PI 3-kinase polypeptides

Information

  • Patent Grant
  • 5948664
  • Patent Number
    5,948,664
  • Date Filed
    Monday, February 12, 1996
    30 years ago
  • Date Issued
    Tuesday, September 7, 1999
    27 years ago
Abstract
The present invention generally provides polypeptides that are related to and/or derived from the family of PI3-kinases. These polypeptides are generally involved in cell signaling cascades which control, e.g., cell cycle progression and intracellular protein sorting. The family of PI3-kinases from which the polypeptides of the invention are derived are generally characterized by their structure as well as their unique substrate specificity.
Description

BACKGROUND OF THE INVENTION
Phosphatidyl Inositol kinases ("PtdIns-kinases") regulate diverse cellular processes including cell signaling, cell cycle progression, and intracellular protein sorting. See, e.g., Herman et al., Nature 358:157-159 (1992), Kapellar et al., Bioessays 16:565-576 (1994), Stephens et al., Nature 351:33-39 (1991) and Kunz et al., Cell 73:585-596 (1993). PtdIns-kinases phosphorylate phosphoinositol lipids at distinct positions on the inositol ring. For example, PtdIns 3-kinases, or "PI 3-kinases", phosphorylate the D3 hydroxyl group on the inositol ring, while PtdIns 4-kinases phosphorylate the D4 hydroxyl group. All of the PtdIns kinases that have been identified to date have been found to contain a core region of sequence similarity, which, without being bound to any particular theory, is believed to be the catalytic domain. This domain, termed the "PtdIns kinase domain", shares limited sequence similarity with the catalytic domain of protein kinases and mutation of conserved residues results in loss of PtdIns kinase activity. See, Carter et al., J. Biochem. 301:415-420 (1994), Dhand et al., EMBO J. 13:522-533 (1994) and Schu et al., Science 260:88-91 (1993).
A number of receptor tyrosine kinases, src-like tyrosine kinases and viral oncoproteins bind and activate one particular cellular PtdIns 3-kinase. Studies of mutants that abrogate the binding of this PtdIns 3-kinase to these molecules indicate that PtdIns 3-kinases mediate mitogenic and cell motility responses of cells to growth factors and oncoproteins. Purification of the polypeptide subunits of this PtdIns 3-kinase reveal that the enzyme exists as a heterodimeric complex composed of a 110 KDa and an 85 KDa subunit. Carpenter et al., J. Biol. Chem. 265:19704-19711 (1990), Fry et al., Biochem. J. 288:383-393 (1992), Morgan et al., Eur. J. Biochem. 191:761-767 (1990), Shibasaki et al., J. Biol. Chem. 266:8108-8114 (1991). The 110 KDa subunit contains a C-terminal PtdIns kinase domain, as well as a small domain at its N-terminus that is sufficient for binding to the 85-Kd subunit (Hiles et al., Cell 70:419-429 (1992), Holt et al., Mol. Cell. Biol. 14:42-49 (1994), Klippel et al., Mol. Cell. Biol. 14:2675-2685 (1994). The 85 KDa subunit serves as an adapter and binds activated growth factor receptors and other tyrosine phosphorylated molecules through two Src homology 2 (SH2) domains. Hu et al., Mol. Cell. Biol. 12:981-990 (1992), McGlade et al., Mol. Cell. Biol. 12:991-997(1992) Reedijk et al., EMBO J. 11:1365-1372 (1992), Yoakim, J. Virol. 66:5485-5491 (1992), Yonezawa et al., J. Biol. Chem. 267:25958-25966 (1992). The association of the enzyme with activated growth factor receptors is believed to localize it to the plasma membrane where its phospholipid substrates reside.
The p110/p85 complex phosphorylates distinct lipids in vitro and in vivo. In vitro, the p110/p85 complex can phosphorylate phosphatidylinositol (PtdIns), phosphatidylinositol 4-phosphate (PtdIns4P) and phophatidylinositol 4,5-bisphosphate (PtdIns(4,5)P.sub.2) on the D3 hydroxyl group of the inositol ring, producing phosphatidylinositol 3-phosphate (PtdIns3P), phosphatidylinositol 3,4-bisphosphate (PtdIns(3,4)P.sub.2) and phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P.sub.3). Kapellar et al., Bioessays 16:565-576 (1994), Stephens et al., Biochim. Biophys. Acta 1179:27-75 (1993). Activation of the p110/p85 complex in cells results in elevated levels of PtdIns(3,4)P.sub.2 and PtdIns(3,4,5)P.sub.3, but not PtdIns3P. Auger et al., Cell 57:167-175 (1989), Stephens et al., Nature 351:33-39 (1991), Traynor-Kaplan et al., Nature 334:353-356 (1988), Traynor-Kaplan J. Biol. Chem. 264:15668-15673 (1989). Studies of the pathways in cells that generate these lipids suggest that PtdIns(3,4)P.sub.2 is formed by the dephosphorylation of PtdIns(3,4,5)P.sub.3 by a PtdIns 5-phosphatase rather than the phosphorylation of PtdIns4P by a PtdIns 3-kinase. Carter et al., Biochem. J. 301:415-420 (1994), Hawkins et al., Nature 358:157-159 (1992).
The stimulation of cells with growth factors or tumor antigens results in a rapid increase in the cellular concentration of PtdIns(3,4)P.sub.2 and PtdIns(3,4,5)P.sub.3 from a low basal level, indicating that these molecules represent novel second messengers in growth factor activated signaling cascades.
Additionally, several protein kinases have recently been described which appear to represent downstream effectors of the lipid products of PtdIns 3-kinases. The Akt protein kinase can be activated in vivo by treating cells with the mitogen PDGF. The binding of PtdIns 3-kinase to the PDGF receptor is essential for Akt activation (Franke et al., Cell 81:727-736 (1995)). Akt can be directly activated in vitro with PtdIns3P. In addition to Akt, particular isoforms of protein kinase C can be activated by the lipid products of PtdIns 3-kinases. Protein kinase C isoforms .delta., .epsilon., .eta., and .zeta. can be activated in vitro with PtdIns(3,4)P.sub.2 or PtdIns(3,4,5)P.sub.3, but not with PtdIns3P. Nakanishi et al., J. Biol. Chem. 268:13-16 (1993), Toker et al., J. Biol. Chem 269:32358-32367 (1994).
PtdIns 3-kinases have also been implicated in the regulation of intracellular protein sorting. For example, the Vps34 PtdIns 3-kinase was initially identified from a Saccharomyces cerevisiae mutant that was defective in the trafficking of proteins to the lysosome-like vacuole. Herman et al., Mol. Cell. Biol. 10:6742-6754 (1990). Vps34 can phosphorylate PtdIns, but not PtdIns4P or PtdIns(4,5)P.sub.2 in vitro, which is consistent with absence of detectable PtdIns(3,4,5)P.sub.3 in yeast. Schu et al., Science 260:88-91 (1993). Vps34 is the major PtdIns 3-kinase in yeast. VPS34 mutant strains contain no detectable PtdIns3P.
Because disregulation of the cellular processes, such as signaling processes involved in cell cycle progression and intracellular protein sorting, can have disastrous effects, it is important to understand and gain control over these processes. This requires identifying the participants in the signaling events involved in these processes and elucidating their mechanism of function. The identification of these participants is important for a wide range of diagnostic, therapeutic and screening applications. In particular, by knowing the structure and function of a particular participant in a signaling cascade, one can design compounds which affect that cascade, to either activate an otherwise inactive pathway, or inactivate an overly active pathway. Similarly, having identified a particular participant in a signaling cascade, one can also identify situations where that cascade is defective, resulting in a particular pathological state.
PI3-kinases have been identified as playing critical roles in several distinct cellular signaling processes. As a result, it is of particular interest to identify these kinases, their substrates, products and effectors. Once identified, these various elements can be used for a variety of therapeutic, diagnostic and screening applications. For example, these components may be used as therapeutic agents for treating disorders resulting from anomalies in signaling cascades. Alternatively, these components may be used alone or in combination, as model systems for screening compounds that affect signaling cascades. Finally, identification of these components leads to an understanding of the cell signaling processes, anomalies in these processes which are responsible for certain disorders, and by implication, diagnostic systems for identifying these disorders. The present invention meets these and many other needs.
SUMMARY OF THE INVENTION
The present invention generally provides novel PI3-kinase polypeptides, nucleic acids encoding these polypeptides, antibodies that are specifically immunoreactive with these polypeptides and methods of using these polypeptides in screening and therapeutic applications.
In one aspect, the present invention provides substantially pure PI3-kinase polypeptides or biologically active fragments thereof. These polypeptides are generally characterized by their ability to phosphorylate the D3 hydroxyl of an inositol ring in PtdIns and PtdIns4P but not PtdIns(4,5)P.sub.2. The polypeptides may further include a C2 domain within their structure. In a more specific aspect, the polypeptides of the invention have an amino acid sequence that is substantially homologous to the sequence of cpk and cpk-m, as shown in FIG. 1, (SEQ ID NOS:12-13) or biologically active fragments thereof.
The polypeptides may, in some aspects, be characterized by their ability to block the interaction between a cpk or cpk-m polypeptide and an antibody that is specifically immunoreactive with cpk or cpk-m. Similarly, the polypeptides may be characterized by their ability to block the interaction between a cpk and/or cpk-m polypeptide and its substrate, such as PtdIns or PtdIns4P.
In another aspect, the present invention provides nucleic acids that encode the polypeptides of the invention. In particular, the nucleic acids of the present invention will typically encode polypeptides which possess the above-described substrate specificity, or biologically active fragments. In a more specific aspect, the nucleic acids of the present invention will have a nucleic acid sequence that is substantially homologous to the nucleic acid sequence for cpk or cpk-m, as shown in FIG. 9 (SEQ ID NOS:27-28). In a related aspect, the present invention provides nucleic acid probes that have at least 15 contiguous nucleotides from the cpk or cpk-m nucleic acid sequences. The present invention also provides expression vectors containing the nucleic acids of the invention, and recombinant host cells that are capable of expressing these nucleic acids.
In a further aspect, the present invention provides methods of using the polypeptides of the present invention. In particular, the present invention provides a method of screening test compounds to identify agonists or antagonists of PI3-kinases and the signalling pathways they control. The methods comprise incubating a mixture of PtdIns or PtdIns4P and a polypeptide selected from the group consisting of cpk, cpk-m or biologically active fragments thereof, in the presence and absence of the test compound. The mixture is assayed to determine the amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the presence and absence of the test compound. The amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the presence of the test compound is compared to the amount of PtdIns3P or PtdIns(3,4)P.sub.2 produced in the absence of the test compound. An increase or decrease in the amount of PtdIns3P or PtdIns(3,4)P.sub.2 in the presence of the test compound is indicative that the test compound is an agonist or antagonist of a PI3-kinase activity, respectively.
The present invention also provides therapeutic methods for treating a symptom of a disorder caused by the dysregulation of a growth factor activation signaling cascade. These methods generally comprise administering to a patient suffering from the disorder, a therapeutically effective amount of a polypeptide or blocking antibody of the present invention.





BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1A and 1B, show a comparison of the amino acid sequences of the Drosophila and murine cpk proteins (SEQ ID NOS:12-13). Both conserved and identical residues are shaded. The following groups of amino acids were considered to be conserved: A, V, L, I, M; D, E; K, R; N, Q; F, Y; S, T. The amino acid numbers are indicated to the right of the sequence.
FIGS. 2A, 2B, and 2C show the domain structure of the cpk proteins. FIG. 2A shows a schematic ribbon diagram comparing the domain structures of cpk with p110, Tor2, Pik1 and Vps34 PtdIns kinases. The PtdIns kinase domains are depicted in black, a region in which cpk and p110 are related is depicted with stripes, and the C2 domain and p85 binding domains are indicated. FIG. 2B shows a comparison of the amino acid sequence of the C2 domains in Drosophila and murine cpk (SEQ ID NO:14-18) with the C2 domains in rabphilin ("rab") (SEQ ID NO:16), synaptotagmin II ("syt II")(SEQ ID NO:17), and protein kinase C ("pkc") (SEQ ID NO:18). Both conserved and identical residues are shaded. FIG. 2C shows a comparison of the amino acid sequences of a part of the catalytic domains of cpk (SEQ ID NOS:19) and cpk-m (SEQ ID NO:20) with the catalytic domains of p110.alpha. (SEQ ID NO:12), p110.beta., (SEQ ID NO:22) p110.gamma. (SEQ ID NO:23), Vps34 (SEQ ID NO:24), Pik1 (SEQ ID NO:25) and Tor2 (SEQ ID NO:26). Only identical amino acids are indicated, i.e., shaded/boxed. The amino acid numbers are indicated to the right of the sequence.
FIGS. 3A and 3B illustrate the detection of cpk protein in lysates prepared from Drosophila embryos. FIG. 3A is an immunoblot of lysates (30 .mu.g) prepared from 0-12 hr Drosophila embryos probed with .alpha.-cpk polyclonal serum. FIG. 3B illustrates the precipitation of cpk protein from embryo lysates. Lysates were precipitated with .alpha.-cpk preimmune (lane 1), .alpha.-cpk immune (lane 2), .alpha.-P6 preimmune (lane 3), and .alpha.-P6 immune sera (lane 4). Preimmune and immune sera are indicated by P and I, respectively.
FIG. 4 shows an immunoblot of cpk protein immunoprecipitated from Drosophila lysates and probed with .alpha.-phosphotyrosine. Drosophila lysates were precipitated using .alpha.-cpk preimmune (lane 1), .alpha.-cpk immune (lane 2), .alpha.-P6 preimmune (lane 3) or .alpha.-P6 immune sera (lane 4).
FIGS. 5A and 5B show the precipitation of proteins from Drosophila lysates using .alpha.-cpk serum and .alpha.-P6 serum. FIG. 5A is an immunoblot of lysates prepared from 0-12 hr Drosophila embryos precipitated with .alpha.-cpk preimmune serum (lane 1), .alpha.-cpk immune serum (lane 2), .alpha.-P6 preimmune serum (lane 4), or .alpha.-p6 immune serum (lane 5). Precipitates were divided in half and half was assayed for PI 3-kinase activity by thin layer chromatography (left panel). Lysates were also precipitated with .alpha.-cpk serum which had been preincubated with cpk protein (lane 3) or .alpha.-P6 serum which had been preincubated with the P6 peptide (lane 6). FIG. 5B is a blot and TLC (left) showing wild-type (lane 1) and kinase deficient (lane 2) cpk proteins which had been tagged with an HA epitope were expressed in COS-7 cells. P and I indicate preimmune and immune sera, respectively. I.sup.c represents either .alpha.-cpk or .alpha.-P6 sera which had been preincubated for 10 min. with 0.5 .mu.g of competitor (cpk and P6, respectively).
FIGS. 6A and 6B show the results of thin layer chromatography of the products of cpk protein activity on PtdIns substrate. The cpk was precipitated from Drosophila (FIG. 6A) and COS-7 cells (FIG. 6B) using .alpha.-cpk or .alpha.-HA serum, respectively. The cpk reaction products (lane 3) migrated at approximately the same position as a �.gamma..sup.32 P!-PtdIns3P standard (lane 2), but not a �.gamma..sup.32 P!-PtdIns4P standard (lane 1). Cpk reaction products were also mixed with either �.gamma..sup.32 P!-PtdIns3P (lane 5) or �.gamma..sup.32 P!-PtdIns4P (lane 4) standards and the mixtures were separated. The cpk reaction products comigrated with �.gamma..sup.32 P!-PtdIns3P (lane 5). The cpk reaction products are designated by cpk-p.
FIG. 7 is a thin layer chromatograph showing phosphorylation of either PtdIns (lane 2), PtdIns4P (lane 4) or PtdIns(4,5)P.sub.2 (lane 6) using cpk protein precipitated from Drosophila embryo lysates. A consitutively active p110 protein (p110*) capable of phosphorylating PtdIns (lane 1), PtdIns4P (lane 3) and PtdIns(4,5)P.sub.2 (lane 5) substrates was used as a control. PIP, PIP.sub.2 and PIP.sub.3 refer to phosphatidylinositol phosphate, phosphatidylinositol bisphosphate, and phosphatidylinositol trisphosphate, respectively.
FIGS. 8A, 8B, and 8C show the coprecipitation of two protein components with cpk, from Drosophila lysates. FIG. 8A shows an immunoblot of lysates (30 .mu.g) prepared from 0-12 hr Drosophila embryos and probed with .alpha.-cpk.m1 serum. FIG. 8B shows the visualization of 90 KDa and 190 KDa proteins which were coprecipitated with cpk. Drosophila lysates were precipitated with Protein A beads alone (1) or beads upon which .alpha.-cpk.m1 had previously been immobilized (2). FIG. 8C shows a blot probed with .alpha.-phosphotyrosine showing that both cpk and the 190 KDa protein may be tyrosine phosphorylated.
FIG. 9 shows the nucleic acid sequence and deduced amino acid sequence of cpk (SEQ ID NOS:27-28).
FIG. 10 shows the nucleic acid sequence and deduced amino acid sequence of cpk-m (SEQ ID NO:29-32).





DESCRIPTION OF THE PREFERRED EMBODIMENT
I. Abbreviations
The various embodiments of the present invention may be described with reference to certain abbreviations. Several of the most commonly used abbreviations are as follows:
______________________________________PtdIns PhosphatidylInositolPtdIns-4P PhosphatidylInositol 4-phosphatePtdIns (4, 5) P.sub.2 PhosphatidylInositol 4,5-bisphosphatePtdIns-Kinase PhosphatidylInositol kinase (also referred to as PI-kinase)PI3-kinase PhosphatidylInositol 3-kinase______________________________________
II. General Description
The present invention generally provides polypeptides that are related to and/or derived from the family of PI3-kinases. These polypeptides are generally involved in cell signaling cascades which control various cellular processes including cell cycle progression and intracellular protein sorting. The family of PI3-kinases from which the polypeptides of the invention are derived are generally characterized by their structure as well as their unique substrate specificity.
The present invention also provides nucleic acids encoding the above-described PI3-kinase polypeptides, antibodies that are capable of interacting with these polypeptides and methods of utilizing these polypeptides in screening systems for identification of agonists or antagonists of cell signaling pathways, generally, and PtdIns phosphorylation, specifically.
III. Proteins and Polypeptides of the Invention
In a first aspect, the present invention provides isolated, or substantially pure polypeptides that are derived from the family of PI3-kinases. The terms "substantially pure" or "isolated", when referring to proteins and polypeptides, denote those polypeptides that are separated from proteins or other contaminants with which they are naturally associated. A protein or polypeptide is considered substantially pure when that protein makes up greater than about 50% of the total protein content of the composition containing that protein, and typically, greater than about 60% of the total protein content. More typically, a substantially pure or isolated protein or polypeptide will make up from about 75 to about 90% of the total protein. Preferably, the protein will make up greater than about 90%, and more preferably, greater than about 95% of the total protein in the composition.
The polypeptides of the present invention are typically derived from PI3-kinases that include a C2 domain within their structure. A C2 domain is generally characterized by its structure, e.g., its homology to similar domains in other proteins, is generally believed to mediate binding to phospholipids or other proteins. The PI3-kinases from which the polypeptides of the present invention are derived may be further characterized by their substrate specificity. In particular, the PI3-kinases from which the polypeptides of the present invention are derived have PI3-kinase activity and are capable of phosphorylating the D3 hydroxyl group on the inositol ring of PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2.
The polypeptides may be further characterized by their relation to a PtdIns 3-kinase isolated from Drosophila melanogaster. This Drosophila PI3-kinase contains a C2 domain and is therefore generally referred to herein as "cpk" for C2 containing PtdIns kinase. The cpk gene represents the first PI3-kinase identified from Drosophila. Additional preferred polypeptides are characterized by their relation to a similar PI3-kinase identified from murine sources, termed cpk-m, which contains a C2 domain and shares extensive sequence identity with cpk. The cpk and cpk-m polypeptides represent a new class of PtdIns 3-kinases. The deduced amino acid sequences for the cpk and cpk-m kinases are shown in FIG. 1.
Analysis of the sequence of the Drosophila and murine cpk proteins reveals a similarity to the p110 family of PtdIns 3-kinases. The cpk genes are 31% identical and 43% similar to a large central region of p110. This region includes both the PtdIns kinase domain (FIG. 2A, black box) and an adjacent region in which p110 and cpk can be distinguished from other PtdIns kinases (striped box). The cpk proteins are also similar to p110 family of PtdIns kinases in the most conserved portion of the catalytic domain (FIG. 2C) (SEQ ID NO:19-26). In this region, the cpk proteins share approximately 45-50% identity with either p110.alpha., p110.beta. or p110.gamma.. In contrast, the cpk proteins share 35%, 29% and 26% identity in this region with the Vps34, Pik1, and Tor2 PtdIns kinases, respectively.
The cpk proteins differ from p110 at both their N- and C-termini. The N-termini of the cpk and cpk-m proteins do not contain any recognizable domain, i.e., the N-terminal domain of p110 that is responsible for binding to the p85 adapter molecule (Holt et al., Mol. Cell. Biol. 14:42-49 (1994), Klippel et al., Mol. Cell Biol. 14:2675-2685 (1994)). The C-termini of cpk and cpk-m proteins contain a "C2" domain (FIG. 2C). These C2 domains are found in a diverse group of proteins and are believed to mediate binding to phospholipids or other proteins. The C2 domains in the cpk and cpk-m sequences are 52% similar to each other, and approximately 38% similar to C2 domains present in protein kinase C, synaptotagmin and rabphilin (FIG. 2B (SEQ ID NO:14-18)).
.alpha.-cpk immune serum recognizes a polypeptide from Drosophila lysates which migrates at approximately 210 KDa, the predicted molecular weight of the cpk protein (FIG. 3). This 210 KDa polypeptide is not recognized by pre-immune serum. Further studies using antibodies raised against fragments of cpk have confirmed the identity of the 210 kDa polypeptide as cpk.
Preferred polypeptides of the present invention will be derived from PI3-kinases having amino acid sequences that are substantially homologous to the amino acid sequences shown in FIG. 1 or biologically active fragments thereof.
The term "biologically active fragment" as used herein, refers to portions of the proteins or polypeptides, which portions possess a particular biological activity. For example, such biological activity may include the ability to bind a particular protein, substrate or ligand, to have antibodies generated against it, to block or otherwise inhibit an interaction between two proteins, between an enzyme and its substrate, between an epitope and an antibody, or may include a particular catalytic activity. With regard to the polypeptides of the present invention, particularly preferred polypeptides or biologically active fragments include, e.g., polypeptides that possess one or more of the biological activities described above, such as the ability to interact with the PI3-kinase substrates described above, e.g., PtdIns and PtdIns4P, or the ability to affect the phosphorylation of those substrates. Fragments possessing this catalytic activity are also termed "catalytically active fragments." Fragments that are specifically recognized and bound by antibodies raised against the polypeptides of the invention are also included in the definition of biologically active fragments. Such fragments are also referred to herein as "immunologically active fragments."
Biologically active fragments of the polypeptides of the invention will generally be useful where it is desired to analyze a single particular biological activity of the polypeptide. For example, therapeutic applications will generally target a single biological activity of the PI3-kinase signaling operation, e.g., substrate binding or substrate phosphorylation, and as such, peptides having fewer than all of these activities will be desired, as discussed in greater detail, below. Alternatively, such fragments may be useful where use of a full length protein is unsuitable for the particular application.
Generally, biologically active fragments of the above described proteins may include any subsequence of a full length PI 3-kinase protein of the invention. Typically, however, such fragments will be from about 5 to about 1500 amino acids in length. More typically, these peptides will be from about 10 to about 500 amino acids in length, more typically about 10 to about 250 amino acids in length, and preferably from about 15 to about 200 amino acids in length. Generally, the length of the fragment may depend, in part, upon the application for which the particular peptide is to be used. For example, for raising antibodies, the peptides may be of a shorter length, e.g., from about 5 to about 50 amino acids in length, whereas for binding or binding inhibition applications, the peptides will generally have a greater length, e.g., from about 10 to about 1000 amino acids in length, preferably, from about 15 to about 500 amino acids in length, and more preferably, from about 15 to about 200 amino acids in length.
The terms "substantially homologous" when referring to polypeptides, refer comparatively to two amino acid sequences which, when optimally aligned, are at least about 75% homologous, preferably at least about 85% homologous more preferably at least about 90% homologous, and still more preferably at least about 95% homologous. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. (U.S.A.) 85:2444, or by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.).
As noted above, the polypeptides of the invention may also be characterized by their ability to block the interaction between two proteins or a protein and its substrate. In particular, included in the polypeptides of the present invention are PI3-kinase derived peptides that are capable of blocking or otherwise inhibiting the interaction between cpk and/or cpk-m and their substrates, e.g., PtdIns and PtdIns4P. Examples of such polypeptides include fragments of cpk or cpk-m, which encompass the substrate binding regions of cpk and cpk-m. One example of such a fragment is the PI3-kinase domain of the cpk protein, bordered by amino acids 863-1587 of the cpk protein, and homologous regions of the cpk-m protein, as well as larger portions of the cpk and cpk-m proteins.
Also as referenced above, the polypeptides of the present invention may also be characterized by their ability to bind antibodies raised against proteins or polypeptides having the amino acid sequences of cpk and cpk-m, as shown in FIG. 1 (SEQ ID NOS:12-13), or fragments thereof. These antibodies generally recognize polypeptides that are homologous to the cpk or cpk-m proteins or their immunologically active fragments. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or domain. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity. Antibodies to the polypeptides of the present invention are discussed in greater detail, below.
The polypeptides of the present invention may generally be prepared using recombinant or synthetic methods well known in the art. Recombinant techniques are generally described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, (2nd ed.) Vols. 1-3, Cold Spring Harbor Laboratory, (1989). Techniques for the synthesis of polypeptides are generally described in Merrifield, J. Amer. Chem. Soc. 85:2149-2456 (1963), Atherton, et al., Solid Phase Peptide Synthesis: A Practical Approach, IRL Press (1989), and Merrifield, Science 232:341-347 (1986). In preferred aspects, the polypeptides of the present invention may be expressed by a suitable host cell that has been transfected with a nucleic acid of the invention, as described in greater detail below.
Biologically active fragments of the above described polypeptides may generally be identified and prepared using methods well known in the art. For example, selective proteolytic digestion, recombinant deletional methods or de novo peptide synthesis methods may be employed to identify portions of the above described peptides that possess the desired biological activity, e.g., substrate binding, catalytic activity and the like. See, e.g., Sambrook, et al.
Isolation and purification of the polypeptides of the present invention can be carried out by methods that are generally well known in the art. For example, the polypeptides may be purified using readily available chromatographic methods, e.g., ion exchange, hydrophobic interaction, HPLC or affinity chromatography, to achieve the desired purity. Affinity chromatography may be particularly attractive in allowing an individual to take advantage of the specific biological activity of the desired peptide, e.g., ligand binding, presence of antigenic determinants or the like. For example, antibodies raised against the cpk protein or immunologically active fragments may be coupled to a suitable solid support and contacted with a mixture of proteins containing the polypeptides of the invention under conditions conducive to the association of these polypeptides with the antibody. Once bound to the immobilized antibody, the solid support is washed to remove unbound material and/or nonspecifically bound proteins. The desired polypeptides may then be eluted from the solid support in substantially pure form by, e.g., a change in salt, pH or buffer concentration. Suitable solid supports for affinity purifications are well known in the art and are generally commercially available from, e.g., Pharmacia, Inc., or Sigma Chemical Co. Examples of such solid supports include agarose, cellulose, dextran, silica, polystyrene or similar solid supports.
In addition to those polypeptides and fragments described above, the present invention also provides fusion proteins which contain these polypeptides or fragments. The term "fusion protein" as used herein, generally refers to a composite protein, i.e., a single contiguous amino acid sequence, made up of two distinct, heterologous polypeptides which are not normally fused together in a single amino acid sequence. Thus, a fusion protein may include a single amino acid sequence that contains two entirely distinct amino acid sequences or two similar or identical polypeptide sequences, provided that these sequences are not normally found together in a single amino acid sequence. Fusion proteins may generally be prepared using either recombinant nucleic acid methods, i.e., as a result of transcription and translation of a gene fusion, which fusion comprises a segment encoding a polypeptide of the invention and a segment encoding a heterologous protein, or by chemical synthesis methods well known in the art.
Also included within the present invention are amino acid variants of the above described polypeptides. These variants may include insertions, deletions and substitutions with other amino acids. For example, in some aspects, conservative amino acid substitutions may be made, i.e., substitution of selected amino acids with different amino acids having similar structural characteristics, e.g., net charge, hydrophobicity and the like. Glycosylation modifications, either changed, increased amounts or decreased amounts, as well as other sequence modifications are also envisioned.
Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) may also be used to generate more stable peptides. In addition, constrained peptides comprising a consensus sequence or a substantially identical consensus sequence variation may be generated by methods known in the art (Rizo and Gierasch (1992) Ann. Rev. Biochem. 61:387; for example, by adding internal cysteine residues capable of forming intramolecular disulfide bridges which cyclize the peptide. Similarly, modification of the amino or carboxy terminals may also be used to confer stabilizing properties upon the polypeptides of the invention, e.g., amidation of the carboxy-terminus or acylation of the amino-terminus. Substitution of amino acids involved in catalytic activity can be used to generate dominant negative inhibitors of signaling pathways.
Furthermore, although primarily described in terms of "proteins" or "polypeptides" one of skill in the art, upon reading the instant specification, will appreciate that these terms also include structural analogs and derivatives of the above-described polypeptides, e.g., polypeptides having conservative amino acid insertions, deletions or substitutions, peptidomimetics and the like. For example, in addition to the above described polypeptides which consist only of naturally-occurring amino acids, peptidomimetics of the polypeptides of the present invention are also provided. Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compounds are termed "peptide mimetics" or "peptidomimetics" (Fauchere, J. (1986) Adv. Drug Res. 15:29; Veber and Freidinger (1985) TINS p.392; and Evans et al. (1987) J. Med. Chem 30:1229, and are usually developed with the aid of computerized molecular modeling. Peptide mimetics that are structurally similar to therapeutically useful peptides may be used to produce an equivalent therapeutic effect. Generally, peptidomimetics are structurally similar to a paradigm polypeptide (i.e., a polypeptide that has a biological or pharmacological activity), such as naturally-occurring receptor-binding polypeptide, but have one or more peptide linkages optionally replaced by a linkage selected from the group consisting of: --CH.sub.2 NH--, --CH.sub.2 S--, --CH.sub.2 --CH.sub.2 --, --CH.dbd.CH-- (cis and trans), --COCH.sub.2 --, --CH(OH)CH.sub.2 --, and --CH.sub.2 SO--, by methods known in the art and further described in the following references: Spatola, A. F. in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, A. F., Vega Data (March 1983), Vol. 1, Issue 3, "Peptide Backbone Modifications" (general review); Morley, J. S., Trends Pharm Sci (1980) pp. 463-468 (general review); Hudson, D. et al., Int J Pept Prot Res (1979) 14:177-185 (--CH.sub.2 NH--, CH.sub.2 CH.sub.2 --); Spatola, A. F. et al., Life Sci (1986) 38:1243-1249 (--CH.sub.2 --S); Hann, M. M., J. Chem Soc Perkin Trans I (1982) 307-314 (--CH--CH--, cis and trans); Almquist, R. G. et al., J Med Chem (1980) 23:1392-1398 (--COCH.sub.2 --); Jennings-White, C. et al., Tetrahedron Lett (1982) 23:2533 (--COCH.sub.2 --); Szelke, M. et al., European Appln. EP 45665 (1982) CA: 97:39405 (1982) (--CH(OH)CH.sub.2 --); Holladay, M. W. et al., Tetrahedron Lett (1983) 24:4401-4404 (--C(OH)CH.sub.2 --); and Hruby, V. J., Life Sci (1982) 31:189-199 (--CH.sub.2 S--).
Peptide mimetics may have significant advantages over polypeptide embodiments, including, for example: more economical production; greater chemical stability; enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.); altered specificity (e.g., a broad-spectrum of biological activities); reduced antigenicity; and others.
For many applications, it may also be desirable to provide the polypeptides of the invention as labeled entities, i.e., covalently attached or linked to a detectable group, to facilitate identification, detection and quantification of the polypeptide in a given circumstance. These detectable groups may comprise a detectable protein group, e.g., an assayable enzyme or antibody epitope as described above in the discussion of fusion proteins. Alternatively, the detectable group may be selected from a variety of other detectable groups or labels, such as radiolabels (e.g., .sup.125 I, .sup.32 P or .sup.35 S) or a chemiluminescent or fluorescent group. Similarly, the detectable group may be a substrate, cofactor, inhibitor or affinity ligand. Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure-activity data and/or molecular modeling. Such non-interfering positions generally are positions that do not form direct contacts with the molecules to which the peptidomimetic binds (e.g., PtdIns) to produce the therapeutic effect. Derivitization (e.g., labeling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic. Generally, peptidomimetics of peptides of the invention bind to their ligands (e.g., PtdIns) with high affinity and/or possess detectable biological activity (i.e., are agonistic or antagonistic to one or more PI3-kinase mediated phenotypic changes).
IV. Nucleic Acids, Expression Vectors and Cell Lines Expressing Same
In another aspect, the present invention provides nucleic acids which encode the polypeptides of the invention, as well as expression vectors that include these nucleic acids, and cell lines and organisms that are capable of expressing these nucleic acids. These nucleic acids, expression vectors and cell lines may generally be used to produce the polypeptides of the invention. Generally, the isolated nucleic acids of the present invention encode a polypeptide which is derived from PI3-kinases that include a C2 domain within their structure. In preferred aspects, the nucleic acids of the invention encode polypeptides having PI3-kinase activity that is characterized by the capability of phosphorylating the D3 hydroxyl group on the inositol ring of PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2.
In preferred aspects, the nucleic acids of the invention encode a polypeptide having an amino acid sequence that is substantially homologous to the amino acid sequences shown in FIG. 1 (SEQ ID NOS:12-13). More preferred are those isolated nucleic acid sequences that are substantially homologous to the nucleotide sequences shown in FIGS. 9 (SEQ ID NOS:27-28) and 10 (SEQ ID NOS:29-30) or fragments thereof, and most preferred are those nucleic acid sequences having the nucleotide sequences shown in FIGS. 9 and 10.
"Nucleic acids" of the present invention include RNA, cDNA, genomic DNA, synthetic forms and mixed polymers, both sense and antisense strands. Furthermore, different alleles of each isoform are also included. The present invention also provides recombinant nucleic acids which are not otherwise naturally occurring. The nucleic acids described herein also include self replicating plasmids and infectious polymers of DNA or RNA. Unless specified otherwise, conventional notation for nucleic acids is used herein. For example, as written, the left hand end of a single stranded polynucleotide sequence is the 5'-end, whereas the right-hand end is the 3'-end. The left hand direction of double-stranded polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences"; sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".
The nucleic acids of the present invention may be present in whole cells, cell lysates or in partially pure or substantially pure or isolated form. When referring to nucleic acids, the terms "substantially pure" or "isolated" generally refer to the nucleic acid separated from contaminants with which it is generally associated, e.g., lipids, proteins and other nucleic acids. The substantially pure or isolated nucleic acids of the present invention will be greater than about 50% pure. Typically, these nucleic acids will be more than about 60% pure, more typically, from about 75% to about 90% pure and preferably from about 95% to about 98% pure.
The DNA compositions will generally include a coding region which encodes a polypeptide possessing PI3-kinase activity. Preferred nucleic acids will typically encode polypeptides having an amino acid sequence which is substantially homologous to the amino acid sequence shown in FIG. 1 (SEQ ID NOS:12-13), or biologically active fragments thereof. More preferred nucleic acids will comprise a segment having more than about 20 contiguous nucleotides from the nucleotide sequences shown in either of FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), with still more preferred nucleic acids having a nucleotide sequence that is substantially homologous to either of the nucleotide sequences shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32). Most preferred nucleic acids are those which include a portion or all of the nucleotide sequence shown in either of FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32).
The phrase "nucleic acid sequence encoding" refers to a nucleic acid which directs the expression of a specific protein or peptide. The nucleic acid sequences include both the DNA strand sequence that is transcribed into RNA and the RNA sequence that is translated into protein. The nucleic acid sequences include both the full length nucleic acid sequences as well as non-full length sequences derived from the full length protein. It being further understood that the sequence includes the degenerate codons of the native sequence or sequences which may be introduced to provide codon preference in a specific host cell.
Substantial homology in the nucleic acid context means that the segments, or their complementary strands, when compared, are the same when properly aligned, with the appropriate nucleotide insertions or deletions, in at least about 60% of the nucleotides, typically, at least about 70%, more typically, at least about 80%, usually, at least about 90%, and more usually, at least about 95% to 98% of the nucleotides. Alternatively, substantial homology exists when the segments will hybridize under selective hybridization conditions to a strand, or its complement, typically using a sequence of at least about 20 contiguous nucleotides derived from the nucleotide sequence shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32). However, larger segments will usually be preferred, e.g., at least about 30 contiguous nucleotides, more usually about 40 contiguous nucleotides, and preferably more than about 50 contiguous nucleotides. Selective hybridization exists when hybridization occurs which is more selective than total lack of specificity. See, Kanehisa, Nucleic Acid Res. 12:203-213 (1984). Examples of such selective hybridization conditions include, e.g., hybridization under the hybridization and wash conditions of 50% formamide at 42.degree. C. Other stringent hybridization conditions may also be selected. Generally, stringent conditions are selected to be about 5.degree. C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically, stringent conditions will be those in which the salt concentration is at least about 0.02 molar at pH 7 and the temperature is at least about 60.degree. C. As other factors may significantly affect the stringency of hybridization, including, among others, base composition and size of the complementary strands, the presence of organic solvents and the extent of base mismatching, the combination of parameters is more important than the absolute measure of any one.
There are various methods of isolating the nucleic acids which encode the polypeptides of the present invention. Typically, the DNA is isolated from a genomic or cDNA library using labeled oligonucleotide probes specific for sequences in the desired DNA. Restriction endonuclease digestion of genomic DNA or cDNA containing the appropriate genes can be used to isolate the DNA encoding the polypeptides of the invention. From the nucleotide sequence given in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), a panel of restriction endonucleases can be constructed to give cleavage of the DNA in desired regions, i.e., to obtain segments which encode biologically active fragments of the polypeptides of the invention. Following restriction endonuclease digestion, DNA encoding the polypeptides of the invention is identified by its ability to hybridize with a nucleic acid probe in, for example, a Southern blot format. These regions are then isolated using standard methods. See, e.g., Sambrook, et al., supra.
The polymerase chain reaction, or "PCR" can also be used to prepare nucleic acids which encode the polypeptides of the present invention. PCR technology is used to amplify nucleic acid sequences of the desired nucleic acid, e.g., the DNA which encodes the polypeptides of the invention, directly from mRNA, cDNA, or genomic or cDNA libraries. Alternatively, solid phase oligonucleotide synthesis methods may also be employed to produce the nucleic acids described herein. Such methods include the phosphoramidite method described by, e.g., Beaucage and Carruthers, Tetrahedron Lett. 22:1859-1862 (1981), or the triester method according to Matteucci, et al., J. Am. Chem. Soc., 103:3185 (1981). A double stranded fragment may then be obtained, if desired, by annealing the chemically synthesized single strands together under appropriate conditions or by synthesizing the complementary strand using DNA polymerase with an appropriate primer sequence.
Appropriate primers and probes for amplifying the nucleic acids described herein, may be generated from analysis of the nucleic acid sequences described herein, e.g., at FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS: 29-32). Briefly, oligonucleotide primers complementary to the two 3' borders of the DNA region to be amplified are synthesized. The PCR is then carried out using the two primers. See, e.g., PCR Protocols: A Guide to Methods and Applications (Innis, M., Gelfand, D., Sninsky, J. and White, T., eds.) Academic Press (1990). Primers can be selected to amplify a variety of different sized segments from the nucleic acid sequence.
The present invention also includes fragments of the above described nucleic acids. Such fragments will generally comprise a segment of from about 15 to about 150 nucleotides. These fragments can be useful as oligonucleotide probes in the methods of the present invention, or alternatively to encode the polypeptides or biologically active fragments of the present invention, described herein. Also provided are substantially similar nucleic acid sequences, allelic variations and natural or induced sequences of the above described nucleic acids. Also included are chemically modified and substituted nucleic acids, e.g., those which incorporate modified nucleotide bases or which incorporate a labelling group.
In one aspect, cDNA encoding the polypeptides of the present invention or fragments thereof, may be readily employed as nucleic acid probes useful for obtaining genes which encode the polypeptides of the present invention. "Nucleic acid probes" may be DNA or RNA fragments. DNA fragments can be prepared, for example, by digesting plasmid DNA, or by use of PCR, or synthesized by either the phosphoramidite or phosphotriester methods described in, e.g., Gait, Oligonucleotide Synthesis: A Practical Approach, IRL Press (1990). Where a specific sequence for a nucleic acid probe is given, it is understood that the complementary strand is also identified and included. The complementary strand will work equally well in situations where the target is a double-stranded nucleic acid.
Typical nucleic acid probes may be readily derived from the nucleotide sequence shown in FIG. 9 (SEQ ID NOS:27-28) or 10 (SEQ ID NOS:29-32), or alternatively, may be prepared from the amino acid sequence of the cpk or cpk-m proteins, as shown in FIG. 1 (SEQ ID NOS:12-13). In particular, probes may be prepared based upon segments of the amino acid sequence which possess relatively low levels of degeneracy, i.e., few or one possible nucleic acid sequences which encode therefor. Suitable synthetic DNA fragments may then be prepared. Examples of such probes include, e.g., those having the following general sequences PK-1, PK-3 �PK-1: 5' GA(AGTC)GA(TC)(ATC)T(AGTC)(CA)G(AGCT)CA(AG)GA 3' (SEQ ID NO:1); PK-3: 5' CC(GA)AA(GA)TC(TGA)AT(GA)TG(TGA)A(AT)3' (SEQ ID NO:2)!, PKIN-N and PKIN-C �PKIN-N:5' AA(AG)(AG)IIGGIGAIGA(CT)TI(AC)GICA(AG)GA 3' (SEQ ID NO:3); PKIN-C: T(ACG)ICC(AG)AA(AG)TCI(AG)(CT)(AG)TGIA(AT)IA 3' (SEQ ID NO:4)!.
Such cDNA probes may be used in the design of oligonucleotide probes and primers for screening and cloning genes which encode the polypeptides of the invention or related polypeptides, e.g., using well known PCR techniques. These nucleic acids, or fragments may comprise part or all of the cDNA sequence that encodes the polypeptides of the present invention. Effective cDNA probes may comprise as few as 15 consecutive nucleotides in the cDNA sequence, but will often comprise longer segments. Further, these probes may further comprise an additional nucleotide sequence, such as a transcriptional primer sequence for cloning, or a detectable group for easy identification and location of complementary sequences.
cDNA or genomic libraries of various types may be screened for new alleles or related sequences using the above probes. The choice of cDNA libraries normally corresponds to tissue sources which are abundant in mRNA for the desired polypeptides. Phage libraries are normally preferred, but plasmid libraries may also be used. Clones of a library are spread onto plates, transferred to a substrate for screening, denatured, and probed for the presence of the desired sequences.
In addition to comprising a segment which encodes one or more of the above described polypeptides or biologically active fragments, the nucleic acids of the present invention may also comprise a segment encoding a heterologous protein, such that the gene is expressed to produce the two proteins as a fusion protein, as substantially described above.
Typically, the nucleic acids of the present invention will be used in expression vectors for the preparation of the polypeptides of the present invention, namely those polypeptides which possess the PI3-kinase activity described above. The phrase "expression vector" generally refers to nucleotide sequences that are capable of affecting expression of a structural gene in hosts compatible with such sequences. These expression vectors typically include at least suitable promoter sequences and optionally, transcription termination signals. Additional factors necessary or helpful in effecting expression may also be used as described herein. DNA encoding the polypeptides of the present invention will typically be incorporated into DNA constructs capable of introduction into and expression in an in vitro cell culture. Often, the nucleic acids of the present invention may be used to produce a suitable recombinant host cell. Specifically, DNA constructs will be suitable for replication in a prokaryotic host, such as bacteria, e.g., E. coli, or may be introduced into a cultured mammalian, plant, insect, yeast, fungi or other eukaryotic cell line. DNA constructs prepared for introduction into a particular host, e.g., bacteria or yeast, will typically include a replication system recognized by the host, the intended DNA segment encoding the desired polypeptide, and transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide encoding segment. A DNA segment is operably linked when it is placed into a functional relationship with another DNA segment. For example, a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence. DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase. However, enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof. The selection of an appropriate promoter sequence will generally depend upon the host cell selected for the expression of the DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed.), vols. 1-3 Cold Spring Harbor Laboratory (1989). The transcriptional regulatory sequences will typically include a heterologous enhancer or promoter which is recognized by the host. The selection of an appropriate promoter will depend upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available. See Sambrook et al., (1989).
Conveniently available expression vectors which include the replication system and transcriptional and translational regulatory sequences together with the insertion site for the polypeptide encoding segment may be employed. Examples of workable combinations of cell lines and expression vectors are described in Sambrook et al., and in Metzger et al., Nature 334:31-36 (1988). For example, suitable expression vectors may be expressed in, e.g., COS-7 cells, by providing constructs including the subject nucleic acids and employing, e.g., a cytomegalovirus enhancer/promoter region with the translation initiation region of the herpes simplex virus thymidine kinase gene. Alternatively, an insect cell line may be selected as the host cell of choice to express the polypeptide. In this case, the cDNA encoding the polypeptides of the invention may be cloned into a baculovirus expression vector (e.g. pV-IKS). The recombinant baculovirus may then be used to transfect a suitable insect host cell, e.g., Sf9 cells, which may then express the polypeptide. See, e.g., D. K. Morrison et al., Cell 58:649-657 (1989), M. D. Summers and G. E. Smith, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Station, College Station, Tex. (1987).
V. Antibodies
The nucleic acids and polypeptides of the present invention or their immunologically active fragments are also useful in producing antibodies, either polyclonal or monoclonal, which are specifically immunoreactive with the polypeptides of the present invention.
The phrase "specifically immunoreactive," when referring to the interaction between an antibody of the invention and a particular protein, refers to an antibody that specifically recognizes and binds with relatively high affinity to the particular protein, such that this binding is determinative of the presence of the protein in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein and do not bind in a significant amount to other proteins present in the sample. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein. See, Harlow and Lane (1988) Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
For production of polyclonal antibodies, an appropriate target immune system is selected, typically a mouse or rabbit, but also including goats, sheep, cows, guinea pigs, monkeys and rats. The substantially purified antigen or plasmid is presented to the immune system in a fashion determined by methods appropriate for the animal. These and other parameters are well known to immunologists. Typically, injections are given in the footpads, intramuscularly, intradermally or intraperitoneally. The immunoglobulins produced by the host can be precipitated, isolated and purified by routine methods, including affinity purification.
For monoclonal antibodies, appropriate animals will be selected and the desired immunization protocol followed. After the appropriate period of time, the spleens of these animals are excised and individual spleen cells are fused, typically, to immortalized myeloma cells under appropriate selection conditions. Thereafter, the cells are clonally separated and the supernatants of each clone are tested for the production of an appropriate antibody specific for the desired region of the antigen. Techniques for producing antibodies are well known in the art. See, e.g., Goding et al., Monoclonal Antibodies: Principles and Practice (2d ed.) Acad. Press, New York, and Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988). Other suitable techniques involve the in vitro exposure of lymphocytes to the antigenic polypeptides or alternatively, to selection of libraries of antibodies in phage or similar vectors. Huse et al., Generation of Large Combinatorial Library of the Immunoglobulin Repertoire in Phage Lambda, Science 246:1275-1281 (1989). Monoclonal antibodies with affinities of 10.sup.8 liters/mole, preferably 10.sup.9 to 10.sup.10 or stronger, will be produced by these methods.
The antibodies generated can be used for a number of purposes, e.g., as probes in immunoassays, for inhibiting interaction between a PI3-kinase, e.g., cpk or cpk-m, and its substrate or other ligands (thereby inhibiting or reducing the signaling cascade) in diagnostic or therapeutic applications, or in research to further elucidate the mechanism of various signaling pathways. Where the antibodies are used to block the interaction between a polypeptide of the invention and an associating molecule, e.g., protein or substrate, the antibody will generally be referred to as a "blocking antibody."
The antibodies of the present invention can be used with or without modification. Frequently, the antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. Such labels include those that are well known in the art, such as the labels described previously for the polypeptides of the invention. Additionally, the antibodies of the invention may be chimeric, human-like or humanized, in order to reduce their potential antigenicity, without reducing their affinity for their target. Chimeric, human-like and humanized antibodies have generally been described in the art. Generally, such chimeric, human-like or humanized antibodies comprise hypervariable regions, e.g., complementarity determining regions (CDRs) from a mammalian animal, i.e., a mouse, and a human framework region. See, e.g., Queen, et al., Proc. Nat'l Acad. Sci. U.S.A. 86:10029 (1989), Verhoeyan, et al., Science 239:1534-1536 (1988). By incorporating as little foreign sequence as possible in the hybrid antibody, the antigenicity is reduced. Preparation of these hybrid antibodies may be carried out by methods well known in the art.
Preferred antibodies are those monoclonal or polyclonal antibodies which specifically recognize and bind the polypeptides of the invention. Accordingly, these preferred antibodies will specifically recognize and bind the polypeptides which have an amino acid sequence that is substantially homologous to the amino acid sequence shown in FIG. 1, or immunologically active fragments thereof. Still more preferred are antibodies which are capable of forming an antibody-ligand complex with the polypeptides of the invention, whereby the ability of the polypeptide to associate with its substrate or normally associated proteins, in vitro, is reduced, e.g., blocking antibodies.
VI. Methods of Use
The polypeptides, antibodies and nucleic acids of the present invention may be used in a variety of important applications. Such applications include but are not limited to screening applications for identifying compounds that generally affect growth factor signal transduction pathways, also termed "signaling cascades," and therapeutic applications for the treatment of proliferative cell disorders.
A. Screening Applications
In a particular aspect, the present invention provides methods of screening test compounds to determine whether the test compounds are capable of affecting growth cell signal transduction pathways. More particularly, the methods described herein are used to screen compounds for their ability to affect the interactions between the polypeptides of the invention, and their respective substrates and ligands, as these interactions are involved in signal transduction pathways.
In one aspect, the present invention provides a screening system for determining whether a test compound is an agonist or antagonist of PI3-kinase activity. An agonist, antagonist or test compound may be a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological materials such as bacteria, plants, fungi, or animal cells or tissues. Typically, test compounds may include structural analogs or peptidomimetics which are derived from the polypeptides or antibodies described herein, and particularly their biologically active fragments, or substrates or ligands thereof. Test compounds are evaluated for potential activity as agonists or antagonists of functions which result in signal transduction, by inclusion in screening assays described herein. An "agonist" will enhance the particular observed activity, e.g., PtdIns phosphorylation at the D3 hydroxyl, while an "antagonist" will diminish the particular observed activity. The terms "agonist" and "antagonist", as used herein, do not imply any particular mechanism of function. Particularly targeted test compounds include polypeptide fragments of the polypeptides of the present invention and structural analogs or peptidomimetics of these peptides.
The screening methods of the present invention typically involve the incubation of a polypeptide of the present invention, e.g., a cpk or cpk-m polypeptide, in the presence of PtdIns or PtdIns4P, as well as a particular test compound. The mixture is then assayed over time, to determine the amount of PtdIns 3P or PtdIns(3,4)P.sub.2 produced in the presence and absence of the test compound. Where the presence of the test compound results in an increase or decrease in the amount of PtdIns 3P or PtdIns(3,4)P.sub.2 produced, it will be indicative that the test compound is an agonist or antagonist of the PI3-kinase mediated signal transduction, respectively.
For determination of the amount of PtdIns3P or PtdIns(3,4)P.sub.2 formed, one may employ any number of a variety of well known assay methods. For example, HPLC analysis can be readily used to quantitatively identify the above described reaction products, using, e.g., tritiated substrates, and the like. Similarly, on a more qualitative level, thin layer chromatography (TLC) can also be used to identify reaction products. The levels of the above described reaction products produced in the presence and absence of the test compound are then compared. Where the presence of the test compound results in an increase or decrease in the level of the reaction product produced by the polypeptide, it is indicative that the test compound is an agonist or antagonist of PI3-kinase activity, respectively, and more particularly, the activity of the cpk polypeptide and/or cpk-m polypeptide, as described herein.
In a related embodiment, the present invention also provides kits for carrying out the above described screening methods. The kits of the present invention generally include a polypeptide of the present invention, e.g., the cpk polypeptide, cpk-m polypeptide or a biologically active fragment thereof, as well as a substrate of the polypeptide where the catalytic activity is to be screened, e.g., PtdIns or PtdIns4P. One or more of these components may generally be provided in premeasured aliquots. The aliquots can be contained in any suitable container such as a vial or a tube. The polypeptide component can be provided in solution or in lyophilized form, and may be immobilized. The polypeptide preparation may also contain preservatives such as sodium azide or protease inhibitors such as EDTA. A carrier protein such as BSA or ovalbumin, usually between 0.5-5%, may also be included to stabilize the polypeptide. The solution form of cpk or cpk-m polypeptide may contain up to 50% glycerol if the enzyme is to be stored frozen, e.g., at -20.degree. C. to -70.degree. C. If the cpk or cpk-m polypeptide is provided in lyophilized form, the kit can include a reconstitution buffer to reconstitute the polypeptide, as well as a reaction buffer. Alternatively, the polypeptide can be added to the reaction buffer and the solution freeze dried. This form can be readily reconstituted in distilled water with the necessary salt components already present for the particular reaction to be screened, so that no additional reaction buffer need be supplied. Thus, depending on the form and composition of the polypeptide preparation, different buffers may be included in the kit and they may be provided in more than one aliquot. Although described in substantial detail herein, these buffers are generally optional. The appropriate substrate or ligand, depending upon the particular screening method used, may be provided in a similar fashion to that of the polypeptide component. The kits will also typically include additional reagents for carrying out the particular method, e.g., stains for detection, antibodies, solid supports and the like, as well as detailed operating specifications for their use. For example, where binding interactions are being screened, the ligand component may generally be supplied within the kit, already coupled to an appropriate support.
Once identified, particular agonists or antagonists may then be used to enhance or block the activity of the polypeptides of the present invention. This may be particularly useful in therapeutic applications (see discussion, below).
B. Therapeutic Applications
In addition to the above described uses, the polypeptides, nucleic acids and antibodies of the present invention may also be used in therapeutic applications for the treatment of human or non-human mammalian patients. The term "treatment" as used herein, refers to the full spectrum of treatments for a given disorder from which the patient is suffering, including alleviation of one, most or all symptoms resulting from that disorder, outright cure for the particular disorder and prevention of the onset of the disorder.
As described previously herein, the polypeptides of the present invention have been implicated as providing a critical step in cell signal transduction, e.g., involved in the growth factor activation cascades. One such growth factor activation cascade leads to the activation of the Ras oncagene, which has been associated with a variety of proliferative disorders including atherosclerosis, inflammatory joint diseases, psoriasis, restenosis following angioplasty, and cancer. See, e.g., G. Pelicci et al. Cell 70, 93-104 (1992); M. Rozakis-Adcock et al. Nature, 360:689 (1992), Hu et al., Science 268:100-102 (1995).
Accordingly, treatment of the above described disorders may generally be carried out by blocking or inhibiting activation of Ras. This may be accomplished by blocking or inhibiting one or more of the activities responsible for signal transduction leading to activation of Ras, including, e.g., the phosphorylation of the D3 hydroxyl of PtdIns and PtdIns4P, which compounds are involved in the signal transduction pathway which activates Ras.
Generally, inhibition of the particular activity may be carried out by providing a polypeptide of the invention which will compete with the endogenous PI3-kinases. For example, by administering to a patient an effective amount of a substrate binding portion of a polypeptide of the invention, as described herein, one may block association of endogenous PI3-kinases with their substrates, and thereby reduce the level of Ras activation. Similar strategies may be employed using blocking antibodies of the present invention, i.e., those antibodies capable of inhibiting the interaction between the polypeptides of the invention and their substrates or other ligands.
The quantities of reagents necessary for effective therapy, also referred to herein as an "effective amount," or "therapeutically effective amount," will depend upon many different factors, including means of administration, target site, physiological state of the patient and other medicants administered. Thus, treatment doses will need to be titrated to optimize safety and efficacy. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of these reagents. Animal testing of effective doses for treatment of particular disorders will provide further predictive indication of human dosage. Generally, therapeutically effective amounts of the GA5Ptase containing polypeptides of the present invention will be from about 0.0001 to about 10 mg/kg, and more usually, from about 0.001 to about 0.1 mg/kg of the host's body weight. Various considerations are described, e.g., in Gilman et al., (Eds.), Goodman and Gilman's: The Pharmacological Basis of Therapeutics, (8th ed. 1990), Pergamon Press, and Remington's Pharmaceutical Sciences (7th ed. 1985) Mack Publishing Co., Easton, Pa. Methods of administration, also discussed in the above references, include, e.g., oral, intravenous, intraperitoneal or intramuscular administration, and local administration, including topical, transdermal diffusion and aerosol administration, for therapeutic, and/or prophylactic treatment. The active agent, i.e., the polypeptide component, will generally be administered in a composition additionally comprising a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include water, saline, buffers and other compounds described in, e.g., the Merck Index, Merck and Co., Rahway, N.J. For some methods of administration, e.g., oral, it may be desirable to provide the active ingredient in a liposomal formulation. This is particularly desirable where the active ingredient may be subject to degradative environments, for example, proteolytic digestive enzymes. Liposomal formulations are well known in the art, and are discussed in, e.g., REMINGTON'S PHARMACEUTICAL SCIENCES, supra. Administration may also be carried out by way of a controlled release composition or device, whereby a slow release of the active ingredient allows continuous administration over a longer period of time.
Constituents of pharmaceutical compositions, in addition to the active agents described herein, include those generally known in the art for the various administration methods used. For example, oral forms generally include powders, tablets, pills, capsules, lozenges and liquids. Similarly, intravenous, intraperitoneal or intramuscular formulations will generally be dissolved or suspended in a pharmaceutically acceptable carrier, e.g., water, buffered water, saline and the like. Additionally, these compositions may include additional constituents which may be required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like. For solid compositions, conventional nontoxic solid carriers may be used which include, e.g., pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate and the like.
Administration may also be carried out by way of a controlled release composition or device, whereby a slow release of the active ingredient allows continuous administration over a longer period of time.
Additionally, as PI3-kinases play critical roles in cell signaling pathways, the present invention may also provide an exogenous regulatory mechanism in the treatment of disorders where these regulatory mechanisms are disfunctional. In particular, the treatment of a particular disorder may comprise gene therapy techniques involving the mutation, dysregulation or augmentation of levels of exogenous PI3-kinase. For example, gene therapy techniques may involve the introduction into afflicted cells, of genes which encode a protein or polypeptide which possesses the PI3-kinase activity. These exogenously introduced genes' products may then augment existing levels of this activity in cells that may be otherwise deficient.
Strategies for gene therapy are reviewed in Friedmann, Science 244:1275 (9189). Genetic constructs encoding the cpk, cpk-m or functional derivatives, can be used in these gene therapy techniques. Delivery of the genetic construct of interest, i.e., the nucleic acid encoding a PI3-kinase protein or fragment, may be accomplished in vivo by administering the therapy vector to an individual patient, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial administration). Alternatively, the vector may be used to deliver nucleic acids to cells ex vivo, such as cells explanted from an individual patient or universal donor hematopoietic stem cells, neurons, etc, e.g., by transfection of the cells with nucleic acids of interest cloned into retroviruses. Following transfection, the cells are reimplanted into the patient, usually after selection for cells which have incorporated the nucleic acid. The infusion into the patient of transfected cells can replace cells which are dysfunctional for the particular regulatory scheme which results in the disorder being treated.
The present invention is further illustrated by the following examples. These examples are merely to illustrate aspects of the present invention and are not intended as limitations of this invention.
VII. Examples
EXAMPLE 1
Identification of the Drosophila and Murine cpk Genes
The cpk and cpk-m genes were obtained by PCR amplification of Drosophila and murine cDNA libraries with the degenerate primers PK-1 and PK-3 �PK-1: 5' GA(AGTC)GA(TC)(ATC)T(AGTC)(CA)G(AGCT)CA(AG)GA 3' (SEQ ID NO:1); PK-3: 5' CC(GA)AA(GA)TC(TGA)AT(GA)TG(TGA)A(AT)3' (SEQ ID NO:2)! for Drosophila. These primers correspond to two regions of conserved amino acids in PtdIns kinase domains, (DE)D(LI)RQD (SEQ ID NO:5) and (FI)HIDFG (SEQ ID NO:6). The murine cpk-m gene was amplified using primers PKIN-N and PKIN-C �PKIN-N:5' AA(AG)(AG)IIGGIGAIGA(CT)TI(AC)GICA(AG)GA 3' (SEQ ID NO:3); PKIN-C: T(ACG)ICC(AG)AA(AG)TCI(AG)(CT)(AG)TGIA(AT)IA 3' (SEQ ID NO:4)!. PCR products of approximately 400 base pairs were recovered and sequencing revealed open reading frames with sequence identity to p110 PtdIns 3-kinases. These DNA fragments were then used as probes to screen cDNA libraries. Large cDNAs, which did not contain the 5' ends of the cpk cDNAs, were recovered from the Drosophila and murine libraries. The 5' ends of the cDNAs were extended using a 5' RACE kit (Gibco BRL). Construction of the Drosophila cDNA library from 4-8 hr Drosophila embryos was previously described in Brown et al., J. Mol. Biol. 203:425-437 (1988). The murine cDNA libraries used were random and oligo(dT) primed mouse brain and mouse liver libraries purchased from Clontech. Standard procedures were used for cloning. The sequence of DNA was determined using an A.L.F. DNA Sequencer (Pharmacia). The size of the cDNA (6.9 kb) is consistent with the size of the mRNA as estimated by northern blot analysis. Conceptual translation of the cDNA revealed a large open reading frame (ORF) encoding a protein with a predicted molecular weight of 210 KDa. The first methionine in this ORF is encoded by the first ATG in the cDNA and it is preceded by an in frame stop codon. The Drosophila and murine cpk proteins are 34% identical and 48% similar (FIG. 1 (SEQ ID NOS:12-13)).
EXAMPLE 2
Generation of .alpha.-cpk Polyclonal Sera
A fragment of the Drosophila cpk protein was expressed in the E. coli strain BL21DE3(lysS) as a hexahistidine fusion protein. The Drosophila cpk cDNA was digested with NcoI (cleaving at position 1892) and HpaI (at position 4157) and the resulting 2265 base pair fragment (corresponding to the fragment encoding amino acids 563-1317) was ligated into the NcoI and Ecl136II sites of pet23d (Novagen). This construct drives expression of an 85 KDa cpk hexahistidine fusion protein, named pet.1. This protein was found to reside completely in inclusion bodies. Accordingly, the inclusion bodies were purified, solubilized in 1.times. Laemmli sample buffer, and electrophoresed on a 8% preparative gel. The pet.1 polypeptide was eluted from a gel slice and then used to immunize rabbits (Berkeley Antibody Company). The resulting polyclonal serum, designated .alpha.-cpk, was purified on an affinity column. The affinity column was prepared by coupling two milligrams of pet.1 protein to an affigel 10 solid support, according to the manufacturer's instructions (Biorad). This antigen column was used to immunoaffinity purify .alpha.-cpk serum. The affinity purified serum was then incubated with whole cell BL21DE3(lysS) lysates that had been immobilized to a PVDF membrane (Millipore). In this manner, antibodies to E. coli proteins that coelute with pet.1 from the gel slice were eliminated. Preimmune serum was similarly treated, for use as a control.
In order to produce an independent serum that recognizes cpk protein, polyclonal .alpha.-peptide serum was also generated by immunizing rabbits with the P6 peptide (NH.sub.2 -CRQDFLSQPSTSSSQY-COOH (SEQ ID NO:7)), which corresponds to amino acids 419-434 of the cpk protein. The P6 peptide was conjugated to the carrier and then used to immunize rabbits (Berkeley Antibody Company).
The resulting .alpha. P-6 serum, which was designated .alpha.-P6, was used to precipitate protein from Drosophila lysates. The precipitates were resolved by SDS-PAGE, transferred to a PVDF membrane and probed with .alpha.-cpk serum (FIG. 3B). Both the .alpha.-cpk and .alpha.-P6 immune sera precipitated a 210 KDa polypeptide that was recognized by .alpha.-cpk serum. p210 was not detected in control precipitates using preimmune sera. Half of each precipitate (e.g., .alpha.-cpk and .alpha.-P6 precipitates) was assayed for PtdIns kinase activity and the other half was used for the detection of cpk protein on a immunoblot. PtdIns kinase activity was detected in precipitates using the .alpha.-cpk and .alpha.-P6 immune sera, but not in precipitates using preimmune sera. The PtdIns kinase activity was competed by preincubating the .alpha.-cpk serum with the cpk fusion protein or the .alpha.-P6 serum with the P6 peptide. Therefore, cpk protein precipitated from Drosophila lysates has a PtdIns kinase activity.
Polyclonal .alpha.-peptide serum against murine cpk-m was generated by immunizing rabbits with the NB-70 peptide (NH.sub.2 -CQGQVSQKDPNGTSS-COOH (SEQ ID NO:8)). This peptide was conjugated with KLH carrier protein before immunizing rabbits (Caltag). The resulting serum, which was designated 4863, was used to precipitate and probe protein from fibroblast cell lysates. A polypeptide with a molecular weight of approximately 210 kDa in the crude cell lysates and precipitates was recognized by the immune serum but not by the preimmune serum. PtdIns kinase activity was detected in precipitates using 4863 immune serum, but not in precipitates obtained using preimmune serum. Both the PtdIns kinase activity and the 210 kDa protein band on a Western blot were competed by preincubating the 4683 serum with the NB-70 peptide.
In order to eliminate the possibility that the activity detected in the .alpha.-cpk and .alpha.-P6 precipitates resulted from a PtdIns kinase coprecipitating with cpk, rather than from cpk protein itself, it was independently determined that cpk can phosphorylate PtdIns. This was accomplished by assaying the activity of cpk protein obtained by exogenous expression in COS-7 cells (FIG. 5B). Wild-type and kinase deficient cpk proteins were tagged with an HA epitope and then expressed in COS-7 cells. A kinase deficient cpk mutant was constructed by changing a conserved lysine in the catalytic domain to arginine. Wild type and mutant cpk proteins were precipitated from COS-7 cell lysates. One half of each precipitate was assayed for PtdIns kinase activity and the other half was used for the detection of cpk protein on an immunoblot. Precipitates containing wild-type cpk protein contained a PtdIns kinase activity, while precipitates containing an equivalent amount of the mutant cpk protein did not (FIG. 5B). These data indicate that cpk protein possesses intrinsic PtdIns kinase activity.
EXAMPLE 3
Preparation of Drosophila Lysates and Immunochemical Assays
Lysates were prepared by dounce homogenizing 0-12 hr Drosophila embryos in lysis buffer (20 mM N-2-hydroxyethyl piperazine-N'-2-ethanesulfonic acid (HEPES) pH 7.5, 150 mM sodium chloride, 2 mM EDTA 10 mM sodium fluoride, 10 mM sodium phosphate (pH 7.5), 10 mM tetrasodium pyrophosphate, 10 mM sodium orthovanadate, 2 mM phenylmethylsulfonyl fluoride, 10% glycerol, 10 trypsin inhibiting units/ml aprotinin, and 20 .mu.M leupeptin). The lysates were then frozen in aliquots at -70.degree. C. Immediately prior to use, an aliquot was thawed, diluted with lysis buffer containing 1% Triton X-100, and the insoluble proteins were pelleted in a microfuge. cpk protein was detected by immunoblotting in the following manner: proteins from lysates were resolved by SDS-PAGE on a 6% gel and then transferred to a PVDF membrane (Millipore) using high molecular weight transfer buffer; the blots were incubated with the appropriate serum diluted in TBS-T (TBS-T: 50 mM Tris pH 8.0; 150 mM sodium chloride, and 0.1% Tween-20) containing 5% dry milk and 1% ovalbumin; and then processed using an enhanced chemiluminescence kit (Amersham).
To determine if the cpk protein is a substrate of a tyrosine kinase, e.g., tyrosine phosphorylated, similar blots were probed with an .alpha.-phosphotyrosine antibody (FIG. 4). The cpk precipitations contained an .alpha.-phosphotyrosine reactive polypeptide migrating at 210 KDa, the molecular weight of the cpk protein.
EXAMPLE 4
PtdIns Kinase Assays
cpk protein was precipitated from either COS-7 cell or Drosophila lysates as described in Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1988)). The precipitations were washed four times in lysis buffer containing 1.0% Triton X-100 and then two times in PtdIns kinase assay buffer (PtdIns kinase assay buffer: 30 mM HEPES pH 7.5, 30 mM magnesium chloride). PtdIns kinase assays in which PtdIns was used as the substrate were performed as previously described in Kaplan et al., Cell 50:1021-1029 (1987) and Whitman et al., Nature 322:644-646 (1988). The PtdIns kinase assays were modified in the following manner for the determination of PtdIns, PtdIns4P and PtdIns(4,5)P.sub.2 substrate specificities. The PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2 lipid substrates were mixed with an equal amount of phosphatidylserine (PS) and then sonicated to form vesicles. Preparation of vesicles with PS assures that the physical properties of the PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2 vesicles are approximately equivalent. The products of these kinase assays were resolved by TLC (Thin Layer Chromatography) using silica gel 60 plates (Whatman) in a buffer consisting of chloroform:acetone:methanol:acetic acid:water (80:30:26:24:14). cpk Kinase assays were further modified by the addition of 0.05% 3-�(3-cholamidopropyl)dimethylammonio!-1-propanesulfonate (CHAPS) to the vesicle substrates and to the PtdIns kinase assay buffer. The addition of CHAPS was determined to stimulate cpk PtdIns kinase activity in vitro.
EXAMPLE 5
Determination of the Position on the Inositol Ring Phosphorylated by cpk
Since the cpk proteins are related to PtdIns kinases, it was of interest to determine whether they could phosphorylate PtdIns, and whether this phosphorylation occurred on the D3 or D4 position of the inositol ring.
PtdIns3P and PtdIns4P were resolved using TLC with a borate buffer system that has previously been described in detail in Walsh et al., Proc. Nat'l Acad. Sci. U.S.A. 88:9184-9187 (1991). �.gamma..sup.32 P!-PtdIns3P and �.gamma..sup.32 P!-PtdIns4P standards were generated in the following manner. PtdIns3-.gamma..sup.32 P was produced by phosphorylating PtdIns with �.gamma..sup.32 P!-ATP using a constitutively active p110 mutant protein (p110*) whose construction and expression was previously described in Hu et al., Science 268:100-102 (1995). PtdIns4-.gamma..sup.32 P was produced by phosphorylating PtdIns with �.gamma..sup.32 P!-ATP with lysates (20 .mu.g) prepared from 0-12 hr Drosophila embryos. PtdIns 4-kinases are generally the most abundant PtdIns kinases found in lysates. In order to verify that the major product of this reaction is indeed PtdIns4P, the reaction products were demonstrated to comigrate with an unlabeled PtdIns4P standard (Sigma), but could be resolved from the PtdIns3-.gamma..sup.32 P standard. The unlabeled PtdIns4P standard was visualized by iodine staining. Cpk protein was precipitated from either Drosophila lysates (FIG. 6A) or COS-7 cell lysates (FIG. 6B) and used to phosphorylate PtdIns. The �.gamma..sup.32 P! labeled products of these reactions were separated by TLC. The cpk products migrated at the position of a �.gamma..sup.32 P! labeled PtdIns3P standard, but not a PtdIns4P standard. The cpk products were then mixed with either PtdIns3P or PtdIns4P standards and the mixtures were resolved by TLC. The lipid products of cpk comigrated with the PtdIns3P standard, but not with the PtdIns4P standard, suggesting that the cpk reaction products are PtdIns3P and that cpk is a PtdIns 3-kinase.
PtdIns 3-kinases have distinct substrate specificities in vitro. For example, Vps34 can only phosphorylate PtdIns, while p110/p85 can phosphorylate PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2. Using in vitro kinase assays, cpk was also determined to have a unique substrate specificity, being capable of phosphorylating PtdIns and PtdIns4P, but not PtdIns(4,5)P.sub.2 (FIG. 7). A constitutively active 110 (p110*, Hu et al., Science 268:100-102 (1995)) was used as a control and it phosphorylated PtdIns, PtdIns4P, and PtdIns(4,5)P.sub.2. It has also been determined that wild-type cpk protein obtained from exogenous expression in COS-7 cells displayed the same substrate specificity as protein derived from Drosophila lysates. A kinase deficient cpk protein obtained from exogenous expression in COS-7 cells served as a control and was unable to phosphorylate any of these substrates.
EXAMPLE 6
Expression of Proteins in COS-7 Cells
A plasmid was constructed that expressed cpk-HA fusion proteins in COS-7 cells. NotI and SmaI sites were introduced into the cpk cDNA at the position of the stop condon using the primer dPIK 34 (dPIK 34: 5' CCCCGGGTCAGCGGCCGCCGTTCCTGGACACCGCGCCCAG 3' (SEQ ID NO:9)), which corresponds to nucleotides 5755-5795 of the cDNA. A triple tandem copy of HA1 epitope on a NotI DNA fragment was ligated into the NotI site. An SpeI site was introduced at the position of the initiating methionine using the primer dPIK 29 (dPIK29: 5' TTAGACGAGACTAGTATGTCAAATCAAGCG 3' (SEQ ID NO:10)), which corresponds to nucleotides 132-162 of the cpk cDNA. The resulting 5683 base pair SpeI/SmaI fragment was ligated into the XbaI/SmaI sites of the mammalian expression vector pCG. pCG is a derivative of pEVRF with a modified polylinker that contains the human cytomegalovirus enhancer/promoter region and the translation initiation region of the herpes simplex virus thymidine kinase gene. A kinase deficient cpk protein was constructed by changing lysine 1347 to arginine with the primer dPIK 27 (dPIK27: 5' GTGGGACCTGATGCCGAATCTTTACCGGCTATCTTTAGGTGCGGA 3' (SEQ ID NO:11)). A constitutively active p110 mutant protein (p110*) was expressed as a control.
EXAMPLE 7
Drug Sensitivity of cpk
Drug sensitivity and divalent cation requirement were determined for the cpk PtdIns kinase activity relative to p110. P110 PtdIns 3-kinase activity is sensitive to wortmannin, a fungal metabolite that has been shown to be a selective inhibitor of PtdIns kinases. In vitro, the wortmannin sensitivity of the cpk PI3-kinase activity is similar to that of p110. The IC-50 (half maximal inhibition) value for p110 was determined to be 7.5 nM, which is a value consistent with previous studies (Woscholski et al., FEBS Lett. 342:109-114 (1994)). The IC-50 for wortmannin inhibition of cpk was 11 nM. Also, p110 requires the addition of either Mg.sup.2+ or Mn.sup.2+ to in vitro kinase assays, although the enzyme is more active in the presence of Mg.sup.2+ (Volinia et al., EMBO J. 14:3339-3348 (1995)). In contrast, cpk strictly requires the presence of Mg.sup.2+ in in vitro kinase assays, and the enzyme is inactive in the presence of Mn.sup.2+.
EXAMPLE 8
Identification of cpk Binding Proteins
Monoclonal antibody serum was generated which specifically recognizes cpk (.alpha.-cpk.m1), for the purpose of identifying cpk binding proteins. The serum recognizes cpk on an immunoblot of lysates prepared from 0-12 hr Drosophila embryos (FIG. 8A). cpk protein was precipitated from Drosophila lysates using .alpha.-cpk.m1 and the precipitates were resolved by SDS-PAGE. The proteins were visualized by silver staining (FIG. 8B). In addition to cpk, two other proteins were observed having approximate molecular weights of 90 KDa and 190 KDa (p90 and p190, respectively). These proteins were not recognized by .alpha.-cpk.m1 serum on an immunoblot, indicating that these fragments are not related to cpk. This also indicates that these proteins are not independently precipitated by the serum. Blots of cpk precipitates containing cpk, p90 and p190 were probed with .alpha.-phosphotyrosine to determine whether these proteins were tyrosine phosphorylated. Proteins migrating at approximately 190 KDa and 210 KDa reacted with the antiphosphotyrosine antibody, indicating tyrosine phosphorylation, and probable regulation by tyrosine kinases (See also FIG. 4).
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. All publications and patent documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent document were so individually denoted.
__________________________________________________________________________# SEQUENCE LISTING- (1) GENERAL INFORMATION:- (iii) NUMBER OF SEQUENCES: 32- (2) INFORMATION FOR SEQ ID NO:1:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (probe)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:# 17 A- (2) INFORMATION FOR SEQ ID NO:2:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 17 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (probe)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:# 17 W- (2) INFORMATION FOR SEQ ID NO:3:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 25 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (probe)- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: one-of(5,6,9 - #,12,17,20)#/note= "inosine"ER INFORMATION:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:# 25 NMGN CARGA- (2) INFORMATION FOR SEQ ID NO:4:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 22 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (probe)- (ix) FEATURE: (A) NAME/KEY: modified.sub.-- - #base (B) LOCATION: one-of(3,12, - #18,21)#/note= "inosine"ER INFORMATION:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:# 22NAW NA- (2) INFORMATION FOR SEQ ID NO:5:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 6 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: one-of(1)#/note= "Xaa is Asp or Glu."ION:- (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: one-of(3)#/note= "Xaa is Leu or Ile."ION:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:- Xaa Asp Xaa Arg Gln Asp1 5- (2) INFORMATION FOR SEQ ID NO:6:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 6 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (ix) FEATURE: (A) NAME/KEY: Region (B) LOCATION: one-of(1)#/note= "Xaa is Phe or Ile."ION:- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:- Xaa His Ile Asp Phe Gly1 5- (2) INFORMATION FOR SEQ ID NO:7:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 16 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:- Cys Arg Gln Asp Phe Leu Ser Gln Pro Ser Th - #r Ser Ser Ser Gln Tyr# 15- (2) INFORMATION FOR SEQ ID NO:8:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 15 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:- Cys Gln Gly Gln Val Ser Gln Lys Asp Pro As - #n Gly Thr Ser Ser# 15- (2) INFORMATION FOR SEQ ID NO:9:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 40 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (primer)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:# 40 GCCG TTCCTGGACA CCGCGCCCAG- (2) INFORMATION FOR SEQ ID NO:10:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 30 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (primer)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:# 30 TGTC AAATCAAGCG- (2) INFORMATION FOR SEQ ID NO:11:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 45 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (primer)- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:#45 AATC TTTACCGGCT ATCTTTAGGT GCGGA- (2) INFORMATION FOR SEQ ID NO:12:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1876 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:- Met Ser Asn Gln Ala His Ile Asp Tyr Asp Ly - #s Gln Phe Gln Asp Asp# 15- Leu Ala Lys Ala Thr Ala Leu Ser Leu Glu Gl - #n His Ala Leu Asp Asp# 30- Tyr Arg Arg Asn Lys Lys Tyr Gly Ser Gly Ty - #r Gln Gln Ser Ser Thr# 45- Val Ala Gly Arg Asp Tyr Gln Ala Ala Gln Ar - #g Ser Gln Ser Leu His# 60- Gln Pro Arg Arg His Ser Glu Val His Gln Va - #l Ala Ile Ser Pro Glu#80- Asn Ala Glu Arg Ser Arg Thr Pro Pro Ala Gl - #n Gly Thr Asp Asn Asp# 95- Leu Ile Cys Phe Ala Ser Pro Thr Ser Lys Gl - #n Pro Glu Ser Ser Ser# 110- Pro Phe Gly Lys Leu Ile Glu Asp Leu Gln Ar - #g Met Gln Pro Thr Asn# 125- Pro Gln Ser Ala Leu Val Pro Met Gly Pro Va - #l Ala Ser Ala Ser Ile# 140- Pro Pro Gln Tyr Gly Phe Pro Pro His Gln Gl - #n Arg Pro Thr Ala Ala145 1 - #50 1 - #55 1 -#60- Gln Pro Thr Pro Tyr Gly Met Val Ala Gly Gl - #y Val Val Gly Gly Pro# 175- Ala Tyr Gly Asp Leu Gln Leu Val Pro Tyr Gl - #n Pro Ala Ala Gln Gln# 190- Gln Arg Pro Leu Asn Ser Glu Glu Leu Gln Ar - #g Leu Tyr Ser Met Pro# 205- Ala Gln Met Ala Val Val Pro Val Pro Gln Pr - #o Asn Ala Tyr Met Tyr# 220- Tyr Pro Gly Ala Val Val Thr Pro Tyr Thr Al - #a Pro Ile Val Pro Gly225 2 - #30 2 - #35 2 -#40- Ser Ala Ala Phe Met Pro Pro Gln Tyr Pro Al - #a Gln Gly Tyr Gly Phe# 255- Gly Gly Ala Tyr Thr His Met Asp Leu Arg Ar - #g Pro Gln Ser Gln Pro# 270- Ala Pro Gln Gln Thr Ala Pro Thr Thr Ser Hi - #s His His Ser Gln Pro# 285- Ser Asn His Ser Thr Ser Ser Pro Ala Glu Al - #a Asn Gly Val Ala Phe# 300- Pro Ala Arg Arg Gln Val Pro Ser Thr Val Gl - #y Val Ser Ser Ser Ser305 3 - #10 3 - #15 3 -#20- His Thr Gly Asn Asn Gly His Ser Ser Val Pr - #o Arg Arg Gly Asn Asp# 335- Leu Ile Asp Leu Asn His Glu Asp Tyr Ser Ar - #g Val Ser Val Leu Glu# 350- Ala Phe Asp Pro Leu Leu Asn Asp Asn Thr Gl - #y Asn Asp Thr Ala Ser# 365- Asp Ser Thr Ser Tyr Tyr Ala Glu Tyr Asp Pr - #o Phe Asp Phe Leu Tyr# 380- Ser Gly Asp Ala Ala Thr Gln Tyr Ser Asp Pr - #o Met Tyr Glu Ala Val385 3 - #90 3 - #95 4 -#00- Asn Arg Trp Asp Lys Thr Val Ala Thr Val Se - #r Pro Asn Val Gly Leu# 415- Ile Gly Trp Arg Gln Asp Phe Leu Ser Gln Pr - #o Ser Thr Ser Ser Ser# 430- Gln Tyr Gly Val Ala Pro Pro Glu Glu Ser Le - #u Lys Leu Ala Glu Asn# 445- Gly Ser Gly Thr Ile Ser Pro Pro Pro Pro Le - #u Pro Pro Arg Asn Gln# 460- Gln Cys Tyr Glu Ser Asn Gln Ala Ala Met Pr - #o Val Ser Arg Pro Pro465 4 - #70 4 - #75 4 -#80- Gln Ser Ser Val Leu Thr Asp Ser Tyr Thr Se - #r Ser Ile Pro Ala Asn# 495- Val Val Leu Asp Arg Arg Lys Thr Cys Thr Ar - #g Leu Tyr Glu Leu Ile# 510- Ser Asp Gln Arg Thr Asp Asp Pro Glu Leu Le - #u Glu Phe Tyr His Met# 525- Val Lys Glu Val Arg Ala Arg Tyr Pro His As - #p Asp Ala Pro Thr Asn# 540- Val Gly His Val Val Ala Ala Glu Phe Asn Ty - #r His Tyr Met Met Asp545 5 - #50 5 - #55 5 -#60- Thr Ser Ile Lys Val Ile Val His Pro Ala Le - #u Asn Thr Leu Gln Ser# 575- Thr Val Leu Ala Ala Ser Met Gly Lys Glu Gl - #n Val Lys Gly Tyr Gly# 590- Met Pro Val Thr Phe Thr Cys Asp Ile Asp Se - #r Val Val Ala Gln Val# 605- Val Ala Gln Ala Leu Ala Ser Leu Glu Gly Gl - #n Val Lys Gly Thr Val# 620- Thr Asp Tyr Ala Val Lys Pro Ile Gly Leu Le - #u Glu Trp Leu Ala Pro625 6 - #30 6 - #35 6 -#40- Thr Ser Arg Leu Ser Gln Leu Glu Cys Val Hi - #s Asn Ser Phe Gln Leu# 655- Glu Lys Asp Val His Leu Gly Leu Cys Leu Se - #r Thr Ala Ala Asn Met# 670- Gln Ala Ile Ala Arg Thr Glu Arg Asp Asp Gl - #u His Asp Ala Asp Leu# 685- Leu Pro Glu His Leu Leu Pro Asn Glu Val Va - #l Gln Ile Val Thr Tyr# 700- Asp Asn Met Met Ile Leu Ile Glu Thr Leu Gl - #u Met Glu Ile Asp Lys705 7 - #10 7 - #15 7 -#20- Leu Glu Ser Ala Ala Asp Gly Val Pro Gly Ar - #g Ser Val Val Ser Cys# 735- Ser Gly Val Val Gln Ala Val Lys Ala Ile Cy - #s Ala Leu Leu Gly Ser# 750- Ile Asp Thr Met Glu Ile Ala Arg Cys Val Al - #a Asp Leu Lys Arg Ile# 765- Cys Glu Val Glu Gln Lys Lys Tyr Ser Thr Gl - #y Ala Ser Asn Pro Glu# 780- Ile Val Ser Asp Tyr Gly Asp Tyr Ala Gln Va - #l Val Leu Arg Pro Arg785 7 - #90 7 - #95 8 -#00- Ser Met Leu Glu Gln Ile Lys Val Lys Cys As - #n Glu Leu Arg Asp Ala# 815- Val Gln Glu Leu Val Glu Leu Tyr Ala Asn Va - #l Phe Arg Val Ala Phe# 830- Ser Val Lys Thr Pro Asp Tyr Ser Thr Thr Pr - #o Ile Pro Ile Ser Cys# 845- Val Ser Lys Pro Ile Val Val Cys Ile Ser Cy - #s Leu His Arg Pro Leu# 860- Pro Asn Trp Lys Phe Asp Asp Tyr Ser Leu Cy - #s Val Gln Ile Val Tyr865 8 - #70 8 - #75 8 -#80- Gly Thr Arg Leu Leu Ser Lys Pro Asn Val Le - #u Thr Cys Ser Asn Asp# 895- Thr Ser Gly Gly Leu Phe Pro Arg Leu Asn Ph - #e Ser Ala Trp Leu Thr# 910- Phe Asp Gln His Pro Ile Cys Thr Leu Pro Ar - #g Glu Ala Arg Leu Thr# 925- Phe Val Leu Tyr Gly Lys Gln Ala Ala Ser Gl - #u Gly Glu Pro Asn Ala# 940- Asp Gln Asn Gly Glu Arg Arg Gln Val Thr Th - #r Glu Leu Gly Trp Cys945 9 - #50 9 - #55 9 -#60- Ser Ile Gln Leu Phe Asp Phe Lys Arg Val Me - #t Ile Cys Gly Pro Tyr# 975- Leu Leu Ser Leu Trp Pro Pro Met Thr Asp Ly - #s Met Leu Gly Pro Ala# 990- Pro Ala Arg Gly Cys His Pro Gln Pro Asp Ph - #e Cys Pro Val Leu Ser# 10050- Ile Glu Val Pro Pro Tyr Gly Gly Arg Ile Gl - #u Phe Pro Glu His Gln# 10205- Glu Val Pro Lys Pro Ala Pro His Tyr Asp Ph - #e Ala Ser Leu Asp Ala# 10401030 - # 1035- Asn Leu Gln Glu Glu Leu Leu Asp Thr Ala Gl - #u Leu Gly Tyr Thr Gly# 10550- Ala Thr Glu Arg Arg Glu Val Phe Trp Glu Ly - #s Arg Leu Tyr Leu Gln# 10705- Ser Tyr Pro Asn Ala Leu Pro Lys Val Leu Hi - #s Ala Ala His Ser Trp# 10850- Asp Tyr Ala Asn Leu Ile Asp Leu His Ala Le - #u Leu His Ser Trp Ala# 11005- Pro Leu Ser Pro Leu Gln Ser Leu Glu Leu Le - #u Leu Pro Arg Tyr Pro# 11201110 - # 1115- Asp Ala Lys Val Arg Glu Lys Ala Val Glu Tr - #p Ile Ser Lys Met Pro# 11350- Asn Asp Gln Leu Val Asp Phe Leu Pro Gln Le - #u Val Gln Ser Leu Lys# 11505- His Asp Thr Tyr Glu Gly Ser Ala Met Ala Ar - #g Phe Leu Leu Ser Lys# 11650- Cys Leu Glu Ser Pro Arg Phe Ala His His Me - #t Tyr Trp Leu Leu Val# 11805- His Ser Leu Pro Asp Asp Pro His Asn Ser Il - #e Gly Ala Ala Met Val# 12001190 - # 1195- Asp Gln Glu Tyr Asp Glu Ser Gln Val Thr Gl - #n Val Arg Tyr Tyr Arg# 12150- Arg Asn Lys Met Met Leu Arg Ala Leu Met Al - #a Ile Cys Gly Glu Lys# 12305- Met Leu Gln Arg Phe Met Tyr Gln His Arg Me - #t Cys Gln Lys Leu Thr# 12450- Thr Ile Ala Glu Ser Val Lys Glu Ala Lys Gl - #u Ser Met Arg Gln Lys# 12605- Ser Leu Ala Ala Gly Met Asp Glu Val His Gl - #n Asp Leu Leu Glu Gln# 12801270 - # 1275- Pro Thr Cys Leu Pro Leu Gly Pro Glu Leu Gl - #u Val Thr Gly Val Ser# 12950- Val Arg Asn Cys Ser Tyr Phe Asn Ser Asn Th - #r Leu Pro Leu Lys Ile# 13105- Asn Phe Val Gly Pro Asp Ala Glu Ser Leu Pr - #o Ala Ile Phe Lys Cys# 13250- Gly Asp Asp Leu Gln Gln Asp Gln Leu Thr Il - #e Gln Leu Ile Arg Ile# 13405- Met Asn Lys Met Trp Leu Ala Glu Arg Leu As - #p Leu Lys Met Val Thr# 13601350 - # 1355- Phe Asn Cys Val Pro Thr Gly Tyr Lys Ser Gl - #y Met Ile Glu Leu Val# 13750- Ser Glu Ala Glu Thr Leu Arg Lys Ile Gln Va - #l Glu Cys Gly Leu Thr# 13905- Gly Ser Phe Lys Asp Arg Pro Ile Ala Glu Tr - #p Leu Gly Lys Gln Asn# 14050- Pro Ser Pro Leu Glu Tyr Gln Ser Ala Val Ar - #g Asn Phe Thr Leu Ser# 14205- Cys Ala Gly Tyr Ser Val Ala Thr Tyr Val Le - #u Gly Ile Cys Asp Arg# 14401430 - # 1435- His Asn Asp Asn Ile Met Leu Lys Thr Ser Gl - #y His Leu Phe His Ile# 14550- Asp Phe Gly Lys Phe Leu Gly Asp Ala Gln Me - #t Phe Gly Asn Phe Lys# 14705- Arg Asp Arg Thr Pro Phe Val Leu Thr Ser As - #p Met Ala Tyr Val Ile# 14850- Asn Gly Gly Asp Lys Pro Ser Thr Asp Phe Hi - #s Tyr Phe Val Asp Leu# 15005- Cys Cys Arg Ala Phe Asn Ile Val Arg Lys As - #n Ala Asp Leu Leu Leu# 15201510 - # 1515- His Thr Leu Ala His Met Ala Thr Ala Gly Me - #t Pro Gly Val Asn Ser# 15350- Asn Ala Val Gln Tyr Val Arg Arg Ala Leu Le - #u Pro Ser Gln Ser Asn# 15505- Pro Glu Ala Ala Ala Thr Phe Ala Lys Met Il - #e Gln Ser Ser Leu Lys# 15650- Ser Trp Phe Thr Gln Phe Asn Phe Phe Leu Hi - #s Asn Leu Ala Gln Met# 15805- Arg Phe Thr Pro Asp Glu Gly Ser Gly Glu Le - #u Leu Ser Phe Val Pro# 16001590 - # 1595- Arg Lys Tyr Thr Met Gln Gln Asp Gly Arg Le - #u Lys Ile Val Lys Val# 16150- Val Cys Phe Gln Lys His Tyr Ser Met Glu Ly - #s Glu Tyr Met Tyr Ile# 16305- Leu Glu Val Thr Arg His Gly Gln Pro Asp Pr - #o Thr His Leu Phe Arg# 16450- Ser Tyr Arg Glu Phe Thr Glu Phe His Gln Ly - #s Leu Cys Met His Phe# 16605- Pro Leu Val Lys Leu His Ser Leu Pro Ala Gl - #y Val His Val Gly Arg# 16801670 - # 1675- Ser Asn Lys Ser Val Ala Glu Lys Arg Leu Pr - #o Leu Ile Gln Arg Phe# 16950- Leu Lys Ser Leu Phe Asp Ala Ser Glu Glu Il - #e Ile Ala His Ser Glu# 17105- Leu Val Tyr Thr Phe Phe His Pro Leu Leu Ar - #g Asp Gln Gln Glu Ala# 17250- Lys Leu Gly Met Pro Lys Ile Lys Glu Val Ly - #s Gln Gln Pro Ser Arg# 17405- Asp Asn Pro His Glu Ile Gly Gln Ile Arg Le - #u Ser Leu Gln Tyr Gln# 17601750 - # 1755- Arg Gly Val Leu Thr Val Met Ile His His Al - #a Lys Gly Leu Pro Met# 17750- Leu Gln Gly Gly Gln Glu Pro Asn Thr Tyr Va - #l Lys Cys Tyr Leu Lys# 17905- Pro Asp Pro Lys Lys Glu Thr Lys Arg Lys Th - #r Lys Val Val Arg Lys# 18050- Thr Cys Val Pro Ser Phe Met Glu Thr Leu Gl - #u Tyr Arg Met Pro Leu# 18205- Asn Ile Ile Gln Glu Arg Arg Leu Gln Val Th - #r Val Trp Ser His Asp# 18401830 - # 1835- Thr Leu Gln Glu Asn Glu Leu Leu Gly Gly Ph - #e Asp Met Asp Leu Ser# 18550- Lys Tyr Asp Leu Arg Gln Glu Leu Val Asp Tr - #p Tyr Arg Leu Gly Ala# 18705- Val Ser Arg Asn 1875- (2) INFORMATION FOR SEQ ID NO:13:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1658 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:- Met Ala Gln Ile Ser Asn Asn Ser Glu Phe Ly - #s Gln Cys Ser Ser Ser# 15- His Pro Glu Pro Ile Arg Thr Lys Asp Val As - #n Lys Ala Glu Ala Leu# 30- Gln Met Glu Ala Glu Ala Leu Ala Lys Leu Gl - #n Lys Asp Arg Gln Met# 45- Thr Asp Ser Pro Arg Gly Phe Glu Leu Ser Se - #r Ser Thr Arg Gln Arg# 60- Thr Gln Gly Phe Asn Lys Gln Asp Tyr Asp Le - #u Met Val Phe Pro Glu#80- Leu Asp Ser Gln Lys Arg Ala Val Asp Ile As - #p Val Glu Lys Leu Thr# 95- Gln Ala Glu Leu Glu Lys Ile Leu Leu Asp As - #p Asn Phe Glu Thr Arg# 110- Lys Pro Pro Ala Leu Pro Val Thr Pro Val Le - #u Ser Pro Ser Phe Ser# 125- Thr Gln Leu Tyr Leu Arg Pro Ser Gly Gln Ar - #g Gly Gln Trp Pro Pro# 140- Gly Leu Cys Gly Pro Ser Thr Tyr Thr Leu Pr - #o Ser Thr Tyr Pro Ser145 1 - #50 1 - #55 1 -#60- Ala Tyr Ser Lys Gln Ala Thr Phe Gln Asn Gl - #y Phe Ser Pro Arg Met# 175- Pro Thr Phe Pro Ser Thr Glu Ser Val Tyr Le - #u Arg Leu Pro Gly Gln# 190- Ser Pro Tyr Phe Ser Tyr Pro Leu Thr Pro Al - #a Thr Pro Phe His Pro# 205- Gln Gly Ser Leu Pro Val Tyr Arg Pro Leu Va - #l Ser Pro Asp Met Ala# 220- Lys Leu Phe Glu Lys Ile Ala Ser Thr Ser Gl - #u Phe Leu Lys Asn Gly225 2 - #30 2 - #35 2 -#40- Lys Ala Arg Thr Asp Leu Glu Ile Ala Asn Se - #r Lys Ala Ser Val Cys# 255- Asn Leu Gln Ile Ser Pro Lys Ser Glu Asp Il - #e Asn Lys Phe Asp Trp# 270- Leu Asp Leu Asp Pro Trp Asp Ala Val Leu Le - #u Glu Glu Arg Ser Pro# 285- Ser Cys His Leu Glu Arg Lys Val Asn Gly Ly - #s Ser Leu Ser Gly Ala# 300- Thr Val Thr Arg Ser Gln Ser Leu Ile Ile Ar - #g Thr Ala Gln Phe Thr305 3 - #10 3 - #15 3 -#20- Lys Ala Gln Gly Gln Val Ser Gln Lys Asp Pr - #o Asn Gly Thr Ser Ser# 335- Leu Pro Thr Gly Ser Ser Leu Leu Gln Glu Ph - #e Glu Val Gln Asn Asp# 350- Glu Val Ala Ala Phe Cys Gln Ser Ile Met Ly - #s Leu Lys Thr Lys Phe# 365- Pro Tyr Thr Asp His Cys Thr Asn Pro Gly Ty - #r Leu Leu Ser Pro Val# 380- Thr Val Gln Arg Asn Met Cys Gly Glu Asn Al - #a Ser Val Lys Val Ser385 3 - #90 3 - #95 4 -#00- Ile Glu Ile Glu Gly Leu Gln Leu Pro Val Th - #r Phe Thr Cys Asp Val# 415- Ser Ser Thr Val Glu Ile Ile Ile Met Gln Al - #a Leu Cys Trp Val His# 430- Asp Asp Leu Asn Gln Val Asp Val Gly Ser Ty - #r Ile Leu Lys Val Cys# 445- Gly Gln Glu Glu Val Leu Gln Asn Asn His Cy - #s Leu Gly Ser His Glu# 460- His Ile Gln Asn Cys Arg Lys Trp Asp Thr Gl - #u Ile Lys Leu Gln Leu465 4 - #70 4 - #75 4 -#80- Leu Thr Leu Ser Ala Met Cys Gln Asn Leu Al - #a Arg Thr Ala Glu Asp# 495- Asp Glu Ala Pro Val Asp Leu Asn Lys Tyr Le - #u Tyr Gln Ile Glu Lys# 510- Pro Tyr Lys Glu Val Met Ile Arg His Pro Va - #l Glu Glu Leu Leu Asp# 525- Ser Tyr His Tyr Gln Val Glu Leu Ala Leu Gl - #n Thr Glu Asn Gln His# 540- Arg Ala Val Asp Gln Val Ile Lys Ala Val Ar - #g Lys Ile Cys Ser Ala545 5 - #50 5 - #55 5 -#60- Leu Asp Gly Val Glu Thr Pro Ser Val Thr Gl - #u Ala Val Lys Lys Leu# 575- Lys Arg Ala Val Asn Leu Pro Arg Asn Lys Se - #r Ala Asp Val Thr Ser# 590- Leu Ser Gly Ser Asp Thr Arg Lys Asn Ser Th - #r Lys Gly Ser Leu Asn# 605- Pro Glu Asn Pro Val Gln Val Ser Met Asp Hi - #s Leu Thr Thr Ala Ile# 620- Tyr Asp Leu Leu Arg Leu His Ala Asn Ser Se - #r Arg Cys Ser Thr Gly625 6 - #30 6 - #35 6 -#40- Cys Pro Arg Gly Ser Arg Asn Ile Lys Glu Al - #a Trp Thr Ala Thr Glu# 655- Gln Leu Gln Phe Thr Val Tyr Ala Ala His Gl - #y Ile Ser Ser Asn Trp# 670- Val Ser Asn Tyr Glu Lys Tyr Tyr Leu Ile Cy - #s Ser Leu Ser His Asn# 685- Gly Lys Asp Leu Phe Lys Pro Ile Gln Ser Ly - #s Lys Val Gly Thr Tyr# 700- Lys Asn Phe Phe Tyr Leu Ile Lys Trp Asp Gl - #u Leu Ile Ile Phe Pro705 7 - #10 7 - #15 7 -#20- Ile Gln Ile Ser Gln Leu Pro Leu Glu Ser Va - #l Leu His Leu Thr Leu# 735- Phe Gly Val Leu Asn Gln Ser Ser Gly Ser Se - #r Pro Asp Ser Asn Lys# 750- Gln Arg Lys Gly Pro Glu Ala Leu Gly Lys Va - #l Ser Leu Thr Leu Phe# 765- Asp Phe Lys Arg Phe Leu Thr Cys Gly Thr Ly - #s Leu Leu Tyr Leu Trp# 780- Thr Ser Ser His Thr Asn Ser Ile Pro Gly Al - #a Ile Pro Lys Lys Ser785 7 - #90 7 - #95 8 -#00- Tyr Val Met Glu Arg Ile Val Leu Gln Val As - #p Phe Pro Ser Pro Ala# 815- Phe Asp Ile Ile Tyr Thr Ser Pro Gln Ile As - #p Arg Asn Ile Ile Gln# 830- Gln Asp Lys Leu Glu Thr Leu Glu Ser Asp Il - #e Lys Gly Lys Leu Leu# 845- Asp Ile Ile His Arg Asp Ser Ser Phe Gly Le - #u Ser Lys Glu Asp Lys# 860- Val Phe Leu Trp Glu Asn Arg Tyr Tyr Cys Le - #u Lys His Pro Asn Cys865 8 - #70 8 - #75 8 -#80- Leu Pro Lys Ile Leu Ala Ser Ala Pro Asn Tr - #p Lys Trp Ala Asn Leu# 895- Ala Lys Thr Tyr Ser Leu Leu His Gln Trp Pr - #o Pro Leu Cys Pro Leu# 910- Ala Ala Leu Glu Leu Leu Asp Ala Lys Phe Al - #a Asp Gln Gly Val Arg# 925- Ser Leu Ala Val Ser Trp Met Glu Ala Ile Se - #r Asp Asp Glu Leu Ala# 940- Asp Leu Leu Pro Gln Phe Val Gln Ala Leu Ly - #s Tyr Glu Ile Tyr Leu945 9 - #50 9 - #55 9 -#60- Asn Ser Ser Leu Val Arg Phe Leu Leu Ser Ar - #g Ala Leu Gly Asn Ile# 975- Gln Ile Ala His Ser Leu Tyr Trp Leu Leu Ly - #s Asp Ala Leu His Asp# 990- Thr His Phe Gly Ser Arg Tyr Glu His Val Le - #u Gly Ala Leu Leu Ser# 10050- Val Gly Gly Lys Gly Leu Arg Glu Glu Leu Se - #r Lys Gln Met Lys Leu# 10205- Val Gln Leu Leu Gly Gly Val Ala Glu Lys Va - #l Arg Gln Ala Ser Gly# 10401030 - # 1035- Ser Thr Arg Gln Val Val Leu Gln Lys Ser Me - #t Glu Arg Val Gln Ser# 10550- Phe Phe Leu Arg Asn Lys Cys Arg Leu Pro Le - #u Lys Pro Ser Leu Val# 10705- Ala Lys Glu Leu Asn Ile Lys Ser Cys Ser Ph - #e Phe Ser Ser Asn Ala# 10850- Met Pro Leu Lys Val Thr Met Val Asn Ala As - #p Pro Leu Gly Glu Glu# 11005- Ile Asn Val Met Phe Lys Val Gly Glu Asp Le - #u Arg Gln Asp Met Leu# 11201110 - # 1115- Ala Leu Gln Met Ile Lys Ile Met Asp Lys Il - #e Trp Leu Lys Glu Gly# 11350- Leu Asp Leu Arg Met Val Ile Phe Arg Cys Le - #u Ser Thr Gly Arg Asp# 11505- Arg Gly Met Val Glu Leu Val Pro Ala Ser As - #p Thr Leu Arg Lys Ile# 11650- Gln Val Glu Tyr Gly Val Thr Gly Ser Phe Ly - #s Asp Lys Pro Leu Ala# 11805- Glu Trp Leu Arg Lys Tyr Asn Pro Ser Glu Gl - #u Glu Tyr Glu Lys Ala# 12001190 - # 1195- Ser Glu Asn Phe Ile Tyr Ser Cys Ala Gly Cy - #s Cys Val Ala Thr Tyr# 12150- Val Leu Gly Ile Cys Asp Arg His Asn Asp As - #n Ile Met Leu Arg Ser# 12305- Thr Gly His Met Phe His Ile Asp Phe Gly Ly - #s Phe Leu Gly His Ala# 12450- Gln Met Phe Gly Ser Phe Lys Arg Asp Arg Al - #a Pro Phe Val Leu Thr# 12605- Ser Asp Met Ala Tyr Val Ile Asn Gly Gly Gl - #u Lys Pro Thr Ile Arg# 12801270 - # 1275- Phe Gln Leu Phe Val Asp Leu Cys Cys Gln Al - #a Tyr Asn Leu Ile Arg# 12950- Lys Gln Thr Asn Leu Phe Leu Asn Leu Leu Se - #r Leu Met Ile Pro Ser# 13105- Gly Leu Pro Glu Leu Thr Ser Ile Gln Asp Le - #u Lys Tyr Val Arg Asp# 13250- Ala Leu Gln Pro Gln Thr Thr Asp Ala Glu Al - #a Thr Ile Phe Phe Thr# 13405- Arg Leu Ile Glu Ser Ser Leu Gly Ser Ile Al - #a Thr Lys Phe Asn Phe# 13601350 - # 1355- Phe Ile His Asn Leu Ala Gln Leu Arg Phe Se - #r Gly Leu Pro Ser Asn# 13750- Asp Glu Pro Ile Leu Ser Phe Ser Pro Lys Th - #r Tyr Ser Phe Arg Gln# 13905- Asp Gly Arg Ile Lys Glu Val Ser Val Phe Th - #r Tyr His Lys Lys Tyr# 14050- Asn Pro Asp Lys His Tyr Ile Tyr Val Val Ar - #g Ile Leu Arg Glu Gly# 14205- His Leu Glu Pro Ser Phe Val Phe Arg Thr Ph - #e Asp Glu Phe Gln Glu# 14401430 - # 1435- Leu His Asn Lys Leu Ser Ile Ile Phe Pro Le - #u Trp Lys Leu Pro Gly# 14550- Phe Pro Asn Arg Met Val Leu Gly Arg Thr Hi - #s Ile Lys Asp Val Ala# 14705- Ala Lys Arg Lys Ile Glu Leu Asn Ser Tyr Le - #u Gln Ser Leu Met Asn# 14850- Ala Ser Thr Asp Val Ala Glu Cys Asp Leu Va - #l Cys Thr Phe Phe His# 15005- Pro Leu Leu Arg Asp Glu Lys Ala Glu Gly Il - #e Ala Arg Ser Ala Gly# 15201510 - # 1515- Ala Val Pro Phe Ser Pro Thr Leu Gly Gln Il - #e Gly Gly Ala Val Lys# 15350- Leu Ser Val Ser Tyr Arg Asn Gly Thr Leu Ph - #e Ile Met Val Met His# 15505- Ile Lys Asp Leu Val Thr Glu Asp Gly Ala As - #p Pro Asn Pro Tyr Val# 15650- Lys Thr Tyr Leu Leu Pro Asp Thr His Lys Th - #r Ser Lys Arg Lys Thr# 15805- Lys Ile Ser Arg Lys Thr Arg Asn Pro Thr Ph - #e Asn Glu Met Leu Val# 16001590 - # 1595- Tyr Ser Gly Tyr Ser Lys Glu Thr Leu Arg Gl - #n Arg Glu Leu Gln Leu# 16150- Ser Val Leu Ser Ala Glu Ser Leu Arg Glu As - #n Phe Phe Leu Gly Gly# 16305- Ile Thr Leu Pro Leu Lys Asp Phe Asn Leu Se - #r Lys Glu Thr Val Lys# 16450- Trp Tyr Gln Leu Thr Ala Ala Thr Tyr Leu# 1655- (2) INFORMATION FOR SEQ ID NO:14:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 137 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:- Gln Gln Pro Ser Arg Asp Asn Pro His Glu Il - #e Gly Gln Ile Arg Leu# 15- Ser Leu Gln Tyr Gln Arg Gly Val Leu Thr Va - #l Met Ile His His Ala# 30- Lys Gly Leu Pro Met Leu Gln Gly Gly Gln Gl - #u Pro Asn Thr Tyr Val# 45- Lys Cys Tyr Leu Lys Pro Asp Pro Lys Lys Gl - #u Thr Lys Arg Lys Thr# 60- Lys Val Val Arg Lys Thr Cys Val Pro Ser Ph - #e Met Glu Thr Leu Glu#80- Tyr Arg Met Pro Leu Asn Ile Ile Gln Glu Ar - #g Arg Leu Gln Val Thr# 95- Val Trp Ser His Asp Thr Leu Gln Glu Asn Gl - #u Leu Leu Gly Gly Phe# 110- Asp Met Asp Leu Ser Lys Tyr Asp Leu Arg Gl - #n Glu Leu Val Asp Trp# 125- Tyr Arg Leu Gly Ala Val Ser Arg Asn# 135- (2) INFORMATION FOR SEQ ID NO:15:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 137 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:- Val Pro Phe Ser Pro Thr Leu Gly Gln Ile Gl - #y Gly Ala Val Lys Leu# 15- Ser Val Ser Tyr Arg Asn Gly Thr Leu Phe Il - #e Met Val Met His Ile# 30- Lys Asp Leu Val Thr Glu Asp Gly Ala Asp Pr - #o Asn Pro Tyr Val Lys# 45- Thr Tyr Leu Leu Pro Asp Thr His Lys Thr Se - #r Lys Arg Lys Thr Lys# 60- Ile Ser Arg Lys Thr Arg Asn Pro Thr Phe As - #n Glu Met Leu Val Tyr#80- Ser Gly Tyr Ser Lys Glu Thr Leu Arg Gln Ar - #g Glu Leu Gln Leu Ser# 95- Val Leu Ser Ala Glu Ser Leu Arg Glu Asn Ph - #e Phe Leu Gly Gly Ile# 110- Thr Leu Pro Leu Lys Asp Phe Asn Leu Ser Ly - #s Glu Thr Val Lys Trp# 125- Tyr Gln Leu Thr Ala Ala Thr Tyr Leu# 135- (2) INFORMATION FOR SEQ ID NO:16:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 140 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:- Asn Ser Tyr Asp Ser Asp Glu Ala Thr Thr Le - #u Gly Ala Leu Glu Phe# 15- Ser Leu Leu Tyr Asp Gln Asp Asn Ser Ser Le - #u His Cys Thr Ile Ile# 30- Lys Ala Lys Gly Leu Lys Pro Met Asp Ser As - #n Gly Leu Ala Asp Pro# 45- Tyr Val Lys Leu His Leu Leu Pro Gly Ala Se - #r Lys Ser Asn Lys Leu# 60- Arg Thr Lys Thr Leu Arg Asn Thr Arg Asn Pr - #o Ile Trp Asn Glu Thr#80- Leu Val Tyr His Gly Ile Thr Asp Glu Asp Me - #t Gln Arg Lys Thr Leu# 95- Arg Ile Ser Val Cys Asp Glu Asp Lys Phe Gl - #y His Asn Glu Phe Ile# 110- Gly Glu Thr Arg Phe Ser Leu Lys Lys Leu ly - #s Pro Asn Gln Arg Lys# 125- Asn Phe Asn Ile Cys Leu Glu Arg Val Ile Pr - #o Met# 140- (2) INFORMATION FOR SEQ ID NO:17:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 138 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:- Gln Gly Gly Glu Lys Glu Glu Pro Glu Lys Le - #u Gly Asp Ile Cys Thr# 15- Ser Leu Arg Tyr Val Pro Thr Ala Gly Lys Le - #u Thr Val Cys Ile Leu# 30- Glu Ala Lys Asn Leu Lys Lys Met Asp Val Gl - #y Gly Leu Ser Asp Pro# 45- Tyr Val Lys Ile His Leu Met Gln Asn Gly Ly - #s Arg Leu Lys Lys Lys# 60- Lys Thr Thr Val Lys Lys Lys Thr Leu Asn Pr - #o Tyr Phe Asn Glu Ser#80- Phe Ser Phe Glu Ile Pro Phe Glu Gln Ile Gl - #n Lys Val Gln Val Val# 95- Val Thr Val Leu Asp Tyr Asp Lys Leu Gly Ly - #s Asn Glu Ala Ile Gly# 110- Lys Ile Phe Val Gly Ser Asn Ala Thr Gly Th - #r Glu Leu Arg His Trp# 125- Ser Asp Met Leu Ala Asn Pro Arg Arg Pro# 135- (2) INFORMATION FOR SEQ ID NO:18:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 136 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:- Ser Leu Cys Gly Cys Asp His Thr Glu Arg Ar - #g Gly Arg Ile Tyr Leu# 15- Glu Ile Asn Val Lys Glu Asn Leu Leu Thr Va - #l Gln Ile Lys Glu Gly# 30- Arg Asn Leu Ile Pro Met Asp Pro Asn Gly Le - #u Ser Asp Pro Tyr Val# 45- Lys Val Lys Leu Ile Pro Asp Asp Lys Asp Gl - #n Ser Lys Lys Lys Thr# 60- Arg Thr Ile Lys Ala Cys Leu Asn Pro Val Tr - #p Asn Glu Thr Leu Thr#80- Tyr Asp Leu Lys Pro Glu Asp Lys Asp Arg Ar - #g Ile Leu Ile Glu Val# 95- Trp Asp Trp Asp Arg Thr Ser Arg Asn Asp Ph - #e Met Gly Ala Leu Ser# 110- Phe Gly Ile Ser Glu Ile Ile Lys Asn Pro Th - #r Asn Gly Trp Phe Lys# 125- Leu Leu Thr Gln Asp Glu Gly Glu# 135- (2) INFORMATION FOR SEQ ID NO:19:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 171 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:- Ala Ile Phe Lys Cys Gly Asp Asp Leu Gln Gl - #n Asp Gln Leu Thr Ile# 15- Gln Leu Ile Arg Ile Met Asn Lys Met Trp Le - #u Ala Glu Arg Leu Asp# 30- Leu Lys Met Val Thr Phe Asn Cys Val Pro Th - #r Gly Tyr Lys Ser Gly# 45- Met Ile Glu Leu Val Ser Glu Ala Glu Thr Le - #u Arg Lys Ile Gln Val# 60- Glu Cys Gly Leu Thr Gly Ser Phe Lys Asp Ar - #g Pro Ile Ala Glu Trp#80- Leu Gly Lys Gln Asn Pro Ser Pro Leu Glu Ty - #r Gln Ser Ala Val Arg# 95- Asn Phe Thr Leu Ser Cys Ala Gly Tyr Ser Va - #l Ala Thr Tyr Val Leu# 110- Gly Ile Cys Asp Arg His Asn Asp Asn Ile Me - #t Leu Lys Thr Ser Gly# 125- His Leu Phe His Ile Asp Phe Gly Lys Phe Le - #u Gly Asp Ala Gln Met# 140- Phe Gly Asn Phe Lys Arg Asp Arg Thr Pro Ph - #e Val Leu Thr Ser Asp145 1 - #50 1 - #55 1 -#60- Met Ala Tyr Val Ile Asn Gly Gly Asp Lys Pr - #o# 170- (2) INFORMATION FOR SEQ ID NO:20:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 171 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:- Val Met Phe Lys Val Gly Glu Asp Leu Arg Gl - #n Asp Met Leu Ala Leu# 15- Gln Met Ile Lys Ile Met Asp Lys Ile Trp Le - #u Lys Glu Gly Leu Asp# 30- Leu Arg Met Val Ile Phe Arg Cys Leu Ser Th - #r Gly Arg Asp Arg Gly# 45- Met Val Glu Leu Val Pro Ala Ser Asp Thr Le - #u Arg Lys Ile Gln Val# 60- Glu Tyr Gly Val Thr Gly Ser Phe Lys Asp Ly - #s Pro Leu Ala Glu Trp#80- Leu Arg Lys Tyr Asn Pro Ser Glu Glu Glu Ty - #r Glu Lys Ala Ser Glu# 95- Asn Phe Ile Tyr Ser Cys Ala Gly Cys Cys Va - #l Ala Thr Tyr Val Leu# 110- Gly Ile Cys Asp Arg His Asn Asp Asn Ile Me - #t Leu Arg Ser Thr Gly# 125- His Met Phe His Ile Asp Phe Gly Lys Phe Le - #u Gly His Ala Gln Met# 140- Phe Gly Ser Phe Lys Arg Asp Arg Ala Pro Ph - #e Val Leu Thr Ser Asp145 1 - #50 1 - #55 1 -#60- Met Ala Tyr Val Ile Asn Gly Gly Glu Lys Pr - #o# 170- (2) INFORMATION FOR SEQ ID NO:21:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 171 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:- Ile Ile Phe Lys Asn Gly Asp Asp Ile Arg Gl - #n Asp Met Leu Thr Ile# 15- Gln Ile Ile Arg Ile Met Glu Asn Ile Trp Gl - #n Asn Gln Gly Leu Asp# 30- Ile Arg Met Leu Pro Tyr Gly Cys Leu Ser Il - #e Gly Asp Cys Val Gly# 45- Leu Ile Glu Val Val Arg Asn Ser His Thr Il - #e Met Gln Ile Gln Cys# 60- Lys Gly Gly Leu Lys Gly Ala Leu Gln Phe As - #n Ser His Thr Leu His#80- Gln Trp Leu Lys Asp Lys Asn Lys Gly Glu Il - #e Tyr Asp Ala Ala Ile# 95- Asp Leu Phe Thr Arg Ser Cys Ala Gly Tyr Cy - #s Val Ala Thr Phe Ile# 110- Leu Gly Ile Gly Asp Arg His Asn Ser Asn Il - #e Met Val Lys Asp Asp# 125- Gly Cys Leu Phe His Ile Asp Phe Gly His Ph - #e Leu Asp His Lys Lys# 140- Lys Lys Phe Gly Tyr Lys Glu Arg Val Pro Ph - #e Val Leu Thr Gln Asp145 1 - #50 1 - #55 1 -#60- Phe Leu Ile Val Ile Ser Lys Gly Ala Gln Gl - #u# 170- (2) INFORMATION FOR SEQ ID NO:22:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 171 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:- Val Ile Phe Lys Asn Gly Asp Asp Ile Arg Gl - #n Asp Met Leu Thr Ile# 15- Gln Met Ile Arg Leu Met Asp Leu Ile Trp Ly - #s Glu Ala Gly Leu Asp# 30- Ile Arg Met Leu Pro Tyr Gly Cys Leu Ala Th - #r Gly Asp Arg Ser Gly# 45- Leu Ile Glu Val Val Ser Thr Ser Glu Thr Il - #e Ala Asp Ile Gln Leu# 60- Asn Ser Ser Asn Val Ala Ala Ala Ala Ala Al - #a Phe Asn Lys Asp Ala#80- Leu Leu Asn Trp Leu Lys Glu Tyr Asn Ser Gl - #y Asp Asp Leu Asp Arg# 95- Ala Ile Glu Glu Phe Thr Leu Ser Cys Ala Gl - #y Tyr Cys Val Ala Ser# 110- Tyr Val Leu Gly Ile Gly Asp Arg His Ser As - #p Asn Ile Met Val Lys# 125- Lys Thr Gly Gln Leu Phe His Ile Asp Phe Gl - #y His Ile Leu Gly Asn# 140- Phe Lys Ser Lys Phe Gly Ile Lys Glu Arg Va - #l Pro Phe Ile Leu Thr145 1 - #50 1 - #55 1 -#60- Tyr Asp Phe Ile His Val Ile Gln Gln Gly Ly - #s# 170- (2) INFORMATION FOR SEQ ID NO:23:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 171 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:- Ile Ile Phe Lys His Gly Asp Asp Ile Arg Gl - #n Asp Met Leu Ile Ile# 15- Gln Ile Leu Arg Ile Met Glu Ser Ile Trp Gl - #u Thr Glu Ser Leu Asp# 30- Ile Cys Ile Leu Pro Tyr Gly Cys Ile Ser Th - #r Gly Asp Lys Ile Gly# 45- Met Ile Glu Ile Val Lys Asp Ala Thr Thr Il - #e Ala Lys Ile Gln Gln# 60- Ser Thr Val Gly Asn Thr Gly Ala Phe Lys As - #p Glu Val Leu Asn His#80- Trp Leu Lys Glu Lys Ser Pro Thr Glu Glu Ly - #s Glu Gln Ala Ala Val# 95- Glu Arg Phe Val Tyr Ser Cys Ala Gly Tyr Cy - #s Val Ala Thr Phe Val# 110- Leu Gly Ile Gly Asp Arg His Asn Asp Asn Il - #e Met Ile Thr Glu Thr# 125- Gly Asn Leu Phe His Ile Asp Phe Gly His Il - #e Leu Gly Asn Tyr Lys# 140- Ser Phe Leu Gly Ile Asn Lys Arg Val Pro Ph - #e Val Leu Thr Pro Asp145 1 - #50 1 - #55 1 -#60- Phe Leu Phe Val Met Gly Thr Ser Gly Lys Ly - #s# 170- (2) INFORMATION FOR SEQ ID NO:24:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 160 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:- Leu Met Phe Lys Val Gly Asp Asp Leu Arg Gl - #n Asp Gln Leu Val Val# 15- Gln Ile Ile Ser Leu Met Asn Glu Leu Leu Ly - #s Asn Glu Asn Val Asp# 30- Leu Lys Leu Thr Pro Tyr Lys Ile Leu Ala Th - #r Gly Pro Gln Glu Gly# 45- Ala Ile Glu Phe Ile Pro Asn Asp Thr Leu Al - #a Ser Ile Leu Ser Lys# 60- Tyr His Gly Ile Leu Gly Tyr Leu Lys Leu Hi - #s Tyr Pro Asp Glu Asn#80- Ala Thr Leu Gly Val Gln Gly Trp Val Leu As - #p Asn Phe Val Lys Ser# 95- Cys Ala Gly Tyr Cys Val Ile Thr Tyr Ile Le - #u Gly Val Gly Asp Arg# 110- His Leu Asp Asn Leu Leu Val Thr Pro Asp Gl - #y His Phe Phe His Ala# 125- Asp Phe Gly Tyr Leu Gly Gln Asp Pro Lys Pr - #o Phe Pro Pro Leu Met# 140- Lys Leu Pro Pro Gln Ile Ile Glu Ala Phe Gl - #y Gly Ala Glu Ser Ser145 1 - #50 1 - #55 1 -#60- (2) INFORMATION FOR SEQ ID NO:25:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 179 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:- Val Ile Ala Lys Thr Gly Asp Asp Leu Arg Gl - #n Glu Ala Phe Ala Tyr# 15- Gln Met Ile Gln Ala Met Ala Asn Ile Trp Va - #l Lys Glu Lys Val Asp# 30- Val Trp Val Lys Arg Met Lys Ile Leu Ile Th - #r Ser Ala Asn Thr Gly# 45- Leu Val Glu Thr Ile Thr Asn Ala Met Ser Va - #l His Ser Ile Lys Lys# 60- Ala Leu Thr Lys Lys Met Ile Glu Asp Ala Gl - #u Leu Asp Asp Lys Gly#80- Gly Ile Ala Ser Leu Asn Asp His Phe Leu Ar - #g Ala Phe Gly Asn Pro# 95- Asn Gly Phe Lys Tyr Arg Arg Ala Gln Asp As - #n Phe Ala Ser Ser Leu# 110- Ala Ala Tyr Ser Val Ile Cys Tyr Leu Leu Gl - #n Val Lys Asp Arg His# 125- Asn Gly Asn Ile Met Ile Asp Asn Glu Gly Hi - #s Val Ser His Ile Asp# 140- Phe Gly Phe Met Leu Ser Asn Ser Pro Gly Se - #r Val Gly Phe Glu Ala145 1 - #50 1 - #55 1 -#60- Ala Pro Phe Lys Leu Thr Tyr Glu Tyr Ile Gl - #u Leu Leu Gly Gly Val# 175- Glu Gly Glu- (2) INFORMATION FOR SEQ ID NO:26:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 184 amino (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: peptide- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:- Tyr Val Leu Lys Gly His Glu Asp Ile Arg Gl - #n Asp Ser Leu Val Met# 15- Gln Leu Phe Gly Leu Val Asn Thr Leu Leu Gl - #n Asn Asp Ala Glu Cys# 30- Phe Arg Arg His Leu Asp Ile Gln Gln Tyr Pr - #o Ala Ile Pro Leu Ser# 45- Pro Lys Ser Gly Leu Leu Gly Trp Val Pro As - #n Ser Asp Thr Phe His# 60- Val Leu Ile Arg Glu His Arg Glu Ala Lys Ly - #s Ile Pro Leu Asn Ile#80- Glu His Trp Val Met Leu Gln Met Ala Pro As - #p Tyr Asp Asn Leu Thr# 95- Leu Leu Gln Lys Val Glu Val Phe Thr Tyr Al - #a Leu Asn Asn Tyr Thr# 110- Arg Ser Leu Ala Val Met Ser Met Thr Gly Ty - #r Ile Leu Gly Leu Gly# 125- Asp Arg His Pro Ser Asn Leu Met Leu Asp Ar - #g Ile Thr Gly Lys Val# 140- Ile His Ile Asp Phe Gly Asp Cys Phe Glu Al - #a Ala Ile Leu Arg Glu145 1 - #50 1 - #55 1 -#60- Lys Phe Pro Glu Lys Val Pro Phe Arg Leu Th - #r Arg Met Leu Thr Tyr# 175- Ala Met Glu Val Ser Gly Ile Glu 180- (2) INFORMATION FOR SEQ ID NO:27:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 6831 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 148..5775- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:- GCTTGTTGCA TTCCGTTTTG TGTTATTTCG TGCTCCCCGT CAAGGGAAAA CC - #TCAACCAA 60- AAAGAGACTA GCAACGGGTG TAAAAAGCAG CGGAGGTGAC ACCTCAAAAA GC - #AACTCAAC 120#CAT ATC GAC 171 GGGGATA ATG TCA AAT CAA GCG# Met Ser Asn Gl - #n Ala His Ile Asp# 5 1- TAC GAC AAA CAA TTC CAG GAT GAC CTG GCC AA - #G GCG ACC GCC CTG AGT 219Tyr Asp Lys Gln Phe Gln Asp Asp Leu Ala Ly - #s Ala Thr Ala Leu Ser# 20- CTA GAG CAG CAT GCC CTC GAT GAC TAC AGG CG - #A AAC AAG AAG TAC GGC 267Leu Glu Gln His Ala Leu Asp Asp Tyr Arg Ar - #g Asn Lys Lys Tyr Gly# 40- TCC GGG TAT CAG CAA AGC TCC ACC GTT GCT GG - #C CGA GAT TAC CAG GCG 315Ser Gly Tyr Gln Gln Ser Ser Thr Val Ala Gl - #y Arg Asp Tyr Gln Ala# 55- GCG CAA CGT AGT CAG AGC CTA CAT CAA CCA CG - #A CGG CAC TCG GAG GTG 363Ala Gln Arg Ser Gln Ser Leu His Gln Pro Ar - #g Arg His Ser Glu Val# 70- CAT CAG GTG GCC ATC AGT CCG GAG AAT GCG GA - #A CGA TCG CGC ACA CCG 411His Gln Val Ala Ile Ser Pro Glu Asn Ala Gl - #u Arg Ser Arg Thr Pro# 85- CCG GCC CAG GGA ACG GAT AAC GAT CTG ATC TG - #C CTC GCA AGT CCC ACC 459Pro Ala Gln Gly Thr Asp Asn Asp Leu Ile Cy - #s Leu Ala Ser Pro Thr# 100- AGC AAG CAG CCA GAG AGT AGC AGT CCC TTT GG - #C AAA CTT ATA GAG GAT 507Ser Lys Gln Pro Glu Ser Ser Ser Pro Phe Gl - #y Lys Leu Ile Glu Asp105 1 - #10 1 - #15 1 -#20- CTG CAG CGG ATG CAG CCG ACC AAT CCG CAG TC - #G GCC CTG GTG CCA ATG 555Leu Gln Arg Met Gln Pro Thr Asn Pro Gln Se - #r Ala Leu Val Pro Met# 135- GGT CCA GTT GCG TCG GCT TCG ATT CCT CCT CA - #A TAC GGC TTC CCA CCT 603Gly Pro Val Ala Ser Ala Ser Ile Pro Pro Gl - #n Tyr Gly Phe Pro Pro# 150- CAT CAG CAA CGT CCA ACG GCT GCT CAG CCC AC - #A CCG TAC GGC ATG GTT 651His Gln Gln Arg Pro Thr Ala Ala Gln Pro Th - #r Pro Tyr Gly Met Val# 165- GCA GGT GGA GTT GTT GGT GGA CCG GCT TAC GG - #T GAC CTG CAG TTG GTG 699Ala Gly Gly Val Val Gly Gly Pro Ala Tyr Gl - #y Asp Leu Gln Leu Val# 180- CCT TAC CAA CCA GCT GCC CAG CAA CAG AGG CC - #A CTA AAC AGC GAG GAG 747Pro Tyr Gln Pro Ala Ala Gln Gln Gln Arg Pr - #o Leu Asn Ser Glu Glu185 1 - #90 1 - #95 2 -#00- CTG CAG CGG CTG TAC AGC ATG CCC GCT CAA AT - #G GCC GTG GTT CCA GTG 795Leu Gln Arg Leu Tyr Ser Met Pro Ala Gln Me - #t Ala Val Val Pro Val# 215- CCG CAG CCA AAC GCC TAT ATG TAC TAT CCC GG - #A GCT GTG GTT ACT CCA 843Pro Gln Pro Asn Ala Tyr Met Tyr Tyr Pro Gl - #y Ala Val Val Thr Pro# 230- TAC ACG GCT CCC ATT GTT CCC GGA TCG GCT GC - #T TTT ATG CCG CCG CAG 891Tyr Thr Ala Pro Ile Val Pro Gly Ser Ala Al - #a Phe Met Pro Pro Gln# 245- TAT CCC GCA CAG GGA TAT GGC TTT GGA GGT GC - #T TAC ACG CAC ATG GAT 939Tyr Pro Ala Gln Gly Tyr Gly Phe Gly Gly Al - #a Tyr Thr His Met Asp# 260- TTG CGT CGA CCC CAA TCG CAA CCA GCT CCC CA - #A CAA ACA GCA CCG ACA 987Leu Arg Arg Pro Gln Ser Gln Pro Ala Pro Gl - #n Gln Thr Ala Pro Thr265 2 - #70 2 - #75 2 -#80- ACA AGT CAT CAT CAC AGC CAA CCG TCC AAC CA - #T TCC ACT TCC TCC CCC1035Thr Ser His His His Ser Gln Pro Ser Asn Hi - #s Ser Thr Ser Ser Pro# 295- GCA GAG GCC AAT GGA GTA GCC TTC CCA GCG CG - #T CGC CAA GTG CCC TCG1083Ala Glu Ala Asn Gly Val Ala Phe Pro Ala Ar - #g Arg Gln Val Pro Ser# 310- ACT GTC GGG GTT AGC TCT AGT AGC CAC ACT GG - #A AAC AAT GGT CAT TCC1131Thr Val Gly Val Ser Ser Ser Ser His Thr Gl - #y Asn Asn Gly His Ser# 325- TCG GTC CCA CGC AGG GGC AAC GAT TTG ATC GA - #C CTC AAC CAC GAG GAC1179Ser Val Pro Arg Arg Gly Asn Asp Leu Ile As - #p Leu Asn His Glu Asp# 340- TAC TCC CGT GTG AGT GTG CTG GAG GCA TTC GA - #T CCC CTG CTA AAC GAC1227Tyr Ser Arg Val Ser Val Leu Glu Ala Phe As - #p Pro Leu Leu Asn Asp345 3 - #50 3 - #55 3 -#60- AAT ACT GGC AAC GAC ACC GCC TCC GAC AGC AC - #T TCC TAC TAT GCG GAA1275Asn Thr Gly Asn Asp Thr Ala Ser Asp Ser Th - #r Ser Tyr Tyr Ala Glu# 375- TAC GAT CCC TTT GAT TTT CTG TAC AGC GGA GA - #T GCA GCA ACC CAA TAT1323Tyr Asp Pro Phe Asp Phe Leu Tyr Ser Gly As - #p Ala Ala Thr Gln Tyr# 390- TCC GAT CCA ATG TAT GAG GCA GTC AAC AGG TG - #G GAC AAA ACT GTG GCC1371Ser Asp Pro Met Tyr Glu Ala Val Asn Arg Tr - #p Asp Lys Thr Val Ala# 405- ACC GTG AGT CCG AAT GTT GGT CTA ATC GGT TG - #G CGC CAA GAT TTT CTG1419Thr Val Ser Pro Asn Val Gly Leu Ile Gly Tr - #p Arg Gln Asp Phe Leu# 420- AGC CAG CCA TCT ACA TCT TCA TCG CAA TAT GG - #T GTT GCG CCG CCA GAG1467Ser Gln Pro Ser Thr Ser Ser Ser Gln Tyr Gl - #y Val Ala Pro Pro Glu425 4 - #30 4 - #35 4 -#40- GAG AGT CTG AAG CTT GCG GAG AAC GGA TCT GA - #A ACT ATC TCG CCT CCT1515Glu Ser Leu Lys Leu Ala Glu Asn Gly Ser Gl - #u Thr Ile Ser Pro Pro# 455- CCG CCG TTG CCG CCC CGG AAC CAG CAG TGC TA - #T GAA TCA AAC CAG GCA1563Pro Pro Leu Pro Pro Arg Asn Gln Gln Cys Ty - #r Glu Ser Asn Gln Ala# 470- GCC ATG CCG GTC TCC AGG CCT CCT CAG TCT TC - #T GTT TTG ACG GAC AGC1611Ala Met Pro Val Ser Arg Pro Pro Gln Ser Se - #r Val Leu Thr Asp Ser# 485- TAC ACC TCC AGC ATT CCG GCC AAC GTG GTG CT - #G GAC CGG CGG AAA ACT1659Tyr Thr Ser Ser Ile Pro Ala Asn Val Val Le - #u Asp Arg Arg Lys Thr# 500- TGT ACA CGA CTG TAC GAA TTG ATC AGC GAC CA - #G CGC ACT GAT GAT CCC1707Cys Thr Arg Leu Tyr Glu Leu Ile Ser Asp Gl - #n Arg Thr Asp Asp Pro505 5 - #10 5 - #15 5 -#20- GAA CTT TTG GAA TTT TAC CAC ATG GTA AAG GA - #G GTG AGG GCA CGC TAT1755Glu Leu Leu Glu Phe Tyr His Met Val Lys Gl - #u Val Arg Ala Arg Tyr# 535- CCG CAT GAC GAT GCG CCC ACC AAT GTG GGA CA - #T GTT GTG GCC GCC GAG1803Pro His Asp Asp Ala Pro Thr Asn Val Gly Hi - #s Val Val Ala Ala Glu# 550- TTT AAT TAT CAC TAC ATG ATG GAC ACC AGC AT - #C AAA GTG ATT GTG CAT1851Phe Asn Tyr His Tyr Met Met Asp Thr Ser Il - #e Lys Val Ile Val His# 565- CCG GCT CTA AAT ACA CTT CAA TCA ACG GTC CT - #G GCT GCG TCC ATG GGC1899Pro Ala Leu Asn Thr Leu Gln Ser Thr Val Le - #u Ala Ala Ser Met Gly# 580- AAG GAA CAG GTG AAG GGA TAT GGA ATG CCA GT - #A ACA TTC ACT TGC GAT1947Lys Glu Gln Val Lys Gly Tyr Gly Met Pro Va - #l Thr Phe Thr Cys Asp585 5 - #90 5 - #95 6 -#00- ATT GAT TCG GTT GTG GCA CAG GTG GTG GCA CA - #A GCT TTG GCC TCG CTG1995Ile Asp Ser Val Val Ala Gln Val Val Ala Gl - #n Ala Leu Ala Ser Leu# 615- GAG GGA CAA GTC AAG GGT ACC GTC ACA GAT TA - #T GCG GTC AAG CCC ATT2043Glu Gly Gln Val Lys Gly Thr Val Thr Asp Ty - #r Ala Val Lys Pro Ile# 630- GGT CTT CTG GAG TGG CTG GCA CCC ACC TCG AG - #A CTG AGT CAG CTG GAG2091Gly Leu Leu Glu Trp Leu Ala Pro Thr Ser Ar - #g Leu Ser Gln Leu Glu# 645- TGC GTG CAC AAT AGC TTC CAA TTG GAG AAG GA - #T GTA CAT TTG GGC CTG2139Cys Val His Asn Ser Phe Gln Leu Glu Lys As - #p Val His Leu Gly Leu# 660- TGC CTT AGT ACG GCG GCA AAC ATG CAG GCT AT - #T GCA CGA ACA GAG CGG2187Cys Leu Ser Thr Ala Ala Asn Met Gln Ala Il - #e Ala Arg Thr Glu Arg665 6 - #70 6 - #75 6 -#80- GAT GAT GAG CAC GAT GCG GAT TTG CTG CCG GA - #A CAT CCT CTT CCA AAC2235Asp Asp Glu His Asp Ala Asp Leu Leu Pro Gl - #u His Pro Leu Pro Asn# 695- GAG GTT GTG CAA ATT GTG ACC TAC GAC AAT AT - #G ATG ATA CTC ATC GAA2283Glu Val Val Gln Ile Val Thr Tyr Asp Asn Me - #t Met Ile Leu Ile Glu# 710- ACG CTG GAG ATG GAG ATT GAC AAG CTG GAA TC - #G GCG GCC GAC GGA GTA2331Thr Leu Glu Met Glu Ile Asp Lys Leu Glu Se - #r Ala Ala Asp Gly Val# 725- CCC GGA CGG AGT GTC GTG AGC TGC TCC GGA GT - #T GTC CAA GCA GTG AAG2379Pro Gly Arg Ser Val Val Ser Cys Ser Gly Va - #l Val Gln Ala Val Lys# 740- GCC ATA TGC GCA CTG CTC GGT TCA ATC GAC AC - #A ATG GAA ATT GCA CGA2427Ala Ile Cys Ala Leu Leu Gly Ser Ile Asp Th - #r Met Glu Ile Ala Arg745 7 - #50 7 - #55 7 -#60- TGT GTT GCC GAT CTG AAG CGC ATT TGC GAG GT - #G GAG CAA AAG AAG TAC2475Cys Val Ala Asp Leu Lys Arg Ile Cys Glu Va - #l Glu Gln Lys Lys Tyr# 775- TCG ACG GGC GCT AGC AAC CCA GAG ATT GTG AG - #T GAC TAT GGT GAT TAC2523Ser Thr Gly Ala Ser Asn Pro Glu Ile Val Se - #r Asp Tyr Gly Asp Tyr# 790- GCT CAA GTT GTA CTC CGC CCG CGC TCC ATG CT - #G GAG CAG ATC AAG GTC2571Ala Gln Val Val Leu Arg Pro Arg Ser Met Le - #u Glu Gln Ile Lys Val# 805- AAG TGC AAC GAG CTG CGA GAT GCA GTG CAA GA - #G CTG GTT GAA TTG TAT2619Lys Cys Asn Glu Leu Arg Asp Ala Val Gln Gl - #u Leu Val Glu Leu Tyr# 820- GCG AAT GTT TTC CGG GTG GCA TTC TCC GTG AA - #G ACG CCC GAT TAC TCA2667Ala Asn Val Phe Arg Val Ala Phe Ser Val Ly - #s Thr Pro Asp Tyr Ser825 8 - #30 8 - #35 8 -#40- ACA ACA CCC ATA CCC ATT TCC TGC GTG TCC AA - #A CCA ATT GTG GTA TGC2715Thr Thr Pro Ile Pro Ile Ser Cys Val Ser Ly - #s Pro Ile Val Val Cys# 855- ATT AGC TGC CTA CAC AGG CCG CTG CCG AAT TG - #G AAG TTC GAC GAT TAT2763Ile Ser Cys Leu His Arg Pro Leu Pro Asn Tr - #p Lys Phe Asp Asp Tyr# 870- TCC CTG TGC GTA CAA ATC GTT TAT GGA ACG CG - #C CTG CTG TCG AAG CCG2811Ser Leu Cys Val Gln Ile Val Tyr Gly Thr Ar - #g Leu Leu Ser Lys Pro# 885- AAT GTG CTG ACC TGC TCC AAC GAT ACA AGT GG - #A GGC CTG TTT CCT CGT2859Asn Val Leu Thr Cys Ser Asn Asp Thr Ser Gl - #y Gly Leu Phe Pro Arg# 900- CTT AAC TTC AGT GCC TGG CTG ACT TTC GAT CA - #G CAT CCC ATC TGC ACT2907Leu Asn Phe Ser Ala Trp Leu Thr Phe Asp Gl - #n His Pro Ile Cys Thr905 9 - #10 9 - #15 9 -#20- CTG CCC AGG GAG GCG CGC CTT ACG TTC GTG TT - #G TAT GGA AAA CAG GCG2955Leu Pro Arg Glu Ala Arg Leu Thr Phe Val Le - #u Tyr Gly Lys Gln Ala# 935- GCC AGC GAA GGC GAA CCC AAC GCC GAT CAG AA - #T GGA GAG AGG CGT CAG3003Ala Ser Glu Gly Glu Pro Asn Ala Asp Gln As - #n Gly Glu Arg Arg Gln# 950- GTG ACC ACT GAA CTG GGT TGG TGT TCG ATC CA - #A CTG TTT GAC TTT AAG3051Val Thr Thr Glu Leu Gly Trp Cys Ser Ile Gl - #n Leu Phe Asp Phe Lys# 965- CGA GTG ATG ATC TGC GGC CCC TAC TTA CTG TC - #T TTA TGG CCA CCA ATG3099Arg Val Met Ile Cys Gly Pro Tyr Leu Leu Se - #r Leu Trp Pro Pro Met# 980- ACG GAC AAA ATG CTT GGA CCA GCT CCG GCT CG - #A GGC TGT CAT CCG CAA3147Thr Asp Lys Met Leu Gly Pro Ala Pro Ala Ar - #g Gly Cys His Pro Gln985 9 - #90 9 - #95 1 -#000- CCC GAC TTT TGC CCC GTT TTG AGC ATT GAA GT - #A CCT CCG TAT GGA GGA3195Pro Asp Phe Cys Pro Val Leu Ser Ile Glu Va - #l Pro Pro Tyr Gly Gly# 10150- CGC ATT GAG TTT CCT GAG CAC CAG GAG GTG CC - #A AAA CCT GCA CCA CAC3243Arg Ile Glu Phe Pro Glu His Gln Glu Val Pr - #o Lys Pro Ala Pro His# 10305- TAC GAT TTT GCC TCT CTG GAT GCC AAT CTT CA - #A GAG GAG CTG CTG GAC3291Tyr Asp Phe Ala Ser Leu Asp Ala Asn Leu Gl - #n Glu Glu Leu Leu Asp# 10450- ACC GCA GAG CTG GGC TAC ACA GGA GCC ACA GA - #A CGA CGT GAA GTG TTC3339Thr Ala Glu Leu Gly Tyr Thr Gly Ala Thr Gl - #u Arg Arg Glu Val Phe# 10605- TGG GAA AAA CGG CTC TAC CTG CAG AGC TAT CC - #C AAT GCC CTG CCA AAG3387Trp Glu Lys Arg Leu Tyr Leu Gln Ser Tyr Pr - #o Asn Ala Leu Pro Lys# 10801070 - # 1075- GTT CTT CAT GCC GCT CAC AGT TGG GAT TAT GC - #C AAT TTG ATC GAT TTG3435Val Leu His Ala Ala His Ser Trp Asp Tyr Al - #a Asn Leu Ile Asp Leu# 10950- CAT GCG CTG CTG CAC TCC TGG GCA CCA CTC TC - #G CCA TTG CAG TCG TTG3483His Ala Leu Leu His Ser Trp Ala Pro Leu Se - #r Pro Leu Gln Ser Leu# 11105- GAG TTA CTT CTG CCA CGA TAT CCG GAT GCT AA - #G GTT CGC GAG AAA GCC3531Glu Leu Leu Leu Pro Arg Tyr Pro Asp Ala Ly - #s Val Arg Glu Lys Ala# 11250- GTG GAG TGG ATC TCC AAG ATG CCC AAC GAC CA - #G CTC GTC GAC TTT CTG3579Val Glu Trp Ile Ser Lys Met Pro Asn Asp Gl - #n Leu Val Asp Phe Leu# 11405- CCT CAA TTG GTG CAA AGT TTA AAA CAT GAC AC - #A TAC GAA GGC TCG GCA3627Pro Gln Leu Val Gln Ser Leu Lys His Asp Th - #r Tyr Glu Gly Ser Ala# 11601150 - # 1155- ATG GCT CGA TTC TTG CTG TCC AAA TGC CTG GA - #G TCA CCG CGC TTT GCC3675Met Ala Arg Phe Leu Leu Ser Lys Cys Leu Gl - #u Ser Pro Arg Phe Ala# 11750- CAT CAC ATG TAT TGG CTG CTT GTA CAC AGT CT - #G CCT GAC GAT CCC CAC3723His His Met Tyr Trp Leu Leu Val His Ser Le - #u Pro Asp Asp Pro His# 11905- AAC TCT ATT GGA GCA GCG ATG GTG GAT CAG GA - #G TAT GAC GAG TCT CAG3771Asn Ser Ile Gly Ala Ala Met Val Asp Gln Gl - #u Tyr Asp Glu Ser Gln# 12050- GTT ACC CAG GTC CGT TAC TAC CGC CGG AAC AA - #A ATG ATG CTG CGT GCT3819Val Thr Gln Val Arg Tyr Tyr Arg Arg Asn Ly - #s Met Met Leu Arg Ala# 12205- TTA ATG GCG ATT TGC GGC GAA AAG ATG CTT CA - #G CGA TTT ATG TAC CAG3867Leu Met Ala Ile Cys Gly Glu Lys Met Leu Gl - #n Arg Phe Met Tyr Gln# 12401230 - # 1235- CAC CGA ATG TGT CAG AAA CTT ACT ACT ATT GC - #G GAG TCG GTT AAA GAG3915His Arg Met Cys Gln Lys Leu Thr Thr Ile Al - #a Glu Ser Val Lys Glu# 12550- GCT AAG GAG TCG ATG CGT CAA AAA AGC CTA GC - #C GCA GGC ATG GAC GAG3963Ala Lys Glu Ser Met Arg Gln Lys Ser Leu Al - #a Ala Gly Met Asp Glu# 12705- GTG CAC CAA GAC TTA CTG GAG CAA CCC ACT TG - #C CTA CCG CTG GGA CCA4011Val His Gln Asp Leu Leu Glu Gln Pro Thr Cy - #s Leu Pro Leu Gly Pro# 12850- GAA CTG GAG GTA ACT GGA GTG AGT GTG CGT AA - #C TGT AGC TAC TTT AAC4059Glu Leu Glu Val Thr Gly Val Ser Val Arg As - #n Cys Ser Tyr Phe Asn# 13005- TCC AAC ACG CTG CCG CTG AAG ATC AAC TTT GT - #G GGA CCT GAT GCC GAA4107Ser Asn Thr Leu Pro Leu Lys Ile Asn Phe Va - #l Gly Pro Asp Ala Glu# 13201310 - # 1315- TCT TTA CCG GCT ATC TTT AAG TGC GGA GAT GA - #C TTG CAG CAG GAT CAG4155Ser Leu Pro Ala Ile Phe Lys Cys Gly Asp As - #p Leu Gln Gln Asp Gln# 13350- TTA ACT ATA CAG CTA ATT AGG ATT ATG AAC AA - #A ATG TGG TTG GCC GAA4203Leu Thr Ile Gln Leu Ile Arg Ile Met Asn Ly - #s Met Trp Leu Ala Glu# 13505- CGA TTG GAC CTG AAG ATG GTC ACC TTT AAT TG - #T GTG CCT ACG GGA TAC4251Arg Leu Asp Leu Lys Met Val Thr Phe Asn Cy - #s Val Pro Thr Gly Tyr# 13650- AAG AGC GGT ATG ATT GAG CTG GTT AGC GAG GC - #G GAA ACG TTG AGA AAA4299Lys Ser Gly Met Ile Glu Leu Val Ser Glu Al - #a Glu Thr Leu Arg Lys# 13805- ATT CAA GTA GAG TGC GGT CTG ACG GGG TCC TT - #T AAG GAT CGC CCG ATC4347Ile Gln Val Glu Cys Gly Leu Thr Gly Ser Ph - #e Lys Asp Arg Pro Ile# 14001390 - # 1395- GCT GAG TGG TTA GGC AAG CAG AAT CCC AGT CC - #T CTC GAG TAC CAG AGT4395Ala Glu Trp Leu Gly Lys Gln Asn Pro Ser Pr - #o Leu Glu Tyr Gln Ser# 14150- GCT GTG CGA AAT TTT ACG CTA TCC TGT GCT GG - #A TAC AGT GTG GCC ACG4443Ala Val Arg Asn Phe Thr Leu Ser Cys Ala Gl - #y Tyr Ser Val Ala Thr# 14305- TAT GTG CTA GGC ATC TGT GAT CCC CAC AAT GA - #C AAC ATC ATG TTA AAG4491Tyr Val Leu Gly Ile Cys Asp Pro His Asn As - #p Asn Ile Met Leu Lys# 14450- ACT TCG GGT CAC TTG TTT CAC ATT GAC TTT GG - #C AAG TTT CTT GGC GAT4539Thr Ser Gly His Leu Phe His Ile Asp Phe Gl - #y Lys Phe Leu Gly Asp# 14605- GCT CAG ATG TTT GGA AAC TTT AAG AGA GAT CG - #C ACT CCA TTT GTC CTG4587Ala Gln Met Phe Gly Asn Phe Lys Arg Asp Ar - #g Thr Pro Phe Val Leu# 14801470 - # 1475- ACT TCC GAC ATG GCT TAT GTC ATA AAT GGC GG - #C GAT AAG CCC TCC ACA4635Thr Ser Asp Met Ala Tyr Val Ile Asn Gly Gl - #y Asp Lys Pro Ser Thr# 14950- GAC TTT CAC TAT TTC GTG GAC CTA TGT TGT CG - #A GCC TTT AAT ATC GTG4683Asp Phe His Tyr Phe Val Asp Leu Cys Cys Ar - #g Ala Phe Asn Ile Val# 15105- CGG AAA AAT GCT GAT CTA CTC TTG CAC ACC CT - #G GCC CAC ATG GCT ACA4731Arg Lys Asn Ala Asp Leu Leu Leu His Thr Le - #u Ala His Met Ala Thr# 15250- GCA GGC ATG CCG GGA GTA AAC TCC AAT GCT GT - #G CAA TAT GTA CGA CGC4779Ala Gly Met Pro Gly Val Asn Ser Asn Ala Va - #l Gln Tyr Val Arg Arg# 15405- GCC CTA TTG CCA TCT CAA TCG AAT CCC GAG GC - #A GCT GCC ACA TTT GCC4827Ala Leu Leu Pro Ser Gln Ser Asn Pro Glu Al - #a Ala Ala Thr Phe Ala# 15601550 - # 1555- AAG ATG ATT CAA TCC TCT TTG AAA AGC TGG TT - #C ACG CAA TTC AAT TTC4875Lys Met Ile Gln Ser Ser Leu Lys Ser Trp Ph - #e Thr Gln Phe Asn Phe# 15750- TTT CTG CAC AAT CTG GCC CAG ACG CGT TTC AC - #C CCA GAC GAG GGA TCA4923Phe Leu His Asn Leu Ala Gln Thr Arg Phe Th - #r Pro Asp Glu Gly Ser# 15905- GGA GAG CTG CTA TCG TTC GTG CCA CGA AAA TA - #T ACA ATG CAG CAG GAT4971Gly Glu Leu Leu Ser Phe Val Pro Arg Lys Ty - #r Thr Met Gln Gln Asp# 16050- GGT CGC TTG AAG ATT GTA AAG GTG GTG TGT TT - #C CAG AAG CAT TAC AGC5019Gly Arg Leu Lys Ile Val Lys Val Val Cys Ph - #e Gln Lys His Tyr Ser# 16205- ATG GAA AAG TTT TAT ATG TAT ATT CTG GAA GT - #G ACG CGA CAT GGA CAG5067Met Glu Lys Phe Tyr Met Tyr Ile Leu Glu Va - #l Thr Arg His Gly Gln# 16401630 - # 1635- CCC GAT CCG ACA CAT TTG TTC CGG TCA TAT CG - #G GAA TTC ACG GAA TTC5115Pro Asp Pro Thr His Leu Phe Arg Ser Tyr Ar - #g Glu Phe Thr Glu Phe# 16550- CAT CAG AAG TTA TGC ATG CAC TTT CCT TTG GT - #T AAA CTG CAC AGT CTG5163His Gln Lys Leu Cys Met His Phe Pro Leu Va - #l Lys Leu His Ser Leu# 16705- CCG GCT GGT GTG CAT GTG GGC CGT TCC AAT AT - #C AAA TCC GTG GCA GAA5211Pro Ala Gly Val His Val Gly Arg Ser Asn Il - #e Lys Ser Val Ala Glu# 16850- AAA CGA CTA CCT CTT ATA CAG CGA TTT TTG AA - #A TCG TTG TTC GAT GCG5259Lys Arg Leu Pro Leu Ile Gln Arg Phe Leu Ly - #s Ser Leu Phe Asp Ala# 17005- TCC GAG GAA ATA GCC CAT TCC GAG CTC GTT TA - #C ACA TTC TTT CAC CCG5307Ser Glu Glu Ile Ala His Ser Glu Leu Val Ty - #r Thr Phe Phe His Pro# 17201710 - # 1715- CTG CTG CGC GAT CAG CAG GAA GCC AAG CTT GG - #G ATG CCG AAG ATA AAG5355Leu Leu Arg Asp Gln Gln Glu Ala Lys Leu Gl - #y Met Pro Lys Ile Lys# 17350- GAG GTG AAG CAA CAA CCG TCG CGG GAT AAT CC - #C CAC GAG ATT GGC CAA5403Glu Val Lys Gln Gln Pro Ser Arg Asp Asn Pr - #o His Glu Ile Gly Gln# 17505- ATA CGA CTA TCG CTG CAA TAT CAA CGC GGC GT - #A CTT ACT GTG ATG ATA5451Ile Arg Leu Ser Leu Gln Tyr Gln Arg Gly Va - #l Leu Thr Val Met Ile# 17650- CAC CAC GCC AAA GAA CTG CCC ATG TTA CAG GG - #C GGT CAG GAG CCC AAC5499His His Ala Lys Glu Leu Pro Met Leu Gln Gl - #y Gly Gln Glu Pro Asn# 17805- ACA TAT GTG AAG TGC TAC CTA AAA CCG GAT CC - #C AAA AAG GAG ACC AAA5547Thr Tyr Val Lys Cys Tyr Leu Lys Pro Asp Pr - #o Lys Lys Glu Thr Lys# 18001790 - # 1795- CGC AAG ACC AAA GTG GTG CGC AAG ACC TGT GT - #G CCC AGT TTC ATG GAA5595Arg Lys Thr Lys Val Val Arg Lys Thr Cys Va - #l Pro Ser Phe Met Glu# 18150- ACT TTG GAG TAC CGA ATG CCA CTG AAT ATT AT - #T CAA GAG CGC CGC CTT5643Thr Leu Glu Tyr Arg Met Pro Leu Asn Ile Il - #e Gln Glu Arg Arg Leu# 18305- CAG GTT ACG GTT TGG TCG CAC GAC ACC CTG CA - #G GAG AAC GAG CTG CTT5691Gln Val Thr Val Trp Ser His Asp Thr Leu Gl - #n Glu Asn Glu Leu Leu# 18450- GGA GGC TTC GAT ATG GAT CTG TCG AAG TAC GA - #C CTG CGA CAG GAG CTC5739Gly Gly Phe Asp Met Asp Leu Ser Lys Tyr As - #p Leu Arg Gln Glu Leu# 18605- GTC GAC TGG TAT CGC CTG GGC GCG GTG TCC AG - #G AAC TGACCAGATC5785Val Asp Trp Tyr Arg Leu Gly Ala Val Ser Ar - #g Asn1865 1870 - # 1875- CTAGGGACGA GCTATTTTGA ACCTCTTGGG ACACTCTGCC TACCGACAAT CA - #GGCCTAGG5845- ATAATGCCAA TACTAATATA TGTTGTGCCT GTCTTCTTTC GATCGCAATA AT - #ACTTACTT5905- ACTCGAAGTG ATTGTACATT CCATATACCA ATATTAAAAA TAACATAACA GT - #AGTAGTAT5965- TATTTCGTAA AATGTGTGCC TCAAATGTAA ATATTTTATA ATGACCGCAA AC - #AACATTCT6025- TTTGGACATC TGAATGTAAT TATAACTATA AAGTATAGAA CATGCTTACT CT - #ATTTACAT6085- TTAAAATCAA TCAATTTTAT TGTGCACCTT GGGAATTCAG AAAATGAATT AT - #ATTGGTAG6145- TTTGTTTGAA TCGTTCTGTC GTCGGCACCT GGCAATTGTT CTTTTGAAGT AG - #TTAAATAT6205- AAAAGTTCAG TATTATGGCT TAAATTCTAT AAGAGATTAT TAAAAACCTT CT - #AGCTCGCT6265- GGTCTGTAAT ATCTAAAATT AAAACTTGCA CGAAGAATAA TCATTACTAA CT - #TTTTTGCA6325- CTTTTCTAAT TACTTAAAGT AAAAAGAGAA CTAAAATTTC CTAAAGAAAT TA - #GGCATTGC6385- AAGCAGAATA ACGCACAGAT ACAGATTCTT TCTGATTGTA TTTTGTTTGT CA - #CTTAATAT6445- TCACAAAATT GCTTTGTCAA AAGCAAACGC CTGACTGGGT CTAAAACAAA TT - #TACAAAGT6505- TATAGGGAAT TACTATCAGA GAGAACAAGA ACTAAAAGTG TCTTAAAAAT GA - #AACGAATA6565- TTGTAAAATA TATAATAAGA GCACACACAC ACCGCAAACA ACAAATTATA TT - #TTTATAGA6625- AAAAAGAAAC ATTCAAAAGC TACTTCTGCC TGAGCATTTC AAATAGTACT TT - #GATACTGA6685- TTAAAAACTA CCTAAGACGT ATCTGATGTT TTCATAAAAT TATAATTAAT AG - #GAAAAAAT6745- TAAATTTCTG AAGTGTTGAG GAATCGTAAA AATGTTAGCT GGCGGTAATC AC - #TTTTGGCA6805# 6831 AAAA AAGGCA- (2) INFORMATION FOR SEQ ID NO:28:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1876 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:- Met Ser Asn Gln Ala His Ile Asp Tyr Asp Ly - #s Gln Phe Gln Asp Asp# 15- Leu Ala Lys Ala Thr Ala Leu Ser Leu Glu Gl - #n His Ala Leu Asp Asp# 30- Tyr Arg Arg Asn Lys Lys Tyr Gly Ser Gly Ty - #r Gln Gln Ser Ser Thr# 45- Val Ala Gly Arg Asp Tyr Gln Ala Ala Gln Ar - #g Ser Gln Ser Leu His# 60- Gln Pro Arg Arg His Ser Glu Val His Gln Va - #l Ala Ile Ser Pro Glu# 80- Asn Ala Glu Arg Ser Arg Thr Pro Pro Ala Gl - #n Gly Thr Asp Asn Asp# 95- Leu Ile Cys Leu Ala Ser Pro Thr Ser Lys Gl - #n Pro Glu Ser Ser Ser# 110- Pro Phe Gly Lys Leu Ile Glu Asp Leu Gln Ar - #g Met Gln Pro Thr Asn# 125- Pro Gln Ser Ala Leu Val Pro Met Gly Pro Va - #l Ala Ser Ala Ser Ile# 140- Pro Pro Gln Tyr Gly Phe Pro Pro His Gln Gl - #n Arg Pro Thr Ala Ala145 1 - #50 1 - #55 1 -#60- Gln Pro Thr Pro Tyr Gly Met Val Ala Gly Gl - #y Val Val Gly Gly Pro# 175- Ala Tyr Gly Asp Leu Gln Leu Val Pro Tyr Gl - #n Pro Ala Ala Gln Gln# 190- Gln Arg Pro Leu Asn Ser Glu Glu Leu Gln Ar - #g Leu Tyr Ser Met Pro# 205- Ala Gln Met Ala Val Val Pro Val Pro Gln Pr - #o Asn Ala Tyr Met Tyr# 220- Tyr Pro Gly Ala Val Val Thr Pro Tyr Thr Al - #a Pro Ile Val Pro Gly225 2 - #30 2 - #35 2 -#40- Ser Ala Ala Phe Met Pro Pro Gln Tyr Pro Al - #a Gln Gly Tyr Gly Phe# 255- Gly Gly Ala Tyr Thr His Met Asp Leu Arg Ar - #g Pro Gln Ser Gln Pro# 270- Ala Pro Gln Gln Thr Ala Pro Thr Thr Ser Hi - #s His His Ser Gln Pro# 285- Ser Asn His Ser Thr Ser Ser Pro Ala Glu Al - #a Asn Gly Val Ala Phe# 300- Pro Ala Arg Arg Gln Val Pro Ser Thr Val Gl - #y Val Ser Ser Ser Ser305 3 - #10 3 - #15 3 -#20- His Thr Gly Asn Asn Gly His Ser Ser Val Pr - #o Arg Arg Gly Asn Asp# 335- Leu Ile Asp Leu Asn His Glu Asp Tyr Ser Ar - #g Val Ser Val Leu Glu# 350- Ala Phe Asp Pro Leu Leu Asn Asp Asn Thr Gl - #y Asn Asp Thr Ala Ser# 365- Asp Ser Thr Ser Tyr Tyr Ala Glu Tyr Asp Pr - #o Phe Asp Phe Leu Tyr# 380- Ser Gly Asp Ala Ala Thr Gln Tyr Ser Asp Pr - #o Met Tyr Glu Ala Val385 3 - #90 3 - #95 4 -#00- Asn Arg Trp Asp Lys Thr Val Ala Thr Val Se - #r Pro Asn Val Gly Leu# 415- Ile Gly Trp Arg Gln Asp Phe Leu Ser Gln Pr - #o Ser Thr Ser Ser Ser# 430- Gln Tyr Gly Val Ala Pro Pro Glu Glu Ser Le - #u Lys Leu Ala Glu Asn# 445- Gly Ser Glu Thr Ile Ser Pro Pro Pro Pro Le - #u Pro Pro Arg Asn Gln# 460- Gln Cys Tyr Glu Ser Asn Gln Ala Ala Met Pr - #o Val Ser Arg Pro Pro465 4 - #70 4 - #75 4 -#80- Gln Ser Ser Val Leu Thr Asp Ser Tyr Thr Se - #r Ser Ile Pro Ala Asn# 495- Val Val Leu Asp Arg Arg Lys Thr Cys Thr Ar - #g Leu Tyr Glu Leu Ile# 510- Ser Asp Gln Arg Thr Asp Asp Pro Glu Leu Le - #u Glu Phe Tyr His Met# 525- Val Lys Glu Val Arg Ala Arg Tyr Pro His As - #p Asp Ala Pro Thr Asn# 540- Val Gly His Val Val Ala Ala Glu Phe Asn Ty - #r His Tyr Met Met Asp545 5 - #50 5 - #55 5 -#60- Thr Ser Ile Lys Val Ile Val His Pro Ala Le - #u Asn Thr Leu Gln Ser# 575- Thr Val Leu Ala Ala Ser Met Gly Lys Glu Gl - #n Val Lys Gly Tyr Gly# 590- Met Pro Val Thr Phe Thr Cys Asp Ile Asp Se - #r Val Val Ala Gln Val# 605- Val Ala Gln Ala Leu Ala Ser Leu Glu Gly Gl - #n Val Lys Gly Thr Val# 620- Thr Asp Tyr Ala Val Lys Pro Ile Gly Leu Le - #u Glu Trp Leu Ala Pro625 6 - #30 6 - #35 6 -#40- Thr Ser Arg Leu Ser Gln Leu Glu Cys Val Hi - #s Asn Ser Phe Gln Leu# 655- Glu Lys Asp Val His Leu Gly Leu Cys Leu Se - #r Thr Ala Ala Asn Met# 670- Gln Ala Ile Ala Arg Thr Glu Arg Asp Asp Gl - #u His Asp Ala Asp Leu# 685- Leu Pro Glu His Pro Leu Pro Asn Glu Val Va - #l Gln Ile Val Thr Tyr# 700- Asp Asn Met Met Ile Leu Ile Glu Thr Leu Gl - #u Met Glu Ile Asp Lys705 7 - #10 7 - #15 7 -#20- Leu Glu Ser Ala Ala Asp Gly Val Pro Gly Ar - #g Ser Val Val Ser Cys# 735- Ser Gly Val Val Gln Ala Val Lys Ala Ile Cy - #s Ala Leu Leu Gly Ser# 750- Ile Asp Thr Met Glu Ile Ala Arg Cys Val Al - #a Asp Leu Lys Arg Ile# 765- Cys Glu Val Glu Gln Lys Lys Tyr Ser Thr Gl - #y Ala Ser Asn Pro Glu# 780- Ile Val Ser Asp Tyr Gly Asp Tyr Ala Gln Va - #l Val Leu Arg Pro Arg785 7 - #90 7 - #95 8 -#00- Ser Met Leu Glu Gln Ile Lys Val Lys Cys As - #n Glu Leu Arg Asp Ala# 815- Val Gln Glu Leu Val Glu Leu Tyr Ala Asn Va - #l Phe Arg Val Ala Phe# 830- Ser Val Lys Thr Pro Asp Tyr Ser Thr Thr Pr - #o Ile Pro Ile Ser Cys# 845- Val Ser Lys Pro Ile Val Val Cys Ile Ser Cy - #s Leu His Arg Pro Leu# 860- Pro Asn Trp Lys Phe Asp Asp Tyr Ser Leu Cy - #s Val Gln Ile Val Tyr865 8 - #70 8 - #75 8 -#80- Gly Thr Arg Leu Leu Ser Lys Pro Asn Val Le - #u Thr Cys Ser Asn Asp# 895- Thr Ser Gly Gly Leu Phe Pro Arg Leu Asn Ph - #e Ser Ala Trp Leu Thr# 910- Phe Asp Gln His Pro Ile Cys Thr Leu Pro Ar - #g Glu Ala Arg Leu Thr# 925- Phe Val Leu Tyr Gly Lys Gln Ala Ala Ser Gl - #u Gly Glu Pro Asn Ala# 940- Asp Gln Asn Gly Glu Arg Arg Gln Val Thr Th - #r Glu Leu Gly Trp Cys945 9 - #50 9 - #55 9 -#60- Ser Ile Gln Leu Phe Asp Phe Lys Arg Val Me - #t Ile Cys Gly Pro Tyr# 975- Leu Leu Ser Leu Trp Pro Pro Met Thr Asp Ly - #s Met Leu Gly Pro Ala# 990- Pro Ala Arg Gly Cys His Pro Gln Pro Asp Ph - #e Cys Pro Val Leu Ser# 10050- Ile Glu Val Pro Pro Tyr Gly Gly Arg Ile Gl - #u Phe Pro Glu His Gln# 10205- Glu Val Pro Lys Pro Ala Pro His Tyr Asp Ph - #e Ala Ser Leu Asp Ala# 10401030 - # 1035- Asn Leu Gln Glu Glu Leu Leu Asp Thr Ala Gl - #u Leu Gly Tyr Thr Gly# 10550- Ala Thr Glu Arg Arg Glu Val Phe Trp Glu Ly - #s Arg Leu Tyr Leu Gln# 10705- Ser Tyr Pro Asn Ala Leu Pro Lys Val Leu Hi - #s Ala Ala His Ser Trp# 10850- Asp Tyr Ala Asn Leu Ile Asp Leu His Ala Le - #u Leu His Ser Trp Ala# 11005- Pro Leu Ser Pro Leu Gln Ser Leu Glu Leu Le - #u Leu Pro Arg Tyr Pro# 11201110 - # 1115- Asp Ala Lys Val Arg Glu Lys Ala Val Glu Tr - #p Ile Ser Lys Met Pro# 11350- Asn Asp Gln Leu Val Asp Phe Leu Pro Gln Le - #u Val Gln Ser Leu Lys# 11505- His Asp Thr Tyr Glu Gly Ser Ala Met Ala Ar - #g Phe Leu Leu Ser Lys# 11650- Cys Leu Glu Ser Pro Arg Phe Ala His His Me - #t Tyr Trp Leu Leu Val# 11805- His Ser Leu Pro Asp Asp Pro His Asn Ser Il - #e Gly Ala Ala Met Val# 12001190 - # 1195- Asp Gln Glu Tyr Asp Glu Ser Gln Val Thr Gl - #n Val Arg Tyr Tyr Arg# 12150- Arg Asn Lys Met Met Leu Arg Ala Leu Met Al - #a Ile Cys Gly Glu Lys# 12305- Met Leu Gln Arg Phe Met Tyr Gln His Arg Me - #t Cys Gln Lys Leu Thr# 12450- Thr Ile Ala Glu Ser Val Lys Glu Ala Lys Gl - #u Ser Met Arg Gln Lys# 12605- Ser Leu Ala Ala Gly Met Asp Glu Val His Gl - #n Asp Leu Leu Glu Gln# 12801270 - # 1275- Pro Thr Cys Leu Pro Leu Gly Pro Glu Leu Gl - #u Val Thr Gly Val Ser# 12950- Val Arg Asn Cys Ser Tyr Phe Asn Ser Asn Th - #r Leu Pro Leu Lys Ile# 13105- Asn Phe Val Gly Pro Asp Ala Glu Ser Leu Pr - #o Ala Ile Phe Lys Cys# 13250- Gly Asp Asp Leu Gln Gln Asp Gln Leu Thr Il - #e Gln Leu Ile Arg Ile# 13405- Met Asn Lys Met Trp Leu Ala Glu Arg Leu As - #p Leu Lys Met Val Thr# 13601350 - # 1355- Phe Asn Cys Val Pro Thr Gly Tyr Lys Ser Gl - #y Met Ile Glu Leu Val# 13750- Ser Glu Ala Glu Thr Leu Arg Lys Ile Gln Va - #l Glu Cys Gly Leu Thr# 13905- Gly Ser Phe Lys Asp Arg Pro Ile Ala Glu Tr - #p Leu Gly Lys Gln Asn# 14050- Pro Ser Pro Leu Glu Tyr Gln Ser Ala Val Ar - #g Asn Phe Thr Leu Ser# 14205- Cys Ala Gly Tyr Ser Val Ala Thr Tyr Val Le - #u Gly Ile Cys Asp Pro# 14401430 - # 1435- His Asn Asp Asn Ile Met Leu Lys Thr Ser Gl - #y His Leu Phe His Ile# 14550- Asp Phe Gly Lys Phe Leu Gly Asp Ala Gln Me - #t Phe Gly Asn Phe Lys# 14705- Arg Asp Arg Thr Pro Phe Val Leu Thr Ser As - #p Met Ala Tyr Val Ile# 14850- Asn Gly Gly Asp Lys Pro Ser Thr Asp Phe Hi - #s Tyr Phe Val Asp Leu# 15005- Cys Cys Arg Ala Phe Asn Ile Val Arg Lys As - #n Ala Asp Leu Leu Leu# 15201510 - # 1515- His Thr Leu Ala His Met Ala Thr Ala Gly Me - #t Pro Gly Val Asn Ser# 15350- Asn Ala Val Gln Tyr Val Arg Arg Ala Leu Le - #u Pro Ser Gln Ser Asn# 15505- Pro Glu Ala Ala Ala Thr Phe Ala Lys Met Il - #e Gln Ser Ser Leu Lys# 15650- Ser Trp Phe Thr Gln Phe Asn Phe Phe Leu Hi - #s Asn Leu Ala Gln Thr# 15805- Arg Phe Thr Pro Asp Glu Gly Ser Gly Glu Le - #u Leu Ser Phe Val Pro# 16001590 - # 1595- Arg Lys Tyr Thr Met Gln Gln Asp Gly Arg Le - #u Lys Ile Val Lys Val# 16150- Val Cys Phe Gln Lys His Tyr Ser Met Glu Ly - #s Phe Tyr Met Tyr Ile# 16305- Leu Glu Val Thr Arg His Gly Gln Pro Asp Pr - #o Thr His Leu Phe Arg# 16450- Ser Tyr Arg Glu Phe Thr Glu Phe His Gln Ly - #s Leu Cys Met His Phe# 16605- Pro Leu Val Lys Leu His Ser Leu Pro Ala Gl - #y Val His Val Gly Arg# 16801670 - # 1675- Ser Asn Ile Lys Ser Val Ala Glu Lys Arg Le - #u Pro Leu Ile Gln Arg# 16950- Phe Leu Lys Ser Leu Phe Asp Ala Ser Glu Gl - #u Ile Ala His Ser Glu# 17105- Leu Val Tyr Thr Phe Phe His Pro Leu Leu Ar - #g Asp Gln Gln Glu Ala# 17250- Lys Leu Gly Met Pro Lys Ile Lys Glu Val Ly - #s Gln Gln Pro Ser Arg# 17405- Asp Asn Pro His Glu Ile Gly Gln Ile Arg Le - #u Ser Leu Gln Tyr Gln# 17601750 - # 1755- Arg Gly Val Leu Thr Val Met Ile His His Al - #a Lys Glu Leu Pro Met# 17750- Leu Gln Gly Gly Gln Glu Pro Asn Thr Tyr Va - #l Lys Cys Tyr Leu Lys# 17905- Pro Asp Pro Lys Lys Glu Thr Lys Arg Lys Th - #r Lys Val Val Arg Lys# 18050- Thr Cys Val Pro Ser Phe Met Glu Thr Leu Gl - #u Tyr Arg Met Pro Leu# 18205- Asn Ile Ile Gln Glu Arg Arg Leu Gln Val Th - #r Val Trp Ser His Asp# 18401830 - # 1835- Thr Leu Gln Glu Asn Glu Leu Leu Gly Gly Ph - #e Asp Met Asp Leu Ser# 18550- Lys Tyr Asp Leu Arg Gln Glu Leu Val Asp Tr - #p Tyr Arg Leu Gly Ala# 18705- Val Ser Arg Asn 1875- (2) INFORMATION FOR SEQ ID NO:29:- (i) SEQUENCE CHARACTERISTICS:#pairs (A) LENGTH: 5285 base (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: DNA (genomic)- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 3..5180- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 5183..5195- (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 5198..5285- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:- TG CAG AGC TCG GCT GGC CGC GGA GTG AGT CGA - # AGC TCT CCT CAG CGG 47#Arg Ser Ser Pro Gln Argrg Gly Val Ser# 15- CCG GCT GAG CCA GCT GAG GCG GGA GAA AAA CA - #T GGC TCG GAC CTT GGA 95Pro Ala Glu Pro Ala Glu Ala Gly Glu Lys Hi - #s Gly Ser Asp Leu Gly# 30- GGG CGC GAA GGC TCG GGT TGC GGT GAA GAC CA - #A GAC TCC CGC AGC GTG 143Gly Arg Glu Gly Ser Gly Cys Gly Glu Asp Gl - #n Asp Ser Arg Ser Val# 45- AGG TCC TGG TAT TTT GGA AGC TAC AAG AAA AA - #A AGA TTA AGA GGT TTG 191Arg Ser Trp Tyr Phe Gly Ser Tyr Lys Lys Ly - #s Arg Leu Arg Gly Leu# 60- TTC TCT TTT GTG GAC ATG GCT CAG ATT TCC AA - #C AAC AGT GAA TTT AAA 239Phe Ser Phe Val Asp Met Ala Gln Ile Ser As - #n Asn Ser Glu Phe Lys# 75- CAA TGT TCA TCT TCA CAT CCA GAA CCA ATA AG - #A ACC AAA GAT GTG AAC 287Gln Cys Ser Ser Ser His Pro Glu Pro Ile Ar - #g Thr Lys Asp Val Asn# 95- AAA GCA GAA GCG TTA CAG ATG GAA GCA GAA GC - #C TTA GCA AAA CTG CAG 335Lys Ala Glu Ala Leu Gln Met Glu Ala Glu Al - #a Leu Ala Lys Leu Gln# 110- AAG GAT AGA CAA ATG ACT GAC AGC CCA AGA GG - #C TTT GAG CTG TCT AGC 383Lys Asp Arg Gln Met Thr Asp Ser Pro Arg Gl - #y Phe Glu Leu Ser Ser# 125- AGC ACT AGA CAA AGA ACA CAA GGT TTT AAC AA - #A CAG GAT TAT GAT CTC 431Ser Thr Arg Gln Arg Thr Gln Gly Phe Asn Ly - #s Gln Asp Tyr Asp Leu# 140- ATG GTG TTT CCT GAG TTG GAT TCC CAA AAA AG - #A GCA GTA GAT ATT GAT 479Met Val Phe Pro Glu Leu Asp Ser Gln Lys Ar - #g Ala Val Asp Ile Asp# 155- GTA GAA AAG CTC ACC CAG GCT GAA CTT GAG AA - #G ATA TTG CTG GAC GAC 527Val Glu Lys Leu Thr Gln Ala Glu Leu Glu Ly - #s Ile Leu Leu Asp Asp160 1 - #65 1 - #70 1 -#75- AAT TTT GAA ACT AGA AAA CCT CCT GCA TTG CC - #A GTT ACT CCT GTT CTG 575Asn Phe Glu Thr Arg Lys Pro Pro Ala Leu Pr - #o Val Thr Pro Val Leu# 190- AGC CCT TCG TTC TCA ACA CAG CTG TAT CTT AG - #A CCT AGT GGT CAA AGA 623Ser Pro Ser Phe Ser Thr Gln Leu Tyr Leu Ar - #g Pro Ser Gly Gln Arg# 205- GGC CAG TGG CCC CCT GGA TTA TGC GGG CCT TC - #C ACG TAC ACT TTA CCT 671Gly Gln Trp Pro Pro Gly Leu Cys Gly Pro Se - #r Thr Tyr Thr Leu Pro# 220- TCT ACT TAT CCT TCA GCA TAC AGT AAA CAG GC - #C ACA TTC CAG AAT GGC 719Ser Thr Tyr Pro Ser Ala Tyr Ser Lys Gln Al - #a Thr Phe Gln Asn Gly# 235- TTC AGT CCA AGG ATG CCC ACT TTT CCA TCA AC - #A GAG TCT GTA TAT TTA 767Phe Ser Pro Arg Met Pro Thr Phe Pro Ser Th - #r Glu Ser Val Tyr Leu240 2 - #45 2 - #50 2 -#55- AGA CTT CCT GGA CAG TCT CCA TAT TTT TCA TA - #T CCT TTG ACA CCT GCC 815Arg Leu Pro Gly Gln Ser Pro Tyr Phe Ser Ty - #r Pro Leu Thr Pro Ala# 270- ACA CCA TTT CAT CCA CAA GGA AGT TTA CCA GT - #C TAT CGG CCA CTA GTC 863Thr Pro Phe His Pro Gln Gly Ser Leu Pro Va - #l Tyr Arg Pro Leu Val# 285- AGT CCT GAC ATG GCA AAA CTA TTT GAA AAA AT - #A GCA AGT ACC TCA GAA 911Ser Pro Asp Met Ala Lys Leu Phe Glu Lys Il - #e Ala Ser Thr Ser Glu# 300- TTT TTA AAA AAT GGG AAA GCA AGG ACT GAT TT - #G GAG ATA GCA AAC TCG 959Phe Leu Lys Asn Gly Lys Ala Arg Thr Asp Le - #u Glu Ile Ala Asn Ser# 315- AAA GCT TCA GTC TGC AAT CTA CAG ATA TCT CC - #A AAG TCT GAA GAC ATC1007Lys Ala Ser Val Cys Asn Leu Gln Ile Ser Pr - #o Lys Ser Glu Asp Ile320 3 - #25 3 - #30 3 -#35- AAT AAG TTT GAT TGG TTA GAC TTG GAT CCT TG - #G GAT GCT GTT CTT CTT1055Asn Lys Phe Asp Trp Leu Asp Leu Asp Pro Tr - #p Asp Ala Val Leu Leu# 350- GAA GAG AGA TCG CCA AGT TGT CAC CTA GAA AG - #A AAG GTG AAT GGA AAA1103Glu Glu Arg Ser Pro Ser Cys His Leu Glu Ar - #g Lys Val Asn Gly Lys# 365- TCC CTT TCT GGG GCA ACT GTA ACA AGA AGC CA - #G TCT TTA ATC ATT CGG1151Ser Leu Ser Gly Ala Thr Val Thr Arg Ser Gl - #n Ser Leu Ile Ile Arg# 380- ACA GCT CAA TTT ACA AAA GCC CAG GGC CAA GT - #A TCT CAG AAA GAC CCA1199Thr Ala Gln Phe Thr Lys Ala Gln Gly Gln Va - #l Ser Gln Lys Asp Pro# 395- AAT GGG ACC AGT AGT TTG CCA ACT GGA AGT TC - #T CTT CTA CAA GAA TTT1247Asn Gly Thr Ser Ser Leu Pro Thr Gly Ser Se - #r Leu Leu Gln Glu Phe400 4 - #05 4 - #10 4 -#15- GAA GTA CAG AAT GAC GAG GTG GCA GCT TTT TG - #T CAA TCC ATT ATG AAA1295Glu Val Gln Asn Asp Glu Val Ala Ala Phe Cy - #s Gln Ser Ile Met Lys# 430- TTG AAG ACC AAA TTT CCA TAT ACT GAT CAC TG - #C ACA AAT CCA GGC TAT1343Leu Lys Thr Lys Phe Pro Tyr Thr Asp His Cy - #s Thr Asn Pro Gly Tyr# 445- TTG TTA AGT CCA GTG ACA GTG CAA AGA AAC AT - #G TGT GGG GAG AAT GCC1391Leu Leu Ser Pro Val Thr Val Gln Arg Asn Me - #t Cys Gly Glu Asn Ala# 460- AGT GTG AAG GTC TCC ATT GAA ATT GAA GGG CT - #T CAA CTA CCA GTT ACT1439Ser Val Lys Val Ser Ile Glu Ile Glu Gly Le - #u Gln Leu Pro Val Thr# 475- TTT ACA TGT GAT GTG AGT TCT ACT GTA GAA AT - #A ATT ATA ATG CAA GCC1487Phe Thr Cys Asp Val Ser Ser Thr Val Glu Il - #e Ile Ile Met Gln Ala480 4 - #85 4 - #90 4 -#95- CTT TCG TGG GTA CAT GAT GAC TTG AAT CAA GT - #G GAT GTT GGC AGC TAC1535Leu Ser Trp Val His Asp Asp Leu Asn Gln Va - #l Asp Val Gly Ser Tyr# 510- ATT CTG AAA GTT TGT GGT CAA GAG GAG GTT CT - #A CAG AAT AAT CAT TGC1583Ile Leu Lys Val Cys Gly Gln Glu Glu Val Le - #u Gln Asn Asn His Cys# 525- CTT GGA AGT CAC GAA CAT ATT CAA AAT TGT CG - #A AAA TGG GAC ACA GAG1631Leu Gly Ser His Glu His Ile Gln Asn Cys Ar - #g Lys Trp Asp Thr Glu# 540- ATT AAA TTA CAG CTC TTG ACC TTG AGT GCA AT - #G TGC CAG AAT CTG GCT1679Ile Lys Leu Gln Leu Leu Thr Leu Ser Ala Me - #t Cys Gln Asn Leu Ala# 555- CGA ACA GCA GAA GAT GAT GAA GCA CCT GTG GA - #T TTA AAC AAA TAC TTG1727Arg Thr Ala Glu Asp Asp Glu Ala Pro Val As - #p Leu Asn Lys Tyr Leu560 5 - #65 5 - #70 5 -#75- TAT CAA ATA GAA AAA CCT TAT AAA GAA GTC AT - #G ACA AGA CAC CCT GTT1775Tyr Gln Ile Glu Lys Pro Tyr Lys Glu Val Me - #t Thr Arg His Pro Val# 590- GAA GAG CTC TTA GAT TCC TAT CAC TAC CAA GT - #A GAA CTG GCT CTT CAA1823Glu Glu Leu Leu Asp Ser Tyr His Tyr Gln Va - #l Glu Leu Ala Leu Gln# 605- ACT GAA AAC CAG CAC CGA GCT GTT GAT CAA GT - #G ATT AAA GCA GTA AGA1871Thr Glu Asn Gln His Arg Ala Val Asp Gln Va - #l Ile Lys Ala Val Arg# 620- AAA ATT TGT AGT GCT TTA GAT GGG GTG GAG AC - #C CCC TCC GTT ACA GAA1919Lys Ile Cys Ser Ala Leu Asp Gly Val Glu Th - #r Pro Ser Val Thr Glu# 635- GCA GTG AAG AAG TTA AAG CGA GCA GTT AAC CT - #T CCA AGG AAT AAA AGT1967Ala Val Lys Lys Leu Lys Arg Ala Val Asn Le - #u Pro Arg Asn Lys Ser640 6 - #45 6 - #50 6 -#55- GCT GAT GTG ACT TCA TTA TCT GGA AGT GAC AC - #A AGG AAG AAC TCA ACT2015Ala Asp Val Thr Ser Leu Ser Gly Ser Asp Th - #r Arg Lys Asn Ser Thr# 670- AAG GGG TCA CTG AAT CCT GAA AAT CCT GTT CA - #A GTA AGC ATG GAT CAC2063Lys Gly Ser Leu Asn Pro Glu Asn Pro Val Gl - #n Val Ser Met Asp His# 685- CTA ACA ACA CGC ATT TAT GAT CTT CTC AGG CT - #C CAT GCA AAT TCT AGT2111Leu Thr Thr Arg Ile Tyr Asp Leu Leu Arg Le - #u His Ala Asn Ser Ser# 700- AGG TGT TCT ACA GGC TGT CCC CGA GGG AGC AG - #G AAC ATC AAG GAA GCA2159Arg Cys Ser Thr Gly Cys Pro Arg Gly Ser Ar - #g Asn Ile Lys Glu Ala# 715- TGG ACT GCA ACG GAG CAG CTC CAG TTC ACT GT - #C TAT GCC GCA CAC GGA2207Trp Thr Ala Thr Glu Gln Leu Gln Phe Thr Va - #l Tyr Ala Ala His Gly720 7 - #25 7 - #30 7 -#35- ATT TCC AGT AAC TGG GTA TCA AAT TAT GAA AA - #A TAC TAC TTG ATA TGT2255Ile Ser Ser Asn Trp Val Ser Asn Tyr Glu Ly - #s Tyr Tyr Leu Ile Cys# 750- TCC CTG TCT CAC AAT GGG AAG GAT CTT TTT AA - #G CCT ATT CAG TCA AAG2303Ser Leu Ser His Asn Gly Lys Asp Leu Phe Ly - #s Pro Ile Gln Ser Lys# 765- AAG GTT GGC ACG TAC AAG AAT TTC TTC TAT CT - #T ATT AAA TGG GAT GAA2351Lys Val Gly Thr Tyr Lys Asn Phe Phe Tyr Le - #u Ile Lys Trp Asp Glu# 780- CTA ATC ATT TTT CCT ATC CAG ATA TCG CAG TT - #G CCA TTA GAA TCA GTT2399Leu Ile Ile Phe Pro Ile Gln Ile Ser Gln Le - #u Pro Leu Glu Ser Val# 795- CTT CAT CTT ACT CTG TTT GGA GTT TTA AAT CA - #G AGC AGT GGA AGT TCC2447Leu His Leu Thr Leu Phe Gly Val Leu Asn Gl - #n Ser Ser Gly Ser Ser800 8 - #05 8 - #10 8 -#15- CCT GAT TCT AAT AAA CAG AGA AAG GGG CCA GA - #A GCT CTG GGC AAA GTT2495Pro Asp Ser Asn Lys Gln Arg Lys Gly Pro Gl - #u Ala Leu Gly Lys Val# 830- TCT TTA ACT CTA TTT GAT TTT AAA CGG TTT TT - #A ACA TGT GGA ACT AAA2543Ser Leu Thr Leu Phe Asp Phe Lys Arg Phe Le - #u Thr Cys Gly Thr Lys# 845- CTT CTC TAC CTT TGG ACT TCA TCA CAT ACA AA - #T TCT ATT CCT GGA GCA2591Leu Leu Tyr Leu Trp Thr Ser Ser His Thr As - #n Ser Ile Pro Gly Ala# 860- ATC CCC AAA AAA AGC TAT GTC ATG GAA AGA AT - #T GTG CTA CAG GTT GAT2639Ile Pro Lys Lys Ser Tyr Val Met Glu Arg Il - #e Val Leu Gln Val Asp# 875- TTT CCT TCT CCT GCG TTT GAC ATT ATT TAT AC - #A TCT CCT CAA ATT GAT2687Phe Pro Ser Pro Ala Phe Asp Ile Ile Tyr Th - #r Ser Pro Gln Ile Asp880 8 - #85 8 - #90 8 -#95- AGA AAC ATT ATA CAG CAA GAC AAG TTG GAA AC - #A CTG GAG AGT GAT ATA2735Arg Asn Ile Ile Gln Gln Asp Lys Leu Glu Th - #r Leu Glu Ser Asp Ile# 910- AAG GGG AAA CTT CTG GAT ATT ATT CAC AGA GA - #T TCA TCA TTT GGA CTT2783Lys Gly Lys Leu Leu Asp Ile Ile His Arg As - #p Ser Ser Phe Gly Leu# 925- TCT AAA GAA GAT AAG GTC TTT TTG TGG GAA AA - #C CGC TAT TAT TGC CTA2831Ser Lys Glu Asp Lys Val Phe Leu Trp Glu As - #n Arg Tyr Tyr Cys Leu# 940- AAA CAT CCA AAT TGT CTT CCG AAG ATA TTA GC - #A AGT GCT CCA AAC TGG2879Lys His Pro Asn Cys Leu Pro Lys Ile Leu Al - #a Ser Ala Pro Asn Trp# 955- AAG TGG GCT AAT CTT GCC AAA ACT TAC TCA TT - #G CTG CAT CAG TGG CCG2927Lys Trp Ala Asn Leu Ala Lys Thr Tyr Ser Le - #u Leu His Gln Trp Pro960 9 - #65 9 - #70 9 -#75- CCA TTG TGC CCA CTA GCT GCA TTG GAG CTC CT - #T GAT GCA AAA TTT GCT2975Pro Leu Cys Pro Leu Ala Ala Leu Glu Leu Le - #u Asp Ala Lys Phe Ala# 990- GAT CAG GGG GTG CGA TCG CTT GCT GTG AGC TG - #G ATG GAG GCC ATT AGT3023Asp Gln Gly Val Arg Ser Leu Ala Val Ser Tr - #p Met Glu Ala Ile Ser# 10050- GAT GAT GAG CTA GCA GAT CTG CTC CCA CAG TT - #C GTA CAG GCT TTG AAA3071Asp Asp Glu Leu Ala Asp Leu Leu Pro Gln Ph - #e Val Gln Ala Leu Lys# 10205- TAT GAA ATT TAT TTG AAT AGT TCA CTA GTG CG - #C TTC CTT CTG TCC AGG3119Tyr Glu Ile Tyr Leu Asn Ser Ser Leu Val Ar - #g Phe Leu Leu Ser Arg# 10350- GCA TTG GGA AAC ATC CAG ATA GCA CAC AGT TT - #G TAT TGG CTT CTC AAG3167Ala Leu Gly Asn Ile Gln Ile Ala His Ser Le - #u Tyr Trp Leu Leu Lys# 10551045 - # 1050- GAT GCT TTG CAT GAT ACA CAC TTT GGA AGC AG - #A TAT GAA CAT GTG TTG3215Asp Ala Leu His Asp Thr His Phe Gly Ser Ar - #g Tyr Glu His Val Leu# 10705- GGT GCT CTC CTC TCT GTA GGA GGA AAA GGA CT - #C AGA GAA GAG CTT TCT3263Gly Ala Leu Leu Ser Val Gly Gly Lys Gly Le - #u Arg Glu Glu Leu Ser# 10850- AAG CAG ATG AAA CTT GTA CAG CTT TTA GGA GG - #A GTG GCA GAA AAA GTA3311Lys Gln Met Lys Leu Val Gln Leu Leu Gly Gl - #y Val Ala Glu Lys Val# 11005- AGG CAG GCT AGT GGA TCA ACA AGA CAG GTT GT - #C CTC CAA AAG AGT ATG3359Arg Gln Ala Ser Gly Ser Thr Arg Gln Val Va - #l Leu Gln Lys Ser Met# 11150- GAA CGG GTA CAG TCC TTT TTT CTG AGA AAT AA - #A TGC CGT CTT CCT CTC3407Glu Arg Val Gln Ser Phe Phe Leu Arg Asn Ly - #s Cys Arg Leu Pro Leu# 11351125 - # 1130- AAA CCA AGT CTA GTG GCA AAA GAA CTG AAT AT - #T AAG TCA TGT TCG TTC3455Lys Pro Ser Leu Val Ala Lys Glu Leu Asn Il - #e Lys Ser Cys Ser Phe# 11505- TTC AGT TCT AAT GCT ATG CCT CTG AAA GTC AC - #A ATG GTG AAT GCT GAC3503Phe Ser Ser Asn Ala Met Pro Leu Lys Val Th - #r Met Val Asn Ala Asp# 11650- CCT CTG GGG GAA GAA ATT AAT GTC ATG TTT AA - #G GTT GGT GAA GAT CTT3551Pro Leu Gly Glu Glu Ile Asn Val Met Phe Ly - #s Val Gly Glu Asp Leu# 11805- CGG CAA GAT ATG TTA GCT TTA CAG ATG ATA AA - #G ATT ATG GAT AAG ATC3599Arg Gln Asp Met Leu Ala Leu Gln Met Ile Ly - #s Ile Met Asp Lys Ile# 11950- TGG CTT AAA GAG GGA CTG GAT CTG AGG ATG GT - #G ATA TTC AGA TGC CTG3647Trp Leu Lys Glu Gly Leu Asp Leu Arg Met Va - #l Ile Phe Arg Cys Leu# 12151205 - # 1210- TCA ACT GGC CGA GAT CGA GGC ATG GTG GAG CT - #A GTT CCT GCT TCA GAT3695Ser Thr Gly Arg Asp Arg Gly Met Val Glu Le - #u Val Pro Ala Ser Asp# 12305- ACC CTC AGG AAA ATC CAA GTG GAA TAT GGT GT - #A ACA GGA TCC TTT AAA3743Thr Leu Arg Lys Ile Gln Val Glu Tyr Gly Va - #l Thr Gly Ser Phe Lys# 12450- GAT AAA CCA CTT GCT GAG TGG CTG AGG AAA TA - #C AAT CCT TCT GAA GAA3791Asp Lys Pro Leu Ala Glu Trp Leu Arg Lys Ty - #r Asn Pro Ser Glu Glu# 12605- GAA TAT GAA AAG GCT TCT GAG AAC TTT ATC TA - #C TCT TGT GCT GGG TGC3839Glu Tyr Glu Lys Ala Ser Glu Asn Phe Ile Ty - #r Ser Cys Ala Gly Cys# 12750- TGT GTA GCC ACC TAT GTT TTA GGC ATT TGT GA - #T CGG CAC AAT GAC AAT3887Cys Val Ala Thr Tyr Val Leu Gly Ile Cys As - #p Arg His Asn Asp Asn# 12951285 - # 1290- ATA ATG CTT CGA AGC ACA GGA CAC ATG TTC CA - #C ATT GAC TTT GGA AAG3935Ile Met Leu Arg Ser Thr Gly His Met Phe Hi - #s Ile Asp Phe Gly Lys# 13105- TTT TTG GGC CAT GCA CAG ATG TTT GGT AGC TT - #C AAA AGG GAC CGA GCT3983Phe Leu Gly His Ala Gln Met Phe Gly Ser Ph - #e Lys Arg Asp Arg Ala# 13250- CCT TTT GTG CTT ACC TCT GAC ATG GCG TAT GT - #C ATT AAT GGA GGT GAA4031Pro Phe Val Leu Thr Ser Asp Met Ala Tyr Va - #l Ile Asn Gly Gly Glu# 13405- AAG CCC ACC ATT CGT TTC CAG TTG TTT GTG GA - #C CTC TGC TGT CAA GCC4079Lys Pro Thr Ile Arg Phe Gln Leu Phe Val As - #p Leu Cys Cys Gln Ala# 13550- TAC AAC TTG ATA AGA AAG CAA ACA AAC CTC TT - #T CTT AAC CTT CTC TCA4127Tyr Asn Leu Ile Arg Lys Gln Thr Asn Leu Ph - #e Leu Asn Leu Leu Ser# 13751365 - # 1370- CTG ATG ATT CCT TCA GGA TTG CCA GAA CTC AC - #A AGT ATT CAG GAT CTG4175Leu Met Ile Pro Ser Gly Leu Pro Glu Leu Th - #r Ser Ile Gln Asp Leu# 13905- AAA TAT GTT AGA GAT GCA CTT CAG CCC CAA AC - #T ACA GAT GCT GAA GCT4223Lys Tyr Val Arg Asp Ala Leu Gln Pro Gln Th - #r Thr Asp Ala Glu Ala# 14050- ACT ATT TTC TTT ACT AGG CTG ATT GAG TCA AG - #T TTG GGA AGC ATT GCC4271Thr Ile Phe Phe Thr Arg Leu Ile Glu Ser Se - #r Leu Gly Ser Ile Ala# 14205- ACA AAG TTT AAT TTC TTC ATT CAT AAC CTT GC - #T CAG CTA CGT TTT TCT4319Thr Lys Phe Asn Phe Phe Ile His Asn Leu Al - #a Gln Leu Arg Phe Ser# 14350- GGC CTT CCT TCT AAT GAT GAG CCC ATC CTT TC - #A TTC TCA CCG AAA ACA4367Gly Leu Pro Ser Asn Asp Glu Pro Ile Leu Se - #r Phe Ser Pro Lys Thr# 14551445 - # 1450- TAC TCC TTT AGA CAA GAT GGC CGG ATC AAG GA - #A GTC TCT GTT TTC ACA4415Tyr Ser Phe Arg Gln Asp Gly Arg Ile Lys Gl - #u Val Ser Val Phe Thr# 14705- TAT CAT AAG AAA TAC AAC CCA GAT AAA CAC TA - #T ATT TAT GTG GTT CGA4463Tyr His Lys Lys Tyr Asn Pro Asp Lys His Ty - #r Ile Tyr Val Val Arg# 14850- ATT CTA AGA GAA GGA CAC CTT GAA CCA TCA TT - #T GTA TTC CGG ACA TTT4511Ile Leu Arg Glu Gly His Leu Glu Pro Ser Ph - #e Val Phe Arg Thr Phe# 15005- GAT GAA TTT CAG GAA CTT CAC AAT AAG CTC AG - #T ATT ATT TTT CCT CTT4559Asp Glu Phe Gln Glu Leu His Asn Lys Leu Se - #r Ile Ile Phe Pro Leu# 15150- TGG AAA TTA CCT GGC TTT CCT AAT AGG ATG GT - #T CTT GGA AGA ACA CAC4607Trp Lys Leu Pro Gly Phe Pro Asn Arg Met Va - #l Leu Gly Arg Thr His# 15351525 - # 1530- ATA AAA GAT GTT GCA GCC AAG AGG AAA ATT GA - #A TTA AAC AGT TAT TTA4655Ile Lys Asp Val Ala Ala Lys Arg Lys Ile Gl - #u Leu Asn Ser Tyr Leu# 15505- CAG AGT TTG ATG AAT GCA TCA ACA GAT GTA GC - #A GAG TGT GAT CTT GTT4703Gln Ser Leu Met Asn Ala Ser Thr Asp Val Al - #a Glu Cys Asp Leu Val# 15650- TGT ACT TTT TTC CAC CCT TTA CTT CGT GAT GA - #G AAA GCT GAA GGA ATA4751Cys Thr Phe Phe His Pro Leu Leu Arg Asp Gl - #u Lys Ala Glu Gly Ile# 15805- GCT AGG TCT GCA GGT GCA GTT CCC TTC AGC CC - #A ACT CTG GGC CAA ATA4799Ala Arg Ser Ala Gly Ala Val Pro Phe Ser Pr - #o Thr Leu Gly Gln Ile# 15950- GGA GGA GCA GTG AAG TTA TCT GTT TCT TAC CG - #A AAT GGC ACC CTC TTC4847Gly Gly Ala Val Lys Leu Ser Val Ser Tyr Ar - #g Asn Gly Thr Leu Phe# 16151605 - # 1610- ATC ATG GTG ATG CAC ATC AAA GAT CTT GTG AC - #T GAA GAT GGG GCT GAC4895Ile Met Val Met His Ile Lys Asp Leu Val Th - #r Glu Asp Gly Ala Asp# 16305- CCA AAT CCC TAT GTC AAA ACA TAC CTG CTT CC - #A GAT ACC CAC AAA ACG4943Pro Asn Pro Tyr Val Lys Thr Tyr Leu Leu Pr - #o Asp Thr His Lys Thr# 16450- TCA AAA CGT AAA ACC AAA ATT TCA CGT AAA AC - #T AGG AAC CCA ACA TTC4991Ser Lys Arg Lys Thr Lys Ile Ser Arg Lys Th - #r Arg Asn Pro Thr Phe# 16605- AAT GAA ATG CTT GTA TAT AGT GGA TAC AGC AA - #A GAA ACT CTG AGG CAG5039Asn Glu Met Leu Val Tyr Ser Gly Tyr Ser Ly - #s Glu Thr Leu Arg Gln# 16750- AGA GAA CTT CAA CTG AGT GTA CTC AGT GCA GA - #A TCA CTG CGG GAG AAT5087Arg Glu Leu Gln Leu Ser Val Leu Ser Ala Gl - #u Ser Leu Arg Glu Asn# 16951685 - # 1690- TTC TTC TTG GGT GGA ATA ACC CTG CCA CTG AA - #A GAT TTC AAC TTG AGC5135Phe Phe Leu Gly Gly Ile Thr Leu Pro Leu Ly - #s Asp Phe Asn Leu Ser# 17105- AAA GAG ACA GTT AAG TGG TAT CAG CTG ACT GC - #G GCA ACG TAT CTA TAA5183Lys Glu Thr Val Lys Trp Tyr Gln Leu Thr Al - #a Ala Thr Tyr Leu# 17250- ACT TCC GAC TTC TGA GCT TTG GAA ACA AGG AG - #T TAT AAA TGT GTG CGC5231#Arg Ser Tyr Lys Cys Val ArgGlu Thr# 17405- ATG CGC ACA TAC ACA CAC TTG GGA ACT TTG TA - #T AAT TTC ATA CTT TGG5279Met Arg Thr Tyr Thr His Leu Gly Thr Leu Ty - #r Asn Phe Ile Leu Trp# 17550# 5285Gln Pro1760- (2) INFORMATION FOR SEQ ID NO:30:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 1726 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:- Gln Ser Ser Ala Gly Arg Gly Val Ser Arg Se - #r Ser Pro Gln Arg Pro# 15- Ala Glu Pro Ala Glu Ala Gly Glu Lys His Gl - #y Ser Asp Leu Gly Gly# 30- Arg Glu Gly Ser Gly Cys Gly Glu Asp Gln As - #p Ser Arg Ser Val Arg# 45- Ser Trp Tyr Phe Gly Ser Tyr Lys Lys Lys Ar - #g Leu Arg Gly Leu Phe# 60- Ser Phe Val Asp Met Ala Gln Ile Ser Asn As - #n Ser Glu Phe Lys Gln# 80- Cys Ser Ser Ser His Pro Glu Pro Ile Arg Th - #r Lys Asp Val Asn Lys# 95- Ala Glu Ala Leu Gln Met Glu Ala Glu Ala Le - #u Ala Lys Leu Gln Lys# 110- Asp Arg Gln Met Thr Asp Ser Pro Arg Gly Ph - #e Glu Leu Ser Ser Ser# 125- Thr Arg Gln Arg Thr Gln Gly Phe Asn Lys Gl - #n Asp Tyr Asp Leu Met# 140- Val Phe Pro Glu Leu Asp Ser Gln Lys Arg Al - #a Val Asp Ile Asp Val145 1 - #50 1 - #55 1 -#60- Glu Lys Leu Thr Gln Ala Glu Leu Glu Lys Il - #e Leu Leu Asp Asp Asn# 175- Phe Glu Thr Arg Lys Pro Pro Ala Leu Pro Va - #l Thr Pro Val Leu Ser# 190- Pro Ser Phe Ser Thr Gln Leu Tyr Leu Arg Pr - #o Ser Gly Gln Arg Gly# 205- Gln Trp Pro Pro Gly Leu Cys Gly Pro Ser Th - #r Tyr Thr Leu Pro Ser# 220- Thr Tyr Pro Ser Ala Tyr Ser Lys Gln Ala Th - #r Phe Gln Asn Gly Phe225 2 - #30 2 - #35 2 -#40- Ser Pro Arg Met Pro Thr Phe Pro Ser Thr Gl - #u Ser Val Tyr Leu Arg# 255- Leu Pro Gly Gln Ser Pro Tyr Phe Ser Tyr Pr - #o Leu Thr Pro Ala Thr# 270- Pro Phe His Pro Gln Gly Ser Leu Pro Val Ty - #r Arg Pro Leu Val Ser# 285- Pro Asp Met Ala Lys Leu Phe Glu Lys Ile Al - #a Ser Thr Ser Glu Phe# 300- Leu Lys Asn Gly Lys Ala Arg Thr Asp Leu Gl - #u Ile Ala Asn Ser Lys305 3 - #10 3 - #15 3 -#20- Ala Ser Val Cys Asn Leu Gln Ile Ser Pro Ly - #s Ser Glu Asp Ile Asn# 335- Lys Phe Asp Trp Leu Asp Leu Asp Pro Trp As - #p Ala Val Leu Leu Glu# 350- Glu Arg Ser Pro Ser Cys His Leu Glu Arg Ly - #s Val Asn Gly Lys Ser# 365- Leu Ser Gly Ala Thr Val Thr Arg Ser Gln Se - #r Leu Ile Ile Arg Thr# 380- Ala Gln Phe Thr Lys Ala Gln Gly Gln Val Se - #r Gln Lys Asp Pro Asn385 3 - #90 3 - #95 4 -#00- Gly Thr Ser Ser Leu Pro Thr Gly Ser Ser Le - #u Leu Gln Glu Phe Glu# 415- Val Gln Asn Asp Glu Val Ala Ala Phe Cys Gl - #n Ser Ile Met Lys Leu# 430- Lys Thr Lys Phe Pro Tyr Thr Asp His Cys Th - #r Asn Pro Gly Tyr Leu# 445- Leu Ser Pro Val Thr Val Gln Arg Asn Met Cy - #s Gly Glu Asn Ala Ser# 460- Val Lys Val Ser Ile Glu Ile Glu Gly Leu Gl - #n Leu Pro Val Thr Phe465 4 - #70 4 - #75 4 -#80- Thr Cys Asp Val Ser Ser Thr Val Glu Ile Il - #e Ile Met Gln Ala Leu# 495- Ser Trp Val His Asp Asp Leu Asn Gln Val As - #p Val Gly Ser Tyr Ile# 510- Leu Lys Val Cys Gly Gln Glu Glu Val Leu Gl - #n Asn Asn His Cys Leu# 525- Gly Ser His Glu His Ile Gln Asn Cys Arg Ly - #s Trp Asp Thr Glu Ile# 540- Lys Leu Gln Leu Leu Thr Leu Ser Ala Met Cy - #s Gln Asn Leu Ala Arg545 5 - #50 5 - #55 5 -#60- Thr Ala Glu Asp Asp Glu Ala Pro Val Asp Le - #u Asn Lys Tyr Leu Tyr# 575- Gln Ile Glu Lys Pro Tyr Lys Glu Val Met Th - #r Arg His Pro Val Glu# 590- Glu Leu Leu Asp Ser Tyr His Tyr Gln Val Gl - #u Leu Ala Leu Gln Thr# 605- Glu Asn Gln His Arg Ala Val Asp Gln Val Il - #e Lys Ala Val Arg Lys# 620- Ile Cys Ser Ala Leu Asp Gly Val Glu Thr Pr - #o Ser Val Thr Glu Ala625 6 - #30 6 - #35 6 -#40- Val Lys Lys Leu Lys Arg Ala Val Asn Leu Pr - #o Arg Asn Lys Ser Ala# 655- Asp Val Thr Ser Leu Ser Gly Ser Asp Thr Ar - #g Lys Asn Ser Thr Lys# 670- Gly Ser Leu Asn Pro Glu Asn Pro Val Gln Va - #l Ser Met Asp His Leu# 685- Thr Thr Arg Ile Tyr Asp Leu Leu Arg Leu Hi - #s Ala Asn Ser Ser Arg# 700- Cys Ser Thr Gly Cys Pro Arg Gly Ser Arg As - #n Ile Lys Glu Ala Trp705 7 - #10 7 - #15 7 -#20- Thr Ala Thr Glu Gln Leu Gln Phe Thr Val Ty - #r Ala Ala His Gly Ile# 735- Ser Ser Asn Trp Val Ser Asn Tyr Glu Lys Ty - #r Tyr Leu Ile Cys Ser# 750- Leu Ser His Asn Gly Lys Asp Leu Phe Lys Pr - #o Ile Gln Ser Lys Lys# 765- Val Gly Thr Tyr Lys Asn Phe Phe Tyr Leu Il - #e Lys Trp Asp Glu Leu# 780- Ile Ile Phe Pro Ile Gln Ile Ser Gln Leu Pr - #o Leu Glu Ser Val Leu785 7 - #90 7 - #95 8 -#00- His Leu Thr Leu Phe Gly Val Leu Asn Gln Se - #r Ser Gly Ser Ser Pro# 815- Asp Ser Asn Lys Gln Arg Lys Gly Pro Glu Al - #a Leu Gly Lys Val Ser# 830- Leu Thr Leu Phe Asp Phe Lys Arg Phe Leu Th - #r Cys Gly Thr Lys Leu# 845- Leu Tyr Leu Trp Thr Ser Ser His Thr Asn Se - #r Ile Pro Gly Ala Ile# 860- Pro Lys Lys Ser Tyr Val Met Glu Arg Ile Va - #l Leu Gln Val Asp Phe865 8 - #70 8 - #75 8 -#80- Pro Ser Pro Ala Phe Asp Ile Ile Tyr Thr Se - #r Pro Gln Ile Asp Arg# 895- Asn Ile Ile Gln Gln Asp Lys Leu Glu Thr Le - #u Glu Ser Asp Ile Lys# 910- Gly Lys Leu Leu Asp Ile Ile His Arg Asp Se - #r Ser Phe Gly Leu Ser# 925- Lys Glu Asp Lys Val Phe Leu Trp Glu Asn Ar - #g Tyr Tyr Cys Leu Lys# 940- His Pro Asn Cys Leu Pro Lys Ile Leu Ala Se - #r Ala Pro Asn Trp Lys945 9 - #50 9 - #55 9 -#60- Trp Ala Asn Leu Ala Lys Thr Tyr Ser Leu Le - #u His Gln Trp Pro Pro# 975- Leu Cys Pro Leu Ala Ala Leu Glu Leu Leu As - #p Ala Lys Phe Ala Asp# 990- Gln Gly Val Arg Ser Leu Ala Val Ser Trp Me - #t Glu Ala Ile Ser Asp# 10050- Asp Glu Leu Ala Asp Leu Leu Pro Gln Phe Va - #l Gln Ala Leu Lys Tyr# 10205- Glu Ile Tyr Leu Asn Ser Ser Leu Val Arg Ph - #e Leu Leu Ser Arg Ala# 10401030 - # 1035- Leu Gly Asn Ile Gln Ile Ala His Ser Leu Ty - #r Trp Leu Leu Lys Asp# 10550- Ala Leu His Asp Thr His Phe Gly Ser Arg Ty - #r Glu His Val Leu Gly# 10705- Ala Leu Leu Ser Val Gly Gly Lys Gly Leu Ar - #g Glu Glu Leu Ser Lys# 10850- Gln Met Lys Leu Val Gln Leu Leu Gly Gly Va - #l Ala Glu Lys Val Arg# 11005- Gln Ala Ser Gly Ser Thr Arg Gln Val Val Le - #u Gln Lys Ser Met Glu# 11201110 - # 1115- Arg Val Gln Ser Phe Phe Leu Arg Asn Lys Cy - #s Arg Leu Pro Leu Lys# 11350- Pro Ser Leu Val Ala Lys Glu Leu Asn Ile Ly - #s Ser Cys Ser Phe Phe# 11505- Ser Ser Asn Ala Met Pro Leu Lys Val Thr Me - #t Val Asn Ala Asp Pro# 11650- Leu Gly Glu Glu Ile Asn Val Met Phe Lys Va - #l Gly Glu Asp Leu Arg# 11805- Gln Asp Met Leu Ala Leu Gln Met Ile Lys Il - #e Met Asp Lys Ile Trp# 12001190 - # 1195- Leu Lys Glu Gly Leu Asp Leu Arg Met Val Il - #e Phe Arg Cys Leu Ser# 12150- Thr Gly Arg Asp Arg Gly Met Val Glu Leu Va - #l Pro Ala Ser Asp Thr# 12305- Leu Arg Lys Ile Gln Val Glu Tyr Gly Val Th - #r Gly Ser Phe Lys Asp# 12450- Lys Pro Leu Ala Glu Trp Leu Arg Lys Tyr As - #n Pro Ser Glu Glu Glu# 12605- Tyr Glu Lys Ala Ser Glu Asn Phe Ile Tyr Se - #r Cys Ala Gly Cys Cys# 12801270 - # 1275- Val Ala Thr Tyr Val Leu Gly Ile Cys Asp Ar - #g His Asn Asp Asn Ile# 12950- Met Leu Arg Ser Thr Gly His Met Phe His Il - #e Asp Phe Gly Lys Phe# 13105- Leu Gly His Ala Gln Met Phe Gly Ser Phe Ly - #s Arg Asp Arg Ala Pro# 13250- Phe Val Leu Thr Ser Asp Met Ala Tyr Val Il - #e Asn Gly Gly Glu Lys# 13405- Pro Thr Ile Arg Phe Gln Leu Phe Val Asp Le - #u Cys Cys Gln Ala Tyr# 13601350 - # 1355- Asn Leu Ile Arg Lys Gln Thr Asn Leu Phe Le - #u Asn Leu Leu Ser Leu# 13750- Met Ile Pro Ser Gly Leu Pro Glu Leu Thr Se - #r Ile Gln Asp Leu Lys# 13905- Tyr Val Arg Asp Ala Leu Gln Pro Gln Thr Th - #r Asp Ala Glu Ala Thr# 14050- Ile Phe Phe Thr Arg Leu Ile Glu Ser Ser Le - #u Gly Ser Ile Ala Thr# 14205- Lys Phe Asn Phe Phe Ile His Asn Leu Ala Gl - #n Leu Arg Phe Ser Gly# 14401430 - # 1435- Leu Pro Ser Asn Asp Glu Pro Ile Leu Ser Ph - #e Ser Pro Lys Thr Tyr# 14550- Ser Phe Arg Gln Asp Gly Arg Ile Lys Glu Va - #l Ser Val Phe Thr Tyr# 14705- His Lys Lys Tyr Asn Pro Asp Lys His Tyr Il - #e Tyr Val Val Arg Ile# 14850- Leu Arg Glu Gly His Leu Glu Pro Ser Phe Va - #l Phe Arg Thr Phe Asp# 15005- Glu Phe Gln Glu Leu His Asn Lys Leu Ser Il - #e Ile Phe Pro Leu Trp# 15201510 - # 1515- Lys Leu Pro Gly Phe Pro Asn Arg Met Val Le - #u Gly Arg Thr His Ile# 15350- Lys Asp Val Ala Ala Lys Arg Lys Ile Glu Le - #u Asn Ser Tyr Leu Gln# 15505- Ser Leu Met Asn Ala Ser Thr Asp Val Ala Gl - #u Cys Asp Leu Val Cys# 15650- Thr Phe Phe His Pro Leu Leu Arg Asp Glu Ly - #s Ala Glu Gly Ile Ala# 15805- Arg Ser Ala Gly Ala Val Pro Phe Ser Pro Th - #r Leu Gly Gln Ile Gly# 16001590 - # 1595- Gly Ala Val Lys Leu Ser Val Ser Tyr Arg As - #n Gly Thr Leu Phe Ile# 16150- Met Val Met His Ile Lys Asp Leu Val Thr Gl - #u Asp Gly Ala Asp Pro# 16305- Asn Pro Tyr Val Lys Thr Tyr Leu Leu Pro As - #p Thr His Lys Thr Ser# 16450- Lys Arg Lys Thr Lys Ile Ser Arg Lys Thr Ar - #g Asn Pro Thr Phe Asn# 16605- Glu Met Leu Val Tyr Ser Gly Tyr Ser Lys Gl - #u Thr Leu Arg Gln Arg# 16801670 - # 1675- Glu Leu Gln Leu Ser Val Leu Ser Ala Glu Se - #r Leu Arg Glu Asn Phe# 16950- Phe Leu Gly Gly Ile Thr Leu Pro Leu Lys As - #p Phe Asn Leu Ser Lys# 17105- Glu Thr Val Lys Trp Tyr Gln Leu Thr Ala Al - #a Thr Tyr Leu# 17250- (2) INFORMATION FOR SEQ ID NO:31:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 4 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:- Thr Ser Asp Phe- (2) INFORMATION FOR SEQ ID NO:32:- (i) SEQUENCE CHARACTERISTICS:#acids (A) LENGTH: 29 amino (B) TYPE: amino acid (D) TOPOLOGY: linear- (ii) MOLECULE TYPE: protein- (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:- Ala Leu Glu Thr Arg Ser Tyr Lys Cys Val Ar - #g Met Arg Thr Tyr Thr# 15- His Leu Gly Thr Leu Tyr Asn Phe Ile Leu Tr - #p Gln Pro# 25__________________________________________________________________________
Claims
  • 1. A substantially pure PI 3-kinase polypeptide, said polypeptide being capable of phosphorylating a D3 hydroxyl of an inositol ring in PtdIns and PtdIns4P but not PtdIns(4,5)P.sub.2.
  • 2. The polypeptide of claim 1, wherein said polypeptide further comprises a C2 domain.
  • 3. The polypeptide of claim 1, wherein said polypeptide has a molecular weight of approximately 210 kDa, wherein said molecular weight is determined by an SDS-PAGE technique.
  • 4. A substantially pure polypeptide, said polypeptide being encoded by a nucleic acid sequence that is capable of hybridizing with a nucleic acid probe selected from the group consisting of: 5'-GA(AGC)GA(C)(AC)T(ATC) (C)G(GCT)CA(G)GA-3' (SEQ ID NO:1); 5'-CC(GA)AA(GA)TC(TGA)AT (GA)TG (TGA)A(AT)-3' (SEQ ID NO:2); 5'-AA(AG)(AG)IIGGIGAIGA(CT) TI(AC)GICA(AG)GA-3' (SEQ ID NO:3); and 5'-T(ACG)ICC(AG)AA(AG)TCI (AG)(CT)(AG)TGIA(AT)IA-3' (SEQ ID NO:4).
  • 5. A substantially pure polypeptide, said polypeptide capable of interacting with a phosphatidyl inositol substrate, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
  • 6. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
  • 7. The polypeptide of claim 5, wherein said polypeptide comprises a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
  • 8. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence encoding a PI 3-kinase domain of a PI 3-kinase protein selected from cpk and cpk-m.
  • 9. The polypeptide of claim 8, wherein said polypeptide comprises an amino acid sequence corresponding to amino acids 863-1587 of a cpk amino acid sequence.
  • 10. The polypeptide of claim 5, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence which encodes an amino acid sequence selected from the group consisting of NH.sub.2 -CQGQVSQKDPNGTSS-COOH (SEQ ID NO:8), NH.sub.2 -CRQDFLSQPSTSSSQY-COOH (SEQ ID NO:7), acylated and amidated forms thereof.
  • 11. The polypeptide of claim 5, wherein said polypeptide comprises a C2 domain.
  • 12. The polypeptide of claim 5, wherein said polypeptide is isolatable from Drosophila.
  • 13. The polypeptide of claim 5, wherein said polypeptide is isolatable from a mouse.
  • 14. A substantially pure polypeptide of claim 1, said polypeptide being specifically immunoreactive with an antibody raised against a cpk or cpk-m polypeptide or immunologically active fragment thereof.
  • 15. A substantially pure polypeptide, said polypeptide being capable of inhibiting the interaction between a PI 3-kinase selected from the group consisting of cpk and cpk-m, and a phosphatidyl inositol substrate selected from the group consisting of PtdIns and PtdIns4P, said polypeptide comprising an amino acid sequence that is encoded by a nucleic acid sequence that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of the nucleic acid sequence of cpk, as shown in FIG. 9 (SEQ ID NOS:27-28), and cpk-m, as shown in FIG. 10 (SEQ ID NOS:29-30).
  • 16. A substantially pure polypeptide, said polypeptide capable of interacting with a phosphatidyl inositol substrate, wherein said polypeptide comprises an amino acid sequence that is encoded by a nucleic acid sequence which hybridizes under stringent conditions to a nucleic acid sequence which encodes an amino acid sequence selected from the group consisting of cpk and cpk-m shown in FIG. 1 (SEQ ID Nos: 12-13).
Foreign Referenced Citations (1)
Number Date Country
9321328 Oct 1993 WOX
Non-Patent Literature Citations (44)
Entry
Auger et al., "PDGF-Dependent Tyrosine Phosphorylation Stimulates Production of Novel Polyphosphoinositides in Intact Cells," Cell, 57:167-175 (1989).
Brown et al., "Functional cDNA Libraries from Drosophila Embryos," J. Mol. Biol., 203:425-437 (1988).
Carpenter et al., "Purification and Characterization of Phosphoinositide 3-Kinase from Rat Liver," J. Biol. Chem., 265(32):19704-19711 (1990).
Carter et al., "Phosphatidylinositol 3,4,5-triphosphate is formed from phosphatidylinositol 4,5-bisphosphate in thrombin-stimulated platelets," Biochem. J. 301:415-420 (1994).
Dhand et al., "PI 3-kinase is a dual specificify enzyme: autoregulation by an intrinsic protein-serine kinase activity," EMBO J., 13(3):522-533 (1994).
Franke et al., "The Protein Kinase Encoded by the Akt Proto-Oncogene is a Target of the PDGF-Activated Phosphatidylinositol 3-Kinase," Cell, 81:727-736 (1995).
Fry et al., "Purification and characterization of a phosphatidylinositol 3-kinase complex from bovine brain by using phosphopeptide affinity columns," Biochem J., 288:383-393 (1992).
Hawkins et al.,"Platelet-derived growth factor stimulates synthesis of PtdIns(3,4,5)P.sub.3 by activating a PtdIns(4,5)P.sub.2 3-OH kinase," Nature, 358:157-159 (1992).
Herman et al., "Characterization of VPS34, a Gene Required for Vacuolar Protein Sorting and Vacuole Segregation in Saccaromyces cerevisiae," Mol. Cell Biol., 10(12):6742-6754 (1990).
Hiles et al., "Phosphatidylinositol 3-Kinase: Structure and Expression of the 110 kd Catalytic Subunit," Cell, 70:419-429 (1992).
Holt et al., "Phosphatidylinositol 3-Kinase Activation is mediated by High-Affinity Interactions between Distinct Domains within the p110 and p85 Subunits," Mol. Cell. Biol., 14(1):42-49 (1994).
Hu et al., "Interaction of Phosphatidylinositol 3-Kinase-Associated p85 with Epidermal Growth Factor and Platelet-Derived Growth Factor Receptors," Mol. Cell Biol., 12(3):981-990 (1992).
Hu et al., "Ras-Dependent Induction of Cellular Responses by Constitutively Active Phosphatidylinositol-3 Kinase," Science, 268:100-102 (1995).
Kapellar and Cantley, "Phosphatidylinositol 3-Kinase," Bioessays, 16(8):565-576 (1994).
Kaplan et al., "Common Elements in Growth Factor Stimulation and Oncogenic Transformation: 85 kd Phosphoprotein and Phosphatidylinositol Kinase Activity," Cell, 50:1021-1029 (1987).
Klippel et al., "The Interaction of Small Domains between the Subunits of Phosphatidylinositol 3-Kinase Determines Enzyme Activity," Mol. Cell Biol., 14(4):2675-2685 (1994).
Kunz et al., "Target of Rapamycin in Yeast, TOR2, Is an Essential Phosphatidylinositol Kinase Homolog Required for G.sub.1 Progression," Cell, 73:585-596 (1993).
MacDougall et al., "A family of phosphoinositide 3-kinases in Drosophila identifies a new mediator of signal transduction," Current Biology, 5(12):1404-1415 (1995).
McGlade et al., "SH2 Domains of the p85.alpha. Subunit of Phosphatidylinositol 3-Kinase Regulate Binding to Growth Factor Receptors," Mol. Cell Biol. 12(3):991-997 (1992).
Metzger et al., "The human oestrogen receptor functions in yeast," Nature, 334:31-36 (1988).
Morgan et al., "Purification and characterization of bovine brain type I phosphatidylinositol kinase," Eur. J. Biochem., 191:761-767 (1990).
Nakanishi et al., "Activation of the .zeta. Isozyme of Protein Kinase C by Phosphatidylinositol 3,4,5-Trisphosphate," J. Biol. Chem., 268(1):13-16 (1993).
Reedijk et al., "Tyr721 regulates specific binding of the CSF-1 receptor kinase insert of PI 3'-kinase SH2 domains: a model for SH2-mediated receptor-target interactions," EMBO J., 11(4):1365-1372 (1992).
Schu et al., "Phosphatidylinositol e-Kinase Encoded by Yeast VPS34 Gene Essential for Protein Sorting," Science, 260:88-91 (1993).
Shibasaki et al., "Two Types of Phosphatidylinositol 3- Kinase from Bovine Thymus," J. Biol. Chem., 266(13):8108-8114 (1991).
Stephens et al., "Pathway of phosphatidylinositol(3,4,5)-triphosphate synthesis in activated neutrophils," Nature, 351:33-39 (1991).
Stephens et al., "Agonist-stimulated synthesis of phosphatidylinositol(3,4,5)-trisphosphate: a new intracellular signalling system?," Biochim. Biophys. Acta, 1179:27-75 (1993).
Toker et al., Activation of Protein Kinase C Family Members by the Novel Polyphosphoinositides PtdIns-3,4-P.sub.2 and PtdIns-3,4,5-P.sub.3 J. Biol. Chem., 269(51):32358-32367 (1994).
Traynor-Kaplan et al., "An inositol tetrakisphosphate-containing phospholipid in activated neutrophils," Nature, 334:353-356 (1988).
Traynor-Kaplan et al., "Transient Increase in Phosphatidylinositol 3,4-Bisphosphate and Phosphatidylinositol Trisphosphate during Activation of Human Neutrophils," J. Biol. Chem., 264(26):15668-15673 (1989).
Whitman et al., "Type I phosphatidylinositol kinase makes a novel inositol phospholipid, phosphatidylinositol-3-phosphate," Nature, 322;644-646 (1988).
Yoakim, "Interactions of Polyomavirus Middle T with the SH2 Domains of the pp85 Subunit of Phosphatidylinositol-3-Kinase," J. Virol., 66(9):5485-5491 (1992).
Yonezawa et al., "Insulin-dependent Formation of a Complex Containing an 85-kDa Subunit of PHosphatidylinositol 3-kinase and Tyrosine-phosphorylated Insulin Receptor Substrate 1," J. Biol. Chem., 267(36):25958-25966 (1992).
Databases EST-STS and n-geneseq, Apr. 1997, relevant hits.
Molz, L. et al., "Cpk is a Novel Class of Drosophila PtdIns 3-Kinase Containing a C2 Domain," J. Biol. Chem. 271(23):13892-13899 (1996).
Virbasius, J.V. et al., "Mouse p170 is a Novel Phosphatidylinositol 3-Kinase Containing a C2 Domain," J. Biol. Chem. 271(23):13304-13307 (1996).
Zvelebil, M.J. et al., "Structural and Functional Diversity of Phosphoinositide 3-kinases," Phil. Trans. R. Soc. Lond. B., 351:217-223 (1996).
Vanhaesebroeck, B. et al., "The Study of Phosphoinositide 3-kinase Function," Cancer Surveys, 27:249-270 (1996).
Volinia, S. et al., "A Human Phosphatidylinositol 3-kinase Complex Related to the Yeast Vps34p-Vps15p Protein Sorting," The EMBO Journal, 14:3339-3348 (1995).
Stoyanov, B. et al., "Cloning and Characterization of a G Protein-Activated Human Phosphoinositide-3 Kinase," Science, 269:690-693 (Aug. 4, 1995).
36th Annual Drosophila Research Conference, Atlanta, Georgia, Apr. 5-9, 1995, Abstract, Molz, L. & Williams, L.T., "Identification of a PI3 Kinase Homologue in Drosophila melanogastor," p. 60.
Abstracts of Papers Presented at the 1995 Meeting on Tyrosine Phosphorylation & Cell Sorting, May 3-7, 1995, Cold Spring Harbor, New York, Abstract, MacDougall, L.K. & Waterfield, M.D., "Characterisation of a Novel Phosphatidylinositol 3-kinase in Drosophila," p. 113.
Abstracts of Papers Presented at the 1995 Meeting on Tyrosine Phosphorylation & Cell Sorting, May 3-7, 1995, Cold Spring Harbor, New York, Abstract, Molz, L. and Williams, L.T., "Identification of a PI3 Kinase Homologue in Drosophila melanogastor," p. 123.
Stephens et al (1994) Curr Biol 4:203-214 "Characterization of a Phosphatidylinositol-Specific Phosphoinositide 3-Kinase From Mammalian Cells".