodiment of the present invention, the nucleotide sequence expressing the exosome-anchoring protein of sequence SEQ ID NO:1 can be the following sequence SEQ ID NO:2: atg ggt tgc aag tgg tca aaa agt agt gtg gtt gga tgg cct gct gta agg gaa aga atg aga cga gct gag cca gca gca gat ggg gtg gga gca gca tct cga gac cta gaa aaa cat gga gca atc aca agt agc aat aca gca gct acc aat gct gat tgt gcc tgg cta gaa gca caa gag gag gag gag gtg ggt ttt cca gtc aca cct cag gta cct tta aga cca atg act tac aag gca gct gta gat ctt agc cac ttt tta aaa gaa aag ggg gga ctg gaa ggg cta att cac tcc caa cga aga caa gat atc ctt gat ctg tgg atc tac cac aca caa ggc tac ttc cct gat tgg cag aac tac aca cca gga cca ggg gtt aga tat cca ctg acc ttt gga tgg tgc tac aag cta gta cca gtt gag cca gag aag tta gaa gaa gcc aac aaa gga gag aac acc agc ttg tta cac cct gtg agc ctg cat gga atg gat gac ccg gcg aga gaa gtg tta gag tgg agg ttt gac agc cgc cta gca ttt cat cac gtg gcc cga gag ctg cat ccg gag tac ttc aag aac tgc tga.
The pharmaceutical composition can be administered preferably by intramuscular administration; other routes of administration can be aerosol administration (i.e. administration to the upper airway), intradermal, mucosal, sub-cute administration.
In addition, the present invention concerns a pharmaceutical composition as mentioned above for use in vaccine prevention and therapy for instance in the prevention and treatment of diseases chosen from the group consisting of chronic infective diseases such as HCV and HIV, tuberculosis and malaria, acute infective diseases such as influenza, West Nile, Crimean-Congo hemorrhagic fever and Ebola diseases, tumors such as breast, pulmonary, prostate or bladder tumor.
The nucleotide sequence, the DNA expression vector or the pharmaceutical composition comprising the same according to the present invention can be used in medical field as well as in veterinary field.
The present invention now will be described by an illustrative, but not limitative way, according to preferred embodiments thereof, with particular reference to enclosed drawings, wherein:
In all IFN-γ Elispot assays, cells were also incubated with 5 ng/ml of PMA and 500 ng/ml of ionomycin. Shown are the mean+SD number of SFU/105 cells. Results are representative of two independent experiments. *p<0.05.
Shown are the values detected for each inoculated mouse. Results are representative of two independent experiments.
All molecular constructs were based on IE-CMV-promoted vectors. The constructions of vectors expressing Nefmut (13), Nefmut-GFP (13), NefG2A-GFP (23), wtNef (24), and HPV-E7 (25), have been already described. 293T, murine muscle C2C12, and HPV-E7 expressing TC-1 tumor cells were grown in Dulbecco's modified Eagle's medium plus 10% heat-inactivated fetal calf serum (FCS). Transfection assays were carried out using the Lipofectamine 2000-based method, which in the case of C2C12 cells was modified by adding liposomes on freshly trypsinized cells. Both mouse splenocytes and EL-4 cells, i.e., murine thymic lymphoma CD4+ T cells originally obtained from C57 BI/6 mice upon treatment with 9,10-dimethyl-1,2-benzanthracene, were cultivated in RPMI medium supplemented with 10% FCS.
Exosomes were isolated from cell supernatants through differential centrifugations. In detail, supernatants were centrifuged at 500×g for 10 min. Then, supernatants underwent differential centrifugations consisting in a first ultracentrifugation at 10,000×g for 30 min. Supernatants were then harvested, filtered with 0.22 μM pore size, and ultracentrifuged at 70,000×g for 1 h. Pelleted vesicles were resuspended in 1×PBS, and ultracentrifuged again at 70,000×g for 1 h. Afterwards, pellets were resuspended in 1:100 of the initial volume of 1×PBS. The recovery of exosomes from plasma of inoculated mice was carried out in a similar way except that samples were 5-fold diluted before starting centrifugations whose running times were doubled. The amounts of recovered exosomes were evaluated by measuring the activity of acetylcholinesterase (AchE), i.e., a classical exosome marker, through the Amplex Red kit (Molecular Probes) following the manufacturer's recommendations. The AchE activity was measured as mU/mL, where 1 mU is defined as the amount of enzyme which hydrolyzes 1 pmole of acetylcholine to choline and acetate per minute at pH 8.0 at 37° C.
Fluorescent exosomes from transfected cell cultures were either directly detected by FACS (Gallios, Beckman Coulter), or, in the case of exosomes isolated from plasma, analyzed upon binding with aldehyde/sulfate latex beads (Invitrogen Molecular Probes). To this end, samples were incubated with 5 μl of beads overnight at r.t. on a rotating plate, and then washed, resuspended in 1×PBS-2% v/v formaldehyde, and FACS analyzed.
For western blot analysis of exosomes, equivalent amounts of nanovesicles were lysed in PBS, 1% Triton X-100 in the presence of anti-proteolytic agents, and then separated by 10% SDS-PAGE. Meanwhile, western blot analysis was carried out also on lysates of transfected cells by washing cells twice with 1×PBS (pH 7.4) and lysing them for 20 min on ice with lysis buffer (20 mM HEPES pH 7.9, 50 mM NaCl, 10 mM EDTA, 2 mM EGTA, 0.5% nonionic detergent IGEPAL CA-630, supplemented with anti-proteolytic agents. Whole cell lysates were centrifuged at 6,000×g for 10 min at 4° C. Protein concentration of cell extracts was determined by the Lowry protein quantitation assay. Aliquots of 30 to 50 μg of total proteins were resolved by 10% SDS-PAGE. Proteins were transferred by electroblotting on a 0.45 μm pore size nitrocellulose membrane (Amersham) overnight using a Bio-Rad Trans-Blot. Filters were revealed using 1:1000 diluted sheep anti-Nef antiserum ARP 444 (a generous gift of M. Harris, University of Leeds, Leeds, UK), and both 1:250 diluted anti-β actin AC-74 mAb from Sigma, and anti-Alix H-270 polyclonal Abs from Santa Cruz.
All studies with animals here described have been approved by the Ethical Committee of the Istituto Superiore di Sanità, Rome, Italy (protocol n. 555/SA/2012) according to Legislative Decree 116/92 which has implemented in Italy the European Directive 86/609/EEC on laboratory animal protection. Animals used in the research have been housed and treated according to the guidelines inserted in here above mentioned Legislative Decree. C57 BI/6 mice were purchased from Charles River Laboratories, and inoculated i.m. two times at ten day intervals with 50 μg each back leg of plasmid DNA purified with endotoxin-free Qiagen kit. Mice were also inoculated subcutaneously (s.c.) with 6 mU equivalents of AchE activity of exosomes purified from plasma of mice injected with DNA vectors for three times at ten day intervals, and sacrificed ten days after the last immunization. To detect both E7- and Nef-specific CD8+ T cell immune responses, splenocytes were put in culture in IFN-γ Elispot microwells (Millipore) in the presence of 5 μg/ml of either HPV-E7 or HIV-1 Net 8- or 9-mer peptides already identified to efficiently bind the H-2 Kb complex of C57 BI/6 mice, i.e., DLYCYEQL (aa 21-28) (SEQ ID NO: 3) and RAHYNIVTF (aa 49-57) (SEQ ID NO: 4) for E7 (HPV-16 Gene Bank accession n. AAD33252.1), and TAATNADCA (aa 48-56) (SEQ ID NO: 5) for Nef (HIV-1, F12 strain, accession number EMBL Z11530). H-2 Kb binding HPV E6-specific KLPQLCTEL (aa. 18-26) (SEQ ID NO: 6) and YDFAFRDL (aa 50-57) (SEQ ID NO: 7) peptides (HPV-16 Gene Bank accession n. AAD33253.1) were used as unrelated peptides. After o.n. incubation, IFN-γ Elispot plates were developed (Mabtech AB), and spot-forming cells were analyzed and counted using an Elispot reader (A.EL.VIS. Elispot reader and Analysis software GmbH).
For analysis by fluorescence microscope, 7 μM slices from quadriceps of inoculated mice were prepared by cryostat (Leika CM 3050) sectioning and placed to slides. The slices were then incubated with 4′,6′-diamidino-2-phenylindole (DAPI, Vector Laboratories) together with an antifade mounting medium. Finally, coverslips were mounted to slides which were then observed with a Zeiss Axioskop 2 Plus fluorescence microscope.
CD8+ T cells were isolated from splenocytes of inoculated mice by positive immunomagnetic selection (Miltenyi Biotec). They were put in co-culture for 6 hours in RPMI 10% FCS with EL-4 cells previously labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen), and treated overnight with either E7 or unrelated peptides. The co-cultures were run at different cell ratios (i.e., from 20:1 to 5:1 effector/target cells) in 200 μl of RPMI 20% in U-bottom 96 well plates. Afterwards, EL-4 cell mortality was scored by FRCS analysis soon after addition of 7-AAD at final concentration of 1 μg/ml.
Plasma from inoculated mice were pooled, and two-fold serial dilutions starting from 1:10 were assayed for the presence of anti-E7 Abs. The end-point dilution corresponded to a <0.1 OD absorbance at 450 nm. Each plasma was assayed in triplicate, and the mean of the absorbance value was taken as final readout. Both recombinant E7 and Nef were used for the assay. The proteins were adsorbed overnight at 4° C. in carbonate buffer (pH 9.4) into Maxisorp microtiter plates (NUNC) at the concentrations of 0.25 μg/well. After a blocking step of 2 h of at 37° C. in PBS containing 3% non-fat dry milk (NFDM), plates were incubated at 37° C. for 1 h with 100 μL of serially diluted plasma in 1% NFDM-PBS. Specific antigen-antibody complexes were detected by a peroxidase-conjugated goat anti-mouse IgG (GE Healthcare Ltd) using tetramethyl benzidine as substrate. After 30 min at room temperature, the enzymatic reaction was stopped by adding 50 μl of 1 M sulphuric acid/well. Washing steps were done with 200 μl/well of PBS containing 0.05% Tween-20 in an automatic washer.
The anti-tumor activity induced by the inoculation of Nefmut/E7— expressing vector was evaluated in mice previously challenged with 2×105 TC-1 cells. DNA inoculations were performed 4 and 11 days after tumor cell challenge following the above reported protocol, and only in mice which developed palpable tumors. Tumor growth was monitored by visual inspection, palpation, and measurement of tumor nodule diameter calculated as (length×width2)/2. At the end of the observation time, tumors were explanted and weighted.
When appropriate, data are presented as mean+standard deviation (SD). In some instances, the paired Student's t-Test was used and confirmed using the non-parametric Wilcoxon rank sum test. p<0.05 was considered significant.
Muscle cells represent the ideal target for a both efficient and stable expression of ectopic DNA upon in vivo administration. The aim was to express Nefmut-based DNA vectors in vivo to engineer the exosomes constitutively released by cells expressing the inoculated DNA. These endogenous exosomes were expected to show characteristics at least similar to those produced in tissue cultures in terms of induction of antigen-specific CTL immune responses.
As already assessed in human cell types of different origin, whether the internalization of a Nefmut-expressing DNA vector in murine muscle cells was sufficient for the production of engineered exosomes has been preliminarily investigated. Notably, murine muscle cells release nanovesicles with exosome-like characteristics whose biogenesis, however, differ from that of MVB-generated exosomes. For the sake of clarity, exosome-like nanovesicles released by murine muscle cells are here defined exosomes.
Murine C2C12 muscle cells and, as control, human 293T cells were transfected with vector expressing GFP fused at the C-terminus of either Nefmut or a Nef isotype (i.e., NefG2A) already characterized for its inefficiency to associate with exosomes (26). Transfected cell cultures were monitored for the respective efficiency of transfection (
In sum, it has been proved that exosome-like nanovesicles released by murine muscle cells can be engineered by Nefmut-derivatives as previously proven in epithelial-like, transformed human 293T cells.
On the basis of the in vitro results which were obtained with murine muscle cells, the expression of the Nefmut-based vector in vivo has been attempted. To this aim, 50 μg of either Nefmut-GFP, NefG2A-GFP, or empty vector were inoculated in each quadriceps of C57 BI/6 mice. Three days later, a number of inoculated mice was sacrificed and their legs cryopreserved. Then, slices obtained from the zones of inoculation were analyzed for the expression of GFP-related products. Consistently with the already described features of Nef and its mutants/derivatives, Nefmut apparently accumulated at the plasma membrane meanwhile disposing also in an intracellular punctate pattern. Differently, the NefG2A mutant, as consequence of the lack of N-terminal myristoylation, disposed in a more diffuse intracytoplasmic distribution (
Next, the immunogenicity of the antigens uploaded in engineered exosomes generated by the inoculation of DNA vectors expressing Nefmut-derivatives was evaluated. To this aim, C57 BI/6 mice (six per group) were inoculated i.m. in each back lag with 50 μg of vectors expressing either Nefmut/E7 or E7 alone, or with empty vector. Of note, the analysis of the immune response after injection of a vector expressing E7 alone was instrumental to evaluate the benefit of the Nefmut-fusion in terms of CD8+ T cell immunogenicity. The inoculations were repeated 10 days later, and after additional 10 days the mice were sacrificed, and the splenocytes cultured o.n. in IFN-γ Elispot microwells in the presence of unrelated, Nef- or E7-specific H-2 Kb nonamers. The levels of CD8+ T cell activation observed in cultures with unrelated peptides remained at background levels and similar to those detected in splenocytes cultured in the absence of peptides (not shown). On the other hand, cell activation was clearly detectable in splenocytes from mice inoculated with the Nefmut/E7 expressing vector after incubation with either E7 or Nef nonamers (
To evaluate whether the CD8+ T cell response associated with a measurable CTL activity, CD8+ T cells were isolated from pools of splenocytes, and then put in co-culture for 6 h at different cell ratios (i.e., from 20:1 to 5:1) with CFSE-labelled EL-4 cells pre-treated o.n. with either unrelated or E7 nonamers. Afterwards, the co-cultures were labelled with 7-AAD, and the mortality levels of target cells scored by FACS analysis. The results reported in
Taken together, these data indicated that the i.m. inoculation of a vector expressing an heterologous antigen fused with Nefmut leads to the induction of a strong antigen-specific CTL response in the absence of antibody production.
The results provide evidence that the i.m. injection of DNA vectors expressing Nefmut-derivatives leads to the production of exosomes uploading Nefmut products correlating with the induction of a CTL response against the foreign antigen incorporated into the exosomes. To support the idea that the high levels of Nefmut incorporation in exosomes were mandatory to elicit the antigen specific CD8+ T cell response, the immunogenicity experiments were reproduced however by inoculating mice with vectors expressing the wild-type isoform of Nef which incorporates in exosomes at much lower extents compared to Nefmut (13). To this end, C57 BI/6 mice (four per group) were injected i.m. in each back lag with 50 μg of a vector expressing either wtNef or Nefmut, or with the empty vector. The inoculations were repeated 10 days later, and after additional 10 days the mice were sacrificed. Splenocytes were then isolated and cultured o.n. in IFN-γ Elispot microwells in the presence of either unrelated or Nef-specific nonamers. As shown in
These results indicate that the efficiency of antigen uploading in exosomes is critical for the induction of the immune response, also suggesting that the functions of wtNef were not per se involved in the CD8+ T cell activation we observed.
To enforce the hypothesis that the CD8+ T cell immune response detected upon inoculation of Nefmut-expressing vectors relies on the in vivo production of engineered exosomes, whether exosomes purified from the plasma of inoculated mice were immunogenic in recipient naïve mice was assessed. To this aim, eight mice were inoculated with vectors expressing E7, Nefmut/E7 or the empty vector following the here above detailed schedule. Eight day after the last immunization, PBMCs were recovered through retro orbital bleeding, and put in IFN-γ Elispot microwells to check the E7-specific CD8+ T cell response. As already observed, the injection of the Nefmut/E7 expressing vector, but not that expressing E7 alone, gave rise to a well detectable E7-specific CD8+ T cell response (
These results indicate that the i.m. injection of DNA expressing Nefmut/E7 leads to the production of immunogenic exosomes, hence further supporting the idea that the DNA-directed production of endogenous, engineered exosomes was on the basis of the observed strong E7-specific CD8+ T cell immune response.
Finally, the potency of the CD8+ T cell immune response evoked by injection of Nefmut/E7 expressing vector in terms of anti-tumor effect has been evaluated. To this end, therapeutic immunization assays on C57 BI/6 mice inoculated s.c. with 2×105 TC-1 cells have been set up. Mice developing a tumor mass detectable by palpation, i.e., of about 2 mm of diameter, were then inoculated with 50 μg/back leg of vectors expressing either empty vector, Nefmut (4 mice per each group) or Nefmut/E7 (six mice) at both days 4 and 11 after cell implantation. As control, 4 tumor-implanted mice were injected with the vehicle alone. At day 21, retro orbital bleeding carried out on mice injected with Nefmut- or Nefmut/E7-expressing vectors served to assess the induction of E7-specific CD8+ T cell immune response (
From these data it can be concluded that the inoculation of Nefmut/E7-expressing DNA vector elicits a CD8+ T cell immune response also in the presence of tumor cells. Most important, this immune response was both strong and rapid enough to strongly inhibit the growth of previously implanted syngeneic tumor cells.
Taken together, these results represent a relevant milestone towards possible therapeutic applications of immunization strategies based on Nefmut-based endogenous exosomes.
The strategy of immunization based on inoculation of DNA vectors expressing an antigen fused to the C-terminus of Nefmut has been successfully applied also to a variety of additional viral antigens (see Tab. 1). In detail, vectors expressing such antigens fused with Nefmut have been injected in either C57 BI/6 or Balb/c mice following the here above described schedule. From 10 to 15 days after the last inoculation, IFNγ ELISPOT assays were carried out with splenocytes from the injected mice using the peptides listed in Table 1.
aShown are the mean values ±SD subtracted background values as calculated from data obtained with splenocytes from four inoculated mice each tested in triplicate wells.
The results support the idea that the injection of DNA expressing antigens fused to Nefmut is instrumental to induce CTL immunity against a wide range of full-length antigens.
DNA coding for the extra-cellular domain (ECD) of activated rHER2/neu was recovered by RT-PCR carried out on total RNA extracted from N202.1A cells, i.e., a cell line derived from FVB mice transgenic for rHER-2/neu (27). The following primers comprising the Nhe I and Eco RI restriction sites at the respective 5′ end were used: forward (just downstream to the signal peptide) 5′ CTAGCT AGCACCCAAGTGTGTACCGGC 3′(SEQ ID NO:18); reverse: 5′CCGGAATTCTCAGTGGGT CA GTTGATGGG 3′(SEQ ID NO:19). To obtain the vector expressing the Nefmut/HER2-ECD fusion product, the PCR product was Nhe I/Eco RI cut, and inserted in frame at the 3′ terminus of an Nhe I/Eco RI digested pcDNA3-based vector expressing Nefmut. Through this strategy, both rat and mouse HER2-ECD sequences were expected to be fused with NeF1t in the resulting molecular constructs. The selection was made on the basis of the presence of rHER2/neu sequence. Vectors expressing Nefmut, Nefmut/GFP, and Nefmut/MART-1 have been already described (13). The IE-CMV-promoted vector expressing the rHER2/neu was kindly provided by A. Amici, University of Urbino, Italy.
293T, MCF-7, murine muscle C2C12 (all obtained from American Type Culture Collection), and TC-1 cells (28) were grown in Dulbecco's modified Eagle's medium plus 10% heat-inactivated fetal calf serum (FCS). Transfection assays were carried out by Lipofectamine 2000-based method (Invitrogen, Thermo Fisher Scientific), which in the case of C2C12 cells was modified by adding liposomes on freshly trypsinized cells. HLA-A.02 B-LCLs (29), murine splenocytes, and CD8+ T lymphocytes were cultivated in RPMI medium plus 10% FCS. Human primary skeletal muscle cells (SKMC) were obtained from Lonza, and cultivated with the recommended medium.
Human PBMCs were isolated from healthy donors by Fycoll-Hypaque density gradients. Monocytes were isolated from PBMCs using an immunomagnetic monocyte selection kit (Miltenyi). Purity of recovered cell populations was assayed by FACS analysis using PE-conjugated anti-CD14 mAb (Becton Dickinson). Monocytes were differentiated to iDCs upon 4-5 days of culture in RPMI medium supplemented with 20% FCS, 30 ng/ml. granulocyte-macrophage colony-stimulating factor (GM-CSF) (Serotec Ltd), and 500 units/mL IL-4 (R&D Systems). DC maturation was obtained through o.n. treatment with 10 ng/mL of lipopolysaccharide (LPS).
Exosomes were isolated through differential centrifugations as previously described (30) starting from supernatants of 293T cells 48 to 72 hours after transfection. The amounts of recovered exosomes were evaluated by measuring the activity of acetylcholinesterase (AchE, i.e., a classical exosome marker) (31) through Amplex Red kit (Molecular Probes, Thermo Fisher) following the manufacturer's recommendations.
Western blot analyses of both cell lysates and exosomes were carried out as described (13). Filters were revealed using 1:1000 diluted sheep anti-Nef antiserum ARP 444 (MRC), 1:250 diluted anti-β actin AC-74 mAb from Sigma, and 1:100 diluted anti-Alix H-270 polyclonal Abs from Santa Cruz.
All studies with animals here described have been approved by the Ethical Committee of the ISS (protocol n. 107/2016-PR) according to Legislative Decree 116/92 which has implemented in Italy the European Directive 86/609/EEC on laboratory animal protection. Animals used in our research have been housed and treated according to the guidelines inserted in here above mentioned Legislative Decree. A colony of 129Sv-NeuT transgenic mice generated and bred in the ISS animal facility (32) was used. In these mice, the activated rHER-2/neu gene is promoted by MMLV LTR and virgin females spontaneously develop mammary carcinomas becoming palpable at 15-20 weeks of age. The presence of the rHER2/neu transgene was routinely checked by PCR as described (32). Mice were inoculated i.m. two times at 15 and 17 weeks of age with 50 μg for each quadriceps of plasmid DNA purified with endotoxin-free Qiagen kit. The mammary glands were inspected once a week for tumor monitoring. Mice bearing tumors exceeding 30 mm of diameter were euthanized.
Plasma from inoculated mice were 1:20 diluted and tested for the presence of anti-HER2/neu antibodies on 293T cells transfected two days before with a HER2/neu expressing vector. After 2 hours of incubation at 4° C., cells were washed and incubated with FITC-conjugated anti-mouse IgGs, and FACS analyzed 1 hour later. As a positive control, 1:20 diluted anti HER2/neu mAb clone 7.16.4 (Sigma) was used.
To detect both HER2/neu- and Nef-specific CD8+ T cell immune responses, splenocytes were put in IFN-γ Elispot microwells (Millipore) in the presence of 5 [tg/rril of either HER2/neu or HIV-1 Nef 9-mer peptides binding the H-2 Kb complex of 129Sv transgenic mice, i.e., ILHDGAYSL (aa 436-444) (33) and TAATNADCA (aa 48-56) (34), respectively. H-2 Kb binding heterologous peptides (35) were used as control. After o.n. incubation, IFN-γ Elispot plates were developed (Mabtech), and spot-forming units (SFUs) counted.
A total of 106 SKMC was transfected with 10 μg of either Nefmut-based or control vectors. After 48 hours, the cells were put in co-culture with iDCs in a 1:5 cell ratio, and, in some instances, in the presence of 2 μM of the inhibitors of exosome biosynthesis GW4869 and spiroepoxide (36-41). After an overnight incubation, iDCs were isolated and matured by LPS treatment for 24 hours. Thereafter, iDCs were washed, and put in co-culture with autologous peripheral blood lymphocytes (PBLs) in a 1:10 cell ratio. A week later, the stimulation procedure was repeated, and, after an additional week, CD8+ T cells were recovered for CTL assays.
CTL assays with murine cells were performed by isolating CD8+ T cells from splenocytes by positive immunomagnetic selection (Miltenyi). They were put in co-culture for 6 hours in RPMI 10% FCS with TC-1 cells previously labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen, Thermo Fisher) following the manufacturer's recommendations, and treated overnight with either HER2/neu, Nef, or unrelated peptides. The co-cultures were run at 10:1 effector/target cell ratio in 200 μL of RPMI 20% in U-bottom 96 well plates. Afterwards, TC-1 cell mortality was scored by FACS analysis soon after addition of 7-AAD at final concentration of 1 μg/ml. CTL assays in human cells were carried out in a similar way except that either MCF-7 or B-LCLs were used as target cells.
Overnight co-cultures comprising iDCs and SKMC transfected two days before with vectors expressing either GFP or Nefmut/GFP, were carried out in a 1:5 cell ratio in the presence or not of GW4869 and spiroepoxide. Thereafter, cells were stained first with anti-CD45 (i.e., a marker of iDCs) for 1 hour at 4° C., and then with Alexa-Fluor 610-conjugated secondary Abs. Finally, co-cultures were labelled with 4′,6′diamino-2-phenylindole (DAPI, Vector Laboratories), and fixed in buffered formaldehyde (2% v/v). Phase contrast and fluorescence images were recorded with an Olympus IX-81 device.
When appropriate, data are presented as mean+standard deviation (SD). In some instances, the paired Student's t-Test was used and confirmed using the non-parametric Wilcoxon rank sum test. p<0.05 was considered significant.
The Extra-Cellular Domain of rHER2/neu is Efficiently Uploaded in Exosomes Upon Fusion with Nefmut
ECD of rHER2/neu deprived of the signal peptide was fused at the C-terminus of Nefmut in the context of a IE-CMV-promoted eukaryotic vector. To check both stability and exosome incorporation of the fusion product, 293T cells were transiently transfected with vectors expressing either Nefmut or Nefmut/HER2-ECD, or with void vector. After 48 hours, cells were lysed and supernatants underwent differential centrifugations to isolate exosomes. Both cell and exosome lysates were analyzed by western blot (
It has been assumed that, as already proven for other Nefmut-based fusion products (21), i.m. injection in mice of the Nefmut/HER2-ECD expressing vector leads to production of immunogenic endogenously engineered exosomes incorporating the Nefmut/HER2-ECD fusion product. The question was whether the expected CD8+ T lymphocyte immunogenicity of these exosomes was strong enough to break the tolerance towards HER2/neu.
The induction of anti-HER2/neu antibodies, i.e., an effect already described in mice injected with rHER2/neu DNA vectors (42, 43) has been tested first(). To this end, HER2/neu transgenic mice were injected with DNA vectors expressing either Nefmut or Nefmut/HER2-ECD (3 per group). Fifteen days after the second injection, plasma were recovered and tested for the presence of anti-HER2/neu Abs using as indicator cells 293T transiently transfected with a DNA vector expressing HER2/neu. As reported in
Next, the antigen-specific CD8+ T lymphocyte response testing splenocytes from injected mice through IFN-γ Elispot assays carried out upon stimulation with H2b-restricted Nef and HER2-ECD nonamers was analyzed. As shown in
These data demonstrate the induction of both Nef and HER/neu specific CD8+ T lymphocyte responses in mice injected with Nefmut/HER2-ECD DNA vector.
Next, the aim of the study was to assess whether the injection of Nefmut/HER2-ECD-expressing DNA vector can induce an HER2/neu-specific CTL activity. To this end, CD8+ T lymphocytes were isolated from splenocytes of HER2/neu transgenic mice inoculated with void vector or with vectors expressing either Nefmut or Nefmut/HER2-ECD. The CD8+ T lymphocytes were then put in co-culture with syngeneic, CFSE-labeled TC-1 cells pre-treated with the appropriate peptides. After 5 hours, the cocultures were stopped, labeled with 7-AAD, and analyzed by FACS to evaluate percentages of dead TC-1 target cells. As shown in
These results established a link between the i.m. delivery of Nefmut/HER2-ECD DNA vector and the induction of HER2/neu-specific CTL activity.
Next, the aim of the study was to assess whether the HER2-ECD-specific CTL activity coupled with a detectable anti-tumor activity. Fifteen weeks old 129Sv-Neu T transgenic mice still free from palpable lesions were injected with either vehicle or DNA vectors expressing Nefmut and Nefmut/HER2-ECD. The injections were repeated two weeks later, and the appearance of palpable tumors was monitored weekly. As reported in
These data highlight a direct relationship between the HER2-ECD-specific CTL activity induced by DNA i.m. injection and anti-tumor activity.
To open the possibility to exploit our CTL vaccine platform in clinic, demonstrating its effectiveness in human system is mandatory. To this end, experiments using conditions at least in part reproducing the mechanism underlying the induction of antigen-specific CD8+ T lymphocyte immune response previously described in mice injected with Nefmut-expressing DNA vectors were set up (1). The transfer of exosomes from transfected muscle cells to IDCs was first documented. SKMC were transfected with either GFP or Nefmut/GFP DNA vectors, and the transfection efficiency was checked by FACS analysis (
Next, cross-priming assays aimed at evaluating the induction of antigen-specific CTL activity were performed as summarized on
Next, these investigations were extended towards antigens fused with Nefmut. In addition, whether the production of engineered exosomes was indeed on the basis of the induction of the antigen-specific CTL activity was verified. To this aim, cross-priming assays were reproduced using a DNA vector expressing Nefmut fused with MART-1, i.e., a human melanoma-associated antigen (44), and following the procedures depicted in
These data indicate that the production by transfected muscle cells of exosomes engineered for the incorporation of Nefmut or derivatives thereof are part of the mechanism underlying the induction of the antigen-specific CTL activity we observed with human cells. Hence, these findings support the idea that the CTL vaccine platform has the potential to be applied in humans against tumor antigens.
1. Halstead S. B., S. J. Thomas. 2011. New Japanese encephalitis vaccines: alternatives to production in mouse brain. Expert Rev. Vaccines. 10: 355-64. doi:10.1586/erv.11.7.
2. Ng T., D. Hathaway, N. Jennings, D. Champ, Y. W. Chiang, H. J. Chu. 2013. Equine vaccine for West Nile virus. Dev. Biol.;114: 221-7.
3. El Garch H., J. M. Minke, J. Rehder, S. Richard, C. Edlund Toulemonde, S. Dinic, C. Andreoni, J. C. Audonnet, R. Nordgren, V. Juillard. 2008. A West Nile virus (WNV) recombinant canarypox virus vaccine elicits WNV-specific neutralizing antibodies and cell-mediated immune responses in the horse. Vet. Immunol. Immunopathol. 123: 230-9.
4. Stüve O., T. N. Eagar, E. M. Frohman, P. D. Cravens. 2007. DNA plasmid vaccination for multiple sclerosis. Arch. Neurol. 64: 1385-6.
5. Guescini M., D. Guidolin, L. Vallorani, L. Casadei, A. M. Gioacchini, P. Tibollo, M. Battistelli, E. Falcieri, L. Battistin, L. F. Agnati, V. Stocchi. 2010. C2C12 myoblasts release micro-vesicles containing mtDNA and proteins involved in signal transduction. Exp Cell Res. 16: 1977-84. doi:10.1016/j.yexcr.2010.04.006.
6. Romancino D. P., G. Paterniti, Y. Campos, A. De Luca, V. Di Felice, A. d'Azzo, A. Bongiovanni. 2013. Identification and characterization of the nano-sized vesicles released by muscle cells. FEBS Lett. 587: 1379-84. doi:10.1016/j.febslet.2013.03.012.
7. Morse M. A., J. Garst, T. Osada, S. Khan, A. Hobeika, T. M. Clay, N. Valente, R. Shreeniwas, M. A. Sutton, A. Delcayre, D. H. Hsu, J. B. Le Pecq, H. K. Lyerly. 2005. A phase I study of dexosome immunotherapy in patients with advanced non-small cell lung cancer. J. Trani Med. 3:9.
8. Escudier B., T. Dorval, N. Chaput, T. André, M. P. Caby, S. Novault, C. Flament, C. Leboulaire, C. Borg, S. Amigorena, C. Boccaccio, C. Bonnerot, O Dhellin, M. Movassagh, S. Piperno, C. Robert, V. Serra, N. Valente, J. B. Le Pecq, A. Spatz, C O. Lantz, T. Tursz, E. Angevin, L. Zitvogel. 2005. Vaccination of metastatic melanoma patients with autologous dendritic cell (DC) derived-exosomes: results of the first phase I clinical trial. J. Transl Med. 3:10.
9. Dai S., D. Wei, Z. Wu, X. Zhou, X. Wei, H. Huang, G. Li. 2008. Phase I clinical trial of autologous ascites-derived exosomes combined with GM-CSF for colorectal cancer. Mol Ther. 16: 782-90. doi: 10.1038/mt.2008.1.
10. Tan A., H. De La Peña, A. M. Seifalian. 2010. The application of exosomes as a nanoscale cancer vaccine. Int J Nanomedicine. 5: 889-900. doi:10.2147/IJN. S13402.
11. Chaput N., C. Théry. 2011 Exosomes: immune properties and potential clinical implementations. Semin Immunopathol. 33:419-40. doi:10.1007/s00281.
12. Peretti S., I. Schiavoni, K. Pugliese, M. Federico. 2005. Cell death induced by the herpes simplex virus-1 thymidine kinase delivered by human immunodeficiency virus-1-based virus-like particles. Mol Ther. 12: 1185-96.
13. Lattanzi L., M. Federico. 2012. A strategy of antigen incorporation into exosomes: comparing cross-presentation levels of antigens delivered by engineered exosomes and by lentiviral virus-like particles. Vaccine. 30: 7229-37. doi: 10.1016/j.vaccine.2012.10.010.
14. Di Bonito P., B. Ridolfi, S. Columba-Cabezas, A. Giovannelli, C. Chiozzini, F. Manfredi, S. Anticoli, C. Arenaccio, M. Federico. 2015. HPV-E7 delivered by engineered exosomes elicits a protective CD8+ T cell-mediated immune response. Viruses. 7: 1079-99. doi: 10.3390/v7031079.
15. Fry E A, Taneja P, Inoue K. 2016. Clinical applications of mouse models for breast cancer engaging HER2/neu. Integr Cancer Sci Ther 3(5):593-603.
16. Rolla S, Nicoló C, Malinarich S, Orsini M, Forni G, Cavallo F, Ria F. 2006. Distinct and non-overlapping T cell receptor repertoires expanded by DNA vaccination in wild-type and HER-2 transgenic BALB/c mice. J Immunol 177(11):7626-7633.
17. Rovero S, Amici A, Di Carlo E, Bei R, Nanni P, Quaglino E, Porcedda P, Boggio K, Smorlesi A, Lollini PL, Landuzzi L, Colombo M P, Giovarelli M, Musiani P, Forni G. 2000. DNA vaccination against rat her-2/Neu p185 more effectively inhibits carcinogenesis than transplantable carcinomas in transgenic BALB/c mice. J. Immunol 165(9):5133-5142.
18. Quaglino E, lezzi M, Mastini C, Amici A, Pericle F, Di Carlo E, Pupa S M, De Giovanni C, Spadaro M, Curcio C, Lollini P L, Musiani P, Forni G, Cavallo F.2004. Electroporated DNA vaccine clears away multifocal mammary carcinomas in her-2/neu transgenic mice. Cancer Res 64(8):2858-2864.
19. Quaglino E, Mastini C, lezzi M, Forni G, Musiani P, Klapper L N, Hardy B, Cavallo F. 2005. The adjuvant activity of BAT antibody enables DNA vaccination to inhibit the progression of established autochthonous Her-2/neu carcinomas in BALB/c mice. Vaccine 23(25):3280-3287.
20. Schreiber R D, Old L J, Smyth M E 2011. Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 331(6024):1565-1570.
21. Di Bonito P, Chiozzini C, Arenaccio C, Anticoli S, Manfredi F, Olivetta E, Ferrantelli F, Falcone E, Ruggieri A, Federico M. 2017. Antitumor HPV E7-specific CTL activity elicited by in vivo engineered exosomes produced through DNA inoculation. Int J Nanomedicine 12:4579-4591.
22. van der Burg S H, Arens R, Ossendorp F, van Hall T, Melief C J. 2016. Vaccines for established cancer: overcoming the challenges posed by immune evasion. Nat Rev Cancer 16(4):219-233.
23. Keppler O. T., I. Allespach, L. SchCiller, D. Fenard, W. C. Greene, O. T. Fackler. 2005. Rodent cells support key functions of the human immunodeficiency virus type 1 pathogenicity factor Nef. J. Virol. 79: 1655-65.
24. D'Aloja P., E. Olivetta, R. Bona, F. Nappi, D. Pedacchia, K. Pugliese, G. Ferrari, P. Verani, M. Federico. 1998. gag, vif, and nef genes contribute to the homologous viral interference induced by a nonproducer human immunodeficiency virus type 1 (HIV-1) variant: identification of novel HIV 1-inhibiting viral protein mutants. J. Virol. 72: 4308-19.
25. Massa S., P. Simeone, A. Muller, E. Benvenuto, A. Venuti, R. Franconi. 2008. Antitumor activity of DNA vaccines based on the human papillomavirus-16 E7 protein genetically fused to a plant virus coat protein. Hum. Gene Ther. 19: 354-64. doi: 10.1089/hum.2007.122.
26. Arenaccio C., C. Chiozzini, S. Columba-Cabezas, F. Manfredi, M. Federico. 2014. Cell activation and HIV-1 replication in unstimulated CD4+ T lymphocytes ingesting exosomes from cells expressing defective HIV-1. Retrovirology. 11: 46. doi: 10.1186/1742-4690-11-46.
27. Nanni P, Nicoletti G, De Giovanni C, Landuzzi L, Di Carlo E, Cavallo F, Pupa S M, Rossi I, Colombo M P, Ricci C, Astolfi A, Musiani P, Forni G, Lollini P L. 2001. Combined allogeneic tumor cell vaccination and systemic interleukin 12 prevents mammary carcinogenesis in HER-2/neu transgenic mice. J Exp Med 194:1195-1205.
28. Halbert C L, Demers G W, Galloway D A. 1991. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol 65: 473-478.
29. Di Bonito P, Grasso F, Mochi S, Petrone L, Fanales-Belasio E, Mei A, Cesolini A, Laconi G, Conrad H, Bernhard H, Dembek C J, Cosma A, Santini S M, Lapenta C, Donati S, Muratori C, Giorgi C, Federico M. 2009. Anti-tumor CD8+ T cell immunity elicited by HIV-1-based virus-like particles incorporating HPV-16 E7 protein. Virology 395:45-55.
30. Théry C, Amigorena S, Raposo G, Clayton A. 2006. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Prot Cell Biol 3. doi: 10.1002/0471143030.cb0322s30.
31. Rieu S, Géminard C, Rabesandratana H, Sainte-Marie J, Vidal M. 2000. Exosomes released during reticulocyte maturation bind to fibronectin via integrin alpha4beta1. Eur J Biochem; 267:583-590.
32. Aricò E, Sestili P, Carpinelli G, Canese R, Cecchetti S, Schiavoni G, D'Urso M T, Belardelli F, Proietti E. 2016. Chemo-immunotherapy induces tumor regression in a mouse model of spontaneous mammary carcinogenesis. Oncotarget 7(3 7):59754-59765.
33. Gritzapis A D, Mahaira L G, Perez S A, Cacoullos N T, Papamichail M, Baxevanis CN. 2006. Vaccination with human HER-2/neu (435-443) CTL peptide induces effective antitumor immunity against HER-2/neu-expressing tumor cells in vivo. Cancer Res 66(10):5452-5460.
34. Liang X, Fu T M, Xie X, Emini E A, Shiver J W. 2002. Development of HIV-1 Nef vaccine components: immunogenicity study of Nef mutants lacking myristoylation and dileucine motif in mice. Vaccine 20:413-421.
35. Bauer S, Heeg K, Wagner H, Lipford G B. 1995. Identification of H-2Kb binding and immunogenic peptides from human papilloma virus tumour antigens E6 and E7. Scand J lmmunol 42:317-323.
36. Chairoungdua A, Smith D L, Pochard P, Hull M, Caplan M J. 2010. Exosome release of beta-catenin: a novel mechanism that antagonizes Wnt signaling. J Cell Biol 190:1079-1091.
37. Kogure T, Lin W L, Yan 1K, Braconi C, Patel T. 2011. Intercellular nanovesicle-mediated microRNA transfer: a mechanism of environmental modulation of hepatocellular cancer cell growth. Hepatology 54:1237-1248.
38. Kosaka N, lguchi H, Yoshioka Y, Takeshita F, Matsuki Y, Ochiya T. 2010. Secretory mechanisms and intercellular transfer of microRNAs in living cells. J Biol Chem 285: 17442-17452.
39. Kosaka N, Iguchi H, Yoshioka Y, Hagiwara K, Takeshita F, Ochiya T. 2012. Competitive interactions of cancer cells and normal cells via secretory microRNAs. J Biol Chem 287:1397-1405.
40. Trajkovic K, Hsu C, Chiantia S, Rajendran L, Wenzel D, Wieland F, Schwille P, Brügger B, Simons M. 2008. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 319:1244-1247.
41. Yuyama K, Sun H, Mitsutake S, Igarashi Y. 2012. Sphingolipid modulated exosome secretion promotes clearance of amyloid-beta by microglia. J Biol Chem 287:10977-10989.
42. Nanni P, Landuzzi L, Nicoletti G, De Giovanni C, Rossi I, Croci S, Astolfi A, lezzi M, Di Carlo E, Musiani P, Forni G, Lollini PL. 2004. Immunoprevention of mammary carcinoma in HER-2/neu transgenic mice is IFN-gamma and B cell dependent. J Immunol 173(4):2288-2296.
43. Rolla S, Marchini C, Malinarich S, Quaglino E, Lanzardo S, Montani M, lezzi M, Angeletti M, Ramadori G, Forni G, Cavallo F, Amid A. 2008. Protective immunity against neu-positive carcinomas elicited by electroporation of plasmids encoding decreasing fragments of rat neu extracellular domain. Hum Gene Ther 19(3):229-240.
44. Busam K J, Jungbluth A A. 1996. Melan-A, a new melanocytic differentiation marker. Adv Anat Pathol 6: 12-18.
45. Rivoltini L, Kawakami Y, Sakaguchi K, Southwood S, Sette A, Robbins P F, Marincola F M, Salgaller M L, Yannelli Y R, Appella E, Rosenberg S A. 1995. Induction of tumor-reactive CTL from peripheral blood and tumor-infiltrating lymphocytes of melanoma patients by in vitro stimulation with an immunodominant peptide of the human melanoma antigen MART-1. J Immunol 154: 2257-2265.
Number | Date | Country | Kind |
---|---|---|---|
102016000101794 | Oct 2016 | IT | national |
Number | Date | Country | |
---|---|---|---|
Parent | 16341042 | Apr 2019 | US |
Child | 18157534 | US |