Patent Application
20190316211
It is provided an alternative splicing (PACE4-altCT) for PACE4 and use of same for detecting and/or treating cancer.
Among malignancies, prostate cancer (PCa) remains the most common type of cancer in men with 233,000 cases each year in the USA; representing 27% of all new cases, as well as the second cause of cancer-related mortality. When diagnosed in its early progression stages, clinical interventions are able to circumvent disease progression and yield high survival rates over 5-15 years. However, when tumor initiated metastatic dissemination at the time of diagnostic or following tumor relapse, survival rates drop considerably, leading to patient death within 5 years in about 75% of cases. Yet, there is virtually no markers allowing the discrimination between cancer that will remain indolent from the high-risk malignancies. Moreover, most antineoplastic agents used for the management of advanced PCa are restricted to traditional chemotherapies and androgen axis manipulating agents. Various molecular targets have been envisaged for therapeutics which have not yielded sufficient survival gain when tested on patients, including angiogenic factors (anti-VEGF/VEGFR), tyrosine kinase receptor and downstream growth-promoting pathways, growth factors and active proteases, such as metalloproteinases (MMPs) or A disintegrin and metalloproteinases (ADAMs). Novel therapeutic avenues arising from yet unexplored biological pathways could provide a solution, either alone or as co-targets.
Among potential targets that have yet to be fully defined are the pro-protein convertases (PCs). These enzymes are responsible for the posttranslational processing of pro-protein substrates and are composed of nine members, namely; furin, PACE4, PC5/6, PC7, PC1/3, PC2, PC4, PCSK9 and SKI-1. The first seven are calcium-dependent serine proteases cleaving at paired basic residues with the consensus cleavage site R-X-(K/R)-R←. The PCs have been loosely associated with malignancies because of their capabilities to enhance the activity of cancer-associated protein substrates, which are overexpressed by tumor cells, e.g. members of the ADAM family of proteases, transforming growth factor-β (TGF-β), MMPs and IGF1R family members.
Among the PCs, PACE4 has been associated with malignant transformation in cancer cell based assays. However, in humans, a clear association of PACE4 overexpression and cancer has been, wherein a PACE4 overexpression in PCa tumours was observed (D'Anjou et al., 2011, Translational Oncology, 4: 157-172) while other PCs levels were not significantly altered. Subsequent studies using animal models supported the hypothesis that PACE4 overexpression has a role in PCa tumour progression, since molecular silencing of PACE4 in PCa xenograft animal models inhibited tumour growth, while the molecular silencing of other PCs did not (Couture et al., 2012, Neoplasia, 14: 1032-1042). These observations led to the development of PACE4-inhibitors (WO2010/003231 and WO 2013/029180) that mimicked molecular silencing, displaying anti-tumoral properties in xenograft models of PCa with increased cell quiescence and reduction of tumor neovascularization (Levesque et al., 2015, Oncotarget, 6: 3680-3693). In spite of this remarkable advancement and in vivo proof of concept, still little is known concerning the mechanisms associated with the sustained PACE4 overexpression in PCa cells and questions remain concerning the possibility that PACE4 levels have a relationship with disease outcome e.g., with tumor aggressiveness and/or patient survival. Various reports have highlighted the spatial and temporal regulation of PACE4 expression and its role in the regulation of embryonic developmental stages. However, there is relatively little information on the regulation of PACE4 expression in a pathophysiologic context despite the fluctuating levels across tissues, in various types of cancers, in osteoarthritis and atherosclerosis. No PACE4-specific substrates have been identified in cancer cells, leaving unexplained the identity of the substrates involved in the observed phenotype of PACE4 knockdown cancer cells. Thus the positioning of PACE4 as a therapeutic target, or as a potential biomarker, in the continuum of PCa disease cannot be fully understood, other than stating that the observed pharmacological effects are the resultant of a wide spectrum of downstream factors.
PCa cells are known to rapidly adapt to anti-androgen therapies and thus counter their anti-proliferation effects as they become androgen-independent. In spite of this, most therapies for PCa management used today have an androgen-based mechanism of action. In contrast to this unchanged continuum, researchers have attempted to define extra-androgenic pathways such as the promiscuous growth factor pathways which are used to either substitute androgen-receptor ligand requirement to activate the receptor (also known as the outlaw pathways) or to directly regulate key cancer cell capabilities such as proliferation, angiogenesis, immunosuppression through their action on either oncogenes or tumor suppressor gene pathways. In normal prostate, growth factors are secreted to act as paracrine and autocrine fine-tuning agents in the regulation of prostatic growth and differentiation. However, when PCa cells emerge, and more importantly when the disease progresses from early to late stages, several alterations in growth factors and their receptors as well as pro-invasive matrix modifying enzymes leads to a drastic changes from paracrine to autocrine mediation of sustained proliferation. Whether these alterations are causal or collateral to oncogenic transformation is often hard to define knowing the strong heterogeneity of PCa.
It is thus highly desired to be provided with novel molecular targets for cancer therapeutics.
In accordance with the present disclosure there is provided a method for detecting a cancer in a subject comprising the steps of obtaining a biological sample from the subject; and detecting the cancer by detecting the presence of PACE4-altCT in the biological sample.
In accordance with the present disclosure there is also provided an antibody specifically binding to PACE4-altCT.
It is further provided a kit comprising an analyte specific reagent specifically binding to PACE4-altCT; and instruction for use.
In an embodiment, the method described herein comprises contacting an analyte specific reagent specifically binding to PACE4-altCT with the biological sample under conditions so as to allow the formation of an analyte-PACE4-altCT complex; and detecting the cancer by detecting the analyte-PACE4-altCT complex.
In another embodiment, the method described herein further comprises the step of detecting the expression of GDF-15 prior or after the detection of the presence of PACE4-altCT in the biological sample.
In an embodiment, the method described herein further comprises the step of detecting the presence of PACE4-FL in the biological sample and calculating a ratio of PACE4-altCT/PACE4-FL wherein a ration of above 2 is indicative of the presence of the cancer.
In an additional embodiment the sample is a blood sample, urine, a tissue specimen, a biopsy needle washes, or circulating cells.
In another embodiment, the analyte is an antibody, a peptide, a primer or a probe.
In another embodiment, the antibody is a monoclonal antibody, a humanized antibody or a polyclonal antibody.
In a further embodiment, the antibody is a mouse antibody, a goat antibody, a human antibody, chicken, donkey, camelid, alpaga, turkey or a rabbit antibody.
In an additional embodiment, the antibody specifically binds to SEQ ID NO: 9.
In another embodiment, the antibody specifically binds to an epitope comprising the amino acid sequence set forth in any one of SEQ ID NOs: 18, 23, 24, 25, and 26.
In a further embodiment, the PACE4-altCT detected is a protein or a nucleic acid molecule.
In an embodiment, the nucleic acid molecule is an RNA or a DNA molecule.
In an embodiment, the probe is an oligonucleotide or a siRNA molecule.
In another embodiment, the probe specifically binds to a nucleotide sequence comprising SEQ ID NOs: 4, 5 or 6.
In a further embodiment, the siRNA comprises the nucleotide sequence set forth in SEQ ID NOs: 10, 11, 12, 13, 14, 15 or 16.
In another embodiment, the method described herein further comprises the step of applying a detection agent that detects the analyte-PACE4altCT complex.
In an embodiment, the detection agent is detected by Western blot, ELISA, immunoprecipitation followed by SDS-PAGE, immunocytochemistry, immunohistochemistry, PCR, or RT-PCR.
In a further embodiment, the PACE4-altCT is detected by mass spectrometry.
In an additional embodiment, the PACE4-altCT is detected by LC-MS/MS quantification.
In a further embodiment, the cancer is in at least one of lungs, thyroid, adrenals, testis, endometrium, pancreas, oesophagus, prostate, ovary, liver, breast, colon, stomach, kidney, bladder, brain, cervix, and lymphoid tissues.
In a specific embodiment, the cancer is a prostate cancer.
In an embodiment, the kit escribed herein further comprises an analyte specific reagent specifically binding to PACE4-FL.
In another embodiment, the kit escribed herein further comprises a detection agent that detects the analyte.
It is further provided the use of an analyte specific reagent specifically binding to PACE4-altCT for detecting a cancer in a sample of a subject.
It is also provided a method of treating a cancer in a patient comprising administering an inhibitor of PACE4-altCT to a patient in need thereof.
In an embodiment, the inhibitor is a siRNA, an antibody or a peptide.
In another embodiment, the peptide comprises the following formula:
Y-Arg4-Xaa3-Xaa2-Arg1-NH2;
In a further embodiment, Xaa5, Xaa6, Xaa7 and Xaa8 are positively charged amino acids or stereoisomers thereof.
In another embodiment, Xaa3 is Val.
In a supplemental embodiment, wherein Xaa2 and Xaa3 are independently selected from Gly and Ala.
In an embodiment, Xaa2 is Lys or Arg.
In another embodiment, Xaa5, Xaa6, Xaa7 and Xaa8 are aliphatic hydrophobic amino acids.
In another embodiment, the aliphatic hydrophobic amino acids are Leu, Iso or Val.
In an additional embodiment, Xaa5, Xaa6, Xaa7 and Xaa8 are Leu.
In another embodiment, the peptide consists of Ac-LLLLRVK-[AMBA]; Ac-[D-Leu]-LLLRVK-[AMBA]; Ac-LLLIRVK-[AMBA]; Ac-[D-Leu]-LLIRVK-[AMBA]; Ac-LLILRVK-[AMBA]; Ac-[D-Leu]-LILRVK-[AMBA]; Ac-LLLQRVK-[AMBA]; Ac-[D-Leu]-LLQRVK-[AMBA]; Ac-[Azaβ3L]LLLRVK-[ΔR-COO]; Ac-LLLLRVK-[ΔR-COO]; Ac-[D-Leu]-LLLRVK-[ΔR-CO].
It is provided the use of an inhibitor of PACE4-altCT for treating a cancer in a patient.
It is also provided a method of treating a cancer in a patient comprising administering an inhibitor of PACE4-altCT to a patient in need thereof.
It is further provided a composition for treating cancer comprising an inhibitor of PACE4-altCT and a carrier.
In an embodiment, the inhibitor of PACE4-altCT is an antibody or an siRNA.
In an embodiment, the siRNA is complementary to a sequence selected from the group consisting of: SEQ ID NO: 4, 5 and 6.
In another embodiment, the siRNA comprises the nucleotide sequence set forth in SEQ ID NOs: 10, 11, 12, 13, 14, 15 or 16.
Reference will now be made to the accompanying drawings.
In accordance with the present disclosure, there is provided a tumor promoting alternative splicing isoform of PACE4 (named PACE4-altCT).
The proprotein convertases (PCs) are now recognized for their implication in malignancies through the activation of a wide spectrum of cancer-related proteins. Critical to the exploitation of PCs as drug targets is the understanding of their cellular and molecular functions. In prostate cancer, which remains the cancer with the highest incidence in men, the proprotein convertase PACE4 (PCSK6 gene name) has been proposed as an attractive target because of its documented importance in tumor progression. The PCs have been suggested as promising targets for the development of cancer therapeutics because of their positions upstream of numerous oncogenic pathways. By their endoproteolytic processing of proproteins, which includes mediators touching all key hallmarks of cancer, the activation by PCs turn out to be a limiting step between gains in term of biological activity (e.g. increased signalling by a growth factor receptor axis) following the overexpression of axis components. For this reason, if PC substrates are overexpressed by cancer cell to maximize autocrine stimulation, a concomitant increase in term of PC activity must be achieved to get full biological outcome. It is thus not surprising to see that PCs overexpression has been documented in many cancer types, however PCs reported as having increased expression are not consistent across all cancers, which may illustrate differences in tumour types and/or the absence of thorough PC scanning, as many studies often only study or assume PC activity to be assigned to a single member, namely furin.
It is provided herein that PACE4 is overexpressed in prostate cancer correlating with tumor aggressiveness, but PACE4 also undergoes a tumor promoting alternative splicing event generating a C-terminally modified isoform (named PACE4-altCT). Mapping at both mRNA and protein levels showed strong tumor reactivity in various types of cancers. Biological characterization of PACE4-altCT showed equivalent enzymatic activity to PACE4. The terminal exon replacement also favours PACE4-altCT expression and ongogenic activity in cancer cells through mRNA stabilization and auto-activation rate enhancement. PACE4-altCT initiation is sensitive to DNA methylation in the surrounding of the substituted terminal exon, as hypomethylation in this region resulted in increased splicing. PACE4-altCT is retained intracellularly and harbors a distinct localization pattern yielding increased cancer cell proliferation. PACE4-specific substrates are disclosed herein in prostate cancer, among which is growth differentiation factor 15.
Significant amount of data now indicate that the proprotein convertase PACE4 represents an attractive target in prostate cancer and in other malignancies as it is upstream of various tumor-promoting processes by the activation/maturation of various cancer-related proteins. It is provided that PACE4 overexpression in prostate cancer correlates with tumor Gleason score and that a yet unreported alternative splicing event emerge during this overexpression process and generates a C-terminally modified isoforms with pro-oncogenic features favoring PACE4 expression/activity through mRNA stabilization, enhancement auto-activation and distinct localization pattern in cells. This splice variant is susceptible to epigenetic regulation is barely found in normal tissues but common in fetal tissues and among various malignancies suggesting a tightly regulated molecular switch reinstated by cancer cells to promote PACE4 expression. Moreover, growth differentiation factor-15 is reported as the first PACE4-specific substrate in prostate cancer cells which may serve both as a PACE4 activity or as a tumor engagement biomarker.
It is provided important post-transcriptional changes that have profound effects on PACE4 mRNA and protein as well as cell trafficking and substrate processing. PACE4 alternative splicing is described as a means of regulating PACE4 expression in PCa. Analyses of PACE4 splicing by PCR and 3′RACE revealed that PCa cells utilize a splicing event leading to alternative cleavage and polyadenylation to substitute PACE4 mRNA 3′ untranslated region (3′UTR) thus promoting mRNA stability and favouring the expression of a C-terminally modified protein isoform (PACE4-altCT) which modulates its activity and retention within the cells. This yet unreported splice variant is strongly up-regulated at both mRNA and resulting protein isoform levels in PCa tissues, as well as in other cancer types such as for example but not limited to lung, thyroid and adrenal cancers. The PACE4-altCT isoform is retained intracellularly and has a different cell distribution pattern different from its parent isoform. PACE4-altCT is also accelerated in its catalytic auto-activation, further sustaining PACE4 activity increase in cancer cells as well as enhanced cell proliferative capabilities. Mapping of PACE4-alt CT across human tissues and tumours revealed a limited endogenous expression pattern, the highest levels being found in fetal tissues and various tumour types, suggesting a tightly regulated mechanism allowing sustained PACE4 activity under proliferation conditions which is taken advantage by cancer cells. PACE4 alternative splicing is further associated with distinctive intra-exonic DNA methylation between prostate normal and cancer tissues, leading to favoured terminal exon replacement following local hypomethylation in the alternative exon and DNA binding of the CCCTC-binding factor (CTCF). Finally, proteomic-based secretome analysis allowed the identification of growth differentiation factor 15 (GDF-15) as a new PACE4 substrate in PCa.
To address whether PACE4 overexpression is a stable feature across prostate tumors or an indicator of tumor aggressiveness, fresh matched normal and cancerous primary tissue specimens were obtained and used for RNA extraction and analyzes. Real-time quantitative PCR (RT-qPCR) analyzes showed that PACE4 overexpression was clearly discernable in tumor samples and that the levels tightly correlated with tumor Gleason scores (
The use of alternative splicing is now recognized as a key mechanism used by cancer cells to promote the expression of genes sustaining proliferation. A more precise mechanism recently exposed is the shortening of 3′UTR regions of oncogenes and proto-oncogenes, which further allows upregulation of gene expression through the evasion from post-translational regulation mechanisms such as repression by microRNAs. PACE4 mRNA is a 969 amino acids long protein (SEQ ID NO: 1) encoded by the 186 kbs PCSK6 gene located on at the 15q26.3 locus, which is not a locus reported to be susceptible to frequent change in PCa specimens (Oncomine™ databases) (partial nucleotide sequence depicted in SEQ ID NO: 2). Analysis of PACE4 mRNA 3′ extremity by 3′ rapid amplification of cDNA end (3′ RACE) and TP-PCR in LNCaP cells revealed the presence of the consensual 1335 nt long 3′UTR (SEQ ID NO: 4) but also the presence of shorter 3′UTRs (164 nt, SEQ ID NO: 6;
Accordingly, compared to the native PACE4 protein which comprises exon 25 sequence consisting of:
PACE4-altCT essentially comprises an alternative sequence for exon 25 consisting of:
Consistent with the nature of 3′UTR and their roles in regulating mRNA stability, sequences of both consensus and alternative 3′UTR were subjected to miRNA sites prediction using RegRNA and miRDB showing striking differences in term of miRNA sites predicted in the sequences with about 90% less sites within the short 3′UTR compared to the long one. Interestingly, the miRNA regulatory sites for miR-9, -21, -124 and -543 predicted by TargetScan are all removed from PACE4 transcripts. miR-124 (a tumor-suppressor miRNA typically downregulated in PCa and miR-21 which are both validated as negative regulators of PACE4 mRNA expression thus implying miRNA evasion by this 3′UTR switch. Actinomycin-D chases followed by RT-qPCR showed that transcripts with the shorter 3′UTR were readily more stable over time when compared to consensual ones with a calculated half-life more than 3 times higher (
Based on the fact that PACE4 is strongly overexpressed in PCa cells with a correlation with tumor aggressiveness, paired prostate adjacent non-cancerous tissues (ANCT) and tumor tissues were analyzed for both PACE4 splice variants by TP-PCR and RT-qPCR to amplify both alternative and consensual mRNA terminating exons. PACE4-altCT mRNA was only observable in the tumor specimens with very low or undetectable levels in the ANCT matched specimens (
Taking advantage of the two distinct C-termini encoded by the two splice variants, polyclonal antibodies were raised and affinity purified from rabbit anti-serum to discriminate both protein isoforms. Despite poor performance in western immunoblotting, the antibodies yielded interpretable in IHC as depicted by the xenograft tissues formed using PACE4-knockdown cell lines. PACE4 IHC on PCa specimens using both antibodies (
To further investigate the mechanisms regulating PACE4 terminal exon splicing, genomic sequences were visualized in UCSC genome browser to locate DNA interacting proteins in the surrounding environment of the alternative exon. Interestingly, the protein CCCTC-binding factor (CTCF) was found to have three reported binding sites according to the chromatin immunoprecipitation followed by sequencing databases (ChIP-Seq;
DNA from both ANCT and cancerous specimens of PCa were analyzed for the methylation status of the different CpG within the alternative terminal exon and significant tumor-specific CpG hypomethylation were found in the intra-exonic and upstream CTCF binding sites (
CTCF was transiently silenced using siRNA in DU145 and LNCaP cells and measured ration of PCAE4-altCT/PACE4-FL mRNAS determined after 72 h showed consequent reduction along with CTCF (
In view of the increased expression of PACE4-altCT mRNA in PCa samples, the expression pattern was observed in other tissues or other cancer types. RNA from normal human tissues were used to map both transcripts. PACE4-altCT mRNA was strongly detected in the liver, the organ reported to express the higher PACE4 levels, the testis, an organ known for its very high splicing activity and the brain/spinal cord with very little expression levels in the other organs (
Splicing indexes were determined on an array of cDNA preparation from various tumor types and normal tissues, (
To address the question whether these two isoforms displayed equivalent functions despite their dissimilarities in their C-termini, V5 tagged-protein were expressed in cell lines (
Conditioned medium containing each isoforms was used to compare the enzymatic activity of both enzymes by monitoring cleavage of the fluorogenic substrate Pyr-Arg-Thr-Lys-Arg-methylcoumaryl-7-amide. C-terminal substitution did not alter activity (
Immunoprecipitations on transiently transfected HEK293-FT cells were subjected to Sequential Window Acquisition of all Theoretical Mass Spectra (SWATH-MS)-based analysis (
To evaluate the biological significance of these isoform-specific features, PACE4-FL and PACE4-altCT were stably expressed as untagged proteins in cell lines using lentiviral-transduction (pLenti6 vectors). Despite similar mRNA expression levels (
siRNAs were designed specifically targeting each splice variant to assess the importance of endogenous PACE4-altCT compared to its parent isoform PACE4-FL. Following transfections, each siRNA efficiently silenced its splice variant (i.e., 70-95% knockdown without affecting the other co-expressed PCs) (
Silencing of PACE4-altCT yielded a much stronger reduction in term of growth and clonogenic capabilities than PACE4-FL silencing, which barely affected these parameters in both LNCaP and DU145 cells (
Secreted factors have previously been suggested as the main effectors of the PACE4-related cancer cells growth phenotype upon gene silencing. For this reason, secretome analysis were performed to identify substrate candidates based on PACE4 variations. A SILAC-based proteomic approach was used to analyze the secretome content in both DU145 and LNCaP PCa cells. shNon-Target cells of both lines were cultured with heavy amino acids (13C6-Arg and 13C6-Lys) and compared with unlabeled (light amino acids culture medium) shPACE4 cells. Heavy amino acids incorporation in cells was confirmed using endogenously generated degradation peptides. Secretome were pooled 1:1, concentrated by acetone-methanol precipitation and fractionated by agarose-gel electrophoresis using a SageELF (Sage Science, Beverly, Mass., USA). Each fraction was analyzed by tandem LC-MS/MS. From the obtained protein identifications, secreted proteins were retrieved using ProteINSIDE and used to draw a heatmap based on light/heavy (L/H; shPACE4/Non-Target) ratio proportions for each cell line. Proteins having PC-based or PC-like processing events, determined by both Uniprot PTM/Processing data or by ProP 1.0 Server were highlighted.
Western blotting were carried out of (i) cell lines silenced with shPACE4, shfurin and shPC7, (ii) cell lines stably expressing PACE4-FL and PACE4-altCT and (iii) cell lines treated with either the non-selective and irreversible PC inhibitor decanoyl-RVKR-chloromethylketone (CMK) or the PACE4 high affinity peptide inhibitor [dLeu]LLLRVK-amidinobenzylamide (Amba; dL-ML-Amba), herein after called C23 (Levesque et al., 2015, Oncotarget, 6: 3680-3693). In order to test the western blot arrays, known PC substrates were chosen, namely, the insulin-like growth factor 1 receptor (IGF1R) and integrin alpha-6 (ITGA6); two well-accepted furin substrates, were evaluated (
Candidate proteins detected with L/H<1 ratio in either DU145 or LNCaP that displayed a PC-based or PC-like cleavage site (
GDF-15 is known to supports both the proliferation and clonogenic potential of LNCaP cells, which is also in line with the observed phenotypes for both PACE4 knockdown and overexpressing cells. This protein is synthetized as a 35 kDa proprotein which requires a PC-based cleavage at the ARGRRRAR196↓, site to generate a ˜17 kDa C-terminal mature form that associates as a disulfide-linked dimer further secreted in the medium. GDF-15 is only detected in LNCaP cells whereas DU145 express very low levels in both medium and cell lysates (
The propeptide of GDF-15 was reported to mediates the protein retention into the extracellular matrix when it can be stored in an uncleaved form until it is cleaved. It was even observed that increased stromal stores of pro-GDF15 in clinical specimens of low-grades PCa (Gleason ≤6) were inversely correlated with tumor relapse. However, only a slight difference could be observed in the processing of GDF-15 in cells overexpressing PACE4-altCT (intracellular) and PACE4-FL (which is secreted and also located in the extracellular matrix. When treated with the cell-permeable and the PEGylated cell-impermeable version of the ML PACE4 peptide inhibitor, cleavage of GDF-15 was more susceptible to the cell-permeable version, again indicating that an important proportion of cleavage is performed inside the cells (
Interestingly, GDF-15 is highly expressed in adult prostate but it was demonstrated that mature GDF-15 is generally undetected in normal tissues in comparison with cancer zones. Analysis of pairs of non-cancerous and tumoral prostate tissues by western blot showed the same pattern (
The discovery of the novel PACE4-altCT isoform, along with its strong expression in PCa specimens compared to benign prostate zones, sheds light on an important mechanism of sustained proliferation that exploits PACE4 activity to promote tumor growth. The generation of this pro-proliferative isoform with drastically different characteristics in terms of trafficking and autocatalytic activation rate appears as a sophisticated molecular switch that sustains PACE4 activity through the evasion of several regulatory elements. As with PACE4-altCT, the 3′UTR shortening of various cancer promoting genes by cancer cells had been reported across cell lines derived from numerous cancer types. Moreover, this observation is not unique to PCa cancer cells and tissues, since various cancer types also displayed strong PACE4 alternative splicing ratios suggesting an important mechanism of action. This result alone shows that PACE4-altCT (mRNA or protein) is a biomarker for PACE4-dependent cancers.
A comprehensive analysis comparing the expression levels of all PCs among such a broad array of cancer types (
PACE4 prodomain removal being the prerequisite step prior to the sequential export from the ER and further transport to the golgi and the TGN (and ultimately the extracellular space) where calcium and pH conditions permits higher activity, the accumulation of PACE4-altCT into the secretory pathway is coherent with the observations that PACE4-altCT displays strong enrichment in term of intracellular mature form (
PACE4 seems to be the sole PC overexpressed in PCa (
Having such PACE4 activity biomarkers measurable in the serum allows to assess target engagement in pharmacological intervention using PACE4 inhibitors but also as an indirect way to measure PACE4 levels in the organs through a simple blood sample. GDF-15 is an ideal marker for such analysis since its expression is strongly limited to the prostate (and to the placenta). On the diagnostic/prognostic point of view, PACE4, or more precisely PACE4-altCT represent a marker directly, either by IHC or directly as serum marker.
Furthermore, levels of PACE4-altCT in plasma correlate with tumor Gleason score. When plasma level of PACE4-altCT collected from patients just prior to radical prostatectomy showed as expected total PACE4 levels were much higher than PACE4-altCT levels, with averages of 31 ng/mL and 5.4 ng/mL, respectively (
The development and validation of PACE4-altCT specific ELISA permitted the confirmation that PACE4-altCT is not only increased in PCa tissues but also that it can be found in the bloodstream.
It is described herein a method for detecting prostate cancer in a subject comprising the steps of obtaining a biological sample from the subject; and detecting said prostate cancer by detecting the presence of PACE4-altCT in said biological sample.
The method described herein can comprise the further steps of contacting an analyte specific reagent specifically binding to the PACE4-altCT with the biological sample under conditions so as to allow the formation of an analyte-PACE4-altCT complex, and detecting prostate cancer by detecting the analyte-PACE4-altCT complex.
The term “analyte specific reagent” or “ASR” refers to any molecule including any chemical, nucleic acid sequence, polypeptide (e.g. receptor protein) or composite molecule and/or any composition that permits quantitative assessment of the analyte level. Accordingly, the analyte can be an antibody, a peptide, a primer or a probe.
The term “specifically binds” as used herein refers to a binding reaction that is determinative of the presence of PACE4-altCT.
The term “antibody” as used herein is intended to include monoclonal antibodies, polyclonal antibodies, and chimeric antibodies. The antibody may be from recombinant sources and/or produced in transgenic animals. The term “antibody fragment” as used herein is intended to include Fab, Fab′, F(ab′)2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, and multimers thereof and bispecific antibody fragments. Antibodies can be fragmented using conventional techniques. For example, F(ab′)2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab′)2 fragment can be treated to reduce disulfide bridges to produce Fab′ fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab′ and F(ab′)2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments and other fragments can also be synthesized by recombinant techniques.
To produce human monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from a human having cancer and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Such techniques are well known in the art, (e.g. the hybridoma technique originally developed by Kohler and Milstein (Nature 256:495-497 (1975)) as well as other techniques such as the human B-cell hybridoma technique (Kozbor et al., Immunol. Today 4:72 (1983)), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., Methods Enzymol, 121:140-67 (1986)), and screening of combinatorial antibody libraries (Huse et al., Science 246:1275 (1989)). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with cancer cells and the monoclonal antibodies can be isolated.
Specific antibodies, or antibody fragments, reactive against particular target polypeptide gene product antigens, can also be generated by screening expression libraries encoding immunoglobulin genes, or portions thereof, expressed in bacteria with cell surface components. For example, complete Fab fragments, VH regions and FV regions can be expressed in bacteria using phage expression libraries (See for example Ward et al., Nature 341:544-546 (1989); Huse et al., Science 246:1275-1281 (1989); and McCafferty et al., Nature 348:552-554 (1990)).
It is thus encompassed an analyte, such as for example a monoclonal or polyclonal antibody, specifically recognizing PACE4-altCT. Accordingly, in an embodiment, the probe recognizes the alternative exon 25 present in PACE4-altCT depicted in SEQ ID NO: 8.
More particularly, said antibody is a monoclonal or a polyclonal antibody. In another embodiment, said antibody is a mouse antibody, a goat antibody, a human antibody or a rabbit antibody. Also encompassed is a humanized antibody specifically recognizing PACE4-altCT. The antibody described herein can comprises an epitope binding fragment selected from the group consisting of: Fv, F(ab′), or F(ab′)2.
More particularly, the antibody described herein specifically binds to an epitope comprising the amino acid sequence set forth in any one of SEQ ID NOs: 18, 23, 24, 25, and 26.
The term “probe” as used herein refers to a nucleic acid sequence that comprises a sequence of nucleotides that will hybridize specifically to a target nucleic acid sequence encoding PACE4-altCT. For example the probe comprises at least 10 or more bases or nucleotides that are complementary and hybridize contiguous bases and/or nucleotides in the target nucleic acid sequence. The length of probe depends on the hybridization conditions and the sequences of the probe and nucleic acid target sequence and can for example be 10-20, 21-70, 71-100, 101-500 or more bases or nucleotides in length. The probes can optionally be fixed to a solid support such as an array chip or a microarray chip.
The term “primer” as used herein refers to a nucleic acid sequence, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of synthesis of when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand is induced (e.g. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend upon factors, including temperature, sequences of the primer and the methods used. A primer typically contains 15-25 or more nucleotides, although it can contain less. The factors involved in determining the appropriate length of primer are readily known to one of ordinary skill in the art.
Thus, the probe specifically recognizing PACE4-altCT can be a primer, an oligonucleotide, a siRNA molecule for example which specifically recognises PACE4-altCT. More particularly, the probe encompassed herein specifically binds to PACE4-altCT. For example, the probe described herein can specifically bind to a nucleotide sequence comprising SEQ ID NOs: 5 or 6. In another embodiment, the siRNA molecule encompassed herein comprises the nucleotide sequence set forth in SEQ ID NOs: 15 or 16.
The method described herein can further comprise the step of applying a detection agent that detects the analyte-PACE4-altCT complex.
A “detectable label” or “detectable agent” as used herein means an agent or composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins which can be made detectable, e.g., by incorporating a radiolabel into the peptide or used to detect antibodies specifically reactive with the peptide.
The detection agent can be detected by techniques known in the art such as Western blot, ELISA, immunoprecipitation followed by SDS-PAGE, immunocytochemistry, immunohistochemistry, PCR, or RT-PCR. Thus, the PACE4 splicing isoform detected can thus be a protein or a nucleic acid molecule.
Accordingly, using antibodies raised against any of the discussed epitopes, Western blots could be carried out on blood-derived specimens (crude or concentrated) to detect PACE4-altCT proteins.
Furthermore, using antibodies raised against any of the discussed epitopes, ELISA could be carried out on blood-derived specimens (crude or concentrated) to quantify PACE4-altCT proteins.
In addition, mass spectrometry (MS) based quantification using multiple reaction monitoring (MRM) resolves many of the reported issues (Makawita and Diamandis, 2010, Clin Chem, 56: 212-222) as it allows high structural specificity and high multiplexing capacity (Anderson and Hunter, 2010, Mol Cell Proteomics, 5: 573-588). MRM quantification is performed by the combination of liquid chromatography (LC) and highly sensitive triple quadrupole MS. To date, the most important limitation of MS technology has been sensitivity, only reaching the mg/L quantification in blood mostly because of interference from abundant proteins. Using proper sample preparation; (i) sample fractionation (Fortin 2009, Anal Chem, 81: 9343-9352), (ii) depletion of abundant proteins (Anderson and Hunter, 2010, Mol Cell Proteomics, 5: 573-588) and (iii) affinity capture of target protein (Nicol et al., 2008, Mol Cell Proteomics, 7: 1974-1982) or target peptide (named: Stable Isotope Standards and Capture by Anti-Peptide Antibodies; SISCAPA) (Anderson et al., 2004, J Proteome Res, 3: 235-244), the limit of quantification (LOQ) for protein (e.g. PSA (Keshishian et al., 2007, Mol Cell Proteomics, 6: 2212-2229) has now improved 1000 fold (mg/L to μg/L) with percent coefficient of variation (% CV) down to 2.8% with results comparable to ELISA assays (Fortin 2009, Anal Chem, 81: 9343-9352). In one report, serum PACE4 detection, was obtained using the SISCAPA method (Klee et al., Clin Chem, 2012, 58: 599-609).
Detection of PACE4-altCT could be performed by affinity enrichment of PACE4 using an antibody that as affinity to all PACE4 splicing isoforms or to PACE4-altCT, using anti-PACE4 peptide (SISCAPA) for selective detection of PACE4 splicing isoforms. For all those methods PACE4 splicing isoforms would be quantified and detected by selective enzymatic digestion and LC-MS/MS analysis.
Alternatively, antibody free methodology could by applied using selective enrichment of target peptide. After PACE4 digestion by selective enzymes (eg. Trypsin, chymotrypsin), the peptide of interest could be selectively enriched by reproducible orthogonal liquid chromatography or by ion exchange or polymeric ion exchange solid phase extraction followed by LC-MS/MS quantification.
In still a further aspect, the disclosure provides a method of selecting prostate cancer subjects for a clinical trial. The method comprises determining a subject's test PACE4-altCT expression profile and prognosis according to a method as described herein; and including or excluding the subject in the clinical trial based on their prognosis.
In a further aspect, it is provided a method for prognosis of a subject having received an initial diagnosis of prostate cancer.
As used herein “prognosis” refers to an indication of the likelihood of a particular clinical outcome, for example, an indication of likelihood of recurrence, metastasis, and/or death due to disease, overall survival or the likelihood of recovery and includes a “good prognosis” and a “poor prognosis”.
As used herein, “good prognosis” indicates that the subject is expected e.g. predicted to survive and/or have no, or is at low risk of having, recurrence or distant metastases within a set time period, for example five years after initial diagnosis of prostate cancer.
As used herein, “poor prognosis” indicates that the subject is expected e.g. predicted to not survive and/or to have, or is at high risk of having, recurrence or distant metastases within a set time period, for example five years of initial diagnosis of prostate cancer.
As used herein, the term “recurrence” refers to the reappearance of cancer, such as prostate cancer within a set period of time from initial diagnosis, for example 5 years.
As used herein, the term “disease free survival” refers to no reappearance of cancer, such as prostate cancer within a set period of time from initial diagnosis, for example 5 years.
A further aspect of the disclosure includes a method of identifying agents for use in the treatment of prostate cancer. Clinical trials seek to test the efficacy of new therapeutics. The efficacy is often only determinable after many months of treatment. The methods disclosed herein are useful for monitoring the expression of PACE4-altCT associated with prognosis. Accordingly, changes in PACE4-altCT expression levels which are associated with a better prognosis are indicative the agent is a candidate as a chemotherapeutic.
Accordingly in an embodiment, the disclosure provides a method for identifying candidate agents for use in treatment of prostate cancer.
As used herein “sample” refers to any subject's sample, including but not limited to a fluid, cell or tissue sample that comprises tumor associated stromal cells, which can be assayed for gene expression levels, particularly genes differentially expressed in patients having or not having prostate cancer. The sample includes for example bulk tumor, isolated stromal cells, a biopsy, a resected tumor sample, a frozen tissue sample, a fresh tissue specimen, a cell sample, and/or a paraffin embedded section or material.
The term “subject” also referred to as “patient” as used herein refers to any member of the animal kingdom, preferably a human being.
Cell lines were obtained and cultured in the following conditions: DU145 (American Type Culture Collection; ATCC, Mannasas USA, RPMI 1640; 5% fetal bovine serum; FBS, Wisent Bioproducts, St Bruno, QC), LNCaP, PC3 and HT-29 (ATCC, RPMI 1640; 10% FBS), SKOV3 (ATCC, DMEM-F12K; 10% FBS), HEK293-FT (Life Technologies Inc., DMEM; 10% FBS, 500 μg/ml Geneticin), Huh7 and A549 (ATCC, DMEM; 10% FBS), HT1080 and HepG2 (ATCC, EMEM; 10% FBS). Stable knockdown cell lines were the same as reported in (Couture et al., 2012). S2 cells were cultured and used for production of recombinant PC as described in Fugere et al. (2002, Journal of Biological Chemistry, 277: 7648-7656).
For actinomycin-D (Sigma Aldrich) or cycloheximide (Sigma Aldrich) treatments, compounds were first dissolved in DMSO, and diluted to a final concentration of 5 μg/mL and 40 μg/mL in the culture medium respectively. Actinomycin-D treatment never exceeded 8 h, which is the time-frame prior to early apoptosis induction. For treatments wit 5-aza-2′-deoxy-cytidine (Sigma Aldrich), compound was first dissolved in DMSO and further diluted prior to addition to cell culture medium, which was changed every day and replaced with fresh one containing the compound for a total exposure of 72 h. For DNA transfections, cells were lipofected using Lipofectamine 3000 (Invitrogen) and DNA plasmids (purified using QIAgen plasmid purification kit following manufacturer guidelines), if not stated otherwise cell were lysed in lysis buffer (Tris-HCl 50 mM, NaCl 150 mM, SDS 0.1%, Na-Deoxycholate 0.5%, Triton-X100 1% and NP-40 1%) containing 1× protease inhibitor (Roche Diagnostics). siRNA (Cell Signaling Technologies) were transfected using Lipofectamine RNAiMax (Life Technologies) following manufacturer guidelines. siRNA were purchased from Cell Signaling Technologies (CTCF siRNA I #6265 and Control siRNA #6568). Cell were lysed 48 h post-transfection either for RNA or protein extraction.
For PACE4 secretion assays, cells were plated at equal densities in 6-well plates for 24 h in complete medium. 24 h later, the medium was replaced by the minimal volume required of fresh culture medium (600 μL without FBS) and the cells were either allowed to secrete for the indicated time (for secretion kinetics) or (for inhibitor treatments) allowed to secrete for an additional 24 h in the presence of the indicated concentrations of agents (heparin (Sandoz, Niirnberg, Germany), 2-bromopalmitate (Sigma Aldrich), FTI-277 (Sigma Aldrich), GGTI-2133 (Santa Cruz Biotechnology Inc., Santa Cruz, Calif., USA)
cDNA were cloned into either pAc5.1-V5-HisA, pcDNA3.1-V5-HisA or pLenti6 vectors encoding PACE4 splice variants which were obtained through gene synthesis (GeneArt, Thermo Fisher Scientific). For transient expression, cells were transfected using pcDNA3.1-V5-HisA constructs (2.5 μg DNA in 6 well-plate) using Lipofectamine3000 reagent (Thermo Fisher Scientific). For stable overexpressing mammalian cell lines, cell were transduced with lentiviral preparation produced as described in (D'Anjou et al., 2013) and further selected using blasticidin (HT1080 and DU145: 5 μg/mL, LNCaP: 20 μg/mL).
For substrates analysis, cell lysates were prepared by plating equal number of cells in p100 mm plates in complete medium. 24 h later, medium was replaced by 6 mL of serum-free fresh medium (with treatment if indicated; 50 μM of dL-ML-Amba or dec-RVKR-CMK (Bachem, Torrance, Calif.) and cells were further incubated 48 h. Medium was then collected and centrifuged at 1,000×g for 10 min at room temperature to remove any floating cells, aliquot of medium were then taken (800 μL), flash-frozen in liquid nitrogen, lyophilized overnight, restituted in 100 μL of Laemmli buffer: 8M urea (1:1) and boiled for 5 min until complete resuspension. 25 μL of concentrated medium were loaded on SDS-PAGE (equivalent of 200 μL of culture medium). Cells were carefully washed with PBS and lysed from cell pellet (resulting from 1,000×g centrifugation) using radio-immunoprecipitation assay buffer (RIPA) as described in (Couture et al., 2012). Samples were incubated 20 min on ice and further centrifuged 30 min at 13.000 rpm at 4° C. Protein concentration was determined by bicinchoninic acid assay (Pierce) to load 15 μg on polyacrylamide gels. 1-actin was used as a loading control, for conditioned media, a Coomassie blue staining was routinely performed to control for protein loading.
For proliferation assays, cell were plated in 96 wells-plates at identical densities and after 72 h, metabolic activity was measured using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent as described in Levesque et al. (2012, Journal of Medicinal Chemistry, 55: 10501-10511). For colony formation assay, cell were plated at low densities (50 cells for HT1080, 100 cells for DU145 and 500 cells for LNCaP) and allowed 10 days to form colonies in complete medium before being stained with crystal violet and manually counted. Stained plates were also scanned (Odyssey Imager, LI-COR Biosciences) and colony area were determined using ImageJ software.
For activity assays, medium collected from stable S2 cells culture expressing the PACE4 isoforms were collected and buffer-exchanged on Amicon-Ultra 30K spinnable units (Millipore) with PACE4 activity buffer (bis-Tris 20 mM pH 6.5, 1 mM CaCl2). Western blotting confirmed equivalent PACE4 amount within each preparation which were further used for activity assays performed as described in Levesque et al. (2012, Journal of Medicinal Chemistry, 55: 10501-10511). For ML-peptide inhibition, 50 μM of inhibitor were added to the activity assays. Identical preparation from wild type S2 cells were used as blank.
For confocal microscopy, HT1080 cells were plated on poly-L-lysine coated glass coverslip and further transfected with pcDNA3.1-V5-HisA vectors. 48 h after transfection, cells were fixed in 4% paraformaldehyde in PBS for 15 min, permeabilized with blocking buffer (PBS; 0.3% Triton-X-100; 2.5% goat serum; 1% BSA) for 1 h at room temperature. Cells were then incubated overnight with the primary antibodies at 4° C. Fluorescent secondary antibodies (AlexaFluor-488 and -594 antibodies, ThermoFisher) were further used (1 h incubation, room temperature) followed by DAPI (300 nM; 10 min, room temperature) and final mounting with SlowFade (Invitrogen). Cells were examined with an Plan Apo 60× oil immersion objective NA 1.42 on inverted spectral scanning confocal microscope FV1000 (Olympus, Tokyo, Japan). In order to avoid the cross-talk between the emitted Alexa Fluor 488 and Alexa Fluor 594 fluorescence was collected sequentially. Images were acquired during the same day, typically from 7-15 cells of similar size from each experimental condition using identical settings of the instrument. For the quantitative analyze of the overlap quadrant ranks (thresholds) were placed forming background (C), red-only (D), green-only (A) and colocalization areas (B). Colocalization index were calculated as (B)/(B+D), and % of colocalization as (B)/(B+D)×100.Quantitative analysis was performed on minimally 7 size-matched cells for each experimental condition.
Prostate tissues used for RNA extraction were freshly (typically within 30 min) dissected from prostate specimen obtained from radical prostatectomies performed at the Centre Hospitalier Universitaire de Sherbrooke. Patients agreed to participate and freely signed a consent form and the research protocol was approved by the Institutional Review Committee for the Use of Human Resected Material at the Centre Hospitalier Universitaire de Sherbrooke. Tissues were frozen at −20° C. with OCT compound (Tissue-Tek; Miles Scientific) and slices of 5 μm were cut and immediately fixed in formalin to perform hematoxylin-eosin staining for pathological examination. Tumor zones were delimitated together with the adjacent non-cancerous tissues by a clinical pathologist and dissection was performed accordingly. Dissected tissues were washed with nano-pure RNase free water (Wisent) to remove all apparent traces of OCT compound. Tissues were then powder-crushed in liquid nitrogen and RNA extraction was performed using QIAgen RNeasy spin columns (QIAgen, Valentia, Calif., USA) following manufacturer instructions. RNA integrity was assessed by analysis using Agilent Bioanalyser with RNA Nano Chips (Agilent Technologies, Palo Alto, Calif., USA).
1 μg RNA was DNase I-treated (Invitrogen), reverse-transcribed using Superscript II reverse transcriptase (Invitrogen), and RNase H-treated (Ambion, Austin, Tex.) before quantitative PCR performed using a Stratagene Mx3005P instrument. Relative expression levels were calculated using β-actin as a reference gene with the formula (1+amplification efficiency)−(CT). Experiments were done at least in three independent experiments (n=3).
PCR experiments flanking all possible exon-exon junctions were designed. In addition, alternative splicing events were covered by at least two independent reactions, where possible, based on the AceView database containing most EST transcripts. The AceView transcript sets were mapped into the LISA database and the LISA automatically generated a splicing map. When possible, the design was such that predicted amplicon sizes fell within the 100 to 400 bp range. The lower limit of 100 bp was set to avoid an overlap with primer and primer-dimer signals. As described in Klinck et al. (2008, Cancer Research, 68: 657-663), end-point PCR reactions were done on 20 ng cDNA in 10 μL final volume containing 0.2 mmol/L each dNTP, 1.5 mmol/L MgCl2, 0.6 μmol/L each primer, and 0.2 units of Taq DNA polymerase. An initial incubation of 2 min at 95° C. was followed by 35 cycles at 94° C. 30 s, 55° C. 30 s, and 72° C. 60 s. The amplification was completed by a 2-min incubation at 72° C. PCR reactions are carried out using a liquid handling system linked to thermocyclers, and the amplified products were analyzed by automated chip-based microcapillary electrophoresis on Caliper LC-90 instruments (Caliper LifeSciences). Amplicon sizing and relative quantitation was performed by the manufacturer's software, before being uploaded to the LISA database.
Rapid amplification of cDNA 3′ends was done using LNCaP total RNA which was reverse transcripted with 10 μM of cDNA cloning primer (GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTTV, SEQ ID NO: 40; IDT, Coralville, Iowa). 3′UTRs were further amplified by PCR (35 cycles; 95° C. 30 sec, 62° C. 30 sec, 72° C. 3 min) using 1 μL of cDNA with F24 (0.2 μM) as a gene specific primer (ACCCAGAAGAGATGCCGG, SEQ ID NO: 41) and 3′RACE primer (0.05 μM; GGCCACGCGTCGACTAGTAC, SEQ ID NO: 42). For nested-PCR, PCR product was diluted 1:1000 and 1 μL was used in side by side with an equivalent dilution of the original cDNA to serve as a control. DNA bands were electro-eluted out from ethidium bromide stained agarose gels, and used for sequencing after ethanol precipitation. 3′UTRs were cloned by nest-PCR using Q5 high-fidelity polymerase PCR products (New Englands Biolabs, Canada) with primers containing AscI (starting just after stop codon) and XbaI (finishing just after poly-adenylation signal) respectively. 3′UTR were inserted into pMIR reporter vector (OriGene Technologies, Inc.; Rockville, Md.) and after used for transfection in cells after vector sequencing using 4 ng DNA per well in 24-well plates. Luciferase activities were measured 24 h later according to the manufacturer's instructions by first removing the medium and then adding Dual-Glo assay solutions (Promega) using a SIRIUS luminometer (Berthold Detection Systems, Pforzhein, Germany). Luminescence was normalized to protein content in samples as determined by bicinchoninic acid assay (Pierce). For miRNA alignment, sequence of the 3′UTR were submitted RegRNA and miRDB.
Rabbit polyclonal antibodies were raised and purified from serum on peptide coated chromatographic column (Pacific Immunology, Ramona, Calif.). For immunohistochemistry, slides with 4 μm tissue slices were incubated 5 min in each of the following solutions at room temperature: 2× xylene, 2× ethanol 100%, 95%, 85%, 70%, 50%, 30%, 2× UltraPure Water, 10 mM citrate buffer pH 6 and further autoclaved in 10 mM Citrate buffer pH6 for 45 min (16 psi, 250° F.). After cool-down at room temperature, IHC was performed using the Peroxidase Detection Kit (Pierce). Tissues sections were incubated overnight at 4° C. with the primary antibodies diluted in BSA 5% in TBST and further incubated following washes with a secondary HRP-conjugated antibody (Anti-Rabbit HRP from BioRad; diluted accordingly in TBST 5% BSA, 1/500). Slides were then counterstained in Harris hematoxylin (Sigma-Aldrich). For blocking peptide co-incubation, 30 μg of epitopic peptide were added to the primary blotting solution. The xenografted line tissues used for antibody validation are those described in Longuespee et al. (2014, Translational Oncology, 7: 410-419). For immunohistochemistry in other cancer types, Paraffin Tissue Array was obtained from Biochain (Newark, Calif.) on which primary tumors as well as matched non-tumoral tissues were present.
Protein were submitted to electrophoresis and further transferred to a nitrocellulose membrane (Hybond, GE Healthcare, Chalfont St. Giles, UK). Before immunodetection, membranes were blocked with 5% (w/v) BSA in a 0.1% Tween-PBS solution. Membranes were then incubated with primary antibodies overnight at 4° C. with agitation followed by incubation with a goat anti-rabbit or anti-mouse IgGs coupled to IRDye800 (LI-COR Biosciences, Lincoln, Nebr.). Immunodetection was then performed using an infrared imager (Odyssey Imager, LI-COR Biosciences). Relative protein expression levels were calculated using the ImageJ software.
DNA was purified from 14 pairs of tumoral and non-tumoral prostate biopsies and from DU145 and LNCaP cells treated with 5axa-dC using DNeasy Blood & Tissue Kit (Qiagen, #69504). Concentration, yield and purity of gDNA samples were measured using spectrometry. All samples provided good gDNA yield and quality (A260/A280 ratio between 1.7 and 2.0). Gold standard pyrosequencing technology was used to determine base-specific cytosine methylation levels located upstream of guanines (sequence called CpG dinucleotides). Three potential CTCF binding sites were targeted close to exon 25 and alternative exon 25 of the PCSK6 gene identified by transcription factor ChIP-seq from ENCODE project with Factorbook (UCSC Genome Bioinformatics) (
Cells were cultured in 150 mm culture dishes and submitted to crosslinking through the addition of formaldehyde to a final concentration of 1.1% for 10 min at room temperature followed by a quenching step with 125 mM glycine for another 5 min. Cells were washed twice with ice-cold PBS, collected using a cell scraper and frozen in liquid nitrogen and stored at −80° C. until analyses. Cell pellets were resuspended in HEPES 10 mM pH 6.5; 0.5 mM EDTA, 0.25% Triton-X-100 and centrifugated at 4,000 rpm at 4° C. for 5 min. Pellet was further lysed by adding 200 μL of Tris 50 mM pH 8.1; 10 mM EDTA, 1% SDS and passing 3 times through a 28 G syringe. Cell preparations were incubated 1 h at 4° C. with constant agitation and nuclei were pelleted by a centrifugation at 5,000 rpm. 400 μL of water was added (to dilute EDTA) to the nuclei and the solution was sonicated 3×10 sec at intensity 6/10 on ice followed by a 13,000 rpm centrifugation for 10 min at 4° C. 1.1×104 micrococal nuclease gel units (New England Biolabs) were added with its manufactured buffers and BSA and incubated for 5 min on ice before being neutralized with 0.5 M EDTA (final concentration: 10 mM). DNA fragmentation was routinely assessed by agarose gel electrophoresis using 10 μL of the fragmented DNA solution (beforehand treated with RNase A 10 μg/mL for 10 min). For each IP, 350 μg of DNA were used (based on concentration determined using the OD260 nM) and 5% of the corresponding volumes were kept aside as Input DNA for quantitation. Each IP was completed to 1 mL with IP buffer (Tris 16.7 mM pH 8.1; 167 mM NaCl, 1.2 mM EDTA, 1.1% Triton X-100, 0.01% SDS). Immunoprecipitations were carried out by incubating the DNA with 10 μg of specific antibody or normal IgG overnight at 4° C. Antibody-DNA complex were retrieved by adding 40 μL of Protein A MagneResyn beforehand incubated 1 h at 4° C. with 350 μg/mL of salmon sperm DNA. After 1 h with the beads, beads were sequentially washed 5 min twice with each of the following buffers: i) Tris 20 mM pH 8.1; 150 mM NaCl, 2 mM EDTA, 1% Triton-X-100, 0.1% SDS, ii) Tris 20 mM pH 8.1; 500 mM NaCl, 2 mM EDTA, 1% Triton-X-100, 0.1% SDS, iii) Tris 10 mM pH 8.1; 1 mM EDTA, 1% NP40, 1% Na-deoxycholate, 0.25 M LiCl and iv) Tris 10 mM pH 8.1; 0.1 mM EDTA. Protease inhibitor (Complete Mini; Roche) was added to all buffers immediately before use Beads (and their corresponding 5% Input DNA) were finally resuspended in 0.1 M NaHCO3; 1% SDS and heated at 65° C. with frequent agitation to elute DNA from the beads. Following centrifugation, the supernatant containing the DNA were incubated with 50 μg/mL proteinase K and 25 μg/mL RNase A overnight at 65° C. DNA was finally purified using QIAquick PCR purification Kit following manufacturer guidelines and 3 M sodium acetate to adjust the solution pH. ChIP isolated DNA was eluted in 50 μL of TE buffer whereas the corresponding 5% input DNA was eluted in 250 μL to put the concentration at 1% equivalent. 3 μL of the purified DNA were further used for qPCR analyses and quantitation was established using the 1% input as a standard.
Normal RNA standardized preparations were obtained from Clontech Laboratories (Total RNA Master Panel II; Mountain View, Calif.). These consist of total RNA from controlled origins controlled by capillary electrophoresis and denaturing formaldehyde agarose gel electrophoresis. 1 μg of RNA was used for further RT-qPCR analyzes. For normal and tumoral cDNA, cDNA were obtained from Origene (Rockville, Md.) Cancer Survey cDNA Array covering different cancers across identical qPCR plates. All samples were analyzed by the addition of premixed SYBRgreen and primers for a single transcript per plate and using the supplied actin primers as normalizer gene according to the manufacturer's instructions.
For SILAC labelling, cells to be labelled were resurrected from their cryovials in RPMI 1640 without L-arginine and L-lysine (ThermoFisher Scientific) complemented with 42 mg/L [13C6]-L-Arginine, 73 mg/L [13C6]-L-Lysine (Cambridge Isotope Laboratories, Inc, MA) and dialyzed fetal bovine serum. After at least three passages in heavy medium, cells were checked for complete labelling using the method described in Scmidt et al. ((2007, Rapid Commun Mass Spectrom, 21: 3919-3926) and cryopreserved for further uses. Proline conversion was manually assessed in Pro containing peptides and was found to be <0.1%. For conditioned media productions, fixed cell numbers were plated in p150 mm culture plates (4.5×106 for DU145 and 6×106 for LNCaP) for 36 h before washing the cells and adding fresh serum-free medium. Cells were allowed to conditions the medium for 24 h, after what it was collected, centrifuged for 5 min at 1,000×g, filtered on a 0.22 μm syringe unit and flash frozen in liquid nitrogen until use. Upon thawing, protease inhibitor cocktail was added (final concentration 1×, Mini protease inhibitor with EDTA, Roche) and concentrated on a 3 kDa Amicon-Ultra centrifugal unit (Millipore), typically 15 mL were concentrated to 1.5 mL before being pooler 1:1 (volume:volume) with the non-labelled conditions (ex. Non-Target: shPACE4) precipitated by the addition of 9 volumes of acetone:methanol (8:1, MS grade Fisher reagents). Precipitation was performed overnight at −80° C. Protein precipitates were collected by centrifugation at 17.000× g, 30 min at 4° C., washed three times with methanol by inversion (4° C., 10 min). Washed pellets were then solubilized in SAGE-Elf sample loading solution (with SDS) and heated at 95° C. for 10 min with DTT (final concentration 10 mM). Samples were loaded on SAGE gel cassettes (3% agarose) and migrated for 1 h before being electro-eluted into 13 fractions. Fractions were collected, diluted 5 times and used for DTT reduction (5 mM, room temperature, 30 min), iodoacetamie alkylation (5 mM, room temperature, 30 min dark) and quenching with DTT (5 mM, room temperature, 30 min, dark). Protein were then digested with trypsin 1 μg per 100 μg (determined using BCA protein titration assay) overnight at 37° C. in a thermo-shaker. Peptide solutions were acidified with 5 μL formic acid before adding 1 volume of KCl 4M. Samples were vortexed 1 min and allowed to stand for 10 min at room temperature before being submitted to ethyl-acetate organic liquid-liquid extraction by adding the maximal volume of ethyl-acetate in the tube. Organic phase was discarded and the aqueous phase containing the peptides was resubmitted to the extraction twice to ensure complete SDS removal. Residual organics were evaporated by letting the tube stand open in a chemical hood for 20 min. Peptide solutions were then re-acidified by adding 5 μL formic acid and peptide were cleaned by solid-phase extraction (Strata-X 33u polymeric reversed phase, 30 mg/l mL) using the following procedure on a vacuum manifold (each solution was allowed to completely drain before adding the next one): 1 mL ACN, 1 mL H2O 0.1% formic acid, acidified peptide solution, 1 mL H2O 0.1% formic acid, 50% ACN 0.1% formic acid: for elution). Peptide were further dried in a Speed-Vac system and restituted in H2O 0.2% formic acid, 3% DMSO and submitted to LC-MS/MS analysis.
Acquisition was performed with a Sciex TripleTOF 5600 (Sciex, Foster City, Calif., USA) equipped with an electrospray interface with a 25 μm iD capillary and coupled to an Eksigent pUHPLC (Eksigent, Redwood City, Calif., USA). Analyst TF 1.6 software was used to control the instrument and for data processing and acquisition. The source voltage was set to 5.2 kV and maintained at 325° C., curtain gas was set at 27 psi, gas one at 12 psi and gas two at 10 psi. Acquisition was performed in Information Dependant Acquisition (IDA). Separation was performed on a reversed phase HALO C18-ES column 0.3 μm i.d., 2.7 μm particles, 150 mm long (Advance Materials Technology, Wilmington, Del.) which was maintained at 60° C. Samples were injected by loop overfilling into a 5 μL loop. For the 120 minute LC gradient, the mobile phase consisted of the following solvent A (0.2% v/v formic acid and 3% DMSO v/v in water) and solvent B (0.2% v/v formic acid and 3% DMSO in ethanol) at a flow rate of 3 μL/min.
The gradient was as follows: 0-88 minutes from 2% B to 30% B, 88-108 minutes from 30% B to 55% B, 108-115 minutes from 55% B to 95% B, hold 95% B for 5 minutes followed by a 1 minute post flush at final conditions. The raw data was processed by the Protein Pilot software (Sciex, Foster City, Calif., USA). Following peptide and protein identification, an unlabelled:labelled (light:heavy) ratio as well as a p-Value was calculated by the software from the individual peptides for every protein. From the obtained protein identifications, secreted proteins were retrieved using ProteINSIDE (Kaspric et al., 2015), only proteins predicted to be secreted (based on the presence of a signal peptide) were considered. Only L/H ratio <1 were considered since many proteins detected with L/H>1 were composed of peptides with high homology with bovine proteins which may lead to misinterpretation as residual albumin was present in the conditioned medium samples. For proteins only identified in the heavy condition (L/H=0), a primary exclusion criterion based on P-value was applied, only P<0.05 were preserved. All proteins were manually searched for PC-based or PC-like processing events, using both Uniprot PTM/Processing data or by ProP 1.0 Server.
For IP-MS analysis, each condition was injected twice. First, acquisition was performed in Information Dependant Acquisition for the generation of the ion library. The samples were then reinjected in and acquired with variable size windows in SWATH mode for the quantification. Separation was performed on a reversed phase HALO C18-ES column 0.3 μm i.d., 2.7 μm particles, 150 mm long (Advance Materials Technology, Wilmington, Del.) which was maintained at 60° C. Samples were injected by loop overfilling into a 5 μL loop. For the 60 minute LC gradient, the mobile phase consisted of the following solvent A (0.2% v/v formic acid and 3% DMSO v/v in water) and solvent B (0.2% v/v formic acid and 3% DMSO in ethanol) at a flow rate of 3 μL/min. The gradient was as follows: 0-44 minutes from 2% B to 30% B, 44-54 minutes from 30% B to 55% B, 54-57 minutes from 55% B to 95% B, hold 95% B for 5 minutes followed by a 5 minute post flush at final conditions. The protein database and the ion library were generated by analysing simultaneously every IDA files with the ProteinPilot software (Sciex, Foster City, Calif., USA). This database was then used to quantify the proteins with the SWATH quantification tool in the Peakview software (Sciex, Foster City, Calif., USA). Peakview outputs an area under the curve of the chromatograms for each peptides that was detected in the sample, as well as a peak score and a false discovery rate. A peptide was considered as correctly integrated if the peak score was higher than 0.5 or if the false discovery rate was lower than 1%. Protein quantification represents the sum of every correctly integrated peptides. To correct the differences in the amount of peptides that was loaded on the column, every protein was divided by a correction factor that took into account the total protein amount of a sample compared to the average of the total protein amount of all the samples.
ML peptide and its derivatives (Peg8-ML and C23) were synthesized as previously described in Kwiatkowska et al. (2014, Journal of Medicinal Chemistry, 57: 98-109). The synthesis GDF-15 spanning peptide was performed manually by a standard solid-phase peptide method on TentaGel S RAM-amide resin (0.5 g, 0.13 mmol/g). Briefly, Fmoc deprotection was carried out with 20% piperidine in DMF (5 and 10 minutes), Fmoc-protected amino acids (3 equiv), O-(7-azabenzotriazol-1-yl)-N,N,N0,N0-tetramethyluronium hexafluorophosphate (HATU, 3 equiv), 1-hydroxy-6-chloro-benzotriazole (6-CI-HOBt, 3 equiv) and N,N-diisopropylethylamine (DIPEA, 9 equiv) were used for coupling. Completion of the reaction was confirmed by the Kaiser test. After final Fmoc deprotection GDF-15 peptide having a L-Gln residue at its N-terminus was acetylated to prevent formation of pyroglutamate using the mixture acetic anhydride/DIPEA/dichloromethane (15:15:70 v/v/v, 10 ml). Peptide was cleaved from the resin using a cocktail of trifluoroacetic acid (TFA)/H2O/triisopropylsilane (TIS) (95:2.5:2.5 v/v/v, 20 ml) for 3 h at room temperature. The products were precipitated in cold diethyl ether, collected by centrifugation, dissolved and freeze-dried to a white solid. The crude peptides were purified by preparative HPLC (VARIAN ProStar). The fractions containing pure product were pooled and lyophylized. The identity and purity of peptides (97%) was confirmed by HRMS (TripleTOF 5600, ABSciex) and analytical HPLC (Agilent Technologies 1100 system) equipped with a diode array detector with Agilent Eclipse XDB C18 column.
GDF-15 peptide (40 μg) was incubated at 37° C. with recombinant PACE4 or soluble furin (16U) in 100 mM Hepes buffer containing 1 mM CaCl2, 1 mM 3-mercaptoethanol, and 1.8 mg/mL BSA, pH 7.5 (total sample volume: 300 μl) over a period of 1 h. Following controls were used: buffer alone and a peptide or an enzyme incubated in buffer. After incubation, the reactions were immediately analyzed by the analytical HPLC (Agilent Technologies, 1100 series with a diode array detector and a fraction collector; injection volume: 95 μl, gradient: 2 to 25% [A] in [B] in 50 min; [A]0.1% aq TFA and [B] acetonitrile+0.1% aq TFA; column: an Agilent Eclipse XDB C18 column (5 μm, 4.6×250 mm). The collected fractions were analysed by SELDI-TOF mass spectrometer (Bio-Rad Laboratories) to identify the cleavage product.
Blood samples were drawn just prior to the prostatectomy procedure from patients who had agreed to participate. For normal patients, samples were collected from patients referred for a PSA titration who had agreed to participate and signed a consent form. Blood was collected in EDTA-coated tubes (Vacutainer; BD) and centrifuged for 15 min at 5,000×g (4° C.). Plasma was then aliquoted and stored at −80° C. until use for ELISA assay (described in the detailed methods section).
While the disclosure has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations, including such departures from the present disclosure as come within known or customary practice within the art, and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims.
The present application claims benefit of U.S. Provisional Application No. 62/427,209 filed Nov. 29, 2016, U.S. Provisional Application No. 62/565,276 filed Sep. 29, 2017, the content of which are hereby incorporated by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CA2017/051431 | 11/29/2017 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62565276 | Sep 2017 | US | |
| 62427209 | Nov 2016 | US |
