Polymorphisms Associated with Coronary Artery Disease

Abstract

The invention provides human polymorphisms that are associated with coronary artery disease (CAD). Polymorphisms in genes were identified that confer an increased susceptibility to CAD or a decreased susceptibility. Particular alleles of the polymorphisms were identified as being associated with differential risk. In particular an allele of CDC42 in combination with an allele of PARD3 was shown to confer increased risk of CAD.

Description

FIELD OF THE INVENTION

The invention is related to polymorphisms associated with coronary artery disease.

BACKGROUND OF THE INVENTION

Coronary artery disease (CAD) occurs when the arteries that supply blood to the heart muscle (coronary arteries) become hardened and narrowed. The arteries harden and become narrow due to the buildup of plaque on the inner walls or lining of the arteries (atherosclerosis). Blood flow to the heart is reduced as plaque narrows the coronary arteries. This decreases the oxygen supply to the heart muscle. CAD is the most common type of heart disease. It is the leading cause of death in the U.S. in both men and women. When blood flow and oxygen supply to the heart are reduced or cut off, you can develop anginia or heart attack. Angina is chest pain or discomfort that occurs when your heart is not getting enough blood. A heart attack happens when a blood clot suddenly cuts off most or all blood supply to part of the heart. Cells in the heart muscle that do not receive enough oxygen-carrying blood begin to die. This can cause permanent damage to the heart muscle. Over time, CAD can weaken your heart muscle and contribute to heart failure and arrhythmias. In heart failure, the heart is not able to pump blood to the rest of the body effectively. Heart failure does not mean that your heart has stopped or is about to stop working. But it does mean that your heart is failing to pump blood the way that it should. Arrhythmias are changes in the normal rhythm of the heartbeats. Some can be quite serious. (National Institutes of Health website, 2003)

Despite the clear role of lifestyle in CAD, family history has also long been recognized as a risk factor, particularly in disease with onset before age 70 (Hunt, S. C., R. R. Williams, and G. K. Barlow, A comparison of positive family history definitions for defining risk of future disease. J Chronic Dis, 1986. 39(10): 809-821). Heritability of the trait is estimated to be ˜0.34 (Williams, F. M., et al., A common genetic factor underlies hypertension and other cardiovascular disorders. BMC Cardiovasc Disord, 2004. 4(1): 20).

SUMMARY OF THE INVENTION

The invention provides methods and compositions for determining susceptibility for coronary artery disease, or related conditions, in an individual. In one aspect, the invention provides nucleic acid sequences that may be used to determine the presence or absence of nucleotides at polymorphic sites in an individual's RNA or genomic DNA that are associated with susceptibility for coronary artery disease, or related conditions. In another aspect, the invention provides a method and kits for identifying a patient having a susceptibility to coronary artery disease having the following steps: (i) obtaining a sample of DNA or RNA from a patient; and (ii) detecting in the sample one or more at-risk polymorphisms located in a sequence of one or more genes selected from the group consisting of those listed in Table 1. In one aspect, the one or more genes are selected from the group consisting of PARD3 and CDC42 (ENSG0000007083 1).

As used herein, an “at-risk polymorphism” is a polymorphism having an association with the presence of coronary artery disease in an individual. In another aspect, an “at-risk polymorphism” is a polymorphism in linkage disequilibrium with a polymorphism listed in Table 1. In still another aspect, an “at-risk polymorphism” is a polymorphism in PARD3 or CDC42. In still another aspect, an “at-risk polymorphism” is a polymorphism in PARD3 or CDC42 listed in Table 1. In preferred aspects one allele of a biallelic polymorphism is identified as being associated with either an increased risk of CAD, called herein an “at-risk allele” or a decreased risk of CAD (conferring a protective effect). The “at-risk allele” may be the major or the minor allele.

In one aspect, SNPs identified in ABCA1 that showed significant allelic associated with CAD were re3758294 and rs4149265. The minor alleles of both appear to be protective and are in high LD with each other.

In another aspect of the invention, it has been discovered that CDC42 and PARD3 act together to increase risk of CAD. Individuals who carry at-risk polymorphisms at both rs16826506 (CDC42) and rs1545214 (PARD3) are at about six times the risk of developing CAD than someone who has wild-type alleles at both loci, as determined by a 2-sided Fisher Exact Test p-value of 0.006. The rare minor allele of rs16826506 is far more common in cases than controls

DEFINITIONS

Terms and symbols of nucleic acid chemistry, biochemistry, genetics, and molecular biology used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like.

“Amplicon” means the product of a polynucleotide amplification reaction. That is, it is a population of polynucleotides, usually double stranded, that are replicated from one or more starting sequences. The one or more starting sequences may be one or more copies of the same sequence, or it may be a mixture of different sequences. Amplicons may be produced by a variety of amplification reactions whose products are multiple replicates of one or more target nucleic acids. Generally, amplification reactions producing amplicons are “template-driven” in that base pairing of reactants, either nucleotides or oligonucleotides, have complements in a template polynucleotide that are required for the creation of reaction products. In one aspect, template-driven reactions are primer extensions with a nucleic acid polymerase or oligonucleotide ligations with a nucleic acid ligase. Such reactions include, but are not limited to, polymerase chain reactions (PCRs), linear polymerase reactions, nucleic acid sequence-based amplification (NASBAs), rolling circle amplifications, and the like, disclosed in the following references that are incorporated herein by reference: Mullis et al, U.S. Pat. Nos. 4,683,195; 4,965,188; 4,683,202; 4,800,159 (PCR); Gelfand et al, U.S. Pat. No. 5,210,015 (real-time PCR with “taqman” probes); Wittwer et al, U.S. Pat. No. 6,174,670; Kacian et al, U.S. Pat. No. 5,399,491 (“NASBA”); Lizardi, U.S. Pat. No. 5,854,033; Aono et al, Japanese patent publ. JP 4-262799 (rolling circle amplification); and the like. In one aspect, amplicons of the invention are produced by PCRs. An amplification reaction may be a “real-time” amplification if a detection chemistry is available that permits a reaction product to be measured as the amplification reaction progresses, e.g. “real-time PCR” described below, or “real-time NASBA” as described in Leone et al, Nucleic Acids Research, 26: 2150-2155 (1998), and like references. As used herein, the term “amplifying” means performing an amplification reaction. A “reaction mixture” means a solution containing all the necessary reactants for performing a reaction, which may include, but not be limited to, buffering agents to maintain pH at a selected level during a reaction, salts, co-factors, scavengers, and the like.

“Complementary or substantially complementary” refers to the hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, such as, for instance, between the two strands of a double stranded DNA molecule or between an oligonucleotide primer and a primer binding site on a single stranded nucleic acid. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, usually at least about 90% to 95%, and more preferably from about 98 to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90% complementary. See, M. Kanehisa Nucleic Acids Res. 12:203 (1984), incorporated herein by reference.

“Coronary artery disease” refers to a disease of the heart and the coronary arteries that is characterized by atherosclerotic arterial deposits that block blood flow to the heart.

“Duplex” means at least two oligonucleotides and/or polynucleotides that are fully or partially complementary undergo Watson-Crick type base pairing among all or most of their nucleotides so that a stable complex is formed. The terms “annealing” and “hybridization” are used interchangeably to mean the formation of a stable duplex. In one aspect, stable duplex means that a duplex structure is not destroyed by a stringent wash, e.g. conditions including tempature of about 5° C. less that the T_m of a strand of the duplex and low monovalent salt concentration, e.g. less than 0.2 M, or less than 0.1 M. “Perfectly matched” in reference to a duplex means that the poly- or oligonucleotide strands making up the duplex form a double stranded structure with one another such that every nucleotide in each strand undergoes Watson-Crick basepairing with a nucleotide in the other strand. The term “duplex” comprehends the pairing of nucleoside analogs, such as deoxyinosine, nucleosides with 2-aminopurine bases, PNAs, and the like, that may be employed. A “mismatch” in a duplex between two oligonucleotides or polynucleotides means that a pair of nucleotides in the duplex fails to undergo Watson-Crick bonding.

“Genetic locus,” or “locus” in reference to a genome or target polynucleotide, means a contiguous subregion or segment of the genome or target polynucleotide. As used herein, genetic locus, or locus, may refer to the position of a nucleotide, a gene, or a portion of a gene in a genome, including mitochondrial DNA, or it may refer to any contiguous portion of genomic sequence whether or not it is within, or associated with, a gene. In one aspect, a genetic locus refers to any portion of genomic sequence, including mitochondrial DNA, from a single nucleotide to a segment of few hundred nucleotides, e.g. 100-300, in length. Usually, a particular genetic locus may be identified by its nucleotide sequence, or the nucleotide sequence, or sequences, of one or both adjacent or flanking regions.

“Hybridization” refers to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide. The term “hybridization” may also refer to triple-stranded hybridization. The resulting (usually) double-stranded polynucleotide is a “hybrid” or “duplex.” “Hybridization conditions” will typically include salt concentrations of less than about 1M, more usually less than about 500 mM and less than about 200 mM. Hybridization temperatures can be as low as 50° C., but are typically greater than 22° C., more typically greater than about 30° C., and preferably in excess of about 37° C. Hybridizations are usually performed under stringent conditions, i.e. conditions under which a probe will hybridize to its target subsequence. Stringent conditions are sequence-dependent and are different in different circumstances. Longer fragments may require higher hybridization temperatures for specific hybridization. As other factors may affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents and extent of base mismatching, the combination of parameters is more important than the absolute measure of any one alone. Generally, stringent conditions are selected to be about 5° C. lower than the T_m for the specific sequence at s defined ionic strength and pH. Exemplary stringent conditions include salt concentration of at least 0.01 M to no more than 1 M Na ion concentration (or other salts) at a pH 7.0 to 8.3 and a temperature of at least 25° C. For example, conditions of 5×SSPE (750 mM NaCl, 50 mM NaPhosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30° C. are suitable for allele-specific probe hybridizations. For stringent conditions, see for example, Sambrook, Fritsche and Maniatis. “Molecular Cloning A laboratory Manual” 2^nd Ed. Cold Spring Harbor Press (1989) and Anderson “Nucleic Acid Hybridization” 1^st Ed., BIOS Scientific Publishers Limited (1999), which are hereby incorporated by reference in its entirety for all purposes above. “Hybridizing specifically to” or “specifically hybridizing to” or like expressions refer to the binding, duplexing, or hybridizing of a molecule substantially to or only to a particular nucleotide sequence or sequences under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.

“Hybridization-based assay” means any assay that relies on the formation of a stable duplex or triplex between a probe and a target nucleotide sequence for detecting or measuring such a sequence. In one aspect, probes of such assays anneal to (or form duplexes with) regions of target sequences in the range of from 8 to 100 nucleotides; or in other aspects, they anneal to target sequences in the range of from 8 to 40 nucleotides, or more usually, in the range of from 8 to 20 nucleotides. A “probe” in reference to a hybridization-based assay mean a polynucleotide that has a sequence that is capable of forming a stable hybrid (or triplex) with its complement in a target nucleic acid and that is capable of being detected, either directly or indirectly. Hybridization-based assays include, without limitation, assays based on use of oligonucleotides, such as polymerase chain reactions, NASBA reactions, oligonucleotide ligation reactions, single-base extensions of primers, circularizable probe reactions, allele-specific oligonucleotides hybridizations, either in solution phase or bound to solid phase supports, such as microarrays or microbeads. There is extensive guidance in the literature on hybridization-based assays, e.g. Hames et al, editors, Nucleic Acid Hybridization a Practical Approach (IRL Press, Oxford, 1985); Tijssen, Hybridization with Nucleic Acid Probes, Parts I & II (Elsevier Publishing Company, 1993); Hardiman, Microarray Methods and Applications (DNA Press, 2003); Schena, editor, DNA Microarrays a Practical Approach (IRL Press, Oxford, 1999); and the like. In one aspect, hybridization-based assays are solution phase assays; that is, both probes and target sequences hybridize under conditions that are substantially free of surface effects or influences on reaction rate. A solution phase assay may include circumstance where either probes or target sequences are attached to microbeads.

“Linkage” describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome, and can be measured by percent recombination between the genes, alleles, loci or genetic markers that are physically-linked on the same chromosome. Loci occurring within 50 centimorgan of each other are linked. Some linked markers occur within the same gene or gene cluster.

“Kit” refers to any delivery system for delivering materials or reagents for carrying out a method of the invention. In the context of assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., probes, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials for assays of the invention. In one aspect, kits of the invention comprise probes specific for interfering polymorphic loci. In another aspect, kits comprise nucleic acid standards for validating the performance of probes specific for interfering polymorphic loci. Such contents may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains probes.

“Ligation” means to form a covalent bond or linkage between the termini of two or more nucleic acids, e.g. oligonucleotides and/or polynucleotides, in a template-driven reaction. The nature of the bond or linkage may vary widely and the ligation may be carried out enzymatically or chemically. As used herein, ligations are usually carried out enzymatically to form a phosphodiester linkage between a 5′ carbon of a terminal nucleotide of one oligonucleotide with 3′ carbon of another oligonucleotide. A variety of template-driven ligation reactions are described in the following references, which are incorporated by reference: Whitely et al, U.S. Pat. No. 4,883,750; Letsinger et al, U.S. Pat. No. 5,476,930; Fung et al, U.S. Pat. No. 5,593,826; Kool, U.S. Pat. No. 5,426,180; Landegren et al, U.S. Pat. No. 5,871,921; Xu and Kool, Nucleic Acids Research, 27: 875-881 (1999); Higgins et al, Methods in Enzymology, 68: 50-71 (1979); Engler et al, The Enzymes, 15: 3-29 (1982); and Namsaraev, U.S. patent publication 2004/0110213.

“Microarray” refers to a solid phase support having a planar surface, which carries an array of nucleic acids, each member of the array comprising identical copies of an oligonucleotide or polynucleotide immobilized to a spatially defined region or site, which does not overlap with those of other members of the array; that is, the regions or sites are spatially discrete. Spatially defined hybridization sites may additionally be “addressable” in that its location and the identity of its immobilized oligonucleotide are known or predetermined, for example, prior to its use. Typically, the oligonucleotides or polynucleotides are single stranded and are covalently attached to the solid phase support, usually by a 5′-end or a 3′-end. The density of non-overlapping regions containing nucleic acids in a microarray is typically greater than 100 per cm², and more preferably, greater than 1000 per cm². Microarray technology is reviewed in the following references: Schena, Editor, Microarrays: A Practical Approach (IRL Press, Oxford, 2000); Southern, Current Opin. Chem. Biol., 2: 404-410 (1998); Nature Genetics Supplement, 21: 1-60 (1999). As used herein, “random microarray” refers to a microarray whose spatially discrete regions of oligonucleotides or polynucleotides are not spatially addressed. That is, the identity of the attached oligonucleotides or polynucleotides is not discernable, at least initially, from its location. In one aspect, random microarrays are planar arrays of microbeads wherein each microbead has attached a single kind of hybridization tag complement, such as from a minimally cross-hybridizing set of oligonucleotides. Arrays of microbeads may be formed in a variety of ways, e.g. Brenner et al, Nature Biotechnology, 18: 630-634 (2000); Tulley et al, U.S. Pat. No. 6,133,043; Stuelpnagel et al, U.S. Pat. No. 6,396,995; Chee et al, U.S. Pat. No. 6,544,732; and the like. Likewise, after formation, microbeads, or oligonucleotides thereof, in a random array may be identified in a variety of ways, including by optical labels, e.g. fluorescent dye ratios or quantum dots, shape, sequence analysis, or the like.

“Nucleoside” as used herein includes the natural nucleosides, including 2′-deoxy and 2′-hydroxyl forms, e.g. as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). “Analogs” in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g. described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990), or the like, with the proviso that they are capable of specific hybridization. Such analogs include synthetic nucleosides designed to enhance binding properties, reduce complexity, increase specificity, and the like. Polynucleotides comprising analogs with enhanced hybridization or nuclease resistance properties are described in Uhlman and Peyman (cited above); Crooke et al, Exp. Opin. Ther. Patents, 6: 855-870 (1996); Mesmaeker et al, Current Opinion in Structual Biology, 5: 343-355 (1995); and the like. Exemplary types of polynucleotides that are capable of enhancing duplex stability include oligonucleotide N3′→P5′ phosphoramidates (referred to herein as “amidates”), peptide nucleic acids (referred to herein as “PNAs”), oligo-2′-O-alkylribonucleotides, polynucleotides containing C-5 propynylpyrimidines, locked nucleic acids (LNAs), and like compounds. Such oligonucleotides are either available commercially or may be synthesized using methods described in the literature.

“Polymerase chain reaction,” or “PCR,” means a reaction for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary strands of DNA. In other words, PCR is a reaction for making multiple copies or replicates of a target nucleic acid flanked by primer binding sites, such reaction comprising one or more repetitions of the following steps: (i) denaturing the target nucleic acid, (ii) annealing primers to the primer binding sites, and (iii) extending the primers by a nucleic acid polymerase in the presence of nucleoside triphosphates. Usually, the reaction is cycled through different temperatures optimized for each step in a thermal cycler instrument. Particular temperatures, durations at each step, and rates of change between steps depend on many factors well-known to those of ordinary skill in the art, e.g. exemplified by the references: McPherson et al, editors, PCR: A Practical Approach and PCR2: A Practical Approach (IRL Press, Oxford, 1991 and 1995, respectively). For example, in a conventional PCR using Taq DNA polymerase, a double stranded target nucleic acid may be denatured at a temperature >90° C., primers annealed at a temperature in the range 50-75° C., and primers extended at a temperature in the range 72-78° C. The term “PCR” encompasses derivative forms of the reaction, including but not limited to, RT-PCR, real-time PCR, nested PCR, quantitative PCR, multiplexed PCR, and the like. Reaction volumes range from a few hundred nanoliters, e.g. 200 nL, to a few hundred μL, e.g. 200 μL. “Reverse transcription PCR,” or “RT-PCR,” means a PCR that is preceded by a reverse transcription reaction that converts a target RNA to a complementary single stranded DNA, which is then amplified, e.g. Tecott et al, U.S. Pat. No. 5,168,038, which patent is incorporated herein by reference. “Real-time PCR” means a PCR for which the amount of reaction product, i.e. amplicon, is monitored as the reaction proceeds. There are many forms of real-time PCR that differ mainly in the detection chemistries used for monitoring the reaction product, e.g. Gelfand et al, U.S. Pat. No. 5,210,015 (“taqman”); Wittwer et al, U.S. Pat. Nos. 6,174,670 and 6,569,627 (intercalating dyes); Tyagi et al, U.S. Pat. No. 5,925,517 (molecular beacons); which patents are incorporated herein by reference. Detection chemistries for real-time PCR are reviewed in Mackay et al, Nucleic Acids Research, 30: 1292-1305 (2002), which is also incorporated herein by reference. “Nested PCR” means a two-stage PCR wherein the amplicon of a first PCR becomes the sample for a second PCR using a new set of primers, at least one of which binds to an interior location of the first amplicon. As used herein, “initial primers” in reference to a nested amplification reaction mean the primers used to generate a first amplicon, and “secondary primers” mean the one or more primers used to generate a second, or nested, amplicon. “Multiplexed PCR” means a PCR wherein multiple target sequences (or a single target sequence and one or more reference sequences) are simultaneously carried out in the same reaction mixture, e.g. Bernard et al, Anal. Biochem., 273: 221-228 (1999)(two-color real-time PCR). Usually, distinct sets of primers are employed for each sequence being amplified. “Quantitative PCR” means a PCR designed to measure the abundance of one or more specific target sequences in a sample or specimen. Quantitative PCR includes both absolute quantitation and relative quantitation of such target sequences. Quantitative measurements are made using one or more reference sequences that may be assayed separately or together with a target sequence. The reference sequence may be endogenous or exogenous to a sample or specimen, and in the latter case, may comprise one or more competitor templates. Typical endogenous reference sequences include segments of transcripts of the following genes: β-actin, GAPDH, β₂-microglobulin, ribosomal RNA, and the like. Techniques for quantitative PCR are well-known to those of ordinary skill in the art, as exemplified in the following references that are incorporated by reference: Freeman et al, Biotechniques, 26: 112-126 (1999); Becker-Andre et al, Nucleic Acids Research, 17: 9437-9447 (1989); Zimmerman et al, Biotechniques, 21: 268-279 (1996); Diviacco et al, Gene, 122: 3013-3020 (1992); Becker-Andre et al, Nucleic Acids Research, 17: 9437-9446 (1989); and the like.

“Polymorphism” refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A polymorphic marker or site is the locus at which such polymorphism occurs. Preferred markers have at least two alleles, each occurring at frequency of greater than 1%, and more preferably greater than 5% or 10% of a selected population. A polymorphic locus may be as small as one base pair. Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, deletions, simple sequence repeats, and insertion elements, such as Alu. The first identified allelic form is arbitrarily designated as the reference form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wildtype form. Diploid organisms may be homozygous or heterozygous for allelic forms. A diallelic polymorphism has two forms. A triallelic polymorphism has three forms.

“Polymorphism” or “genetic variant” means a substitution, inversion, insertion, or deletion of one or more nucleotides at a genetic locus, or a translocation of DNA from one genetic locus to another genetic locus. In one aspect, polymorphism means one of multiple alternative nucleotide sequences that may be present at a genetic locus of an individual and that may comprise a nucleotide substitution, insertion, or deletion with respect to other sequences at the same locus in the same individual, or other individuals within a population. An individual may be homozygous or heterozygous at a genetic locus; that is, an individual may have the same nucleotide sequence in both alleles, or have a different nucleotide sequence in each allele, respectively. In one aspect, insertions or deletions at a genetic locus comprises the addition or the absence of from 1 to 10 nucleotides at such locus, in comparison with the same locus in another individual of a population (or another allele in the same individual). Usually, insertions or deletions are with respect to a major allele at a locus within a population, e.g. an allele present in a population at a frequency of fifty percent or greater.

“Single nucleotide polymorphism” or “SNP” occurs at a polymorphic site occupied by a single nucleotide, which is the site of variation between allelic sequences. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations). A single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site. A transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine or vice versa. Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.

“Isolated nucleic acid” means an object species invention that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition). Preferably, an isolated nucleic acid comprises at least about 50 percent (on a molar basis) of all macromolecular species present; and more preferably, an isolated nucleic acid comprises at least about 90 percent (on a molar basis) of all macromolecular species present. Most preferably, the object species is purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods).

“Linkage disequilibrium” or “LD” or “allelic association” or “association” means the preferential association of a particular allele or genetic marker with a specific allele, or genetic marker at another chromosomal location more frequently than expected by chance given the particular allele frequency in the population. For example, if locus X has alleles a and b, which occur equally frequently, and another locus Y has alleles c and d, which occur equally frequently, one would expect the haplotype ac to occur with a frequency of 0.25 in a population of individuals. If ac occurs more frequently, then alleles a and c are considered in linkage disequilibrium. Linkage disequilibrium may result from natural selection of certain combination of alleles, through the admixture of two or more genetically different populations or because an allele has been introduced into a population too recently to have reached equilibrium (random association) between linked alleles.

A “marker” or “biomarker” in linkage disequilibrium with disease predisposing variants can be particularly useful in detecting susceptibility to disease (or association with sub-clinical phenotypes) notwithstanding that the marker does not cause the disease. For example, a marker (X) that is not itself a causative element of a disease, but which is in linkage disequilibrium with a gene (including regulatory sequences) (Y) that is a causative element of a phenotype, can be used detected or indicate susceptibility to the disease in circumstances in which the gene Y may not have been identified or may not be readily detectable. Younger alleles (i.e., those arising from mutation relatively recently) are expected to have a larger genomic segment in linkage disequilibrium. The age of an allele can be determined from whether the allele is shared among different human ethnic groups and/or between humans and related species.

A “study population” can consist of any number of individuals, subjects or biological samples that may come from human or non-human organisms.

“Polynucleotide” or “oligonucleotide” are used interchangeably and each mean a linear polymer of nucleotide monomers. Monomers making up polynucleotides and oligonucleotides are capable of specifically binding to a natural polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, base stacking, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. Such monomers and their internucleosidie linkages may be naturally occurring or may be analogs thereof, e.g. naturally occurring or non-naturally occurring analogs. Non-naturally occurring analogs may include PNAs, phosphorothioate internucleosidie linkages, bases containing linking groups permitting the attachment of labels, such as fluorophores, or haptens, and the like. Whenever the use of an oligonucleotide or polynucleotide requires enzymatic processing, such as extension by a polymerase, ligation by a ligase, or the like, one of ordinary skill would understand that oligonucleotides or polynucleotides in those instances would not contain certain analogs of internucleosidic linkages, sugar moities, or bases at any or some positions. Polynucleotides typically range in size from a few monomeric units, e.g. 5-40, when they are usually referred to as “oligonucleotides,” to several thousand monomeric units. Whenever a polynucleotide or oligonucleotide is represented by a sequence of letters (upper or lower case), such as “ATGCCTG,” it will be understood that the nucleotides are in 5′→3′ order from left to right and that “A” denotes deoxyadenosine, “C” denotes deoxycytidine, “G” denotes deoxyguanosine, and “T” denotes thymidine, “I” denotes deoxyinosine, “U” denotes uridine, unless otherwise indicated or obvious from context. Unless otherwise noted the terminology and atom numbering conventions will follow those disclosed in Strachan and Read, Human Molecular Genetics 2 (Wiley-Liss, New York, 1999). Usually polynucleotides comprise the four natural nucleosides (e.g. deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine for DNA or their ribose counterparts for RNA) linked by phosphodiester linkages; however, they may also comprise non-natural nucleotide analogs, e.g. including modified bases, sugars, or internucleosidic linkages. It is clear to those skilled in the art that where an enzyme has specific oligonucleotide or polynucleotide substrate requirements for activity, e.g. single stranded DNA, RNA/DNA duplex, or the like, then selection of appropriate composition for the oligonucleotide or polynucleotide substrates is well within the knowledge of one of ordinary skill, especially with guidance from treatises, such as Sambrook et al, Molecular Cloning, Second Edition (Cold Spring Harbor Laboratory, New York, 1989), and like references.

“Primer” means an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3′ end along the template so that an extended duplex is formed. The sequence of nucleotides added during the extension process are determined by the sequence of the template polynucleotide. Usually primers are extended by a DNA polymerase. Primers usually have a length in the range of from 14 to 36 nucleotides.

“Readout” means a parameter, or parameters, which are measured and/or detected that can be converted to a number or value. In some contexts, readout may refer to an actual numerical representation of such collected or recorded data. For example, a readout of fluorescent intensity signals from a microarray is the address and fluorescence intensity of a signal being generated at each hybridization site of the microarray; thus, such a readout may be registered or stored in various ways, for example, as an image of the microarray, as a table of numbers, or the like.

“Solid support”, “support”, and “solid phase support” are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface or surfaces. In many embodiments, at least one surface of the solid support will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different compounds with, for example, wells, raised regions, pins, etched trenches, or the like. According to other embodiments, the solid support(s) will take the form of beads, resins, gels, microspheres, or other geometric configurations. Microarrays usually comprise at least one planar solid phase support, such as a glass microscope slide.

“Specific” or “specificity” in reference to the binding of one molecule to another molecule, such as a labeled target sequence for a probe, means the recognition, contact, and formation of a stable complex between the two molecules, together with substantially less recognition, contact, or complex formation of that molecule with other molecules. In one aspect, “specific” in reference to the binding of a first molecule to a second molecule means that to the extent the first molecule recognizes and forms a complex with another molecule in a reaction or sample, it forms the largest number of the complexes with the second molecule. Preferably, this largest number is at least fifty percent. Generally, molecules involved in a specific binding event have areas on their surfaces or in cavities giving rise to specific recognition between the molecules binding to each other. Examples of specific binding include antibody-antigen interactions, enzyme-substrate interactions, formation of duplexes or triplexes among polynucleotides and/or oligonucleotides, receptor-ligand interactions, and the like. As used herein, “contact” in reference to specificity or specific binding means two molecules are close enough that weak non-covalent chemical interactions, such as Van der Waal forces, hydrogen bonding, base-stacking interactions, ionic and hydrophobic interactions, and the like, dominate the interaction of the molecules.

“T_m” is used in reference to “melting temperature.” Melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation. Tm=81.5+0.41 (% G+C), when a nucleic acid is in aqueous solution at 1 M NaCl (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H. T. & SantaLucia, J., Jr., Biochemistry 36, 10581-94 (1997)) include alternative methods of computation which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.

“Sample” means a quantity of material from a biological, environmental, medical, or patient source in which detection or measurement of target nucleic acids is sought. On the one hand it is meant to include a specimen or culture (e.g., microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin. Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may include materials taken from a patient including, but not limited to cultures, blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum, semen, needle aspirates, and the like. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, rodents, etc. Environmental samples include environmental material such as surface matter, soil, water and industrial samples, as well as samples obtained from food and dairy processing instruments, apparatus, equipment, utensils, disposable and non-disposable items. These examples are not to be construed as limiting the sample types applicable to the present invention.

DETAILED DESCRIPTION OF THE INVENTION

The invention provides a collection of novel polymorphisms in genes encoding products related to susceptibility and/or course or outcome of coronary artery disease. Detection of polymorphisms in such genes is useful in designing and performing diagnostic assays for evaluation of genetic risks for coronary artery disease and other related conditions. Analysis of such polymorphisms is also useful in designing prophylactic and therapeutic regimes customized to underlying abnormalities. Detection of such polymorphisms is also useful for conducting clinical trials of drugs for treatment of these diseases and the underlying biological abnormalities. The polymorphisms of the invention also have more general applications, such as forensics, paternity testing, linkage analysis and positional cloning.

Polymorphisms of the Invention

A study was designed to assess common alleles in 237 candidate genes for association with CAD and to assess rare alleles in a subset of such candidate genes for association with CAD. Common alleles were measured using molecular inversion probes, which are disclosed in the following references that are incorporated by reference: Willis et al, U.S. Pat. No. 6,858,412; Hardenbol et al, Nature Biotechnology, 21: 673-678 (2003); and Hardenbol et al, Genome Research, 15: 269-275 (2005). Rare alleles were identified using mismatch repair detection, a polymorphism discovery technique disclosed in the following references that are incorporated by reference: Faham et al, U.S. patent publication 2003/0003472; Faham et al, Human Molecular Genetics, 10: 1657-1664 (2001); and Fakhrair-Rad et al, Genome Research, 14: 1404-1412 (2004). After discovery, rare single nucleotide polymorphisms were measured using molecular inversion probe technology.

Analyzed samples included DNA obtained from 314 cases and 314 controls. The enrollment criteria for cases were as follows: US White Caucasians; CAD with 70% occlusion or greater in at least one artery. Cases were excluded if any of the following applied: diagnosed with type 2 diabetes; MI (heart attack); extreme hypertension (systolic bp>180 or diastolic bp>100 or with end-organ damage); hypotension (systolic bp<90 and diastolic bp<50); heavy smokers (current users of greater than one pack per day). Controls were drawn from a group of healthy US White Caucasians. Exclusion criteria were as follows: first degree-relatives with type 2 diabetes; hypertension (systolic bp>140 or diastolic bp>90); fasting glucose>126 mg/dl; total cholesterol=>300 mg/dl. Controls were matched to cases with the following criteria: exact match for gender; age match control is −3/+6 years of the case; body mass index (BMI) match is ±3 units.

Measures of the association of polymorphisms in cases with CAD were obtained by applying chi-squared tests and Fisher's exact tests to the data as follows: (i) p-value of chi-square of 2-by-2 allele count table (designated “P-Value Allele Chiˆ2”), (ii) Fisher Exact test p-value (2-sided) of 2-by-2 allele count table (designated “P-Value Allele Fisher”), (iii) p-value of chi-square of 3-by-2 genotype count table (designated “P-Value Genotype Chiˆ2”), (iv) Fisher Exact test p-value (2-sided) of 2-by-2 genotype count table assuming recessive model (minor/minor vs all others)(designated “P-Value Recessive Fisher”), and (v) Fisher Exact test p-value (2-sided) of 2-by-2 genotype count table assuming dominant model (carriers of minor allele vs all others) (designated “P-Value Dominant Fisher”). If any of the resulting measures was equal to or less than 0.05, the polymorphism was deemed to have a significant association with CAD. Such polymorphisms are listed in Table 1. Column designations (in addition to those described above) are as follows: “SNP” is a reference SNP (or “refSNP”) cluster identifier or an MRD ID (which are further identified by sequence in Table 2); “Gene” is a HUGO or Ensembl ID (as of May 2005); “Chrom” is chromosome number; “Posn” is the base position on the indicated chromosome (NCBI build 35); “Major Allele” is self-explanatory; “Minor Allele” is self-explanatory; “1 Case” is the count of major allele in cases; “2 Case” is the count of minor allele in cases; “1 Cntr” is the count of major allele in controls; “2 Cntr” is the count of minor allele in controls; “1/1 Case” is the count of major/major genotype in cases; “1/2 Case” is the count of major/minor genotype in cases; “2/2 Case” is the count of minor/minor genotype in cases; “1/1 Cntr” is the count of major/major genotype in controls; “1/2 Cntr” is the count of major/minor genotype in controls; and “2/2 Cntr” is the count of minor/major genotype in controls. SNPs in Table 2 were identified in the study. The SNP alleles are as follows: M is A or C, Y is C or T, W is A or T and K is G or T.

In one aspect, SNPs in CDC42 and PARD3 were found to act together to increase risk of CAD. Individuals who carry at-risk polymorphisms at both rs16826506 (CDC42) and rs1545214 (PARD3) are at about six times the risk of developing CAD than someone who has wild-type alleles at both loci, as determined by a 2-sided Fisher Exact Test p-value of 0.006. SNP rs16826506 is found in the following sequence: SEQ ID NO 1: 5′-aagtaatggt atattaaatt tggaatatag Mgaaaacaat gacccataat gtcatgataa a-3′ where the major allele is A and the minor allele is C. SNP rs1545214 is found in the following sequence SEQ ID NO 2: 5′-tcaattttag aatgtcaggg ctgtctatgg Matattccaa acctcgacat tcaaagtggc a-3′ with major allele C and minor allele A. In some aspects the patient may be identified at being at increased risk for CAD if the patient is heterozygous at both SNPs rs1545214 and rs16826506, but the patient may also be identified as being at increased risk if the patient is homozygous for the minor allele of one or both SNPs.

Analysis of Polymorphisms

A. Preparation of Samples. Polymorphisms are detected in a target nucleic acid from an individual being analyzed. For assay of genomic DNA, virtually any biological sample (other than pure red blood cells) is suitable. For example, convenient tissue samples include whole blood, semen, saliva, tears, urine, fecal material, sweat, buccal epithelium, skin and hair. For assay of cDNA or mRNA, the tissue sample must be obtained from an organ in which the target nucleic acid is expressed.

Many of the methods described below require amplification of DNA from target samples. This can be accomplished by e.g., PCR. See generally PCR Technology: Principles and Applications for DNA Amplification (ed. H. A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. No. 4,683,202 (each of which is incorporated by reference for all purposes).

Other suitable amplification methods include the ligase chain reaction (LCR) (see Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989)), and self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)) and nucleic acid based sequence amplification (NASBA). The latter two amplification methods involve isothermal reactions based on isothermal transcription, which produce both single stranded RNA (ssRNA) and double stranded DNA (dsDNA) as the amplification products in a ratio of about 30 or 100 to 1, respectively.

B. Single Base Extension Methods for Detecting Polymorphisms. Single base extension methods are described by e.g., U.S. Pat. No. 5,846,710, U.S. Pat. No. 6,004,744, U.S. Pat. No. 5,888,819 and U.S. Pat. No. 5,856,092. In brief, the methods work by hybridizing a primer that is complementary to a target sequence such that the 3′ end of the primer is immediately adjacent to but does not span a site of potential variation in the target sequence. That is, the primer comprises a subsequence from the complement of a target polynucleotide terminating at the base that is immediately adjacent and 5′ to the polymorphic site. The hybridization is performed in the presence of one or more labeled nucleotides complementary to base(s)that may occupy the site of potential variation. For example, for a biallelic polymorphisms two differentially labeled nucleotides can be used. For a tetraallelic polymorphism four differentially labeled nucleotides can be used. In some methods, particularly methods employing multiple differentially labeled nucleotides, the nucleotides are dideoxynucleotides. Hybridization is performed under conditions permitting primer extension if a nucleotide complementary to a base occupying the site of variation in the target sequence is present. Extension incorporates a labeled nucleotide thereby generating a labeled extended primer. If multiple differentially labeled nucleotides are used and the target is heterozygous then multiple differentially labeled extended primers can be obtained. Extended primers are detected providing an indication of which bas(es) occupy the site of variation in the target polynucleotide.

C. Allele-Specific Probes. The design and use of allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP 235,726, Saiki, WO 89/11548. Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles. Some probes are designed to hybridize to a segment of target DNA such that the polymorphic site aligns with a central position (e.g., in a 15 mer at the 7 position; in a 16 mer, at either the 8 or 9 position) of the probe. This design of probe achieves good discrimination in hybridization between different allelic forms. Allele-specific probes are often used in pairs, one member of a pair showing a perfect match to a reference form of a target sequence and the other member showing a perfect match to a variant form. Several pairs of probes can then be immobilized on the same support for simultaneous analysis of multiple polymorphisms within the same target sequence. The polymorphisms can also be identified by hybridization to nucleic acid arrays, some example of which are described by WO 95/11995 (incorporated by reference in its entirety for all purposes).

D. Allele-Specific Amplification Methods. An allele-specific primer hybridizes to a site on target DNA overlapping a polymorphism and only primes amplification of an allelic form to which the primer exhibits perfect complementarily. See Gibbs, Nucleic Acid Res. 17, 2427-2448 (1989). This primer is used in conjunction with a second primer that hybridizes at a distal site. Amplification proceeds from the two primers leading to a detectable product signifying the particular allelic form is present. A control is usually performed with a second pair of primers, one of which shows a single base mismatch at the polymorphic site and the other of which exhibits perfect complementarily to a distal site. The single-base mismatch prevents amplification and no detectable product is formed. In some methods, the mismatch is included in the 3′-most position of the oligonucleotide aligned with the polymorphism because this position is most destabilizing to elongation from the primer. See, for example, WO 93/22456.

E. Direct-Sequencing. The direct analysis of the sequence of polymorphisms of the present invention can be accomplished using either the dideoxy-chain termination method or the Maxam-Gilbert method (see Sambrook et al., Molecular Cloning, A Laboratory Manual (2nd Ed., CSHP, New York 1989); Zyskind et al., Recombinant DNA Laboratory Manual, (Acad. Press, 1988)).

F. Denaturing Gradient Gel Electrophoresis. Amplification products generated using the polymerase chain reaction can be analyzed by the use of denaturing gradient gel electrophoresis. Different alleles can be identified based on the different sequence-dependent melting properties and electrophoretic migration of DNA in solution. Erlich, ed., PCR Technology, Principles and Applications for DNA Amplification, (W. H. Freeman and Co, New York, 1992), Chapter 7.

G. Single-Strand Conformation Polymorphism Analysis. Alleles of target sequences can be differentiated using single-strand conformation polymorphism analysis, which identifies base differences by alteration in electrophoretic migration of single stranded PCR products, as described in Orita et al., Proc. Nat. Acad. Sci. 86, 2766-2770 (1989). Amplified PCR products can be generated as described above, and heated or otherwise denatured, to form single stranded amplification products. Single-stranded nucleic acids may refold or form secondary structures that are partially dependent on the base sequence. The different electrophoretic mobilities of single-stranded amplification products can be related to base-sequence difference between alleles of target sequences.

Methods of Use

After determining polymorphic form(s) present in an individual at one or more polymorphic sites, this information can be used in a number of methods.

A. Association Studies with CAD

The polymorphisms of the invention may contribute to the phenotype of an organism in different ways. Some polymorphisms occur within a protein coding sequence and contribute to phenotype by affecting protein structure. The effect may be neutral, beneficial or detrimental, or both beneficial and detrimental, depending on the circumstances. By analogy, a heterozygous sickle cell mutation confers resistance to malaria, but a homozygous sickle cell mutation causes severe disease. Other polymorphisms occur in non-coding regions but may exert phenotypic effects indirectly via influence on replication, transcription, and translation. A single polymorphism may affect more than one phenotypic trait. Likewise, a single phenotypic trait may be affected by polymorphisms in different genes.

Correlation is performed for a population of individuals who have been tested for the presence or absence of CAD or an intermediate phenotype and for one or more polymorphic markers or polymorphic sites. To perform such analysis, the presence or absence of a set of polymorphic forms (i.e. a polymorphic set) is determined for a set of the individuals, some of whom exhibit a particular trait, and some of whom may exhibit lack of the trait. The alleles of each polymorphism of the set are then reviewed to determine whether the presence or absence of a particular allele is associated with the trait of interest. Correlation can be performed by standard statistical methods including, but not limited to, chi-squared test, Fisher Exact Test, Analysis of Variance, contingency table tests, logistic regression, parametric linkage analysis, non-parametric linkage analysis etc and statistically significant correlations between polymorphic form(s) and phenotypic characteristics are noted. For example, it might be found that the presence of allele A1 at polymorphism A correlates with CAD, measured either as a categorical or continuous trait. As a further example, it might be found that the combined presence of allele A1 at polymorphism A and allele B1 at polymorphism B correlates with CAD or a sub-phenotype.

B. Diagnosis of CAD

Polymorphic forms that correlate with CAD or sub-phenotypes are useful in diagnosing CAD or susceptibility thereto or predicting disease prognosis. Combined detection of several such polymorphic forms typically increases the probability of an accurate diagnosis. For example, the presence of a single polymorphic form known to correlate with CAD might indicate a probability of 20% that an individual has or is susceptible to CAD, whereas detection of five polymorphic forms, each of which correlates with less than 20% probability, might indicate a probability up to 80% that an individual has or is susceptible to CAD. Analysis of the polymorphisms of the invention can be combined with that of other polymorphisms or other risk factors for CAD, such as family history. Polymorphisms could be used to diagnose CAD or sub-phenotypes of CAD at the pre-symptomatic stage, as a method of post-symptomatic diagnosis, as a method of confirmation of diagnosis or as a post-mortem diagnosis.

Patients diagnosed with CAD can be treated with conventional therapies and/or can be counseled to avoid environmental factors that exacerbate the condition. Patients diagnosed with CAD may also be counseled about the risk of genetically transmitting the disease to offspring, or counseled about the risk of family members sharing genetic variation(s) relevant to CAD.

C. Drug Screening

The polymorphism(s) showing the strongest correlation with CAD within a given gene are likely either to have a causative role in the manifestation of the phenotype or to be in linkage disequilibrium with the causative variants. Such a role can be confirmed by in vitro gene expression of the variant gene or by producing a transgenic animal expressing a human gene bearing such a polymorphism and determining whether the animal develops the phenotype. Polymorphisms in coding regions that result in amino acid changes usually cause CAD by decreasing, increasing or otherwise altering the activity of the protein encoded by the gene in which the polymorphism occurs. Polymorphisms in coding regions that introduce stop codons usually cause CAD by reducing (heterozygote) or eliminating (homozygote) functional protein produced by the gene. Occasionally, stop codons result in production of a truncated peptide with aberrant activities relative to the full-length protein. Polymorphisms in regulatory regions typically cause CAD or related phenotypes by causing increased or decreased expression of the protein encoded by the gene in which the polymorphism occurs. Polymorphisms in exonic or untranslated sequences can cause CAD or related phenotypes either through the same mechanism as polymorphisms in regulatory sequences or by causing altered spliced patterns resulting in an altered protein.

Having identified certain polymorphisms as having causative roles in CAD, and having elucidated at least in general terms whether such polymorphisms increase or decrease the activity or expression level of associated proteins, customized therapies can be devised for classes of patients with different genetic subtypes of diseases. For example, if a polymorphism in a given protein causes CAD by increasing the expression level or activity of the protein, the diseases associated with the polymorphism can be treated by administering an antagonist of the protein. If a polymorphism in a given protein causes CAD by decreasing the expression level or activity of a protein, the form of CAD associated with the polymorphism can be treated by administering the protein itself, a nucleic acid encoding the protein that can be expressed in a patient, or an analog or agonist of the protein.

The polymorphisms of the invention are also useful for conducting clinical trials of drug candidates for CAD. Such trials are performed on treated or control populations having similar or identical polymorphic profiles at a defined collection of polymorphic sites. Use of genetically matched populations eliminates or reduces variation in treatment outcome due to genetic factors, leading to a more accurate assessment of the efficacy of a potential drug.

Furthermore, the polymorphisms of the invention may be used after the completion of a clinical trial to elucidate differences in response to a given treatment. For example, the set of polymorphisms may be used to stratify the enrolled patients into disease sub-types or classes. It may further be possible to use the polymorphisms to identify subsets of patients with similar polymorphic profiles who have unusual (high or low) response to treatment or who do not respond at all (non-responders). In this way, information about the underlying genetic factors influencing response to treatment can be used in many aspects of the development of treatment (these range from the identification of new targets, through the design of new trials to product labeling and patient targeting). Additionally, the polymorphisms may be used to identify the genetic factors involved in adverse response to treatment (also called adverse events or adverse drug reactions). For example, patients who show adverse response may have more similar polymorphic profiles than would be expected by chance. This would allow the early identification and exclusion of such individuals from treatment. It would also provide information that might be used to understand the biological causes of adverse events and to modify the treatment to avoid such outcomes.

Even if a polymorphism is not causative but is instead in linkage disequilibrium with a causative variant, it may still be useful for genetic tests, including diagnosis, prognosis, and drug screening.

D. Forensics

Determination of which polymorphic forms occupy a set of polymorphic sites in an individual identifies a set of polymorphic forms that distinguishes the individual. See generally National Research Council, The Evaluation of Forensic DNA Evidence (Eds. Pollard et al., National Academy Press, DC, 1996). The more sites that are analyzed the lower the probability that the set of polymorphic forms in one individual is the same as that in an unrelated individual. Preferably, if multiple sites are analyzed, the sites are unlinked. Thus, polymorphisms of the invention are often used in conjunction with polymorphisms in distal genes. Preferred polymorphisms for use in forensics are diallelic because the population frequencies of two polymorphic forms can usually be determined with greater accuracy than those of multiple polymorphic forms at multi-allelic loci.

The capacity to identify a distinguishing or unique set of forensic markers in an individual is useful for forensic analysis. For example, one can determine whether a blood sample from a suspect matches a blood or other tissue sample from a crime scene by determining whether the set of polymorphic forms occupying selected polymorphic sites is the same in the suspect and the sample. If the set of polymorphic markers does not match between a suspect and a sample, it can be concluded (barring experimental error) that the suspect was not the source of the sample. If the set of markers does match, one can conclude that the DNA from the suspect is consistent with that found at the crime scene. If frequencies of the polymorphic forms at the loci tested have been determined (e.g., by analysis of a suitable population of individuals), one can perform a statistical analysis to determine the probability that a match of suspect and crime scene sample would occur by chance.

p(ID) is the probability that two random individuals have the same polymorphic or allelic form at a given polymorphic site. In diallelic loci, four genotypes are possible: AA, AB, BA, and BB. If alleles A and B occur in a haploid genome of the organism with frequencies x and y, the probability of each genotype in a diploid organism are (see WO 95/12607): Homozygote: p(AA)=x² Homozygote: p(BB)=y²=(1−x)² Single Heterozygote: p(AB)=p(BA)=xy=x(1−x) Both Heterozygotes: p(AB+BA)=2xy=2x(1−x)

The probability of identity at one locus (i.e., the probability that two individuals, picked at random from a population will have identical polymorphic forms at a given locus) is given by the equation: p(ID)=(x²)²+(2xy)²+(y²)².

These calculations can be extended for any number of polymorphic forms at a given locus. For example, the probability of identity p(ID) for a 3-allele system where the alleles have the frequencies in the population of x, y and z, respectively, is equal to the sum of the squares of the genotype frequencies: p(ID)=x⁴+(2xy)²+(2yz)²+(2xz)²+z⁴+y⁴

In a locus of n alleles, the appropriate binomial expansion is used to calculate p(ID) and p(exc).

The cumulative probability of identity (cum p(ID)) for each of multiple unlinked loci is determined by multiplying the probabilities provided by each locus. cum p(ID)=p(ID1)p(ID2)p(ID3) . . . p(IDn)

The cumulative probability of non-identity for n loci (i.e. the probability that two random individuals will be different at 1 or more loci) is given by the equation: cum p(nonID)=1−cum p(ID).

If several polymorphic loci are tested, the cumulative probability of non-identity for random individuals becomes very high (e.g., one billion to one). Such probabilities can be taken into account together with other evidence in determining the guilt or innocence of the suspect.

F. Paternity Testing

The object of paternity testing is usually to determine whether a male is the father of a child. In most cases, the mother of the child is known and thus, the mother's contribution to the child's genotype can be traced. Paternity testing investigates whether the part of the child's genotype not attributable to the mother is consistent with that of the putative father. Paternity testing can be performed by analyzing sets of polymorphisms in the putative father and the child.

If the set of polymorphisms in the child attributable to the father does not match the putative father, it can be concluded, barring experimental error, that the putative father is not the real biological father. If the set of polymorphisms in the child attributable to the father does match the set of polymorphisms of the putative father, a statistical calculation can be performed to determine the probability of coincidental match.

The probability of parentage exclusion (representing the probability that a random male will have a polymorphic form at a given polymorphic site that makes him incompatible as the father) is given by the equation (see WO 95/12607): p(exc)=xy(1−xy)

where x and y are the population frequencies of alleles A and B of a diallelic polymorphic site.

(At a triallelic site p(exc)=xy(1−xy)+yz(1−yz)+xz(l-xz)+3xyz(1−xyz))), where x, y and z and the respective population frequencies of alleles A, B and C).

The probability of non-exclusion is p(non-exc)=1−p(exc)

The cumulative probability of non-exclusion (representing the value obtained when n loci are used) is thus: cum p(non-exc)=p(non-exc1)p(non-exc2)p(non-exc3) . . . p(non-excn)

The cumulative probability of exclusion for n loci (representing the probability that a random male will be excluded) cum p(exc)=1−cum p(non-exc).

If several polymorphic loci are included in the analysis, the cumulative probability of exclusion of a random male is very high. This probability can be taken into account in assessing the liability of a putative father whose polymorphic marker set matches the child's polymorphic marker set attributable to his/her father.

G. Genetic Mapping of Phenotypic Traits

The polymorphisms shown in Table 2 can also be used to establish physical linkage between a genetic locus associated with a trait of interest and polymorphic markers that are not associated with the trait, but are in physical proximity with the genetic locus responsible for the trait and co-segregate with it. Such analysis is useful for mapping a genetic locus associated with a phenotypic trait to a chromosomal position, and thereby cloning gene(s) responsible for the trait. See Lander et al., Proc. Natl. Acad. Sci. (USA) 83, 7353-7357 (1986); Lander et al., Proc. Natl. Acad. Sci. (USA) 84, 2363-2367 (1987); Donis-Keller et al., Cell 51, 319-337 (1987); Lander et al., Genetics 121, 185-199 (1989)). Genes localized by linkage can be cloned by a process known as directional cloning. See Wainwright, Med. J. Australia 159, 170-174 (1993); Collins, Nature Genetics 1, 3-6 (1992) (each of which is incorporated by reference in its entirety for all purposes).

Linkage studies are typically performed on members of a family. Available members of the family are characterized for the presence or absence of a phenotypic trait and for a set of polymorphic markers. The distribution of polymorphic markers in an informative meiosis is then analyzed to determine which polymorphic markers co-segregate with a phenotypic trait. See, e.g., Kerem et al., Science 245, 1073-1080 (1989); Monaco et al., Nature 316, 842 (1985); Yamoka et al., Neurology 40, 222-226 (1990); Rossiter et al., FASEB Journal 5, 21-27 (1991).

Linkage is analyzed by calculation of LOD (log of the odds) values. A lod value is the relative likelihood of obtaining observed segregation data for a marker and a genetic locus when the two are located at a recombination fraction θ, versus the situation in which the two are not linked, and thus segregating independently (Thompson & Thompson, Genetics in Medicine (5th ed, W.B. Saunders Company, Philadelphia, 1991); Strachan, “Mapping the human genome” in The Human Genome (BIOS Scientific Publishers Ltd, Oxford), Chapter 4). A series of likelihood ratios are calculated at various recombination fractions (θ), ranging from θ=0.0 (coincident loci) to θ=0.50 (unlinked). Thus, the likelihood at a given value of θ is proportional to the probability of data if loci linked at θ to probability of data if loci unlinked. The computed likelihoods are usually expressed as the log (base10) of this ratio (i.e., a lod score). For example, a lod score of 3 indicates 1000:1 odds against an apparent observed linkage being a coincidence. The use of logarithms allows data collected from different families to be combined by simple addition. Computer programs are available for the calculation of lod scores for differing values of θ (e.g., LIPED, MLINK (Lathrop, Proc. Nat. Acad. Sci. (USA) 81, 3443-3446 (1984)). For any particular lod score, a recombination fraction may be determined from mathematical tables. See Smith et al., Mathematical tables for research workers in human genetics (Churchill, London, 1961); Smith, Ann. Hum. Genet. 32, 127-150 (1968). The value of θ at which the lod score is the highest is considered to be the best estimate of the recombination fraction. Positive lod score values suggest that the two loci are linked, whereas negative values suggest that linkage is less likely (at that value of θ) than the possibility that the two loci are unlinked. By convention, a combined lod score of +3 or greater (equivalent to greater than 1000:1 odds in favor of linkage) is considered definitive evidence that two loci are linked. Similarly, by convention, a negative lod score of −2 or less is taken as definitive evidence against linkage of the two loci being compared. Negative linkage data are useful in excluding a chromosome or a segment thereof from consideration. The search focuses on the remaining non-excluded chromosomal locations.

V. Kits

The invention further provides kits comprising assay components to implement detection assays specific for polymorphisms of the invention. Thus, for hybridization-based assays, such components include probes capable of forming stable duplexes with predetermined regions adjacent to or encompassing polymorphisms of the inventions. For assays that depend on a polymerase-based primer extension reaction for detection, such as a PCR or single-base extension reaction, assay components include at least one primer having a sequence complementary to a region adjacent to or encompassing such polymorphism. Likewise, for ligation-based detection assays, such as OLA, circularizable probe reactions, and the like, oligonucleotides are provided that are complementary to adjacent regions near, or encompassing, a polymorphism of the invention. In another embodiment, at least one allele-specific oligonucleotide is provided as described above. Often, the kits contain one or more pairs of allele-specific oligonucleotides hybridizing to different forms of a polymorphism. In some kits, the allele-specific oligonucleotides are provided immobilized to a substrate. For example, the same substrate can comprise allele-specific oligonucleotide probes for detecting at least one, or at least 5, or at least 10, or all of the polymorphisms shown in Table 1. Optional additional components of the kit include, for example, restriction enzymes, reverse transcriptase or polymerase, the substrate nucleoside triphosphates, means used to label (for example, an avidin-enzyme conjugate and enzyme substrate and chromogen if the label is biotin), and the appropriate buffers for reverse transcription, PCR, or hybridization reactions. Usually, the kit also contains instructions for carrying out the methods.

From the foregoing, it is apparent that the invention includes a number of general uses that can be expressed concisely as follows. The invention provides for the use of any of the nucleic acid segments described above in the diagnosis or monitoring of diseases, particularly CAD and related conditions. The invention further provides for the use of any of the nucleic acid segments in the manufacture of medicines for the treatment or prophylaxis of such diseases. The invention further provides for the use of any of the DNA segments as a pharmaceutical.

All publications and patent applications cited above are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent application were specifically and individually indicated to be so incorporated by reference. Although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.

TABLE 1
										P-Value	P-Value							P-Value	P-Value	P-Value
				Major	Minor	1	2			Allele	Allele	1/1	1/2	2/2	1/1	1/2	2/2	Genotype	Recessive	Dominant
SNP	Gene	Chrom	Posn	Allele	Allele	Case	Case	1 Cntr	2 Cntr	Chi{circumflex over ( )}2	Fisher	Case	Case	Case	Cntr	Cntr	Cntr	Chi{circumflex over ( )}2	Fisher	Fisher
rs12024382	ENSG00000070831	1	22053947	C	G	599	29	580	48	0.02543	0.03364	285	29	0	268	44	2	0.060664	0.499203	0.048408
rs6661161	ENSG00000070831	1	22118977	T	C	509	117	536	90	0.03997	0.04774	204	101	8	229	78	6	0.096114	0.788147	0.037641
rs16826506	ENSG00000070831	1	22154596	A	C	599	25	619	7	0.00123	0.00113	288	23	1	306	7	0	0.006483	0.4992	0.001611
rs2582020	EPHB2	1	22852001	C	T	574	34	567	55	0.02782	0.036	270	34	0	258	51	2	0.061	0.499251	0.038057
rs750012	EPHB2	1	22855811	C	T	539	63	583	43	0.02488	0.02564	240	59	2	272	39	2	0.053682	1	0.022431
rs10917325	EPHB2	1	22954584	C	T	296	322	330	292	0.0693	0.07823	63	170	76	91	148	72	0.034828	0.706711	0.012032
rs309476	EPHB2	1	22958046	A	C	318	288	303	323	0.1529	0.15477	74	170	59	73	157	83	0.109767	0.044369	0.777132
rs1467416	EPHB2	1	22961345	G	A	338	290	311	317	0.12737	0.14205	83	172	59	78	155	81	0.105599	0.043837	0.714759
rs1516526	EPHB2	1	22968755	A	G	332	296	307	321	0.15823	0.17552	77	178	59	74	159	81	0.100864	0.043837	0.851903
rs309499	EPHB2	1	22980252	C	T	325	267	307	313	0.06078	0.06572	80	165	51	79	149	82	0.020986	0.007884	0.711979
rs11591185	AK2	1	33171277	G	A	547	81	569	59	0.04855	0.05941	239	69	6	256	57	1	0.070718	0.122907	0.117917
rs6700177	NFYC	1	40887547	G	A	376	252	354	274	0.20831	0.22972	117	142	55	92	170	52	0.061195	0.831979	0.041984
rs1289658	TRIM45	1	117368130	A	G	379	249	353	275	0.1368	0.15252	109	161	44	104	145	65	0.082091	0.034765	0.736046
rs7511654	NOTCH2	1	120106754	G	A	618	4	622	0	0.04515	0.1244	307	4	0	311	0	0	0.133595	1	0.123793
rs10923918	NOTCH2	1	120124927	G	T	449	177	441	187	0.55785	0.5758	166	117	30	146	149	19	0.022377	0.104107	0.110375
rs6685892	NOTCH2	1	120170046	A	T	581	47	568	58	0.25489	0.26372	273	35	6	256	56	1	0.01132	0.122907	0.079385
rs2793831	NOTCH2	1	120235944	T	C	581	47	568	60	0.18886	0.22503	273	35	6	256	56	2	0.024817	0.28591	0.079385
rs391102	NOTCH2	1	120266176	A	C	580	48	566	62	0.16228	0.19423	272	36	6	254	58	2	0.0206	0.28591	0.065509
rs12401436	ENSG00000125462	1	153195543	T	G	454	170	418	210	0.01712	0.01945	169	116	27	146	126	42	0.069006	0.073483	0.055727
rs716461	PLXNA2	1	204646024	G	A	426	182	452	172	0.35804	0.37821	137	152	15	163	126	23	0.043579	0.24238	0.076818
rs4844409	PLXNA2	1	204677703	C	T	455	169	466	160	0.54063	0.56344	156	143	13	178	110	25	0.008475	0.064334	0.092401
rs881758	PLXNA2	1	204781943	C	A	473	153	496	132	0.14826	0.15725	173	127	13	201	94	19	0.017015	0.364499	0.028051
rs10746422	ENSG00000008141	1	206177098	A	G	423	205	390	238	0.05132	0.05874	145	133	36	117	156	41	0.076249	0.626731	0.028799
rs742257	ENSG00000008141	1	206183697	C	T	427	185	402	218	0.06502	0.06861	151	125	30	127	148	35	0.112562	0.600711	0.042883
rs2072941	ENSG00000008141	1	206199990	T	C	311	315	332	296	0.25911	0.28307	81	149	83	77	178	59	0.034598	0.022183	0.713636
rs7519942	ENSG00000008141	1	206214343	G	C	563	61	587	39	0.02087	0.02192	254	55	3	276	35	2	0.062161	0.685993	0.019497
rs4675094	IRS1	2	227477296	G	C	584	44	563	65	0.03531	0.04459	271	42	1	253	57	4	0.095797	0.373002	0.06765
rs9879090	ENSG00000163939	3	52623305	C	T	352	274	316	306	0.05465	0.06104	99	154	60	70	176	65	0.036213	0.617746	0.011633
rs9877209	MGLL	3	128929337	C	G	337	291	372	256	0.04639	0.05296	88	161	65	109	154	51	0.129783	0.181132	0.085292
rs6787155	MGLL	3	128946306	A	C	512	116	481	147	0.03157	0.03735	211	90	13	181	119	14	0.041651	1	0.016792
rs608318	MGLL	3	128967455	A	C	551	77	536	92	0.21486	0.24696	245	61	8	225	86	3	0.025028	0.222431	0.080403
MRD_3427	SH3BP2	4	2943461	T	G	514	112	485	143	0.03184	0.03525	214	86	13	188	109	17	0.085172	0.575308	0.030373
rs4961	SH3BP2	4	2943715	G	T	515	113	487	141	0.04918	0.05772	214	87	13	190	107	17	0.133926	0.575308	0.055249
rs2932965	PPARGC1A	4	23481755	G	A	476	152	509	119	0.0236	0.02804	182	112	20	204	101	9	0.049927	0.055524	0.084996
rs3774921	PPARGC1A	4	23486916	A	G	330	298	355	273	0.15658	0.1738	92	146	76	94	167	53	0.062937	0.029528	0.93037
rs3755863	PPARGC1A	4	23491791	G	A	371	257	347	281	0.17115	0.18967	115	141	58	87	173	54	0.026184	0.754598	0.020963
rs2970853	PPARGC1A	4	23499788	G	A	444	180	482	146	0.02403	0.02438	160	124	28	183	116	15	0.056902	0.040733	0.09164
rs6448227	PPARGC1A	4	23524900	C	T	482	146	514	112	0.01896	0.02109	185	112	17	210	94	9	0.060354	0.159717	0.03863
rs1466414	KLF3	4	38486890	A	G	360	182	431	161	0.0194	0.01996	121	118	32	157	117	22	0.06633	0.086169	0.053065
rs337623	KLF3	4	38496411	C	T	515	111	488	140	0.04354	0.04809	209	97	7	190	108	16	0.081465	0.087175	0.114781
rs6531656	KLF3	4	38506767	T	C	523	95	490	122	0.03583	0.03651	229	65	15	211	68	27	0.121355	0.05593	0.180009
rs729064	KLF3	4	38512489	T	C	500	88	477	121	0.01728	0.01819	228	44	22	209	59	31	0.105557	0.2503	0.040068
rs3796533	KLF3	4	38515372	G	A	544	84	506	122	0.00378	0.00473	237	70	7	208	90	16	0.019143	0.087175	0.01382
rs4699733	ENSG00000164025	4	100494712	C	G	427	201	460	168	0.04093	0.04737	144	139	31	170	120	24	0.10874	0.397193	0.045933
rs1826909	ENSG00000164025	4	100574921	C	T	398	230	371	257	0.11791	0.1321	122	154	38	115	141	58	0.084319	0.034731	0.621398
rs1229984	ENSG00000164025	4	100596497	G	A	602	26	584	44	0.02683	0.03585	288	26	0	275	34	5	0.041444	0.061506	0.115402
rs17586163	ENSG00000164025	4	100631749	T	C	562	66	585	43	0.02115	0.02707	253	56	5	273	39	2	0.078541	0.450496	0.039449
rs10516440	ENSG00000164025	4	100662571	A	G	541	85	570	58	0.01556	0.01647	231	79	3	259	52	3	0.02783	1	0.009115
rs6851750	ENSG00000164025	4	100670197	C	T	529	87	499	103	0.15099	0.15589	235	59	14	227	45	29	0.027651	0.017131	0.849887
rs6532816	ENSG00000164025	4	100675511	C	T	542	86	570	58	0.01315	0.01656	231	80	3	259	52	3	0.023059	1	0.009115
rs991316	ENSG00000164025	4	100679623	G	A	355	271	350	278	0.72739	0.73305	89	177	47	101	148	65	0.044226	0.076054	0.339305
rs1154461	ENSG00000164025	4	100700080	G	C	425	199	452	176	0.13543	0.13908	135	155	22	169	114	31	0.003068	0.250685	0.008459
rs1573496	ENSG00000164025	4	100706847	C	G	574	54	549	79	0.02187	0.02744	263	48	3	240	69	5	0.069916	0.724805	0.027639
rs3811800	MTP	4	100851731	A	G	434	194	390	238	0.00896	0.0106	149	136	29	114	162	38	0.017118	0.30108	0.005911
rs3816873	MTP	4	100861842	T	C	480	148	442	184	0.01938	0.02119	185	110	19	154	134	25	0.049488	0.353382	0.016241
rs1057613	MTP	4	100862163	G	A	348	280	309	319	0.02758	0.03177	93	162	59	73	163	78	0.080148	0.081763	0.085381
rs17599091	MTP	4	100870097	C	G	614	14	598	30	0.01407	0.02033	301	12	1	284	30	0	0.01001	1	0.010707
rs2903202	MTP	4	100874183	A	T	564	62	539	89	0.02024	0.02385	255	54	4	229	81	4	0.033455	1	0.013188
MRD_3470	ENSG00000109471	4	123735585	A	C	424	202	452	174	0.08429	0.09592	140	144	29	170	112	31	0.030655	0.892126	0.020362
rs6843773	ENSG00000109436	4	141923723	T	C	321	293	348	276	0.21809	0.23117	88	145	74	91	166	55	0.120837	0.048529	0.929429
rs4956472	ENSG00000109436	4	141936979	A	G	335	291	373	255	0.03573	0.04029	92	151	70	106	161	47	0.054199	0.018543	0.264186
rs6845527	ENSG00000109436	4	141946906	A	G	303	325	340	288	0.03674	0.04209	71	161	82	92	156	66	0.104658	0.158305	0.068496
rs1532013	ENSG00000109436	4	142014072	G	A	341	287	297	331	0.01301	0.01519	95	151	68	71	155	88	0.047685	0.079118	0.037227
rs4555724	ENSG00000109436	4	142016302	T	C	379	247	340	288	0.02189	0.0225	114	151	48	97	146	71	0.052401	0.02481	0.151333
rs6056	FGA	4	155846426	C	T	504	124	532	96	0.03766	0.04487	203	98	13	224	84	6	0.095912	0.16059	0.086991
rs4220	FGA	4	155849364	G	A	504	124	534	94	0.02541	0.03057	203	98	13	225	84	5	0.056042	0.09151	0.071928
rs765199	NPR3	5	32778222	G	A	492	128	489	135	0.66913	0.67753	200	92	18	185	119	8	0.019456	0.046894	0.18731
rs700926	NPR3	5	32781040	T	G	493	135	468	160	0.09611	0.11007	198	97	19	170	128	16	0.035817	0.728431	0.028622
rs6450502	PDE4D	5	58396235	A	T	611	17	597	31	0.03935	0.05465	297	17	0	284	29	1	0.109629	1	0.06781
rs986067	PDE4D	5	58424151	C	T	611	17	597	31	0.03935	0.05465	297	17	0	284	29	1	0.109629	1	0.06781
rs929820	PDE4D	5	58429089	C	T	436	192	416	212	0.227	0.25107	148	140	26	145	126	43	0.083912	0.040572	0.872917
rs997421	PDE4D	5	58465399	C	T	580	48	561	67	0.06304	0.07785	272	36	6	249	63	2	0.005575	0.28591	0.019247
rs1862563	PDE4D	5	58473284	T	C	535	93	496	130	0.0058	0.00626	229	77	8	197	102	14	0.023166	0.201555	0.00801
rs1824788	PDE4D	5	58476015	G	A	342	286	307	321	0.04812	0.05484	96	150	68	75	157	82	0.132309	0.223668	0.072818
rs6877256	PDE4D	5	58498498	C	T	594	32	577	51	0.0321	0.04035	282	30	1	266	45	3	0.107229	0.623801	0.053662
rs9292201	PDE4D	5	58618370	T	C	536	92	561	67	0.03388	0.04143	227	82	5	250	61	3	0.095707	0.724805	0.03974
rs921942	PDE4D	5	58823614	C	A	332	296	303	325	0.1017	0.11402	91	150	73	67	169	78	0.084467	0.708855	0.034229
rs4551023	PDE4D	5	58837048	C	T	452	176	483	145	0.04492	0.0522	164	124	26	184	115	15	0.108633	0.105236	0.127106
rs7728286	PDE4D	5	58854479	C	T	407	221	435	193	0.09282	0.10503	139	129	46	147	141	26	0.042582	0.016846	0.574905
rs296410	PDE4D	5	58937990	C	T	295	333	334	294	0.02774	0.03195	67	161	86	91	152	71	0.06934	0.1969	0.034229
rs12654264	HMGCR	5	74684359	A	T	395	233	399	229	0.81494	0.86066	127	141	46	115	169	30	0.03892	0.065921	0.367111
rs3846663	HMGCR	5	74691482	C	T	395	233	402	226	0.68169	0.72518	127	141	46	116	170	28	0.02259	0.034817	0.412637
rs252802	EFNA5	5	106790483	C	T	305	323	338	290	0.06249	0.07082	78	149	87	88	162	64	0.097826	0.03974	0.415452
rs152602	EFNA5	5	106804017	G	C	430	196	393	235	0.02273	0.02392	145	140	28	122	149	43	0.066239	0.077115	0.063415
rs152599	EFNA5	5	106807204	G	T	403	225	362	266	0.01775	0.02068	124	155	35	105	152	57	0.03228	0.017443	0.135545
rs537500	EFNA5	5	106821490	C	T	461	167	488	138	0.06055	0.06536	168	125	21	194	100	19	0.093313	0.870439	0.03557
rs3909931	EFNA5	5	106821882	T	A	484	144	511	115	0.04614	0.05076	183	118	13	211	89	13	0.048532	1	0.020632
rs152577	EFNA5	5	106830196	A	T	383	245	377	249	0.782	0.81721	103	177	34	123	131	59	4.62E−04	0.004971	0.096568
rs341276	EFNA5	5	106898137	C	G	531	97	505	123	0.0536	0.06331	230	71	13	203	99	12	0.042101	1	0.024813
rs180791	EFNA5	5	106951468	G	A	537	89	555	73	0.17104	0.17866	233	71	9	243	69	2	0.09577	0.036788	0.401804
rs352614	EFNA5	5	106977080	G	T	493	135	526	102	0.01732	0.02088	195	103	16	221	84	9	0.063435	0.220073	0.034768
rs3805665	ENSG00000197208	5	131672617	G	A	593	35	569	57	0.01646	0.01726	279	35	0	261	47	5	0.025292	0.030506	0.050206
rs270606	ENSG00000197208	5	131678766	C	T	417	205	447	181	0.11347	0.12584	135	147	29	164	119	31	0.054681	0.892199	0.030634
rs156322	ENSG00000197208	5	131681824	A	G	415	207	447	181	0.0885	0.09876	133	149	29	164	119	31	0.036039	0.892199	0.020184
rs273915	ENSG00000197208	5	131688018	G	C	419	209	447	181	0.08773	0.09959	134	151	29	164	119	31	0.032074	0.892144	0.020405
rs3806837	PCDHGA2	5	140703358	A	G	573	55	548	80	0.02275	0.02848	260	53	1	238	72	4	0.059016	0.373002	0.03835
rs11575948	PCDHGA2	5	140704244	A	C	589	39	567	61	0.02184	0.02817	275	39	0	255	57	2	0.04666	0.499203	0.036301
rs6877775	PCDHGA2	5	140707976	G	A	589	39	566	60	0.02671	0.02805	275	39	0	255	56	2	0.055154	0.248804	0.036301
rs10214288	PCDHGA2	5	140714062	A	G	589	39	567	59	0.03395	0.03563	275	39	0	256	55	2	0.067149	0.248804	0.046458
rs4151698	PCDHGA2	5	140733429	A	G	580	42	561	63	0.03363	0.04099	269	42	0	251	59	2	0.064478	0.499197	0.051886
rs3806832	PCDHGA2	5	140745907	C	T	604	22	588	40	0.01971	0.02608	291	22	0	274	40	0	0.05682	1	0.022325
rs17208397	PCDHGA2	5	140778823	G	C	508	116	555	73	5.77E−04	6.63E−04	211	86	15	244	67	3	0.001706	0.003826	0.005379
rs3805695	PCDHGA2	5	140838429	G	A	539	83	518	110	0.04125	0.04216	232	75	4	212	94	8	0.113266	0.383074	0.052892
rs6865659	CSF1R-PDGFRB	5	149465965	A	G	402	216	445	183	0.02793	0.02894	135	132	42	152	141	21	0.01605	0.005028	0.260579
rs165979	CSF1R-PDGFRB	5	149475963	G	A	304	286	353	269	0.06792	0.07381	85	134	76	94	165	52	0.020759	0.007156	0.722252
rs1075846	CSF1R-PDGFRB	5	149484351	A	G	397	211	424	200	0.32351	0.33399	141	115	48	141	142	29	0.02445	0.020153	0.808384
rs6579775	CSF1R-PDGFRB	5	149514041	C	T	512	112	487	141	0.04724	0.04899	209	94	9	190	107	17	0.122411	0.159746	0.09687
MRD_3435	KCNMB1	5	169748952	C	T	540	44	589	29	0.03924	0.04065	249	42	1	280	29	0	0.094428	0.485857	0.045369
rs2804921	ENSG00000124523	6	13702645	G	T	475	151	445	183	0.04441	0.0477	182	111	20	159	127	28	0.138159	0.293049	0.065249
rs1052215	ZNF305	6	28456137	C	A	416	212	381	247	0.04028	0.04629	138	140	36	120	141	53	0.105054	0.066703	0.167883
MRD_3459	AIF1	6	31691910	C	T	538	90	565	63	0.01984	0.02465	230	78	6	255	55	4	0.058833	0.751925	0.022183
rs1035798	AGPAT1-PBX2-	6	32259200	C	T	497	127	463	165	0.01324	0.01351	199	99	14	173	117	24	0.05124	0.131096	0.028222
	NOTCH4
rs2071280	AGPAT1-PBX2-	6	32272847	C	G	570	22	561	39	0.0292	0.03493	277	16	3	261	39	0	0.001453	0.121874	0.008268
	NOTCH4
rs2071287	AGPAT1-PBX2-	6	32278411	G	A	338	284	302	326	0.02704	0.0275	94	150	67	78	146	90	0.086399	0.042752	0.151787
	NOTCH4
rs2071286	AGPAT1-PBX2-	6	32287874	G	A	519	105	488	136	0.02621	0.03131	218	83	11	196	96	20	0.094132	0.139391	0.075098
	NOTCH4
rs3131290	AGPAT1-PBX2-	6	32291153	G	A	402	224	364	264	0.0231	0.02399	128	146	39	114	136	64	0.026905	0.009461	0.251346
	NOTCH4
rs423023	AGPAT1-PBX2-	6	32296275	C	G	444	174	409	217	0.01341	0.01456	163	118	28	136	137	40	0.05115	0.157781	0.024557
	NOTCH4
rs422951	AGPAT1-PBX2-	6	32296361	A	G	357	253	327	295	0.03556	0.03901	106	145	54	93	141	77	0.086927	0.038466	0.227676
	NOTCH4
rs520803	AGPAT1-PBX2-	6	32296581	G	A	440	174	407	217	0.01485	0.01705	161	118	28	135	137	40	0.055657	0.158035	0.024349
	NOTCH4
rs415929	AGPAT1-PBX2-	6	32297010	A	G	440	174	409	217	0.01653	0.01721	161	118	28	136	137	40	0.061416	0.158526	0.02988
	NOTCH4
rs443198	AGPAT1-PBX2-	6	32298384	T	C	375	243	360	264	0.28418	0.29888	107	161	41	109	142	61	0.077416	0.039513	1
	NOTCH4
rs3134931	AGPAT1-PBX2-	6	32298598	A	G	428	188	398	226	0.03338	0.03515	152	124	32	126	146	40	0.07857	0.381143	0.029167
	NOTCH4
rs1062193	PTP4A1	6	64350112	A	G	617	7	611	17	0.04083	0.06143	305	7	0	297	17	0	0.118444	1	0.058927
rs1597555	ENSG00000105778	7	32319358	A	C	388	240	360	268	0.10744	0.12055	120	148	46	93	174	47	0.062892	1	0.0283
rs7806941	ENSG00000105778	7	32326559	G	T	388	240	360	268	0.10744	0.12055	120	148	46	93	174	47	0.062892	1	0.0283
rs10951338	ENSG00000105778	7	32333329	A	G	377	233	353	265	0.09466	0.10365	117	143	45	91	171	47	0.056009	0.910239	0.021405
rs17365780	ENSG00000105778	7	32402641	T	C	499	127	537	91	0.00676	0.00728	199	101	13	229	79	6	0.025109	0.109528	0.012894
rs6966960	ENSG00000105778	7	32639711	A	T	444	184	482	146	0.01484	0.01761	160	124	30	185	112	17	0.049353	0.06781	0.054163
rs17150806	ENSG00000105778	7	32819284	C	T	502	124	531	97	0.04264	0.04546	199	104	10	224	83	7	0.112835	0.474189	0.040979
rs1534313	SEMA3C	7	80015555	T	C	543	85	561	67	0.11941	0.14116	237	69	8	247	67	0	0.016277	0.007468	0.392978
rs979856	SEMA3C	7	80183857	G	C	417	211	382	246	0.0401	0.04609	144	129	41	124	134	56	0.141764	0.121816	0.125227
rs7793260	CALCR	7	92696781	C	T	463	165	429	199	0.03446	0.04005	165	133	16	142	145	27	0.079856	0.113191	0.078967
rs10243420	CALCR	7	92710824	G	A	394	234	422	202	0.06942	0.07515	121	152	41	146	130	36	0.112171	0.626809	0.043269
rs17165475	CALCR	7	92728359	C	T	628	0	624	4	0.04516	0.1244	314	0	0	310	4	0	0.133611	1	0.123805
rs8491	PON1	7	94570265	C	A	404	222	355	269	0.00565	0.00647	123	158	32	99	157	56	0.010349	0.005789	0.054546
rs757158	PON1	7	94600179	C	T	341	285	371	257	0.09989	0.11043	83	175	55	119	133	62	0.001873	0.538723	0.002744
rs7778571	ZNF3	7	99309468	A	G	489	139	489	135	0.83088	0.83784	182	125	7	194	101	17	0.02884	0.038914	0.289758
rs6592	ZNF3	7	99312758	C	A	456	166	423	201	0.03247	0.03464	171	114	26	144	135	33	0.085679	0.411892	0.030544
rs6960432	ZNF3	7	99315526	C	G	363	265	383	245	0.2505	0.27497	96	171	47	121	141	52	0.049358	0.661529	0.043897
rs264	LPL	8	19857460	G	A	544	80	524	104	0.06166	0.06647	243	58	11	219	86	9	0.031987	0.657621	0.023052
rs10503814	CLU	8	27510492	C	T	605	19	595	33	0.05005	0.06468	294	17	1	281	33	0	0.040608	0.498403	0.039968
rs3824260	CYP7A1	8	59575744	G	A	366	262	411	217	0.00895	0.01055	112	142	60	138	135	41	0.039653	0.05018	0.04145
rs7833904	CYP7A1	8	59580216	T	A	358	270	394	234	0.03823	0.04387	95	168	51	125	144	45	0.042594	0.579444	0.015187
rs9643665	STAU2	8	74609639	C	G	550	78	546	82	0.73497	0.79965	238	74	2	243	60	11	0.020802	0.021141	0.706278
rs1454627	VLDLR	9	2621738	A	G	400	228	440	186	0.01305	0.01384	131	138	45	157	126	30	0.052573	0.084409	0.03729
rs1551411	VLDLR	9	2621932	C	T	453	175	488	140	0.02271	0.02679	164	125	25	191	106	17	0.076532	0.263318	0.036265
rs10812381	VLDLR	9	2624646	T	A	332	296	309	319	0.1942	0.21429	95	142	77	68	173	73	0.022039	0.778958	0.017795
rs1329024	ELAVL2	9	23696348	A	G	550	44	536	68	0.02207	0.02268	264	22	11	249	38	15	0.071387	0.548676	0.026933
rs7038525	ELAVL2	9	23762277	C	T	507	121	533	95	0.05188	0.0614	204	99	11	228	77	9	0.117459	0.820931	0.047472
rs9410448	ENSG00000148082	9	88875259	A	G	372	256	339	289	0.06027	0.06843	103	166	45	96	147	71	0.026955	0.009943	0.606885
rs3750399	ENSG00000148082	9	88886517	C	T	412	216	394	234	0.28949	0.31712	126	160	28	125	144	45	0.090492	0.045787	1
rs3758294	ABCA1	9	104744370	T	C	537	87	490	138	2.15E−04	2.27E−04	227	83	2	193	104	17	2.09E−04	6.12E−04	0.002908
rs2575878	ABCA1	9	104746634	C	T	320	306	354	274	0.06221	0.06988	81	158	74	105	144	65	0.114926	0.388253	0.044255
rs4149265	ABCA1	9	104752053	C	T	488	140	447	179	0.01041	0.01142	187	114	13	162	123	28	0.022161	0.015668	0.053837
rs5951621	SMPX	X	21488620	A	C	501	125	540	86	0.00324	0.00404	234	33	46	258	24	31	0.063486	0.087938	0.024784
rs3788756	SMPX	X	21522578	A	C	359	269	395	233	0.0381	0.04373	156	47	111	173	49	92	0.259446	0.124503	0.201071
rs6633442	SMPX	X	21534457	A	G	306	322	347	281	0.02058	0.02384	129	48	137	151	45	118	0.197797	0.143506	0.091733
rs11544223	FGD1	X	54354049	A	G	618	8	607	21	0.01494	0.02254	306	6	1	298	11	5	0.119934	0.216504	0.087175
rs12011120	FGD1	X	54359170	A	G	606	8	603	21	0.01645	0.02264	300	6	1	296	11	5	0.1272	0.216563	0.087333
rs1155955	OPHN1	X	67080112	G	A	593	33	577	51	0.04358	0.05428	290	13	10	281	15	18	0.276811	0.174992	0.207289
rs5965536	OPHN1	X	67300796	G	C	542	86	565	63	0.04475	0.0546	261	20	33	274	17	23	0.309616	0.207289	0.177378
rs10752256	SEC61A2	10	12213178	A	G	328	290	356	266	0.14079	0.15342	91	146	72	97	162	52	0.119908	0.044743	0.662715
rs7919751	SEC61A2	10	12226455	A	G	336	292	308	318	0.12752	0.14181	101	134	79	75	158	80	0.054524	0.927054	0.026181
rs1441017	PARD3	10	34475456	C	A	398	230	436	192	0.0232	0.02702	126	146	42	148	140	26	0.059101	0.053428	0.090991
rs1660619	PARD3	10	34491115	C	T	385	243	425	203	0.01835	0.02142	119	147	48	151	123	40	0.035915	0.421109	0.012398
rs1274484	PARD3	10	34496697	A	G	379	249	344	284	0.0457	0.0522	116	147	51	91	162	61	0.098257	0.348183	0.041485
rs1274474	PARD3	10	34519660	G	C	299	325	339	289	0.03186	0.03642	76	147	89	85	169	60	0.021572	0.006445	0.465007
rs1274478	PARD3	10	34527008	G	A	370	254	423	201	0.00183	0.00221	106	158	48	135	153	24	0.003073	0.003711	0.021233
rs648768	PARD3	10	34530607	A	G	428	200	389	239	0.021	0.02448	144	140	30	113	163	38	0.040229	0.368787	0.014829
rs1121682	PARD3	10	34532194	C	A	434	192	486	142	0.00125	0.00139	151	132	30	188	110	16	0.005806	0.032785	0.003912
rs2570326	PARD3	10	34553836	G	A	310	318	341	287	0.08001	0.0902	81	148	85	89	163	62	0.095437	0.037922	0.529637
rs1545214	PARD3	10	34560365	C	A	444	184	502	126	1.47E−04	1.85E−04	160	124	30	197	108	9	2.97E−04	7.37E−04	0.00369
rs1111267	PARD3	10	34567393	C	A	462	166	494	132	0.02613	0.02855	171	120	23	194	106	13	0.078365	0.121303	0.062606
rs2570322	PARD3	10	34580172	G	A	586	42	611	17	8.56E−04	0.00119	273	40	1	298	15	1	0.001971	1	7.32E−04
rs1570650	PARD3	10	34970874	G	A	615	5	628	0	0.02414	0.03002	305	5	0	314	0	0	0.07787	1	0.02977
rs16912153	UBE2D1	10	59765272	G	A	603	21	588	36	0.04197	0.0568	291	21	0	277	34	1	0.109822	1	0.067839
rs10509089	UBE2D1	10	59776243	A	T	621	7	609	19	0.0174	0.02734	307	7	0	295	19	0	0.055641	1	0.025756
rs7907725	UBE2D1	10	59781919	A	G	621	7	609	19	0.0174	0.02734	307	7	0	295	19	0	0.055641	1	0.025756
rs10826174	UBE2D1	10	59797416	G	C	387	241	352	276	0.04478	0.0512	124	139	51	92	168	54	0.022756	0.830733	0.009133
rs10826175	UBE2D1	10	59801062	G	A	365	263	328	300	0.03579	0.03604	110	145	59	77	174	63	0.013629	0.762303	0.005158
rs2763345	ENSG00000099288	10	71273522	G	C	580	48	556	72	0.02124	0.02692	267	46	1	249	58	7	0.038532	0.068572	0.076054
rs2763356	ENSG00000099288	10	71298608	T	G	590	10	603	21	0.05863	0.06888	291	8	1	291	21	0	0.036979	0.490196	0.038964
rs10768219	RAG1	11	36579047	C	T	391	237	353	275	0.02911	0.03357	124	143	47	109	135	70	0.057348	0.023871	0.247466
rs3824894	ENSG00000175274	11	44892047	A	G	347	275	308	318	0.01982	0.02025	104	139	68	74	160	79	0.025376	0.345996	0.00777
rs835984	ENSG00000175274	11	44892269	G	A	328	264	378	238	0.03567	0.04093	88	152	56	114	150	44	0.102122	0.15437	0.069934
rs4945138	CAPN5	11	76457861	G	A	344	258	335	287	0.24775	0.25062	107	130	64	85	165	61	0.037184	0.617794	0.029718
rs7926553	CAPN5	11	76470079	A	C	378	242	413	213	0.06647	0.0684	120	138	52	132	149	32	0.056681	0.018863	0.414412
rs614128	NOX4	11	88853762	G	C	580	48	604	24	0.00358	0.00492	266	48	0	291	22	1	0.002768	1	0.002303
rs490934	NOX4	11	88863264	G	C	556	48	587	23	0.00193	0.0021	254	48	0	283	21	1	0.001418	1	8.88E−04
MRD_3565	NOX4	11	88864101	C	A	372	134	401	105	0.03185	0.03219	131	110	12	159	83	11	0.038309	1	0.015148
rs553635	NOX4	11	88869079	C	T	575	51	594	32	0.03091	0.04032	263	49	1	282	30	1	0.073094	1	0.031588
rs7914	MCAM	11	118685526	C	T	469	127	442	168	0.01183	0.01314	182	105	11	154	134	17	0.029341	0.334334	0.01097
rs2846690	ENSG00000120471	11	128314137	G	A	424	172	478	144	0.0231	0.02614	154	116	28	189	100	22	0.074219	0.305783	0.027323
rs17123579	ENSG00000123416	12	47808845	A	G	396	228	439	189	0.01558	0.01649	123	150	39	158	123	33	0.023244	0.454525	0.006381
rs177079	ENSG00000074729	12	51172381	G	A	376	236	411	211	0.09003	0.09727	109	158	39	139	133	39	0.056794	1	0.026525
rs941022	BLOC1S1	12	54397591	T	G	368	256	336	292	0.05105	0.05293	112	144	56	77	182	55	0.004267	0.916886	0.00228
rs1513103	PTPRR	12	69388653	G	A	525	103	552	76	0.02931	0.03563	223	79	12	245	62	7	0.110824	0.351819	0.054264
rs1513099	PTPRR	12	69437900	A	G	425	203	388	240	0.02889	0.03345	145	135	34	116	156	42	0.061428	0.391866	0.023295
rs10506608	PTPRR	12	69441647	A	G	561	67	584	44	0.02223	0.02836	250	61	3	274	36	4	0.021436	1	0.013279
rs9971690	CRADD	12	92606492	G	A	331	295	313	315	0.28237	0.28378	94	143	76	71	171	72	0.054765	0.707583	0.037227
rs7304935	CRADD	12	92723753	T	C	447	179	399	229	0.00293	0.00314	153	141	19	129	141	44	0.002527	0.001278	0.054163
rs1485888	CRADD	12	92728005	A	C	380	246	416	212	0.04166	0.04612	120	140	53	137	142	35	0.089863	0.039001	0.194066
rs10859600	CRADD	12	92742628	T	C	391	235	430	198	0.02519	0.02795	127	137	49	150	130	34	0.090603	0.078202	0.076955
rs1165679	TRA1	12	102825705	C	A	497	105	531	81	0.0419	0.0463	205	87	9	229	73	4	0.108915	0.171777	0.072339
rs1177457	TRA1	12	102838594	C	T	450	176	407	221	0.00707	0.00756	160	130	23	128	151	35	0.022302	0.128915	0.010349
rs6486602	EPIM	12	129831194	G	C	373	253	406	222	0.06449	0.0711	106	161	46	120	166	28	0.069931	0.026248	0.279761
rs7962097	EPIM	12	129849744	G	A	499	119	524	102	0.17179	0.18211	205	89	15	217	90	6	0.123785	0.04738	0.440631
rs368392	ENSG00000073910	13	31539978	C	T	484	144	494	132	0.43075	0.45365	192	100	22	189	116	8	0.020852	0.013723	0.870239
rs733258	ENSG00000073910	13	31554200	T	C	520	108	492	136	0.04583	0.054	222	76	16	194	104	16	0.044153	1	0.022592
rs17077090	ENSG00000073910	13	31586074	C	T	615	13	603	25	0.04807	0.06865	302	11	1	289	25	0	0.034555	1	0.040687
rs12877839	ENSG00000073910	13	31745833	T	A	401	213	372	250	0.04569	0.04602	133	135	39	121	130	60	0.078468	0.0283	0.288037
rs17255807	ENSG00000050130	14	59026912	G	A	601	25	587	41	0.04442	0.05711	290	21	2	274	39	1	0.045373	0.623801	0.032893
rs743165	ENSG00000050130	14	59041958	T	C	359	269	322	304	0.04176	0.0472	111	137	66	84	154	75	0.070493	0.390642	0.024813
rs716218	MEIS2	15	34979253	G	A	375	253	389	239	0.41836	0.45239	105	165	44	130	129	55	0.015844	0.273442	0.047699
rs3099886	MEIS2	15	35049404	T	C	487	141	461	167	0.08815	0.10098	181	125	8	173	115	26	0.006324	0.002247	0.573303
rs1357470	MEIS2	15	35067343	G	C	493	135	462	166	0.04045	0.04726	187	119	8	174	114	26	0.006394	0.002247	0.332742
rs10518924	MEIS2	15	35088857	A	G	577	51	556	72	0.04619	0.05724	266	45	3	248	60	6	0.151586	0.50465	0.07811
rs10518928	MEIS2	15	35140532	T	C	501	127	487	141	0.33493	0.37062	208	85	21	184	119	11	0.005913	0.101097	0.057984
rs4625687	MEIS2	15	35151546	A	G	440	188	405	223	0.03531	0.04082	155	130	29	123	159	32	0.034372	0.787768	0.012692
rs4244559	MEIS2	15	35159903	T	C	432	196	398	230	0.04272	0.04914	156	120	38	121	156	37	0.010403	1	0.006238
rs7161976	MEIS2	15	35161477	C	A	595	33	573	55	0.01502	0.01981	281	33	0	263	47	4	0.029517	0.123805	0.045783
rs1464284	MEIS2	15	35173799	T	G	345	283	317	311	0.11355	0.12699	105	135	74	76	165	73	0.021783	1	0.013511
rs1800588	LIPC	15	56510967	C	T	481	147	515	113	0.01789	0.02143	183	115	16	211	93	10	0.057804	0.316643	0.025756
rs261332	LIPC	15	56514617	G	A	466	136	499	105	0.02375	0.0256	178	110	13	206	87	9	0.065462	0.395642	0.022328
rs7183248	LIPC	15	56586337	T	A	495	133	465	163	0.0461	0.05374	202	91	21	175	115	24	0.085017	0.757344	0.03407
rs2899631	LIPC	15	56589377	C	G	495	133	464	164	0.03953	0.04624	202	91	21	175	114	25	0.087949	0.646317	0.03407
rs3829460	LIPC	15	56645237	A	T	438	188	473	155	0.03357	0.03656	158	122	33	184	105	25	0.113517	0.273781	0.045068
rs7180596	CA12	15	61447672	G	A	615	5	626	0	0.02436	0.03026	305	5	0	313	0	0	0.078503	1	0.030011
rs951266	CHRNA5	15	76665596	C	T	439	189	401	227	0.02271	0.02648	154	131	29	133	135	46	0.065544	0.048408	0.109056
rs16969968	CHRNA5	15	76669980	G	A	440	188	399	227	0.0173	0.01923	155	130	29	133	133	47	0.050379	0.028021	0.092535
MRD_3767	ENSG00000185232	15	89256462	C	T	558	30	600	12	0.00308	0.00416	265	28	1	294	12	0	0.013115	0.49	0.005379
rs35181	CDH11	16	63598622	G	T	320	308	345	283	0.15757	0.17483	86	148	80	89	167	58	0.095145	0.042751	0.858752
rs1520231	CDH11	16	63634145	T	C	338	290	343	285	0.77704	0.82079	100	138	76	87	169	58	0.039717	0.09753	0.295007
rs8048351	CDH11	16	63660793	C	A	342	286	340	286	0.95875	1	108	126	80	92	156	65	0.049251	0.18482	0.198802
rs2877427	CDH11	16	63699839	A	G	517	111	482	146	0.01436	0.01729	216	85	13	179	124	11	0.004275	0.835651	0.002904
rs3803704	ENSG00000180917	16	69876078	A	G	482	146	458	170	0.11861	0.13468	192	98	24	164	130	20	0.029347	0.639522	0.029591
rs11654176	NALP1	17	5398562	T	C	533	95	511	117	0.09746	0.11351	222	89	3	212	87	15	0.016138	0.006742	0.437036
rs3744717	NALP1	17	5402238	T	C	566	62	548	80	0.10873	0.12959	253	60	1	243	62	9	0.036254	0.020513	0.378123
rs7214862	COX10	17	13941530	T	G	540	88	511	117	0.02682	0.03235	228	84	2	207	97	10	0.026241	0.036788	0.083534
rs1860084	COX10	17	13950591	T	C	527	99	493	133	0.0134	0.01626	215	97	1	194	105	14	0.00178	8.59E−04	0.092909
rs12150592	FBXW10	17	18620558	A	G	565	63	580	48	0.13592	0.16376	257	51	6	266	48	0	0.04403	0.030506	0.392345
rs8081248	NOS2A	17	23106091	G	A	340	240	373	247	0.58706	0.59693	90	160	40	118	137	55	0.026514	0.218328	0.072259
rs2715553	RARA	17	35749846	T	C	308	300	342	280	0.12862	0.13756	78	152	74	104	134	73	0.091864	0.850124	0.042005
rs7220606	ITGB3	17	42729794	G	A	367	241	347	275	0.1041	0.10608	120	127	57	95	157	59	0.049007	1	0.022448
rs11650072	ITGB3	17	42748664	C	T	389	177	383	189	0.52276	0.52641	141	107	35	123	137	26	0.044422	0.224333	0.110601
rs2696247	COL1A1	17	45624902	A	G	414	52	457	85	0.03665	0.04237	186	42	5	189	79	3	0.010975	0.480519	0.010521
rs8905	PRKAR1B	17	64039397	T	G	544	84	571	57	0.01581	0.01987	235	74	5	261	49	4	0.037717	1	0.014151
rs16952176	PTPRM	18	7582299	A	G	627	1	620	8	0.01919	0.03839	313	1	0	306	8	0	0.063178	1	0.037724
rs4130485	PTPRM	18	8251221	G	T	412	216	387	241	0.14258	0.15922	130	152	32	125	137	52	0.059651	0.025478	0.745197
rs6417047	PTPRM	18	8264246	G	A	344	284	307	321	0.03667	0.04201	92	160	62	84	139	91	0.025537	0.009115	0.534044
rs582420	PTPRM	18	8322974	G	A	459	163	431	195	0.05349	0.06037	164	131	16	154	123	36	0.016144	0.00549	0.37987
rs12456630	PTPRM	18	8327540	A	G	366	260	403	225	0.03805	0.04238	113	140	60	135	133	46	0.136793	0.137044	0.086382
rs609039	PTPRM	18	8393289	A	C	454	170	488	140	0.04244	0.04939	161	132	19	190	108	16	0.080186	0.606565	0.0296
rs8086835	NEDD4L	18	54132690	T	C	434	190	423	205	0.40344	0.42925	143	148	21	146	131	37	0.06475	0.037967	0.872972
rs4499341	INSR	19	7151990	T	C	375	253	411	217	0.03581	0.04122	109	157	48	131	149	34	0.099457	0.123253	0.084507
rs8108661	INSR	19	7155619	C	A	302	326	330	298	0.11407	0.12754	64	174	76	88	154	72	0.077417	0.777962	0.031927
rs890860	INSR	19	7179165	C	T	510	118	498	128	0.45989	0.47746	199	112	3	198	102	13	0.034766	0.011593	1
rs3745364	STXBP2	19	7605205	C	T	385	227	427	199	0.0496	0.05551	126	133	47	151	125	37	0.163969	0.240396	0.089514
rs8104576	LDLR	19	11063569	G	A	619	5	628	0	0.02459	0.03051	307	5	0	314	0	0	0.07916	1	0.03026
rs10417567	NOTCH3	19	15169068	C	T	538	60	533	87	0.03222	0.03476	241	56	2	228	77	5	0.092333	0.450955	0.043129
rs10854166	FKBP8	19	18513844	T	C	339	273	324	300	0.2214	0.23119	100	139	67	77	170	65	0.048042	0.769036	0.032609
rs851303	LIPE	19	47599284	T	A	479	97	482	110	0.43602	0.44448	194	91	3	198	86	12	0.064781	0.033139	0.929925
rs2694555	DHX34	19	52577355	A	C	587	39	605	23	0.03599	0.03769	278	31	4	291	23	0	0.06455	0.061506	0.100074
rs1042265	FTL	19	54163632	C	T	481	71	533	53	0.03885	0.04538	209	63	4	242	49	2	0.114908	0.437981	0.049341
rs3219281	NR1H2	19	55578899	C	T	564	50	546	74	0.02673	0.02935	258	48	1	244	58	8	0.033982	0.03772	0.098384
rs241606	RNF24-FTLL1	20	3863885	T	G	373	255	334	294	0.02652	0.0306	114	145	55	94	146	74	0.094186	0.075159	0.107083
rs17287269	RNF24-FTLL1	20	3890178	A	C	308	320	348	280	0.02385	0.02755	81	146	87	100	148	66	0.086707	0.062796	0.112641
rs6116130	RNF24-FTLL1	20	3895026	A	T	540	86	513	115	0.02728	0.03101	234	72	7	207	99	8	0.050255	1	0.018158
rs998132	RNF24-FTLL1	20	3913054	C	T	310	318	349	279	0.02755	0.03175	82	146	86	100	149	65	0.09389	0.061618	0.134721
rs17287822	RNF24-FTLL1	20	3926536	C	T	541	87	513	115	0.03151	0.03791	234	73	7	207	99	8	0.05931	1	0.02314
rs6114735	C20orf39	20	24393155	A	G	418	210	450	176	0.04111	0.04358	139	140	35	163	124	26	0.122257	0.280966	0.055204
rs4815272	C20orf39	20	24396895	T	A	408	212	459	163	0.00217	0.00244	132	144	34	172	115	24	0.005998	0.170761	0.001736
rs6049737	C20orf39	20	24420839	C	G	349	269	387	239	0.05499	0.05714	94	161	54	122	143	48	0.081153	0.516275	0.028516
rs6138332	C20orf39	20	24512317	A	G	331	257	329	289	0.28651	0.29786	83	165	46	88	153	68	0.106764	0.048598	1
rs4813522	C20orf39	20	24525509	T	C	529	99	544	84	0.23027	0.26281	228	73	13	232	80	2	0.014834	0.006737	0.786878
rs1736493	PLTP	20	43964041	T	C	577	49	598	30	0.02622	0.02746	267	43	3	284	30	0	0.053988	0.123805	0.051035
rs6015591	SYCP2	20	57879024	G	C	384	228	354	258	0.07968	0.0902	131	122	53	104	146	56	0.069462	0.832733	0.030597
rs3787751	HLCS	21	37082033	C	T	348	264	318	304	0.0432	0.04568	98	152	56	84	150	77	0.112718	0.062608	0.185813
rs8132225	HLCS	21	37085192	C	T	571	53	544	82	0.00872	0.01052	260	51	1	240	64	9	0.013115	0.02051	0.045262
rs732252	HLCS	21	37087251	C	T	582	44	599	29	0.06829	0.0714	270	42	1	289	21	4	0.008896	0.373002	0.021088
rs3787755	HLCS	21	37095567	C	G	412	216	444	184	0.05261	0.06037	131	150	33	163	118	33	0.025941	1	0.013108
rs1041832	HLCS	21	37104999	A	G	352	276	388	240	0.03895	0.04466	90	172	52	123	142	49	0.017703	0.828116	0.006923
rs2835535	HLCS	21	37222089	G	A	337	285	380	246	0.01979	0.02199	87	163	61	112	156	45	0.057756	0.088527	0.039413
rs3827189	HLCS	21	37233863	T	C	321	307	357	271	0.04154	0.04183	75	171	68	97	163	54	0.099653	0.18965	0.060055
rs762376	HLCS	21	37262526	C	T	360	264	333	295	0.09675	0.09952	106	148	58	83	167	64	0.12041	0.614304	0.045222
rs915845	ABCG1	21	42508507	T	G	546	78	523	105	0.03458	0.03752	238	70	4	219	85	10	0.090417	0.174686	0.071926
rs178744	ABCG1	21	42535865	G	A	434	194	397	231	0.02735	0.03174	154	126	34	122	153	39	0.035695	0.618725	0.012624
rs2839478	ABCG1	21	42540151	G	A	430	198	404	224	0.12037	0.13527	151	128	35	124	156	34	0.066339	1	0.036419
rs225398	ABCG1	21	42561663	G	C	290	200	254	206	0.21684	0.23758	73	144	28	49	156	25	0.086193	0.884809	0.03608
rs3788010	ABCG1	21	42589091	A	G	348	268	389	237	0.04279	0.04344	91	166	51	120	149	44	0.067911	0.435441	0.02228
rs1541290	ABCG1	21	42591552	A	G	315	311	355	273	0.02753	0.03142	74	167	72	99	157	58	0.066289	0.168988	0.031893
rs2839483	ABCG1	21	42594106	A	G	384	240	422	204	0.03003	0.03334	111	162	39	138	146	29	0.073245	0.201604	0.03364
rs738809	ENSG00000099991	22	22730046	A	G	420	196	450	176	0.15428	0.17287	151	118	39	157	136	20	0.023857	0.009026	0.809882
rs13057834	ENSG00000099991	22	22863646	T	C	543	19	607	9	0.03074	0.03522	262	19	0	299	9	0	0.091443	1	0.033089
rs1009544	SREBF2	22	40563848	C	G	539	89	535	91	0.85386	0.87228	228	83	3	233	69	11	0.051986	0.033051	0.651017
rs133287	SREBF2	22	40590919	G	A	277	283	310	248	0.04142	0.04201	60	157	63	83	144	52	0.070258	0.295506	0.025966
rs4253755	PPARA	22	44935895	G	A	541	79	555	69	0.35892	0.38172	238	65	7	243	69	0	0.027806	0.00738	0.774255
rs6007662	PPARA	22	44941564	A	G	470	158	479	149	0.55457	0.59944	182	106	26	178	123	13	0.059612	0.046003	0.808777
rs4253760	PPARA	22	44942903	T	G	511	117	515	113	0.77042	0.82679	216	79	19	208	99	7	0.018906	0.025756	0.550923
rs1042311	PPARA	22	44948299	C	T	619	7	627	1	0.03295	0.03824	306	7	0	313	1	0	0.101389	1	0.037724

TABLE 2
Sequence Definitions of Polymorphic Sites
Discovered by MRD
MRD_3565 SEQ ID NO 3:
cctaccaggcagaggtgtttaaccccttcgttggcgagccagctcctcca
ggacacagccatgccgccggccccgccgcgctgcgctctgtgcccgccgg
Mccgagaaggagcgggcggcggccggggcagcggttacagttgtgcggcc
tgccgggccgctgagcgaggaccgagggtcaaagactgagtggaagcccg
a
MRD_3435 SEQ ID NO 4:
Cgtcctgtgggtcttgagcagcagacagtttctttctgcctggacccccg
cccccaccccaaaagaggccacagagcttcagcaggaagtttggcctccc
Ygcccgtctccagggaagcagcttttggtccccatctggggcaagcctcc
atgcccaaacatggtcaagtctgagcacacagcctggagacacagactcg
g
MRD_3567 SEQ ID NO 5
ggccttaccttcgcgcctgcagccgcaggtcctgctctgaggggctgaac
acatgctggagctggtgcttggcaattgcctgccacttgcctctgttttc
Wcgctccagccgctcccagatttctgggatctaggagagagaagtggaga
gtggcaggaaggtgctggtaaagtgggacagtggtcctgagcagctaact
t
MRD_3459 SEQ ID NO 6
gaaaaccctccagtcagcgcttatcccttctgctctctcccctcacccag
agaaatacatggagtttgaccttaatggaaatggcgatattggtgagaaa
Ygggtgatttgcgggggcagggtggtgtgcaggcctaagaagacagaggt
ctctcctacatgctccattcctcatgatttgggagggggcccacctacca
c
MRD_3427 SEQ ID NO 7
aaaattaggagtggaattactgagtcatagggtatgcatgtgttcaactt
ttgtggatgtttccacatgattttccaaagtgaaaccctgttttgagatc
Kggaatattgactgtctttcactctccttggaccctagggctacagaact
ggctacccttatcgataccctgctctgagagagaagtctaaaaaatacag
c
MRD_3470 SEQ ID NO 8
gctctaattcatgcaattaacgccttctgtatgaaacagtttttcctcct
ttctttaagggggtggggatacaaaagtaactcagaaaattttctttgtc
Mtaaaactacactgaacatgtgaatagcatattgtggtggacaagagcaa
gagtaaacagatgaaaagaataaatgtttagatttgttgataaaacagga
a

Claims

1. A method of identifying a patient having an increased susceptibility to CAD, the method comprising the steps of: obtaining a sample of DNA or RNA from the patient; and determining which alleles are present in the sample at one or more at-risk polymorphisms selected from the group listed in Table 1; and identifying the patient as having an increased susceptibility to CAD if the at risk allele is present in the patient.

2. The method of claim 1 wherein said one or more at-risk polymorphism is located in PARD3 or CDC42.

3. The method of claim 2 wherein at least one at-risk polymorphism is located in PARD3 and at least one at-risk polymorphism is located in CDC42.

4. The method of claim 1, wherein the patient is human.

5. The method of claim 3 wherein said at least one at-risk polymorphism in CDC42 is rs16826506 and wherein said at least one at-risk polymorphism in PARD3 is rs1545214.

6. The method of claim 3 wherein a C at rs16826506 and an A at rs1545214 indicate that the patient has an increased susceptibility to CAD.

7. A method for determining if a patient has an increased susceptibility to CAD, the method comprising the steps of: obtaining a nucleic acid sample from said patient; determining if a C is present at SNP rs16826506; determining if an A is present at SNP rs1545214; and determining that the patient has an increased susceptibility to CAD if a C is present at SNP rs16826506 and an A is present at SNP rs1545214.

8. The method of claim 7 wherein the patient is human.

9. The method of claim 7 wherein the sample is obtained from blood or saliva.

10. A method for identifying a patient as having an increased susceptibility to CAD, the method comprising the steps of: obtaining a nucleic acid sample from said patient; determining if a C is present at position 31 of SEQ ID NO 1 and an A at position 31 of SEQ ID NO 2; and identifying the patient as having an increased susceptibility to CAD if the patient has a C is present at position 31 of SEQ ID NO 1 and an A at position 31 of SEQ ID NO 2.

11. The method of claim 10 where the patient is human.

12. The method of claim 10 where the sample is obtained from blood or saliva.

13. The method of claim 10 wherein the step of determining is carried out by allele specific hybridization.

14. The method of claim 10 wherein the step of determining is carried out by allele specific primer extension.

15. The method of claim 10 wherein the step of determining is carried out by molecular inversion probe analysis.

16. The method of claim 10 wherein the step of determining is carried out by oligonucleotide ligation assay.