Patent Application
20060148750
Not Applicable
Not Applicable
The present invention relates to HIV Pol polynucleotide pharmaceutical products, as well as the production and use thereof which, when directly introduced into living vertebrate tissue, preferably a mammalian host such as a human or a non-human mammal of commercial or domestic veterinary importance, express the HIV Pol protein or biologically relevant portions thereof within the animal, inducing a cellular immune response which specifically recognizes human immunodeficiency virus-1 (HIV-1). The polynucleotides of the present invention are synthetic DNA molecules encoding codon optimized HIV-1 Pol and derivatives of optimized HIV-1 Pol, including constructs wherein protease, reverse transcriptase, RNAse H and integrase activity of HIV-1 Pol is inactivated. The polynucleotide vaccines of the present invention should offer a prophylactic advantage to previously uninfected individuals and/or provide a therapeutic effect by reducing viral load levels within an infected individual, thus prolonging the asymptomatic phase of HIV-1 infection.
Human Immunodeficiency Virus-1 (HIV-1) is the etiological agent of acquired human immune deficiency syndrome (AIDS) and related disorders. HIV-1 is an RNA virus of the Retroviridae family and exhibits the 5′ LTR-gag-pol-env-LTR 3′organization of all retroviruses. The integrated form of HIV-1, known as the provirus, is approximately 9.8 Kb in length. Each end of the viral genome contains flanking sequences known as long terminal repeats (LTRs). The HIV genes encode at least nine proteins and are divided into three classes; the major structural proteins (Gag, Pol, and Env), the regulatory proteins (Tat and Rev); and the accessory proteins (Vpu, Vpr, Vif and Nef).
The gag gene encodes a 55-kilodalton (kDa) precursor protein (p55) which is expressed from the unspliced viral mRNA and is proteolytically processed by the HIV protease, a product of the pol gene. The mature p55 protein products are p17 (matrix), p24 (capsid), p9 (nucleocapsid) and p6.
The pol gene encodes proteins necessary for virus replication; a reverse transcriptase, a protease, integrase and RNAse H. These viral proteins are expressed as a Gag-Pol fusion protein, a 160 kDa precursor protein which is generated via a ribosomal frame shifting. The viral encoded protease proteolytically cleaves the Pol polypeptide away from the Gag-Pol fusion and further cleaves the Pol polypeptide to the mature proteins which provide protease (Pro, P10), reverse transcriptase (RT, P50), integrase (IN, p31) and RNAse H (RNAse, p15) activities.
The nef gene encodes an early accessory HIV protein (Nef) which has been shown to possess several activities such as down regulating CD4 expression, disturbing T-cell activation and stimulating HIV infectivity.
The env gene encodes the viral envelope glycoprotein that is translated as a 160-kilodalton (kDa) precursor (gp160) and then cleaved by a cellular protease to yield the external 120-kDa envelope glycoprotein (gp120) and the transmembrane 41-kDa envelope glycoprotein (gp41). Gp120 and gp41 remain associated and are displayed on the viral particles and the surface of HIV-infected cells.
The tat gene encodes a long form and a short form of the Tat protein, a RNA binding protein which is a transcriptional transactivator essential for HIV-1 replication.
The rev gene encodes the 13 kDa Rev protein, a RNA binding protein. The Rev protein binds to a region of the viral RNA termed the Rev response element (RRE). The Rev protein is promotes transfer of unspliced viral RNA from the nucleus to the cytoplasm. The Rev protein is required for HW late gene expression and in turn, HIV replication.
Gp120 binds to the CD4/chemokine receptor present on the surface of helper T-lymphocytes, macrophages and other target cells in addition to other co-receptor molecules. X4 (macrophage tropic) virus show tropism for CD4/CXCR4 complexes while a R5 (T-cell line tropic) virus interacts with a CD4/CCR5 receptor complex. After gp120 binds to CD4, gp41 mediates the fusion event responsible for virus entry. The virus fuses with and enters the target cell, followed by reverse transcription of its single stranded RNA genome into the double-stranded DNA via a RNA dependent DNA polymerase. The viral DNA, known as provirus, enters the cell nucleus, where the viral DNA directs the production of new viral RNA within the nucleus, expression of early and late HIV viral proteins, and subsequently the production and cellular release of new virus particles. Recent advances in the ability to detect viral load within the host shows that the primary infection results in an extremely high generation and tissue distribution of the virus, followed by a steady state level of virus (albeit through a continual viral production and turnover during this phase), leading ultimately to another burst of virus load which leads to the onset of clinical AIDS. Productively infected cells have a half life of several days, whereas chronically or latently infected cells have a 3-week half life, followed by non-productively infected cells which have a long half life (over 100 days) but do not significantly contribute to day to day viral loads seen throughout the course of disease.
Destruction of CD4 helper T lymphocytes, which are critical to immune defense, is a major cause of the progressive immune dysfunction that is the hallmark of HIV infection. The loss of CD4 T-cells seriously impairs the body's ability to fight most invaders, but it has a particularly severe impact on the defenses against viruses, fungi, parasites and certain bacteria, including mycobacteria.
Effective treatment regimens for HIV-1 infected individuals have become available recently. However, these drugs will not have a significant impact on the disease in many parts of the world and they will have a minimal impact in halting the spread of infection within the human population. As is true of many other infectious diseases, a significant epidemiologic impact on the spread of HIV-1 infection will only occur subsequent to the development and introduction of an effective vaccine. There are a number of factors that have contributed to the lack of successful vaccine development to date. As noted above, it is now apparent that in a chronically infected person there exists constant virus production in spite of the presence of anti-HIV-1 humoral and cellular immune responses and destruction of virally infected cells. As in the case of other infectious diseases, the outcome of disease is the result of a balance between the kinetics and the magnitude of the immune response and the pathogen replicative rate and accessibility to the immune response. Pre-existing immunity may be more successful with an acute infection than an evolving immune response can be with an established infection. A second factor is the considerable genetic variability of the virus. Although anti-HIV-1 antibodies exist that can neutralize HIV-1 infectivity in cell culture, these antibodies are generally virus isolate-specific in their activity. It has proven impossible to define serological groupings of HIV-1 using traditional methods. Rather, the virus seems to define a serological “continuum” so that individual neutralizing antibody responses, at best, are effective against only a handful of viral variants. Given this latter observation, it would be useful to identify immunogens and related delivery technologies that are likely to elicit anti-HIV-1 cellular immune responses. It is known that in order to generate CTL responses antigen must be synthesized within or introduced into cells, subsequently processed into small peptides by the proteasome complex, and translocated into the endoplasmic reticulum/Golgi complex secretory pathway for eventual association with major histocompatibility complex (MHC) class I proteins. CD8+ T lymphocytes recognize antigen in association with class I MHC via the T cell receptor (TCR) and the CD8 cell surface protein. Activation of naive CD8+ T cells into activated effector or memory cells generally requires both TCR engagement of antigen as described above as well as engagement of costimulatory proteins. Optimal induction of CTL responses usually requires “help” in the form of cytokines from CD4+ T lymphocytes which recognize antigen associated with MHC class II molecules via TCR and CD4 engagement.
Larder, et al., (1987, Nature 327: 716-717) and Larder, et al., (1989, Proc. Natl. Acad. Sci. 86: 4803-4807) disclose site specific mutagenesis of HIV-1 RT and the effect such changes have on in vitro activity and infectivity related to interaction with known inhibitors of RT.
Davies, et al. (1991, Science 252:, 88-95) disclose the crystal structure of the RNase H domain of HIV-1 Pol.
Schatz, et al. (1989, FEBS Lett. 257: 311-314) disclose that mutations Glu478Gln and His539Phe in a complete HIV-1 RT/RNase H DNA fragment results in defective RNase activity without effecting RT activity.
Mizrahi, et al. (1990, Nucl. Acids. Res. 18: pp. 5359-5353) disclose additional mutations Asp443Asn and Asp498Asn in the RNase region of the pol gene which also results in defective RNase activity. The authors note that the Asp498Asn mutant was difficult to characterize due to instability of this mutant protein.
Leavitt, et al. (1993, J. Biol. Chem. 268: 2113-2119) disclose several mutations, including a Asp64Val mutation, which show differing effect on HIV-1 integrase (IN) activity.
Wiskerchen, et al. (1995, J. Virol. 69: 376-386) disclose singe and double mutants, including mutation of aspartic acid residues which effect HIV-1 IN and viral replication functions.
It would be of great import in the battle against AIDS to produce a prophylactic- and/or therapeutic-based HIV vaccine which generates a strong cellular immune response against an HIV infection. The present invention addresses and meets this needs by disclosing a class of DNA vaccines based on host delivery and expression of modified versions of the HIV-1 gene, pol.
The present invention relates to synthetic DNA molecules (also referred to herein as “polynucleotides”) and associated DNA vaccines (also referred to herein as “polynucleotide vaccines”) which elicit cellular immune and humoral responses upon administration to the host, including primates and especially humans, and also including a non-human mammal of commercial or domestic veterinary importance. An effect of the cellular immune-directed vaccines of the present invention should be the lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection. In particular, the present invention relates to DNA vaccines which encode various forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DNA molecules of the present invention encode codon optimized versions of wild type HIV-1 Pol, codon optimized versions of HIV-1 Pol fusion proteins, and codon optimized versions of HIV-1 Pol proteins and fusion protein, including but not limited to pol modifications involving residues within the catalytic regions responsible for RT, RNase and IN activity within the host cell.
A particular embodiment of the present invention relates to codon optimized wt-pol DNA constructs wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized “wild type” sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity. The nucleotide sequence of a DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:1 and the corresponding amino acid sequence of the expressed protein is disclosed herein as SEQ ID NO:2.
The present invention preferably relates to a HIV-1 DNA pol construct which is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity. One type of HIV-1 pol mutant may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. To this end, an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4,
Another aspect of the present invention is to generate HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as the leader peptide from human tPA. To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5′ end of the coding region. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame disclosed herein as SEQ ID NO:6.
The present invention especially relates to a HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide, such as the human tPA leader, at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. Any such HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, including but by no means limited to the human tPA leader sequence. Therefore, any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in
The present invention also relates to a substantially purified protein expressed from the DNA polynucleotide vaccines of the present invention, especially the purified proteins set forth below as SEQ ID NOs: 2, 4, 6, and 8. These purified proteins may be useful as protein-based HIV vaccines.
The present invention also relates to non-codon optimized versions of DNA molecules and associated polynucleotides and associated DNA vaccines which encode the various wild type and modified forms of the HIV Pol protein disclosed herein. Partial or fully codon optimized DNA vaccine expression vector constructs are preferred, but it is within the scope of the present invention to utilize “non-codon optimized” versions of the constructs disclosed herein, especially modified versions of HIV Pol which are shown to promote a substantial cellular immune and humoral immune responses subsequent to host administration.
The DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors. DNA plasmid expression vectors utilized in the present invention include but are not limited to constructs which comprise the cytomegalovirus promoter with the intron A sequence (CMV-intA) and a bovine growth hormone transcription termination sequence. In addition, DNA plasmid vectors of the present invention preferably comprise an antibiotic resistance marker, including but not limited to an ampicillin resistance gene, a neomycin resistance gene or any other pharmaceutically acceptable antibiotic resistance marker. In addition, an appropriate polylinker cloning site and a prokaryotic origin of replication sequence are also preferred. Specific DNA vectors exemplified herein include V1, V1J (SEQ ID NO:13), V1Jneo (SEQ ID NO:14), V1Jns (
The present invention especially relates to a DNA vaccine and a pharmaceutically active vaccine composition which contains this DNA vaccine, and the use as prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HIV condition. These DNA vaccines are represented by codon optimized DNA molecules encoding codon optimized HIV-1 Pol (e.g. SEQ ID NO:2), codon optimized HIV-1 Pol fused to an amino terminal localized leader sequence (e.g. SEQ ID NO:6), and especially preferable, and the essence of the present invention, biologically inactive Pol proteins (IA Pol; e.g., SEQ ID NO:4) devoid of significant PR, RT, RNase or IN activity associated with wild type Pol and a concomitant construct which contains a leader peptide at the amino terminal region of the IA Pol protein. These constructs are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide. Preferred DNA vaccines of the present invention comprise codon optimized DNA molecules encoding codon optimized HIV-1 Pol and inactivated version of Pol, ligated in DNA vectors disclosed herein, or any of the aforementioned vectors wherein a nucleotide sequence encoding a leader peptide, preferably the human tPA leader, is fused directly downstream of the CMV-intA promoter, including but not limited to V1Jns-tpa, as shown in
Therefore, the present invention relates to DNA vaccines which include, but are in no way limited to V1Jns-WTPol (comprising the DNA molecule encoding WT Pol, as set forth in SEQ ID NO:2), V1Jns-tPA-WTPol, (comprising the DNA molecule encoding tPA Pol, as set forth in SEQ ID NO:6), V1Jns-IAPol (comprising the DNA molecule encoding IA Pol, as set forth in SEQ ID NO:4), and V1Jns-tPA-IAPol, (comprising the DNA molecule encoding tPA-IA Pol, as set forth in SEQ ID NO:8). Especially preferred are V1Jns-IAPol and V1Jns-tPA-IAPol, as exemplified in Example Section 2.
The present invention also relates to HIV Pol polynucleotide pharmaceutical products, as well as the production and use thereof, wherein the DNA vaccines are formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention, namely by promoting an enhanced cellular and/or humoral response subsequent to inoculation. A preferred adjuvant is an aluminum phosphate-based adjuvant or a calcium phosphate based adjuvant, with an aluminum phosphate adjuvant being especially preferred. Another preferred adjuvant is a non-ionic block copolymer, preferably comprising the blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer. These adjuvanted forms comprising the DNA vaccines disclosed herein are useful in increasing cellular responses to DNA vaccination.
As used herein, a DNA vaccine or DNA polynucleotide vaccine is a DNA molecule (i.e., “nucleic acid”, “polynucleotide”) which contains essential regulatory elements such that upon introduction into a living, vertebrate cell, it is able to direct the cellular machinery to produce translation products encoded by the respective pol genes of the present invention.
FIGS. 1A-B shows schematic representation of DNA vaccine expression vectors V1Jns (A) and V1Jns-tPA (B) utilized for HIV-1 pol and HIV-1 modified pol constructs.
The present invention relates to synthetic DNA molecules and associated DNA vaccines which elicit CTL and Th cellular immune responses upon administration to the host, including primates and especially humans. An effect of the cellular immune-directed vaccines of the present invention should be a lower transmission rate to previously uninfected individuals and/or reduction in the levels of the viral loads within an infected individual, so as to prolong the asymptomatic phase of HIV-1 infection. In particular, the present invention relates to DNA vaccines which encode various forms of HIV-1 Pol, wherein administration, intracellular delivery and expression of the HIV-1 Pol gene of interest elicits a host CTL and Th response. The preferred synthetic DNA molecules of the present invention encode codon optimized wild type Pol (without Pro activity) and various codon optimized inactivated HIV-1 Pol proteins. The HIV-1 pol constructs disclosed herein are especially preferred for pharmaceutical uses, especially for human administration as a DNA vaccine. The HIV-1 genome employs predominantly uncommon codons compared to highly expressed human genes. Therefore, the pol open reading frame has been synthetically manipulated using optimal codons for human expression. As noted above, a preferred embodiment of the present invention relates to DNA molecules which comprise a HIV-1 pol open reading frame, whether encoding full length pol or a modification or fusion as described herein, wherein the codon usage has been optimized for expression in a mammal, especially a human.
The synthetic pol gene disclosed herein comprises the coding sequences for the reverse transcriptase (or RT which consists of a polymerase and RNase H activity) and integrase (IN). The protein sequence is based on that of Hxb2r, a clonal isolate of IIIB; this sequence has been shown to be closest to the consensus lade B sequence with only 16 nonidentical residues out of 848 (Korber, et al., 1998, Human retroviruses and AIDS, Los Alamos National Laboratory, Los Alamos, N. Mex.). The skilled artisan will understand after review of this specification that any available HIV-1 or HIV-2 strain provides a potential template for the generation of HIV pol DNA vaccine constructs disclosed herein. It is further noted that the protease gene is excluded from the DNA vaccine constructs of the present invention to insure safety from any residual protease activity in spite of mutational inactivation. The design of the gene sequences for both wild-type (wt-pol) and inactivated pol (IA-pol) incorporates the use of human preferred (“humanized”) codons for each amino acid residue in the sequence in order to maximize in vivo mammalian expression (Lathe, 1985, J. Mol. Biol. 183:1-12). As can be discerned by inspecting the codon usage in SEQ ID NOs: 1, 3, 5 and 7, the following codon usage for mammalian optimization is preferred: Met (ATG), Gly (GGC), Lys (AAG), Trp (TGG), Ser (TCC), Arg (AGG), Val (GTG), Pro (CCC), Thr (ACC), Glu (GAG); Leu (CTG), His (CAC), Ile (ATC), Asn (AAC), Cys (TGC), Ala (GCC), Gin (CAG), Phe (TTC) and Tyr (TAC). For an additional discussion relating to mammalian (human) codon optimization, see WO 97/31115 (PCT/US97/02294), which is hereby incorporated by reference. It is intended that the skilled artisan may use alternative versions of codon optimization or may omit this step when generating IRV pol vaccine constructs within the scope of the present invention. Therefore, the present invention also relates to non-codon optimized versions of DNA molecules and associated DNA vaccines which encode the various wild type and modified forms of the H[V Pol protein disclosed herein. However, codon optimization of these constructs is a preferred embodiment of this invention.
A particular embodiment of the present invention relates to codon optimized wt-pol DNA constructs (herein, “wt-pol” or “wt-pol (codon optimized))” wherein DNA sequences encoding the protease (PR) activity are deleted, leaving codon optimized “wild type” sequences which encode RT (reverse transcriptase and RNase H activity) and IN integrase activity. A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:1, the open reading frame being contained from an initiating Met residue at nucleotides 10-12 to a termination codon from nucleotides 2560-2562. SEQ ID NO:1 is as follows:
The open reading frame of the wild type pol construct disclosed as SEQ ID NO:1 contains 850 amino acids, disclosed herein as SEQ ID NO:2, as follows:
The present invention especially relates to a codon optimized HIV-1 DNA pol construct wherein, in addition to deletion of the portion of the wild type sequence encoding the protease activity, a combination of active site residue mutations are introduced which are deleterious to HIV-1 pol (RT-RH-IN) activity of the expressed protein. Therefore, the present invention preferably relates to a HIV-1 DNA pol construct which is devoid of DNA sequences encoding any PR activity, as well as containing a mutation(s) which at least partially, and preferably substantially, abolishes RT, RNase and/or IN activity. One type of HIV-1 pol mutant may include but is not limited to a mutated DNA molecule comprising at least one nucleotide substitution which results in a point mutation which effectively alters an active site within the RT, RNase and/or IN regions of the expressed protein, resulting in at least substantially decreased enzymatic activity for the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct in a DNA molecule which contains at least one point mutation which alters the active site of the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. To this end, an especially preferred HIV-1 DNA pol construct is exemplified herein and contains nine codon substitution mutations which results in an inactivated Pol protein (IA Pol: SEQ ID NO:4,
It is preferred that point mutations be incorporated into the IApol mutant vaccines of the present invention so as to lessen the possibility of altering epitopes in and around the active site(s) of HIV-1 Pol.
To this end, SEQ ID NO:3 discloses the nucleotide sequence which codes for a codon optimized pol in addition to the nine mutations shown in Table 1, disclosed as follows, and referred to herein as “IApol”:
In order to produce the IA-pol DNA vaccine construction, inactivation of the enzymatic functions was achieved by replacing a total of nine active-site residues from the enzyme subunits with alanine side-chains. As shown in Table 1, all residues that comprise the catalytic triad of the polymerase, namely Asp112, Asp187, and Asp188, were substituted with alanine (Ala) residues (Larder, et al., Nature 1987, 327: 716-717; Larder, et al., 1989, Proc. Natl. Acad. Sci. 1989, 86: 4803-4807). Three additional mutations were introduced at Asp445, Glu480 and Asp500 to abolish RNase H activity (Asp551 was left unchanged in this IA Pol construct), with each residue being substituted for an Ala residue, respectively (Davies, et al., 1991, Science 252:, 88-95; Schatz, et al., 1989, FEBS Lett. 257: 311-314; Mizrahi, et al., 1990, Nucl. Acids. Res. 18: pp. 5359-5353). HIV pol integrase function was abolished through three mutations at Asp626, Asp678 and Glu714. Again, each of these residues has been substituted with an Ala residue (Wiskerchen, et al., 1995, J. Virol. 69: 376-386; Leavitt, et al., 1993, J. Biol. Chem. 268: 2113-2119). Amino acid residue Pro3 of SEQ ID NO:4 marks the start of the RT gene. The complete amino acid sequence of IA-Pol is disclosed herein as SEQ ID NO:4, as follows:
As noted above, it will be understood that any combination of the mutations disclosed above may be suitable and therefore be utilized as an IA-pol-based vaccine of the present invention. For example, it may be possible to mutate only 2 of the 3 residues within the respective reverse transcriptase, RNase H, and integrase coding regions while still abolishing these enzymatic activities. However, the IA-pol construct described above and disclosed as SEQ ID NO:3, as well as the expressed protein (SEQ ID NO:4) is preferred. It is also preferred that at least one mutation be present in each of the three catalytic domains.
Another aspect of the present invention is to generate codon optimized HIV-1 Pol-based vaccine constructions which comprise a eukaryotic trafficking signal peptide such as from tPA (tissue-type plasminogen activator) or by a leader peptide such as is found in highly expressed mammalian proteins such as immunoglobulin leader peptides. Any functional leader peptide may be tested for efficacy. However, a preferred embodiment of the present invention is to provide for HIV-1 Pol mutant vaccine constructions as disclosed herein which also comprise a leader peptide, preferably a leader peptide from human tPA. In other words, a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) may also comprise a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. As shown in
To this end, the present invention relates to a DNA molecule which encodes a codon optimized wt-pol DNA construct wherein the protease (PR) activity is deleted and a human tPA leader sequence is fused to the 5′end of the coding region ( herein, “tPA-wt-pol”). A DNA molecule which encodes this protein is disclosed herein as SEQ ID NO:5, the open reading frame being contained from an initiating Met residue at nucleotides 8-10 to a termination codon from nucleotides 2633-2635. SEQ ID NO:5 is as follows:
The open reading frame of the wild type tPA-pol construct disclosed as SEQ ID NO:5 contains 875 amino acids, disclosed herein as SEQ ID NO:6, as follows:
The present invention also relates to a codon optimized HIV-1 Pol mutant such as IA-Pol (SEQ ID NO:4) which comprises a leader peptide at the amino terminal portion of the protein, which may effect cellular trafficking and hence, immunogenicity of the expressed protein within the host cell. Any such HIV-1 DNA pol mutant disclosed in the above paragraphs is suitable for fusion downstream of a leader peptide, such as a leader peptide including but not limited to the human tPA leader sequence. Therefore, any such leader peptide-based HIV-1 pol mutant construct may include but is not limited to a mutated DNA molecule which effectively alters the catalytic activity of the RT, RNase and/or IN region of the expressed protein, resulting in at least substantially decreased enzymatic activity one or more of the RT, RNase H and/or IN functions of HIV-1 Pol. In a preferred embodiment of this portion of the invention, a leader peptide/HIV-1 DNA pol construct contains a mutation or mutations within the Pol coding region which effectively abolishes RT, RNase H and IN activity. An especially preferable HIV-1 DNA pol construct is a DNA molecule which contains at least one point mutation which alters the active site and catalytic activity within the RT, RNase H and IN domains of Pol, such that each activity is at least substantially abolished, and preferably totally abolished. Such a HIV-1 Pol mutant will most likely comprise at least one point mutation in or around each catalytic domain responsible for RT, RNase H and IN activity, respectfully. An especially preferred embodiment of this portion of the invention relates to a human tPA leader fused to the IA-Pol protein comprising the nine mutations shown in Table 1. The DNA molecule is disclosed herein as SEQ ID NO:7 and the expressed tPA-IA Pol protein comprises a fusion junction as shown in
The open reading frame of the tPA-IA-pol construct disclosed as SEQ ID NO:7 contains 875 amino acids, disclosed herein as tPA-IA-Pol and SEQ ID NO:8, as follows:
The present invention also relates to a substantially purified protein expressed from the DNA polynucleotide vaccines of the present invention, especially the purified proteins set forth below as SEQ ID NOs: 2,4, 6, and 8. These purified proteins may be useful as protein-based HIV vaccines.
The DNA backbone of the DNA vaccines of the present invention are preferably DNA plasmid expression vectors. DNA plasmid expression vectors are well known in the art and the present DNA vector vaccines may be comprised of any such expression backbone which contains at least a promoter for RNA polymerase transcription, and a transcriptional terminator 3′to the H[V pol coding sequence. In one preferred embodiment, the promoter is the Rous sarcoma virus (RSV) long terminal repeat (LTR) which is a strong transcriptional promoter. A more preferred promoter is the cytomegalovirus promoter with the intron A sequence (CMV-intA). A preferred transcriptional terminator is the bovine growth hormone terminator. In addition, to assist in large scale preparation of an HIV pol DNA vector vaccine, an antibiotic resistance marker is also preferably included in the expression vector. Ampicillin resistance genes, neomycin resistance genes or any other pharmaceutically acceptable antibiotic resistance marker may be used. In a preferred embodiment of this invention, the antibiotic resistance gene encodes a gene product for neomycin resistance. Further, to aid in the high level production of the pharmaceutical by fermentation in prokaryotic organisms, it is advantageous for the vector to contain an origin of replication and be of high copy number. Any of a number of commercially available prokaryotic cloning vectors provide these benefits. In a preferred embodiment of this invention, these functionalities are provided by the commercially available vectors known as pUC. It is desirable to remove non-essential DNA sequences. Thus, the lacZ and lacI coding sequences of pUC are removed in one embodiment of the invention.
DNA expression vectors which exemplify but in no way limit the present invention are disclosed in PCT International Application No. PCT/US94/02751, International Publication No. WO 94/21797, hereby incorporated by reference. A first DNA expression vector is the expression vector pnRSV, wherein the rous sarcoma virus (RSV) long terminal repeat (LTR) is used as the promoter. A second embodiment relates to plasmid VI, a mutated pBR322 vector into which the CMV promoter and the BGH transcriptional terminator is cloned. Another embodiment regarding DNA vector backbones relates to plasmid V1J. Plasmid V1J is derived from plasmid V1 and removes promoter and transcription termination elements in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields. Therefore, V1J also contains the CMVintA promoter and (BGH) transcription termination elements which control the expression of the HIV pol-based genes disclosed herein. The backbone of V1J is provided by pUC18. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of minimum size. The entire lac operon was removed and the remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase, treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element. In a preferred DNA expression vector, the ampicillin resistance gene is removed from V1J and replaced with a neomycin resistance gene, to generate V1Jneo. An especially preferred DNA expression vector is V1Jns, which is the same as V1J except that a unique Sfi1 restriction site has been engineered into the single Kpn1 site at position 2114 of V1J-neo. The incidence of Sfi1 sites in human genomic DNA is very low (approximately 1 site per 100,000 bases). Thus, this vector allows careful monitoring for expression vector integration into host DNA, simply by Sfi1 digestion of extracted genomic DNA. Yet another preferred DNA expression vector used as the backbone to the HIV-1 pol-based DNA vaccines of the present invention is V1R. In this vector, as much non-essential DNA as possible is “trimmed” from the vector to produce a highly compact vector. This vector is a derivative of V1Jns. This vector allows larger inserts to be used, with less concern that undesirable sequences are encoded and optimizes uptake by cells when the construct encoding specific influenza virus genes is introduced into surrounding tissue. The specific DNA vectors of the present invention include but are not limited to V1, V1J (SEQ ID NO:13), V1Jneo (SEQ ID NO:14), V1Jns (
The present invention especially relates to a DNA vaccine and a pharmaceutically active vaccine composition which contains this DNA vaccine, and the use as prophylactic and/or therapeutic vaccine for host immunization, preferably human host immunization, against an HIV infection or to combat an existing HIV condition. These DNA vaccines are represented by codon optimized DNA molecules encoding HIV-1 Pol or biologically active Pol modifications or Pol-containing fusion proteins which are ligated within an appropriate DNA plasmid vector, with or without a nucleotide sequence encoding a functional leader peptide. DNA vaccines of the present invention may comprise codon optimized DNA molecules encoding HIV-1 Pol or biologically active Pol modifications or Pol-containing fusion proteins ligated in DNA vectors V1, V1J (SEQ ID NO:14), V1Jneo (SEQ ID NO:15), V1Jns (
It will be evident upon review of the teaching within this specification that numerous vector/Pol antigen constructs may be generated. While the exemplified constructs are preferred, any number of vector/Pol antigen combinations are within the scope of the present invention, especially wild type or modified/inactivated Pol proteins which comprise at least one, preferably 5 or more and especially all nine mutations as shown in Table 1, with or without the inclusion of a leader sequence such as human tPA.
The DNA vector vaccines of the present invention may be formulated in any pharmaceutically effective formulation for host administration. Any such formulation may be, for example, a saline solution such as phosphate buffered saline (PBS). It will be useful to utilize pharmaceutically acceptable formulations which also provide long-term stability of the DNA vector vaccines of the present invention. During storage as a pharmaceutical entity, DNA plasmid vaccines undergo a physiochemical change in which the supercoiled plasmid converts to the open circular and linear form. A variety of storage conditions (low pH, high temperature, low ionic strength) can accelerate this process. Therefore, the removal and/or chelation of trace metal ions (with succinic or malic acid, or with chelators containing multiple phosphate ligands) from the DNA plasmid solution, from the formulation buffers or from the vials and closures, stabilizes the DNA plasmid from this degradation pathway during storage. In addition, inclusion of non-reducing free radical scavengers, such as ethanol or glycerol, are useful to prevent damage of the DNA plasmid from free radical production that may still occur, even in apparently demetalated solutions. Furthermore, the buffer type, pH, salt concentration, light exposure, as well as the type of sterilization process used to prepare the vials, may be controlled in the formulation to optimize the stability of the DNA vaccine. Therefore, formulations that will provide the highest stability of the DNA vaccine will be one that includes a demetalated solution containing a buffer (phosphate or bicarbonate) with a pH in the range of 7-8, a salt (NaCl, KCl or LiCl) in the range of 100-200 mM, a metal ion chelator (e.g., EDTA, diethylenetriaminepenta-acetic acid (DTPA), malate, inositol hexaphosphate, tripolyphosphate or polyphosphoric acid), a non-reducing free radical scavenger (e.g. ethanol, glycerol, methionine or dimethyl sulfoxide) and the highest appropriate DNA concentration in a sterile glass vial, packaged to protect the highly purified, nuclease free DNA from light. A particularly preferred formulation which will enhance long term stability of the DNA vector vaccines of the present invention would comprise a Tris-HCl buffer at a pH from about 8.0 to about 9.0; ethanol or glycerol at about 3% w/v; EDTA or DTPA in a concentration range up to about 5 mM; and NaCl at a concentration from about 50 mM to about 500 mM. The use of such stabilized DNA vector vaccines and various alternatives to this preferred formulation range is described in detail in PCT International Application No. PCT/US97/06655 and PCT International Publication No. WO 97/40839, both of which are hereby incorporated by reference.
The DNA vector vaccines of the present invention may also be formulated with an adjuvant or adjuvants which may increase immunogenicity of the DNA polynucleotide vaccines of the present invention. A number of these adjuvants are known in the art and are available for use in a DNA vaccine, including but not limited to particle bombardment using DNA-coated gold beads, co-administration of DNA vaccines with plasmid DNA expressing cytokines, chemokines, or costimulatory molecules, formulation of DNA with cationic lipids or with experimental adjuvants such as saponin, monophosphoryl lipid A or other compounds which increase immunogenicity of the DNA vaccine. Another adjuvant for use in the DNA vector vaccines of the present invention are one or more forms of an aluminum phosphate-based adjuvant wherein the aluminum phosphate-based adjuvant possesses a molar PO4 /Al ratio of approximately 0.9. An additional mineral-based adjuvant may be generated from one or more forms of a calcium phosphate. These mineral-based adjuvants are useful in increasing cellular and humoral responses to DNA vaccination. These mineral-based compounds for use as DNA vaccines adjuvants are disclosed in PCT International Application No. PCT/US98/02414, PCT International Publication No. WO 98/35562, which is hereby incorporated by reference. Another preferred adjuvant is a non-ionic block copolymer which shows adjuvant activity with DNA vaccines. The basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer. Newman et al. (1998, Critical Reviews in Therapeutic Drug Carrier Systems 15(2): 89-142) review a class of non-ionic block copolymers which show adjuvant activity. The basic structure comprises blocks of polyoxyethylene (POE) and polyoxypropylene (POP) such as a POE-POP-POE block copolymer. Newman et al. id., disclose that certain POE-POP-POE block copolymers may be useful as adjuvants to an influenza protein-based vaccine, namely higher molecular weight POE-POP-POE block copolymers containing a central POP block having a molecular weight of over about 9000 daltons to about 20,000 daltons and flanking POE blocks which comprise up to about 20% of the total molecular weight of the copolymer (see also U.S. Reissue Pat. No. 36,665, U.S. Pat. Nos. 5,567,859, 5,691,387, 5,696,298 and 5,990,241, all issued to Emanuele, et al., regarding these POE-POP-POE block copolymers). WO 96/04932 further discloses higher molecular weight POE/POP block copolymers which have surfactant characteristics and show biological efficacy as vaccine adjuvants. The above cited references within this paragraph are hereby incorporated by reference in their entirety. It is therefore within the purview of the skilled artisan to utilize available adjuvants which may increase the immune response of the polynucleotide vaccines of the present invention in comparison to administration of a non-adjuvanted polynucleotide vaccine.
The DNA vector vaccines of the present invention are administered to the host by any means known in the art, such as enteral and parenteral routes. These routes of delivery include but are not limited to intramusclar injection, intraperitoneal injection, intravenous injection, inhalation or intranasal delivery, oral delivery, sublingual administration, subcutaneous administration, transdermal administration, transcutaneous administration, percutaneous administration or any form of particle bombardment, such as a biolostic device such as a “gene gun” or by any available needle-free injection device. The preferred methods of delivery of the HIV-1 Pol-based DNA vaccines disclosed herein are intramuscular injection, subcutaneous administration and needle-free injection. An especially preferred method is intramuscular delivery.
The amount of expressible DNA to be introduced to a vaccine recipient will depend on the strength of the transcriptional and translational promoters used in the DNA construct, and on the immunogenicity of the expressed gene product. In general, an immunologically or prophylactically effective dose of about 1 μg to greater than about 20 mg, and preferably in doses from about 1 mg to about 5 mg is administered directly into muscle tissue. As noted above, subcutaneous injection, intradermal introduction, impression through the skin, and other modes of administration such as intraperitoneal, intravenous, inhalation and oral delivery are also contemplated. It is also contemplated that booster vaccinations are to be provided in a fashion which optimizes the overall immune response to the Pol-based DNA vector vaccines of the present invention.
The aforementioned polynucleotides, when directly introduced into a vertebrate in vivo, express the respective HIV-1 Pol protein within the animal and in turn induce a cellular immune response within the host to the expressed Pol antigen. To this end, the present invention also relates to methods of using the HIV-1 Pol-based polynucleotide vaccines of the present invention to provide effective immunoprophylaxis, to prevent establishment of an HIV-1 infection following exposure to this virus, or as a post-HIV infection therapeutic vaccine to mitigate the acute HIV-1 infection so as to result in the establishment of a lower virus load with beneficial long term consequences. As noted above, the present invention contemplates a method of administration or use of the DNA pol-based vaccines of the present invention using an any of the known routes of introducing polynucleotides into living tissue to induce expression of proteins.
Therefore, the present invention provides for methods of using a DNA pol-based vaccine utilizing the various parameters disclosed herein as well as any additional parameters known in the art, which, upon introduction into mammalian tissue induces intracellular expression of these DNA pol-based vaccines. This intracellular expression of the Pol-based immunogen induces a cellular immune response which provides a substantial level of protection against an existing HIV-1 infection or provides a substantial level of protection against a future infection in a presently uninfected host.
The following examples are provided to illustrate the present invention without, however, limiting the same hereto.
V1—Vaccine vector V1 was constructed from pCMVIE-AKI-DHFR (Whang et al., 1987, J. Virol. 61: 1796). The AKI and DHFR genes were removed by cutting the vector with EcoRI and self-ligating. This vector does not contain intron A in the CMV promoter, so it was added as a PCR fragment that had a deleted internal SacI site [at 1855 as numbered in Chapman, et al., 1991, Nuc. Acids Res. 19: 3979). The template used for the PCR reactions was pCMVintA-Lux, made by ligating the HindIlI and NheI fragment from pCMV6a120 (see Chapman et al., ibid.), which includes hCMV-IE1 enhancer/promoter and intron A, into the HindIII and XbaI sites of pBL3 to generate pCMVIntBL. The 1881 base pair luciferase gene fragment (HindIII-SmaI Klenow filled-in) from RSV-Lux (de Wet et al., 1987, Mol. Cell Biol. 7: 725) was ligated into the SalI site of pCMVIntBL, which was Klenow filled-in and phosphatase treated. The primers that spanned intron A are: 5′ primer: 5′-CTATAT AAGCAGAGCTCGTTTAG-3′ (SEQ ID NO: 10); 3′ primer: 5′-GTAGCAAA GATCTAAGGACGGTGACTGCAG-3′ (SEQ ID NO:I 1). The primers used to remove the SacI site are: sense primer, 5′-GTATGTGTCTGAAAATGAGCGTGGAGATTGGGCTCGCAC-3′ (SEQ ID NO:12) and the antisense primer, 5′-GTGCGAGCCCAATCTCCACGCTCATTTTCAGAC ACATAC-3′ (SEQ ID NO:13). The PCR fragment was cut with Sac I and Bgl II and inserted into the vector which had been cut with the same enzymes.
V1J—Vaccine vector V1J was generated to remove the promoter and transcription termination elements from vector V1 in order to place them within a more defined context, create a more compact vector, and to improve plasmid purification yields. V1J is derived from vectors V1 and pUC18, a commercially available plasmid. V1 was digested with SspI and EcoRI restriction enzymes producing two fragments of DNA. The smaller of these fragments, containing the CMVintA promoter and Bovine Growth Hormone (BGH) transcription termination elements which control the expression of heterologous genes, was purified from an agarose electrophoresis gel. The ends of this DNA fragment were then “blunted” using the T4 DNA polymerase enzyme in order to facilitate its ligation to another “blunt-ended” DNA fragment. pUC18 was chosen to provide the “backbone” of the expression vector. It is known to produce high yields of plasmid, is well-characterized by sequence and function, and is of small size. The entire lac operon was removed from this vector by partial digestion with the HaeII restriction enzyme. The remaining plasmid was purified from an agarose electrophoresis gel, blunt-ended with the T4 DNA polymerase treated with calf intestinal alkaline phosphatase, and ligated to the CMVintA/BGH element described above. Plasmids exhibiting either of two possible orientations of the promoter elements within the pUC backbone were obtained. One of these plasmids gave much higher yields of DNA in E. coli and was designated V1J. This vector's structure was verified by sequence analysis of the junction regions and was subsequently demonstrated to give comparable or higher expression of heterologous genes compared with V1. The nucleotide sequence of V1J is as follows:
V1Jneo—Construction of vaccine vector V1Jneo expression vector involved removal of the ampr gene and insertion of the kanr gene (neomycin phosphotransferase). The ampr gene from the pUC backbone of V1J was removed by digestion with SspI and Eam11051 restriction enzymes. The remaining plasmid was purified by agarose gel electrophoresis, blunt-ended with T4 DNA polymerase, and then treated with calf intestinal alkaline phosphatase. The commercially available kanr gene, derived from transposon 903 and contained within the pUC4K plasmid, was excised using the PstI restriction enzyme, purified by agarose gel electrophoresis, and blunt-ended with T4 DNA polymerase. This fragment was ligated with the V1J backbone and plasmids with the kanr gene in either orientation were derived which were designated as V1Jneo #'s 1 and 3. Each of these plasmids was confirmed by restriction enzyme digestion analysis, DNA sequencing of the junction regions, and was shown to produce similar quantities of plasmid as V1J. Expression of heterologous gene products was also comparable to V1J for these V1Jneo vectors. V1Jneo#3, referred to as V1Jneo hereafter, was selected which contains the kanr gene in the same orientation as the ampr gene in V1J as the expression construct and provides resistance to neomycin, kanamycin and G418. The nucleotide sequence of V1Jneo is as follows:
V1Jns—The expression vector VIJns was generated by adding an SfiI site to V1Jneo to facilitate integration studies. A commercially available 13 base pair SfiI linker (New England BioLabs) was added at the KpnI site within the BGH sequence of the vector. V1Jneo was linearized with KpnI, gel purified, blunted by T4 DNA polymerase, and ligated to the blunt SfiI linker. Clonal isolates were chosen by restriction mapping and verified by sequencing through the linker. The new vector was designated V1Jns. Expression of heterologous genes in V1Jns (with SfiI) was comparable to expression of the same genes in V1Jneo (with KpnI).
The nucleotide sequence of V1Jns is as follows:
The underlined nucleotides of SEQ ID NO:16 represent the Sfi1 site introduced into the Kpn 1 site of V1Jneo.
V1Jns-tPA—The vaccine vector V1Jns-tPA was constructed in order to fuse an heterologous leader peptide sequence to the pol DNA constructs of the present invention. More specifically, the vaccine vector V1Jns was modified to include the human tissue-specific plasminogen activator (tPA) leader. As an exemplification, but by no means a limitation of generating a pol DNA construct comprising an amino-terminal leader sequence, plasmid V1Jneo was modified to include the human tissue-specific plasminogen activator (tPA) leader. Two synthetic complementary oligomers were annealed and then ligated into V1Jneo which had been BglII digested. The sense and antisense oligomers were 5′-GATCACCATGGATGCAATGAAGAG AGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCAG CGA-3′ (SEQ ID NO: 17); and, 5′-GATCTCGCTGGGCGAAACGAAGACTGCTCC ACACAGCAGCAGCACACAGCAGAGCCCTCTCTTCATTGCATCCATGGT-3′ (SEQ ID NO:18). The Kozak sequence is underlined in the sense oligomer. These oligomers have overhanging bases compatible for ligation to BglII-cleaved sequences. After ligation the upstream BglII site is destroyed while the downstream BglII is retained for subsequent ligations. Both the junction sites as well as the entire tPA leader sequence were verified by DNA sequencing. Additionally, in order to conform with V1Jns (=V1Jneo with an SfiI site), an SfiI restriction site was placed at the KpnI site within the BGH terminator region of V1Jneo-tPA by blunting the KpnI site with T4 DNA polymerase followed by ligation with an SfiI linker (catalogue #1138, New England Biolabs), resulting in V1Jns-tPA. This modification was verified by restriction digestion and agarose gel electrophoresis.
The V1Jns-tpa vector nucleotide sequence is as follows:
V1R—Vaccine vector V1R was constructed to obtain a minimum-sized vaccine vector without unneeded DNA sequences, which still retained the overall optimized heterologous gene expression characteristics and high plasmid yields that V1J and V1Jns afford. It was determined that (1) regions within the pUC backbone comprising the E. coli origin of replication could be removed without affecting plasmid yield from bacteria; (2) the 3′-region of the kanr gene following the kanamycin open reading frame could be removed if a bacterial terminator was inserted in its place; and, (3) ˜300 bp from the 3′- half of the BGH terminator could be removed without affecting its regulatory function (following the original KpnI restriction enzyme site within the BGH element). V1R was constructed by using PCR to synthesize three segments of DNA from V1Jns representing the CMVintA promoter/BGH terminator, origin of replication, and kanamycin resistance elements, respectively. Restriction enzymes unique for each segment were added to each segment end using the PCR oligomers: SspI and XhoI for CMVintAIBGH; EcoRV and BamHI for the kanr gene; and, BclI and SalI for the orir. These enzyme sites were chosen because they allow directional ligation of each of the PCR-derived DNA segments with subsequent loss of each site: EcoRV and SspI leave blunt-ended DNAs which are compatible for ligation while BamHI-and BclI leave complementary overhangs as do SalI and XhoI. After obtaining these segments by PCR each segment was digested with the appropriate restriction enzymes indicated above and then ligated together in a single reaction mixture containing all three DNA segments. The 5′-end of the orir was designed to include the T2 rho independent terminator sequence that is normally found in this region so that it could provide termination information for the kanamycin resistance gene. The ligated product was confirmed by restriction enzyme digestion (>8 enzymes) as well as by DNA sequencing of the ligation junctions. DNA plasmid yields and heterologous expression using viral genes within V1R appear similar to V1Jns. The net reduction in vector size achieved was 1346 bp (V1Jns=4.86 kb; V1R=3.52 kb). PCR oligomer sequences used to synthesize V1R (restriction enzyme sites are underlined and identified in brackets following sequence) are as follows: (1) 5′-GGTACAAATATTGGCTATTGG CCATTGCATACG-3′ (SEQ ID NO:19) [SspI]; (2) 5′-CCACATCTCGAGGAAC CGGGTCAATTCTTCAGCACC-3′ (SEQ ID NO:20) [XhoI] (for CMVintA/BGH segment); (3) 5′-GGTACAGATATCGGAAAGCCACGTTGTGTCTCAAAATC-3′ (SEQ ID NO:21) [EcoRV]; (4) 5′-CACATGGATCCGTAAT GCTCTGCCAGTGTT ACAACC-3′ (SEQ ID NO:2) [BamHI], (for kanamycin resistance gene segment) (5) 5′-GGTACATG ATCACGTAGAAAAGATCA AAGGATCTTCTTG-3′ (SEQ ID NO:23) [BclI]; (6) 5′-CCACATGTCGACCCGTAAA AAGGCCGCGTTGCTGG-3′ (SEQ ID NO:24): [SalI], (for E. coli origin of replication).
The nucleotide sequence of vector V1R is as follows:
Codon Optimized HIV-1 Pol and HIV-1 IA Pol Derivatives as DNA Vector Vaccines Synthesis of WT-optpol and IA-opt-pol Gene—Construction of both genes were conducted by Midland Certified Reagent Company (Midland, Tex.) following established strategies. Ten double stranded oligonucleotides, ranging from 159 to 340 bases long and encompassing the entire pol gene, were synthesized by solid state methods and cloned separately into pUC18. For the wt-pol gene, the fragments are as follows:
The next stage of the synthesis was to consolidate these cassettes into three roughly equal fragments (alpha, beta, gamma) and was performed as follows:
Alpha: The SspI-HindIII small fragment of pJS6C1-4 was transferred into the Ecl136II-HindIII sites of pJS6B2-5 to give pJS6BC1-1. Into the EcoRI-PmlI sites of this plasmid was inserted the EcoRI-Ecl136II small fragment of pJS6A1-7 to give pJS6α1-8.
Beta: The EcoRI-ApaI small fragment of pJS6D1-4 was inserted into the corresponding sites of pJS6E1-2 to give pJS6DE1-2. Also, the EcoRI-XcmI small fragment of pJS6F1-5 was inserted into the corresponding sites of pJS6G1-2 to give pJS6FG1-1. Then the EcoRI-KpnI small fragment of pJS6DE1-2 was inserted into the corresponding sites of pJS6FG1-1 to give pJS601-1.
Gamma: The SacI-HindIII small fragment of pJS6J1-1 was inserted into the corresponding sites of pJS6I1-2 to give pJS6IJ1-1. This plasmid was propagated through E. coli SCS110 (dam−/dcm−) to permit subsequent cleavage at the BclI site. The BclI-HindIII small fragment of the unmethylated pJS6IJ1-1 was inserted into the BglII-HindIII sites of pJS6H1-14 to give pJS6χ1-1.
The wt-pol alpha, beta, gamma were ligated into the entire sequence as follows:
To construct the entire IA-pol gene, only 3 new small fragments were synthesized:
Expression Vector Construction—pUC18-wt-pol and pUC18-IA-pol were digested with BglII in order to isolate fragments containing the entire pol genes. V1R, V1Jns, V1Jns-tpa (Shiver, et al., 1995, Immune responses to HIV gp120 elicited by DNA vaccination. In Vaccines 95 (eds. Chanock, R. M., Brown, F., Ginsberg, H. S., & Norrby, E.) @ pp. 95-98; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; see also Example Section 1) were digested with BglII. The cut vectors were then treated with calf intestinal alkaline phosphatase. Both wt-pol and IA-pol genes were ligated into cut V1R using T4 DNA ligase (16° C., overnight). Competent DH5α cells were transformed with aliquots of the ligation mixtures. Colonies were screened by restriction digestion of amplified plasmid isolates. Following a similar strategy, the BglII fragment containing the IA-pol was subcloned into the BglII site of V1Jns. To ligate the IA-pol gene into V1Jns-tpa, the IA-pol gene was PCR-amplified from V1R-IA-pol using pfu polymerase and the following pair of primers: 5′-GGTACAAGATCTCCGCCCCCATCTCCCCCATTGAGA-3′ (SEQ ID NO:26), and 5′-CCACATAGATCTGCCCGGGCTTTAGTCCTCATC-3′ (SEQ ID NO:27). The upstream primer was designed to remove the initiation met codon and place the pol gene in frame with the tpa leader coding sequence from V1Jns-tpa. The PCR product was purified from the agarose gel slab using Sigma DNA Purification spin columns. The purified products were digested with BglII and subcloned into the BglII site of V1Jns-tpa.
Results—The codon humanized wt- and IA-pol genes were constructed via stepwise ligation of 10 synthetic dsDNA fragments (Ferretti, et al., 1986, Proc. Natl. Acad. Sci. USA 83: 599-603). For expression in mammalian systems, the IA-pol gene was subcloned into V1R, V1Jns, and V1Jns-tpa. All these vectors place the gene under the control of the human cytomegalovirus/intron A hybrid promoter (hCMVIA). The DNA sequence of the IA-pol gene and the expressed protein product are shown in
Materials—E. coli DH5α strain, penicillin, streptomycin, ACK lysis buffer, hepes, L-glutamine, RPMI1640, and ultrapure CsCl were obtained from Gibco/BRL (Grand Island, N.Y.). Fetal bovine serum (FBS) was purchased from Hyclone. Kanamycin, Tween 20, bovine serum albumin, hydrogen peroxide (30%), concentrated sulfuric acid, β-mercaptoethanol (β-ME), and concanavalin A were obtained from Sigma (St. Louis, Mo.). Female balb/c mice at 4-6 wks of age were obtained from Taconic Farms (Germantown, N.Y.). 0.3-mL insulin syringes were purchased from Myoderm. 96-well flat bottomed Maxisorp plates were obtained form NUNC (Rochester, N.Y.). HIV-1IIIB RT p66 recombinant protein was obtained from Advanced Biotechnologies, Inc. (Columbia, Md.). 20-mer peptides were synthesized by Research Genetics (Huntsville, Ala.). Horseradish peroxidase (HRP)-conjugated rabbit anti-mouse IgG1 was obtained from ZYMED (San Francisco, Calif.). 1,2-phenylenediamine dihydrochloride (OPD) tablets was obtained from DAKO (Norway). Purified rat anti-mouse IFN-gamma (IgG1, clone R4-6A2), biotin-conjugated rat anti-mouse IFN-gamma (IgG1, clone XMG 1.2), and strepavidin-alkaline phosphatase conjugate were purchased from PharMingen (San Diego, Calif.). 1-STEP NBT/BCIP dye was obtained from Pierce Chemicals (Rockford, Ill.). 96-well Multiscreen membrane plate was purchased from Millipore (France). Cell strainer was obtained from Becton-Dickinson (Franklin Lakes, N.J.).
Plasmid Preparation—E. coli DH5α cells expressing the pol plasmids were grown to saturation in LB broth supplemented with 100 ug/mL kanamycin. Plasmid were purified by standard CsCl method and solubilized in saline at concentrations greater than 5 mg/mL until further use.
Vaccination—The plasmids were prepared in phosphate-buffered saline and administered into balb/c by needle injection (28-½G insulin syringe) of 50 uL aliquot into each quad muscle. V1Jns-IApol was administered at 0.3, 3, 30 ug dose and for comparison, V1Jns-tpa-LApol was given at 30 ug dose. Immunizations were conducted at T=0 and T=8 wks (for select animals from the 30-ug dose cohorts).
ELISA Assay—At T=12 wks, blood samples were collected by making an incision of a tail vein and the serum separated. Anti-RT titers were obtained following standard secondary antibody-based ELISA. Briefly, Maxisorp plates were coated by overnight incubation with 100 uL of 1 ug/mL HIV-1 RT protein (in PBS). The plates were washed with PBS/0.05% Tween 20 and incubated for approx. 2h with 200 uL/well of blocking solution (PBS/0.05% tween/1% BSA). The blocking solution was decanted; 100 uL aliquot of serially diluted serum samples were added per well and incubated for 2 h at room temperature. The plates were washed and 100 uL of 1/1000-diluted HRP-rabbit anti-mouse IgG were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 uL OPD/H2O2 solution for 15 min. The reaction was quenched by adding 100 uL of 0.5M H2SO4 per well. OD492 readings were recorded.
ELIspot—Spleens were collected from 5 mice/cohort at T=13-14 wks and pooled into a tube of 8-mL RIO medium (RPMI1640, 10% FBS, 2 mM L-glutamine, 100U/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM β-ME). Multiscreen opaque plates were coated with 100 μl/well of capture mAb (purified R4-6A2 diluted in PBS to 5 μg/ml) at 4° C. overnight. The plates were washed with PBS/Pen/Strep in hood and blocked with 200 μl/well of complete R10 medium for 37° C. for at least 2 hrs. The mouse spleens were ground on steel mesh, collected into 15 ml tubes and centrifuged at 1200 rpm for 10 min. The pellet was treated in ACK buffer (4 ml of lysis buffer per spleen) for 5 min at room temperature to lyse red blood cells. The cell pellet was centrifuged as before, resuspended in K-medium (5 ml per mouse spleen), filtered through a cell strainer and counted using a hemacytometer. Block medium was decanted from the plates and 100 μl/well of cell samples (5.0×10e5 cells per well) plus antigens were added. Pol-specific CD4+ cells were stimulated using a mixture of previously identified two epitope-containing peptides (aa641-660, aa731-750). Antigen-specific CD8+ cells were stimulated using a pool of four peptide epitope-containing peptides (aa201-220, aa311-330, aa571-590, aa781-800) or with individual peptides. A final concentration of 4 ug/mL per peptide was used. Each splenocyte sample is tested for IFN-gamma secretion by adding the mitogen, concanavalin A. Plates were incubated at 37° C., 5% CO2 for 20-24 h. The plates were washed with PBS/0.05% Tween 20 and soaked with 100 uL/well of 5 ug/mL biotin-conjugated rat anti-mouse IFN-mAb (clone XMG1.2) at 4° C. overnight. The plates were washed and soaked with 100 uL/well 1/2500 dilution of strepavidin-AP (in PBS/0.005% Tween/5% FCS) for 30 min at 37° C. Following a wash, spots were developed by incubating with 100 μl/well 1-step NBT/BCIP for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each wells were determined using a dissecting microscope and normalized to 10e6 cells.
Results—Single vaccination of balb/c mice with V1Jns-IApol is able to induce antigen-specific antibody (
Materials—E. coli DH5α strain, penicillin, streptomycin, and ultrapure CsCl were obtained from Gibco/BRL (Grand Island, N.Y.). Kanamycin and phytohemagluttinin (PHA-M) were obtained from Sigma (St. Louis, Mo.). 20-mer peptides were synthesized by SynPep (Dublin, Calif.) and Research Genetics (Huntsville, Ala.). 96-well Multiscreen Immobilon-P membrane plates were obtained from Millipore (France). Strepavidin-alkaline phosphatase conjugate were purchased form Pharmingen (San Diego, Calif.). 1-Step NBT/BCIP dye was obtained form Pierce Chemicals (Rockford, Ill.). Rat anti-human IFN-gamma mAb and biotin-conjugated anti-human IFN-gamma reagent were obtained from R&D Systems (Minneapolis, Minn.). Dynabeads M-450 anti-human CD4 were obtained from Dynal (Norway). HIVp24 antigen assay was purchased from Coulter Corporation (Miami, Fla.). HIV-1IIIB RT p66 recombinant protein was obtained from Advanced Biotechnologies, Inc. (Columbia, Md.). Plastic 8 well strips/plates, flat bottom, Maxisorp, are obtained from NUNC (Rochester, N.Y.). HIV+ human serum 9711234 was obtained from Biological Specialty Corp.
Plasmid Preparation—E. coli DH5α cells expressing the pol plasmids were grown to saturation in LB supplemented with 100 ug/mL kanamycin. Plasmid were purified by standard CsCl method and solubilized in saline at concentrations greater than 5 mg/mL until further use.
Vaccination—Cohorts of 3 rhesus macaques (approx. 5-10 kg) were vaccinated with 5 mg dose of either V1Jns-IApol or V1Jns-tpa-LApol. The vaccine was administered by needle injection of two 0.5 mL aliquots of 5 mg/mL plasmid solution (in phosphate-buffered saline, pH 7.2) into both deltoid muscles. Prior to vaccination, the monkeys were chemically restraint with i.m. injection of 10 mg/kg ketamine. The animals were immunized 3× at 4 week intervals (T=0, 4, 8 wks).
Sample Collection—Blood samples were collected at T=0, 4, 8, 12, 16, 18 wks; sera and PBMCs were isolated using established protocols.
ELIspot Assay—Immobilon-IP plates were coated with 100 ul/well of rat anti-human IFN-gamma mAb at 15 ug/mL at 4° C. overnight. The plates are then washed with PBS and block by adding 200 uL/well of R10 medium. 4×10e5 peripheral blood cells were plated per well and to each well, either media or one of the pol peptide pools (final concentration of 4 ug/mL per peptide) or PHA, a known mitogen, is added to a final volume of 100 uL. Duplicate wells were set up per sample per antigen and stimulation was performed for 20-24 h at 37° C. The plates are then washed; biotinylated anti-human IFN-gamma reagent is added (0.1 ug/mL, 100 uL per well) and allowed to incubate for overnight at 4° C. The plates are again washed and 100 uL of 1:2500 dilution of the strepavidin-alkaline phosphatase reagent (in PBS/0.005% Tween/5% FCS) is added and allowed to incubate for 2 h at ambient room temperature. After another wash, spots are developed by incubating with 100 uL/well of 1-step NBT/BCIP for 6-10 min. CD4− T cell depletion was performed by adding 1 bead particle/10 cell of Dynabeads M450 anti-human CD4, prewashed with PBS, and incubating on the shaker at 4° C. for 30 min. The beads are fractionated magnetically and the unbound cells collected and quantified before plating onto the ELISpot assay plates ( at 4×10e5 cells per well).
CTL Assay—Procedures for establishing bulk CTL culture with fresh or cryopreserved peripheral blood mononuclear cells (PBMC) are as follows. Twenty percent total PBMC were infected in 0.5 ml volume with recombinant vaccinia virus, Vac-tpaPol, respectively, at multiplicity of infection (moi) of 5 for 1 hr at 37° C., and then combined with the remaining PBMC sample. The cells were washed once in 10 ml R-10 medium, and plated in a 12 well plate at approximately 5 to 10×106 cells/well in 4 ml R-10 medium. Recombinant human IL-7 was added to the culture at the concentration of 330 U/ml. Two or three days later, one milliliter of R-10 containing recombinant human IL-2 (100 U/ml) was added to each well. And twice weekly thereafter, two milliliters of cultured media were replaced with 2 ml fresh R-10 medium with rhIL-2 (100 U/ml). The lymphocytes were cultured at 37° C. in the presence of 5% CO2 for approximately 2 weeks, and used in cytotoxicity assay as described below. The effector cells harvested from bulk CTL cultures were tested against autologous B lymphoid cell lines (BLCL) sensitized with peptide pools. To prepare for the peptide-sensitized targets, the BLCL cells were washed once with R-10 medium, enumerated, and pulsed with peptide pool (about 4 to 8 μg/ml concentration for each individual peptide) in 1 ml volume overnight. A mock target was prepared by pulsing cells with peptide-free DMSO diluent to match the DMSO concentration in the peptide-pulsed targets. The cells were enumerated the next morning, and 1×106 cells were resuspended in 0.5 ml R-10 medium. Five to ten microliters of Na51CrO4 were added to the tubes at the same time, and the cells were incubated for 1 to 2 hr 37° C. The cells were then washed 3 times and resuspended at 5×104 cells/ml in R-10 medium to be used as target cells. The cultured lymphocytes were plated with target cells at designated effector to target (E:T) ratios in triplicates in 96-well plates, and incubated at 37° C. for 4 hours in the presence of 5% CO2. A sample of 30 μl supernatant from each well of cell mixture was harvested onto a well of a Lumaplate-96 (Packard Instrument, Meriden, Conn.), and the plate was allowed to air dry overnight. The amount of 51Cr in the well was determined through beta-particle emission, using a plate counter from Packard Instrument. The percentage of specific lysis was calculated using the formula as: % specific lysis=(E-S)/(M-S). The symbol E represents the average cpm released from target cells in the presence of effector cells, S is the spontaneous cpm released in the presence of medium only, and M is the maximum cpm released in the presence of 2% Triton X-100.
ELISA Assay—The pol-specific antibodies in the monkeys were measured in a competitive RT EIA assay, wherein sample activity is determined by the ability to block RT antigen from binding to coating antibody on the plate well. Briefly, Maxisorp plates were coated with saturating amounts of pol positive human serum (97111234). 250 uL of each sample is incubated with 15 uL of 266 ng/mL RT recombinant protein (in RCM 563, 1% BSA, 0.1% tween, 0.1% NaN3) and 20 uL of lysis buffer (Coulter p24 antigen assay kit) for 15 min at room temperature. Similar mixtures are prepared using serially diluted samples of a standard and a negative control which defines maximum RT binding. 200 uL/well of each sample and standard were added to the washed plate and the plate incubated 16-24 h at room temperature. Bound RT is quantified following the procedures described in Coulter p24 assay kit and reported in milliMerck units per mL arbitrarily defined by the chosen standard.
Results—Repeated vaccinations with V1Jns-IApol induced in 1 of 3 monkeys (94R033) significant levels of antigen-specific T cell activation (
Immunization with V1Jns-tpa-IApol produced T cell responses from all 3 vaccinees (FIGS. 6A-C,
For the Elispot assay, antigen specific stimulation were performed by using pools of 20-mer peptide pools based on the vaccine sequence. The vaccine pol sequence differs from the wild-type HIV-1 sequence by 9 point mutations, thereby affecting 16 of the 20-mer peptides in the pool. Comparable responses were observed in the vaccinees when these peptides are replaced with those using the wild-type sequences.
Four of the vaccinees gave anti-RT titers above background after 3 dosages of the plasmids (Table 2).
Materials and Methods—Extraction of virus-derived pol gene—The gene for RT-IN (wt-pol; a non-codon optimized wild type pol gene derived directly from the HIV IIIB genome) was extracted and amplified from the HIV IIIB genome using two primers, 5′-CAG GCG AGA TCT ACC ATG GCC CCC ATT AGC CCT ATT GAG ACT GTA-3′ (SEQ ID NO:29) and 5′-CAG GCG AGA TCT GCC CGG GCT TTA ATC CTC ATC CTG TCT ACT TGC CAC-3′ (SEQ ID NO:30 ), containing BglII sites. The reaction contained 200 nmol of each primer, 2.5 U of pfu Turbo DNA polymerase (Stratagene, La Jolla, Calif.), 0.2 mM of each dNTPs, and the template DNA in 10 mM KCl, 10 mM (NH)2SO4, 20 mM Tris-HCl pH 8.75, 2 mM MgSO4, 0.1% TritonX-100, 0.1 mg/ml bovine serum albumin (BSA). Thermocycling conditions were as follows: 20 cycles of 1 min at 95° C., 1 min at 56° C., and 4 mins at 72° C. with 15-min capping at 72° C. The digested PCR fragment was subcloned into the BglII site of the expression plasmid V1Jns (Shiver, et al., 1995, Immune responses to HIV gp120 elicited by DNA vaccination. In Chanock, R. M., Brown, F., Ginsberg, H. S., and Norrby, E. (Eds.) Vaccines 95. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp 95-98; see also Example section 1 herein) expression plasmid following similar procedures as described above. The ligation mixtures were then used to transform competent E. coli DH5 cells and screened by PCR amplification of individual colonies. Sequence of the entire gene insert was confirmed. All plasmid constructs for animal immunization were purified by CsCl method (Sambrook, et al., 1989, Fritsch and Maniatis, T. (Eds) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor).
In vitro expression in mammalian cells—1.5×106 293 cells were transfected with 1 or 10 μg of V1R-wt-pol (codon optimized) and V1Jns-wt-pol (virus derived) using the Cell Phect kit and incubated for 48 h at 37° C., 5% CO2, 90% humidity. Supernatants and cell lysates were prepared and assayed for protein content using Pierce Protein Assay reagent (Rockford, Ill.). Aliquots containing equal amounts of total protein were loaded unto 10-20% Tris glycine gel (Novex, San Diego, Calif.) along with the appropriate molecular weight markers. The pol product was detected using anti-serum from a seropositive patient (Scripps Clinic, San Diego, Calif.) diluted 1:1000 and the bands developed using goat anti-human IgG-HRP (Bethyl, Montgomery, Tex.) at 1:2000 dilution and standard ECL reagent kit (Pharmacia LKB Biotechnology, Uppsala, Sweden).
Ultrasensitive RT activity assay of pol constructs—RT activities from codon optimized wt-pol and IA pol plasmids were analyzed by the Product-Enhanced Reverse Transcriptase (PERT) assay using Perkin Elmer 7700, Taqman technology (Arnold, et al., 1999, One-step fluorescent probe product-enhanced reverse transcriptase assay. In McClelland, M., Pardee, A. (Eds.) Expression genetics: accelerated and high-throughput methods. Biotechniques Books, Natick, Mass., pp. 201-210). Background levels for this assay were determined using 1:100,000 dilution of lysates from mock (chemical treatment only, no vector) transfected 293 cells. This background range is set as RT/reaction tube of 0.00 to 56.28 which is taken from the mean value of 13.80±3 standard deviations (sd=14.16). Any individual value >56.28 would be considered positive for PERT assay. Cells lysates were prepared similarly for the following samples: mock transfection with empty V1Jns vector; no vector control; transfection with V1Jns-tpa-pol (codon optimized); and transfection with V1Jns-IApol (codon optimized). Samples were serially diluted to 1:100,000 in PERT buffer and 24 replicates for each sample at this dilution were assayed for RT activity.
Rodent immunization with optimized and virus-derived pol plasmids—To compare the immunogenic properties of wt-pol (codon optimized) and virus-derived pol gene, cohorts of BALB/c mice (N=10) were vaccinated with 1 μg, 10 μg, and 100 μg doses of V1R-wt-pol (codon optimized) and V1Jns-wt-pol plasmid (virus derived). At 5 weeks post dose 1, 5 of 10 mice per cohort were boosted with the same dose of plasmid they initially received. In all cases, the vaccines were suspended or diluted in 6 mM sodium phosphate, 150 mM sodium chloride, pH 7.2, and the total dose was injected to both quadricep muscles in 50 μL aliquots using a 0.3-mL insulin syringe with 28-½G needles (Becton-Dickinson, Franklin Lakes, N.J.).
Anti-RT ELISA—Anti-RT titers were obtained following standard secondary antibody-based ELISA. Maxisorp plates (NUNC, Rochester, N.Y.) were coated by overnight incubation with 100 μL of 1 μg /mL HIV-1 RT protein (Advanced Biotechnologies, Columbia, Md.) in PBS. The plates were washed with PBS/0.05% Tween 20 using Titertek MAP instrument (Hunstville, Ala.) and incubated for approximately 2 h with 200 μL/well of blocking solution (PBS/0.05% tween/1% BSA). The blocking solution was decanted; 100 μL aliquot of serially diluted serum samples were added per well and incubated for 2 h at room temperature. An initial dilution of 100-fold is performed followed by 4-fold serial dilution. The plates were washed and 100 μL of 1/1000-diluted HRP-rabbit anti-mouse IgG (ZYMED, San Francisco, Calif.) were added with 1 h incubation. The plates were washed thoroughly and soaked with 100 μL 1,2-phenylenediamine dihydrochloride/hydrogen peroxide (DAKO, Norway) solution for 15 min. The reaction was quenched by adding 100 μL of 0.5M H2SO4 per well. OD492 readings were recorded using Titertek Multiskan MCC/340 with S20 stacker. Endpoint titers were defined as the highest serum dilution that resulted in an absorbance value of greater than or equal to 0.1 OD492 (2.5 times the background value).
ELIspot assay—Antigen-specific INFγ-secreting cells from mouse spleens were detected using the ELIspot assay (Miyahira, et al., 1995, Quantification of antigen specific CD8+ T cells using an ELISPOT assay. J. Immunol. Methods 1995, 181, 45-54). Typically, spleens were collected from 3-5 mice/cohort and pooled into a tube of 8-mL complete RPMI media (RPMI1640, 10% FBS, 2 mM L-glutamine, 100U/mL Penicillin, 100 u/mL streptomycin, 10 mM Hepes, 50 uM β-ME). Multiscreen opaque plates (Millipore, France) were coated with 100 μL/well of 5 μg/mL purified rat anti-mouse IFN-γ IgG1, clone R4-6A2 (Pharmingen, San Diego, Calif.), in PBS at 4° C. overnight. The plates were washed with PBS/penicillin/streptomycin in hood and blocked with 200 μL/well of complete RPMI media for 37° C. for at least 2 h. The mouse spleens were ground on steel mesh, collected into 15 ml tubes and centrifuged at 1200 rpm for 10 min. The pellet was treated with 4 mL ACK buffer (Gibco/BRL) for 5 min at room temperature to lyse red blood cells. The cell pellet was centrifuged as before, resuspended in complete RPMI media (5 ml per mouse spleen), filtered through a cell strainer and counted using a hemacytometer. Block media was decanted from the plates and to each well, 100 μL of cell samples (5×105 cells per well) and 100 μL of the antigen solution were added. To the control well, 100 μL of the media were added; for specific responses, peptide pools containing either CD4+ or CD8+ epitopes were added. In all cases, a final concentration of 4 μg/mL per peptide was used. Each sample/antigen mixture were performed in triplicate wells. Plates were incubated at 37° C., 5% CO2, 90% humidity for 20-24 h. The plates were washed with PBS/0.05% Tween 20 and incubated with 100 μL/well of 1.25 μg/mL biotin-conjugated rat anti-mouse IFN-γ mAb, clone XMG1.2 (Pharmingen) at 4° C. overnight. The plates were washed and incubated with 100 μL/well 1/2500 dilution of strepavidin-alkaline phosphatase conjugate (Pharmingen) in PBS/0.005% Tween/5% FBS for 30 min at 37° C. Following a wash, spots were developed by incubating with 100 μl/well 1-step NBT/BCIP (Pierce Chemicals) for 6-10 min. The plates were washed with water and allowed to air dry. The number of spots in each well was determined using a dissecting microscope and the data normalized to 106 cell input.
Results—In vitro expression of Pol in mammalian cells—Heterologous expression of the optimized wt or IA pol genes (V1R-wt-pol (codon optimized), V1Jns-LApol (codon optimized), V1Jns-tpa-LApol (codon optimized)) in 293 cells (
Ultrasensitive RT assay of cells transfected with Pol constructs—Table 4 summarizes the levels of polymerase activity from mock (vector only) control, IApol (codon optimized)and wt-pol plasmids (codon optimized). Results indicate that the wild-type POL transfected cells contained RT activity approximately 4-5 logs higher than the 293 cell only baseline values. Mock transfected cells contained activity no higher than baseline values. The RT activity from opt-IApol-transfected cells was also found to be no different than baseline values; no individual reaction tube resulted in RT activity higher than the established cut-off value of 56.
Comparative immunogenicity of optimized and virus-derived pol plasmid—To compare the in vivo potencies of both constructs, BALB/c mice (N=10 per group) were vaccinated with escalating doses (1, 10, 100 μg) of either V1Jns-wt-pol (virus derived) or V1R-wt-pol (codon optimized). At 5 wks post dose 1, 5 of 10 animals were randomly boosted with the same vaccine and dose they received initially.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
This application claims the benefit, under 35 U.S.C. §119(e), of U.S. provisional application 60/171,542, filed Dec. 22, 1999.
| Number | Date | Country | |
|---|---|---|---|
| 60171542 | Dec 1999 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10168217 | Sep 2002 | US |
| Child | 11345127 | Feb 2006 | US |
