Peptides having GDP exchange factor activity, nucleic acid sequences coding for these peptides, preparation and use

The present invention relates to novel peptide and nucleotide sequences, and to their pharmaceutical use. More especially, the invention relates to peptides capable of modulating the levels of GDP exchange with p21-GDP complexes.
The products of ras genes, generally designated p21 proteins, perform a key role in the control of cell division in all eukaryotic organisms in which they have been investigated. Some specific modifications of these proteins cause them to lose their normal control and lead them to become oncogenic. Thus, a large number of human tumours have been associated with the presence of modified ras genes. Similarly, an overexpression of these p21 proteins can lead to a disturbance of cell proliferation. An understanding of the exact role of these p21 proteins in cells, their mode of functioning and their characteristics hence constitutes a major stake for an understanding of and therapeutic approach to carcinogenesis.
In vivo, the exact nature of the events responsible for the activation of p21 proteins is not yet known. It is known that they exert their functions by fluctuating between two confirmational states; an inactive form bound to GDP and an active form bound to GTP, but the factors effecting the transition between these two forms are not clearly identified. Recent studies report physiological situations during which the proportion of ras proteins bound to GTP increases in the cell. These situations comprise the activation of T lymphocytes and the stimulation of 3T3 fibroblasts by growth factors including EGF and PDGF (Downward et al., Nature 346 (1990) 719; Gibbs et al., J. Biol. Chem. 265 (1990) 20437). The increase in the proportion of p21-GTP may be at least partially explained by the action of a protein performing a role analogous to that of a receptor of the G proteins of transduction. In this connection, some proteins capable of promoting the exchange of GDP with p21 proteins have been identified, from ox brain [West et al., FEBS Lett. 259 (1990) 245] and rat brain [Wolfman and Macara, Science 248 (1990) 67]. The differing cellular localization of these under which they were obtained suggests that they are different proteins. They are as active on normal ras proteins as on those which are oncogenic. These activities are grouped together under the term GEF: Guanidine nucleotide Exchange Factor, or GRF.
In Saccharomyces cerevisiae yeast, GRF activity has been attributed to the product of the CDC25 gene [Camonis et al., EMBO J. 5 (1986) 375], and studies have been carried out in order to understand the signalling pathway involving the product of the CDC25, RAS1 and RAS2 genes on the one hand and adenylate cyclase on the other hand in Saccharomyces cerevisiae yeast. In particular, many studies have focused on characterization of the product of the CDC25 gene, which was the least known element of this chain. The product of the CDC25 gene constitutes the element furthest upstream in the cascade of reactions leading to the activation of p21 in yeast. The work carried out in this field has contributed to demonstrating that the product of this gene must act as a GDP.fwdarw.GTP exchange factor for activating ras proteins. A second gene of S. cerevisiae yeast, SDC25, structurally very closely related to CDC25, has been isolated and characterized. The active domain of SDC25 seems to be an exchange factor capable of acting in vitro and in vivo on ras proteins. This domain constitutes the first molecular constituent described which is endowed with this activity.
Very recently, a protein of the GRF type has also been demonstrated in mice [Vanoni and Martegani, J. Cell. Bioch. Suppl. 16B (1992) 220].
However, to date, no GRF activity has been isolated and characterized in man. The present invention is specifically the outcome of the demonstration by the Applicant of the existence of a human GDP exchange factor. The present invention is, more especially, the outcome of the identification, isolation and characterization of peptides and nucleotide sequences of human origin, designated hGRF and hSOS, capable of modulating the state of activation of p21 proteins.
A first aspect of the hence invention consists of peptides which can be used pharmaceutically. More especially, a subject of the invention lies in peptides capable of modulating the levels of exchange of GDP with p21-GDP complexes. It is understood that p21 denotes any expression product of a normal or oncogenic ras gene.
More especially, the peptides of the invention are chosen from all or part of the sequences SEQ ID no. 2, 3, 4, 6 or 8, or of a derivative of these sequences.
For the purposes of the present invention, the term derivative denotes any molecule obtained by modification, of a genetic and/or chemical nature, of these sequences and which retains the desired activity. Modification of a genetic and/or chemical nature should be understood to mean any mutation, substitution, deletion, addition and/or modification of one or more residues. Such derivatives may be generated for different purposes, such as, in particular, that of increasing the affinity of the peptide for its interaction site, that of improving its levels of production, that of increasing its resistance to proteases, that of increasing its therapeutic efficacy or of reducing its side effects, or that of endowing it with novel pharmacokinetic and/or biological properties.
In a particular embodiment of the invention, the peptides of the invention are peptides capable of stimulating the exchange of GDP with the p21-GDP complex.
In another particular embodiment of the invention, the peptides of the invention are peptides capable of slowing down or inhibiting the exchange of GDP with the p21-GDP complex. Such peptides are preferably peptides capable of antagonizing the interaction of GDP exchange factor with the p21-GDP complex. Hence they can be fragments of the sequences mentioned above or of derivatives of these sequences. Such fragments may be generated in different ways. In particular, they may be synthesized chemically on the basis of the sequences given in the present application, using the peptide synthesizers known to a person skilled in the art. They may also be synthesized genetically, by expression in a cell host of a nucleotide sequence coding for the desired peptide. In this case, the nucleotide sequence may be prepared chemically using an oligonucleotide synthesizer, on the basis of the peptide sequence given in the present application and the genetic code. The nucleotide sequence may also be prepared from the sequences given in the present application (SEQ ID no. 1, 5 and 7), by enzymatic cleavages, ligation, cloning, and the like, according to the techniques known to a person skilled in the art, or by the screening of DNA libraries with probes produced on the basis of these sequences. Moreover, the peptides of the invention, capable of slowing down or inhibiting the exchange of GDP with the p21-GDP complex, can also be peptides having a sequence corresponding to the site of interaction of the exchange factor with the p21-GDP complex.
Another subject of the invention lies in polyclonal or monoclonal antibodies or antibody fragments directed against a peptide as is defined above. Such antibodies may be generated by methods known to a person skilled in the art, in the light of the teachings given in the present application. In particular, these antibodies may be prepared by immunization of an animal against a peptide of the invention, withdrawal of blood and isolation of the antibodies. These antibodies may also be generated by the preparation of hybridomas according to the techniques known to a person skilled in the art.
More preferably, the antibodies or antibody fragments of the invention possess the capacity to inhibit at least partially the interaction of the exchange factor with the p21-GDP complex. They may thus be used to regulate the state of activation of the product of ras genes.
Moreover, these antibodies may also be used to detect and/or assay human GDP exchange factor in biological samples, and consequently to provide information about the state of activation of the product of ras genes.
The present invention hence makes it possible to generate peptides derived from the sequences SEQ ID no. 2-4, 6 and 8, as well as antibodies directed against these peptides, possessing advantageous biological properties with a view to pharmaceutical use. The biological activity of the different peptides and antibodies of the invention with respect to GDP exchange may be evaluated in different way, as illustrated in the examples.
The invention also provides compounds which are non-peptide or not exclusively peptide in nature and which can be used pharmaceutically. It is, in effect, possible, starting from the active proteinaceous units described in the present application, to produce molecules which inhibit the ras protein-dependant signalling pathway which are not exclusively peptide in nature and are compatible with pharmaceutical use. In this connection, the invention relates to the use of a polypeptide of the invention as is described above for the preparation of molecules which are non-peptide or not exclusively peptide in nature and are pharmacologically active on the levels of GDP exchange, by determination of the structural elements of this polypeptide which are important for its activity and reproduction of these elements by structures which are non-peptide or not exclusively peptide in nature. The subject of the invention is also pharmaceutical compositions comprising one or more molecules thus prepared.
The subject of the present invention is also any nucleic acid sequence coding for a polypeptide as is defined above. More preferably, the sequence in question is chosen from:
(a) all or part of the sequences SEQ ID no. 1, 5 or 7 or of their complementary strand,
(b) any sequence hybridizing with a sequence (a) and coding for a polypeptide according to the invention, and
(c) the sequences derived from the sequences (a) and (b) as a result of the degeneracy of the genetic code.
The different nucleotide sequences of the invention can be of artificial origin or otherwise. They can be genomic, cDNA, RNA sequences, hybrid sequences or synthetic or semi-synthetic sequences. These sequences may be obtained, for example, by the screening of DNA libraries (cDNA library, genomic DNA library) by means of probes produced on the basis of the sequences SEQ ID no. 1, 5 or 7. Such libraries may be prepared from cells of different origins by standard techniques of molecular biology known to a person skilled in the art. The nucleotide sequences of the invention may also be prepared by chemical synthesis, in particular according to the phosphoramidite method, or alternatively by mixed methods including the chemical or enzymatic modification of sequences obtained by the screening of libraries.
These nucleotide sequences according to the invention can be used in the pharmaceutical field, such use either being for the in vitro production of the peptides of the invention, or being for the production of anti-sense sequences or for the production of the peptides of the invention in the context of a gene therapy, or alternatively being for the detection and diagnosis, by hybridization experiments, of the expression or of an overexpression of an amplified, mutated or rearranged GDP exchange factor in biological samples, or for the isolation of homologous sequences from other cell sources.
For the production of the peptides of the invention, the nucleic acid sequences defined above are generally placed under the control of signals permitting their expression in a cell host. The choice of these signals (promoters, terminators, secretion leader sequence, and the like) can vary in accordance with the cell host used. Preferably, these nucleotide sequences of the invention form part of a vector, which can be autonomously replicating or integrative. More especially, autonomously replicating vectors may be prepared using sequences displaying autonomous replication in the chosen host. Integrative vectors, for their part, may be prepared, for example, using sequences homologous to certain regions of the host's genome, permitting integration of the vector by homologous recombination.
The cell hosts which can be used for the production of the peptides of the invention are equally well eukaryotic or prokaryotic hosts. Among eukaryotic hosts which are suitable, animal cells, yeasts or fungi may be mentioned. In particular, as regards yeasts, yeasts of the genus Saccharomyces, Kluyveromyces, Pichia, Schwanniomyces or Hansenula may be mentioned. As regards animal cells, COS, CHO, C127 cells, and the like, may be mentioned. Among fungi, Aspergillus ssp. or Trichoderma ssp. may be mentioned more especially. As prokaryotic hosts, it is preferable to use the following bacteria, E. coli, Bacillus or Streptomyces.
The nucleic acid sequences according to the invention may also be used for the production of anti-sense oligonucleotides or of genetic anti-sense sequences which can be used as pharmaceutical agents. Inhibition of the expression of certain oncogenes by anti-sense sequences has proved to be a useful strategy in understanding the role of these oncogenes, and an especially promising approach in the production of an anticancer treatment. Anti-sense sequences are small-sized oligonucleotides which is complementary to the coding strand of a given gene and which, as a result, are capable of hybridizing specifically with the transcribed mRNA, inhibiting its translation into protein. The subject of the invention is thus anti-sense sequences capable of at least partially inhibiting the production of peptides stimulating the exchange of GDP with p21-GDP complexes. Such sequences can consist of all or part of the nucleic acid sequences defined above. They are generally sequences or fragments of sequences complementary to sequences coding for peptides stimulating GDP exchange. Such oligonucleotides may be obtained from the sequences SEQ ID no. 1, 5 or 7, by fragmentation, and the like, or by chemical synthesis. Such sequences may be used in the context of gene therapies, for the transfer and in vivo expression of anti-sense sequences or of peptides capable of modulating the levels of exchanges of GDP with ras proteins. In this connection, the sequences may be incorporated in vectors, in particular of viral origin.
The invention also relates, as nucleotide sequences, to nucleotide probes, synthetic or otherwise, capable of hybridizing with the nucleotide sequences defined above which code for a peptide of the invention, or with the corresponding mRNA. Such probes may be used in vitro as a diagnostic tool, for detection of the expression of GDP exchange factor, or alternatively for the demonstration of genetic abnormalities (incorrect splicing, polymorphism, point mutations, and the like). Such probes must be labelled beforehand, and different techniques for this purpose are known to a person skilled in the art. The hybridization conditions under which these probes can be used are the normal conditions of stringency (see, in particular, the general cloning techniques below as well as the examples). These probes may also be used for the demonstration and isolation of homologous nucleic acid sequences coding for a peptide of the invention, from other cell sources, as illustrated in the examples.
The subject of the invention is also any pharmaceutical composition comprising as active principle at least one peptide as is defined above.
Its subject is also any pharmaceutical composition comprising as active principle at least one antibody and/or antibody fragment as is defined above, as well as any pharmaceutical composition comprising as active principle at least one nucleotide sequence as is defined above.
Moreover, its subject is also pharmaceutical compositions in which the peptides, antibodies and nucleotide sequence defined above are combined with one another or with other active principles.
The pharmaceutical compositions according to the invention may be used to modulate the activation of p21 proteins and, as a result, to modulate the proliferation of certain cell types. More especially, these pharmaceutical compositions are intended for the treatment of cancers. Many cancers have, in effect, been associated with the presence of oncogenic ras proteins. Among cancers most often containing mutated ras genes, there may be mentioned, in particular, adenocarcinomas of the pancreas, 90% of which have a Ki-ras oncogene mutated on the twelfth codon [Almoguera et al., Cell 53 (1988) 549], adenocarcinomas of the colon and cancers of the thyroid (50%), or carcinomas of the lung and myeloid leukaemias [30%, Bos, J. L. Cancer Res. 49 (1989) 4682].
The subject of the invention is also the use of the molecules described above for modulating the activity of p21 proteins. In particular, the invention relates to the use of these molecules for at least partially inhibiting the activation of p21 proteins.
The invention also provides a method for detection of the expression and/or of an overexpression of a ras gene in a biological sample. Such a method comprises, for example, bringing such a sample into contact with an antibody or antibody fragment according to the invention, visualization of the antigen-antibody complexes and comparison of the results obtained with a standard sample. In such a method, the antibody may be in suspension or immobilized beforehand on a support. This method can also comprise bringing the sample into contact with a nucleotide probe according to the invention, demonstration of hybrids obtained and comparison with those obtained in the case of a standard sample.
The present invention may he used in the therapeutic field: since the peptides, antibodies and nucleotide sequences of the invention are capable of modulating the activity of ras genes, they make it possible, in effect, to intervene in the process of development of cancers. As illustrated in the examples, the nucleotide sequences of the invention make it possible, in particular, to express peptides capable of complementing the temperature sensitivity of yeasts carrying a cdc25 mutation. They also make it possible to express peptides capable of suppressing a RAS2ts dominant mutation, demonstrating a competition with the normal expression product of the CDC25 gene for interaction with the p21 proteins. The invention may also be used in the field of diagnosis and typing of cancers: the antibodies and nucleotide probes of the invention make possible, in effect, the identification of cancers in which a ras gene is involved, as well as the diagnosis of cancers associated with the overexpression of a normal or oncogenic ras gene.
Other advantages of the present invention will become apparent on reading the examples which follow, which are to be considered as illustrative and non-limiting.

LEGEND TO THE FIGURES
FIG. 1: Trans-activation test: This figure shows as ordinates the levels of CAT activity (% relative to background) of recombinant CHO strains, according to the cDNA sequence used for the transformation.
FIG. 2: Test of GTP exchange activity: This figure shows as ordinates the ratio of the p21-GDP/p21-GTP forms of recombinant CHO strains, according to the cDNA sequence used for the transformation.
FIG. 3: Test of GDP exchange activity in vitro: This figure shows, in terms of time and for 2 concentrations of a peptide of the invention, the decrease in the proportion of GDP remaining bound to the p21 protein.

GENERAL CLONING TECHNIQUES
The methods traditionally used in molecular biology, such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in a caesium chloride gradient, agarose or acrylamide gel electrophoresis, purification of DNA fragments by electroelution, protein extractions with phenol or phenol/chloroform, ethanol or isopropanol precipitation of DNA in a saline medium, transformation in Escherichia coli, and the like, are well known to a person skilled in the art and are amply described in the literature [Maniatis T. et al., "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982; Ausubel F. M. et al. (eds), "Current Protocols in Molecular Biology", John Wiley and Sons, New York 1987].
Restriction enzymes were supplied by New England Biolabs (Biolabs), Bethesda Research Laboratories (BRL) or, Amersham, and are used according to the suppliers' recommendations.
Plasmids of the pBR322, pUC, .lambda.gt11 and pGEX 2T type and phages of the M13 series are of commercial origin.
For ligation, the DNA fragments are separated according to size by agarose or acrylamide gel electrophoresis, extracted with phenol or with a phenol/chloroform mixture, precipitated with ethanol and then incubated in the presence of phage T4 DNA ligase (Biolabs) according to the supplier's recommendations.
The filling of 5' protruding ends is performed with the Klenow fragment of E. coli DNA polymerase I (Biolabs) according to the supplier's specifications. The destruction of 3' protruding ends is performed in the presence of phage T4 DNA polymerase (Biolabs) used according to the manufacturer's recommendations. The destruction of 5' protruding ends is performed by a controlled treatment with S1 nuclease.
Mutagenesis directed in vitro by synthetic oligodeoxynucleotides is performed according to the method developed by Taylor et al. [Nucleic Acids Res.13 (1985) 8749-8764] using the kit distributed by Amersham.
The enzymatic amplification of DNA fragments by the so-called PCR [Polymerase-catalyzed Chain Reaction, Saiki R. K. et al., Science 230 (1985) 1350-1354; Mullis K. B. and Faloona F. A., Meth. Enzym. 155 (1987) 335-350] technique is performed using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications.
Verification of the nucleotide sequences is performed by the method developed by Sanger et al. [Proc. Natl. Acad. Sci. USA, 74 (1977) 5463-5467] using the kit distributed by Amersham.
For the hybridization experiments, the normal conditions of stringency are generally as follows: hybridization: 3.times. SCC in the presence of 5.times. Denhart's at 65.degree. C.; washing: 0.5.times. SSC at 65.degree. C.
1. Isolation of the human GDP exchange factor (hGRF) gene
5.times.10.sup.5 phages of a human brain library constructed in the vector .lambda.gt11 [Skolnik et al., Cell 65 (1991) 83] were screened according to the techniques described by Sambrook, Fritsch and Maniatis (Molecular cloning; Cold Spring Harbor Laboratory Press; 1989).
The probe used for the screening of this library is a .sup.32 P-labelled 137-base pair human cDNA fragment. This probe was prepared by PCR on the total DNA of the abovementioned library using the following degenerate oligonucleotides as primers:
__________________________________________________________________________-ATC CGT CAG GTA CAT CCC CAG GTA TGG CAC ACA T T T T T T A A A A G A G G G__________________________________________________________________________
for the oligonucleotide of the 3' end of the fragment (SEQ ID no. 11), and
______________________________________-GCA ATT TTT CGG CTT AAG AAG ACT TGGT C C A C A A CC A T G AG C A G______________________________________
for the oligonucleotide of the 5' end of the fragment (SEQ ID no. 12).
The probe was labelled with .sup.32 P by random priming according to the technique of Feinberg and Vogelstein [Anal. Biochem. 137 (1984) 266], and the PCR reaction was conducted at approximately 40.degree. C. under the conditions described in the general cloning techniques.
Among the different positive clones obtained by hybridization with this probe, one comprises the whole of an open reading frame which carries the exchange activity with respect to Ha-Ras.
This .lambda.gt11 clone contains a 3-kb cDNA which has been introduced in the form of an EcoRI fragment at the corresponding site of an M13mp18 vector. This cDNA was then sequenced using commercial "reverse" and "-20" primers and also using specific oligonucleotides according to the Sanger technique (see general cloning techniques).
The nucleotide sequence of the human GDP exchange factor gene carried by the fragment thereby obtained is presented in the sequence SEQ ID no. 1, together with the deduced peptide sequences (SEQ ID no. 2, 3 and 4).
2. Preparation of subfragments
Different derivatives or fragments of the gene thereby obtained may be prepared and used, in particular for the expression of peptides of the invention. In particular, the following fragments were prepared by enzymatic cleavage, and separated by electroelution:
a PstI-EcoRI fragment comprising a portion of the exchange factor coding region (936 up to the stop codon) as well as the 3' non-coding region of the fragment,
an EcoNI-EcoRI fragment comprising a portion of the exchange factor coding region (910 up to the stop codon) as well as the 3' non-coding region of the fragment,
an EagI-EcoRI fragment comprising a portion of the exchange factor coding region (up to the stop codon) as well as the 3' non-coding region of the fragment,
a BalI-EcoRI fragment comprising a portion of the exchange factor coding region (up to the stop codon) as well as the 3' non-coding region of the fragment, and
an NaeI-EcoRI fragment comprising a portion of the exchange factor coding region (up to the stop codon) as well as the 3' non-coding region of the fragment,
It is understood that the 3' non-coding region carried by these fragments is of secondary importance and that it may be removed, either by digestion by means of a nuclease, or by cleavage with an enzyme having a site close to the stop codon, such as, in particular, SmaI, the site for which is localized approximately 30 bp after the stop codon.
It is also understood that other fragments may be prepared, such as, in particular, fragments not containing the region coding for the entire C-terminal portion, as well as derivatives of these fragments, obtained by mutation, substitution, addition or modification of a chemical and/or genetic nature.
3. Biological characterization
The functionalities of the peptides according to the invention were tested:
in mammalian cells,
in Saccharomyces cerevisiae yeast, or alternatively
in vitro on the recombinant Ha-Ras protein.
3.1. For the functional evaluation in mammalian cells, the DNA sequences coding for peptides of the invention, such as for example, those described in Example 2, may be placed under the control of the SV40 early promoter in the vector pCym1 described by Camonis et al. [Gene 86 (1990) 263].
In this example, the PstI-EcoRI and EcoNI-EcoRI fragments described in Example 2 were inserted into this vector.
The vectors thereby obtained were tested by transient transfection into CHO cells according to the protocol described by Rey et al. [Oncogene 6 (1991) 347].
Two criteria of functionality were studied in this way:
the capacity of the vectors to trans-activate a promoter governing the expression of a reporter gene, which is, in this instance, the bacterial gene coding for chloramphenicol acetyltransferase (CAT gene),
their capacity to promote the loading with GTP of the Ras protein of transfected CHO cells.
a) For the trans-activation tests, CHO cells at 50% confluence were transfected (see, for example, the protocol described by Schweighoffer et al., Science, In Press), on the one hand with 0.5 .mu.g of a vector carrying the CAT gene under the control of a synthetic promoter composed of the murine promoter of the thymidine kinase gene and 4 PEA1 repeat elements derived from the polyoma enhancer [Wasylyk et al., EMBO J. 7 (1988) 2475), and on the other hand with 4.5 .mu.g of an expression vector carrying, under the control of the SV40 early promoter, no coding cDNA (lane 1), cDNA of normal Ha-Ras (lane 2), cDNA of Ha-Ras activated at position 12 (Val 12) (lane 3), the 3' end of SDC25 cDNA, described by Rey et al. cited above (lane 4), and cDNA coding for a peptide according to the invention, described above (lane 5).
The results are presented in FIG. 1. With lane 1 corresponding to the baseline activation, lane 5 (obtained for the PstI-EcoRI fragment: CDC hum.) shows that the expression of a peptide of the invention permits trans-activation of the synthetic promoter studied.
The same qualitative result was obtained for the other fragments studied.
b) So as to verify that this trans-activation does indeed involve a loading of the ras proteins of CHO cells with nucleotides, the same transient transfections were carried out with .sup.32 P-labelled orthophosphate being added to the culture medium.
This labelling protocol, as well as that for the immunoprecipitation of cellular ras proteins, is described by Rey et al. cited above. The results obtained are presented in FIG. 2. They show that the peptides of the invention are capable of modulating the levels of exchange of GDP with ras proteins, since some of them (peptide CDC Hum. expressed by the PstI-EcoRI fragment described above) are capable of promoting the loading with GTP of the ras proteins of CHO cells immunoprecipitated with Y 13-259 antibody.
3.2. The peptides of the invention were also tested functionally in S. cerevisiae cdc25.sup.- yeast. To this end, the vectors described above (3.1.), which are shuttle vectors, were introduced into the yeast strain OL97-1-11B [Camonis and Jacquet, Mol. Cell. Biol. 8 (1988) 2980]. The results obtained show that the cDNA fragments according to the invention code for peptides which are capable of complementing the lack of growth of this strain at 36.degree. C. These results thus show that these fragments code for peptides which are functional in vivo in S. cerevisiae.
3.3. The capacity of the DNA sequences of the invention to code for peptides capable of promoting the exchange of GDP with purified Ha-Ras proteins was also demonstrated in vitro according to the protocol described by Rey et al. Mol. Cell. Biol. 9 (1989) 3904].
To this end, the sequences of the invention are expressed in E. coli strain TG1 in the form of fusion proteins with glutathione S-transferase (GST) according to the technique described by Smith and Johnson [Gene 67 (1988) 31]. To this end, the different DNA fragments described in 3.1. above were cloned, in the form of SmaI-EcoRI fragments, into the vector pGEX 2T (Pharmacia), at the 3' end of, and in frame with, a cDNA coding for GST. The SmaI-EcoRI fragments are obtained by adding an adapter by means of a ligase. The vectors thereby obtained are then used to transform E. coli strain TG1. The cells thus transformed are precultured overnight at 37.degree. C., diluted to 1/10 in LB medium, added of IPTG to induce expression (2 hours, 25.degree. C.) and then cultured for approximately 21 hours at 25.degree. C. The cells are then lysed, and the fusion proteins produced are purified by affinity on an agarose-GSH column. To this end, the bacterial lysate is incubated in the presence of the gel (prepared and equilibrated with the lysis buffer) for 15 minutes at 4.degree. C. After three washes with a Tris-HCl buffer, pH 7.4, the proteins are eluted in the presence of a Tris-HCl buffer, pH 7.7, containing an excess of GSH. The supernatant is harvested and centrifuged.
The GDP exchange activity of the peptides of the invention with respect to purified Ha-Ras proteins was then demonstrated in vitro according to the protocol described by Rey et al. (Mol. Cell. Biol. cited above). The results obtained are presented in FIG. 3. They show, in particular, that the peptide of the invention corresponding to the CDC hum sequence, expressed by the PstI-EcoRI fragment described above, stimulates GDP exchange.
4. Demonstration of homologous sequences
Nucleic acid sequences homologous to that presented in FIG. 1 were demonstrated by two different strategies:
by PCR, under the conditions described in the general cloning techniques, on cDNAs neosynthesized from placental mRNA, using as primers degenerate oligonucleotides chosen to cover sequences which are conserved between the sequence SEQ ID no. 1 and the sequence of the SOS protein [Bonfini et al., Science 255 (1992) 603].
By screening a placental cDNA library using a probe consisting of the whole of the sequence SEQ ID no. 1 labelled with .sup.32 P. This screening was carried out under conditions of low stringency: hybridization at 50.degree. C. in 5.times. SSC, 5.times. Denhart's medium; followed by washing at 50.degree. C. in 2.times. SSC medium.
These two strategies enabled sequences homologous to the sequence SEQ ID no. 1 to be revealed. These sequences may be readily isolated and characterized. They constitute nucleic acid sequences for the purposes of the present invention when they code (or their fragments or derivatives) for peptides capable of modulating the levels of exchanges of GDP with p21-GDP complexes.
In particular, this strategy made it possible to identify, from placental mRNA and using the oligonucleotides oligo 2449 (SEQ ID no. 9) and oligo 2451 (SEQ ID no. 10), 2 cDNAs coding for factors designated hSOS1 and hSOS2, the partial sequences of which are shown in SEQ ID no. 5 and SEQ ID no. 7, respectively. The mRNAs corresponding to these factors are present in all tissues in which they have been looked for, in contrast to the factor described in Example 1 which appears to be localized only in the brain. The chromosomal localization of these genes was performed, and gave the following results:
h-GRF:15q2.4.
h-SOS1:4q2.1.
h-SOS2:14q2.2.
5. Testing for exchange factors of the h-GRF type in other tissues
An anti-h-GRF antibody was prepared in rabbits by immunization with an antigen corresponding to the fragment of 280 amino acids localized between residues 211 and 489 of the h-GRF factor presented in SEQ ID no. 4.
These antibodies enabled proteins of apparent molecular weights 30, 55, 75, 95 and 140 kDa to be detected, by ELISA, in human cortex and brain precursor cells. The diversity of molecular weights suggests the presence of multiple cDNAs. Preincubation of the anti-h-GRF antibody with h-GRF abolishes the detection of the proteins identified, thereby demonstrating the specificity of the signal.
__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 12(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 2652 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iii) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..2445(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 445..2445 (SEQ ID NO 3)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 976..2445 (SEQ ID NO 4)(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:GGCGATGGCTGTAAGATCCTCCTGGACACCAGCCAGACCTTTGTGAGA48GlyAspGlyCysLysIleLeuLeuAspThrSerGlnThrPheValArg151015CAAGGTTCCCTCATTCAGGTGCCCATGTCTGAAAAGGGCAAGATCACC96GlnGlySerLeuIleGlnValProMetSerGluLysGlyLysIleThr202530AGGGGGCGCCTGGGGTCTCTCTCCCTAAAGAAAGAGGGCGAGCGACAG144ArgGlyArgLeuGlySerLeuSerLeuLysLysGluGlyGluArgGln354045TGCTTCCTGTTTTCTAAGCATCTGATTATCTGTACCAGAGGCTCTGGA192CysPheLeuPheSerLysHisLeuIleIleCysThrArgGlySerGly505560GGGAAGCTTCACTTGACCAAGAATGGAGTCATATCCCTCATTGACTGC240GlyLysLeuHisLeuThrLysAsnGlyValIleSerLeuIleAspCys65707580ACTTTATTGGAGGAGCCAGAAAGCACGGAGGAGGAAGCCAAAGGATCC288ThrLeuLeuGluGluProGluSerThrGluGluGluAlaLysGlySer859095GGCCAAGACATAGATCACTTGGATTTTAAAATCGGGGTGGAGCCAAAG336GlyGlnAspIleAspHisLeuAspPheLysIleGlyValGluProLys100105110GATTCCCCGCCCTTTACAGTCATCCTAGTGGCCTCGTCCAGACAGGAG384AspSerProProPheThrValIleLeuValAlaSerSerArgGlnGlu115120125AAGGCAGCGTGGACCAGTGACATCAGCCAGTGTGTTGGTAACATCCGA432LysAlaAlaTrpThrSerAspIleSerGlnCysValGlyAsnIleArg130135140TGCAATGGGCTCATGATGAAGCCATTTGAAGAAAATTCCAAGGTCACT480CysAsnGlyLeuMetMetLysProPheGluGluAsnSerLysValThr145150155160GTGCCGCAGATGATCAAGTCCGACGCCTCCTTATATTGTGATGATGTT528ValProGlnMetIleLysSerAspAlaSerLeuTyrCysAspAspVal165170175GACATTCGCTTCAGCAAAACCATGAACTCCTGCAAAGTGCTGCAGATC576AspIleArgPheSerLysThrMetAsnSerCysLysValLeuGlnIle180185190GCCTACGCCAGTGTGGAGCGGCTGCTGGAGAGGCTGACGGACCTGCGC624AlaTyrAlaSerValGluArgLeuLeuGluArgLeuThrAspLeuArg195200205TTCCTGAGCATCGACTTCCTCAACACCTTCCTGCACTCCTACCGCGTC672PheLeuSerIleAspPheLeuAsnThrPheLeuHisSerTyrArgVal210215220TTCACCACCGCCATCGTGGTCCTGGACAAGCTCATTACCATCTACAAG720PheThrThrAlaIleValValLeuAspLysLeuIleThrIleTyrLys225230235240AAGCCTATCAGTGCCATTCCTGCCAGGTCGCTGGAGCTCCTGTTTGCC768LysProIleSerAlaIleProAlaArgSerLeuGluLeuLeuPheAla245250255AGTGGCCAGAACAATAAGCTCCTGTACGGTGAACCCCCCAAGTCCCCG816SerGlyGlnAsnAsnLysLeuLeuTyrGlyGluProProLysSerPro260265270CGCGCCACCCGCAAGTTCTCCTCGCCGCCACCTCTGTCCATCACCAAG864ArgAlaThrArgLysPheSerSerProProProLeuSerIleThrLys275280285ACATCGTCACCGAGCCGCCGGCGGAAGCTCTCCCTGAACATCCCCATC912ThrSerSerProSerArgArgArgLysLeuSerLeuAsnIleProIle290295300ATCACTGGCGGCAAGGCCCTGGACCTGGCCGCCCTCAGCTGCAACTCC960IleThrGlyGlyLysAlaLeuAspLeuAlaAlaLeuSerCysAsnSer305310315320AATGGCTACACCAGCATGTACTCGGCCATGTCACCCTTCAGCAAGGCC1008AsnGlyTyrThrSerMetTyrSerAlaMetSerProPheSerLysAla325330335ACGCTGGACACCAGCAAGCTCTATGTGTCCAGCAGCTTCACCAACAAG1056ThrLeuAspThrSerLysLeuTyrValSerSerSerPheThrAsnLys340345350ATTCCAGATGAGGGCGATACGACCCCTGAGAAGCCCGAAGACCCTTCA1104IleProAspGluGlyAspThrThrProGluLysProGluAspProSer355360365GCGCTCAGCAAGCAGAGCTCAGAAGTCTCCATGAGAGAGGAGTCAGAT1152AlaLeuSerLysGlnSerSerGluValSerMetArgGluGluSerAsp370375380ATTGATCAAAACCAGAGTGATGATGGTGATACTGAAACATCACCAACT1200IleAspGlnAsnGlnSerAspAspGlyAspThrGluThrSerProThr385390395400AAATCTCCAACAACACCCAAATCAGTCAAAAACAAAAATTCTTCAGAG1248LysSerProThrThrProLysSerValLysAsnLysAsnSerSerGlu405410415TTCCCACTCTTTTCCTATAACAATGGAGTCGTCATGACCTCCTGTCGT1296PheProLeuPheSerTyrAsnAsnGlyValValMetThrSerCysArg420425430GAACTGGACAATAACCGCAGTGCCTTGTCGGCCGCCTCTGCCTTTGCC1344GluLeuAspAsnAsnArgSerAlaLeuSerAlaAlaSerAlaPheAla435440445ATAGCAACCGCCGGGGCCAACGAGGGCACCCCAAACAAGGAGAAGTAC1392IleAlaThrAlaGlyAlaAsnGluGlyThrProAsnLysGluLysTyr450455460CGGAGGATGTCCTTAGCCAGTGCAGGGTTTCCCCCAGACCAGAGGAAT1440ArgArgMetSerLeuAlaSerAlaGlyPheProProAspGlnArgAsn465470475480GGAGACAAGGAGTTTGTGATCCGCAGAGCAGCCACCAATCGTGTCTTG1488GlyAspLysGluPheValIleArgArgAlaAlaThrAsnArgValLeu485490495AACGTGCTCCGCCACTGGGTGTCCAAGCACTCTCAGGACTTTGAGACC1536AsnValLeuArgHisTrpValSerLysHisSerGlnAspPheGluThr500505510AACGATGAGCTCAAATGCAAGGTGATCGGCTTCCTGGAAGAAGTCATG1584AsnAspGluLeuLysCysLysValIleGlyPheLeuGluGluValMet515520525CACGACCCGGAGCTCCTGACCCAGGAGCGGAAGGCTGCAGCCAACATC1632HisAspProGluLeuLeuThrGlnGluArgLysAlaAlaAlaAsnIle530535540ATCAGGACTCTGACCCAGGAGGACCCAGGTGACAACCAGATCACGCTG1680IleArgThrLeuThrGlnGluAspProGlyAspAsnGlnIleThrLeu545550555560GAGGAGATCACGCAGATGGCTGAAGGCGTGAAGGCTGAGCCCTTTGAA1728GluGluIleThrGlnMetAlaGluGlyValLysAlaGluProPheGlu565570575AACCACTCAGCCCTGGAGATCGCGGAGCAGCTGACCCTGCTAGATCAC1776AsnHisSerAlaLeuGluIleAlaGluGlnLeuThrLeuLeuAspHis580585590CTCGTCTTCAAGAAGATTCCTTATGAGGAGTTCTTCGGACAAGGATGG1824LeuValPheLysLysIleProTyrGluGluPhePheGlyGlnGlyTrp595600605ATGAAACTGGAAAAGAATGAAAGGACCCCTTATATCATGAAAACCACT1872MetLysLeuGluLysAsnGluArgThrProTyrIleMetLysThrThr610615620AAGCACTTCAATGACATCAGTAACTTGATTGCTTCAGAAATCATCCGC1920LysHisPheAsnAspIleSerAsnLeuIleAlaSerGluIleIleArg625630635640AATGAGGACATCAACGCCAGGGTGAGCGCCATCGAGAAGTGGGTGGCC1968AsnGluAspIleAsnAlaArgValSerAlaIleGluLysTrpValAla645650655GTAGCTGACATATGCCGCTGCCTCCACAACTACAATGCCGTACTGGAG2016ValAlaAspIleCysArgCysLeuHisAsnTyrAsnAlaValLeuGlu660665670ATCACCTCGTCCATGAACCGCAGTGCAATCTTCCGGCTCAAAAAGACG2064IleThrSerSerMetAsnArgSerAlaIlePheArgLeuLysLysThr675680685TGGCTCAAAGTCTCTAAGCAGACTAAAGCTTTGATTGATAAGCTCCAA2112TrpLeuLysValSerLysGlnThrLysAlaLeuIleAspLysLeuGln690695700AAGCTTGTGTCATCTGAGGGCAGATTTAAGAATCTCAGAGAAGCTTTG2160LysLeuValSerSerGluGlyArgPheLysAsnLeuArgGluAlaLeu705710715720AAAAATTGTGACCCACCCTGTGTCCCTTACCTGGGGATGTACCTCACC2208LysAsnCysAspProProCysValProTyrLeuGlyMetTyrLeuThr725730735GACCTGGCCTTCATCGAGGAGGGGACGCCCAATTACACGGAAGACGGC2256AspLeuAlaPheIleGluGluGlyThrProAsnTyrThrGluAspGly740745750CTGGTCAACTTCTCCAAGATGAGGATGATATCCCATATTATCCGAGAG2304LeuValAsnPheSerLysMetArgMetIleSerHisIleIleArgGlu755760765ATTCGCCAGTTTCAACAAACTGCCTACAAAATAGAGCACCAAGCAAAG2352IleArgGlnPheGlnGlnThrAlaTyrLysIleGluHisGlnAlaLys770775780GTAACGCAATATTTACTGGACCAATCTTTTGTAATGGATGAAGAAAGC2400ValThrGlnTyrLeuLeuAspGlnSerPheValMetAspGluGluSer785790795800CTCTACGAGTCTTCTCTCCGAATAGAACCAAAACTCCCCACCTGAAGCTGTG2452LeuTyrGluSerSerLeuArgIleGluProLysLeuProThr805810815CCCAGCCCAGACCCAGCTGCTCCCGGGGACATGTGCTAGATGATACTGTACATATTCGTT2512TGGTTTCACTGGATTTTCTTCTTCAGTATGTGCTTCTCCAAGAATACAAATCGTCCTTGT2572TCTTAGATTCCTGTAGAACCGGAATATGAATTTCTGCACCGTTTCAGACTTCGCCCACCC2632ATCCCTCCCCTCGCCCGAAT2652(2) INFORMATION FOR SEQ ID NO: 2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 814 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:GlyAspGlyCysLysIleLeuLeuAspThrSerGlnThrPheValArg151015GlnGlySerLeuIleGlnValProMetSerGluLysGlyLysIleThr202530ArgGlyArgLeuGlySerLeuSerLeuLysLysGluGlyGluArgGln354045CysPheLeuPheSerLysHisLeuIleIleCysThrArgGlySerGly505560GlyLysLeuHisLeuThrLysAsnGlyValIleSerLeuIleAspCys65707580ThrLeuLeuGluGluProGluSerThrGluGluGluAlaLysGlySer859095GlyGlnAspIleAspHisLeuAspPheLysIleGlyValGluProLys100105110AspSerProProPheThrValIleLeuValAlaSerSerArgGlnGlu115120125LysAlaAlaTrpThrSerAspIleSerGlnCysValGlyAsnIleArg130135140CysAsnGlyLeuMetMetLysProPheGluGluAsnSerLysValThr145150155160ValProGlnMetIleLysSerAspAlaSerLeuTyrCysAspAspVal165170175AspIleArgPheSerLysThrMetAsnSerCysLysValLeuGlnIle180185190AlaTyrAlaSerValGluArgLeuLeuGluArgLeuThrAspLeuArg195200205PheLeuSerIleAspPheLeuAsnThrPheLeuHisSerTyrArgVal210215220PheThrThrAlaIleValValLeuAspLysLeuIleThrIleTyrLys225230235240LysProIleSerAlaIleProAlaArgSerLeuGluLeuLeuPheAla245250255SerGlyGlnAsnAsnLysLeuLeuTyrGlyGluProProLysSerPro260265270ArgAlaThrArgLysPheSerSerProProProLeuSerIleThrLys275280285ThrSerSerProSerArgArgArgLysLeuSerLeuAsnIleProIle290295300IleThrGlyGlyLysAlaLeuAspLeuAlaAlaLeuSerCysAsnSer305310315320AsnGlyTyrThrSerMetTyrSerAlaMetSerProPheSerLysAla325330335ThrLeuAspThrSerLysLeuTyrValSerSerSerPheThrAsnLys340345350IleProAspGluGlyAspThrThrProGluLysProGluAspProSer355360365AlaLeuSerLysGlnSerSerGluValSerMetArgGluGluSerAsp370375380IleAspGlnAsnGlnSerAspAspGlyAspThrGluThrSerProThr385390395400LysSerProThrThrProLysSerValLysAsnLysAsnSerSerGlu405410415PheProLeuPheSerTyrAsnAsnGlyValValMetThrSerCysArg420425430GluLeuAspAsnAsnArgSerAlaLeuSerAlaAlaSerAlaPheAla435440445IleAlaThrAlaGlyAlaAsnGluGlyThrProAsnLysGluLysTyr450455460ArgArgMetSerLeuAlaSerAlaGlyPheProProAspGlnArgAsn465470475480GlyAspLysGluPheValIleArgArgAlaAlaThrAsnArgValLeu485490495AsnValLeuArgHisTrpValSerLysHisSerGlnAspPheGluThr500505510AsnAspGluLeuLysCysLysValIleGlyPheLeuGluGluValMet515520525HisAspProGluLeuLeuThrGlnGluArgLysAlaAlaAlaAsnIle530535540IleArgThrLeuThrGlnGluAspProGlyAspAsnGlnIleThrLeu545550555560GluGluIleThrGlnMetAlaGluGlyValLysAlaGluProPheGlu565570575AsnHisSerAlaLeuGluIleAlaGluGlnLeuThrLeuLeuAspHis580585590LeuValPheLysLysIleProTyrGluGluPhePheGlyGlnGlyTrp595600605MetLysLeuGluLysAsnGluArgThrProTyrIleMetLysThrThr610615620LysHisPheAsnAspIleSerAsnLeuIleAlaSerGluIleIleArg625630635640AsnGluAspIleAsnAlaArgValSerAlaIleGluLysTrpValAla645650655ValAlaAspIleCysArgCysLeuHisAsnTyrAsnAlaValLeuGlu660665670IleThrSerSerMetAsnArgSerAlaIlePheArgLeuLysLysThr675680685TrpLeuLysValSerLysGlnThrLysAlaLeuIleAspLysLeuGln690695700LysLeuValSerSerGluGlyArgPheLysAsnLeuArgGluAlaLeu705710715720LysAsnCysAspProProCysValProTyrLeuGlyMetTyrLeuThr725730735AspLeuAlaPheIleGluGluGlyThrProAsnTyrThrGluAspGly740745750LeuValAsnPheSerLysMetArgMetIleSerHisIleIleArgGlu755760765IleArgGlnPheGlnGlnThrAlaTyrLysIleGluHisGlnAlaLys770775780ValThrGlnTyrLeuLeuAspGlnSerPheValMetAspGluGluSer785790795800LeuTyrGluSerSerLeuArgIleGluProLysLeuProThr805810(2) INFORMATION FOR SEQ ID NO: 3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 666 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:MetMetLysProPheGluGluAsnSerLysValThrValProGlnMet151015IleLysSerAspAlaSerLeuTyrCysAspAspValAspIleArgPhe202530SerLysThrMetAsnSerCysLysValLeuGlnIleAlaTyrAlaSer354045ValGluArgLeuLeuGluArgLeuThrAspLeuArgPheLeuSerIle505560AspPheLeuAsnThrPheLeuHisSerTyrArgValPheThrThrAla65707580IleValValLeuAspLysLeuIleThrIleTyrLysLysProIleSer859095AlaIleProAlaArgSerLeuGluLeuLeuPheAlaSerGlyGlnAsn100105110AsnLysLeuLeuTyrGlyGluProProLysSerProArgAlaThrArg115120125LysPheSerSerProProProLeuSerIleThrLysThrSerSerPro130135140SerArgArgArgLysLeuSerLeuAsnIleProIleIleThrGlyGly145150155160LysAlaLeuAspLeuAlaAlaLeuSerCysAsnSerAsnGlyTyrThr165170175SerMetTyrSerAlaMetSerProPheSerLysAlaThrLeuAspThr180185190SerLysLeuTyrValSerSerSerPheThrAsnLysIleProAspGlu195200205GlyAspThrThrProGluLysProGluAspProSerAlaLeuSerLys210215220GlnSerSerGluValSerMetArgGluGluSerAspIleAspGlnAsn225230235240GlnSerAspAspGlyAspThrGluThrSerProThrLysSerProThr245250255ThrProLysSerValLysAsnLysAsnSerSerGluPheProLeuPhe260265270SerTyrAsnAsnGlyValValMetThrSerCysArgGluLeuAspAsn275280285AsnArgSerAlaLeuSerAlaAlaSerAlaPheAlaIleAlaThrAla290295300GlyAlaAsnGluGlyThrProAsnLysGluLysTyrArgArgMetSer305310315320LeuAlaSerAlaGlyPheProProAspGlnArgAsnGlyAspLysGlu325330335PheValIleArgArgAlaAlaThrAsnArgValLeuAsnValLeuArg340345350HisTrpValSerLysHisSerGlnAspPheGluThrAsnAspGluLeu355360365LysCysLysValIleGlyPheLeuGluGluValMetHisAspProGlu370375380LeuLeuThrGlnGluArgLysAlaAlaAlaAsnIleIleArgThrLeu385390395400ThrGlnGluAspProGlyAspAsnGlnIleThrLeuGluGluIleThr405410415GlnMetAlaGluGlyValLysAlaGluProPheGluAsnHisSerAla420425430LeuGluIleAlaGluGlnLeuThrLeuLeuAspHisLeuValPheLys435440445LysIleProTyrGluGluPhePheGlyGlnGlyTrpMetLysLeuGlu450455460LysAsnGluArgThrProTyrIleMetLysThrThrLysHisPheAsn465470475480AspIleSerAsnLeuIleAlaSerGluIleIleArgAsnGluAspIle485490495AsnAlaArgValSerAlaIleGluLysTrpValAlaValAlaAspIle500505510CysArgCysLeuHisAsnTyrAsnAlaValLeuGluIleThrSerSer515520525MetAsnArgSerAlaIlePheArgLeuLysLysThrTrpLeuLysVal530535540SerLysGlnThrLysAlaLeuIleAspLysLeuGlnLysLeuValSer545550555560SerGluGlyArgPheLysAsnLeuArgGluAlaLeuLysAsnCysAsp565570575ProProCysValProTyrLeuGlyMetTyrLeuThrAspLeuAlaPhe580585590IleGluGluGlyThrProAsnTyrThrGluAspGlyLeuValAsnPhe595600605SerLysMetArgMetIleSerHisIleIleArgGluIleArgGlnPhe610615620GlnGlnThrAlaTyrLysIleGluHisGlnAlaLysValThrGlnTyr625630635640LeuLeuAspGlnSerPheValMetAspGluGluSerLeuTyrGluSer645650655SerLeuArgIleGluProLysLeuProThr660665(2) INFORMATION FOR SEQ ID NO: 4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 489 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:MetTyrSerAlaMetSerProPheSerLysAlaThrLeuAspThrSer151015LysLeuTyrValSerSerSerPheThrAsnLysIleProAspGluGly202530AspThrThrProGluLysProGluAspProSerAlaLeuSerLysGln354045SerSerGluValSerMetArgGluGluSerAspIleAspGlnAsnGln505560SerAspAspGlyAspThrGluThrSerProThrLysSerProThrThr65707580ProLysSerValLysAsnLysAsnSerSerGluPheProLeuPheSer859095TyrAsnAsnGlyValValMetThrSerCysArgGluLeuAspAsnAsn100105110ArgSerAlaLeuSerAlaAlaSerAlaPheAlaIleAlaThrAlaGly115120125AlaAsnGluGlyThrProAsnLysGluLysTyrArgArgMetSerLeu130135140AlaSerAlaGlyPheProProAspGlnArgAsnGlyAspLysGluPhe145150155160ValIleArgArgAlaAlaThrAsnArgValLeuAsnValLeuArgHis165170175TrpValSerLysHisSerGlnAspPheGluThrAsnAspGluLeuLys180185190CysLysValIleGlyPheLeuGluGluValMetHisAspProGluLeu195200205LeuThrGlnGluArgLysAlaAlaAlaAsnIleIleArgThrLeuThr210215220GlnGluAspProGlyAspAsnGlnIleThrLeuGluGluIleThrGln225230235240MetAlaGluGlyValLysAlaGluProPheGluAsnHisSerAlaLeu245250255GluIleAlaGluGlnLeuThrLeuLeuAspHisLeuValPheLysLys260265270IleProTyrGluGluPhePheGlyGlnGlyTrpMetLysLeuGluLys275280285AsnGluArgThrProTyrIleMetLysThrThrLysHisPheAsnAsp290295300IleSerAsnLeuIleAlaSerGluIleIleArgAsnGluAspIleAsn305310315320AlaArgValSerAlaIleGluLysTrpValAlaValAlaAspIleCys325330335ArgCysLeuHisAsnTyrAsnAlaValLeuGluIleThrSerSerMet340345350AsnArgSerAlaIlePheArgLeuLysLysThrTrpLeuLysValSer355360365LysGlnThrLysAlaLeuIleAspLysLeuGlnLysLeuValSerSer370375380GluGlyArgPheLysAsnLeuArgGluAlaLeuLysAsnCysAspPro385390395400ProCysValProTyrLeuGlyMetTyrLeuThrAspLeuAlaPheIle405410415GluGluGlyThrProAsnTyrThrGluAspGlyLeuValAsnPheSer420425430LysMetArgMetIleSerHisIleIleArgGluIleArgGlnPheGln435440445GlnThrAlaTyrLysIleGluHisGlnAlaLysValThrGlnTyrLeu450455460LeuAspGlnSerPheValMetAspGluGluSerLeuTyrGluSerSer465470475480LeuArgIleGluProLysLeuProThr485(2) INFORMATION FOR SEQ ID NO: 5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1092 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iii) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..1092(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:ATTACTAAAATAATCCAAAGGAAAAAAATTGCAAGAGACAATGGACCA48IleThrLysIleIleGlnArgLysLysIleAlaArgAspAsnGlyPro151015GGTCATAATATTACATTTCAGAGTTCACCTCCCACAGTTGAGTGGCAT96GlyHisAsnIleThrPheGlnSerSerProProThrValGluTrpHis202530ATAAGCAGACCTGGGCACATAGAGACTTTTGACCTGCTCACCTTACAC144IleSerArgProGlyHisIleGluThrPheAspLeuLeuThrLeuHis354045CCAATAGAAATTGCTCGACAACTCACTTTACTTGATTCAGATCTATAC192ProIleGluIleAlaArgGlnLeuThrLeuLeuAspSerAspLeuTyr505560CGAGCTGTACAGCCATCAGATTTAGTTGGAAGTGTGTGGACAAAAGAA240ArgAlaValGlnProSerAspLeuValGlySerValTrpThrLysGlu65707580GACAAAGAAATTAACTCTCCTAATCTTCTGAAAATGATTCGACATACC288AspLysGluIleAsnSerProAsnLeuLeuLysMetIleArgHisThr859095ACCAACCTCACTCTGTGGTTTGAGAAATGTATTGTAGAAACTGAAAAT336ThrAsnLeuThrLeuTrpPheGluLysCysIleValGluThrGluAsn100105110TTAGAAGAAAGAGTAGCTGTGGTGAGTCGAATTATTGAGATTCTACAA384LeuGluGluArgValAlaValValSerArgIleIleGluIleLeuGln115120125GTCTTTCAAGAGTTGAACAACTTTAATGGGGTCCTTGAGGTTGTCAGT432ValPheGlnGluLeuAsnAsnPheAsnGlyValLeuGluValValSer130135140GCTATGAATTCCTCACCTGTTTACAGACTAGACCACACATTTGAGCAA480AlaMetAsnSerSerProValTyrArgLeuAspHisThrPheGluGln145150155160ATACCAAGTCGCCAGAAGAAAATTTTAGAAGAAGCTCATGAATTGAGT528IleProSerArgGlnLysLysIleLeuGluGluAlaHisGluLeuSer165170175GAAGATCACTATAAGAAATATTTGGCAAAACTCAGGTCTATTAATCCA576GluAspHisTyrLysLysTyrLeuAlaLysLeuArgSerIleAsnPro180185190CCATGTGTGCCTTTCTTTGGAATTTATCTACATAATATCTTGAAAACA624ProCysValProPhePheGlyIleTyrLeuHisAsnIleLeuLysThr195200205GAAGAAGGCAACCCTGAGGTCCTAAAAAGACATGGAAAAGAGCTTATA672GluGluGlyAsnProGluValLeuLysArgHisGlyLysGluLeuIle210215220AACTTTAGCAAAAGGAGGAAAGTAGCAGAAATAACAGGAGAGATCCAG720AsnPheSerLysArgArgLysValAlaGluIleThrGlyGluIleGln225230235240CAGTACCAAAATCAGCCTTACTGTTTACGAGTAGAATCAGATATCAAA768GlnTyrGlnAsnGlnProTyrCysLeuArgValGluSerAspIleLys245250255AGGTTCTTTGAAAACTTGAATCCGATGGGAAATAGCATGGAGAGGGAA816ArgPhePheGluAsnLeuAsnProMetGlyAsnSerMetGluArgGlu260265270TTTACAGATTATCTTTTCAACAAATCCCTAGAAATAGAACCACGAAAC864PheThrAspTyrLeuPheAsnLysSerLeuGluIleGluProArgAsn275280285CCTAAGCCTCTCCCAAGATTTCCAAAAAAATATACGTATCCCCTAAAA912ProLysProLeuProArgPheProLysLysTyrThrTyrProLeuLys290295300TCTCCTGGTGTCCGGCCATCAAACCCAAGACCGGGTACCATGAGGATC960SerProGlyValArgProSerAsnProArgProGlyThrMetArgIle305310315320CCCACCCCTCTACAGCAGGAACCACGAAAAATAAGTTATAGTAGAATA1008ProThrProLeuGlnGlnGluProArgLysIleSerTyrSerArgIle325330335CCAGAGTCAGAGACAGAGAGTACTGCTAGTGCACCTAATTCACCAAGG1056ProGluSerGluThrGluSerThrAlaSerAlaProAsnSerProArg340345350ACACCTCTAACACCTCCACCTGCATCAGGAACATCA1092ThrProLeuThrProProProAlaSerGlyThrSer355360(2) INFORMATION FOR SEQ ID NO: 6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 364 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:IleThrLysIleIleGlnArgLysLysIleAlaArgAspAsnGlyPro151015GlyHisAsnIleThrPheGlnSerSerProProThrValGluTrpHis202530IleSerArgProGlyHisIleGluThrPheAspLeuLeuThrLeuHis354045ProIleGluIleAlaArgGlnLeuThrLeuLeuAspSerAspLeuTyr505560ArgAlaValGlnProSerAspLeuValGlySerValTrpThrLysGlu65707580AspLysGluIleAsnSerProAsnLeuLeuLysMetIleArgHisThr859095ThrAsnLeuThrLeuTrpPheGluLysCysIleValGluThrGluAsn100105110LeuGluGluArgValAlaValValSerArgIleIleGluIleLeuGln115120125ValPheGlnGluLeuAsnAsnPheAsnGlyValLeuGluValValSer130135140AlaMetAsnSerSerProValTyrArgLeuAspHisThrPheGluGln145150155160IleProSerArgGlnLysLysIleLeuGluGluAlaHisGluLeuSer165170175GluAspHisTyrLysLysTyrLeuAlaLysLeuArgSerIleAsnPro180185190ProCysValProPhePheGlyIleTyrLeuHisAsnIleLeuLysThr195200205GluGluGlyAsnProGluValLeuLysArgHisGlyLysGluLeuIle210215220AsnPheSerLysArgArgLysValAlaGluIleThrGlyGluIleGln225230235240GlnTyrGlnAsnGlnProTyrCysLeuArgValGluSerAspIleLys245250255ArgPhePheGluAsnLeuAsnProMetGlyAsnSerMetGluArgGlu260265270PheThrAspTyrLeuPheAsnLysSerLeuGluIleGluProArgAsn275280285ProLysProLeuProArgPheProLysLysTyrThrTyrProLeuLys290295300SerProGlyValArgProSerAsnProArgProGlyThrMetArgIle305310315320ProThrProLeuGlnGlnGluProArgLysIleSerTyrSerArgIle325330335ProGluSerGluThrGluSerThrAlaSerAlaProAsnSerProArg340345350ThrProLeuThrProProProAlaSerGlyThrSer355360(2) INFORMATION FOR SEQ ID NO: 7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1956 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: cDNA(iii) HYPOTHETICAL: NO(iii) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 1..1956(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:AGGTTTGAAATCCCAGAGCCAGAACCTACAGAAGCAGATAAACTAGCA48ArgPheGluIleProGluProGluProThrGluAlaAspLysLeuAla151015CTTGAGAAAGGAGAACAACCAATCTCTGCAGATCTAAAGAGGTTCAGA96LeuGluLysGlyGluGlnProIleSerAlaAspLeuLysArgPheArg202530AAGGAATATATCCAACCAGTACAGCTACGGGTGTTGAACGTGCAGCGG144LysGluTyrIleGlnProValGlnLeuArgValLeuAsnValGlnArg354045CACTGGGTTGAACATCACCCCCATGACTTTGAAAGAGACTTGGAACTG192HisTrpValGluHisHisProHisAspPheGluArgAspLeuGluLeu505560CTCGAAAGACTAGAATCCTTCACCTCAAGCGCTCACAGAGCGAAAGCA240LeuGluArgLeuGluSerPheThrSerSerAlaHisArgAlaLysAla65707580ATGAAGAAGTGGGTAGAGAGCATCGCTAAGACCATCAGGAGGAAGAAG288MetLysLysTrpValGluSerIleAlaLysThrIleArgArgLysLys859095CAAGCTCAGGCAAATGGAGTAAGCCATAATATTACCTTTGAAAGTCCA336GlnAlaGlnAlaAsnGlyValSerHisAsnIleThrPheGluSerPro100105110CCTCCACCAATTGAATGGCATATCAGCAAACCAGGACAGTTTGAAACA384ProProProIleGluTrpHisIleSerLysProGlyGlnPheGluThr115120125TTTGATCTCATGACACTTCATCCAATAGAAATTGCACGTCAGCTGACA432PheAspLeuMetThrLeuHisProIleGluIleAlaArgGlnLeuThr130135140CTTTTGGAGTCTGATCTTTACAGGAAAGTTCAACCGTCTGAACTTGTA480LeuLeuGluSerAspLeuTyrArgLysValGlnProSerGluLeuVal145150155160GGGAGTGTGTGGACCAAAGAAGATAAAGAAATAAATTCTCCAAATTTA528GlySerValTrpThrLysGluAspLysGluIleAsnSerProAsnLeu165170175TTAAAAATGATTCGCCATACCACAAATCTCACCCTCTGGTTTGAAAAA576LeuLysMetIleArgHisThrThrAsnLeuThrLeuTrpPheGluLys180185190TGCATTGTGGAAGCAGAAAATTTTGAAGAACGGGTGGCAGTACTAAGT624CysIleValGluAlaGluAsnPheGluGluArgValAlaValLeuSer195200205AGAATTATAGAAATTCTGCAAGTTTTTCGAGATTTGAATAATTTCAAT672ArgIleIleGluIleLeuGlnValPheArgAspLeuAsnAsnPheAsn210215220GGCGTATTGGAGATAGTCAGTGCAGTAAATTCAGTGTCAGTATACAGA720GlyValLeuGluIleValSerAlaValAsnSerValSerValTyrArg225230235240CTAGACCATACCTTTGAGGCACTGCAGGAAAGGAAAAGGAAAATTTTG768LeuAspHisThrPheGluAlaLeuGlnGluArgLysArgLysIleLeu245250255GACGAAGCTGTGGAATTAAGTCAAGATCACTTTAAAAAATACCTAGTA816AspGluAlaValGluLeuSerGlnAspHisPheLysLysTyrLeuVal260265270AAACTTAAGTCAATCAATCCACCTTGTGTGCCTTTTTTTGGAATATAT864LysLeuLysSerIleAsnProProCysValProPhePheGlyIleTyr275280285TTAACAAATATTCTGAAGACCGAAGAAGGGAATAATGATTTTTTAAAA912LeuThrAsnIleLeuLysThrGluGluGlyAsnAsnAspPheLeuLys290295300AAGAAAGGGAAAGATTTAATCAATTTCAGTAAGAGGAGGAAAGTAGCT960LysLysGlyLysAspLeuIleAsnPheSerLysArgArgLysValAla305310315320GAAATTACTGGAGAAATTCAGCAGTATCAGAATCAGCCGTACTGCCTA1008GluIleThrGlyGluIleGlnGlnTyrGlnAsnGlnProTyrCysLeu325330335CGGATAGAACCAGATATGAGGAGATTCTTTGAAAACCTTAACCCCATG1056ArgIleGluProAspMetArgArgPhePheGluAsnLeuAsnProMet340345350GGAAGTGCATGTGAAAAAGAGTTTACAGATTATTTGTTCAACAAAAGT1104GlySerAlaCysGluLysGluPheThrAspTyrLeuPheAsnLysSer355360365TTAGAAATAGAACCACGAAATTGTAAACAGCCACCACGATTTCCACGA1152LeuGluIleGluProArgAsnCysLysGlnProProArgPheProArg370375380AAAAGTACATTTGAACTAAAAGAACCAGGAATACGACCAAATGCAGGA1200LysSerThrPheGluLeuLysGluProGlyIleArgProAsnAlaGly385390395400CGACATGGAGAAACAAGTGGAACAAGAGGACATCCAACACCTCTAGAA1248ArgHisGlyGluThrSerGlyThrArgGlyHisProThrProLeuGlu405410415AGAGAACCATATAAAATAGAATTTGAAAGAATAGCTGAAACAGAACTA1296ArgGluProTyrLysIleGluPheGluArgIleAlaGluThrGluLeu420425430GAAAGTACAGTAAGTGCACCAACAAGTCCAAATACTCCCTCAACACCA1344GluSerThrValSerAlaProThrSerProAsnThrProSerThrPro435440445CCAGTTTCAGCATCATCAGATCACTCAGTATTTTTAGATGTAGATCTA1392ProValSerAlaSerSerAspHisSerValPheLeuAspValAspLeu450455460AACAGTAGTCACGGATCAAACACAATCTTTGCACCTGTGCTACTACCA1440AsnSerSerHisGlySerAsnThrIlePheAlaProValLeuLeuPro465470475480AAGTCCAAGTCTTTCTTTAGTTCATGTGGAAGTTTACATAAACTAAGT1488LysSerLysSerPhePheSerSerCysGlySerLeuHisLysLeuSer485490495GAAGAGCCCCTGATTCCTCCTCCTCTTCCTCCTCGAAAAAAGTTTGAT1536GluGluProLeuIleProProProLeuProProArgLysLysPheAsp500505510CATGATGGCTCAAATTCCAAGGGAAATATGAAATCTGATGATGATCCT1584HisAspGlySerAsnSerLysGlyAsnMetLysSerAspAspAspPro515520525CCTGCTATTCCACCGAGACAGCCTCCTCCTCCAAAGGTAAAACCCAGA1632ProAlaIleProProArgGlnProProProProLysValLysProArg530535540GTTCCTGTTCCTACTGGTGCATTTGATGGGCCTCTGCATAGTCCACCT1680ValProValProThrGlyAlaPheAspGlyProLeuHisSerProPro545550555560CCGCCACCACCAAGAGATCCTCTTCCTGATACCCCTCCACCAGTTCCC1728ProProProProArgAspProLeuProAspThrProProProValPro565570575CTTCGGCCTCCAGAACACTTTATAAACTGTCCATTTAATCTTCAGCCA1776LeuArgProProGluHisPheIleAsnCysProPheAsnLeuGlnPro580585590CCTCCACTGGGGCATCTTCACAGAGATTCAGACTGGCTCAGAGACATT1824ProProLeuGlyHisLeuHisArgAspSerAspTrpLeuArgAspIle595600605AGTACGTGTCCAAATTCGCCAAGCACTCCTCCTAGCACACCCTCTCCA1872SerThrCysProAsnSerProSerThrProProSerThrProSerPro610615620AGGGTACCGCGTCGATGCTATGTGCTCAGTTCTAGTCAGAATAATCTT1920ArgValProArgArgCysTyrValLeuSerSerSerGlnAsnAsnLeu625630635640GCTCATCCTCCAGCTCCCCCTGTTCCACCAAGGGAG1956AlaHisProProAlaProProValProProArgGlu645650(2) INFORMATION FOR SEQ ID NO: 8:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 652 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:ArgPheGluIleProGluProGluProThrGluAlaAspLysLeuAla151015LeuGluLysGlyGluGlnProIleSerAlaAspLeuLysArgPheArg202530LysGluTyrIleGlnProValGlnLeuArgValLeuAsnValGlnArg354045HisTrpValGluHisHisProHisAspPheGluArgAspLeuGluLeu505560LeuGluArgLeuGluSerPheThrSerSerAlaHisArgAlaLysAla65707580MetLysLysTrpValGluSerIleAlaLysThrIleArgArgLysLys859095GlnAlaGlnAlaAsnGlyValSerHisAsnIleThrPheGluSerPro100105110ProProProIleGluTrpHisIleSerLysProGlyGlnPheGluThr115120125PheAspLeuMetThrLeuHisProIleGluIleAlaArgGlnLeuThr130135140LeuLeuGluSerAspLeuTyrArgLysValGlnProSerGluLeuVal145150155160GlySerValTrpThrLysGluAspLysGluIleAsnSerProAsnLeu165170175LeuLysMetIleArgHisThrThrAsnLeuThrLeuTrpPheGluLys180185190CysIleValGluAlaGluAsnPheGluGluArgValAlaValLeuSer195200205ArgIleIleGluIleLeuGlnValPheArgAspLeuAsnAsnPheAsn210215220GlyValLeuGluIleValSerAlaValAsnSerValSerValTyrArg225230235240LeuAspHisThrPheGluAlaLeuGlnGluArgLysArgLysIleLeu245250255AspGluAlaValGluLeuSerGlnAspHisPheLysLysTyrLeuVal260265270LysLeuLysSerIleAsnProProCysValProPhePheGlyIleTyr275280285LeuThrAsnIleLeuLysThrGluGluGlyAsnAsnAspPheLeuLys290295300LysLysGlyLysAspLeuIleAsnPheSerLysArgArgLysValAla305310315320GluIleThrGlyGluIleGlnGlnTyrGlnAsnGlnProTyrCysLeu325330335ArgIleGluProAspMetArgArgPhePheGluAsnLeuAsnProMet340345350GlySerAlaCysGluLysGluPheThrAspTyrLeuPheAsnLysSer355360365LeuGluIleGluProArgAsnCysLysGlnProProArgPheProArg370375380LysSerThrPheGluLeuLysGluProGlyIleArgProAsnAlaGly385390395400ArgHisGlyGluThrSerGlyThrArgGlyHisProThrProLeuGlu405410415ArgGluProTyrLysIleGluPheGluArgIleAlaGluThrGluLeu420425430GluSerThrValSerAlaProThrSerProAsnThrProSerThrPro435440445ProValSerAlaSerSerAspHisSerValPheLeuAspValAspLeu450455460AsnSerSerHisGlySerAsnThrIlePheAlaProValLeuLeuPro465470475480LysSerLysSerPhePheSerSerCysGlySerLeuHisLysLeuSer485490495GluGluProLeuIleProProProLeuProProArgLysLysPheAsp500505510HisAspGlySerAsnSerLysGlyAsnMetLysSerAspAspAspPro515520525ProAlaIleProProArgGlnProProProProLysValLysProArg530535540ValProValProThrGlyAlaPheAspGlyProLeuHisSerProPro545550555560ProProProProArgAspProLeuProAspThrProProProValPro565570575LeuArgProProGluHisPheIleAsnCysProPheAsnLeuGlnPro580585590ProProLeuGlyHisLeuHisArgAspSerAspTrpLeuArgAspIle595600605SerThrCysProAsnSerProSerThrProProSerThrProSerPro610615620ArgValProArgArgCysTyrValLeuSerSerSerGlnAsnAsnLeu625630635640AlaHisProProAlaProProValProProArgGlu645650(2) INFORMATION FOR SEQ ID NO:9:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 41 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 15(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 18(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 21(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 27(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 30(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 33(D) OTHER INFORMATION: /mod.sub.-- base=i(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:GATATCGAATTCCGNGTNYTNAAYGTNYTNMGNCAYTGGGT41(2) INFORMATION FOR SEQ ID NO:10:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 34 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: single(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 15(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 21(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 30(D) OTHER INFORMATION: /mod.sub.-- base=i(ix) FEATURE:(A) NAME/KEY: modified.sub.-- base(B) LOCATION: 33(D) OTHER INFORMATION: /mod.sub.-- base=i(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:AAGCTTGAATTCCKNMKYTTNSWRAARTTNAKNA34(2) INFORMATION FOR SEQ ID NO: 11:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 33 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: simple(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(iii) HYPOTHETICAL: NO(iii) ANTI-SENSE: NO(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:ATCHGTNAGGTACATNCCHAGGTAKGGNACACA33(2) INFORMATION FOR SEQ ID NO: 12:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 27 bases(B) TYPE: nucleic acid(C) STRANDEDNESS: simple(D) TOPOLOGY: linear(ii) MOLECULE TYPE: other nucleic acid(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:GCNATHTTYCGNCTNAARAARACNTGG27__________________________________________________________________________

Peptides having GDP exchange factor activity, nucleic acid sequences coding for these peptides, preparation and use

Information

Patent Number

Date Filed

Date Issued

Inventors

Original Assignees

Examiners

Agents

CPC

US Classifications

Field of Search

US

International Classifications

Abstract

Description

Claims

Priority Claims (1)

PCT Information

Non-Patent Literature Citations (4)

Entry
Bonfini, L. et al., Science, 255: 603-606, 1992 (Jan.).
Shou et al., Nature, 358: 351-4, 1992 (Jul.).
Martegani, E, et al., EMBO J., 11(6): 2151-7, 1992 (Jun.).
Wei, W. et al., PNAS, 89: 7100-7104, Aug. 1992.