Patent Application
20120231449
The invention is directed at methods and eukaryotic host cells for transgene expression. Transgene expression is boosted by favoring homogenous recombination (HR) over non homologous end joining (NHEJ). The invention is also directed at providing, in an non-primate eukaryotic host cell, proteins involved in primate, in particular human, pathways that mediate or influence translocation across the ER membrane and/or secretion across the cytoplasmic membrane.
The biotechnological production of therapeutical proteins as well as gene and cell therapy depends on the successful expression of transgenes introduced into an eukaryotic cell. Successful transgene expression often requires integration of the transgene into the host chromosome and is limited, among others, by the number of transgene copies integrated and by epigenetic effects that can cause low or unstable transcription and/or high clonal variability. Failing or reduced transport of the transgene expression product out of the cell also often limits production of therapeutical proteins as well as gene and cell therapy.
The publications and other materials, including patents and accession numbers, used herein to illustrate the invention and, in particular, to provide additional details respecting the practice are incorporated herein by reference in their entirety. For convenience, the publications are referenced in the following text by author and date and are listed alphabetically by author in the appended bibliography.
The fact that the DNA of eukaryotes is highly compacted into chromatin allows the entire eukaryotic genome to fit within a nucleus which is a few micrometers diameter. However, this fact entails that gene expression is controlled via the local and temporary condensation and de-condensation of the chromatin, which involves a highly regulated and sophisticated cell machinery. In addition, transgene integration into the host chromosome is, in most cases, a random event resulting in a random integration locus and a varying copy number. The generally observed high degree of variability among independent transformants in stable transgene expression is thought to depend on the number of transgene copies that integrate within the host genome and on the chromatin environment at the site of transgene integration (Kalos and Fournier, 1995; Recillas-Targa et al., 2002). The expression of a transgene integrated into a random locus may be influenced by the arbitrary presence of regulatory elements at the integration locus as well as by the chromatin structure of chromosomal domains adjacent to the integration locus. For instance, a phenomenon called position effect variation can induce silencing of an active gene with time, because of its proximity to repressive heterochromatin (Robertson et al., 1995; Henikoff, 1996; Wakimoto, 1998).
Numerous methods, such as calcium-phosphate DNA co-precipitation, the polyethylenimine method, electroporation and polycationic lipids have been developed to facilitate gene transfer with variable transfection efficiencies. One way to augment the copy number of the transgene and thus increasing transgene expression, is gene amplification (Kaufman, 2000). An alternative is to optimize the expression vector by the insertion of synthetic or natural regulatory sequences.
To increase and stabilize transgene expression in mammalian cells, epigenetic regulators are being increasingly used to protect transgenes from negative position effects (Bell and Felsenfeld, 1999) and include boundary or insulator elements, locus control regions (LCRs), stabilizing and antirepressor (STAR) elements, ubiquitously acting chromatin opening (UCOE) elements and the aforementioned matrix attachment regions (MARs). All of these epigenetic regulators have been used for recombinant protein production in mammalian cell lines (Zahn-Zabal et al., 2001; Kim et al., 2004) and for gene therapies (Agarwal et al., 1998; Allen et al., 1996; Castilla et al., 1998).
As mentioned above, failing or reduced transport of the transgene expression product out of the cell also often limits production of therapeutical proteins as well as gene and cell therapy. The transgene expression product often encounters different bottlenecks: The cell that is only equipped with the machinery to process and transport its innate proteins can get readily overburdened by the transport of certain types of transgene expression products, especially when they are produced at abnormally high levels as often desired, letting the product aggregate within the cell and/or, e.g., preventing proper folding of a functional protein product.
Different approaches have been pursued to overcome transportation and processing bottlenecks. For example, CHO cells with improved secretion properties were engineered by the expression of the SM proteins Munc18c or Sly1, which act as regulators of membranous vesicles trafficking and hence secreted protein exocytosis (U.S. Patent Publication 20090247609). The X-box-binding protein 1 (Xbp1), a transcription factor that regulates secretory cell differentiation and ER maintenance and expansion, or various protein disulfide isomerases (PDI), have also been used to decrease ER stress and increase protein secretion (Mohan et al. 2007). Other attempts to increase protein secretion included the expression of the chaperones ERp57, calnexin, calreticulin and BiP1 in CHO cells (Chung et al., 2004). Finally, expression of a cold shock-induced protein, the cold-inducible RNA-binding protein (CIRP), was shown to increase the yield of recombinant γ-interferon. Attempts were also made to overexpress proteins of the secretory complexes. However, for instance, Lakkaraju et al. (2008) reported that exogenous SRP14 expression in WT human cells (e.g. in cells that were not engineered to express low SRP14 levels) did not improve secretion efficiency of the secreted alkaline phosphatase protein.
Thus, there is a need for efficient, more reliable transgene expression, e.g., recombinant protein production and for gene therapy. There is also a need to successfully transport the transgene expression product outside the cell.
This and other needs in the art are addressed by certain embodiments of the present invention.
The present invention is directed at a method for transgene expression comprising (a) providing an eukaryotic, preferably a mammalian, host cell, wherein said host cell has been modified or treated to increase homologous recombination (HR), decrease non homologous end joining (NHEJ) and/or to enhanced HR/NHEJ ratio in said cell, and (b) transfecting said cell, with at least one vector comprising said transgene, and optionally, with a matrix attachment region (MAR) element, wherein said MAR element is provided to said transgene in cis or trans.
The transfection in (b) may be a subsequent transfection, including just a single subsequent transfection, and may be preceded by an initial transfection, including just a single initial transfection, with nucleic acid such as a vector or nucleic acid fragments. The cell cycle of a cell population of said cell may be synchronized, e.g., by subjecting the cell population to a chemical or temperature treatment. The initial and subsequent transfection may take place at a time when a majority of the cells of the population are at the G1 phase of the cell cycle. More than 30%, more than 31%, 32%, 33%, 34%, 35%, 36%, 36%, 38%, 39%, 40%, 41%, 42%, 43%, 44% or 45% of the cells of the cell population may be in the G1 phase. Preferably, prior to the initial transfection an HR enzyme, an HR activator and/or a NHEJ suppressor may be administered. The cell may also be a recombinant eukaryotic host cell and may comprise a transgenic sequence encoding an HR enzyme, an HR activator and/or a NHEJ suppressor. The cell may also be mutated in a NHEJ or a HR gene. Alternatively or additionally, the genome said cell may mutated to inactivate NHEJ, to increases expression or activity of at least one HR enzyme, at least one HR activator and/or at least one NHEJ suppressor.
The nucleic acid of said initial transfection is, in certain embodiments, a vector comprising a transgene. The vector of the initial transfection and at least one vector of said at least one subsequent transfection may form concatemeric structures prior and/or after integration into the genome of the cell. The concatemeric structures may comprise at least 200, 300, 400, 500 or 600 copies of said transgene. The HR/NHEJ ratio of the cell may be up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 times higher than a ratio found in the cell not comprising said transgenic sequence and not being mutated, respectively. The NHEJ activity of the cell may equal about 0.
The integrated copy number of said transgene integrated into the genome of said cell following said at least one subsequent transfection may be more than twice that of a reference value representing the integrated copy number obtained by directly transfection the cell with the vector of (b).
The nucleic acid of the initial transfection may be a vector comprising a MAR element and said transgene. Following the initial transfection, e.g., a single initial transfection, the expression of said transgene may reach an initial level and the expression of the transgene following the subsequent transfection, e.g., a single subsequent transfection, may reach a subsequent level that is more than additive, preferably more than twice, three or four times that of said initial level. Alternatively or additionally, after the initial transfection, the transgene copy number integrated into the genome of the cell may equal (n) and following the at least one subsequent transfection, the transgene copy number integrated into the genome may be more than 2(n), 3(n) or 4(n). The transgene may be integrated into the genome of said cell as a concatemeric structure at a single locus.
The MAR element in (b) may ameliorate expression, substantially or fully prevent inhibitory effects from co-integration of multiple copies of the vector comprising the transgene.
More than 50%, 60%, 70%, 80% of the vectors of the at least one subsequent transfection may be transported into the nucleus.
After the initial transfection an initial level of transgene expression product and an initial transgene copy number may be reached. Following said at least one subsequent transfection, the level of transgene expression product may increase to a subsequent level and the initial transgene copy number may increase to a subsequent transgene copy number, wherein the increase between the first and second level of transgene expression product may exceed the increase between the initial transgene copy number and the subsequent transgene copy number by 20%, 30%, 40%, 50% or 60%.
The vector sequence of said vector of the at least one first transfection may have 100% or at least 95%, 90%, 85% or 80% sequence identity with the vector sequence of at least the vector of a first of said subsequent transfection(s). The vector of the initial transfection may comprise a MAR element and said MAR element may have 100% or at least 95%, 90%, 85% or 80% sequence identity with the MAR element of at least the vector of a first of said subsequent transfection(s). The vector of the initial transfection may comprise a transgene and the transgene may have 100% or at least 95%, 90%, 85% or 80% sequence identity with the transgene of at least the vector of a first of said subsequent transfection(s). The MAR element may be provided in cis as part of the vector in (b). In certain embodiments, the transgene is flanked by at least two MAR elements. The MAR element may be located upstream of a promoter/enhancer sequence of said transgene.
The MAR sequence may have at least 90% sequence identity with: SEQ ID NOs: 1-3 or is a variant thereof.
The invention is also directed at a recombinant eukaryotic, preferably mammalian, host cell, comprising
The invention is also directed at a recombinant eukaryotic, preferably mammalian, host cell, comprising
The one or more HR enzymes may be Rad 51, Rad 52, RecA, Rad 54, RuvC or BRCA2 and/or the HR activator may be RS-1 and/or the NHEJ suppressor may be NU7026 and/or wortmannin.
The transgene may be functionally linked to a control element for inducible expression such as an inducible promoter, wherein said inducible promoter is optionally a promoter activated physically such as a heat shock promoter or chemically such as promoter activated a IPTG or Tetracycline.
The mutation(s) in (c) or (d) may be mutation(s) in a xrcc4 gene, RAD51 strand transferase gene, a DNA-dependent protein kinase gene, the Rad 52 gene, the RecA gene, the Rad 54 gene, the RuvC gene and/or the BRCA2 gene.
The transgene may be integrated into a single locus of the genome of the cell and may form a concatemeric structure. The concatemeric structure may comprise at least 200, 300, 400, 500 or 600 copies of the transgene.
The invention is also directed at a recombinant eukaryotic, preferably mammalian host cell, comprising
The at least one MAR may be provided in cis, the majority of said transgenes may be provided with a MAR for each of said transgenes and/or the transgene may be flanked by at least two of said MAR elements. The at least one MAR element may have at least 90% sequence identity with SEQ ID NOs: 1-3 or may be a variant of SEQ ID NOs: 1-3 and/or may be located upstream of a promoter/enhancer sequence of said transgene. The cell may be a CHO cell, a HEK 293 cell, a stem cell or a progenitor cell.
The invention is also directed at the use of any one of the recombinant eukaryotic host cells mentioned herein, in particular for the expression of said transgene.
The invention is also directed at a kit comprising
The kit may also contain a synchronizing agent or instructions on how to synchronize a cell population comprising said cell(s). The vector may be used to transfect the cell at least twice, each time when the majority of the cell of said cell population is at the G1 phase.
The invention is also directed at a non-primate recombinant eukaryotic host cell comprising
a transgenic sequence encoding at least one primate protein or a primate RNA involved in translocation across the ER membrane and/or secretion across the cytoplasmic membrane, such as a protein or a RNA of a signal recognition particle (SRP) or a protein of a secretory complex (translocon) or a subunit thereof.
The cell may further comprise a transgene functionally attached to a signal peptide coding sequence, wherein said transgene may be present in the cell in multiple copies, preferably in form of a concatemeric structure. The cell may comprise at least 200, 300, 400, 500 or 600 copies of the transgene. A signal peptide encoded by said signal peptide coding sequence may comprise a hydrophobic stretch of amino acids and may have one or more sequences for interacting with SRP54. The cell may also comprise an epigenetic regulator element, such as an MAR element, located in cis or trans to said transgene. The protein or RNA involved in the translocation across the ER membrane and/or secretion across the cytoplasmic membrane may be a protein or RNA of the SPR, in particular SPR9, SPR14, SPR19, SPR54, SPR68, SPR72 and/or 7SRNA. The protein of the SPR may be a human SPR14, preferably combined with one or more other of said proteins or RNA involved in the translocation across the ER membrane and/or secretion across the cytoplasmic membrane. The one or more other of said proteins may be human SR and/or human Translocon proteins. The protein of the SPR may be human SPR54, preferably combined with one or more other of said proteins or RNA involved in the translocation across the ER membrane and/or secretion across the cytoplasmic membrane. The one or more other of said proteins may be human SR and/or human Translocon proteins.
The protein or RNA involved in the secretion and/or translocation across the cytoplasmic membrane may be one of the proteins of the translocon, in particular Sec61αβγ, Sec62, Sec63 and/or a subunit thereof. The protein or RNA involved in the secretion and/or translocation across the cytoplasmic membrane may be a combination of SRP9, SR14 and a Translocon protein. The transgene may a immunoglobulin, a subunit or fragment thereof or a fusion protein. The non-primate cell may be a rodent cell, preferably a CHO cell. The signal sequence coding sequence may have at least 90% sequence identity with SEQ ID NOs: 4-11 or may be a variant of any one of said sequences.
The invention is also directed at the use of the non-primate recombinant eukaryotic host cells in the secretion and/or translocation of a transgene expression product across the cytoplasmic membrane of the cell.
The invention is also directed at a kit comprising
The invention is further directed at a method for protein secretion of a transgene comprising:
The transgenic sequence may increase a total amount of protein or RNA involved in secretion and/or translocation across the cytoplasmic membrane present in said cell by more than 10%, 20%, 30%, 40% 50%, 60%, 70%, 80%, 90% or 100% above a level found in the cell prior to comprising/expressing said transgenic sequence.
The transgene may be present in the cell as a concatemeric structure integrated into the genome of the cell, wherein the concatemeric structure preferably comprises at least 200, 300, 400, 500 or 600 copies of the transgene and may be integrated at a single locus of a genome of said cell.
A signal peptide encoded by the signal peptide coding sequence may comprise a hydrophobic stretch of amino acids and may have sequences for interacting with SRP54.
The transfection in (b) may be a subsequent transfection and may be preceded by an initial transfection with nucleic acid such as a vector or nucleic acid fragments.
The vector of the initial transfection may correspond to the vector in (b).
The transgenic sequence may have at least 90% sequence identity with a sequence selected from the group of SEQ ID NOs: 4-11 or may be a variant of any one of said sequences.
The invention is also directed at a method for identifying a protein secretion and/or translocation increasing activity of a transgenic sequence comprising:
A transgene as used in the context of the present invention is an isolated and purified deoxyribonucleotide (DNA) sequence coding for a given mature protein (also referred to herein as a DNA encoding a protein) or for a precursor protein or a functional RNA. Some preferred transgenes according to the present invention are transgenes encoding immunoglobulins (Igs) and Fc-fusion proteins and other proteins, in particular proteins with therapeutical activity (“biotherapeutics”). As used herein, the term transgene shall, in the context of a DNA encoding a protein, not include untranscribed flanking regions such as RNA transcription initiation signals, polyadenylation addition sites, promoters or enhancers. Generally, the term transgene is used in the present context when referring to a DNA sequence that is introduced into a cell such as an eukaryotic host cell via transfection (the term also includes, in the context of the present invention, the process of introducing foreign DNA via a viral vector, which is also sometimes referred to as transduction) and which encodes the product of interest also referred to herein as the “transgene expression product” or “heterologous protein”. The transgene might be functionally attached to a signal peptide coding sequence, which encodes a signal peptide which in turn mediates and/or facilitates translocation and/or secretion across the endoplasmic reticulum and/or cytoplasmic membrane and is removed prior or during secretion. The term “transgenic sequence”, on the other hand is used, when referring to a DNA sequence that is introduced into a cell such as an eukaryotic host cell via transfection and which increase the expression and/or secretion of the product of interest. A transgenic sequence often encodes a protein or a RNA sequence. Transgenic sequences of the present invention are, e.g., those that specifically enhance HR (homologous recombination) or decrease non homologous end joining (NHEJ). Respective proteins are discussed in more detail below. Other “transgenic sequences” are those that encode protein(s) or RNA(s) involved in the processing, secretion and/or translocation across the endoplasmic reticulum and/or cytoplasmic membranes. The “transgenic sequences” may include non-translated control sequences.
An enhancement of the expression and/or secretion is measured relative to a value obtained from a control cell that does not comprise the respective transgenic sequence. Any statistically significant enhancement relative to the value of a control qualifies as a promotion.
The HR/NHEJ ratio (or HR/NHEJ activity ratio) is the ratio of HR (homologous recombination) to NHEJ (non homologous end joining) activity occurring in a cell such as a eukaryotic cell, e.g., a recombinant eukaryotic host cell. The HR/NHEJ ratio is generally measured in a cell population, that is, a group of, e.g., eukaryotic cells of the same kind, e.g., a CHO cell clone. When reference is made herein to, e.g., optimizing or enhancing (increasing), e.g., the HR/NHEJ ratio of a cell it is to be understood that the fact that such optimization or enhancement occurred in the respective cell population. The reference point for any such optimization or enhancement is the ratio that exists in a corresponding cell population in which no measures were performed to enhance or optimize HR/NHEJ ratio. This is, e.g., the parent cell population of said cell, i.e., the cell population from which the enhanced or optimized cell is derived. The HR/NHEJ ratio (or HR/NHEJ activity ratio) can be enhanced to exceed more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 times that of the reference cell population, which may be referred to herein, e.g., as a “cell not comprising said transgenic sequence and/or not being mutated.” Optimization and enhancement measurements include treatments in which the cell is “treated” generally without being genetically modified. Such a treatment includes the simple measure of synchronizing the cell population so that, e.g., a majority of cells of the population are, at the time of transfection, in the G1 phase. Different methods are known to accomplish such a synchronization and include, but are not limited to, use of chemical agents (synchronizing chemicals) and low temperature. Golzio et al. (2002) describe the cell synchronization by subjecting the cells to a treatment with sodium butyrate. Grosjean et al. (2002) describe that a majority of cells are arrested at the border between the G1 and S-phase after administration of mimosine as synchronizing chemical. Bjursell et al. (1973) describe synchronizing CHO cells using thymidine.
HR has been reported to require a group of RAD51-related proteins (West 2003). Thus, HR can be enhanced by providing supplemental HR proteins (HR enzymes) to the cells, which include, e.g., Rad 51, Rad 52, RecA, Rad 54, RuvC or BRCA2. HR activators may also be employed. Those include, but are not limited to, RS-1 (RD51-stimulatory compound 1). RS-1 enhances the homologous recombination activity of hRAD51 by promoting the formation of active presynaptic filaments (Jayathilaka et al. 2008). NHEJ has been reported to involve, in mammalian cells, two protein complexes, the heterodimer Ku80-Ku70 associated with DNA-PKcs and ligase IV with its co-factor XRCC4 (Delacôte et al., 2002). Suppressors of the NHEJ, which may also employed in the context of the present invention, include NU7026 (2-(morpholin-4-yl)-benzo(h) chomen-4-one), a DNA-PK inhibitor. Suppression of the NHEJ function using the chemical NU7026 may facilitate access of DNA ends to an intact homologous recombination repair pathway (Yang et al. 2009). Another suppressor of NHEJ is Wortmannin, a PI3k inhibitor of p110 PI 3 kinase, which also inhibits DNA-dependent protein kinase, which is known to mediate DNA double strand repair (Boulton et al., 1996).
The HR/NHEJ ratio of a cell may be enhanced by overexpressing those HR enzymes, HR activators and/or NHEJ suppressors or by HR activating or NHEJ suppressing physical or chemical treatments. One way of accomplishing such an overexpression is by introducing a “transgenic sequence” encoding such enzymes etc. into the respective cell. Such a sequence is referred to as “transgenic sequence” to signify that it is not part of the corresponding unmodified cell. The transgenic sequence is often integrated into the genome of the cell.
The proteins described above, such as the HR enzymes, activators and/or the NHEJ suppressors may be expressed in the modified cell inductively or constitutively. A person skilled can readily ascertain the appropriate vector constructions that allow for an inductive or constitutive expression.
Similarly, cells have been modified by mutation to enhance HR and/or decrease NHEJ and/or enhance the HR/NHEJ ratio of a cell. Several publications describe the inhibition of the NHEJ pathway, the pathway responsible for random integration of polynucleotides in cells, as a method for improving the HR/NHEJ ratio (see for example Krappmann et al., 2006). Genes and/or proteins that can be inactivated to block NHEJ include Ku80, Ku70, Ligase IV or XRCC4 (see also reference herein to the V3.3 mutant) and may, in the context of the present invention, result in very significant enhancements of the HR/NHEJ ratio and improvement of transgene expression, such as up to 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50 or even up to 60-fold increase on average of transgene expression. Similarly, certain mutations may enhance HR by, e.g., enhancing the expression of certain endogenous HR enzymes or activators of a cell.
A HR/NHEJ peak (or HR/NHEJ activity peak) is a period during the cell cycle of a cell population of eukaryotic cells at which HR/NHEJ ratio is elevated and peaks. If, in context of the present invention, reference is made to a HR/NHEJ peak of a cell, it is understood that reference is made to a cell of a cell population of the same kind, e.g., a cell population modified by a transgenic sequence to express a HR enzyme. The “HR/NHEJ peak” encompasses a time interval around the highest HR/NHEJ elevation (the tip of the peak, peak tip) in a graph plotting time against a value representing HR/NHEJ or just HR. The preferred time interval for a transfection is before the HR/NHEJ peak (e.g. at the G1 phase of the cell cycle), so that DNA reaches the cell nucleus as the time around the tip of the peak (peak tip, e.g. late S and G2 phases), defined by the point in time at which a 50% rise or more of the HR/NHEJ (or just HR) from the value at which the line towards the tip of the peak starts to rise (“bottom value”) to the tip of the peak has been reached. A peak comes into existence, e.g., when a minimum number of cells in the cell population are in the G1, or early S phase, a phase when HR activity is known to be low, and/or when the majority of cells are in the S phase or in the G2 phase, when HR activity is known to be highest.
A point in time when the majority of the cells of a cell population are in the G1 phase is also demonstrated in the graphs shown in
A functional RNA includes any type of RNA that produces a direct or indirect effect in the cell that differs from being translated into a protein. Typical examples are antisense RNAs or small interfering RNAs (si RNAs).
An eukaryotic host cell is a cell that does or is designed to “host” a transgene according to the present invention. A recombinant eukaryotic host cell is genetically modified, that is contains additional sequences, either as part of its genome or as part of an extrachromosomal element, such as a vectors, generally to enhance expression or secretion of the transgene expression product.
A concatemer or concatemeric structure is a long continuous DNA stretch or molecule that contains multiple copies of the same monomeric DNA sequences linked in series. In the context of the present invention the monomeric DNA sequence is or comprises often a transgene. The concatemeric structures of the transgene which might include, e.g., promoter and enhancer sequences, generally integrate into the genome of the host cell. This integration can happen at multiple locations (loci) (integration sites) of the chromosome of the host or at a single locus. A single concatemeric structure might include more than 200, 300, 400, 500, 600, 700 or more than 800 monomeric DNA sequences comprising said transgene. A head-to-tail array of the monomeric DNA sequences is preferentially observed. Transgenes that are said to be present in a cell in multiple copies may have a concatemeric structure.
A MAR element, a MAR construct, a MAR sequence, a S/MAR or just a MAR according to the present invention is a nucleotide sequence sharing one or more (such as two, three or four) characteristics with a naturally occurring “SAR” or “MAR” and having at least one property that facilitates protein expression of any gene influenced by said MAR. A MAR element has also the feature of being an isolated and/or purified nucleic acid with MAR activity, in particular, with transcription modulation, preferably enhancement activity, but also with, e.g., expression stabilization activity and/or other activities which are also described under “enhanced MAR constructs.” MAR elements belong to a wider group of epigenetic regulator elements which also include boundary or insulator elements, locus control regions (LCRs), stabilizing and antirepressor (STAR) elements, and ubiquitously acting chromatin opening (UCOE) elements. MAR elements may be defined based on the identified MAR they are primarily based on: A MAR S4 construct is, accordingly, a MAR elements that whose majority of nucleotide (50% plus) are based on MAR S4. Several simple sequence motifs high in A and T content have often been found within SARs and/or MARs, but for the most part, their functional importance and potential mode of action has been unresolved. These include the A-box, the T-box, DNA unwinding motifs, SATB1 binding sites (H-box, A/T/C25) and consensus topoisomerase II sites for vertebrates or Drosophila.
An AT/TA-dinucleotide rich bent DNA region (hereinafter referred to as “AT-rich region”) as commonly found in MAR elements is a bent DNA region comprising a high number of A and Ts, in particular in form of the dinucleotides AT and TA. In a preferred embodiment, it contains at least 10% of dinucleotide TA, and/or at least 12% of dinucleotide AT on a stretch of 100 contiguous base pairs, preferably at least 33% of dinucleotide TA, and/or at least 33% of dinucleotide AT on a stretch of 100 contiguous base pairs (or on a respective shorter stretch when the AT-rich region is of shorter length), while having a bent secondary structure. However, the “AT-rich regions” may be as short as about 30 nucleotides or less, but is preferably about 50 nucleotides, about 75 nucleotides, about 100 nucleotides, about 150, about 200, about 250, about 300, about 350 or about 400 nucleotides long or longer.
Some binding sites are also often have relatively high A and T content such as the SATB1 binding sites (H-box, A/T/C25) and consensus Topoisomerase II sites for vertebrates (RNYNNCNNGYNGKTNYNY) or Drosophila (GTNWAYATTNATNNR). However, a binding site region (module), in particular a TFBS region, which comprises a cluster of binding sites, can be readily distinguished from AT and TA dinucleotides rich regions (“AT-rich regions”) from MAR elements high in A and T content by a comparison of the bending pattern of the regions. For example, for human MAR 1—68, the latter might have an average degree of curvature exceeding about 3.8 or about 4.0, while a TFBS region might have an average degree of curvature below about 3.5 or about 3.3. Regions of an identified MAR can also be ascertained by alternative means, such as, but not limited to, relative melting temperatures, as described elsewhere herein. However, such values are specie specific and thus may vary from specie to specie, and may, e.g., be lower. Thus, the respective AT and TA dinucleotides rich regions may have lower degrees of curvature such as from about 3.2 to about 3.4 or from about 3.4 to about 3.6 or from about 3.6 to about 3.8, and the TFBS regions may have proportionally lower degrees of curvatures, such a below about 2.7, below about 2.9, below about 3.1, below about 3.3. In SMAR Scan II, respectively lower window sizes will be selected by the skilled artisan.
The terms MAR element, MAR construct, a MAR sequence, a S/MAR or just a MAR also includes enhanced MAR constructs that have properties that constitute an enhancement over an natural occurring and/or identified MAR on which a MAR construct according to the present invention may be based. Such properties include, but are not limited to, reduced length relative to the full length natural occurring and/or identified MAR, gene expression/transcription enhancement, enhancement of stability of expression, tissue specificity, inducibility or a combination thereof. Accordingly, a MAR element that is enhanced may, e.g., comprise less than about 90%, preferably less than about 80%, even more preferably less than about 70%, less than about 60%, or less than about 50% of the number of nucleotides of an identified MAR sequence. A MAR element may enhance gene expression and/or transcription of a transgene upon transformation of an appropriate cell with said construct.
A MAR element is preferably inserted upstream of a promoter region to which a gene of interest is or can be operably linked. However, in certain embodiments, it is advantageous that a MAR element is located upstream as well as downstream or just downstream of a gene/nucleotide acid sequence of interest. Other multiple MAR arrangements both in cis and/or in trans are also within the scope of the present invention.
The present invention is also directed to uses of MAR elements combined with one or more non-MAR epigenetic regulators such as, but not limited to, histone modifiers such as histone deacetylase (HDAC), other DNA elements (epigenetic regulator elements) such as locus control regions (LCRs), insulators such as cHS4 or antirepressor elements (e.g., stabilizer and antirepressor elements (STAR or UCOE elements) or hot spots (Kwaks THJ and Otte AP).
Synthetic, when used in the context of a MAR/MAR element refers to a MAR whose design involved more than simple reshuffling, duplication and/or deletion of sequences/regions or partial regions, of identified MARs or MARs based thereon. In particular, synthetic MARs/MAR elements generally comprise one or more, preferably one, region of an identified MAR, which, however, might in certain embodiment be synthesized or modified, as well as specifically designed, well characterized elements, such as a single or a series of TFBSs, which are, in a preferred embodiment, produced synthetically. These designer elements are in many embodiments relatively short, in particular, they are generally not more than about 300 bps long, preferably not more than about 100, about 50, about 40, about 30, about 20 or about 10 bps long. These elements may, in certain embodiments, be multimerized. Such synthetic MAR elements are also part of the present invention and it is to be understood that generally the present description can be understood that anything that is said to apply to a “MAR element” equally applies to a synthetic MAR element.
Functional fragments of nucleotide sequences of identified MAR elements are also included in the above definition as long as they maintain functions of a MAR element as described above.
Some preferred identified MAR elements include, but are not limited to, MAR 1—68, MAR X—29, MAR 1—6, MAR S4, MAR S46 including all their permutations as disclosed in WO2005040377 and US patent publication 20070178469, which are specifically incorporated by reference into the present application for the disclosure of the sequences of these and other MAR elements. The chicken lysozyme MAR is also a preferred embodiment (see, U.S. Pat. No. 7,129,062, which is also specifically incorporated herein for its disclosure of MAR elements).
Cis refers to the placement of two or more elements (such as chromatin elements) on the same nucleic acid molecule such as, but not limited to, the same vector or chromosome.
Trans refers to the placement of two or more elements (such as chromatin elements) on the two or more nucleic acid molecules such as, but not limited to, two or more vectors or chromosomes.
A sequence is said to act in cis and/or trans on, e.g., a gene when it exerts its activity from a cis/trans location.
A transgene or transgenic sequence of the present invention is often part of a vector. A vector according to the present invention is a nucleic acid molecule capable of transporting another nucleic acid, such as a transgene that is to be expressed by this vector, to which it has been linked, generally into which it has been integrated. For example, a plasmid is a type of vector, a retrovirus or lentivirus is another type of vector. In a preferred embodiment of the invention, the vector is linearized prior to transfection.
The vector sequence of a vector is the DNA or RNA sequence of the vector excluding any “other” nucleic acids such as transgenes as well as genetic elements such as MAR elements.
When the present specification refers to “plasmid” or “vector” homology, the term refers to the homology (herein used synonymous with sequence identity) of the entire plasmid or vector including MARs and genes.
An eukaryotic, including a mammalian cell, such as a recombinant eukaryotic host cell, according to the present invention is capable of being maintained under cell culture conditions. Non-limiting examples of this type of cell are non-primate eukaryotic host cells such as Chinese hamster ovary (CHOs) cells and baby hamster kidney cells (BHK, ATCC CCL 10). Primate eukaryotic host cells include, e.g., human cervical carcinoma cells (HELA, ATCC CCL 2) and monkey kidney CV1 line transformed with SV40 (COS-7, ATCC CRL-1587). A recombinant eukaryotic host cell signifies a cell that has been modified, e.g., by transfection with transgenic sequence and/or by mutation. The eukaryotic host cells are able to perform post-transcriptional modifications of proteins expressed by said cells. In certain embodiments of the present invention, the cellular counterpart of the eukaryotic (e.g., non-primate) host cell is fully functional, i.e., has not been, e.g., inactivated by mutation. Rather the transgenic sequence (e.g., primate) is expressed in addition to its cellular counterpart (e.g., non-primate).
Transfection according to the present invention is the introduction of a nucleic acid into a recipient eukaryotic cell, such as, but not limited to, by electroporation, lipofection, via a viral vector (sometimes referred to as “transduction”) or via chemical means including those involving polycationic lipids.
Transformation as used herein, refers to modifying an eukaryotic cell by the addition of a nucleic acid. For example, a transformed a cell includes a cell that that has been transfected with a transgenic sequence, e.g., via electroporation of a vector comprising this sequence. However, in many embodiments of the invention, the way of introducing the transgenic sequences of the present invention into a cell, is not limited to any particular method.
A single transfection means that the described transfection is only performed once.
Transcription means the synthesis of RNA from a DNA template. “Transcriptionally active” refers to a transgene that is being transcribed.
Identity means the degree of sequence relatedness between two nucleotide sequences as determined by the identity of the match between two strings of such sequences, such as the full and complete sequence. Identity can be readily calculated. While there exists a number of methods to measure identity between two nucleotide sequences, the term “identity” is well known to skilled artisans (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Methods commonly employed to determine identity between two sequences include, but are not limited to those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipman, D., SIAM J Applied Math. 48: 1073 (1988). Preferred methods to determine identity are designed to give the largest match between the two sequences tested. Such methods are codified in computer programs. Preferred computer program methods to determine identity between two sequences include, but are not limited to, GCG (Genetics Computer Group, Madison Wis.) program package (Devereux, J., et al., Nucleic Acids Research 12(1). 387 (1984)), BLASTP, BLASTN, FASTA (Altschul et al. (1990); Altschul et al. (1997)). The well-known Smith Waterman algorithm may also be used to determine identity.
As an illustration, by a nucleic acid comprising a nucleotide sequence having at least, for example, 95% “identity” with a reference nucleotide sequence means that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence may occur at the 5′ or 3′ terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. Sequence identities of more about 60%, about 70%, about 75%, about 85% or about 90% are also within the scope of the present invention.
A nucleic acid sequence having substantial identity to another nucleic acid sequence refers to a sequence having point mutations, deletions or additions in its sequence that have no or marginal influence on the respective method described and is often reflected by one, two, three or four mutations in 100 bps.
The invention is directed to both polynucleotide and polypeptide variants. A “variant” refers to a polynucleotide or polypeptide differing from the polynucleotide or polypeptide of the present invention, but retaining essential properties thereof. Generally, variants are overall closely similar and in many regions, identical to the polynucleotide or polypeptide of the present invention.
The variants may contain alterations in the coding regions, non-coding regions, or both. Especially preferred are polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred. Moreover, variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred.
The invention also encompasses allelic variants of said polynucleotides. An allelic variant denotes any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
A promoter sequence or just promoter is a nucleic acid sequence which is recognized by a host cell for expression of a specific nucleic acid sequence. The promoter sequence contains transcriptional control sequences which regulate the expression of the polynucleotide. The promoter may be any nucleic acid sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. The promoter is “functionally linked” to a specific nucleic acid sequence if it exercises its function on said promoter.
Enhancers are cis-acting elements of DNA, usually from about 10 to about 300 nucleotides long that act on a promoter to increase its transcription. Enhancers from globin, elastase, albumin, alpha-fetoprotein, and insulin enhancers may be used. However, an enhancer from a virus may be used; examples include SV40 on the late side of the replication origin, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin and adenovirus enhancers.
Exponentially as used herein is not an exact mathematical term, but describes a biological growth curve of cells, wherein a graph of such a growth is not as a straight line, but is a curve that points upwards and, at least over a certain period of time, continuously becomes steeper. In any event, it connotes a more than additive, e.g. increase.
A variability of expression as used in the context of the present invention refers to the variability in expression of one transformed cell versus another transformed cell of the same kind. This variability is a result of differing transgene copies and/or the site of transgene integration. Also, the co-integration of multiple copies of a transgene at the same locus may lead to silencing and thus contribute to the variability.
Moreover, the term comprise and derivations thereof do not exclude other elements or steps. Furthermore, the indefinite article “a” and derivations thereof do not exclude a plurality. The functions of several of the features mentioned in the claims can be fulfilled by a unity. The terms substantially, about, approximately and the like in connection with a characteristic or a value in particular also define exactly this characteristic or exactly this value.
The variability in transgene expression among independent transformants is influenced by the number of genes stably integrated in the genome of the cells and by the site of integration. While studying MARs and in particular while determining why MARs yield higher expression of transgenes, several observations were made that resulted in broader, MAR independent, finding:
First, via quantitative PCR it could be proven that MAR elements increase the number of transgene copies integrated in the genome. These results substantiated previous semi-quantitative observations (Kim et al., 2004; Girod et al., 2005). In addition, fluorescent in situ hybridization analysis of metaphase chromosomes of stable cell pools showed higher intensity of fluorescence in cells transfected with MARs, thus confirming the increase of transgene integration.
Further investigations, resulted in the finding that, after a single transfection with a transgene and a respective MAR, the MAR excreted no significant effect on the amount of plasmids transported to the cell nuclei after transfection. A possible explanation was that concatemerization and/or integration explained the high copy number integrated in the genome of the cells. The initial idea was that MARs may play a role as DNA recombination signals. Because of their structural properties, such as their unwinding and unpairing potential, the possibility existed that they could augment the frequency of homologous recombination between transfected plasmids, thus allowing the formation of bigger concatemers and integration of high number of plasmid copies.
Secondly, the phenomenon was investigated that, under certain circumstances, two successive transfections (a single initial transfection and subsequent ones) with a MAR next to the transgene allow a more than additive increase in transgene expression rather than providing just an additive, e.g., two-fold increase, that one would expect from e.g. two independent transfections.
Via quantitative PCR it was demonstrated that the high transgene expression associated with successive MAR transfections was based on a similar high increase of the number of integrated transgene copies after multiple transfection events as compared to one single event.
While there was an increase in number of plasmids that entered the nucleus, it was further investigated whether the high number of integrated transgene copies in successive MAR transfections may, at least in part, be due to better concatemerization between homologous plasmids introduced into the cells during the successive transfections. A process involving homologous recombination was suspected and tested by studying the effect of plasmid homology. In particular, double transfections were performed with different combinations of transgenes, plasmid backbones and/or MARs. FACS analyses reveal that high plasmid homology (vector sequence homology and transgene as well as MAR homology) was generally required for higher efficiency of integration and transgene expression. Changing either the gene of expression and vector sequence or MARs reduced both the efficiency of integration and transgene expression. In fact, the observed effect of double transfection was totally abolished when all sequences differed.
In addition, the timing between successive transfections was shown to be very important to achieve the optimal protein expression. It was hypothesized that, at the time of the second transfection, cells should be in a cell cycle state that is favorable for a higher recombination rate, leading to a formation of bigger concatamers and integration of more plasmids into the host genome. As discussed above, the concatermierzation of transgenes may result from two principal mechanisms that exist in an eukaryotic cell, one is HR and the other is NHEJ. Thus, the effect one or the other on the double transfection were tested. For this, different CHO mutants were used that were either deficient in non-homologous end-joining or homologous recombination. It was found that the NHEJ pathway antagonized efficient transgene integration and expression, while a functional homologous recombination pathway and homologous DNA sequences on the transfected vectors favored high-level expression. When mutant CHO cells that relied solely on homologous recombination were used, transfections of MAR-containing vector yielded a very high increase in the level of transgene expression as compared to non-mutated cells. Also, FISH analysis did not show any multiple integration events with successive transfections at specific time intervals, here 21 hours, indicating that all transgene integrated at one chromosomal locus.
Thus, the effect of the host cells deficient in non-homologous end-joining or homologous recombination on integration of the MAR influenced transgene, led to a broader concept, unrelated to MARs, namely that transgene integration is favored by HR and disfavored by NHEJ. Thus, we devised methods and constructs that take advantage of this finding to increase transgene integration and thus transgene expression. The methods include method to increase the HR, decrease the NHEJ and/or increase the HR/NHEJ ratio at the time of integration with treatments, such a chemical or temperature treatments or other treatments that that allow a synchronization of a cell population. Other treatments and modifications are described above under the discussion of the HR/NHEJ ratio. The constructs were primarily cells having the suitable makeup to allow for a HR enhancement, a NHEJ decrease and/or an enhancement of the HR/NHEJ ration.
The decrease the NHEJ and/or the enhancement of HR or the HR/NHEJ ratio in the host cell has also a particularly advantageous effect in the context of successive transfections which may or may not involve a MAR.
However, while the MAR independent process provide considerable progress in terms of transgene integration and expression, MARs and other epigenetic regulators still provide further advantageous properties that in part can be explained by favorably influencing homologous recombination as well as by other mechanisms, some of which have been discussed previously (see, e.g., US Patent Publication US 2007/0178469).
MAR elements have been described to have the ability to improve transgene expression by reducing population expressing low level of protein by protecting transgenes from the silencing effects, which likely result from the integration in non-permissive heterochromatic loci (Bell and Felsenberg, 1999). The anti-silencing effect observed in the presence of MAR may be mediated by chromatin modifications such as histone hyperacetylation at the site of transgene integration (Recillas-Targa et al., 2002; Yasui et al., 2002) or changes in subnuclear localization. Additionally, MARs may recruit regulatory proteins that modify chromatin to adopt a more transcriptionally permissive state, or they can recruit transcription factors that activate gene expression (Yasui et al., 2002; Hart and Laemmli, 1998). Alternatively, but not exclusively, MAR may recruit proteins to remodel chromatin structure towards an open state more permissive for integration events. Also the transcription of transgenes can be improved by an activation of the transgene promoter or enhancer by MAR. MAR may also favor integration in a permissive locus within the chromosome. Finally, they may enhance the transgene copy number integrated in the host genome by a mechanism unrelated to HR.
In this context, it should be noted that the perception that a higher copy number always supports stronger expression of a transgene is not necessarily valid since the presence of multiple copies integrated into the host genome favors silencing, resulting from the propensity of repeated elements to pair and assemble in heterochromatin. Alternatively, expression of repeated genes may lead to the formation of double-stranded and/or small interfering RNAs, which in turn may lead to epigenetic silencing. However, in the context of the present invention, it could be shown that the transgene copy number and cell fluorescence levels were shown to correlate well in the presence of MAR. Thus, an increase in transgene expression is likely not only to result from the integration of more transgene copies in the genome of cells, but to be favored by MAR-mediated inhibition of epigenetic silencing events that are associated with the integration of tandem gene copies.
As noted above, especially in the context of successive transfections, the increase in transgene integration/expression in the experiments performed, could be in part explained it by quantifying the amount of transgenes transported in the nuclei. Indeed, it could be shown that cell nuclei receive more plasmids with two transfections, in particular with MARs, and particularly during the second transfection, since the first transfection may facilitate DNA uptake and nuclear transport by the cells during the second transfection. Indeed, by assessing the intracellular trafficking of the DNA and quantifying the percentile of labeled pDNA in cellular organelles such as lysosomes, nuclei and cytosol after each transfection, it could be shown that plasmid DNA bearing a MAR seemed to escape lysosome degradation and to enter the nucleus during the second transfection much more efficiently. An explanation might be that the plasmids, in particular those of the first transfection, may saturate the cellular degradation machinery, thus allowing a more efficient DNA transport to the nucleus during the second transfection.
Thus, combining cells having an enhanced HR/NHEJ ratio, enhanced HR and/or a decreased NHEJ with MAR elements can be highly effective and is part of the present invention.
Transgenes use the recombination machineries to integrate at a double strand break into the host genome.
Double-strand breaks (DSBs) are the biologically most deleterious type of genomic damage potentially leading to cell death or a wide variety of genetic rearrangements. Accurate repair is essential for the successful maintenance and propagation of the genetic information.
There are two major DSB repair mechanisms: non-homologous end-joining (NHEJ) and homologous recombination (HR). Homologous recombination is a process for genetic exchange between DNA sequences that share homology and is operative only the S/G2 phases of the cell cycle, while NHEJ simply pieces together two broken DNA ends, usually with no sequence homology, and it functions in all phases of the cell cycle but is of particular importance during G0-G1 and early S-phase of mitotic cells (Wong and Capecchi, 1985; Delacote and Lopez, 2008). In vertebrates, HR and NHEJ differentially contribute to DSB repair, depending on the nature of the DSB and the phase of the cell cycle (Takata et al., 1998).
Conceptually, the molecular mechanism of the NHEJ process seems to be simple: 1) a set of enzymes capture the broken DNA molecule, 2) a molecular bridge that brings the two DNA ends together is formed and 3) the broken molecules are re-ligated. To perform such reactions, the NHEJ machinery in mammalian cells involves two protein complexes, the heterodimer Ku80/Ku70 associated with DNA-PKcs (catalytic subunit of DNA-dependent protein kinase) and DNA ligase IV with its co-factor XRCC4 (X-ray-complementing Chinese hamster gene 4) and many protein factors, such as Artemis and XLF (XRCC4-like factor; or Cernunnos) (Delacote et al., 2002). NHEJ is frequently considered as the error-prone DSB repair because it simply pieces together two broken DNA ends, usually with no sequence homology and it generates small insertions and deletions (Moore and Haber, 1996; Wilson et al., 1999). NHEJ provides a mechanism for the repair of DSBs throughout the cell cycle, but is of particular importance during G0-G1 and early S-phase of mitotic cells (Takata et al., 1998; Delacote and Lopez, 2008). The repair of DSBs by NHEJ is observed in organisms ranging from bacteria to mammals, indicating that it has been conserved during evolution.
After DSB formation the key step in NHEJ repair pathway is the physical juxtaposition of the broken DNA ends. NHEJ is initiated by the association of the Ku70/80 heterodimer protein complex to both ends of the broken DNA molecule to capture, tether the ends together and create a scaffold for the assembly of the other NHEJ key factors. The DNA-bound Ku heterodimer complex recruits DNA-PKcs to the DSB, a 460 kDa protein belonging to the PIKK (phosphoinositide 3-kinase-like family of protein kinases) (Gottlieb and Jackson, 1993) and activates its serine/threonine kinase function (Yaneva et al., 1997). Two DNA-PKcs molecules interact together across the DSB, thus forming a molecular bridge between both broken DNA ends and inhibit their degradation (DeFazio et al., 2002). Then, DNA ends can be directly ligated, although the majority of termini generated from DSB have to be properly processed prior to ligation (Nikjoo et al., 1998). Depending of the nature of the break, the action of different combinations of processing enzymes may be required to generate compatible overhangs, by filling gaps, removing damaged DNA or secondary structures surrounding the break. This step in the NHEJ process is considered to be responsible for the occasional loss of nucleotides associated with NHEJ repair. One key end-processing enzyme in mammalian NHEJ is Artemis, a member of the metallo-β-lactamase superfamily of enzymes, which was discovered as the mutated gene in the majority of radiosensitive severe combined immunodeficiency (SCID) patients (Moshous et al., 2001). Artemis has both a 5′→3′ exonuclease activity and a DNA-PKcs-dependent endonuclease activity towards DNA-containing ds-ss transitions and DNA hairpins (Ma et al., 2002). Its activity is also regulated by ATM. Thus, Artemis seems likely to be involved in multiple DNA-damage responses. However, only a subset of DNA lesions seem to be repaired by Artemis, as no major defect in DSB repair were observed in Artemis-lacking cells (Wang et al., 2005, Darroudi et al., 2007).
DNA gaps must be filled in to enable the repair. Addition of nucleotides to a DSB is restricted to polymerases μ and λ (Lee et al., 2004; Capp et al., 2007). By interaction with XRCC4, polynucleotide kinase (PNK) is also recruited to DNA ends to permit both DNA polymerization and ligation (Koch et al., 2004). Finally, NHEJ is completed by ligation of the DNA ends, a step carried out by a complex containing XRCC4, DNA ligase IV and XLF (Grawunder et al., 1997). Other ligases can partially substitute DNA ligase IV, because NHEJ can occur in the absence of XRCC4 and Ligase IV (Yan et al., 2008). Furthermore, studies showed that XRCC4 and Ligase IV do not have roles outside of NHEJ, whereas in contrast, KU acts in other processes such as transcription, apoptosis, and responses to microenvironment (Monferran et al., 2004; Müller et al., 2005; Downs and Jackson, 2004).
As the person skilled in the art will readily understand, any mutation in or around one of the genes of the above referenced proteins (e.g., the heterodimer Ku80/Ku70, DNA-PKcs, but in particular DNA ligase IV, XRCC4, Artemis and XLF (XRCC4-like factor; or Cernunnos), PIKK (phosphoinositide 3-kinase-like family of protein kinases), that will decrease or shut down the NHEJ is within the scope of the present invention. Similarly, any protein or transgenic sequence acting on any one of the above pathways to decrease it or shut it down is within the scope of the present invention.
Homologous recombination (HR) is a very accurate repair mechanism. A homologous chromatid serves as a template for the repair of the broken strand. HR takes place during the S and G2 phases of the cell cycle, when the sister chromatids are available. Classical HR is mainly characterized by three steps: 1) resection of the 5′ of the broken ends, 2) strand invasion and exchange with a homologous DNA duplex, and 3) resolution of recombination intermediates. Different pathways can complete DSB repair, depending on the ability to perform strand invasion, and include the synthesis-dependent strand-annealing (SDSA) pathway, the classical double-strand break repair (DSBR) (Szostak et al, 1983), the break-induced replication (BIR), and, alternatively, the single-strand annealing (SSA) pathway. All HR mechanisms are interconnected and share many enzymatic steps.
The first step of all HR reactions corresponds to the resection of the 5′-ended broken DNA strand by nucleases with the help of the MRN complex (MRE11, RAD50, NBN (previously NBS1, for Nijmegen breakage syndrome 1)) and CtIP (CtBP-interacting protein) (Sun et al., 1991; White and Haber, 1990). The resulting generation of a 3′ single-stranded DSB is able to search for a homologous sequence. The invasion of the homologous duplex is performed by a nucleofilament composed of the 3′ ss-DNA coated with the RAD51 recombinase protein (Benson et al., 1994). The requirement of the replication protein A (RPA), an heterotrimeric ssDNA-binding protein, involved in DNA metabolic processes linked to ssDNA in eukaryotes (Wold, 1997), is necessary for the assembly of the RAD51-filament (Song and sung, 2000). Then RAD51 interacts with RAD52, which has a ring-like structure (Shen et al., 1996) to displace RPA molecules and facilitate RAD51 loading (Song and sung, 2000). Rad52 is important for recombination processes in yeast (Symington, 2002). However, in vertebrates, BRCA2 (breast cancer type 2 susceptibility protein) rather than RAD52 seems to play an important role in strand invasion and exchange (Davies and Pellegrini, 2007; Esashi et al., 2007). RAD51/RAD52 interaction is stabilized by the binding of RAD54. RAD54 plays also a role in the maturation of recombination intermediates after D-loop formation (Bugreev et al., 2007). In the other hand, BRCA1 (breast cancer 1) interacts with BARD1 (BRCA1 associated RING domain 1) and BACH1 (BTB and CNC homology 1) to perform ligase and helicase DSB repair activity, respectively (Greenberg et al., 2006). BRCA1 also interacts with CtIP in a CDK-dependent manner and undergoes ubiquitination in response to DNA damage (Limbo et al., 2007). As a consequence, BRCA1, CtIP and the MRN complex play a role in the activation of HR-mediated repair of DNA in the S and G2 phases of the cell cycle.
The invasion of the nucleofilament results in the formation of a heteroduplex called displacement-loop (D-loop) and involves the displacement of one strand of the duplex by the invasive strand and the pairing with the other. Then, several HR pathways can complete the repair, using the homologous sequence as template to replace the sequence surrounding the DSB. Depending of the mechanism used, reciprocal exchanges (crossovers) between the homologous template and the broken DNA molecule may be or may not be associated to HR repair. Crossovers may have important genetic consequences, such as genome rearrangements or loss of heterozygosity.
As the person skilled in the art will readily understand any mutation in or around one of the genes of the above referenced proteins (e.g., proteins of the MRN complex (MRE11, RAD50, NBN (previously NBS1, for Nijmegen breakage syndrome 1)) and CtIP (CtBP-interacting protein), RAD51, the replication protein A (RPA), Rad52, BRCA2 (breast cancer type 2 susceptibility protein), RAD54, BRCA1 (breast cancer 1) interacts with BARD1 (BRCA1 associated RING domain 1), BACH1 (BTB and CNC homology 1)) that will enhance HR is within the scope of the present invention. Similarly, any protein or transgenic sequence acting on any one of the above pathways to enhance it is within the scope of the present invention.
NHEJ and HR appear to be the two main eukaryotic DSB-repair pathways. Nevertheless, the balance between them differs widely among species. Vertebrate cells use NHEJ more frequently than yeast. One explanation is that the complexity of higher eukaryotic genomes makes the search for homology necessary for HR more difficult. In addition, the high level of repetitiveness may be dangerous for genetic stability if case of ectopic recombination. Alternatively, some factors, such as DNA-PKcs, BRCA1 and Artemis are found in vertebrates but not in yeast.
In mammals, it is known that NHEJ and HR operate in both competitive and collaborative manners, and studies on rodent cells and human cancer cell lines have shown that the choice between NHEJ and HR pathways depends on cell cycle stages. NHEJ provides a mechanism for the repair of DSBs throughout the cell cycle, but is of particular importance during G0-G1 and early S-phase of mitotic cells (Takata et al., 1998; Delacote and Lopez, 2008), whereas HR is active in late S/G2 phases. Several factors are also important in the regulation of the choice between both pathways, including regulated expression and phosphorylation of repair proteins, chromatin accessibility for repair factors, and the availability of homologous repair templates. A key factor that regulates HR efficiency is template availability. It is thus not surprising that cells upregulate HR during S and G2 phases of the cell cycle when sister chromatids are available because they are the favorite template for HR (Dronkert et al., 2000). This preference can be explained by an effect of proximity between sister chromatids from the time they form in S phase until they segregate in anaphase. But the presence of a homologous template is not sufficient for HR competence. Increasing evidence indicates that the shift from NHEJ toward HR as cells progress from G1 to S/G2 is actively regulated.
Indeed, HR is tightly regulated by CDK-dependent cell cycle controls in mammalian cells. It has been demonstrated that CDK-mediated phosphorylation of serine 3291 of BRCA2 blocks its interaction with RAD51 in M and early G1 phases. This phosphorylation represents one of the mechanisms by which HR is down-regulated (Esashi et al., 2007). Additionally, a fundamental difference between HR and NHEJ is that HR-mediated repair requires DNA resection (approx. 100-200 nucleotides) for homology searching and strand invasion (Sung and Klein, 2006). It is now clear DNA 5′-ended resection, is a key step that contributes to the choice of DSB repair, by initiating HR and inhibiting further possibilities of NHEJ. Resection depends on CDK1 activity. Interestingly, blocking CDK1 led to the persistence of MRE1 at the DSB site, suggesting that CDK1 activity is required for the regulation of end resection, rather than for MRN recruitment to broken ends (Ira et al., 2004). Finally, RAD51 and RAD52 expressions increase during S phase and contribute to HR activation (Chen et al., 1997). In contrast, NHEJ is down-regulated by the decrease of DNA-PK activity in S phase (Lee et al., 1997).
The regulation of the choice between repair pathways may be controlled by the early acting proteins that act in both repair pathways. MRN complex and ATM are among them, and along with their mediator and transducer proteins form an efficient network that senses and signals any DNA damage. This network starts working very fast after the damage and is switch off soon after the task is accomplished.
The MRN complex is involved in DNA repair mechanisms, such as HR, NHEJ, DNA replication, telomere maintenance and in the signalling to the cell cycle checkpoints (D'Amours and Jackson, 2002; van den Bosch et al., 2003). The first step in DNA damage repair is the association of MRN complex as a heterotetramer (M2R2) with the broken ends of DSBs (de Jager et al., 2001), through the DNA-binding motif of MRE1. This binding is arranged as a globular domain with RAD50 WalkerA and B motifs and bridge DNA molecules.
MRN complex is thus the first sensor of DSBs and it activates ATM (Mirzoeva and Petrini, 2003; Lavin 2007) by two steps. First, it increases the local concentration of DNA ends to a level that triggers ATM monomerization. Then NBN binding to ATM converts it into active conformation (Dupre et al., 2006). Once activated, ATM plays the central role in DSB signalling and phosphorylates a variety of protein targets. For instance, ATM induces cell cycle arrest through the action of p53 intermediate (Canman et al., 1998; Waterman et al., 1998). Other substrates, e.g. NBS, MRE1, BRCA1, CHK2, FANCD2, Artemis and DNA-PKcs are phosphorylated by the activated ATM kinase and are important to determine the fate of the cells by play roles in DNA repair, cell cycle control, and transcription. The MRN complex and ATM are interdependent in the recognition and signalling of DSBs (Lavin, 2007).
A rapid phosphorylation of H2A by ATM at the C-terminal S139 residue is also observed in response to DSBs (Burma et al., 2001; Stiff et al., 2004). Phosphorylated H2AX (γH2AX) was found on megabase regions surrounding DSBs within seconds and function as a DNA damage signal transduction by serving as a docking site for several proteins (Kim et al., 2006).
The nuclease activity of MRE11 has been found to regulate the generation of single-stranded DNA in cooperation with CtIP in mammalian cells (Limbo et al., 2007; Sartori et al., 2007) by processing the 3′-ssDNA, a binding site for RPA (White and Haber, 19990). The RPA-ssDNA complex inhibits any further nuclease activity and provides the site of action of repair machinery (Sugiyma et al., 1997; Williams et al., 2007). This is followed either by HR or A-NHEJ, depending on the presence of homologous sequences, protein regulation and the size of resection (Rass et al., 2009).
CtIP was first characterized as a cofactor for the transcriptional repressor CtBP (carboxy-terminal binding protein) and for its binding to cell cycle regulators, such as the retinoblastoma protein and BRCA1 (Fusco et al., 1998; Schaeper et al., 1998; Wong et al., 1998). CtIP is known to have both transcription-dependent and independent implications in cell cycle progression (Liu and Lee, 2006; Wu and Lee, 2006). In addition to its central role in the cell cycle checkpoint response to DNA DSB, recent work suggested that CtIP controls the decision to repair DSB damage by HR by initiating DBS end resection (Sartori et al., 2007; You et al., 2009). In addition, it might also participate in the limited resection for DSB ends required for MMEJ during G1 phase (Yun and Hiom, 2009). Therefore, CtIP links cell cycle control, DNA damage checkpoints and repair. As the MRN complex is also necessary for DSB end resection, it is likely that CtIP provides a physical connection between the MRN complex and BRCA1 (Bernstein and Rothstein, 2009; Takeda et al., 2007).
Mutations in any of these genes involved in DNA repair, lead to genomic instability syndromes, such as ataxia-telangiectasia-like disorder (ATLD) (Steward et al., 1999; Taylor et al., 2004), Nijmegen breakage syndrome (NBS) and a variant form of Nijmegen breakage syndrome (Bendix-Waltes et al., 2005) for mutation in MRE11, NBS, and RAD50, respectively. In addition, null mutations lead to embryonic lethality in mice (Xiao and Weaver 1997; Luo et al., 1999; Zhu et al., 2001). Other mutations in the ATM or ATR genes cause genome instability syndromes, such as ataxia-telangiectasia (A-T) or Seckel syndrome (SCKL1), respectively (O'Driscoll et al., 2003). Artemis deficiency (Moshous et al., 2001), DNA ligase IV deficiency (LigIV) (O'Driscoll et al., 2001), Cernunnos-XLF (XRCC4-like factor) deficiency (Buck et al., 2006), Bloom syndrome (BS), Werner Syndrome (WS), and Fanconi anemia (FA) are associated with other members of the DNA damage repair machinery (Taniguchi and D'Andrea, 2006). Furthermore, in addition to genomic instability disorder, the patients with such syndromes often suffer from various types of malignancies, which indicate a link between unrepaired DNA damages and cancer occurrence. Genes involved in DNA repair play thus a critical role in tumor prevention.
As the person skilled in the art will readily understand any mutation in or around one of the genes of the above referenced that will enhance HR, decrease NHEJ and/or enhance the HR/NHEJ ratio, e.g., by shifting the choice between repair pathways towards HR, is within the scope of the present invention. Similarly, any protein or transgenic sequence acting on any one of the above pathways to enhance HR, decrease NHEJ and/or enhance the HR/NHEJ ratio is within the scope of the present invention.
In transfected cell populations there are generally a small minority of cells that produce considerable amounts of the transgene expression product (medium or high producer clones/cells displaying more than 10-100 and 100-1000, respectively relative light units (RLUs)) and cells that hardly produce any transgene expression product (low producer clones/cells, e.g., displaying less than 10 RLUs). However, in some cases, no high producer clones/cells can be obtained from specific transgenes. It could be shown that this differences is transgene expression is product specific and that there are certain “difficult-to-express” proteins. Low producer cells for such difficult-to-express proteins, but to a small extent also medium and high producer cells, e.g., for easy-to-express proteins, showed intracellular precipitation of in particular precursor protein and potentially polypeptide cross-linking, thus indicating possible problems in the processing, folding and/or assembly of the final product.
Further data presented herein suggested problems in protein secretion, in particular in ER translocation and processing. Despite previous unsuccessful attempts to increase protein secretion by expressing components of the protein secretion pathway (Lakkaraju et al., 2008), the combination of a non-primate cell, such as a CHO cell and transgenic sequence, in particular a primate, e.g. human sequence encoding such a component resulted in the surprising improvement of secretion of not only the low producer cells, but also in high producer cells. Of the components tested, particular ones and particular combinations entailed particularly favorable results. For example, SRP14 was one of the proteins that was successfully tested. It may be required to halt elongation until the nascent polypeptide may find an available SR with the help of SRP54. Since a further combination with Translocon (Transl) provided particularly high secretion, the resulting complex may need to associate to Transl in order for translocation to occur, which itself leads to the removal of the signal peptide in the endoplasmic reticulum and to the secretion of a properly processed and assembled protein. However, as the person skilled in the art will readily understand, the introduction of transgenic sequences of other components and the combinations of such sequences is within the scope of the present invention. Reference is in particular made to the description of the protein secretion pathway elsewhere herein.
Herein, the term translocation is primarily used to refer to the transport across the membrane of the endoplasmic reticulum. It should, however, be recognized that the term is often used in the literature to refer to a more generic concept.
The Protein Secretion Pathway
The secretion of proteins is a process common to organisms of all three kingdoms. This complex secretion pathway requires most notably the protein translocation from the cytosol across the cytoplasmic membrane of the cell. Multiple steps and a variety of factors are required to for the protein to reach its final destination. In mammalian cells, this secretion pathway involves two major macromolecular assemblies, the signal recognition particle (SRP) and the secretory complex (Sec-complex or translocon). The SRP is composed of six proteins with masses of 9, 14, 19, 54, 68 and 72 kDa and a 7S RNA (Keenan, Freymann et al. 2001) and the translocon is a donut shaped particle composed of Sec61αβγ, Sec62 and Sec63.
The first step in protein secretion depends on the signal peptides, which comprises a specific peptide sequence at the amino-terminus of the polypeptide that mediates translocation of nascent protein across the membrane and into the lumen of the endoplasmic reticulum (ER). During this step, the signal peptide that emerges from the leading translating ribosome interacts with the subunit of the SRP particle that recognizes the signal peptide, namely, SRP54. The SRP binding to the signal peptide blocks further elongation of the nascent polypeptide resulting in translation arrest. The SRP9 and −14 proteins are required for the elongation arrest (Walter and Blobel 1981). In a second step, the ribosome-nascent polypeptide-SRP complex is docked to the ER membrane through interaction of SRP54 with the SRP receptor (SR) (Gilmore, Blobel et al. 1982; Pool, Stumm et al. 2002). The SR is a heterodimeric complex containing two proteins, SRα and SRβ that exhibit GTPase activity (Gilmore, Walter et al. 1982). The interaction of SR with SRP54 depends on the binding of GTP (Connolly, Rapiejko et al. 1991). The SR coordinates the release of SRP from the ribosome-nascent polypeptide complex and the association of the exit site of the ribosome with the Sec61 complex (translocon). The growing nascent polypeptide enters the ER through the translocon channel and translation resumes at its normal speed. The ribosome stays bound on the cytoplasmic face of the translocon until translation is completed. In addition to ribosomes, translocons are closely associated with ribophorin on the cytoplasmic face and with chaperones, such as calreticulin and calnexin, and protein disulfide isomerases (PDI) and oligosaccharyl transferase on the luminal face. After extrusion of the growing nascent polypeptide into the lumen of the ER, the signal peptide is cleaved from the pre-protein by an enzyme called a signal peptidase, thereby releasing the mature protein into the ER. Following post-translational modification, correct folding and multimerization, proteins leave the ER and migrate to the Golgi apparatus and then to secretory vesicles. Fusion of the secretory vesicles with the plasma membrane releases the content of the vesicles in the extracellular environment.
Remarkably, secreted proteins have evolved with particular signal sequences that are well suited for their own translocation across the cell membrane. The various sequences found as distinct signal peptides might interact in unique ways with the secretion apparatus. Signal sequences are predominantly hydrophobic in nature, a feature which may be involved in directing the nascent peptide to the secretory proteins. In addition to a hydrophobic stretch of amino acids, a number of common sequence features are shared by the majority of mammalian secretion signals. Different signal peptides vary in the efficiency with which they direct secretion of heterologous proteins, but several secretion signal peptides (i.e. those of interleukin-, immunoglobulin-, histocompatibility receptor-signal sequence, etc) have been identified which may be used to direct the secretion of heterologous recombinant proteins. Despite similarities, these sequences are not optimal for promoting efficient secretion of some proteins that are difficult to express, because the native signal peptide may not function correctly out of the native context, or because of differences linked to the host cell or to the secretion process. The choice of an appropriate signal sequence for the efficient secretion of a heterologous protein may be further complicated by the interaction of sequences within the cleaved signal peptide with other parts of the mature protein (Johansson, Nilsson et al. 1993).
Certain human MARs, e.g., MAR 1-68, have been found to potently increase and stabilize gene expression in cultured cells as well as mice when inserted upstream of the promoter/enhancer sequences (Girod et al. 2007, Galbete et al. 2009).
An analysis of the effect of MARs and successive transfections on gene transfer and expression is shown in
The Figures show that co-transfection of a GFP expression vector and an antibiotic resistance plasmid, followed by antibiotic selection of cells having stably integrated the transgenes in their genome, typically yields a bimodal distribution of the fluorescence in polyclonal cell populations when analyzed by flow cytometry (
When the same GFP expression vector was co-transfected two weeks later with a distinct antibiotic resistance gene, a 2.4-fold increase of fluorescence was observed on average after selection for resistance to the second antibiotic, which is close to the expected 2-fold increase (
Overall, the expression levels obtained from the two consecutive (a first and a subsequent) transfections of MAR-containing plasmids were so high that the GFP fluorescence could be readily seen from the cell culture monolayers in the daylight, without UV irradiation (
An important parameter driving high expression upon repeated transfection was found to be the time interval between the transfections. The synergistic effect on expression was not observed when re-transfecting cells after two weeks, when the two transfections behaved as two independent and thus additive events (
As timing between transfections seemed to play a role in high transgene expression, the effect of systematic variations of the time interval between transfections was analyzed. In the model cells, the highest GFP expression level was observed when the second transfection was performed 21 hours after the first one, yielding consistently a five-fold increase of fluorescence as compared to a single transfection.
The distribution of the cells along the division cycle was determined by propidium iodide staining of the DNA. This analysis indicated an over-representation of cells at the G1 phase 18 h after cell passaging, and this was found to correspond to the timing that yields the highest expression from a single transfection (
FISH analysis suggested that elevated expression upon successive transfections may result in part from the integration of a higher number of the transgene copies in the genome (
In
In
The results show that cells doubly transfected with MAR-GFP exhibited 3.8-fold more GFP transgene copies in their nuclei than cells transfected just once with MAR-GFP (
These conclusions were strengthened by confocal imaging of DNA transport, where plasmids used for the first transfection were labeled with rhodamine while the secondly transfected plasmids were labeled with Cy5 (dark (small dots) and white (small dots) labels respectively,
The transport of transfected plasmid DNA in CHO cells, which is known to comprise cellular uptake, lysosomal escape and nuclear import, is limited by endosomal/lysosomal degradation (Akita et al. 2007). Thus, the intracellular trafficking of transfected plasmid DNA was assessed by quantifying its distribution in cellular organelles and in the cytosol after each transfection, after specific staining of the endosomal/lysosomal and nuclear compartments to distinguish them from the cytosol. Results summarized in
Next, it was tested whether the increased transport of plasmid DNA elicited by the MAR and the consecutive transfections may increase transgene integration into the genome of CHO cells. Stable polyclonal cell populations were selected as for
Successive transfections also mediated a 4-fold increase of plasmid integration, which is commensurate to the increase in free extracellular episomes noted in transient transfections (
When assessing GFP expression and transgene copy number in individual cell clones isolated from the polyclonal populations, a good overall correlation was found between transgene expression and copy number (
As the high GFP fluorescence observed from successive transfections of MAR-containing plasmids results in part from the increased transgene integration at a single chromosomal locus, the molecular basis of this effect was assessed. For instance, the integration of a MAR-containing plasmid during the first transfection might promote secondary integration at the same genomic locus during the second transfection, as could be expected from the ability of the MAR to maintain chromatin in an accessible state and thus to provide proper targets for homologous recombination. Alternatively, the high number of integrated transgene copies observed from successive transfections may result from a more efficient concatemerization of the plasmids introduced during both transfections, as may be mediated by the high concentration of extrachromosomal episomes in the nucleus. Homologous recombination was proposed to mediate the formation of large concatemers of transfected plasmids (Folger et al. 1985), which may lead to the co-integration of multiple plasmid copies upon recombination with the genomic DNA. In the latter model, homologous recombination may occur between similar plasmid sequences on the plasmids used during the first and second transfections, and thus the efficacy of transgene integration and expression should depend on DNA sequence homologies.
This latter possibility was first assessed by analyzing the effect of plasmid homology on transgene expression by performing successive transfections with different combinations of transgenes (GFP or DsRed), plasmid backbones (ampicillin or kanamycin bacterial resistance) and/or MARs (chicken lysozyme MAR or the human MAR 1-68).
The results show that transfection of distinct MARs, transgenes, or bacterial resistance all decreased the high expression normally observed with successive transfections (
Homologous recombination is often elicited as a DNA repair mechanism of double-stranded breaks, in a process that was termed Homologous Recombination Repair (HRR, ADD REF). Thus, it was tested whether plasmid linearization prior to transfection mediates the high expression obtained from successive transfections.
A more than additive increase of transgene expression was also observed with circular plasmids, however, the overall expression was lower than that obtained using linear plasmids (
The requirement of plasmid homology and double-strand breaks to achieve the higher expression levels upon the double transfection implies that homologous recombination may be involved. Transgenes were proposed to integrate into the cell genome using two families of antagonistic pathways, termed non-homologous end-joining (NHEJ) or homologous recombination (HR). These pathways are more active during specific phases of the cell cycle, as exemplified by HR, which is used to repair DNA damages during or after DNA replication in the S and G2/M phases of the cell cycle (Takata et al. 1998). Cells lacking classical NHEJ genes show a double-stranded break (DSB) repair biased in favour of HR, suggesting that these two major pathways normally compete to repair these DNA lesions (Delacote et al. 2002). Thus, one way to activate HR is to suppress or genetically inactivate NHEJ, as seen in yeast and mammalian cells (Delacote et al. 2002, Clikeman et al. 2001, Allen et al. 2002, Pierce et al. 2001). A possible implication of HR-related mechanisms in the increased transgene expression that results from the MAR and/or successive transfections was thus directly assessed using CHO cell lines mutated in a key component of either pathways, and which are thus only competent for either HR or NHEJ.
The 51D1 CHO mutant derivative lacks the RAD51 strand transferase and is thus deficient in homologous recombination, while V3.3 CHO cells lack the catalytic activity of DNA-dependent protein kinase DNA-PK that plays an essential role to initiate the NHEJ pathway (Jackson 1997, Hinz et al. 2006, Jeggo 1997). A 3-fold increase of the overall GFP fluorescence was mediated by the MAR in a polyclonal population of wild-type parental cell lines (AA8), as compared to cells stably transfected without the MAR (
Similar trends were noted for successive transfections, in that GFP expression from V3.3 cells was increased both by the presence of the MAR and by the successive transfections as compared to parental AA8 cells (
These results clarify the significance of the HR pathway in the integration and maintenance of the two selections genes used in the successive gene transfer process.
As can be seen in the scheme shown in
First, bottlenecks or defects that may affect the expression and secretion of IgG heavy and light chain by CHO cell clones that display high or low Mab production levels we studied.
Various clones of CHO-K1 S expressing different recombinant IgGs were generated.
As can be seen from
The intracellular heavy and light chains (HC and LC) expressed by each clone were analyzed in order to find a correlation between polypeptide biosynthesis and IgG secretion level of the different clones. Total cell extracts and secreted IgG immuno-precipitates produced by CHO-K1 S clones at steady state were resolved under reducing condition by SDS-PAGE. The protein migration profiles revealed the expected 50 kDa and 25 kDa bands of the HC and LC of high IgG-producer clones 12B, 16D and S29, respectively. However, the light chain expressed by the low IgG-producers C24 and C58 migrated at an abnormally high apparent molecular weight (
To assess the biochemical nature of the anomalous LC, we extracted the intracellular HC and LC content in PBS solution containing 1% triton X-100 (Tx) and separated the Tx-soluble from the Tx-insoluble proteins by centrifugation at 10.000×g for 10 minutes. After complete protein solubilization in SDS-containing Laemmli's buffer supplemented with urea 9 M, the fractions were resolved by reducing SDS-PAGE. The LC and HC of the high IgG-producer clones were detected only into the Tx-soluble fraction as expected (
Cycloheximide-based chase assays were then performed to investigate the IgG folding and assembly kinetic as well as the fate of the IgG aggregates in the CHO cell clones. SDS-PAGE analysis of the high-producer clone under non reducing condition revealed an accumulation of free LC species and the formation of HC and LC dimers. The HC-containing species appeared to decrease progressively with a concomitant incorporation into HC-LC complexes and in completed IgG tetramers (
These results prompted the following hypotheses: (1) the ER folding machinery and secretion capacity of the high IgG-producers are close to saturation by the large biosynthesis and accumulation of H— and LC, but that the cells could nevertheless proceed with the assembly of normally structured Mab; (2) the accumulation of assembly-incompetent LC aggregates produced by the low IgG-producers explained a secretion defect of these clones; and (3) the potential lack of LC signal peptide cleavage and concomitant aggregation of the LC in low-IgG producers, which might indicate a default of the co-translational translocation of the polypeptide in the ER.
To assess a potential malfunctioning of the ER in the low producer clones, the expression of different sensors of the ER protein folding and stress responses were investigated. Over-expression of recombinant proteins beyond the folding capacity of the ER has been shown to trigger a set of cellular responses collectively called the Unfolded-Proteins-Response (UPR). Although these cellular mechanisms may act to improve the ER folding capacity, to reduce ER stress and to restore ER functionality, they can also reduce the yield of recombinant proteins (Khan S U et al, 2008; Kang S—W et al, 2006). For instance, the activation of ERAD (ER-associated degradation) gene expression upon UPR can target unfolded or misassembled ER-retained recombinant proteins to degradation pathways. Moreover, in the case of severe ER stress, cells that are not able to adapt their protein secretion machineries may trigger the apoptosis pathway.
To assess if LC misprocessing and/or the over-expression of recombinant immunoglobulin chains may induce ER stress and/or UPR, low and high producer clones were cultivated for 7 days and analyzed at various times along the culture procedure.
The Western blot demonstrated an increased expression of BiP, a sentinel marker of UPR activation, in the two low producer clones. In contrast, no increase of BiP level was detected for the high producer clone (
The expression level of the CHOP pro-apoptotic transcription factor, whose expression can be induced when the protein-folding bottleneck or misfolding cannot be resolved by UPR, was also analyzed. Both the low and high IgG-producer CHO clones exhibited over-expression of CHOP protein when compared to control cells that do not express the Mab (
These observations implied that a BiP-mediated UPR responses of the low producer clone resulted in the terminal phase of UPR and in the activation of apoptotic cell death programs. In contrast, the high producer clones did not trigger BiP-mediated UPR response, although a CHOP-mediated pro-apoptotic response was induced in these clones. This suggested that the abnormal and huge over-expression of the recombinant Mab may have initiated the cell death programs independently of the main ER stress sensor BiP.
It could also been shown that the different IgG-producer clones exhibited various folding and processing status of the recombinant IgG proteins and that distinct cellular and molecular responses of the host cell were induced during their expression and secretion. Therefore, these various low and high producer clones may both face limitations that may negatively affect industrial production of easy- or difficult-to-express recombinant proteins. We thus went on to use these high and low IgG-producers CHO clones as cellular models to identify novels means to improve recombinant IgG production using bioengineering approaches.
The lack of solubility of the LC in the low producer clones and its slow mobility suggested the presence of peptide signal, and it argued in favor of an inefficient targeting and/or misprocessing of LC pre-proteins to the ER compartment. Thus, it was possible that signal peptide misprocessing and aggregation of the IgG light chain of the recombinant IgG may results from improper targeting and/or translocation into the ER. Recent studies suggested that the bioengineering of the host cell lines to express ER stress related proteins such as BiP could improve secretion of heterologous protein (Peng and M. Fussenegger, 2009). However, this was not an option likely to succeed in our case as ER stress protein BiP was found to be already spontaneously upregulated in the low-producer clones.
Attempts to improve protein secretion by the over-expression of components of the protein translocation machinery have not been met with success in mammalian cell lines. For instance, SR14 expression beyond normal levels did not improve secretion efficiency from cultured human cells (Lakkaraju et al., 2008).
Irrespective of these results, attempts were made to enhance protein secretion by expressing proteins of —or related to— the Signal Recognition Particle (SRP), which is a multiprotein-RNA complex that binds affinity-signal peptide and mediates the docking of SRP-RNA-Ribosome complex onto the ER membrane. Specifically, (1) the human SRP14 subunit, (2) a dominant-negative mutant of the FADD (FAS-associated death domain) protein involved in the regulation of cell apoptosis were expressed, as well as (3) the unrelated GFP protein as a control.
Two clonal cell lines were used, one expressing a low yield monoclonal antibody (e.g. infliximab, a difficult-to-express protein) and one expressing a high yield MAb (e.g. trastuzumab, an easy-to-express protein) harbouring the same signal peptide, and 5.1×105 cells were re-transfected with 5 μg of plasmid encoding the indicated proteins by electroporation (MICROPORATOR, 1250V, 20 ms pulse time and 3 pulses). After microporation, the cells were added to SFM4CHO medium (HYCLONE) supplemented with 8 mM glutamine and 2×HT. Two days later, the cells were transferred in T75 plates at an appropriate dilution of the selection marker (300 μg/ml G418) and the cells were further cultured. After approximately two weeks, drug-resistant cells were expanded in shake flask and the SRP14-expressing populations were diluted for single-cell cloning in a limiting dilution process. Results presented below were generated with cell clones expressing the indicated proteins.
Firs, the Tx solubility of intracellular HC and LC was determined and the secretion level of the high and low IgG-producers clones expressing the SRP-related proteins.
In
Interestingly, the western blot analysis indicated that the over-expression of full length human SRP14 (Genebank access number X73459.1, which is incorporated herein by reference in its entirety) led to the conversion of the pro-LC into a species migrating like the normal LC mature form competent for folding and assembly with the HC, while the migration of HC was not affected (
To determine the consequence of exogenous expression of SRP14 on recombinant IgG titer, supernatant cell culture were then analyzed by ELISA to probe for properly assembled Mab. The over-expression of SRP14 in low IgG-producers lead to a significant increase in IgG secretion from the low producer clone (
The action of the exogenous SRP14 expression is unexpected. The expression may have caused an extended delay of the LC elongation in the difficult-to-produce IgG producer clones, given the function of this subunit in the elongation arrest mediated by SRP. Proper processing the Mabs of the low producer clones may require an unexpectedly long translational pausing, possibly because the kinetics of docking of the complex mediating the translocation of these particular IgGs onto the ER may be slower than that of other secreted proteins. Modulation of the translation kinetic by the exogenous SRP14 components could in return influence the co-translocation of the pro-LC in the ER and thus restore the efficient processing of the signal peptide.
The effect of another control protein, namely the FAS-associated protein with death domain (FADD), was also evaluated by expressing a dominant negative mutant of FADD (FADD-DN) (Newton, Harris et al. 1998). Unexpectedly, the over-expression of FADD-DN was also found to abolish LC aggregation, as found for SRP14 (
The good results obtained after the expression of SRP14 prompted the testing of the effect of other proteins that may contribute to proper translocation of nascent polypeptides in the ER. Other proteins of the Signal Recognition Particle (SRP), which is a multiprotein-RNA complex that binds affinity-signal peptide and mediates the docking of SRP-RNA-Ribosome complex onto the ER membrane, or proteins that relate to SRP function were also tested. Specifically, we expressed (1) the human SRP54 subunit, in an attempt to augment the signal sequence recognition, (2) the human SRP9 and/or SRP14 subunit, as these two polypeptides form a complex in vivo, to possibly slow down translation, (3) the human SRP receptor (SR) subunits α and β attempting to increase the capacity of the translocation machinery, and (4) the translocons Sec61 human subunits (Transl), to possibly improve translocation in the ER.
As can be seen from the figure, expression of SRP14 or SRP54 led to a strong increase in Mab secretion, whereas SR and Transl led to a smaller but still significant increase of secretion, while SRP9 alone did not significantly improve expression (
pGEGFPcontrol contains the SV40 early promoter, enhancer and vector backbone from pGL3 (PROMEGA) driving the expression of eGFP gene from pEGFP-N1 (CLONTECH). pPAG01SV40EGFP results from the insertion of the chicken lysozyme MAR fragment upstream of the SV40 early promoter of pGEGFPcontrol (Girod et al. 2005). The human MAR 1-68 was identified by the SMARScan program using DNA structural properties. It was cloned from human bacterial artificial chromosomes in pBluescript and then inserted into pGEGFPcontrol upstream the SV40 early promoter, resulting in the p1-68 (NcoI filled) SV40EGFP plasmid (Girod et al. 2007). pGL3-CMV-DsRed was created by inserting the DsRed gene, under the control of the CMV promoter (including the enhancer), from pCMV-DsRed (CLONTECH) in pGL3-basic (PROMEGA). pGL3-CMV-DsRed-kan was then created by exchanging the ampicillin gene of pGL3-CMV-DsRed for kanamycin resistance gene from pCMV-DsRed (CLONTECH) by digestion of both plasmids with BspHI. Then, the chicken lysozyme or the human 1-68 MAR were inserted into the pGL3-CMV-DsRed-kan plasmid. They were inserted as KpnI/BgIII fragment containing the chicken lysozyme fragment, or as KpnI/BamHI human 1-68MAR fragment, upstream of the CMV promoter in pGL3-CMV-DsRed-kan, resulting in pPAG01GL3-CMV-DsRed and p1-68(NcoI) filled GL3-CMV-DsRed, respectively.
The CHO DG44 cell line (Urlaub 1983) was cultivated in DMEM: F12 (GIBCO) supplemented with HT (GIBCO) and 10% foetal bovine serum (FBS, GIBCO). Parental CHO cells AA8, NHEJ deficient cells V3.3 and HR deficient cells 51D1 (Adayapalam et al., 2008) were kindly provided by Dr. Fabrizio Palitti and were cultivated in DMEM: F12 medium with 10% foetal bovine serum and antibiotics.
Transfections were performed with these cells using Lipofect-AMINE 2000, according to the manufacturer's instructions (INVITROGEN). GFP or DsRed fluorescence levels were analyzed using a fluorescence-activated cell sorter (FACS), one, two or three days post transfection (transient transfections). Stable pools of CHO-DG44 cells expressing GFP and/or DsRed were obtained by cotransfection of the resistance plasmid pSVpuro (CLONTECH). After two weeks of selection with 5 μg/ml puromycin for CHO-DG44 (8 μg/ml puromycin for AA8, V3.3 and 51D1), cells were analyzed by FACS. Multiple transfection were performed as follows: after first transfection, the cells were then transfected a second time as described above, except that the resistance plasmid carried another resistance gene, pSV2 neo (CLONTECH). The two transfections were timed to follow the cell cycle, unless otherwise indicated in the text. Twenty-four hours after the second transfection, cells were passaged and selected with 250 μg/ml G418 and/or 2.5 μg/ml puromycin (250 μg/ml G418 and 4 μg/ml puromycin for AA8, V3.3 and 5A1 D1). After three weeks of selection, GFP and/or DsRed expression was analyzed by FACS.
Transient expression of eGFP and DsRed proteins was quantified at 24 h, 48 h or 72 h after transfection using a FACScalibur flow cytometer (BECTON DICKINSON), whereas expression of stable cell pools was determined after at least 2 weeks of antibiotic selection. Cells were washed with PBS, harvested in trypsin-EDTA, pooled, and resuspended in serum-free synthetic ProCHO5 medium (CAMBREX corporation). Fluorescence analyses were acquired on the FACScalibur flow cytometer (BECTON DICKINSON) with the settings of 350V on the GFP channel (FL-1) and 450V on the DsRed channel (FL-3) for transient expression, whereas settings of 240V for FL-1 and 380V for FL-3 were used to analyze stable expression. 100′000 events were acquired for stable transfections and 10′000 for transient transfections. Data processing was performed using the WinMD software.
At the indicated times, the cell cycle status was analyzed by flow cytometry of CHO cells after staining of the DNA with propidium iodide (PI). Cells were first washed with a (PBS), trypsinized and harvested in 1 ml of growth media by centrifugation for 5 min at 1500 rpm in a microcentrifuge. After an additional PBS wash, cells were resuspended in 1 ml of PBS before fixing with ethanol by the addition of 500 μl of cold 70% ethanol dropwise to the cell suspension under agitation in a vortex. Samples were incubated for 30 minutes at −20° C. and cells were centrifuged as before. The resulting cell pellet was resuspended in 500 ml of cold PBS, supplemented with 50 μg/ml of RNaseA and DNA was stained with 40 μg/ml of PI for 30 minutes in the dark. Cells were then washed with PBS, centrifuged and resuspended in 500 μl of ProCHO5 medium (CAMBREX corporation) before analysis in a FACScalibur flow cytometer (FL-3 channel; BECTON DICKINSON). 10′000 events were acquired for each sample.
FISH (Fluorescent In Situ Hybridization) were performed as described in Derouazi et al. (2006) and Girod et al. (2007). Briefly, metaphase chromosomal spreads were obtained from cells transfected with or without the 1-68 human MAR and treated with colchicine. Fluorescence in situ hybridization was performed using hybridization probes prepared by the direct nick translation of pSV40GEGFP plasmid without the MAR.
Nuclei were isolated one, two or three days after transient transfection(s), from proliferating and confluent CHO DG44 cells grown in 6-well plates. 1×106 cells were washed twice with cold PBS, resuspended in 2 volumes of cold buffer A (10 mM HEPES (pH 7.5), 10 mM KCl, 1.5 mM Mg(OAc)2, 2 mM dithiothreitol) and allowed to swell on ice for 10 min. Cells were disrupted using a Dounce Homogeniser. The homogenate was centrifuged for 2 min at 2000 rpm at 4° C. The pellet of disrupted cells was then resuspended in 150 μl of PBS and deposited on a cushion of Buffer B (30% sucrose, 50 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 0.1 mM EDTA) and centrifuged for 9 min at 1200 g. The pellets of nuclei were resuspended in 200 μl of Buffer C (40% glycerol, 50 mM Tris-HCl (pH 8.3), 5 mM MgCl2, 0.1 mM EDTA) and stored frozen at −80° C. until required (Milligan et al. 2000).
Total cell DNA was isolated from CHO DG44 stable cell pools or from isolated cell nuclei using the DNeasy Tissue Kit from QIAGEN. For stable cell pools, 1×106 confluent CHO DG44 cells growing in 6-well plates were collected. DNA extraction was performed according to the manufacturer's instruction for the isolation of total DNA from cultured Animal cells. For isolated cell nuclei, frozen pellets of nuclei were first thawed and centrifuged at 300 g for 5 min to remove Buffer C before beginning DNA extraction following the same protocol as for stable cell lines.
To determine the copy number of transgenes integrated in the genome, approximately 6 ng of genomic DNA were analyzed by quantitative PCR using the SYBR Green-Taq polymerase kit from EUROGENTEC Inc. and ABI Prism 7700 PCR machine. The following primers were used to quantify GFP DNA: GFP-For: ACATTATGCCGGACAAAGCC and GFP-Rev: TTGTTTGGTAATGATCAGCAAGTTG, while primers GAPDH-For: CGACCCCTTCAT-TGACCTC and GAPDH-Rev: CTCCACGACATACTCAGCACC were used to amplify the GAPDH gene. The ratios of the GFP target gene copy number were calculated relative to that of the GAPDH reference gene as described previously (Karlen et al. 2007). To determine transgene import into nuclei after transfection, quantitative PCR was performed on DNA extracted from purified nuclei using the same GFP and GAPDH primer pairs as above.
The number of GAPDH gene and pseudogene copies used as reference was estimated for the mouse genome, as the CHO genome sequence is not available as yet. Alignment were performed by BLAST analysis performed using the NCBI software of the DNA sequence of the 190 bp amplicon generated by the GAPDH primers on the mouse genome, which gave a number of 88 hits per haploid genome. As the CHO DG44 are near-diploid cells (Derouazi et al. 2006), we estimate that 176 copies of the GAPDH genes and pseudogenes occur in the genome of CHO DG44 cells. This number was used as a normalization reference to determine the GFP transgene copy number.
pGEGFPcontrol and p1-68 (NcoI filled) SV40EGFP plasmids were labelled either with rhodamine by the Label IT Tracker TH-Rhodamine Kit or with Cy5 by the Label IT Tracker Cy 5 Kit (MIRUS, MIRUSBIO) according to the manufacturer's protocol, and purified by ethanol precipitation. For transfection, DNA transfection was carried out with the Lipofectamine 2000 Reagent (INVITROGEN) according to the supplier's instructions. At 3, 6 and 21 h after transfection, the medium was removed and the cells were fixed with 4% paraformaldehyde at room temperature for 15 min. When indicated, cells were treated for 30 min with LysoTracker™ Red DND-99 (Molecular Probes, INVITROGEN) at a final concentration of 75 nM before the fixation, to stain the acidic organelles (e.g., endosomes and lysosomes) according to the manufacturer's instructions. The fixed cells were then washed twice with PBS and mounted in a DAPI/Vectashied solution to stain the nuclei.
Fluorescence and bright-field images were captured using a CARL ZEISS LSM 510 Meta inverted confocal laser-scanning microscope, equipped with a 63×NA 1.4 planachromat objective. Z-series images were obtained from the bottom of the coverslip to the top of the cells. Each 8-bit TIFF image was transferred to the ImageJ software to quantify the total brightness and pixel area of each region of interest. For data analysis, the pixel areas of each cluster in the cytosol si(cyt), nucleus si(nuc) and lysosome si(lys) were separately summed in each XY plane. Theses values (S′Z=j(cyt), S′Z=j(nuc) and S′Z=j(lys), respectively) were further summed through all of Z series of images and denoted S(cyt), S(nuc) and S(lys), respectively. The total pixel area for the clusters of labelled pDNA in the cells, S(tot), was calculated as the sum of S(cyt), S(nuc) and S(lys). The fraction of pDNA in each compartment was calculated as F(k)=S(k)/S(tot), where represents each subcellular compartment (nucleus, cytosol or lysosome).
The expression vectors contain the bacterial beta-lactamase gene from Transposon Tn3 (AmpR), conferring ampicillin resistance, and the bacterial CoIE1 origin of replication. As derivatives of pGL3 Control (PROMEGA), the terminator region of the vector bears a SV40 enhancer positioned downstream the SV40 polyadenylation signal. A human gastrin terminator has been inserted between the SV40 polyA signal and the SV40 enhancer. Each vector also includes two human 1—68 SGE flanking the expression cassette and an integrated puromycin resistance gene under the control of the SV40 promoter. All the vectors encode the GOI under the control of the hGAPDH promoter (
The different cloned transgenes were amplified by PCR using the Pwo SuperYield DNA Polymerase Kit following the manufacturer's instructions (ROCHE), human universal cDNA as template (BioChain®) and specific primers (MICROSYNTH AG, Switzerland, see Table 1) for the 5′ and 3′ ends of the CDS with 5′ tails carrying a compatible restriction site for the cloning into the expression vector.
The PCR product and the expression vector were digested by the appropriate restriction enzymes (NEW ENGLAND BIOLABS or PROMEGA). The digested DNA were electrophoresed on a 1% w/v agarose (EUROBIO, CHEMIE BRUNSCHWEIG AG) gel. The vector band and the digested PCR product were cut out of the gel by visualization under preparative UV lamp that does not damage the DNA (UL-6L, VILBER LOURMAT), transferred into a 1.5 mL microtube and purified using standard techniques (WIZARD SV Gel and PCR CleanUp System™, PROMEGA) following the manufacturer's instructions.
Both purified fragments (the digested Selexis™ expression vector and PCR product) were ligated together using LigaFast™ Rapid DNA Ligation System (PROMEGA) in a final volume of 10 μL for 5 min at RT (=Room Temperature) following the manufacturer's instructions. The whole ligation mixture was used to transform 50 μL of competent DH5 alpha cells (INVITROGEN) following the manufacturer's instructions. The integrity and proper structure of the newly created plasmid was checked by restriction analysis. One bacterial clone was expanded in 5 mL of LB+100 μg/mL ampicillin in shake tube for bulk extraction of plasmid DNA. The plasmid was extracted using WIZARD Plus SV Minipreps kit (PROMEGA) following the manufacturer's instructions. The integrity of the plasmid was confirmed by sequencing the GOI and associated flanking sequences.
Upon confirmation, a maxipreparation of the vector was done with a standard DNA isolation kit (JETSTAR 2.0, GENOMED) from a 150 mL overnight culture in LB supplemented with 100 μg/mL ampicillin to obtain very pure plasmid DNA. After purification the DNA was resuspended in 300 μL sterile deionized water. Linearization was performed by Pvul digestion and DNA quantification was conducted using Quant-iT PicoGreen dsDNA assay kit (INVITROGEN/Molecular Probes).
CHO cells were passaged one day prior to transfection at a density of 300,000 cell/ml. On the day of transfection, the cells were counted and 510,000 cells were harvested by centrifugation. The supernatant was removed and the cell pellet was resuspended in 30 ul of resuspension buffer (Buffer R, INVITROGEN). Four micrograms of linearized plasmid encoding one protein to be tested was added to the cells and the cells were electroporated using the Microporator-mini device from DIGITAL BIO TECHNOLOGY. The settings used for electroporation were 1230 volts, 20 us and 3 pulses.
The electroporated cells were cultured in 6 well plate containing 3 ml of culture medium (SFM4CHO, Hyclone™) supplemented with 8 mM glutamine and 2×HT. One day post-transfection, the selection of stable transfectants was started by adding 500 μg/ml of G418 to the medium. At day three of culture, the cells were harvested by centrifugation and the medium was renewed with 10 ml of fresh culture medium supplemented with antibiotics. After a week, 1.5×106 cells were transferred into a 50 ml minireactor tube (TBS) containing 5 ml of culture medium supplemented with antibiotics and incubated in a shaking incubator. The culture was maintained by passaging twice a weak. At the time of sub-cultivation, the number of cells was recorded and the concentration of the product was determined by ELISA. Those numbers were used to calculate the specific productivity in order to compare the effect of the different protein tested.
Although the invention is illustrated and described in detail on the basis of the Figures and the corresponding description, this illustration and this detailed description are to be understood to be illustrative and exemplary and not as restricting the invention. It is self-evident that a person skilled in the art can make changes and adaptations without leaving the scope of the following claims. In particular, the invention also comprises embodiments with any combination of features which are mentioned herein in connection with different embodiments.
This application claims the benefit of U.S. provisional application No. 61/243,950, filed Sep. 18, 2009, which is incorporated herein by reference in its entirety.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/IB10/02337 | 9/20/2010 | WO | 00 | 6/4/2012 |
| Number | Date | Country | |
|---|---|---|---|
| 61243950 | Sep 2009 | US |
