Polynucleotide formula against porcine reproductive and respiratory pathologies

Abstract

The present invention relates to a vaccine formula allowing in particular the vaccination of pigs against reproductive and respiratory pathologies. It also relates to a corresponding method of vaccination.

Description

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

Not applicable.

BACKGROUND OF THE INVENTION

1. Field of the Invention

The present invention relates to a vaccine formula allowing in particular the vaccination of pigs against reproductive and respiratory pathologies. It also relates to a corresponding method of vaccination.

2. Description of Related Art including Information Disclosed under 37 C.F.R. § 1.97 AND 37 C.F.R. § 1.98

During the past decades, the methods for the production of pigs have changed fundamentally. The intensive breeding in an enclosed space has become generalized with, as a corollary, the dramatic development of respiratory pathologies.

The range of symptoms of porcine respiratory pathology is in general grouped under the complex name of pig respiratory disease and involves a wide variety of pathogenic agents comprising viruses as well as bacteria and mycoplasmas.

The principal agents involved in the respiratory disorders are Actinobacillus pleuropneumoniae , the infertility and respiratory syndrome virus (PRRS) also called mysterious disease virus, the Aujeszky's disease virus (PRV) and the swine flu virus.

Other viruses cause reproductive disorders leading to abortions, mummifications of the fetus and infertility. The principal viruses are PRRS, the parvovirus and the conventional hog cholera virus (HCV). Secondarily, the swine flu virus PRV and A. pleuropneumoniae can also cause such disorders. Deaths may occur with A. pleuropneumoniae , HCV and PRV.

In addition, interactions between microorganisms are very important in the porcine respiratory complex. Indeed, most of the bacterial pathogens are habitual hosts of the nasopharangeal zones and of the tonsils in young animals. These pathogens, which are derived from the sows, are often inhaled by the young pigs during their first few hours of life, before the cholostral immunity has become effective. The organisms living in the upper respiratory tract may invade the lower tract when the respiratory defense mechanisms of the host are damaged by a precursor agent such as A. pleuropneumoniae or by viruses. The pulmonary invasion may be very rapid, in particular in the case of precursor pathogens such as A. pleuropneumoniae which produce potent cytotoxins capable of damaging the cilia of the respiratory epithelial cells and the alveolar macrophages.

Major viral infections, such as influenza, and respiratory coronavirus and Aujeszky's virus infections, may play a role in the pathogenicity of the respiratory complex, besides bacteria with respiratory tropism and mycoplasmas.

Finally, some agents have both a respiratory and a reproductive effect. Interactions may also occur from the point of view of the pathology of reproduction.

It therefore appears to be necessary to try to develop an effective prevention against the principal pathogenic agents involved in porcine reproductive and respiratory pathologies.

The associations developed so far were prepared from inactivated vaccines or live vaccines and, optionally, mixtures of such vaccines. Their development poses problems of compatibility between valencies and of stability. It is indeed necessary to ensure both the compatibility between the different vaccine valencies, whether from the point of view of the different antigens used from the point of view of the formulations themselves, especially in the case where both inactivated vaccines and live vaccines are combined. The problem of the conservation of such combined vaccines and also of their safety especially in the presence of an adjuvant also exists. These vaccines are in general quite expensive.

Patent applications WO-A-90 11092, WO-A-93 19183, WO-A-94 21797 and WO-A-95 20660 have made use of the recently developed technique of polynucleotide vaccines. It is known that these vaccines use a plasmid capable of expressing, in the host cells, the antigen inserted into the plasmid. All the routes of administration have been proposed (intraperitoneal, intravenous, intramuscular, transcutaneous, intradermal, mucosal and the like). Various vaccination means can also be used, such as DNA deposited at the surface of gold particles and projected so as to penetrate into the animals' skin (Tang et al., Nature, 356, 152-154, 1992) and liquid jet injectors which make it possible to transfect at the same time the skin, the muscle, the fatty tissues and the mammary tissues (Furth et al., Analytical Biochemistry, 205, 365-368, 1992). (See also U.S. Pat. Nos. 5,846,946, 5,620,896, 5,643,578, 5,580,589, 5,589,466, 5,693,622, and 5,703,055; Science, 259:1745-49, 1993; Robinson et al., seminars in IMMUNOLOGY, 9:271-83, 1997; Luke et al., J. Infect. Dis. 175(1):91-97, 1997; Norman et al., Vaccine, 15(8):801-803, 1997; Bourne et al., The Journal of Infectious Disease, 173:800-7, 1996; and, note that generally a plasmid for a vaccine or immunological composition can comprise DNA encoding an antigen operatively linked to regulatory sequences which control expression or expression and secretion of the antigen from a host cell, e.g., a mammalian cell; for instance, from upstream to downstream, DNA for a promoter, DNA for a eukaryotic leader peptide for secretion, DNA for the antigen, and DNA encoding a terminator.)

The polynucleotide vaccines may also use both naked DNAs and DNAs formulated, for example, inside cationic lipid liposomes.

M-F Le Potier et al., (Second International Symposium on the Eradication of Aujeszky's Disease (pseudorabies) Virus Aug. 6th to 8 th 1995 Copenhagen, Denmark) and M. Monteil et al., (Les Journées d'Animation Scientifique du Département de Pathologie Animale [Scientific meeting organized by the department of animal pathology], INRA-ENV, Ecole Nationale Vétérinaire, LYON, Dec. 13-14, 1994) have tried to vaccinate pigs against the Aujeszky's disease virus with the aid of a plasmid allowing the expression of the gD gene under the control of a strong promoter, the type 2 adenovirus major late promoter. In spite of a good antibody response level, no protection could be detected. Now, satisfactory results in the area of protection have been recorded after inoculation of pigs with a recombinant adenovirus into which the gD gene and the same promoter have been inserted, proving that the gD glcyoprotein could be sufficient for inducing protection in pigs.

The prior art gives no protective result in pigs by the polynucleotide vaccination method.

BRIEF SUMMARY OF THE INVENTION

The invention proposes to provide a multivalent vaccine formula which makes it possible to ensure vaccination of pigs against a number of pathogenic agents involved in particular in respiratory pathology and/or in reproductive pathology.

Another objective of the invention is to provide such a vaccine formula combining different valencies while exhibiting all the criteria required for mutual compatibility and stability of the valencies.

Another objective of the invention is to provide such a vaccine formula which makes it possible to combine different valencies in the same vehicle.

Another objective of the invention is to provide such a vaccine formula which is easy and inexpensive to use.

Yet another objective of the invention is to provide such a vaccine formula and a method for vaccinating pigs which makes it possible to obtain protection, including multivalent protection, with a high level of efficiency and of long duration, as well as good safety and an absence of residues.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows plasmid pVR102.

FIG. 2 shows the sequence of the PRV gB gene (NIA strain) SEQ ID NO:1.

FIG. 3 shows construction of the plasmid pAB090.

FIG. 4 shows the sequence of the PRV gD gene (NIA3 strain) SEQ ID NO:6.

FIG. 5 shows construction f the plasmid pPB098.

FIG. 6 shows the sequence of the porcine flu HA gene (H1N1 strain) SEQ ID NO:11.

FIG. 7 shows construction of the plasmid pPB143.

FIG. 8 shows the sequence of the porcine flu NP gene (H1N1 strain) SEQ ID NO:14.

FIG. 9 shows construction of the plasmid pPB42 .

FIG. 10 shows the sequence of the porcine flu HA gene (H3N2 strain) SEQ ID NO:17.

FIG. 11 shows construction of the plasmid pPB144.

FIG. 12 shows the sequence of the porcine flu NP gene (H2N2 strain) SEQ ID NO:18.

FIG. 13 shows construction of the plasmid pPB132.

FIG. 14 shows plasmid pAB025.

FIG. 15 shows plasmid pAB001.

FIG. 16 shows plasmid pAB091.

FIG. 17 shows plasmid pAB092.

FIG. 18 shows plasmid pAB004.

FIG. 19 shows plasmid pAB069.

FIG. 20 shows plasmid pAB061.

FIG. 21 shows plasmid pPB162.

FIG. 22 shows plasmid pPB163.

FIG. 23 shows plasmid pPB174′.

FIG. 24 shows plasmid pPB189.

FIG. 25 shows plasmid pPB190.

DETAILED DESCRIPTION OF THE INVENTION

The subject of the present invention is therefore a vaccine formula in particular against porcine reproductive and/or respiratory pathology, comprising at least 3 polynucleotide vaccine valencies each comprising a plasmid integrating, so as to express it in vivo in the host cells, a gene with one porcine pathogen valency, these valencies being selected from those of the group consisting of Aujeszky's disease virus (PRV or pseudorabies virus), swine flu virus (swine influenza virus, SIV), pig mysterious disease virus (PRRS virus), parvovirosis virus (PPV virus), conventional hog cholera virus (HCV virus) and bacterium responsible for actinobacillosis ( A. pleuropneumoniae ), the plasmids comprising, for each valency, one or more of the genes selected from the group consisting of gB and gD for the Aujeszky's disease virus, HA, NP and N for the swine flu virus, ORF5 (E), ORF3, ORF6 (M) for the PRRS virus, VP2 for the parvovirosis virus, E1, E2 for the conventional hog cholera virus and apxI, apxII and apxIII for A. pleuropneumoniae.

Valency in the present invention is understood to mean at least one antigen providing protection against the virus for the pathogen considered, it being possible for the valency to contain, as subvalency, one or more modified natural genes from one or more strains of the pathogen considered.

Pathogenic agent gene is understood to mean not only the complete gene but also the various nucleotide sequences, including fragments which retain the capacity to induce a protective response. The notion of a gene covers the nucleotide sequences equivalent to those described precisely in the examples, that is to say the sequences which are different but which encode the same protein. It also covers the nucleotide sequences of other strains of the pathogen considered, which provide cross-protection or a protection specific for a strain or for a strain group. It also covers the nucleotide sequences which have been modified in order to facilitate the in vivo expression by the host animal but encoding the same protein.

Preferably, the vaccine formula according to the invention will comprise the Aujeszky and porcine flu valencies to which other valencies, preferably selected from the PRRS and A. pleuropneumoniae (actinobacillosis) valencies, can be added. Other valencies selected from the parvovirosis and conventional hog cholera valencies can be optionally added to them.

It goes without saying that all the combinations of valencies are possible. However, within the framework of the invention, the Aujeszky and porcine flu, followed by PRRS and A. pleuropneumoniae , valencies are considered to be preferred.

From the point of view in of a vaccination directed more specifically against the porcine respiratory pathology the valencies will be preferably selected from Aujeszky, porcine flu, PRRS and actinobacillosis.

From the point of view of a vaccination directed specifically against the reproductive pathology, the valencies will be preferably selected from PRRS, parvovirosis, conventional hog cholera and Aujeszky.

As regards the Aujeszky valency, either of the gB and gD genes may be used. Preferably, both genes are used, these being in this case mounted in different plasmids or in one and the same plasmid.

As regards the porcine flu valency, the HA and NP genes are preferably used. Either of these two genes or both genes simultaneously can be used, mounted in different plasmids or in one and the same plasmid. Preferably, the HA sequences from more than one influenza virus strain, in particular from the different strains found in the field, will be combined in the same vaccine. On the other hand, NP provides cross-protection and the sequence from a single virus strain will therefore be satisfactory.

As regards the PRSS valency, the E and ORF3 or alternatively M genes are preferably used. These genes can be used alone or in combination; in the case of a combination, the genes can be mounted into separate plasmids or into plasmids combining 2 or 3 of these genes. Genes derived from at least two strains, especially from a European strain and an American strain, will be advantageously combined in the same vaccine.

As regards the conventional hog cholera valency, either of the E1 and E2 genes or also E1 and E2 genes combined, in two different plasmids or optionally in one and the same plasmid, can be used.

As regards the actinobacillosis valency, one of the three genes mentioned above or a combination of 2 or 3 of these genes, mounted in different plasmids or mixed plasmids, may be used in order to provide protection against the different stereotypes of A. pleuropneumoniae . For the apxI, II and III antigens, it may be envisaged that the coding sequences be modified in order to obtain the detoxified antigens, in particular as in the examples.

The vaccine formula according to the invention can be provided in the form of a dose volume generally of between 0.1 and 10 ml, and in particular between 1 and 5 ml especially for vaccinations by the intramuscular route.

The dose will be generally between 10 ng and 1 mg, preferably between 100 ng and 50 μg and preferably between 1 μg and 250 μg per plasmid type.

Use will preferably be made of naked plasmids simply placed in the vaccination vehicle which will be in general physiological saline (0.9% NaCl), ultrapure water, TE buffer and the like. All the polynucleotide vaccine forms described in the prior art can of course be used.

Each plasmid comprises a promoter capable of ensuring the expression of the gene inserted, under its control, into the host cells. This will be in general a strong eukaryotic promoter and in particular a cytomegalovirus early CMV-IE promoter of human or murine origin, or optionally of another origin such as rats, pigs and guinea pigs.

More generally, the promoter may be either of viral origin or of cellular origin. As viral promoter, there may be mentioned the SV40 virus early or late promoter or the Rous sarcoma virus LTR promoter. It may also be a promoter from the virus from which the gene is derived, for example the gene's own promoter.

As cellular promoter, there may be mentioned the promoter of a cytoskeleton gene, for example the desmin promoter (Bolment et al., Journal of Submicroscopic Cytology and Pathology, 1990, 22, 117-122; and Zhenlin et al., Gene, 1989, 78, 243-254), or alternatively the actin promoter.

When several genes are present in the same plasmid, these may be presented in the same transcription unit or in two different units.

The combination of the different vaccine valencies according to the invention may be preferably achieved by mixing the polynucleotide plasmids expressing the antigen(s) of each valency, but it is also possible to envisage causing antigens of several valencies to be expressed by the same plasmid.

The subject of the invention is also monovalent vaccine formulae comprising one or more plasmids encoding one or more genes from one of the viruses selected from the group consisting of PRV, PRRS, PPV, HCV and A. pleuropneumoniae, the genes being those described above. Besides their monovalent character, these formulae may possess the characteristics stated above as regards the choice of the genes, their combinations, the composition of the plasmids, the dose volumes, the doses and the like.

The monovalent vaccine formulae may be used (i) for the preparation of a polyvalent vaccine formula as described above, (ii) individually against the actual pathology, (iii) combined with a vaccine of another type (live or inactivated whole, recombinant, subunit) against another pathology, or (iv) as booster for a vaccine as described below.

The subject of the present invention is in fact also the use of one or more plasmids according to the invention for the manufacture of a vaccine intended to vaccinate pigs first vaccinated by means of a first conventional vaccine of the type in the prior art, namely, in particular, selected from the group consisting of a live whole vaccine, an inactivated whole vaccine, a subunit vaccine, a recombinant vaccine, this first vaccine (monovalent or multivalent) having (that is to say containing or capable of expressing) the antigen(s) encoded by the plasmids or antigen(s) providing cross-protection. Remarkably, the polynucleotide vaccine has a potent booster effect which results in an amplification of the immune response and the acquisition of a long-lasting immunity.

In general, the first-vaccination vaccines can be selected from commercial vaccines available from various veterinary vaccine producers.

The subject of the invention is also a vaccination kit grouping together a first-vaccination vaccine as described above and a vaccine formula according to the invention for the booster. It also relates to a vaccine formula according to the invention accompanied by a leaflet indicating the use of this formula as a booster for a first vaccination as described above.

The subject of the present invention is also a method for vaccinating pigs against the porcine reproductive pathology and/or respiratory pathology, comprising the administration of an effective dose of a vaccine formula as described above. This vaccination method comprises the administration of one or more doses of the vaccine formula, it being possible for these doses to be administered in succession over a short period of time and/or in succession at widely spaced intervals.

The vaccine formulae according to the invention can be administered in the context of this method of vaccination, by the different routes of administration proposed in the prior art for polynucleotide vaccination and by means of known techniques of administration. The vaccination can in particular be used by the intradermal route with the aid of a liquid jet, preferably multiple jet, injector and in particular an injector using an injection head provided with several holes or nozzles, in particular comprising from 5 or 6 holes or nozzles, such as the Pigjet apparatus manufactured and distributed by the company Endoscoptic, Laons, France.

The dose volume for such an apparatus will be reduced preferably to between 0.1 and 0.9 ml, in particular between 0.2 and 0.6 ml and advantageously between 0.4 and 0.5 ml, it being possible for the volume to be applied in one or several, preferably 2, applications.

The subject of the invention is also the method of vaccination consisting in making a first vaccination as described above and a booster with a vaccine formula according to the invention. In a preferred embodiment of the process according to the invention, there is administered in a first instance, to the animal, an effective dose of the vaccine of the conventional, especially inactivated, live, attenuated or recombinant, type, or alternatively a subunit vaccine, so as to provide a first vaccination, and, after a period preferably of 2 to 6 weeks, the polyvalent or monovalent vaccine according to the invention is administered.

The invention also relates to the method of preparing the vaccine formulae, namely the preparation of the valencies and mixtures thereof, as evident from this description.

The invention will now be described in greater detail with the aid of the embodiments of the invention taken with reference to the accompanying drawings.

EXAMPLES

Example 1

Culture of the Viruses

The viruses are cultured on the appropriate cellular system until a cytopathic effect is obtained. The cellular systems to be used for each virus are well known to persons skilled in the art. Briefly, the cells sensitive to the virus used, which are cultured in Eagle's minimum essential medium (MEM medium) or another appropriate medium, are inoculated with the viral strain studied using a multiplicity of infection of 1. The infected cells are then incubated at 37° C. for the time necessary for the appearance of a complete cytopathic effect (on average 36 hours).

Example 2

Culture of the Bacteria and Extraction of the Bacterial DNA

The A. pleuropneumoniae strains were cultured as described by A. Rycroft et al. (J. Gen. Microbiol., 1991, 137, 561-568). The high-molecular weight DNA (chromosomal DNA) was prepared according to the standard techniques described by J. Sambrook et al. ( Molecular Cloning: A Laboratory Manual , 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989).

Example 3

Extraction of the Viral Genomic DNAs:

After culturing, the supernatant and the lysed cells are harvested and the entire viral suspension is centrifuged at 1000 g for 10 minutes at +4° C. so as to remove the cellular debris. The viral particles are then harvested by ultracentrifugation at 400,000 g for 1 hour at +4° C. The pellet is taken up in a minimum volume of buffer (10 mM Tris, 1 mM EDTA; pH 8.0). This concentrated viral suspension is treated with proteinase K (100 μg/ml final) in the presence of sodium dodecyl sulphate (SDS) (0.5% final) for 2 hours at 37° C. The viral DNA is then extracted with a phenol/chloroform mixture and then precipitated with 2 volumes of absolute ethanol. After leaving overnight at −20° C., the DNA is centrifuged at 10,000 g for 15 minutes at +4° C. The DNA pellet is dried and then taken up in a minimum volume of sterile ultrapure water. It can then be digested with restriction enzymes.

Example 4

Isolation of the Viral Genomic RNAs

The RNA viruses were purified according to techniques well known to persons skilled in the art. The genomic viral RNA of each virus was then isolated using the “guanidium thiocyanate/phenol-chloroform” extraction technique described by P. Chromczynski and N. Sacchi (Anal. Biochem., 1987, 162, 156-159).

Example 5

Molecular Biology Techniques

All the constructions of plasmids were carried out using the standard molecular biology techniques described by J. Sambrook et al. ( Molecular Cloning: A Laboratory Manual , 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989). All the restriction fragments used for the present invention were isolated using the “Geneclean” kit (BIO 101 Inc. La Jolla, Calif.).

Example 6

RT-PCR Technique

Specific oligonucleotides (comprising restriction sites at their 5′ ends to facilitate the cloning of the amplified fragments) were synthesized such that they completely cover the coding regions of the genes which are to be amplified (see specific examples). The reverse transcription (RT) reaction and the polymerase chain reaction (PCR) were carried out according to standard techniques (J. Sambrook et al., Molecular Cloning: A Laboratory Manual , 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989). Each RT-PCR reaction was performed with a pair of specific amplimers and taking, as template, the viral genomic RNA extracted. The complementary DNA amplified was extracted with phenol/chloroform/isoamyl alcohol (25:24:1) before being digested with restriction enzymes.

Example 7

Plasmid pVR1012

The plasmid pVR1012 (FIG. No. 1 ) was obtained from Vical Inc., San Diego, Calif., USA. Its construction has been described in J. Hartikka et al. (Human Gene Therapy, 1996, 7, 1205-1217).

Example 8

Construction of the Plasmid pAB090 (PRV gB Gene)

The plasmid pPR2.15 (M. Rivière et al., J. Virol., 1992, 66, 3424-3434) was digested with ApaI and NaeI in order to release a 2665 bp ApaI-NaeI fragment (fragment A) containing the gene encoding Aujeszky's disease virus (NIA3 strain) gB glycoprotein (FIG. No. 2 and SEQ ID No. 1).

By hybridizing the following 2 oligonucleotides:

AB166 (33 mer) (SEQ ID No. 3)

5′ GATGCCCGCTGGTGGCGGTCTTTGGCGCGGGCC 3′

AB167 (33 mer) (SEQ ID No. 4)

5′ ACGTCTACGGGCGACCACCGCCAGAAACCGCGC 3′

a 33 bp fragment containing the sequence of the gD gene, from the initial ATG codon up to the ApaI site, was reconstructed, with the creation of a PstI site in 5′ (fragment B).

By hybridizing the following 2 oligonucleotides:

AB168 (45 mer) (SEQ ID No. 5)

5′ GGCACTACCAGCGCCTCGAGAGCGAGGACCCCGACGCCCTGTAGG 3′

AB169 (49 mer) (SEQ ID No. 6)

5′ GATCCCTACAGGGCGTCGGGGTCCTCGCTCTCGAGGCGCTGGTAGTGCC 3′

a 45 bp fragment containing the sequence of the gD gene, from the NaeI site to the TAG stop codon was reconstructed, with the creation of a BamHI site in 3′ (fragment C).

The fragments A, B and C were ligated together into the vector pVR1012 (Example 7), previously digested with PstI and BamHI, to give the plasmid pAB090 (7603 bp) (FIG. No. 3 ).

Example 9

Construction of the Plasmid pPBO98 (PRV gD Gene)

The plasmid pPR29 (M. Rivière et al., J. Virol., 1992, 66, 3424-3434) was digested with SalI and BglII in order to liberate a 711 bp SalI-BglII fragment (fragment A) containing the 3′ part of the gene encoding the Aujeszky's disease virus (NIA3 strain) gD glycoprotein (FIG. No. 4 and SEQ ID No. 6).

The plasmid pPR29 was digested with Eco47III and SalI in order to liberate a 498 bp Eco47III-SalI fragment containing the 5′ part of the gene encoding the Aujeszky's disease virus (NIA3 strain) gD glycoprotein (fragment B).

By hybridizing the following 2 oligonucleotides:

PB101 (15 mer) (SEQ ID No. 9)

5′ GATGCTGCTCGCAGC 3′

PB102 (19 mer) (SEQ ID No. 10)

5′ GCTGCGAGCAGCATCTGCA 3′

a 15 bp fragment containing the 5′ sequence of the gD gene, from the initial ATG codon up to the Eco47III site was reconstructed, with the creation of a PstI site in 5′ (fragment C).

After purification, the fragments A, B and C were ligated together into the vector pVR1012 (Example 7), previously digested with PstI and BglII, to give the plasmid pPB098 (6076 bp) (FIG. No. 5 ).

Example 10

Construction of the Plasmid pBP143 (porcine flu HA gene, H1N1 strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out in the porcine flu virus (SIV, H1N1 “SW” strain) genomic RNA, prepared according to the technique described in Example 4, and with the following oligonucleotides:

PB107 (32 mer) (SEQ ID No. 11)

5′ GTTCTGCAGCACCCGGGAGCAAAAGCAGGGGA 3′

PB108 (33 mer) (SEQ ID No. 12)

5′ ATTGCGGCCGCTAGTAGAAACAAGGGTGTTTTT 3′

so as to precisely isolate the gene encoding the HA protein from SIV H1N1 (FIG. No. 6 and SEQ ID No. 11) in the form of a 1803 bp PCR fragment. After purification, this fragment was ligated with the vector PCRII-direct (Invitrogen Reference K2000-01), to give the vector pPB137 (5755 bp). The vector pPB137 was digested with EcoRV and NotI in order to liberate a 1820 bp EcoRV-NotI fragment containing the HA gene. This fragment was then ligated into the vector pVR1012 (Example 7), previously digested with EcoRV and NotI, to give the plasmid pPB143 (6726 bp) (FIG. No. 7).

Example 11

Construction of the Plasmid pPB142 (porcine flu NP gene, H1N1 strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the porcine flu virus (SIV H1N1 “SW” strain) genomic RNA, prepared according to the technique described in Example 4, and with the following oligonucleotides:

PB097 (36 mer) (SEQ ID No. 15)

5′ CCGGTCGACCGGGATAATCACTCACTGAGTGACATC 3′

PB098 (33 mer) (SEQ ID No. 16)

5′ TTGCGGCCGCTGTAGAAACAAGGGTATTTTTCT 3′

so as to precisely isolate the gene encoding the NP protein from SIV H1N1 (FIG. No. 8 and SEQ ID No. 14) in the form of an SalI-NotI fragment. After purification, the 1566 bp RT-PCR product was ligated with the vector PCRII-direct (Invitrogen Reference K2000-01), to give the vector pPB127 (5519 bp).

The vector pPB127 was digested with SalI and NotI in order to liberate a 1560 bp SalI-NotI fragment containing the NP gene. This fragment was then ligated into the vector pVR1012 (Example 7), previously digested with SalI and NotI, to give the plasmid pPB142 (6451 bp) (FIG. No. 9 ).

Example 12

Construction of the Plasmid pPB144 (porcine flu HA gene, H3N2 strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the porcine flu virus (strain SIV H3N2 Côtes du Nord 1987) genomic RNA, prepared according to the technique described in Example 4, and with the following oligonucleotides:

PB095 (31 mer) (SEQ ID No. 19)

5′ GTTCTGCAGGCAGGGGATAATTCTATCAACC 3′

PB096 (36 mer) (SEQ ID No. 20)

5′ TTGCGGCCGCAAGGGTGTTTTTAATTACTAATATAC 3′

so as to precisely isolate the gene encoding the HA protein from SIV H3N2 (FIG. No. 10 and SEQ ID No. 17) in the form of a PstI-NotI fragment. After purification, the 1765 bp RT-PCR product was ligated with the vector PCRII-direct (Invitrogen Reference K2000-01) to give the vector pPB120 (5716 bp).

The vector pPB120 was digested with NotI in order to liberate a 1797 bp NotI-NotI fragment containing the HA gene. This fragment was then ligated into the vector pVR1012 (Example 7), previously digested with NotI, to give the plasmid pPB144 (6712 bp) containing the H3N2 HA gene in the correct orientation relative to the promoter (FIG. No. 11 ).

Example 13

Construction of the Plasmid pPB132 (porcine flu NP gene, H3N2 strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the porcine flu virus (strain SIV H3 N2 Côtes du Nord 1987) genomic RNA, prepared according to the technique described in Example 4, and with the following oligonucleotides:

PB097 (36 mer) (SEQ ID No. 15)

5′ CCGGTCGACCGGGATAATCACTCACTGAGTGACATC 3′

PB098 (33 mer) (SEQ ID No. 16)

5′ TTGCGGCCGCTGTAGAAACAAGGGTATTTTTCT 3′

so as to precisely isolate the gene encoding the NP protein from SIV H3N2 (FIG. No. 12 and SEQ ID No. 18) in the form of a SalI-NotI fragment. After purification, the 1564 bp RT-PCR product was ligated with the vector PCRII-direct (Invitrogen Reference K2000-01) in order to give the vector pPB123 (5485 bp).

The vector pPB123 was digested with SalI and NotI in order to liberate a SalI-NotI fragment of 1558 bp containing the NP gene. This fragment was then ligated into the vector pVR1012 (Example 7), previously digested with SalI and NotI, to give the plasmid pPB132 (6449 bp) (FIG. No. 13 ).

Example 14

Construction of the Plasmid pAB025 (PRRSV ORF5 gene, Lelystad strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the PRRSV virus (Lelystad strain) genomic RNA (J. Meulenberg et al., Virology, 1993, 19, 62-72), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB055 (34 mer) (SEQ ID No. 25)

5′ ACGCGTCGACAATATGAGATGTTCTCACAAATTG 3′

AB056 (33 mer) (SEQ ID No. 26)

5′ CGCGGATCCCGTCTAGGCCTCCCATTGCTCAGC 3′

so as to precisely isolate the “ORF5” gene encoding the envelope glycoprotein E (gp25) from the PRRS virus, Lelystad strain. After purification, the 630 bp RT-PCR product was digested with SalI and BamHI in order to isolate a 617 bp SalI-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pAB025 (5486 bp) (FIG. No. 14 ).

Example 15

Construction of the Plasmid pAB001 (PRRSV ORF5 gene, USA strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the PRRSV virus (ATCC VR2332 strain) genomic RNA (M. Murtaugh et al., Arch Virol., 1995, 140, 1451-1460), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB001 (30 mer) (SEQ ID No. 27)

5′ AACTGCAGATGTTGGAGAAATGCTTGACCG 3′

AB002 (30 mer) (SEQ ID No. 22)

5′ CGGGATCCCTAAGGACGACCCCATTGTTCC 3′

so as to precisely isolate the gene encoding the envelope glycoprotein E(“gp25”) from the PRRS virus, ATCC-VR2332 strain. After purification, the 620 bp RT-PCR product was digested with PstI and BamHI in order to isolate a 606 bp PstI-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with PstI and BamHI, to give the plasmid pAB001 (5463 bp) (FIG. No. 15 ).

Example 16

Construction of the Plasmid pAB091 (PPRSV ORF3 gene, Lelystad strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the PRRSV virus (Lelystad strain) genomic RNA (J. Meulenberg et al., 1993), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB170 (32 mer) (SEQ ID No. 29)

5′ AAACTGCAGCAATGGCTCATCAGTGTGCACGC 3′

AB171 (30 mer) (SEQ ID No. 30)

5′ CGCGGATCCTTATCGTGATGTACTGGGGAG 3′

so as to precisely isolate the “ORF3” gene encoding the envelope glycoprotein “gp45” from the PRRS virus, Lelystad strain. After purification, the 818 bp RT-PCR product was digested with PstI and BamHI in order to isolate an 802 bp PstI-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with PstI and BamHI, to give the plasmid pAB091 (5660 bp) (FIG. No. 16 ).

Example 17

Construction of the Plasmid pAB092 (PPRSV ORF3 gene, USA strain)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the PRRSV virus (ATCC-VR2332 strain) genomic RNA (M. Murtaugh et al., 1995), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AN172 (32 mer) (SEQ ID No. 31)

5′ AAACTGCAGCAATGGTTAATAGCTGTACATTC 3′

AB173 (32 mer) (SEQ ID No. 32)

5′ CGCGGATCCCTATCGCCGTACGGCACTGAGGG 3′

so as to precisely isolate the “ORF3” gene encoding the envelope glycoprotein “gp45” from the PRRS virus, ATCC-VR2332 strain. After purification, the 785 bp RT-PCR product was digested with PstI and BamHI in order to isolate a 769 bp Pst-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with PstI and BamHI, to give the plasmid pAB092 (5627 bp) (FIG. No. 17 ).

Example 18

Construction of the Plasmid pAB004 (porcine parvovirus VP2 gene)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the porcine parvovirus (NADL2 strain) genomic RNA (J. Vasudevacharya et al., Virology, 1990, 178, 611-616), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB007 (33 mer) SEQ ID No. 33)

5′ AAAACTGCAGAATGAGTGAAAATGTGGAACAAC 3′

AB010 (33 mer) (SEQ ID No. 34)

5′ CGCGGATCCCTAGTATAATTTTCTTGGTATAAG 3′

so as to amplify a 1757 bp fragment containing the gene encoding the porcine parvovirus VP2 protein. After purification, the RT-PCR product was digested with PstI and BamHI to give a 1740 bp PstI-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with PstI and BamHI, to give the plasmid pAB004 (6601 bp) (FIG. No. 18 ).

Example 19

Construction of the Plasmid pAB069 (hog chlolera HCV E1 gene)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the hog cholera virus (HCV) (Alfort strain) genomic RNA (G. Meyers et al., Virology, 1989, 171, 18-27), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB126 (36 mer) (SEQ ID No. 35)

5′ ACGCGTCGACATGAAACTAGAAAAAGCCCTGTTGGC 3′

AB127 (34 mer) (SEQ ID No. 36)

5′ CGCGGATCCTCATAGCCGCCCTTGTGCCCCGGTC 3′

so as to isolate the sequence encoding the E1 protein from the HCV virus in the form of a 1363 bp RT-PCR fragement. After purification, this fragment was digested with SalI and BamHI to give a 1349 bp SalI-BamHI fragment.

This fragment was ligated with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pABO69 (6218 bp) (FIG. No. 19 ).

Example 20

Construction of the Plasmid pAB061 (hog cholera HCV E2 gene)

An RT-PCR reaction according to the technique described in Example 6 was carried out with the hog cholera virus (HCV) (Alfort strain) genomic RNA (G. Meyers et al., 1989), prepared according to the technique described in Example 4, and with the following oligonucleotides:

AB118 (36 mer) (SEQ ID No. 37)

5′ ACGCGTCGACATGTCAACTACTGCGTTTCTCATTTG 3′

AB119 (33 mer) (SEQ ID No. 38)

5′ CGCGGATCCTCACTGTAGACCAGCAGCGAGCTG 3′

so as to isolate the sequence encoding the E2 protein from the HCV virus in the form of a 1246 bp RT-PCR fragment. After purification, this fragment was digested with SalI and BamHI to give a 1232 bp SalI-BamHI fragment. This fragment was ligated with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pAB061 (6101 bp) (FIG. No. 20 ).

Example 21

Construction of the Plasmid pBP162 (deleted Actinobacillus pleuropneumoniae apxI gene)

The A. pleuropneumoniae apxI gene was cloned so as to delete the glycine-rich amino acid region (involved in the binding of the calcium ion) which is between amino acids 719 and 846.

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 1) genomic DNA (J. Frey et al., Infect. Immun., 1991, 59, 3026-3032), prepared according to the technique described in Examples 2 and 3, and with the following oligonucleotides:

PB174 (32 mer) (SEQ ID No. 39)

5′ TTGTCGACGTAAATAGCTAAGGAGACAACATG 3′

PB189 (29 mer) (SEQ ID No. 40)

5′ TTGAATTCTTCTTCAACAGAATGTAATTC 3′

so as to amplify the 5′ part of the apxI gene encoding the A. pleuropneumoniae haemolysin I protein, in the form of a SalI-EcoRI fragment. After purification, the 2193 bp PCR product was digested with SalI and EcoRI in order to isolate a 2183 bp SalI-EcoRI fragment (fragment A).

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 1) genonic DNA (J. Frey et al., 1991) and with the following oligonucleotides:

BP190 (32 mer) (SEQ ID No. 41)

5′ TTGAATTCTATCGCTACAGTAAGGAGTACGG 3′

PB175 (31 mer) (SEQ ID No. 42)

5′ TTGGATCCGCTATTTATCATCTAAAAATAAC 3′

so as to amplify the 3′ part of the apxI gene encoding the A. pleuropneumoniae haemolysin I protein, in the form of an EcoRI-BamHI fragment. After purification, the 576 bp PCR product was digested with EcoRI and BamHI in order to isolate a 566 bp EcoRI-BamHI fragment (fragment B). The fragments A and B were ligated together with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pPB162 (7619 bp) (FIG. No. 21 ).

Example 22

Construction of the Plasmid pPB163 (deleted A. pleourpneumoniae apxII gene)

The A. pleuropneumoniae apxII gene was cloned so as to delete the glycine-rich amino acid region (involved in the binding of the calcium ion) which is between amino acids 716 and 813.

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 9) genomic DNA (M. Smits et al., Infection and Immunity, 1991, 59, 4497-4504), prepared according to the technique described in Examples 2 and 3, and with the following oligonucleotides:

PB176 (31 mer) (SEQ ID No. 43)

5′ TTGTCGACGATCAATTATATAAAGGAGACTC 3′

PB191 (30 mer) (SEQ ID No. 44)

5′ TTGAATTCCTCTTCAACTGATTTGAGTGAG 3′

so as to amplify the 5′ part of the apxII gene encoding the A. pleuropneumoniae haemolysin II protein, in the form of an SalI-EcoRI fragment. After purification, the 2190 bp PCR product was digested with SalI and EcoRI in order to isolate a 2180 bp SalI-EcoRI fragment (fragment A).

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 9) genomic DNA (M. Smits et al., 1991) and with the following oligonucleotides:

PB192 (29 mer) (SEQ ID No. 45)

5′ TTGAATTCGTAAATCTTAAAGACCTCACC 3′

PB177 (30 mer) (SEQ ID No. 46)

5′ TTGGATCCACCATAGGATTGCTATGATTTG 3′

so as to amplify the 3′ part of the apxII gene encoding the A. pleuropneumoniae haemolysin II protein, in the form of an EcoRI-BamHI fragment. After purification, the 473 bp PCR product was digested with EcoRI and BamHI in order to isolate a 463 bp EcoRI-BamHI fragment (fragment B).

The fragments A and B were ligated together with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pPB163 (7513 bp) (FIG. No. 22 ).

Example 23

Construction of the Plasmids pPB174′, pPB189 and pPB190 (deleted A. pleuropneumoniae apxIII gene)

First Example of Deletion in AxIII (plasmid pPB174′):

The Actinobacillus pleuropneumoniae apxIII gene was cloned so as to delete the glycine-rich amino acid region (involved in the binding of the calcium ion) which is between amino acids 733 and 860.

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815), prepared according to the technique described in Examples 2 and 3, and with the following oligonucleotides:

PB278 (30 mer) (SEQ ID No. 47)

5′ TTTGTCGACATGAGTACTTGGTCAAGCATG 3′

PB279 (28 mer) (SEQ ID No. 48)

5′ TTTATCGATTCTTCTACTGAATGTAATTC 3′

so as to amplify the 5′ part of the apxIII gene (encoding the Actinobacillus pleuropneumoniae haemolysin III protein) in the form of an SalI and ClaI fragment. After purification, the 2216 bp PCR product was digested with SalI and ClaI in order to isolate a 2205 bp SalI-ClaI fragment (fragment A).

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815) and with the following oligonucleotides:

PB280 (33 mer) (SEQ ID No. 49)

5′ TTTATCGATTTATGTTTATCGTTCCACTTCAGG 3′

PB307 (32 mer) (SEQ ID No. 50)

5′ TTGGATCCTTAAGCTGCTCTAGCTAGGTTACC 3′

so as to amplify the 3′ part of the apxIII gene (encoding the A. pleuropneumoniae haemolysin III protein) in the form of a ClaI-BamHI fragment. After purification, the 596 bp PCR product was digested with ClaI and BamHI in order to isolate a 583 bp ClaI-BamHI fragment (fragment B).

The fragments A and B were ligated together with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pPB174′ (7658 bp) (FIG. No. 23 ).

Second Example of Deletion in ApxIII (plasmid pPB189):

The A. pleuropneumoniae apxIII gene was cloned so as to delete the glycine-rich amino acid region (involved in the binding of the calcium ion) which is between amino acids 705 and 886.

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815), prepared according to the technique described in Examples 2 and 3, and with the following oligonucleotides:

PB278 (30 mer) (SEQ ID No. 47)

5′ TTTGTCGACATGAGTACTTGGTCAAGCATG 3′

PB303 (32 mer) (SEQ ID No. 51)

5′ TTTATCGATTTCTTCACGTTTACCAACAGCAG 3′

so as to amplify the 5′ part of the apxIII gene (encoding the A. pleuropneumoniae haemolysin III protein) in the form of a SalI-ClaI fragment. After purification, the 2133 bp PCR product was digested with SalI and ClaI in order to isolate a 2122 bp SalI-ClaI fragment (fragment A).

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815) and with the following oligonucleotides:

PB306 (31 mer) (SEQ ID No. 52)

5′ TTTATCGATTCTGATTTTTCCTTCGATCGTC 3′

PB307 (32 mer) (SEQ ID No. 50)

5′ TTGGATCCTTAAGCTGCTCTAGCTAGGTTACC 3′

so as to amplify the 3′ part of the apxIII gene (encoding the A. pleuropneumoniae haemolysin III protein) in the form of a ClaI-BamHI fragment. After purification, the 518 bp PCR product was digested with ClaI and BamHI in order to isolate a 506 bp ClaI-BamHI fragment (fragment B).

The fragments A and B were ligated together with the vector pVR1012 (Example 7), previously digested with SaII and BamHI, to give the plasmid pPB189 (7496 bp) (FIG. No. 24 ).

Third Example of Deletion in ApxIII (plasmid pPB190):

The A. pleuropneumoniae apxIII gene was cloned so as to delete the glycine-rich amino acid region (involved in the binding of the calcium ion) which is between amino acids 718 and 876.

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815), prepared according to the technique described in Examples 2 and 3, and with the following oligonucleotides:

PB278 (30 mer) (SEQ ID No. 47)

5′ TTTGTCGACATGAGTACTTGGTCAAGCATG 3′

PB304 (33 mer) (SEQ ID No. 53)

5′ TTTATCGATACCTGATTGCGTTAATTCATAATC 3′

so as to amplify the 5′ part of the apxIII gene (encoding the A. pleuropneumoniae haemolysin III protein) in the form of a SalI-ClaI fragment. After purification, the 2172 bp PCR product was digested with SalI and ClaI in order to isolate a 2161 bp SalI-ClaI fragment (fragment A).

A PCR reaction was carried out with the A. pleuropneumoniae (serotype 8) genomic DNA (M. Smits, 1992, Genbank sequence accession No.=X68815) and with the following oligonucleotides:

PB305 (31 mer) (SEQ ID No. 54)

5′ TTTATCGATAAATCTAGTGATTTAGATAAAC 3′

PB307 (32 mer) (SEQ ID No. 50)

5′ TTGGATCCTTAAGCTGCTCTAGCTAGGTTACC 3′

so as to amplify the 3′ part of the apxIII gene (encoding the A. pleuropneumoniae haemolysin III protein) in the form of a ClaI-BamHI fragment. After purification, the 548 bp PCR product was digested with ClaI and BamHI in order to isolate a 536 bp ClaI-BamHI fragment (fragment B).

The fragments A and B were ligated together with the vector pVR1012 (Example 7), previously digested with SalI and BamHI, to give the plasmid pPB190 (7565 bp) (FIG. No. 25 ).

Example 24

Preparation and Purification of the Plasmids

For the preparation of the plasmids intended for the vaccination of animals, any technique may be used which makes it possible to obtain a suspension of purified plasmids predominantly in the supercoiled form. These techniques are well known to persons skilled in the art. There may be mentioned in particular the alkaline lysis technique followed by two successive ultracentrifugations on a caesium chloride gradient in the presence of ethidium bromide as described in J. Sambrook et al. ( Molecular Cloning: A Laboratory Manual , 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989). Reference may also be made to patent applications PCT WO 85/21250 and PCT WO 96/02658 which describe methods for producing, on an industrial scale, plasmids which can be used for vaccination. For the purposes of the manufacture of vaccines (see Example 17), the purified plasmids are resuspended so as to obtain solutions at a high concentration (>2 mg/ml) which are compatible with storage. To do this the plasmids are resuspended either in ultrapure water or in TE buffer (10 mM Tris-HCl; 1 mM EDTA, pH 8.0).

Example 25

Manufacture of the Associated Vaccines

The various plasmids necessary for the manufacture of an associated vaccine are mixed starting with their concentrated solutions (Example 16). The mixtures are prepared such that the final concentration of each plasmid corresponds to the effective dose of each plasmid. The solutions which can be used to adjust the final concentration of the vaccine may be either a 0.9% NaCl solution, or PBS buffer.

Specific formulations such as liposomes, cationic lipids, may also be used for the manufacture of the vaccines.

Example 26

Vaccination of Pigs

The pigs are vaccinated with doses of 100 μg, 250 μg or 500 μg per plasmid.

The injections can be performed with a needle by the intramuscular route. In this case, the vaccinal doses are administered in a volume of 2 ml.

The injections can be performed by the intradermal route using a liquid jet injection apparatus (with no needle) delivering a dose of 0.2 ml at 5 points (0.04 ml per point of injection) (for example “PIGJET” apparatus). In this case, the vaccinal doses are administered in 0.2 or 0.4 ml volumes, which corresponds to one or two administrations respectively. When two successive administrations are performed by means of the PIGJET apparatus, these administrations are spaced out so that the two injection zones are separated from each other by a distance of about 1 to 2 centimetres.

54 1 2742 DNA Pseudorabies virus CDS (1)..(2742) 1atg ccc gct ggt ggc ggt ctt tgg cgc ggg ccc cgg ggg cat cgg ccc 48Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pro Arg Gly His Arg Pro 1 5 10 15ggg cac cac ggc ggt gct ggc ctc gga cgt ctt tgg cct gct cca cac 96Gly His His Gly Gly Ala Gly Leu Gly Arg Leu Trp Pro Ala Pro His 20 25 30cac gct gca gct gcg cgg ggc gcc gtc gcg cta gcg ctg ctg ctg ctg 144His Ala Ala Ala Ala Arg Gly Ala Val Ala Leu Ala Leu Leu Leu Leu 35 40 45gcg ctc gcc gcg gcc ccg ccg tgc ggc gcg gcg gcc gtg acg cgg gcc 192Ala Leu Ala Ala Ala Pro Pro Cys Gly Ala Ala Ala Val Thr Arg Ala 50 55 60gcc tcg gcc tcg ccg acg ccc ggg acg ggc gcc acc ccc aac gac gtc 240Ala Ser Ala Ser Pro Thr Pro Gly Thr Gly Ala Thr Pro Asn Asp Val 65 70 75 80tcc gcc gag gcg tcc ctc gag gag atc gag gcg ttc tcc ccc ggc ccc 288Ser Ala Glu Ala Ser Leu Glu Glu Ile Glu Ala Phe Ser Pro Gly Pro 85 90 95tcg gag gcc ccc gac ggc gag tac ggc gac ctg gac gcg cgg acg gcc 336Ser Glu Ala Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala 100 105 110gtg cgc gcg gcc gcg acc gag cgg gac cgc ttc tac gtc tgc ccg ccg 384Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro 115 120 125ccg tcc ggc tcc acg gtg gtg cgg ctg gag ccc gag cag gcc tgc ccc 432Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro 130 135 140gag tac tcg cag ggg cgc aac ttc acg gag ggg atc gcc ctg ctc ttc 480Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Leu Leu Phe145 150 155 160aag gag aac atc gcc ccg cac aag ttc aag gcc cac atc tac tac aag 528Lys Glu Asn Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys 165 170 175aac gtc atc gtc acg acc gtg tgg tcc ggg agc acg tac gcg gcc atc 576Asn Val Ile Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile 180 185 190acg aac cgc ttc aca gac cgc gtg ccc gtc ccc gtg cag gag atc acg 624Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr 195 200 205gac gtg atc gac cgc cgc ggc aag tgc gtc tcc aag gcc gag tac gtg 672Asp Val Ile Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val 210 215 220cgc aac aac cac aag gtg acc gcc ttc gac cgc gac gag aac ccc gtc 720Arg Asn Asn His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val225 230 235 240gag gtg gac ctg cgc ccc tcg cgc ctg aac gcg ctc ggc acc cgc gcc 768Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Ala 245 250 255tgg cac acc acc aac gac acc tac acc aag atc ggc gcc gcg ggc ttc 816Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe 260 265 270tac cag acg ggc acc tcc gtc aac tgc atc gtc gag gag gtg gag gcg 864Tyr Gln Thr Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala 275 280 285cgc tcc gtg tac ccc tac gac tcc ttc gcc ctg tcc acg ggg gac att 912Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile 290 295 300gtg tac atg tcc ccc ttc tac ggc ctg cgc gag ggg gcc cac ggg gag 960Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu305 310 315 320cag atc ggc tac gcg ccc ggg cgc ttc cag cag gtg gag cac tac tac 1008Gln Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr 325 330 335ccc atc gac ctg gac tcg cgc ctc cgc gcc tcc gag agc gtg acg cgc 1056Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg 340 345 350aac ttt cta cgc acg ccg cac ttc acg gtg gcc tgg gac tgg gcc ccc 1104Asn Phe Leu Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro 355 360 365aag acg cgg cgc gtg tgc agc ctg gcc aag tgg cgc gag gcc gag gag 1152Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu 370 375 380atg acc cgc gac gag acg cgc gac ggc tcc ttc cgc ttc acg tcg cgg 1200Met Thr Arg Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg385 390 395 400gcc ctg ggc gcc tcc ttc gtc agc gac gtc acg cag ctg gac ctg cag 1248Ala Leu Gly Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln 405 410 415cgc gtg cac ctg ggc gac tgc gtc ctc cgc gag gcc tcg gag gcc atc 1296Arg Val His Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile 420 425 430gac gcc atc tac cgg cgg cgc tac aac agc acg cac gtg ctg gcc ggc 1344Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Ser Thr His Val Leu Ala Gly 435 440 445gac agg ccc gag gtg tac ctc gcc cgc ggg ggc ttc gtg gtg gcc ttc 1392Asp Arg Pro Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe 450 455 460cgc ccg ctg atc tcg aac gag ctg gcg cag ctg tac gcg cgc gag ctc 1440Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu465 470 475 480gag cgc ctc ggc ctc gcc ggc gtc gtg ggc ccc gcg gcc ccc gcg gcc 1488Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pro Ala Ala Pro Ala Ala 485 490 495gcc cgt cgg gcc cgg cgc tcc ccc ggc ccg gcg ggg acg ccc gag ccg 1536Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro 500 505 510ccg gcc gtc aac ggc acg ggg cac ctg cgc atc acc acg ggc tcg gcg 1584Pro Ala Val Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala 515 520 525gag ttt gcg cgc ctg cag ttc acc tac gac cac atc cag gcg cac gtg 1632Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val 530 535 540aac gac atg ctg ggc cgc atc gcg gcc gcc tgg tgc gag ctg cag aac 1680Asn Asp Met Leu Gly Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn545 550 555 560aag gac cgc acc ctg tgg agc gag atg tcg cgc ctg aac ccc agc gcc 1728Lys Asp Arg Thr Leu Trp Ser Glu Met Ser Arg Leu Asn Pro Ser Ala 565 570 575gtg gcc acg gcc gcg ctc ggc cag cgc gtc tgc gcg cgc atg ctc ggc 1776Val Ala Thr Ala Ala Leu Gly Gln Arg Val Cys Ala Arg Met Leu Gly 580 585 590gac gtg atg gcc atc tcg cgg tgc gtg gag gtg cgc ggc ggc gtg tac 1824Asp Val Met Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr 595 600 605gtg cag aac tcc atg cgc gtg ccc ggc gag cgc ggc acg tgc tac agc 1872Val Gln Asn Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser 610 615 620cgc ccg ctg gtc acc ttc gag cac aac ggc acg ggc gtg atc gag ggc 1920Arg Pro Leu Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly625 630 635 640cag ctc ggc gac gac aac gag ctc ctc atc tcg cgc gac ctc atc gag 1968Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu 645 650 655ccc tgc acc ggc aac cac cgg cgc tac ttt aag ctg ggg agc ggg tac 2016Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Ser Gly Tyr 660 665 670gtg tac tac gag gac tac aac tac gtg cgc atg gtg gag gtg ccc gag 2064Val Tyr Tyr Glu Asp Tyr Asn Tyr Val Arg Met Val Glu Val Pro Glu 675 680 685acg atc agc acg cgg gtt acc ctg aac ctg acg ctg ctg gag gac cgc 2112Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg 690 695 700gag ttc ctg ccc ctc gag gtg tac acg cgc gag gag ctc gcc gac acg 2160Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr705 710 715 720ggc ctc ctg gac tac agc gag atc cag cgc cgc aac cag ctg cac gcg 2208Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala 725 730 735ctc aag ttc tac gac atc gac cgc gtg gtc aag gtg gac cac aac gtg 2256Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Val 740 745 750gtg ctg ctg cgc ggc atc gcc aac ttc ttc cag ggc ctc ggc gac gtg 2304Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gln Gly Leu Gly Asp Val 755 760 765ggc gcc gcc gtc ggc aag gtg gtc ctg ggt gcc acg ggg gcc gtg atc 2352Gly Ala Ala Val Gly Lys Val Val Leu Gly Ala Thr Gly Ala Val Ile 770 775 780tcg gcc gtc ggc ggc atg gtg tcc ttc ctg tcc aac ccc ttc ggg gcg 2400Ser Ala Val Gly Gly Met Val Ser Phe Leu Ser Asn Pro Phe Gly Ala785 790 795 800ctc gcc atc ggg ctg ctg gtg ctg gcc ggc ctg gtc gcg gcc ttc ctg 2448Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Leu Val Ala Ala Phe Leu 805 810 815gcc tac cgg cac atc tcg cgc ctg cgc cgc aac ccc atg aag gcc ctg 2496Ala Tyr Arg His Ile Ser Arg Leu Arg Arg Asn Pro Met Lys Ala Leu 820 825 830tac ccc gtc acg acg aag acg ctc aag gag gac ggc gtc gac gaa ggc 2544Tyr Pro Val Thr Thr Lys Thr Leu Lys Glu Asp Gly Val Asp Glu Gly 835 840 845gac gtg gac gag gcc aag ctg gac cag gcc cgg gac atg atc cgg tac 2592Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Arg Asp Met Ile Arg Tyr 850 855 860atg tcc atc gtg tcg gcc ctc gag cag cag gag cac aag gcg cgc aag 2640Met Ser Ile Val Ser Ala Leu Glu Gln Gln Glu His Lys Ala Arg Lys865 870 875 880aag aac agc ggg ccc gcg ctg ctg gcc agc cgc gtc ggg gcg atg gcc 2688Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Arg Val Gly Ala Met Ala 885 890 895acg cgc cgc cgg cac tac cag cgc ctc gag agc gag gac ccc gac gcc 2736Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Ser Glu Asp Pro Asp Ala 900 905 910ctg tag 2742Leu 2 913 PRT Pseudorabies virus 2Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pro Arg Gly His Arg Pro 1 5 10 15Gly His His Gly Gly Ala Gly Leu Gly Arg Leu Trp Pro Ala Pro His 20 25 30His Ala Ala Ala Ala Arg Gly Ala Val Ala Leu Ala Leu Leu Leu Leu 35 40 45Ala Leu Ala Ala Ala Pro Pro Cys Gly Ala Ala Ala Val Thr Arg Ala 50 55 60Ala Ser Ala Ser Pro Thr Pro Gly Thr Gly Ala Thr Pro Asn Asp Val 65 70 75 80Ser Ala Glu Ala Ser Leu Glu Glu Ile Glu Ala Phe Ser Pro Gly Pro 85 90 95Ser Glu Ala Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr Ala 100 105 110Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro Pro 115 120 125Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys Pro 130 135 140Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Leu Leu Phe145 150 155 160Lys Glu Asn Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr Lys 165 170 175Asn Val Ile Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala Ile 180 185 190Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile Thr 195 200 205Asp Val Ile Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr Val 210 215 220Arg Asn Asn His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro Val225 230 235 240Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg Ala 245 250 255Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly Phe 260 265 270Tyr Gln Thr Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu Ala 275 280 285Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp Ile 290 295 300Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly Glu305 310 315 320Gln Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr Tyr 325 330 335Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr Arg 340 345 350Asn Phe Leu Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala Pro 355 360 365Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu Glu 370 375 380Met Thr Arg Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser Arg385 390 395 400Ala Leu Gly Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu Gln 405 410 415Arg Val His Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala Ile 420 425 430Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Ser Thr His Val Leu Ala Gly 435 440 445Asp Arg Pro Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala Phe 450 455 460Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu Leu465 470 475 480Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pro Ala Ala Pro Ala Ala 485 490 495Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu Pro 500 505 510Pro Ala Val Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser Ala 515 520 525Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His Val 530 535 540Asn Asp Met Leu Gly Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln Asn545 550 555 560Lys Asp Arg Thr Leu Trp Ser Glu Met Ser Arg Leu Asn Pro Ser Ala 565 570 575Val Ala Thr Ala Ala Leu Gly Gln Arg Val Cys Ala Arg Met Leu Gly 580 585 590Asp Val Met Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val Tyr 595 600 605Val Gln Asn Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr Ser 610 615 620Arg Pro Leu Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu Gly625 630 635 640Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile Glu 645 650 655Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Ser Gly Tyr 660 665 670Val Tyr Tyr Glu Asp Tyr Asn Tyr Val Arg Met Val Glu Val Pro Glu 675 680 685Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp Arg 690 695 700Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp Thr705 710 715 720Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His Ala 725 730 735Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn Val 740 745 750Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gln Gly Leu Gly Asp Val 755 760 765Gly Ala Ala Val Gly Lys Val Val Leu Gly Ala Thr Gly Ala Val Ile 770 775 780Ser Ala Val Gly Gly Met Val Ser Phe Leu Ser Asn Pro Phe Gly Ala785 790 795 800Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Leu Val Ala Ala Phe Leu 805 810 815Ala Tyr Arg His Ile Ser Arg Leu Arg Arg Asn Pro Met Lys Ala Leu 820 825 830Tyr Pro Val Thr Thr Lys Thr Leu Lys Glu Asp Gly Val Asp Glu Gly 835 840 845Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Arg Asp Met Ile Arg Tyr 850 855 860Met Ser Ile Val Ser Ala Leu Glu Gln Gln Glu His Lys Ala Arg Lys865 870 875 880Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Arg Val Gly Ala Met Ala 885 890 895Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Ser Glu Asp Pro Asp Ala 900 905 910Leu 3 33 DNA Aujesky′s Disease Virus (NIA3 Strain) 3gatgcccgct ggtggcggtc tttggcgcgg gcc 33 4 33 DNA Aujesky′s Disease Virus (NIA3 Strain) 4acgtctacgg gcgaccaccg ccagaaaccg cgc 33 5 45 DNA Aujesky′s Disease Virus (NIA3 Strain) 5ggcactacca gcgcctcgag agcgaggacc ccgacgccct gtagg 45 6 49 DNA Aujesky′s Disease Virus (NIA3 Strain) 6gatccctaca gggcgtcggg gtcctcgctc tcgaggcgct ggtagtgcc 49 7 1213 DNA Aujesky′s Disease Virus (NIA3 Strain) CDS (1)..(1212) 7atg ctg ctc gca gcg cta ttg gcg gcg ctg gtc gcc cgg acg acg ctc 48Met Leu Leu Ala Ala Leu Leu Ala Ala Leu Val Ala Arg Thr Thr Leu 1 5 10 15ggt gcg gac gtg gac gcc gtg ccc gcg ccg acc ttc ccc ccg ccc gcg 96Gly Ala Asp Val Asp Ala Val Pro Ala Pro Thr Phe Pro Pro Pro Ala 20 25 30tac ccg tac acc gag tcg tgg cag ctg acg ctg acg acg gtc ccc tcg 144Tyr Pro Tyr Thr Glu Ser Trp Gln Leu Thr Leu Thr Thr Val Pro Ser 35 40 45ccc ttc gtc ggc ccc gcg gac gtc tac cac acg cgc ccg ctg gag gac 192Pro Phe Val Gly Pro Ala Asp Val Tyr His Thr Arg Pro Leu Glu Asp 50 55 60ccg tgc ggg gtg gtg gcg ctg atc tcc gac ccg cag gtg gac cgg ctg 240Pro Cys Gly Val Val Ala Leu Ile Ser Asp Pro Gln Val Asp Arg Leu 65 70 75 80ctg aac gag gcg gtg gcc cac cgg cgg ccc acg tac cgc gcc cac gtg 288Leu Asn Glu Ala Val Ala His Arg Arg Pro Thr Tyr Arg Ala His Val 85 90 95gcc tgg tac cgc atc gcg gac ggg tgc gca cac ctg ctg tac ttt atc 336Ala Trp Tyr Arg Ile Ala Asp Gly Cys Ala His Leu Leu Tyr Phe Ile 100 105 110gag tac gcc gac tgc gac ccc agg cag gca gat ctt tgg gcg ctg ccg 384Glu Tyr Ala Asp Cys Asp Pro Arg Gln Ala Asp Leu Trp Ala Leu Pro 115 120 125gcg ccg cac cac gcc gat gtg gtg gac ccc gtc cgc gga cta cat gtt 432Ala Pro His His Ala Asp Val Val Asp Pro Val Arg Gly Leu His Val 130 135 140ccc cac gga gga cga gct ggg gct gct cat ggt ggc ccc cgg gcg gtt 480Pro His Gly Gly Arg Ala Gly Ala Ala His Gly Gly Pro Arg Ala Val145 150 155 160caa cga ggg cca gta ccg gcg cct ggt gtc cgt cga cgg cgt gaa cat 528Gln Arg Gly Pro Val Pro Ala Pro Gly Val Arg Arg Arg Arg Glu His 165 170 175cct cac cga ctt cat ggt ggc gct ccc cga ggg gca aga gtg ccc gtt 576Pro His Arg Leu His Gly Gly Ala Pro Arg Gly Ala Arg Val Pro Val 180 185 190cgc ccg cgt gga cca gca ccg cac gta caa gtt cgg cgc gtg ctg gag 624Arg Pro Arg Gly Pro Ala Pro His Val Gln Val Arg Arg Val Leu Glu 195 200 205cga cga cag ctt caa gcg ggg cgt gga cgt gat gcg att cct gac gcc 672Arg Arg Gln Leu Gln Ala Gly Arg Gly Arg Asp Ala Ile Pro Asp Ala 210 215 220gtt cta cca gca gcc ccc gca ccg gga ggt ggt gaa cta ctg gta ccg 720Val Leu Pro Ala Ala Pro Ala Pro Gly Gly Gly Glu Leu Leu Val Pro225 230 235 240caa gaa cgg ccg gac gct ccc gcg ggc cca cgc cgc cgc cac gcc gta 768Gln Glu Arg Pro Asp Ala Pro Ala Gly Pro Arg Arg Arg His Ala Val 245 250 255cgc cat cga ccc cgc gcg gcc ctc ggc ggg ctc gcc gag gcc ccg gcc 816Arg His Arg Pro Arg Ala Ala Leu Gly Gly Leu Ala Glu Ala Pro Ala 260 265 270ccg gcc ccg gcc ccg gcc ccg gcc gaa gcc cga gcc cgc ccc ggc gac 864Pro Ala Pro Ala Pro Ala Pro Ala Glu Ala Arg Ala Arg Pro Gly Asp 275 280 285gcc cgc gcc ccc cga ccg cct gcc cga gcc ggc gac gcg gga cca cgc 912Ala Arg Ala Pro Arg Pro Pro Ala Arg Ala Gly Asp Ala Gly Pro Arg 290 295 300cgc cgg ggg ccg ccc cac gcc gcg acc ccc gag gcc cga gac gcc gca 960Arg Arg Gly Pro Pro His Ala Ala Thr Pro Glu Ala Arg Asp Ala Ala305 310 315 320ccg ccc ctt cgc ccc gcc ggc cgt cgt gcc cag cgg gtg gcc gca gcc 1008Pro Pro Leu Arg Pro Ala Gly Arg Arg Ala Gln Arg Val Ala Ala Ala 325 330 335cgc gga gcc gtt cca gcc gcg gac ccc cgc cgc gcc ggg cgt ctc gcg 1056Arg Gly Ala Val Pro Ala Ala Asp Pro Arg Arg Ala Gly Arg Leu Ala 340 345 350cca ccg ctc ggt gat cgt cgg cac ggg cac cgc gat ggg cgc gct cct 1104Pro Pro Leu Gly Asp Arg Arg His Gly His Arg Asp Gly Arg Ala Pro 355 360 365ggt ggg cgt gtg cgt cta cat ctt ctt ccg cct gag ggg ggc gaa ggg 1152Gly Gly Arg Val Arg Leu His Leu Leu Pro Pro Glu Gly Gly Glu Gly 370 375 380gta tcg cct cct ggg cgg tcc cgc gga cgc cga cga gct aaa agc gca 1200Val Ser Pro Pro Gly Arg Ser Arg Gly Arg Arg Arg Ala Lys Ser Ala385 390 395 400gcc cgg tcc gta g 1213Ala Arg Ser Val 8 404 PRT Aujesky′s Disease Virus (NIA3 Strain) 8Met Leu Leu Ala Ala Leu Leu Ala Ala Leu Val Ala Arg Thr Thr Leu 1 5 10 15Gly Ala Asp Val Asp Ala Val Pro Ala Pro Thr Phe Pro Pro Pro Ala 20 25 30Tyr Pro Tyr Thr Glu Ser Trp Gln Leu Thr Leu Thr Thr Val Pro Ser 35 40 45Pro Phe Val Gly Pro Ala Asp Val Tyr His Thr Arg Pro Leu Glu Asp 50 55 60Pro Cys Gly Val Val Ala Leu Ile Ser Asp Pro Gln Val Asp Arg Leu 65 70 75 80Leu Asn Glu Ala Val Ala His Arg Arg Pro Thr Tyr Arg Ala His Val 85 90 95Ala Trp Tyr Arg Ile Ala Asp Gly Cys Ala His Leu Leu Tyr Phe Ile 100 105 110Glu Tyr Ala Asp Cys Asp Pro Arg Gln Ala Asp Leu Trp Ala Leu Pro 115 120 125Ala Pro His His Ala Asp Val Val Asp Pro Val Arg Gly Leu His Val 130 135 140Pro His Gly Gly Arg Ala Gly Ala Ala His Gly Gly Pro Arg Ala Val145 150 155 160Gln Arg Gly Pro Val Pro Ala Pro Gly Val Arg Arg Arg Arg Glu His 165 170 175Pro His Arg Leu His Gly Gly Ala Pro Arg Gly Ala Arg Val Pro Val 180 185 190Arg Pro Arg Gly Pro Ala Pro His Val Gln Val Arg Arg Val Leu Glu 195 200 205Arg Arg Gln Leu Gln Ala Gly Arg Gly Arg Asp Ala Ile Pro Asp Ala 210 215 220Val Leu Pro Ala Ala Pro Ala Pro Gly Gly Gly Glu Leu Leu Val Pro225 230 235 240Gln Glu Arg Pro Asp Ala Pro Ala Gly Pro Arg Arg Arg His Ala Val 245 250 255Arg His Arg Pro Arg Ala Ala Leu Gly Gly Leu Ala Glu Ala Pro Ala 260 265 270Pro Ala Pro Ala Pro Ala Pro Ala Glu Ala Arg Ala Arg Pro Gly Asp 275 280 285Ala Arg Ala Pro Arg Pro Pro Ala Arg Ala Gly Asp Ala Gly Pro Arg 290 295 300Arg Arg Gly Pro Pro His Ala Ala Thr Pro Glu Ala Arg Asp Ala Ala305 310 315 320Pro Pro Leu Arg Pro Ala Gly Arg Arg Ala Gln Arg Val Ala Ala Ala 325 330 335Arg Gly Ala Val Pro Ala Ala Asp Pro Arg Arg Ala Gly Arg Leu Ala 340 345 350Pro Pro Leu Gly Asp Arg Arg His Gly His Arg Asp Gly Arg Ala Pro 355 360 365Gly Gly Arg Val Arg Leu His Leu Leu Pro Pro Glu Gly Gly Glu Gly 370 375 380Val Ser Pro Pro Gly Arg Ser Arg Gly Arg Arg Arg Ala Lys Ser Ala385 390 395 400Ala Arg Ser Val 9 15 DNA Aujesky′s Disease Virus (NIA3 Strain) 9gatgctgctc gcagc 15 10 19 DNA Aujesky′s Disease Virus (NIA3 Strain) 10gctgcgagca gcatctgca 19 11 32 DNA Porcine Flu Virus (SIV, H1N1 “SW” Strain) 11gttctgcagc acccgggagc aaaagcaggg ga 32 12 33 DNA Porcine Flu Virus (SIV, H1N1 “SW” Strain) 12attgcggccg ctagtagaaa caagggtgtt ttt 33 13 1701 DNA Porcine Flu Virus (SIV, H1N1 “SW” Strain) CDS (1)..(1698) 13atg gaa gca aaa cta ttc gta tta ttc tgt aca ttc act gcg ctg aaa 48Met Glu Ala Lys Leu Phe Val Leu Phe Cys Thr Phe Thr Ala Leu Lys 1 5 10 15gct gac acc atc tgt gta gga tac cat gct aac aat tcc aca gat act 96Ala Asp Thr Ile Cys Val Gly Tyr His Ala Asn Asn Ser Thr Asp Thr 20 25 30gtc gac aca ata ctg gag aag aat gtg act gtg act cat tca gtt aat 144Val Asp Thr Ile Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn 35 40 45tta cta gaa aac agt cat aat gga aaa ctc tgc agc ctg aat gga gta 192Leu Leu Glu Asn Ser His Asn Gly Lys Leu Cys Ser Leu Asn Gly Val 50 55 60gcc ccc ttg caa cta ggg aag tgc aac gta gca ggg tgg atc ctt ggc 240Ala Pro Leu Gln Leu Gly Lys Cys Asn Val Ala Gly Trp Ile Leu Gly 65 70 75 80aac cca gaa tgt gac ctg ttg ctc aca gcg aat tca tgg tct tac ata 288Asn Pro Glu Cys Asp Leu Leu Leu Thr Ala Asn Ser Trp Ser Tyr Ile 85 90 95ata gag act tca aat tca gaa aat gga aca tgc tac ccc gga gaa ttc 336Ile Glu Thr Ser Asn Ser Glu Asn Gly Thr Cys Tyr Pro Gly Glu Phe 100 105 110att gat tat gag gaa tta agg gag cag ctg agt tca gtg tct tca ttt 384Ile Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe 115 120 125gaa agg ttt gaa att ttc cca aaa gca aac tca tgg cca aat cat gag 432Glu Arg Phe Glu Ile Phe Pro Lys Ala Asn Ser Trp Pro Asn His Glu 130 135 140aca acc aaa ggt att aca gct gca tgc tct tac tct gga acc ccc agt 480Thr Thr Lys Gly Ile Thr Ala Ala Cys Ser Tyr Ser Gly Thr Pro Ser145 150 155 160ttt tat cgg aat ttg cta tgg ata gta gag agg gaa aat tcc tat cct 528Phe Tyr Arg Asn Leu Leu Trp Ile Val Glu Arg Glu Asn Ser Tyr Pro 165 170 175aaa ctc agc aaa tca tac aca aac aac aaa ggg aaa gaa gtg ctt ata 576Lys Leu Ser Lys Ser Tyr Thr Asn Asn Lys Gly Lys Glu Val Leu Ile 180 185 190atc tgg gga gtg cac cac cct cca act acc aat gac caa caa agc ctc 624Ile Trp Gly Val His His Pro Pro Thr Thr Asn Asp Gln Gln Ser Leu 195 200 205tat cag aat gct gat gca tat gtt tca gtt ggg tca tca aaa tac aac 672Tyr Gln Asn Ala Asp Ala Tyr Val Ser Val Gly Ser Ser Lys Tyr Asn 210 215 220cga agg ttc aca cca gaa ata gca gct aga cct aaa gtc aaa gga caa 720Arg Arg Phe Thr Pro Glu Ile Ala Ala Arg Pro Lys Val Lys Gly Gln225 230 235 240gca ggc aga atg aat tat tat tgg aca ttg tta gat caa gga gac acc 768Ala Gly Arg Met Asn Tyr Tyr Trp Thr Leu Leu Asp Gln Gly Asp Thr 245 250 255ata acg ttt gaa gcc act ggg aac tta ata gca cca tgg tac gcc ttc 816Ile Thr Phe Glu Ala Thr Gly Asn Leu Ile Ala Pro Trp Tyr Ala Phe 260 265 270gca ttg aat aag ggc tct ggt tct gga att ata acg tcg gat act ccg 864Ala Leu Asn Lys Gly Ser Gly Ser Gly Ile Ile Thr Ser Asp Thr Pro 275 280 285gtt cac aat tgt gat aca aag tgc caa acc cct cat ggg gcc ttg aac 912Val His Asn Cys Asp Thr Lys Cys Gln Thr Pro His Gly Ala Leu Asn 290 295 300agt agt ctt cct ttt cag aac gta cat ccc atc act att gga gaa tgc 960Ser Ser Leu Pro Phe Gln Asn Val His Pro Ile Thr Ile Gly Glu Cys305 310 315 320ccc aaa tat gtt aaa agc acc aaa ctg aga atg gca aca gga cta agg 1008Pro Lys Tyr Val Lys Ser Thr Lys Leu Arg Met Ala Thr Gly Leu Arg 325 330 335aac gtc ccc tct att caa tcc aga gga ctt ttc gga gca att gct gga 1056Asn Val Pro Ser Ile Gln Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly 340 345 350ttc att gaa gga gga tgg aca gga atg ata gat ggg tgg tat ggg tat 1104Phe Ile Glu Gly Gly Trp Thr Gly Met Ile Asp Gly Trp Tyr Gly Tyr 355 360 365cac cat cag aat gag cag gga tct ggt tac gca gct gat cag aaa agc 1152His His Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser 370 375 380aca caa att gca att gac ggg atc agc aac aaa gtg aac tca gta att 1200Thr Gln Ile Ala Ile Asp Gly Ile Ser Asn Lys Val Asn Ser Val Ile385 390 395 400gag aaa atg aac act caa ttc act gca gtg ggc aag gaa ttc aat gat 1248Glu Lys Met Asn Thr Gln Phe Thr Ala Val Gly Lys Glu Phe Asn Asp 405 410 415cta gaa aaa agg att gag aat ttg aat aag aaa gtc gat gat ggg ttt 1296Leu Glu Lys Arg Ile Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe 420 425 430ttg gat gtt tgg aca tat aat gct gag ttg ctc gtt ttg ctc gag aac 1344Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn 435 440 445gaa agg act cta gat ttc cat gac ttt aac gta aga aat tta tat gaa 1392Glu Arg Thr Leu Asp Phe His Asp Phe Asn Val Arg Asn Leu Tyr Glu 450 455 460aag gtc aag tca caa ttg aga aac aat gcc aaa gaa atc ggg aat ggt 1440Lys Val Lys Ser Gln Leu Arg Asn Asn Ala Lys Glu Ile Gly Asn Gly465 470 475 480tgt ttt gag ttc tat cac aaa tgt gat gac gaa tgc atg aag agc gta 1488Cys Phe Glu Phe Tyr His Lys Cys Asp Asp Glu Cys Met Lys Ser Val 485 490 495aag aat ggc aca tat aac tac ccc aaa tat tca gaa gaa tcc aaa ttg 1536Lys Asn Gly Thr Tyr Asn Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu 500 505 510aat aga gag gaa ata gac ggt gtg aaa cta gaa tca atg gga gtt tac 1584Asn Arg Glu Glu Ile Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr 515 520 525cag att ttg gcg atc tac tcc aca gtc gcc agt tcc ctg gtc ttg tta 1632Gln Ile Leu Ala Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu 530 535 540gtc tcc ctg ggg gca atc agc ttc tgg atg tgt tct aat ggg tca ttg 1680Val Ser Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu545 550 555 560caa tgc aga ata tgc att taa 1701Gln Cys Arg Ile Cys Ile 565 14 566 PRT Porcine Flu Virus (SIV, H1N1 “SW” Strain) 14Met Glu Ala Lys Leu Phe Val Leu Phe Cys Thr Phe Thr Ala Leu Lys 1 5 10 15Ala Asp Thr Ile Cys Val Gly Tyr His Ala Asn Asn Ser Thr Asp Thr 20 25 30Val Asp Thr Ile Leu Glu Lys Asn Val Thr Val Thr His Ser Val Asn 35 40 45Leu Leu Glu Asn Ser His Asn Gly Lys Leu Cys Ser Leu Asn Gly Val 50 55 60Ala Pro Leu Gln Leu Gly Lys Cys Asn Val Ala Gly Trp Ile Leu Gly 65 70 75 80Asn Pro Glu Cys Asp Leu Leu Leu Thr Ala Asn Ser Trp Ser Tyr Ile 85 90 95Ile Glu Thr Ser Asn Ser Glu Asn Gly Thr Cys Tyr Pro Gly Glu Phe 100 105 110Ile Asp Tyr Glu Glu Leu Arg Glu Gln Leu Ser Ser Val Ser Ser Phe 115 120 125Glu Arg Phe Glu Ile Phe Pro Lys Ala Asn Ser Trp Pro Asn His Glu 130 135 140Thr Thr Lys Gly Ile Thr Ala Ala Cys Ser Tyr Ser Gly Thr Pro Ser145 150 155 160Phe Tyr Arg Asn Leu Leu Trp Ile Val Glu Arg Glu Asn Ser Tyr Pro 165 170 175Lys Leu Ser Lys Ser Tyr Thr Asn Asn Lys Gly Lys Glu Val Leu Ile 180 185 190Ile Trp Gly Val His His Pro Pro Thr Thr Asn Asp Gln Gln Ser Leu 195 200 205Tyr Gln Asn Ala Asp Ala Tyr Val Ser Val Gly Ser Ser Lys Tyr Asn 210 215 220Arg Arg Phe Thr Pro Glu Ile Ala Ala Arg Pro Lys Val Lys Gly Gln225 230 235 240Ala Gly Arg Met Asn Tyr Tyr Trp Thr Leu Leu Asp Gln Gly Asp Thr 245 250 255Ile Thr Phe Glu Ala Thr Gly Asn Leu Ile Ala Pro Trp Tyr Ala Phe 260 265 270Ala Leu Asn Lys Gly Ser Gly Ser Gly Ile Ile Thr Ser Asp Thr Pro 275 280 285Val His Asn Cys Asp Thr Lys Cys Gln Thr Pro His Gly Ala Leu Asn 290 295 300Ser Ser Leu Pro Phe Gln Asn Val His Pro Ile Thr Ile Gly Glu Cys305 310 315 320Pro Lys Tyr Val Lys Ser Thr Lys Leu Arg Met Ala Thr Gly Leu Arg 325 330 335Asn Val Pro Ser Ile Gln Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly 340 345 350Phe Ile Glu Gly Gly Trp Thr Gly Met Ile Asp Gly Trp Tyr Gly Tyr 355 360 365His His Gln Asn Glu Gln Gly Ser Gly Tyr Ala Ala Asp Gln Lys Ser 370 375 380Thr Gln Ile Ala Ile Asp Gly Ile Ser Asn Lys Val Asn Ser Val Ile385 390 395 400Glu Lys Met Asn Thr Gln Phe Thr Ala Val Gly Lys Glu Phe Asn Asp 405 410 415Leu Glu Lys Arg Ile Glu Asn Leu Asn Lys Lys Val Asp Asp Gly Phe 420 425 430Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Leu Glu Asn 435 440 445Glu Arg Thr Leu Asp Phe His Asp Phe Asn Val Arg Asn Leu Tyr Glu 450 455 460Lys Val Lys Ser Gln Leu Arg Asn Asn Ala Lys Glu Ile Gly Asn Gly465 470 475 480Cys Phe Glu Phe Tyr His Lys Cys Asp Asp Glu Cys Met Lys Ser Val 485 490 495Lys Asn Gly Thr Tyr Asn Tyr Pro Lys Tyr Ser Glu Glu Ser Lys Leu 500 505 510Asn Arg Glu Glu Ile Asp Gly Val Lys Leu Glu Ser Met Gly Val Tyr 515 520 525Gln Ile Leu Ala Ile Tyr Ser Thr Val Ala Ser Ser Leu Val Leu Leu 530 535 540Val Ser Leu Gly Ala Ile Ser Phe Trp Met Cys Ser Asn Gly Ser Leu545 550 555 560Gln Cys Arg Ile Cys Ile 565 15 36 DNA Porcine Flu Virus (SIV, H1N1 “SW” Strain) 15ccggtcgacc gggataatca ctcactgagt gacatc 36 16 33 DNA Porcine Flu Virus (SIV, H1N1 “SW” Strain) 16ttgcggccgc tgtagaaaca agggtatttt tct 33 17 1497 DNA swine influenza virus CDS (1)..(1494) 17atg gcg tct caa ggc acc aaa cga tct tat gag cag atg gaa acc ggt 48Met Ala Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 5 10 15gga gaa cgc cag aat gct act gaa atc aga gca tct gtt ggg gga atg 96Gly Glu Arg Gln Asn Ala Thr Glu Ile Arg Ala Ser Val Gly Gly Met 20 25 30gtt ggt gga att gga aga ttc tac ata cag atg tgc act gaa ctc aaa 144Val Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Glu Leu Lys 35 40 45ctc agt gac tat gaa ggg agg ctg atc cag aac agc ata aca ata gag 192Leu Ser Asp Tyr Glu Gly Arg Leu Ile Gln Asn Ser Ile Thr Ile Glu 50 55 60aga atg gtt ctc tct gca ttt gat gag agg agg aac aaa tac ctg gaa 240Arg Met Val Leu Ser Ala Phe Asp Glu Arg Arg Asn Lys Tyr Leu Glu 65 70 75 80gaa cat ccc agt gcg ggg aag gac cca aag aaa act gga ggt cca atc 288Glu His Pro Ser Ala Gly Lys Asp Pro Lys Lys Thr Gly Gly Pro Ile 85 90 95tac aga aag aga gac gga aaa tgg atg aga gag ctg att cta tat gac 336Tyr Arg Lys Arg Asp Gly Lys Trp Met Arg Glu Leu Ile Leu Tyr Asp 100 105 110aaa gag gag atc agg agg att tgg cgt caa gca aac aat ggt gaa gat 384Lys Glu Glu Ile Arg Arg Ile Trp Arg Gln Ala Asn Asn Gly Glu Asp 115 120 125gct act gct ggt ctc act cat ctg atg att tgg cat tcc aac ctg aat 432Ala Thr Ala Gly Leu Thr His Leu Met Ile Trp His Ser Asn Leu Asn 130 135 140gat gcc aca tat cag aga aca aga gct ctc gtg cgt act ggg atg gac 480Asp Ala Thr Tyr Gln Arg Thr Arg Ala Leu Val Arg Thr Gly Met Asp145 150 155 160ccc aga atg tgc tct ctg atg caa gga tca act ctc ccg agg aga tct 528Pro Arg Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser 165 170 175gga gct gct ggt gcg gca gta aag gga gtt ggg acg atg gta atg gaa 576Gly Ala Ala Gly Ala Ala Val Lys Gly Val Gly Thr Met Val Met Glu 180 185 190ctg att cgg atg ata aaa gcg ggg atc aat gat cgg aac ttc tgg aga 624Leu Ile Arg Met Ile Lys Ala Gly Ile Asn Asp Arg Asn Phe Trp Arg 195 200 205ggc gaa aat gga cga aga aca aga att gca tat gag aga atg tgc aac 672Gly Glu Asn Gly Arg Arg Thr Arg Ile Ala Tyr Glu Arg Met Cys Asn 210 215 220atc ctc aaa ggg aaa ttt cag aca gca gcg caa caa gca atg atg gac 720Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Gln Ala Met Met Asp225 230 235 240cag gtg cga gaa atg aca aat cct ggg aat gct gag act gaa gac ctt 768Gln Val Arg Glu Met Thr Asn Pro Gly Asn Ala Glu Thr Glu Asp Leu 245 250 255atc ttt ctg gca cga tct gca ctc att ctg aga gga tca gtg gct cat 816Ile Phe Leu Ala Arg Ser Ala Leu Ile Leu Arg Gly Ser Val Ala His 260 265 270aaa tcc tgc ctg cct gct tgt gta tat gga ctt gtt gtg gca agt gga 864Lys Ser Cys Leu Pro Ala Cys Val Tyr Gly Leu Val Val Ala Ser Gly 275 280 285tat gac ttt gaa aga gaa ggg tac tct cta gtc gga ata gat cct ttc 912Tyr Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe 290 295 300cgt ctg ctc caa aac agc cag gtg ttc agc ctc att aga cca aat gag 960Arg Leu Leu Gln Asn Ser Gln Val Phe Ser Leu Ile Arg Pro Asn Glu305 310 315 320aat cca gca cat aag agt cag ctg gta tgg atg gca tgc cat tct gca 1008Asn Pro Ala His Lys Ser Gln Leu Val Trp Met Ala Cys His Ser Ala 325 330 335gca ttt gaa gat ctg aga gtg tca agt ttc atc aga ggg aca aga gtg 1056Ala Phe Glu Asp Leu Arg Val Ser Ser Phe Ile Arg Gly Thr Arg Val 340 345 350gtc cca aga gga caa ctg tcc acc aga gga gtt caa att gct tca aat 1104Val Pro Arg Gly Gln Leu Ser Thr Arg Gly Val Gln Ile Ala Ser Asn 355 360 365gaa aac atg gaa aca atg gag tcc agt act ctt gaa ctg aga agc aaa 1152Glu Asn Met Glu Thr Met Glu Ser Ser Thr Leu Glu Leu Arg Ser Lys 370 375 380tac tgg gct ata aga acc agg agc gga gga aac acc aac caa cag aga 1200Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn Thr Asn Gln Gln Arg385 390 395 400gca tct gca ggg caa atc agt gta caa ctt act ttc tcg gta cag aga 1248Ala Ser Ala Gly Gln Ile Ser Val Gln Leu Thr Phe Ser Val Gln Arg 405 410 415aat ctt cct ttc gag aga gcg acc atc atg gca gca ttt aca ggg aac 1296Asn Leu Pro Phe Glu Arg Ala Thr Ile Met Ala Ala Phe Thr Gly Asn 420 425 430act gaa ggc aga aca tct gac atg agg act gaa att ata aga atg atg 1344Thr Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Ile Ile Arg Met Met 435 440 445gaa agt gcc aga cca gaa gat gtg tcc ttc cag ggg cgg gga gtc ttc 1392Glu Ser Ala Arg Pro Glu Asp Val Ser Phe Gln Gly Arg Gly Val Phe 450 455 460gag ctc tcg gac gaa aag gca acg aac ccg atc gtg cct tcc ttt gac 1440Glu Leu Ser Asp Glu Lys Ala Thr Asn Pro Ile Val Pro Ser Phe Asp465 470 475 480atg agt aat gag gga tct tat ttc ttc gga gac aat gca gag gag tat 1488Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr 485 490 495gac aat taa 1497Asp Asn 18 498 PRT swine influenza virus 18Met Ala Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 5 10 15Gly Glu Arg Gln Asn Ala Thr Glu Ile Arg Ala Ser Val Gly Gly Met 20 25 30Val Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Glu Leu Lys 35 40 45Leu Ser Asp Tyr Glu Gly Arg Leu Ile Gln Asn Ser Ile Thr Ile Glu 50 55 60Arg Met Val Leu Ser Ala Phe Asp Glu Arg Arg Asn Lys Tyr Leu Glu 65 70 75 80Glu His Pro Ser Ala Gly Lys Asp Pro Lys Lys Thr Gly Gly Pro Ile 85 90 95Tyr Arg Lys Arg Asp Gly Lys Trp Met Arg Glu Leu Ile Leu Tyr Asp 100 105 110Lys Glu Glu Ile Arg Arg Ile Trp Arg Gln Ala Asn Asn Gly Glu Asp 115 120 125Ala Thr Ala Gly Leu Thr His Leu Met Ile Trp His Ser Asn Leu Asn 130 135 140Asp Ala Thr Tyr Gln Arg Thr Arg Ala Leu Val Arg Thr Gly Met Asp145 150 155 160Pro Arg Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser 165 170 175Gly Ala Ala Gly Ala Ala Val Lys Gly Val Gly Thr Met Val Met Glu 180 185 190Leu Ile Arg Met Ile Lys Ala Gly Ile Asn Asp Arg Asn Phe Trp Arg 195 200 205Gly Glu Asn Gly Arg Arg Thr Arg Ile Ala Tyr Glu Arg Met Cys Asn 210 215 220Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Gln Ala Met Met Asp225 230 235 240Gln Val Arg Glu Met Thr Asn Pro Gly Asn Ala Glu Thr Glu Asp Leu 245 250 255Ile Phe Leu Ala Arg Ser Ala Leu Ile Leu Arg Gly Ser Val Ala His 260 265 270Lys Ser Cys Leu Pro Ala Cys Val Tyr Gly Leu Val Val Ala Ser Gly 275 280 285Tyr Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe 290 295 300Arg Leu Leu Gln Asn Ser Gln Val Phe Ser Leu Ile Arg Pro Asn Glu305 310 315 320Asn Pro Ala His Lys Ser Gln Leu Val Trp Met Ala Cys His Ser Ala 325 330 335Ala Phe Glu Asp Leu Arg Val Ser Ser Phe Ile Arg Gly Thr Arg Val 340 345 350Val Pro Arg Gly Gln Leu Ser Thr Arg Gly Val Gln Ile Ala Ser Asn 355 360 365Glu Asn Met Glu Thr Met Glu Ser Ser Thr Leu Glu Leu Arg Ser Lys 370 375 380Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn Thr Asn Gln Gln Arg385 390 395 400Ala Ser Ala Gly Gln Ile Ser Val Gln Leu Thr Phe Ser Val Gln Arg 405 410 415Asn Leu Pro Phe Glu Arg Ala Thr Ile Met Ala Ala Phe Thr Gly Asn 420 425 430Thr Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Ile Ile Arg Met Met 435 440 445Glu Ser Ala Arg Pro Glu Asp Val Ser Phe Gln Gly Arg Gly Val Phe 450 455 460Glu Leu Ser Asp Glu Lys Ala Thr Asn Pro Ile Val Pro Ser Phe Asp465 470 475 480Met Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr 485 490 495Asp Asn 19 31 DNA Porcine Flu Virus (Strain SIV H3N2 Cote du Nord 1987) 19gttctgcagg caggggataa ttctatcaac c 31 20 36 DNA Porcine Flu Virus (Strain SIV H3N2 Cote du Nord 1987) 20ttgcggccgc aagggtgttt ttaattacta atatac 36 21 1701 DNA swine influenza virus CDS (1)..(1698) 21atg aag act gtc att gcc ttg agc tac att ttc tgt ctg gtt ctt ggc 48Met Lys Thr Val Ile Ala Leu Ser Tyr Ile Phe Cys Leu Val Leu Gly 1 5 10 15caa gac ctt cca gaa aat ggc agc agc aca gca aag cct ggt ctg gga 96Gln Asp Leu Pro Glu Asn Gly Ser Ser Thr Ala Lys Pro Gly Leu Gly 20 25 30cat cat gcg gtg cca aac gga acg tta gtg aaa aca atc acg aat gat 144His His Ala Val Pro Asn Gly Thr Leu Val Lys Thr Ile Thr Asn Asp 35 40 45cag atc gaa gtg act aat gct act gag ctg gtc cag agt ttc tca atg 192Gln Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Ser Phe Ser Met 50 55 60ggt aaa ata tgc aac aat cct cat cga gtt ctt gat gga gca aac tgt 240Gly Lys Ile Cys Asn Asn Pro His Arg Val Leu Asp Gly Ala Asn Cys 65 70 75 80aca ctg ata gat gct cta ttg ggg gac cct cat tgt gat ggc ttt caa 288Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro His Cys Asp Gly Phe Gln 85 90 95aat gag aaa tgg gac ctt ttc gtt gaa cgc agc aaa tgc ttc agc aac 336Asn Glu Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Cys Phe Ser Asn 100 105 110tgt tac cct tat gat gtg cca gat tat gcc tcc ctt agg tca cta att 384Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Ile 115 120 125gcc tct tcg ggc act ttg gag ttt atc aat gaa ggt ttc aat tgg act 432Ala Ser Ser Gly Thr Leu Glu Phe Ile Asn Glu Gly Phe Asn Trp Thr 130 135 140ggg gtc act cag aac gga gga agc aat gct tgc aag agg ggg cct gat 480Gly Val Thr Gln Asn Gly Gly Ser Asn Ala Cys Lys Arg Gly Pro Asp145 150 155 160agc ggt ttc ttc agt agg ctg aac tgg ttg tac aaa tca gga aac aca 528Ser Gly Phe Phe Ser Arg Leu Asn Trp Leu Tyr Lys Ser Gly Asn Thr 165 170 175tac ccg atg ctg aac gtg act atg cca aac agt gat aat ttt gac aaa 576Tyr Pro Met Leu Asn Val Thr Met Pro Asn Ser Asp Asn Phe Asp Lys 180 185 190tta tac att tgg ggg gtt cac cat ccg agc aca gac agg gaa caa acc 624Leu Tyr Ile Trp Gly Val His His Pro Ser Thr Asp Arg Glu Gln Thr 195 200 205aac cta tat gtt caa gta tca ggg aaa gca acg gtt ttc acc aag aga 672Asn Leu Tyr Val Gln Val Ser Gly Lys Ala Thr Val Phe Thr Lys Arg 210 215 220agc cag cag acc ata atc ccg aac agt cgg tct aga ccc tgg gta agg 720Ser Gln Gln Thr Ile Ile Pro Asn Ser Arg Ser Arg Pro Trp Val Arg225 230 235 240ggt ctg tct agt aga ata agc atc cat tgg aca ata gtt aaa ccg ggg 768Gly Leu Ser Ser Arg Ile Ser Ile His Trp Thr Ile Val Lys Pro Gly 245 250 255gac att ctg ata att aat agt aat ggg aac cta att gct cct cgg ggt 816Asp Ile Leu Ile Ile Asn Ser Asn Gly Asn Leu Ile Ala Pro Arg Gly 260 265 270tac ttc aaa atg cac aat ggg aga agc tca ata atg agg tca gat gca 864Tyr Phe Lys Met His Asn Gly Arg Ser Ser Ile Met Arg Ser Asp Ala 275 280 285cct att ggc acc tgc agt tct gaa tgc atc act cca aat gga agc atc 912Pro Ile Gly Thr Cys Ser Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile 290 295 300cca aat gac aaa ccc ttt caa aac gta aac aag atc aca tat ggg gca 960Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Lys Ile Thr Tyr Gly Ala305 310 315 320tgt cct aag tat gtt aaa caa aac act ctg aag ttg gca aca ggg atg 1008Cys Pro Lys Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr Gly Met 325 330 335cgg aat ata ccg gaa aaa caa act aga ggc ata ttc ggc gca ata gca 1056Arg Asn Ile Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala 340 345 350ggt ttc ata gag aat ggt tgg gaa gga atg gta gac ggc tgg tac ggt 1104Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly 355 360 365ttc aga cat caa aat tct gag ggc aca gga caa gca gca gac ctt aaa 1152Phe Arg His Gln Asn Ser Glu Gly Thr Gly Gln Ala Ala Asp Leu Lys 370 375 380agc acc caa gca gcc atc gac caa atc aac ggg aaa ctg aat aga cta 1200Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu385 390 395 400atc gag aag acg aac ggg aaa ttc cat caa atc gaa aag gaa ttc tca 1248Ile Glu Lys Thr Asn Gly Lys Phe His Gln Ile Glu Lys Glu Phe Ser 405 410 415ata gta gaa ggg aga att cag gac ctc gag aaa tac gtt gaa gac act 1296Ile Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr 420 425 430aaa ata gat ctc tgg tct tac aat gcg gaa ctt ctt gtc gct ctg gag 1344Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu 435 440 445aac caa cat aca att gat ctg act gac tcg gaa atg agc aaa ctg ttt 1392Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Ser Lys Leu Phe 450 455 460gaa aaa aca agg agg caa ctg agg gaa aat gct gag gac atg gga aac 1440Glu Lys Thr Arg Arg Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn465 470 475 480ggt tgc ctt caa ata tac cac aaa tgt gac aat gct tgc ata gag tca 1488Gly Cys Leu Gln Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Glu Ser 485 490 495atc aga aat ggg act tat gac cat aat gaa tac aga gac gaa gca tta 1536Ile Arg Asn Gly Thr Tyr Asp His Asn Glu Tyr Arg Asp Glu Ala Leu 500 505 510aac aac cga ttt cag atc aaa ggt gtt gag ctg aag tcg gga tac aaa 1584Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys 515 520 525gac tgg atc ctg tgg att tcc tct gcc ata tca tgc ttt ttg ctt tgt 1632Asp Trp Ile Leu Trp Ile Ser Ser Ala Ile Ser Cys Phe Leu Leu Cys 530 535 540gtt gtt ttg cta gga ttt atc atg tgg gcc tgc cag aaa ggc aac att 1680Val Val Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile545 550 555 560agg tgc aac att tgc atc tga 1701Arg Cys Asn Ile Cys Ile 565 22 566 PRT swine influenza virus 22Met Lys Thr Val Ile Ala Leu Ser Tyr Ile Phe Cys Leu Val Leu Gly 1 5 10 15Gln Asp Leu Pro Glu Asn Gly Ser Ser Thr Ala Lys Pro Gly Leu Gly 20 25 30His His Ala Val Pro Asn Gly Thr Leu Val Lys Thr Ile Thr Asn Asp 35 40 45Gln Ile Glu Val Thr Asn Ala Thr Glu Leu Val Gln Ser Phe Ser Met 50 55 60Gly Lys Ile Cys Asn Asn Pro His Arg Val Leu Asp Gly Ala Asn Cys 65 70 75 80Thr Leu Ile Asp Ala Leu Leu Gly Asp Pro His Cys Asp Gly Phe Gln 85 90 95Asn Glu Lys Trp Asp Leu Phe Val Glu Arg Ser Lys Cys Phe Ser Asn 100 105 110Cys Tyr Pro Tyr Asp Val Pro Asp Tyr Ala Ser Leu Arg Ser Leu Ile 115 120 125Ala Ser Ser Gly Thr Leu Glu Phe Ile Asn Glu Gly Phe Asn Trp Thr 130 135 140Gly Val Thr Gln Asn Gly Gly Ser Asn Ala Cys Lys Arg Gly Pro Asp145 150 155 160Ser Gly Phe Phe Ser Arg Leu Asn Trp Leu Tyr Lys Ser Gly Asn Thr 165 170 175Tyr Pro Met Leu Asn Val Thr Met Pro Asn Ser Asp Asn Phe Asp Lys 180 185 190Leu Tyr Ile Trp Gly Val His His Pro Ser Thr Asp Arg Glu Gln Thr 195 200 205Asn Leu Tyr Val Gln Val Ser Gly Lys Ala Thr Val Phe Thr Lys Arg 210 215 220Ser Gln Gln Thr Ile Ile Pro Asn Ser Arg Ser Arg Pro Trp Val Arg225 230 235 240Gly Leu Ser Ser Arg Ile Ser Ile His Trp Thr Ile Val Lys Pro Gly 245 250 255Asp Ile Leu Ile Ile Asn Ser Asn Gly Asn Leu Ile Ala Pro Arg Gly 260 265 270Tyr Phe Lys Met His Asn Gly Arg Ser Ser Ile Met Arg Ser Asp Ala 275 280 285Pro Ile Gly Thr Cys Ser Ser Glu Cys Ile Thr Pro Asn Gly Ser Ile 290 295 300Pro Asn Asp Lys Pro Phe Gln Asn Val Asn Lys Ile Thr Tyr Gly Ala305 310 315 320Cys Pro Lys Tyr Val Lys Gln Asn Thr Leu Lys Leu Ala Thr Gly Met 325 330 335Arg Asn Ile Pro Glu Lys Gln Thr Arg Gly Ile Phe Gly Ala Ile Ala 340 345 350Gly Phe Ile Glu Asn Gly Trp Glu Gly Met Val Asp Gly Trp Tyr Gly 355 360 365Phe Arg His Gln Asn Ser Glu Gly Thr Gly Gln Ala Ala Asp Leu Lys 370 375 380Ser Thr Gln Ala Ala Ile Asp Gln Ile Asn Gly Lys Leu Asn Arg Leu385 390 395 400Ile Glu Lys Thr Asn Gly Lys Phe His Gln Ile Glu Lys Glu Phe Ser 405 410 415Ile Val Glu Gly Arg Ile Gln Asp Leu Glu Lys Tyr Val Glu Asp Thr 420 425 430Lys Ile Asp Leu Trp Ser Tyr Asn Ala Glu Leu Leu Val Ala Leu Glu 435 440 445Asn Gln His Thr Ile Asp Leu Thr Asp Ser Glu Met Ser Lys Leu Phe 450 455 460Glu Lys Thr Arg Arg Gln Leu Arg Glu Asn Ala Glu Asp Met Gly Asn465 470 475 480Gly Cys Leu Gln Ile Tyr His Lys Cys Asp Asn Ala Cys Ile Glu Ser 485 490 495Ile Arg Asn Gly Thr Tyr Asp His Asn Glu Tyr Arg Asp Glu Ala Leu 500 505 510Asn Asn Arg Phe Gln Ile Lys Gly Val Glu Leu Lys Ser Gly Tyr Lys 515 520 525Asp Trp Ile Leu Trp Ile Ser Ser Ala Ile Ser Cys Phe Leu Leu Cys 530 535 540Val Val Leu Leu Gly Phe Ile Met Trp Ala Cys Gln Lys Gly Asn Ile545 550 555 560Arg Cys Asn Ile Cys Ile 565 23 1497 DNA swine influenza virus CDS (1)..(1494) 23atg gcg tct caa ggc act aaa cga tct tat gag cag atg gaa acc ggt 48Met Ala Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 5 10 15gga gaa cgc cgg aat gct act gaa atc aga gca tct gtt ggg gga atg 96Gly Glu Arg Arg Asn Ala Thr Glu Ile Arg Ala Ser Val Gly Gly Met 20 25 30gtt ggt gga att gga aga ttc tac ata cag atg tgc act aaa ctc aaa 144Val Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Lys Leu Lys 35 40 45ctc agt gac tat gaa ggg agg ctg atc cag aac agc ata aca ata gag 192Leu Ser Asp Tyr Glu Gly Arg Leu Ile Gln Asn Ser Ile Thr Ile Glu 50 55 60aga atg gtt ctc tct gca ttt gat gag agg agg aac aaa tac ctg gaa 240Arg Met Val Leu Ser Ala Phe Asp Glu Arg Arg Asn Lys Tyr Leu Glu 65 70 75 80gaa cat ccc agt gcg ggg aag gac cca aag aaa act gga ggt cca ata 288Glu His Pro Ser Ala Gly Lys Asp Pro Lys Lys Thr Gly Gly Pro Ile 85 90 95tac aga aag aga gac gga aaa tgg atg aga gag ctg att atg tat gac 336Tyr Arg Lys Arg Asp Gly Lys Trp Met Arg Glu Leu Ile Met Tyr Asp 100 105 110aaa gag gag atc agg agg att tgg cgt caa gca aac aat ggt gaa gat 384Lys Glu Glu Ile Arg Arg Ile Trp Arg Gln Ala Asn Asn Gly Glu Asp 115 120 125gct act gct ggt ctc act cat ctg atg att tgg cat tcc aac ctg aat 432Ala Thr Ala Gly Leu Thr His Leu Met Ile Trp His Ser Asn Leu Asn 130 135 140gat gcc aca tat cag aga aca aga gct ctc gtg cgt act ggg atg gac 480Asp Ala Thr Tyr Gln Arg Thr Arg Ala Leu Val Arg Thr Gly Met Asp145 150 155 160ccc aga atg tgc tct ctg atg caa gga tca act ctc ccg agg aga tct 528Pro Arg Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser 165 170 175gga gct gct ggt gca gca gta aag gga gtt ggg acg atg gta atg gaa 576Gly Ala Ala Gly Ala Ala Val Lys Gly Val Gly Thr Met Val Met Glu 180 185 190ctg att cgg atg ata aag cgg ggg atc aat gat cgg aac ttc tgg aga 624Leu Ile Arg Met Ile Lys Arg Gly Ile Asn Asp Arg Asn Phe Trp Arg 195 200 205ggc gaa aat gga cga aga aca aga att gca tat gag aga atg tgc aac 672Gly Glu Asn Gly Arg Arg Thr Arg Ile Ala Tyr Glu Arg Met Cys Asn 210 215 220atc ctc aaa ggg aaa ttt cag aca gca gcg caa cga gca acg atg gac 720Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala Thr Met Asp225 230 235 240cag gtg cga gaa agc aga aat cct ggg aat gct gag att gaa gac ctt 768Gln Val Arg Glu Ser Arg Asn Pro Gly Asn Ala Glu Ile Glu Asp Leu 245 250 255atc ttt cta gca cga tct gca ctc att ctg aga gga tca gtg gct cat 816Ile Phe Leu Ala Arg Ser Ala Leu Ile Leu Arg Gly Ser Val Ala His 260 265 270aaa tcc tgt ctg cct gct tgt gta tat gga ctt gtt gtg gca agt gga 864Lys Ser Cys Leu Pro Ala Cys Val Tyr Gly Leu Val Val Ala Ser Gly 275 280 285tat gac ttt gaa aga gaa ggg tac tct cta gtc gga ata gat cct ttc 912Tyr Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe 290 295 300cgt ctg ctc cag aac agc cag gtg ttc agc ctc att aga cca aat gag 960Arg Leu Leu Gln Asn Ser Gln Val Phe Ser Leu Ile Arg Pro Asn Glu305 310 315 320aat cca gca cat aag agt cag ttg gta tgg atg gca tgc cat tct gca 1008Asn Pro Ala His Lys Ser Gln Leu Val Trp Met Ala Cys His Ser Ala 325 330 335gca ttt gaa gat ctg aga gtg tca agt ttc atc aga ggg aca aaa gtg 1056Ala Phe Glu Asp Leu Arg Val Ser Ser Phe Ile Arg Gly Thr Lys Val 340 345 350gtc cca aga gga caa ctg tcc act aga gga gtt caa att gct tca aat 1104Val Pro Arg Gly Gln Leu Ser Thr Arg Gly Val Gln Ile Ala Ser Asn 355 360 365gaa aac atg gaa aca atg gac tcc att act ctt gaa ctg aga agc aaa 1152Glu Asn Met Glu Thr Met Asp Ser Ile Thr Leu Glu Leu Arg Ser Lys 370 375 380tac tgg gct ata aga acc agg agc gga gga aac acc aac caa cag agg 1200Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn Thr Asn Gln Gln Arg385 390 395 400gca tct gca ggg caa atc agt gta caa cct act ttc tcg gta cag aga 1248Ala Ser Ala Gly Gln Ile Ser Val Gln Pro Thr Phe Ser Val Gln Arg 405 410 415aat ctt cct ttc gag aga gcg acc atc atg gca gca ttt aca ggg aac 1296Asn Leu Pro Phe Glu Arg Ala Thr Ile Met Ala Ala Phe Thr Gly Asn 420 425 430act gaa ggc aga aca tct gac atg agg act gaa att ata aga atg atg 1344Thr Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Ile Ile Arg Met Met 435 440 445gaa agt gcc aga cca gaa gat gtg tcc ttc cag ggg cgg gga gtc ttc 1392Glu Ser Ala Arg Pro Glu Asp Val Ser Phe Gln Gly Arg Gly Val Phe 450 455 460gag ctc tcg gac gaa aaa gca acg aac ccg atc gtg cct tcc ttt gac 1440Glu Leu Ser Asp Glu Lys Ala Thr Asn Pro Ile Val Pro Ser Phe Asp465 470 475 480gtg agt aat gag gga tct tat ttc ttc gga gac aat gca gag gag tat 1488Val Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr 485 490 495aac aat taa 1497Asn Asn 24 498 PRT swine influenza virus 24Met Ala Ser Gln Gly Thr Lys Arg Ser Tyr Glu Gln Met Glu Thr Gly 1 5 10 15Gly Glu Arg Arg Asn Ala Thr Glu Ile Arg Ala Ser Val Gly Gly Met 20 25 30Val Gly Gly Ile Gly Arg Phe Tyr Ile Gln Met Cys Thr Lys Leu Lys 35 40 45Leu Ser Asp Tyr Glu Gly Arg Leu Ile Gln Asn Ser Ile Thr Ile Glu 50 55 60Arg Met Val Leu Ser Ala Phe Asp Glu Arg Arg Asn Lys Tyr Leu Glu 65 70 75 80Glu His Pro Ser Ala Gly Lys Asp Pro Lys Lys Thr Gly Gly Pro Ile 85 90 95Tyr Arg Lys Arg Asp Gly Lys Trp Met Arg Glu Leu Ile Met Tyr Asp 100 105 110Lys Glu Glu Ile Arg Arg Ile Trp Arg Gln Ala Asn Asn Gly Glu Asp 115 120 125Ala Thr Ala Gly Leu Thr His Leu Met Ile Trp His Ser Asn Leu Asn 130 135 140Asp Ala Thr Tyr Gln Arg Thr Arg Ala Leu Val Arg Thr Gly Met Asp145 150 155 160Pro Arg Met Cys Ser Leu Met Gln Gly Ser Thr Leu Pro Arg Arg Ser 165 170 175Gly Ala Ala Gly Ala Ala Val Lys Gly Val Gly Thr Met Val Met Glu 180 185 190Leu Ile Arg Met Ile Lys Arg Gly Ile Asn Asp Arg Asn Phe Trp Arg 195 200 205Gly Glu Asn Gly Arg Arg Thr Arg Ile Ala Tyr Glu Arg Met Cys Asn 210 215 220Ile Leu Lys Gly Lys Phe Gln Thr Ala Ala Gln Arg Ala Thr Met Asp225 230 235 240Gln Val Arg Glu Ser Arg Asn Pro Gly Asn Ala Glu Ile Glu Asp Leu 245 250 255Ile Phe Leu Ala Arg Ser Ala Leu Ile Leu Arg Gly Ser Val Ala His 260 265 270Lys Ser Cys Leu Pro Ala Cys Val Tyr Gly Leu Val Val Ala Ser Gly 275 280 285Tyr Asp Phe Glu Arg Glu Gly Tyr Ser Leu Val Gly Ile Asp Pro Phe 290 295 300Arg Leu Leu Gln Asn Ser Gln Val Phe Ser Leu Ile Arg Pro Asn Glu305 310 315 320Asn Pro Ala His Lys Ser Gln Leu Val Trp Met Ala Cys His Ser Ala 325 330 335Ala Phe Glu Asp Leu Arg Val Ser Ser Phe Ile Arg Gly Thr Lys Val 340 345 350Val Pro Arg Gly Gln Leu Ser Thr Arg Gly Val Gln Ile Ala Ser Asn 355 360 365Glu Asn Met Glu Thr Met Asp Ser Ile Thr Leu Glu Leu Arg Ser Lys 370 375 380Tyr Trp Ala Ile Arg Thr Arg Ser Gly Gly Asn Thr Asn Gln Gln Arg385 390 395 400Ala Ser Ala Gly Gln Ile Ser Val Gln Pro Thr Phe Ser Val Gln Arg 405 410 415Asn Leu Pro Phe Glu Arg Ala Thr Ile Met Ala Ala Phe Thr Gly Asn 420 425 430Thr Glu Gly Arg Thr Ser Asp Met Arg Thr Glu Ile Ile Arg Met Met 435 440 445Glu Ser Ala Arg Pro Glu Asp Val Ser Phe Gln Gly Arg Gly Val Phe 450 455 460Glu Leu Ser Asp Glu Lys Ala Thr Asn Pro Ile Val Pro Ser Phe Asp465 470 475 480Val Ser Asn Glu Gly Ser Tyr Phe Phe Gly Asp Asn Ala Glu Glu Tyr 485 490 495Asn Asn 25 34 DNA PRRSV Virus (Lelystad Strain) 25acgcgtcgac aatatgagat gttctcacaa attg 34 26 33 DNA PRRSV Virus (Lelystad Strain) 26cgcggatccc gtctaggcct cccattgctc agc 33 27 30 DNA PRRSV Virus (ATCCVR2332 Strain) 27aactgcagat gttggagaaa tgcttgaccg 30 28 30 DNA PRRSV Virus (ATCCVR2332 Strain) 28cgggatccct aaggacgacc ccattgttcc 30 29 32 DNA PRRSV Virus (Lelystad Strain) 29aaactgcagc aatggctcat cagtgtgcac gc 32 30 30 DNA PRRSV Virus (Lelystad Strain) 30cgcggatcct tatcgtgatg tactggggag 30 31 32 DNA PRRSV Virus (ATCCVR2332 Strain) 31aaactgcagc aatggttaat agctgtacat tc 32 32 32 DNA PRRSV Virus (ATCCVR2332 Strain) 32cgcggatccc tatcgccgta cggcactgag gg 32 33 33 DNA Porcine Parvovirus (NADL2 Strain) 33aaaactgcag aatgagtgaa aatgtggaac aac 33 34 33 DNA Porcine Parvovirus (NADL2 Strain) 34cgcggatccc tagtataatt ttcttggtat aag 33 35 36 DNA Hog Cholera Virus (Alfort Strain) 35acgcgtcgac atgaaactag aaaaagccct gttggc 36 36 34 DNA Hog Cholera Virus (Alfort Strain) 36cgcggatcct catagccgcc cttgtgcccc ggtc 34 37 36 DNA Hog Cholera Virus (Alfort Strain) 37acgcgtcgac atgtcaacta ctgcgtttct catttg 36 38 33 DNA Hog Cholera Virus (Alfort Strain) 38cgcggatcct cactgtagac cagcagcgag ctg 33 39 32 DNA Actinobacillus Pleuropneumoniae (Serotype 1) 39ttgtcgacgt aaatagctaa ggagacaaca tg 32 40 29 DNA Actinobacillus Pleuropneumoniae (Serotype 1) 40ttgaattctt cttcaacaga atgtaattc 29 41 31 DNA Actinobacillus Pleuropneumoniae (Serotype 1) 41ttgaattcta tcgctacagt aaggagtacg g 31 42 31 DNA Actinobacillus Pleuropneumoniae (Serotype 1) 42ttggatccgc tatttatcat ctaaaaataa c 31 43 31 DNA Actinobacillus Pleuropneumoniae (Serotype 9) 43ttgtcgacga tcaattatat aaaggagact c 31 44 30 DNA Actinobacillus Pleuropneumoniae (Serotype 9) 44ttgaattcct cttcaactga tttgagtgag 30 45 29 DNA Actinobacillus Pleuropneumoniae (Serotype 9) 45ttgaattcgt aaatcttaaa gacctcacc 29 46 30 DNA Actinobacillus Pleuropneumoniae (Serotype 9) 46ttggatccac cataggattg ctatgatttg 30 47 30 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 47tttgtcgaca tgagtacttg gtcaagcatg 30 48 29 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 48tttatcgatt cttctactga atgtaattc 29 49 33 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 49tttatcgatt tatgtttatc gttccacttc agg 33 50 32 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 50ttggatcctt aagctgctct agctaggtta cc 32 51 32 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 51tttatcgatt tcttcacgtt taccaacagc ag 32 52 31 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 52tttatcgatt ctgatttttc cttcgatcgt c 31 53 33 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 53tttatcgata cctgattgcg ttaattcata atc 33 54 31 DNA Actinobacillus Pleuropneumoniae (Serotype 8) 54tttatcgata aatctagtga tttagataaa c 31

Claims

1. An immunogenic composition for inducing in a porcine host an immunological response against respiratory disease comprising a plasmid that contains and expresses in vivo in a porcine host cell a nucleic acid molecule having the sequence encoding Aujeszky's disease virus gB protein and/or Aujeszky's disease virus gD protein and a pharmaceutically acceptable carrier.

2. The composition according to claim 1, wherein the plasmid contains and expresses nucleic acid molecules encoding both gB and gD.

3. The composition according to claim 1, wherein the plasmid contains and expresses a nucleic acid molecule encoding gB.

4. The composition according to claim 1, wherein the plasmid contains and expresses a nucleic acid molecule encoding gD.

5. The composition according to claim 1, which comprises a first plasmid that contains and expresses a nucleic acid molecule encoding gB and a second plasmid that contains and expresses a nucleic acid molecule encoding gD.

6. An immunogenic composition for inducing in a porcine host an immunological response against a PRRS virus comprising a plasmid that contains and expresses in vivo in a porcine host cell a nucleic acid molecule encoding at least one of PRRS virus E, ORF3 and M proteins.

7. The composition according to claim 6, wherein the plasmid contains and expresses a nucleic acid molecule encoding the E protein.

8. The composition according to claim 6, wherein the plasmid contains and expresses a nucleic acid molecule encoding the ORF3 protein.

9. The composition according to claim 6, wherein the plasmid contains and expresses a nucleic acid molecule encoding the M protein.

10. The composition according to claim 6, which comprises a first plasmid that contains and expresses a PRRS gene and a second plasmid that contains and expresses a PRRS gene, the PRRS genes being selected from the group consisting of E, ORF3 and M.

11. An immunogenic composition for inducing in a porcine host an immunological response against a conventional hog cholera virus comprising a plasmid that contains and expresses in vivo in a porcine host cell a nucleic acid molecule encoding at least one of E1 and E2 proteins.

12. The composition according to claim 11, wherein the plasmid contains and expresses a nucleic acid molecule encoding E1.

13. The composition according to claim 11, wherein the plasmid contains and expresses a nucleic acid molecule encoding E2.

14. The composition according to claim 11, wherein the plasmid contains and expresses a nucleic acid molecule encoding E1 and contains and expresses a nucleic acid molecule encoding E2.

15. The composition according to composition according to claim 11, wherein a first plasmid contains and expresses a nucleic acid molecule encoding E1 and a second plasmid contains and expresses a nucleic acid molecule encoding E2.

16. A method for inducing an immunological response in a porcine comprising: administering to said porcine a vaccine selected from the group consisting of a live whole vaccine, an inactivated whole vaccine, a subunit vaccine, and a recombinant vaccine; and thereafter, administering to said porcine an immunogenic composition as claimed in any one of claims 1-5, 6-10, and 11-15.

17. A method for inducing an immunological response in a porcine comprising administering to said porcine an immunogenic composition as claimed in any one of claims 1-5, 6-10, and 11-15.

18. A kit comprising (i) an immunogenic composition according to any one of claims 1-5, 6-10, and 11-15, and (ii) a porcine vaccine selected from the group consisting of a live whole vaccine, an inactivated whole vaccine, a subunit vaccine, and recombinant vaccine.