Patent Grant
11898183
The present disclosure broadly relates to the field of genetically engineered microorganisms, and in particular the present disclosure discloses genetically engineered microorganisms capable of producing podophyllotoxin, and/or derivatives, and/or precursors thereof.
Disease or disorders are treated at present by either surgical or non-surgical methods. Non-surgical methods include administering a therapy that could be either or a combination of chemical, biological or physical methods, given to the patient via various possible delivery routes as applicable for the disease and as found suitable by a qualified physician.
Many of these methods have short-comings, especially while treating terminally ill patients. This is due to the difficulty in managing the right dosages given to the patient. Many drug compounds are known to exert adverse effects on the patient, ranging from mild to severe, amplified by dosages over a prolonged period of drug intake while treating the disease.
Targeted therapies using innovative drug delivery systems mitigate the adverse reaction by precise delivery of dosages to the target site and organ and by reducing the dosages in the circulatory system. One such method includes treating a disease using immunotherapy.
One of the major limitations of immunotherapies is the limited number of responders to such therapies. In some terminal diseases, there are only one in five patients who responds positively to the immunotherapy. This is postulated due to variations of several factors, some of which are difficult to enumerate and have a complex association with an ecosystem as a whole.
Other innovative therapies such as gene therapy and cell therapy continue to be promising, but their lacunae include scalability and reproducibility in results. In some cases, patients have also developed severe side effects.
Few other physical targeted therapies, such as the use of electromagnetic pulse waves are futuristic at this point, leaving a huge unmet need in treating patients by minimizing adverse effects.
Therefore, studies focussing on different techniques for targeted drug delivery for treating diseases are the need of the hour.
In an aspect of the present disclosure, there is provided a recombinant microbe producing podophyllotoxin, or its derivatives, comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate (C4H), 4-coumaroyl CoA-ligase (4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT), p-coumaroyl quinate 3′-hydroxylase (C3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), cytochrome P450 oxidoreductase CYP719, O-methyltransferase (OMT), cytochrome P450 oxidoreductase CYP71, and 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD).
In another aspect of the present disclosure, there is provided a method for producing podophyllotoxin or its derivatives, said method comprising: (a) obtaining the recombinant microbe as described herein; and (b) culturing the recombinant microbe in a medium under suitable conditions for producing podophyllotoxin or its derivatives.
In another aspect of the present disclosure, there is provided a recombinant microbe producing etoposide, or its derivatives, comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate (C4H), 4-coumaroyl CoA-ligase (4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT), p-coumaroyl quinate 3′-hydroxylase (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), cytochrome P450 oxidoreductase CYP719, O-methyltransferase (OMT), cytochrome P450 oxidoreductase CYP71, 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), cytochrome P450 oxidoreductase CYP82D, UDP glucosyl transferase, and 2-Deoxy-d-ribose-5-phosphate aldolase.
In another aspect of the present disclosure, there is provided a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives.
In another aspect of the present disclosure, there is provided a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of at least one regulatory circuit.
In another aspect of the present disclosure, there is provided a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of a hypoxia-responsive regulatory circuit.
In another aspect of the present disclosure, there is provided a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of a nitric oxide-responsive regulatory circuit.
In another aspect of the present disclosure, there is provided a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of an arabinose-responsive regulatory circuit.
In another aspect of the present disclosure, there is provided method for treating cancer in a subject, said method comprising: administering a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of a hypoxia-responsive regulatory circuit, to a subject, wherein the expression of genes is induced by hypoxic conditions to enable the recombinant microbe to secrete etoposide, or its derivatives for treating cancer in the subject.
In another aspect of the present disclosure, there is provided a method for treating cancer in a subject, said method comprising: administering a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of a nitric oxide-responsive regulatory circuit, to a subject, wherein the expression of genes is induced by the presence of nitric oxide to enable the recombinant microbe to secrete etoposide, or its derivatives for treating cancer in the subject.
In another aspect of the present disclosure, there is provided a method for treating cancer in a subject, said method comprising: administering a recombinant microbe comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate 4-coumaroyl CoA-ligase fusion (C4H4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase p-coumaroyl quinate 3′-hydroxylase fusion (HCTC3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, and a protein transporter, wherein the recombinant microbe secretes etoposide, or its derivatives, and wherein the expression of the genes is under the control of an arabinose-responsive regulatory circuit, to a subject, wherein the expression of genes is induced by the presence of arabinose to enable the recombinant microbe to secrete etoposide, or its derivatives for treating cancer in the subject
In another aspect of the present disclosure, there is provided a composition comprising: (a) the recombinant microbe as described herein; and (b) at least one pharmaceutically acceptable carrier.
In another aspect of the present disclosure, there is provided a method for treating cancer, said method comprising: administering the composition as described herein to a subject for treating cancer.
These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.
Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.
For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.
The articles “a”, “an” and “the” are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.
The terms “comprise” and “comprising” are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as “consists of only”.
Throughout this specification, unless the context requires otherwise the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.
The term “including” is used to mean “including but not limited to”. “Including” and “including but not limited to” are used interchangeably. The term “recombinant” refers to the microbe which is constructed artificially, and such a microbe does not occur in nature. The term “programmed microbe” refers to the microbe which is recombinantly constructed or programmed to fulfil a specific purpose. The term “derivatives” refers to any derivative of the molecule disclosed in the present disclosure. The term “precursor” refers to any molecule that is produced earlier in the pathway as compared to the final product. The term “pharmaceutically acceptable carrier” refers to carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered bacterial or viral compound.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.
As discussed in the background section, the main problems that are faced with the current treatment modalities for cancer are: (a) lack of targeted therapies; and (b) use of higher dosage of the drug leading to adverse effects. In order to solve the problems existing in the art, the present disclosure discloses recombinant microbe which is used for producing podophyllotoxin or its derivatives like etoposide, Further, the recombinant microbes as disclosed herein are used for treating cancer. As per one of the implementations, the recombinant microbe is administered to a subject such that the microbe lodges itself near the affected area. Post administration, the microorganism is designed to produce the drug compound at the intended site of action within the human lungs. This is expected to bring down the circulating dosage of the drug to considerably low level to mitigate adverse effects of the drug.
Recombinant Microbes and the Genes for Construction of the Same
In an implementation of the present disclosure, there is provided a recombinant microbe for producing podophyllotoxin, or its derivatives, comprising genes encoding phenyl alanine ammonia-lyase (PAL), cinnamate-4-hydroxylate (C4H), 4-coumaroyl CoA-ligase (4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT), p-coumaroyl quinate 3′-hydroxylase (C3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), cytochrome P450 oxidoreductase CYP719, O-methyltransferase (OMT), cytochrome P450 oxidoreductase CYP71, and 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), wherein the derivative produced is deoxypodophyllotoxin. It is further disclosed that the recombinant microbe further comprising gene encoding cytochrome P450 oxidoreductase CYP82D produces desmethylepipodophyllotoxin. In another implementation, the recombinant microbe further comprising gene encoding UDP glucosyl transferase produces desmethylepipodophyllotoxin glucopyranoside. In yet another implementation, the recombinant microbe further comprising gene encoding 2-Deoxy-d-ribose-5-phosphate aldolase produces etoposide.
In another implementation of the present disclosure, two or more genes are fused together to encode the respective fusion proteins. As per one implementation the genes encoding cinnamate-4-hydroxylate (C4H) and 4-coumaroyl CoA-ligase (4CL) are fused, and wherein the genes encoding hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT) and p-coumaroyl quinate 3′-hydroxylase (C3H) are fused to encode the fusion proteins. It can be contemplated that genes as described herein if amenable to fusion can be fused to obtain the recombinant microbe of the present disclosure. As per an implementation, the genes are fused using a flexible linker—GGGGSGGGGSGGGGS. Other linkers can also be used in order to perform the fusion of the genes.
In another implementation of the present disclosure, the genes are separated by a ribosome binding sequence (RBS) in order to obtain enhanced translation efficiency.
The RBS can have a nucleic acid sequence as set forth in SEQ ID NO: 61 (TCTTAATCATGCACAGGAGACTTTCTA) or the nucleic acid sequence as set forth in SEQ ID NO: 62 (AAGTTCACTTAAAAAGGAGAGATCAACA). Further, a person skilled in the art can use any other well-known RBS sequences in order to increase the translation efficiency.
As per an implementation, the genes encoding: PAL having an amino acid sequence as set forth in SEQ ID NO: 2, C4H4CL having an amino acid sequence as set forth in SEQ ID NO: 12, HCTC3H having an amino acid sequence as set forth in SEQ ID NO: 14, CCoAOMT having an amino acid sequence as set forth in SEQ ID NO: 18, DIRPLR having an amino acid sequence as set forth in SEQ ID NO: 20, SDH having an amino acid sequence as set forth in SEQ ID NO: 22, and CYP719 having an amino acid sequence as set forth in SEQ ID NO: 26 were assembled in pRSF vector. The next six genes of the pathway were selected as follows: the genes encoding OMT having an amino acid sequence as set forth in SEQ ID NO: 30, CYP71 having an amino acid sequence as set forth in SEQ ID NO: 32, 2-ODD having an amino acid sequence as set forth in SEQ ID NO: 36, CYP82D having an amino acid sequence as set forth in SEQ ID NO: 40, UGT having an amino acid sequence as set forth in SEQ ID NO: 46, DERA having an amino acid sequence as set forth in SEQ ID NO: 50 were assembled in p15A vector.
As per an implementation, there is provided a recombinant vector comprising at least one nucleic acid fragment encoding phenyl alanine ammonia-lyase (PAL), Cinnamate-4-hydroxylate (C4H), 4-coumaroyl CoA-ligase (4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT), p-coumaroyl quinate 3′-hydroxylase (C3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, and UDP glucosyl transferase, at least one gene encoding a protein transporter selected from the group consisting of ATP-Binding Cassette (ABC) transporter, Major Facilitator Superfamily (MFS) transporters, SMR (small multidrug resistant) family, RND (Resistance-Nodulation-Cell Division) family, and the MATE (multidrug and toxic compound extrusion) family, and at least one regulatory circuit selected from the group consisting of nitric oxide (NO) operon, arabinose (AraC) operon, fumarate and nitrate reductase (FNR) operon, thiosulphate-responsive regulatory circuit, and tetrathionate-responsive regulatory circuit. Also, there is provided a method for obtaining recombinant vector as described herein, said method comprises method comprising: (a) obtaining one or more recombinant vector, said recombinant vector encoding a repertoire of genes encoding phenyl alanine ammonia-lyase (PAL), Cinnamate-4-hydroxylate (C4H), 4-coumaroyl CoA-ligase (4CL), hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT), p-coumaroyl quinate 3′-hydroxylase (C3H), caffeoyl CoA O-methyltransferase (CCoAOMT), bifunctional pinoresinol-lariciresinol reductase (DIRPLR), secoisolariciresinol dehydrogenase (SDH), O-methyltransferase (OMT), 2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD), 2-Deoxy-d-ribose-5-phosphate aldolase, Cytochrome P450 oxidoreductase CYP719, Cytochrome P450 oxidoreductase CYP71, Cytochrome P450 oxidoreductase CYP82D, UDP glucosyl transferase, at least one gene encoding a protein transporter selected from the group consisting of ATP-Binding Cassette (ABC) transporter, Major Facilitator Superfamily (MFS) transporters, SMR (small multidrug resistant) family, RND (Resistance-Nodulation-Cell Division) family, and the MATE (multidrug and toxic compound extrusion) family, and at least one regulatory circuit selected from the group consisting of nitric oxide (NO) operon, arabinose (AraC) operon, fumarate and nitrate reductase (FNR) operon, thiosulphate-responsive regulatory circuit, and tetrathionate-responsive regulatory circuit; and (b) transforming a host microbe with the recombinant vector obtained in step (a), to obtain the recombinant microbe.
Microbe as Per the Present Disclosure
In an implementation of the present disclosure, the recombinant microbe refers to any microbe as per the requirement. As per one implementation, the microbe is a bacterium including, but not limited to the genus Escherichia, Bacillus, Bacteroides, Bifidobacterium, Brevibacteria, Clostridium, Enterococcus, Lactobacillus, Lactococcus, Saccharomyces, Staphylococcus, Klebsiella, Citrobacter, Pseudobutyrivibrio, and Ruminococcus. The bacterium can be a species including, but not limited to Escherichia coli, Bacillus coagulans, Bacillus subtilis, Bacteroides fragilis, Bacteroides subtilis, Bacteroides thetaiotaomicron, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium lactis, Bifidobacterium longum, Clostridium butyricum, Enterococcus faecium, Lactobacillus acidophilus, Lactobacillus bulgaricus, Lactobacillus casei, Lactobacillus johnsonii, Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus, Lactococcus lactis, Firmicutes (including species of Eubacterium), Roseburia, Faecalibacterium, Enterobacter, Faecalibacterium prausnitzii, Clostridium difficile, Subdoligranulum, Clostridium sporogenes, Campylobacter jejuni, Clostridium saccharolyticum.
As per another implementation, the recombinant microbe can be any one selected from commensal bacteria.
As per another implementation, the microbe is E. coli Nissle 1917 strain. The genetically engineered bacteria are Escherichia coli strain Nissle 1917 (E. coli Nissle), a Gram-negative bacterium of the Enterobacteriaceae family that has evolved into one of the best characterized probiotics (Ukena et al., 2007). The strain is characterized by its complete harmlessness (Schultz, 2008), and has GRAS (generally recognized as safe) status (Reister et al., 2014, emphasis added). Genomic sequencing confirmed that E. coli Nissle lacks prominent virulence factors (e.g., E. coli a-hemolysin, P-fimbrial adhesins) (Schultz, 2008). In addition, it has been shown that E. coli Nissle does not carry pathogenic adhesion factors, does not produce any enterotoxins or cytotoxins, is not invasive, and is not uropathogenic. (Sonnenborn et al., 2009). As early as in 1917, E. coli Nissle was packaged into medicinal capsules, called Mutaflor, for therapeutic use. E. coli Nissle has since been used to treat ulcerative colitis in humans in vivo (Rembacken et al., 1999), to treat inflammatory bowel disease, Crohn's disease, and pouchitis in humans in vivo (Schultz, 2008), and to inhibit enteroinvasive Salmonella, Legionella, Yersinia, and Shigella in vitro (Altenhoefer et al., 2004). It is commonly accepted that E. coli Nissle's therapeutic efficacy and safety have convincingly been proven (Ukena et al., 2007).
E. coli Nissle 1917 was isolated in 1917 by the German physician Alfred Nissle from the stool of a German soldier who, unlike his comrades, survived an outbreak of enterocolitis. This strain is widely used as a probiotic, produced under the trade name of Mutoflor™, to treat intestinal disorders including diarrhoea, irritable bowel disease, ulcerative colitis and Crohn's disease (Altenhoefer et al., 2004; Lodinova-Zadnikova et al., 1997; Rembacken et al., 1999). E. coli Nissle 1917 is furthermore of interest due to its specific ability to grow in tumours. Bacteriolytic tumor-therapy was first described in the 1950s (Parker et al., 1947; Malmgren and Flanigan, 1955), based on the fact that some types of anaerobic bacteria can selectively propagate in tumours but not in other organs. These bacterial strains include Bifidobacterium (Yi et al., 2005), Clostridia species (Agrawal et al., 2004), Corynebacterium parvum (Fisher et al., 1990), Salmonella typhimurium (Zhao et al., 2005, 2006), Salmonella choleraesuis (Lee et al., 2004, 2005a,b) and Bordetella pertussis (Pawelek, 2005). Most anticancer drugs are delivered into patients orally or somatically, which results in prolonged side-effects. Therefore, it will be greatly advantageous to specifically deliver anticancer drugs into tumours to increase the effect of the drugs on the tumour and to reduce side-effects on other organs. Many trials have been performed to express anticancer peptides and RNAi in the bacterial strains selectively growing in tumours (Jia et al. 2005; Dang et al. 2001; Loeffler et al. 2007). However, so far, no work has been performed using these strains to express anticancer drugs like podophyllotoxin derivatives such as etoposide. E. coli in general is extremely easy to culture and is highly amenable to experimentation and manipulation. E. coli Nissle 1917 is particularly useful due to its non-pathogenic nature and its ability to specifically grow in tumours. Therefore, Escherichia coli Nissle 1917 is a particularly suitable heterologous host for the expression of genes capable of etoposide biosynthesis, according to the present invention.
Etoposide pathway may be integrated into the bacterial chromosome at one or more integration sites. For example, one or more copies of the gene cassette may be integrated into the bacterial chromosome. Having multiple copies of the gene cassette integrated into the chromosome allows for greater production of the Etoposide and also permits fine-tuning of the level of expression. As per one implementation, exemplary integration sites within the E. coli 1917 Nissle chromosome are NupG, AslB, AraC, LacZ, dapA, Cea, YfeD, ThyA, malP, GalK, GTP. One skilled in the art can identify other safe harbour sites where the genes can be integrated without interfering with expression of essential genes.
Transporter Proteins to Enable Secretion of Podophyllotoxin or its Derivatives Outside the Recombinant Microbe
In an implementation of the present disclosure, apart from the genes encoding the enzymes for podophyllotoxin pathway, the recombinant microbe further comprises at least one gene encoding a protein transporter. The protein transporter is selected from the group consisting of ATP-Binding Cassette (ABC) transporter, Major Facilitator Superfamily (MFS) transporters, SMR (small multidrug resistant) family, RND (Resistance-Nodulation-Cell Division) family, and the MATE (multidrug and toxic compound extrusion) family. The protein transporter as disclosed herein is capable of secreting the end product outside the cell. Typically, ABC family transporters are multicomponent primary active transporters, capable of transporting molecules in response to ATP hydrolysis. Non-limiting examples of endogenous ABC transporter genes include the genes at the loci PDRS, PDR10, PDR15, SNQ2, YOR1, YOL075c and PDR18 (or a functional homolog thereof). The Major Facilitator Superfamily (MFS) transporters are polypeptides that can transport small solutes in response to chemiosmotic ion gradients. Saier, Jr. et al., J. Mol. Microbiol. Biotechnol. 1:257-279 (1999). The MFS transporter family is sometimes referred to as the uniporter-symporter-antiporter family. MFS transporters function, inter alia, in sugar uptake and drug efflux systems. MFS transporters typically contain conserved MFS-specific motifs. Non-limiting examples of endogenous MFS transporter genes include the genes at the TPO1, TPO3, and FLR1 loci (or a functional homolog thereof).
Other transporter families include the SMR (small multidrug resistant) family, RND (Resistance-Nodulation-Cell Division) family, and the MATE (multidrug and toxic compound extrusion) family. The SMR family members are integral membrane proteins characterized by four alpha-helical transmembrane strands that confer resistance to a broad range of antiseptics, lipophilic quaternary ammonium compounds (QAC), and aminoglycoside resistance in bacteria. See, Bay and Turner, BMC Evol Biol., 9: 140 (2009).
As per an implementation, the ABC transporter genes encoding proteins having an amino acid sequence selected from the group consisting of SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 56, and SEQ ID NO: 58 can be used for constructing the recombinant microbe as disclosed herein.
Regulatory Circuits for Controlling the Expression of Genes of Podophyllotoxin Pathway
Transcriptional repressors and activators bind to operator sequences in DNA and respectively inhibit and enhance the transcription of genes by RNA polymerase, thus increasing or decreasing output signal flux. The transcription rate can be controlled by varying the concentration of regulator. For example, in addition to classical examples of inducible promoters controlled by regulators that bind to metabolites (e.g. LacI, AraC), signalling molecules (e.g. LuxR), and metal ions (e.g. ArsR), more recent CRISPR (clustered regularly interspaced short palindromic repeats)-based tools which require binding of guide RNA (gRNA) sequences have been developed (Qi et al, 2013, Kiani et al, 2014). Nuclease inactive Cas9 protein can function as a repressor that works by steric hindrance of RNAP at the promoter, or Cas9 can also be fused with other repressors or activators. Synthetic promoters and genes can be designed to contain multiple different regulator binding sites in order to increase the number of inputs that control the transcriptional output (Stanton et al, 2013). Recently, the interlinked relationship between the microbiome and pH of the niches they occupy have been under investigation in regard to conditions such as acne and bacterial vaginosis. In order to provide some growth or survival advantage in acidic conditions, the PcadC region of the cadBA operon in E. coli activates transcription under external acidic pH and in the presence of lysine. Using b-galactosidase assays, it was shown that PcadC could significantly increase expression when the pH was decreased from 7.6 to 5.4. A system like this could be used to design a biosensor circuit to only activate in predetermined locations or to detect dysbiotic pH at microbial niches. Propionate inducible system (pPro) was identified and characterised from the prpBCDE operons of E. coli and Salmonella enterica. It was shown that after intake into the cell, propionate is activated to propionyl-CoA by prpE-encoded propionyl-CoA synthetase. the prpR transcriptional activator gene, the PprpB promoter region can be used to create the pPro inducible expression system as sensing circuit (Lee and Keasling, 2005).
In an implementation of the present disclosure, the recombinant microbe as described herein further comprises at least one regulatory circuit selected from the group consisting of nitric oxide (NO) operon, arabinose (AraC) operon, fumarate and nitrate reductase (FNR) operon, thiosulphate-responsive regulatory circuit, and tetrathionate-responsive regulatory circuit. The presence of a regulatory circuit is important to control the expression of the genes responsible for the synthesis of podophyllotoxin or its derivatives.
Once the recombinant microbe is administered to a subject in need thereof, the expression of the genes can be controlled. As per one implementation, to create inducible systems for use in E. coli Nissle 1917, parts from a large repertoire of systems that govern carbohydrate utilization are used, which include cytoplasmic transcription factors, extracytoplasmic function sigma/anti-sigma pairs, and hybrid two-component systems (HTCS), among others. In E. coli nissle, arabinose and rhamnose metabolism is mediated by the AraC/Xy1S-family transcriptional activator, RhaR, which activates transcription at the Pbad promoter. The AraC operon can be cloned upstream of the genes responsible for synthesis of podophyllotoxin or its derivatives in such a manner that on providing arabinose or rhamnose, the genes could be induced and the absence of arabinose or rhamnose would ensure that the genes are not expressed.
Nitric oxide is a natural marker of inflammation in lung cancer, making it an ideal input signal for this engineered microorganism. Inflamed lung epithelial cells produce nitric oxide by up-regulating inducible nitric oxide synthase (iNOS), an enzyme that produces nitric oxide from L-arginine. Therefore, as per another implementation, nitric oxide sensing can be combined through NorR regulatory unit with podophyllotoxins pathway biosynthesis genes. The recombinant microbes harboring the genes controlled by NorR circuitry would ensure the secretion of podophyllotoxin or its derivatives in the presence of nitric oxide and would limit unnecessary production of the compound.
Since hypoxia is a prevalent condition in the tumour microenvironment, the recombinant microbe can also be engineered with an FNR regulatory operon. Under oxygen rich conditions binding of the transcription factor FNR to the hypoxia-inducible promoter will be impeded, leading to repressed expression of the downstream gene. In tumor microenvironment with relatively low levels of oxygen the FNR transcription factor can bind to the promoter, leading to the expression of the downstream gene.
Treatment Modalities with the Recombinant E. coli Nissle Capable of Producing Etoposide
As per one implementation of the present disclosure, there is provided a recombinant microbe capable of treating cancer. The recombinant microbe is capable of producing podophyllotoxin, or its precursor, or its derivatives. In another aspect, the recombinant microbe is E. coli Nissle 1917 genetically engineered to produce etoposide which can be used for treating cancer in a subject. The recombinant microbe is capable of targeting cancer cells. The targeting can be done by low oxygen condition such as hypoxic environment prevalent among cancerous cells.
As per another implementation, the recombinant microbe is capable of producing one or more anti-cancer molecule, and said anti-cancer molecule can be any derivative, or precursor of podophyllotoxin or any molecule from the podophyllotoxin pathway. The recombinant microbe can be administered locally at the site of tumour (intratumoral administration). The recombinant microbe can be administered orally through aerosol formulation, such a route of administration will provide the opportunity for the recombinant bacteria to lodge in the lung and produce the anti-cancer molecules for treating lung cancer. In order to ensure targeted production of etoposide, or podophyllotoxin derivative (anti-cancer molecule), the recombinant microbe can be cloned under a regulatory circuit such that the production of the anti-cancer molecules can be restricted to the presence of the relevant inducer. The inducer can be hypoxic conditions, or the presence of nitric oxide which are the hallmarks of the conditions prevalent in cancerous cells such that the production of the anti-cancer molecule takes place only in the niche of cancerous cells.
In another implementation, the inducer can also be provided externally in form of arabinose for inducing production of the anti-cancer molecule, the genes for which are cloned under the control of AraC regulatory operon.
In one another implementation, the treatment regime can be decided based on the survival of the recombinant microbe inside the human subject. A fresh dose of the recombinant microbe can be provided at a pre-decided interval of a few days to few weeks to few months depending on the requirement of the anti-cancer molecule and the stage of the tumour. The formulation for oral administration can be prepared as per the technique well known in the art. The dosage of the recombinant microbe can be adjusted based on the requirement of the anti-cancer molecule and the type and stage of the tumour. The administration technique can be adjusted as per the requirement.
In some implementations, the treatment regimen can include one or more intratumoral administrations. In some implementations, a treatment regimen can include an initial dose, followed by at least one subsequent dose. One or more doses can be administered sequentially in two or more cycles. For instance, a first dose may be administered at day 1, and a second dose may be administered after 1, 2, 3, 4, 5, 6, days or 1, 2, 3, or 4 weeks or after a longer interval. Additional doses may be administered after 1, 2, 3, 4, 5, 6, days or after 1, 2, 3, or 4 weeks or longer intervals. In some implementations, the first and subsequent administrations have the same dosage. In other implementations, different doses are administered. In some implementations, more than one dose is administered per day, for example, two, three or more doses can be administered per day.
As per one implementation of the present disclosure, the recombinant microbe capable of producing at least one derivative, or at least one pre-cursor of podophyllotoxin is capable of killing cancerous cells. The recombinant microbe is capable of killing 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90% cancerous cells over a particular site.
In an implementation of the present disclosure, there is provided a composition comprising the recombinant microbe as disclosed in the present disclosure, and a pharmaceutically acceptable carrier. The carrier can be any pharmaceutically acceptable substance well described in the art. The carriers can be selected from the group consisting of thickeners, diluents, buffers, buffering agents, surface active agents, neutral or cationic lipids, lipid complexes, liposomes, and penetration enhancers. For example, the pharmaceutical composition may include, but is not limited to, the addition of calcium bicarbonate, sodium bicarbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glycols, and surfactants, including, for example, polysorbate 20. In some embodiments, the genetically engineered bacteria of the present disclosure may be formulated in a solution of sodium bicarbonate, e.g., 1 molar solution of sodium bicarbonate (to buffer an acidic cellular environment, such as the stomach, for example). The genetically engineered bacteria may be administered and formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
Although the subject matter has been described with reference to specific embodiments, this description is not meant to be construed in a limiting sense. Various modifications of the disclosed embodiments, as well as alternate embodiments of the subject matter, will become apparent to persons skilled in the art upon reference to the description of the subject matter. It is therefore contemplated that such modifications can be made without departing from the spirit or scope of the present subject matter as defined
The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may vary.
The present section highlights the examples of the present disclosure. The criticality of the disclosure is mentioned in this section and the method of using the recombinant microbe has been disclosed herein.
Sequences Used in the Present Disclosure.
Several nucleic acid sequences encoding different enzymes of the podophyllotoxin were studied for their ability to encode the respective enzymes for showing the desirable enzyme activity. As is mentioned in the later part of the examples, that not all genes are able to encode the proteins (enzymes) having desirable enzyme activity. Therefore, Table 1 depicts the nucleic acid sequence of the genes which provided desirable results in terms of expressing a protein having the desirable enzyme activity. The nucleic acid sequences of different genes were codon optimised to achieve optimal expression in E. coli Nissle 1917 cell. Table 1 provides the sequence of the codon optimised genes. Table 2 depicts the amino acid sequence of the corresponding nucleic acid sequences listed in Table 1.
Genes from different microbes that encode ABC transporter proteins were studied, and interestingly it was found that not all ABC transporter proteins were able to provide the desirable secretion of etoposide outside the cell. Therefore, Table 3 lists the codon optimised nucleic acid sequences of the genes which provided the desirable results. Similarly, Table 4 lists the amino acid sequences encoded by the nucleic acid mentioned in the Table 3.
Rhodosporidium
toruloides
Populus
kitakamiensis
Strobilurus
tenacellus
Penicillium
antarcticum
Ganoderma
sinense
Azospirillum
Coffea
canephora
Eleocharis
dulcis
Chamaecyparis
formosensis
Linum
usitatissimum
Juglans
regia
Papaver
somniferum
Cinnamomum
micranthum
Papaver
somniferum
Sinopodophyllum
hexandrum
Cinnamomum
micranthum
Microcystis
viridis
Nitrospira
moscoviensis
Nifrospira
japonica
Panax
ginseng
Malus
domestica
Lycium
barbarum
Cicer
arietinum
Barbarea
vulgaris
Desulfatibacillum
aliphaticiyorans
Table 2 depicts the amino acid sequence of the enzymes which the recombinant microbe expresses in order to produce podophyllotoxin and its derivates. The table only depicts the sequences of those proteins which provided the desirable results.
Rhodosporidium
toruloides
Populus
kitakamiensis
Strobilurus
tenacellus
Ganoderma
sinense
Azospirillum
Coffea
canephora
Eleocharis
dulcis
Chamaecyparis
formosensis
Linum
usitatissimum
Juglans
regia
Papaver
somniferum
Cinnamomum
micranthum
Papaver
somniferum
Cinnamomum
micranthum
Microcystis
viridis
Nitrospira
moscoviensis
Nitrospira
japonica
Panax
ginseng
Malus
domestica
Lycium
barbarum
Cicer
arietinum
Barbarea
vulgaris
Desulfatibacillum
aliphaticivorans
Table 3 depicts the nucleic acid sequence of different types of ABC transporter genes that provided desirable results as per the present disclosure.
Trichophyton
equinum
Mucor
ambiguus
Cutibacterium
granulosum
Magnetospirillum
magneticum
Trichophyton
equinum
Mucor
ambiguus
Cutibacterium
granulosum
Magnetospirillum
magneticum
Enzyme Identification for Obtaining Recombinant Microbe as Per the Present Disclosure
In order to identify highly active, stereo specific enzymes for the pathway steps, functional homologs from various species were shortlisted for each of the pathway step. Shortlisted pathway genes were codon optimized for E. coli and gene synthesized (Table 1 and Table 2).
Functional homologs of the polypeptides described above are also suitable for use in producing etoposide in a recombinant host. A functional homolog is a polypeptide that has sequence similarity to a reference polypeptide, and that carries out one or more of the biochemical or physiological function(s) of the reference polypeptide. A functional homolog and the reference polypeptide may be naturally occurring polypeptides, and the sequence similarity may be due to convergent or divergent evolutionary events. As such, functional homologs are sometimes designated in the literature as homologs, or orthologs, or paralogs. Variants of a naturally occurring functional homolog, such as polypeptides encoded by mutants of a wild type coding sequence, may themselves be functional homologs. Functional homologs can also be created via site-directed mutagenesis of the coding sequence for a polypeptide, or by combining domains from the coding sequences for different naturally-occurring polypeptides (“domain swapping”). Techniques for modifying genes encoding functional polypeptides described herein are known and include, inter alia, directed evolution techniques, site-directed mutagenesis techniques and random mutagenesis techniques, and can be useful to increase specific activity of a polypeptide, alter substrate specificity, alter expression levels, alter subcellular location, or modify polypeptide:polypeptide interactions in a desired manner. Such modified polypeptides are considered functional homologs. The term “functional homolog” is sometimes applied to the nucleic acid that encodes a functionally homologous polypeptide. Functional homologs can be identified by analysis of nucleotide and polypeptide sequence alignments. For example, performing a query on a database of nucleotide or polypeptide sequences can identify homologs of etoposide biosynthesis polypeptides. Sequence analysis can involve BLAST, Reciprocal BLAST, or PSI-BLAST analysis of nonredundant databases using a known podophyllotoxin biosynthesis gene sequence as the reference sequence. Amino acid sequence is, in some instances, deduced from the nucleotide sequence.
Rhodosporidium
toruloides
Phoma sp.
Populus
kitakamiensis
Trifolium
subterraneum
Strobilurus
tenacellus
Cicer arietinum
Penicillium
antarcticum
Ganoderma
sinense
Psathyrella
aberdarensis
Vanilla planifolia
Capsicum
annuum
Azospirillum sp.
Rhodobacter
johrii
Arabidopsis
thaliana
Selaginella
moellendorffii
Lonicera
japonica
Coffea canephora
Dictyostelium
discoideum
Plagiochasma
appendiculatum
Eleocharis dulcis
Chamaecyparis
formosensis
Bambusa
emeiensis
Taiwania
cryptomerioides
Linum
usitatissimum
Dysosma
pleiantha
Dysosma
versipellis
Juglans regia
Cladophialophora
carrionii
Argemone
mexicana
Eschscholzia
californica
Coptis japonica
Papaver
somniferum
Cinnamomum
micranthum
Papaver
somniferum
Plumulus lupulus
Dictyostelium
discoideum
Sinopodophyllum
hexandrum
Vanilla planifolia
Cinnamomum
micranthum
Persea
americana
Populus
trichocarpa
Juglans regia
Actinidia
chinensis
Acer yangbiense
Stigmatella
aurantiaca
Microcystis
viridis
Candidates
Nitrospira
Nitrospira
moscoviensis
Nitrospira
japonica
Scutellaria
baicalensis
Cucumis melo
Panax ginseng
Fallopia
sachalinensis
Juglans regia
Eschscholzia
californica
Arabidopsis
thaliana
Mates domestica
Lycium barbarum
Centella asiatica
Centella asiatica
Cicer arietinum
Lycium barbarum
Barbarea
vulgaris
Isatis tinctoria
Rhodococcus
erythropolis
Desulfatibacillum
aliphaticivorans
Ruminococcaceae bacterium
Thermo sulfurimonas
dismutans
Aquifex aeolicus
Kocuria
rhizophila
Alkaliphilus
oremlandii
Gloeothece
citriformis
Rhizobium
meliloti
Photobacterium
profundum
Synechocystis sp.
Proteus mirabilis
Pyrobaculum
islandicum
Lactobacillus
sakei
Desulfotalea
psychrophila
Exiguobacterium
sibiricum
Crocosphaera
subtropica
Pasteurella
multocida
Nocardia
farcinica
Pelobacter
carbinolicus
Trichormus
variabilis
It can be observed from Table 5, that not all homologs of a particular enzyme provide the desirable efficacy while being expressed in E. coli host cell.
PAL—In the case of Phenylalanine ammonia-lyase, the protein sequence of Ganoderma sinense provides the maximum enzyme activity in terms of 98%, whereas the protein sequence from Phoma sp., Trifohum subterraneum, Cicer arietinum, and Psathyrella aberdarensis did not provide satisfactory enzyme activity. Therefore, the sequence from Ganoderma sinense was considered for constructing the recombinant microbe.
C4CHL fusion—It can be observed from Table 5 that the fusion protein of Azospirillum sp. provides the maximum enzyme activity (97%), whereas the fusion protein from other organisms mentioned in Table 5 did not provide desirable results.
HCTC3H fusion—The maximum enzyme activity observed was from the fusion protein of Coffea canephora (89%), whereas, very little or no enzyme activity was observed from other microbes.
Caffeoyl CoA O-methyltransferase (CCoAOMT)—The maximum activity observed was from the protein of Chamaecyparis formosensis (95%). Further, the protein of Eleocharis dulcis also provided reasonable enzyme activity of 61%, whereas, the protein from other organisms did not yield desirable results.
Bifunctional pinoresinol-lariciresinol reductase (DIRPLR)—The desirable enzyme activity was observed for the protein from the microorganism Linum usitatissimum.
Secoisolariciresinol dehydrogenase (SDH)—Of the results described in Table 5, the protein from the microbe Juglans regia provided the desirable results of 99% enzyme activity.
CYP719—The highest enzyme activity was observed for the protein from the microbe Cinnamomum micranthum. Further, the enzyme activity of the protein from the microbe Papaver somniferum also provided satisfactory results.
O-methyltransferase 3 (OMT)—The results obtained with protein from Papaver somniferum and Sinopodophyllum hexandrum provided desirable enzyme activity of 88%, and 99%, respectively.
CYP71—The enzyme activity of the protein from Cinnamomum micranthum provided the desirable result of 94%.
2-oxoglutarate/Fe(II)-dependent dioxygenase (2-ODD)—The results obtained with protein from Nitrospira moscoviensis and Nitrospira japonica provided desirable enzyme activity of 96%, and 88%, respectively.
CYP82D—The enzyme activity of the protein from Panax ginseng was desirable around 93%, whereas the protein from other microbes failed to show any enzyme activity.
Glycosyltransferase (UGT)—Of the many proteins tested, the enzyme activity of the protein from Cicer arietinum was the highest (97%).
2-Deoxy-d-ribose-5-phosphate aldolase (DERA)—It can be observed from Table 5 that proteins of many microbes were tested for the enzyme activity, amongst them, the protein from Desulfatibacillum ahphaticivorans showed the highest enzyme activity of 83%.
Construction of Fusion Enzymes
As per one of the possible implementations of the present disclosure, two proteins—cinnamate-4-hydroxylate (C4H) and 4-coumaroyl CoA-ligase (4CL) were expressed as one fusion protein. Also, other two proteins which were expressed as one fusion protein were hydroxycinnamoyl-CoA quinate hydroxycinnamoyltransferase (HCT) and p-coumaroyl quinate 3′-hydroxylase (HCTC3H). The fusion gene and the corresponding fusion protein was prepared using the following method. A flexible (GGGGS)3 (SEQ ID NO: 64) linker was inserted between the C-terminal of the upstream protein and the 15 N-terminal of the downstream protein i.e., (upstream protein C-terminal)-GGGGSGGGGSGGGGS (SEQ ID NO: 63)-(downstream protein N-terminal). The enzyme fusion constructs were made for the selected genes (Table 5). Pathway genes and the fusion constructs were individually cloned in E. coli expression vector pET28+ under T7 promoter and transformed in E. coli BL21 cells. Recombinant bacterial cells were induced with IPTG and enzyme functionality was tested with pathway specific substrates (Table 5) using lysed E. coli cell extracts. HPLC analysis was carried out to quantify the product formation and in turn shortlisting of efficient enzymes for functional pathway assembly towards Etoposide in E. coli.
The E. coli transformants were grown overnight at 37° C. in 1 ml of M9 minimal media containing ampicillin (100 mg/1), in 96-well format. The next day, 150 μl of each culture was inoculated into 3 ml M9 minimal media containing ampicillin (100 mg/1), IPTG 0.1 mM in 24-well format, and incubated at 30° C. and 200 rpm for ˜20 hours. The following day, cells were spun down and pellets were resuspended in 100 μl of lysis buffer containing 10 mM Tris-HCl pH 8, 5 mM MgCl2, 1 mM CaCl2) and complete mini protease inhibitor EDTA-free (3 tablets/100 ml) (Hoffmann-La Roche, Basel, Switzerland) and frozen at −80° C. for at least 15 minutes to promote cell lysis. Pellets were thawed at room temperature and 50 μl of DNase mix (1 μl of 1.4 mg/ml DNase in H2O (˜80000 u/ml), 1.2 μl of MgCl2 500 mM and 47.8 μl of 4×PBS buffer solution) was added to each well. Plates were shaken at 500 rpm for 5 min at room temperature to allow degradation of genomic DNA. Plates were spun down at 4000 rpm for 30 min at 4° C. and six μl of the lysates were used in in vitro using appropriate substrates for enzymes as per Table 6. In each case, the resulting compounds were measured by HPLC. Results were analysed in comparison with the lysates expressing the corresponding controls (the empty plasmid).
For extraction, 1 mL of the culture was centrifuged at maximum speed (>13,000 RPM) to pellet cells. Media was decanted to a fresh 1.5 mL microfuge tube and the pH was adjusted by addition of 50 μl hydrochloric acid (1N), followed by overnight freezing at −20° C. Tubes were thawed at room temperature and extracted twice with an equal volume (1 ml) of ethyl acetate. Ethyl acetate was dried under nitrogen gas, and the dried residue was resuspended in 100 μL methanol. All samples were stored at −20° C. prior to HPLC.
Etoposide Pathway Assembly in E. coli Nissle 1917
Co-expression of multiple target genes in E. coli is advantageous for studying multi enzymatic pathways. Co-expression often achieves optimal yield, solubility, and activity and may protect individual subunits from degradation. The vectors used in the present disclosure carry compatible replicons and antibiotic resistance markers and may be used together in appropriate host strains to co-express multiple proteins either as monocistronic or polycistronic expression. The capability of vectors to be co-transformed, propagated, and induced for robust target protein co-expression makes them ideal for the analysis of multi enzymatic biosynthesis pathways. The vectors are designed with compatible replicons and drug resistance genes for effective propagation and maintenance of four plasmids in a single cell.
To facilitate constitutive production of Etoposide in Escherichia coli Nissle 1917, the first seven genes of the pathway (PAL, C4H4CL, HCTC3H, CCoAOMT, DIRPLR, SDH, and CYP719) are assembled in pRSF vector and next six genes of the pathway (OMT, CYP71, 2-ODD, CYP82D, UGT, DERA) are assembled in p15A vector.
As can be observed from Table 5, it can be appreciated that certain enzymes of the pathway when produced from recombinant E. coli Nissle 1917 performed better in terms of enzyme activity as compared to the others. In similar lines, the enzyme homolog providing the highest enzyme activity was selected per enzyme type for the construction of the recombinant E. coli Nissle 1917 in order to perform further experiments.
The genes encoding: PAL having an amino acid sequence as set forth in SEQ ID NO: 2, C4H4CL having an amino acid sequence as set forth in SEQ ID NO: 12, HCTC3H having an amino acid sequence as set forth in SEQ ID NO: 14, CCoAOMT having an amino acid sequence as set forth in SEQ ID NO: 18, DIRPLR having an amino acid sequence as set forth in SEQ ID NO: 20, SDH having an amino acid sequence as set forth in SEQ ID NO: 22, and CYP719 having an amino acid sequence as set forth in SEQ ID NO: 26 were assembled in pRSF vector.
The next six genes of the pathway were selected as follows. The genes encoding OMT having an amino acid sequence as set forth in SEQ ID NO: 30, CYP71 having an amino acid sequence as set forth in SEQ ID NO: 32, 2-ODD having an amino acid sequence as set forth in SEQ ID NO: 36, CYP82D having an amino acid sequence as set forth in SEQ ID NO: 40, UGT having an amino acid sequence as set forth in SEQ ID NO: 46, DERA having an amino acid sequence as set forth in SEQ ID NO: 50 were assembled in p15A vector. The corresponding nucleic acid sequences have been given in Table 1 as presented previously.
Although the recombinant microbe was constructed as per details mentioned above, however, it can be contemplated that other functional homologs of the enzymes showing desirable activity can be used to arrive at different recombinant microbes.
Transcriptional and translational elements, are synthesized (Gen9, Cambridge, MA) and cloned into vector pBR322 and p15A. The pathway cassette was placed under the control of either of the promoter sequences as follows.
GapA promoter having a nucleic acid sequence as set forth in SEQ ID NO: 59 (TTGCTCACATCTCACTTTAATCGTGCTCACATTACGTGACTGATTCTAACA AAACATTAACACCAACTGGCAAAATTTTGTCCTAAACTTGATCTCGACGA AATGGCTGCACCTAAATCGTGATGAAAATCACATTTTTATCGTAATTGCCC TTTAAAATTCGGGGCGCCGACCCCATGTGGTCTCAAGCCCAAAGGAAGAG TGAGGCGAGTCAGTCGCGTAATGCTTAGGCACAGGATTGATTTGTCGCAA TGATTGACACGATTCCGCTTGACGCTGCGTAAGGTTTTTGTAATTTTACAG GCAACCTTTTATTCA)
TufB promoter having a nucleic acid sequence as set forth in SEQ ID NO: 60 (TAAAAAGAATTATGGTTTAGCAGGAGCGCATTGTTGAGCACAATGATGTT GAAAAAGTGTGCTAATCTGCCCTCCGTTCGGCTGTTTCTTCATCGTGTCGC ATAAAATGTGACCAATAAAACAAATTATGCAATTTTTTAGTTGCATGAACT CGCATGTCTCCATAGAATGCGCGCTACTTG).
It can be contemplated that any well-known and suitable promoter sequences apart from the ones disclosed herein can also be used for constructing the recombinant microbe.
For efficient translation of genes, each synthetic gene in the operon was separated by ribosome binding sites (RBS). The RBS can have a nucleic acid sequence as set forth in SEQ ID NO: 61 (TCTTAATCATGCACAGGAGACTTTCTA) or the nucleic acid sequence as set forth in SEQ ID NO: 62 (AAGTTCACTTAAAAAGGAGAGATCAACA). Further, a person skilled in the art can use any other well-known RBS sequence in order to increase the translation efficiency.
Plasmids p15A and pRSF assembled with entire etoposide pathway genes were co-transformed in E. coli Nissle and recombinant clones were selected on dual antibiotic LB agar plates containing kanamycin (25 μg/ml) and chloramphenicol (15 μg/ml). Recombinant clones were screened for biosynthesis of etoposide and the presence of etoposide was confirmed through mass analysis. E. coli Nissle recombinant clone (JNM2450) which produced highest etoposide levels was selected for further analysis like screening of ABC transporter genes for etoposide secretion and the like.
ABC Transporter for Etoposide Secretion
A transporter (also referred to as a membrane transport protein) is a membrane protein involved in the movement of molecules and ions across a biological membrane. Transporters span the membrane in which they are localized and across which they transport substances. Transporters can operate to move substances by facilitated diffusion or by active transport. Transport proteins have been classified according to various criteria at the Transporter Classification Database. See, Saier Jr. et al., Nucl. Acids Res., 37:D274-278 (2009). Two families of plasma membrane transporters are thought to be ubiquitous among living organisms: the ATP-Binding Cassette (ABC) transporters and the Major Facilitator Superfamily (MFS) transporters. ATP-binding cassette transporters (ABC transporters) are transmembrane proteins that utilize the energy of adenosine triphosphate (ATP) hydrolysis to carry out translocation of various substrates across membranes. They can transport a wide variety of substrates across extra- and intracellular membranes, including metabolic products, lipids and sterols, and drugs. Proteins are classified as ABC transporters based on the sequence and organization of their ATP-binding cassette domain. Typically, ABC family transporters are multicomponent primary active transporters, capable of transporting molecules in response to ATP hydrolysis. Non-limiting examples of endogenous ABC transporter genes include the genes at the loci PDRS, PDR10, PDR15, SNQ2, YOR1, YOL075c and PDR18 (or a functional homolog thereof).
A total of 20 ABC transporter genes from various organisms (Table 6) were selected and codon optimized for expression in E. coli system. To determine the effect of various transporters on etoposide secretion in E. coli Nissle clone (JNM2450), a library of E. coli Nissle strains was constructed by cloning the transporter genes under a constitutive promoter GapA.
E. coli Nissle clone (JNM2450) producing etoposide was co-transformed with ColE1 plasmid harbouring various transporter genes. The recombinant clones were grown in M9 minimal media at 37° C. for overnight and the supernatant was subjected for HPLC analysis. Table 6 below depicts the percentage of etoposide secretion achieved by using the different ABC transporters.
Candida albicans
Trichophyton rubrum
Neosartorya fumigata
Emericella nidulans
Aspergillus oryzae
Trichophyton rubrum
Trichophyton equinum (SEQ ID NO: 52)
Purpureocillium lilacinum
Wickerhamomyces ciferrii
Mucor ambiguous (SEQ ID NO: 54)
Sporisorium scitamineum
Cutibacterium granulosum (SEQ ID NO: 56)
Botryosphaeria parva
Colletotrichum fructicola
Clohesyomyces aquations
Cadophora sp.
Magnetospirillum magneticum
Lactobacillus paracasei
Rothia kristinae
Acinetobacter baumannii
As can be observed from Table 6, that the clone (JNM144) harbouring ABC transporter gene (SEQ ID NO: 55), and encoding ABC transporter protein as per SEQ ID NO: 56 from Cutibacterium granulosum showed highest etoposide secretion in the supernatant compared to the control strain.
Therefore, along with the etoposide pathway assembly as discussed in Example 4, the gene encoding ABC transporter having an amino acid sequence as set forth in SEQ ID NO: 56 was also cloned to obtain the recombinant E. coli Nissle 1917. The recombinant E. coli Nissle 1917 obtained along with the ABC transporter as described herein was used for further studies as described in forthcoming examples. It can be contemplated that other transporters well-known in the art can also be used for obtaining the recombinant microbe.
Controlling the Expression of the Genes Cloned in the Recombinant E. coli Nissle 1917
It is imperative to control the expression of genes comprised in the recombinant E. coli Nissle 1917 obtained as per the previous Examples 1-4. In order to effectuate the same, different kinds of regulatory circuit can be used for eventually controlling the secretion of etoposide by the recombinant bacterium.
Engineering E. coli Nissle 1917 with AraC Transcriptional Regulator that can Detect Arabinose and Rhamnose
To create inducible systems for use in E. coli Nissle, parts from a large repertoire of systems that govern carbohydrate utilization were used, which included cytoplasmic transcription factors, extracytoplasmic function sigma/anti-sigma pairs, and hybrid two-component systems (HTCS), among others. In E. coli Nissle, arabinose and rhamnose metabolism is mediated by the AraC/Xy1S-family transcriptional activator, RhaR, which activates transcription at the Pbad promoter. To assay the functionality of Pbad as an inducible system, 250 bp of the promoter-RBS region was cloned upstream of the etoposide pathway (as described in Example 3) into the expression vectors. Gene expression was conditional on the concentration of arabinose and rhamnose and demonstrated a response curve with an output dynamic range of 104-fold. Fitting the response curve to a Hill function revealed a threshold K of 0.3 mM and a Hill coefficient n=1.4.
Engineering E. coli Nissle 1917 with Lung Airway Epithelial Cell Specific Nitric Oxide (NO) Regulatory Operon
Nitric oxide is a natural marker of inflammation in lung cancer, making it an ideal input signal for this engineered microorganism. Inflamed lung epithelial cells produce nitric oxide by up-regulating inducible nitric oxide synthase (iNOS), an enzyme that produces nitric oxide from L-arginine. Nitric oxide sensing was combined through NorR regulatory unit with podophyllotoxin (etoposide) pathway biosynthesis genes. The following design strategy is incorporated to successfully couple nitric oxide sensing to switch activation.
The sequence used for promoter PnorV extended into the coding sequence of NoR. Additionally, rather than using the sequence for the native ribosomal binding site (RBS) for norV, a stronger synthetic RBS was used and spacer to drive multiple genes. To characterize the switching properties of the nitric oxide responsive engineered E. coli Nissle strains, the nitric oxide donors DETA/NO (diethylenetriamine/nitric oxide adduct) and SNP (sodium nitro prusside) were used as sources of nitric oxide.
Engineering E. coli Nissle 1917 with the FNR Regulatory Operon that can Detect Hypoxic Conditions
E. coli Nissle strain JNM1024 was genetically engineered to express genes for biosynthesis of podophyllotoxin under the control of an FNR transcriptional regulator. Under oxygen-rich conditions, binding of the transcription factor FNR to the hypoxia-inducible promoter will be impeded, leading to repressed expression of the downstream gene. In tumor microenvironment with relatively low levels of oxygen, the FNR transcription factor can bind to the promoter, leading to the expression of the downstream gene. Sodium sulphite is used to make an hypoxia environment in laboratory conditions. Comparing with a control, under oxygen-limiting conditions FNR controlled pathway genes showed expression leading to biosynthesis of podophyllotoxin (
Therefore, it can be clearly observed that the production of etoposide by the recombinant E. coli Nissle takes place only in the presence of the respective inducers. Whereas, in the absence of any inducer, etoposide production is not observed. Hence, the production of etoposide can be controlled and limited to only the location where it is required to be produced.
Laboratory Bioassay for Treating Lung Cancer Cell Lines with E. coli Nissle 1917 Producing Podophyllotoxins
The lung cancer cell lines such as NCI-H69, NCI-H128, NCIH209, SHP-77, PC-9 were used to study the E. coli Nissle bacterial clones producing podophyllotoxin.
Lung cancer cells were added to each well of a 6-well plate containing 1.5 ml DMEM supplemented with 10% FBS. Cells were cultured in the wells overnight at 37° C., 95% air, and 5% CO2 to allow them to form a ˜90% confluent monolayer. The culture medium in each well was then replaced with 1 ml fresh medium supplemented before adding 50 μl of engineered bacterial suspension with OD600˜1.0. Wild type bacteria were also added to control wells containing fresh media. Inducers such as arabinose or rhamnose, sodium nitro prusside (SNP) and cobalt chloride were used for activating the AraC operon, NO generation and creating hypoxic conditions in tumour cell lines respectively. After incubating the plates for overnight under the same conditions as described above, the effects of native and engineered bacteria releasing podophyllotoxins on tumour cell viability were assessed using CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega, Madison, WI). These experiments were repeated 5 times for each combination of tumor cell type. Statistical significance of sample difference was evaluated with the Mann-Whitney U test.
To visualize E. coli interactions with tumour cells, 1.5 ml of DMEM supplemented with 10% FBS plus 0.5 ml of B16.F10 or EMT6 cell suspension (approximately 3×106 cells/ml) were added to each well of a 6-well plate. Cells were incubated in plates overnight at 37° C., 95% air, and 5% CO2 to obtain confluent monolayers. For co-visualization of tumour cells and bacteria, tumour cells were stained prior to bacterial infection by incubating with 1 μM calcein-AM in serum-free DMEM at 37° C. for 15 min. The medium in each well was then replaced with fresh, serum-supplemented medium. Monolayers were inoculated with 40 μl of an overnight culture of E. coli (0D600 ˜1.0) and incubated at 37° C., 95% air, and 5% CO2 for overnight. Medium was then removed from each well and monolayers were gently washed three times with PBS before visualizing with confocal microscopy (Zeiss LSM 510).
Advantages of the Present Disclosure:
The present disclosure discloses recombinant (programmed) microbe capable of producing podophyllotoxin, or its derivatives, or its precursors. As per one of the example, the recombinant microbe produces etoposide which is an anti-cancer molecule and can solve the problem of the targeted therapy and regulating the dosage of the molecule for the treatment. The recombinant microbe as disclosed herein is capable of producing etoposide in the presence of inducers like hypoxic conditions, or the presence of nitric oxide which are the hallmarks of the cancerous cells. Therefore, the production of etoposide by the recombinant bacteria present in the tumour microenvironment leads to targeted therapy and that too with a much lesser amount of etoposide. Such a treatment would lead to a reduction in the dosage of the anti-cancer molecule required for the cancer treatment, therefore, circumventing the problem of side effects of the chemotherapy, and increasing the chances of survival of the subject.
The present disclosure discloses the recombinant microbe which can be used to produce podophyllotoxin pathway precursors, or derivatives. The methods disclosed in the present disclosure provides three distinct advantages, first amongst them, such tools permit cloning of large fragments of nucleic acids into the bacterial genome (both episomally and integrated into its genome); second of them, they enable rapid scalability in cloning the metabolic pathway for the drug compound; third, is their versatile nature to adapt cloning variety of control circuitry inside the microorganism. Therefore, the recombinant microbe leads to a stable production of the end-product which further can have numerous applications.
This application claims the benefit of U.S. Provisional Application No. 63/058,662, filed Jul. 30, 2020, the entirety of which is incorporated herein for any and all purposes The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Oct. 15, 2023 is named Sequence.txt and is 224 KB in size.
| Number | Name | Date | Kind |
|---|---|---|---|
| 20050026866 | Pawelek | Feb 2005 | A1 |
| Entry |
|---|
| Agrawal et al.; “Bacteriolytic therapy can generate a potent immune response against experimental tumors”; PNAS; vol. 101 No. 42; Oct. 2004; p. 15172-15177. |
| Saier Jr. et al.; “The Major Facilitator Superfamily”; J. Mol. Microbiol. Biotechnol.; vol. 1(2); 1999; p. 257-279. |
| Saier Jr. et al.; “The Transporter Classification Database: recent advances”; Nucleic Acids Research; vol. 37; Jan. 2009; p. D274-D278. |
| Altenhoefer et al.; “The probiotic Escherichia coli strain Nissle 1917 interferes with invasion of human intestinal epithelial cells by diferent enteroinvasive bacterial pathogens”; FEMS Immunology and Medical Microbiology; vol. 40; 2004; p. 223-229. |
| Bay et al.; “Diversity and evolution of the small multidrug resistance protein family”; BMC Evolutionary Biology; vol. 9; 2009; 27 pages. |
| Dang et al.; “Combination bacteriolytic therapy for the treatment of experimental tumors”; PNAS; vol. 98 No. 26; Dec. 2001; p. 15155-15160. |
| Fisher et al.; “Evaluation of the Worth of Corynebacterium parvum in Conjunction With Chemotherapy as Adjuvant Treatment for Primary Breast Cancer”; Cancer; vol. 66 No. 2; 1990; p. 220-227. |
| Jia et al.; “Oral Delivery of Tumor-Targeting Salmonella to Treat Cancer in Mice”; Bacterial Therapy of Cancer; Chapter3; 2005; p. 25-33. |
| Lee et al.; “A Propionate-Inducible Expression System for Enteric Bacteria”; Applied and Environmental Microbiology; vol. 71 No. 11; Nov. 2005; p. 6856-6862. |
| Lee et al.; “Endostatin gene therapy delivered by Salmonella choleraesuis in murine tumor models”; The Journal of Gene Medicine; vol. 6; 2004; p. 1382-1393. |
| Lee et al.; “Systemic Administration of Attenuated Salmonella choleraesuis in Combination with Cisplatin for Cancer Therapy”; Molecular Therapy; vol. 11 No. 5; May 2005; p. 707-716. |
| Lee et al.; “Systemic administration of attenuated Salmonella choleraesuis carrying thrombospondin-1 gene leads to tumor-specific transgene expression, delayed tumor growth and prolonged survival in the murine melanoma model”; Cancer Gene Therapy; vol. 12; 2005; p. 175-184. |
| Lodinova-Zadnikova et al.; “Effect of Preventive Administration of a Nonpathogenic Escherichia coliStrain on the Colonization of the Intestine with Microbial Pathogens in Newborn Infants”; Biology of the Neonate; vol. 71; 1997; p. 224-232. |
| Loeffler et al.; “Attenuated Salmonella engineered to produce human cytokine LIGHT inhibit tumor growth”; PNAS; vol. 104 No. 31; Jul. 2007; p. 12879-12883. |
| Malmgren et al.; “Localization of the Vegetative Form of Clostridium tetani in Mouse Tumors Following Intravenous Spore Administration”; Cancer Research; vol. 15; 1955; p. 473-478. |
| Parker et al.; “Effect of H'istolyticus Infection and Toxin on Transplantable Mouse Tumors”; Experimental Biology and Medicine; vol. 66; 1947; p. 461-467. |
| Reister et al.; “Complete genome sequence of the Gram-negative probiotic Escherichia coli strain Nissle 1917”; Journal of Biotechnology; vol. 187; 2014; p. 106-107. |
| Rembacken et al.; “Non-pathogenic Escherichia coli versus mesalazine for the treatment of ulcerative colitis: a randomised trial”; The Lancet; vol. 354; Aug. 1999; p. 635-639. |
| Schultz et al.; “Clinical Use of E. coli Nissle 1917 in Inflammatory Bowel Disease”; Clinical Review—Inflamm Bowel Disease; vol. 14 No. 7; Jul. 2008; p. 1012-1018. |
| Sonnenborn et al.; “The non-pathogenic Escherichia coli strain Nissle 1917—features of a versatile probiotic”; Microbial Ecology in Health and Disease; vol. 21; 2009; p. 122-158. |
| Ukena et al.; “Probiotic Escherichia coli Nissle 1917 Inhibits Leaky Gut by Enhancing Mucosal Integrity”; PLos ONE; Issue 12—e1308; Dec. 2007; 9 pages. |
| Yi et al.; “Antitumor effect of cytosine deaminase/5-fluorocytosine suicide gene therapy system mediated by Bifidobacterium infantis on melanoma1”; Acta Pharmacologica Sinica; vol. 26; May 2005; p. 629-634. |
| Zhao et al.; “Tumor-targeting bacterial therapy with amino acid auxotrophs of GFP-expressing Salmonella typhimurium”; PNAS; vol. 102 No. 3; Jan. 2005; p. 755-760. |
| Zhao et al.; “Targeted Therapy with a Salmonella typhimurium Leucine-Arginine Auxotroph Cures Orthotopic Human Breast Tumors in Nude Mice”; Cancer Research; vol. 66; Aug. 2006; p. 7647-7652. |
| Number | Date | Country | |
|---|---|---|---|
| 20220033867 A1 | Feb 2022 | US |
| Number | Date | Country | |
|---|---|---|---|
| 63058662 | Jul 2020 | US |
