Patent Application
20110301227
This application contains a sequence listing submitted herewith electronically. The content of the sequence listing is incorporated by reference in this application.
Integrins are a family of heterodimeric transmembrane receptors that, besides providing a physical link between the basement membrane (BM) and the cytoskeleton of epithelial cells, act as platforms for intracellular signaling as a consequence of ligand binding and cross talk with receptor tyrosine-kinases (RTKs) (Giancotti and Tarone, 2003). To date, 18α and 8β subunits have been identified in the human, leading to the formation of at least 24 distinct functional receptors. However, extensive alternative splicing and post-translational modification of both groups of subunits leads to the generation of considerably more forms in vivo (de Melker and Sonnenberg, 1999).
The α6 subunit mRNA undergoes alternative splicing yielding two distinct isoforms (Hogervorst et al., 1991), termed α6A and α6B, with distinct cytoplasmic domains and dissimilar patterns of expression throughout the human organism (Hogervorst et al., 1993). The different isoforms result from alternative splicing of a single exon (Hogervorst et al., 1991). Thus, the inclusion of an alternatively spliced exon results in the formation of the α6A variant, while exclusion leads to a reading frame shift, usage of an alternative stop codon and formation of the α6B variant. The A variant has been reported to be the only variant expressed in the mammary gland, peripheral nerves and basal keratinocytes while the B variant is predominant in the kidney. The intestine was initially reported to express both variants (Hogervorst et al., 1993). These patterns of expression for α6A and α6B as well as their dissimilar temporal expression during embryonic development (Thorsteinsdottir et al., 1995) may imply that they serve different biological functions. The α6A and -B subunits possess divergent capacities of initiating intracellular biochemical events, namely tyrosine phosphorylation of paxillin (Shaw et al., 1995) and activation of the Ras-MEK-ERK pathway (Wei et al., 1998).
In the human intestine, the α6 subunit dimerizes with the β4 subunit forming the α6β4 integrin (Basora et al., 1999). The relatively simple structural and functional renewal unit of the small intestine, the crypt-villus axis, makes it an attractive model for the study of epithelial cell proliferation and maturation (Babyatsky and Podolsky, 1995). Positional control of the enterocytes and their subsequent function is controlled by cell-cell and cell-extracellular matrix (ECM) interactions with the underlying the basement membrane (BM) (Teller and Beaulieu, 2001). The importance of the latter is exemplified by the inductive effects on enterocytic cytology by specific laminin variants (Vachon and Beaulieu, 1995; Virtanen et al., 2000), while analysis of several molecules involved in cell-ECM interactions, including integrins, has revealed distinct patterns of expression along the crypt-villus axis in relation to the differentiation state of enterocytes (Beaulieu, 1997; Teller and Beaulieu, 2001). Furthermore, the α6β4 integrin has been shown to be an important player in mediating migration and invasion of colon cancer cells (Lohi et al., 2000; Mercurio and Rabinovitz, 2001; Ni et al., 2005; Pouliot et al., 2001).
Integrins do not possess intrinsic signaling capacities, but rather mediate positional information by interacting with a large range of scaffolding proteins resulting in activation of several signaling molecules, such as Ras and PI3K, leading to subsequent activation of, among other molecules, JNK, Jun, Erk and CyclinD (Giancotti et al., 2003). The net result of this integrin mediated intracellular signaling is control of cellular functions such as proliferation, migration, invasion and survival, all of which are pivotal events in cancer progression (Guo and Giancotti, 2004).
The accumulated findings of an association between high expression levels of the α6 integrin subunit and carcinoma cell invasion, metastatic capacity, apoptosis evasion and negative patient outcome (Mercurio and Rabinovitz, 2001; Friedrichs et al., 1995; Chung and Mercurio, 2004) strongly argues in favor of a role for α6 containing integrins in human cancers. While the α6 subunit can dimerize with either β1 or β4 subunits, it preferentially dimerizes with the β4 subunit. In fact, in cells that express significant amounts of β4, such as human intestinal epithelial cells (Basora et al., 1999), the formation of α6β1 is nominal. Recent work has demonstrated an overall up-regulation of the expression of the β4 integrin subunit in primary tumors of the human colon (Ni et al., 2005) strongly supporting the notion that the α6β4 integrin is an important player in the migration and invasion of colon cancer cells (Mercurio and Rabinovitz, 2001; Pouliot et al., 2001). These observations, taken together with the reported presence of this major laminin receptor at the invasive front of colorectal cancers (Lohi et al, 2000), argues for an important role for the α6β4 integrin in colon cancer progression (Mercurio et al., 2001).
It would be highly desirable to be provided with the relationship between α6β4A and α6B isoforms and the proliferation of normal and cancer cells. This relationship would be beneficial in the design of new diagnostic and therapeutic tools for conditions associated with aberrant proliferation, such as neoplastic proliferation.
As shown herein, the B:A ratio of the isoforms of the integrin α6 are tightly linked to the regulation of the cell cycle. Therefore, the present application concerns the modulation of that ratio for the treatment of hyper/hypo-proliferative state. The present application also concerns the use of this ration for diagnosing an hyper or hypoproliferative state.
According to one aspect, the present application provides a method of inhibiting the proliferation of a cell. The method comprises increasing the ratio of an isoform B to an isoform A of the integrin α6 subunit in said cell, thereby inhibiting the proliferation of a cell. This ratio modulation can be done by increasing the expression, transcription or activity of the isoform B and/or decreasing the expression, transcription or activity of the isoform A. In an embodiment, the cell is from a gastro-intestinal tract, the colon for example. In another embodiment, the cell is a malignant cell. In yet another embodiment, the method further comprises over-expressing a nucleic acid encoding the isoform B or limiting the expression of a nucleic acid encoding the isoform A for increasing the ratio. In a further embodiment, the nucleic acid is a recombinant nucleic acid. In another embodiment, the method can comprise over-transcribing or increasing the stability an mRNA encoding the isoform B or decreasing the transcription or activity of the isoform A so as to increase the ratio. In an embodiment, the mRNA is encoded by a recombinant nucleic acid. In yet another embodiment, the method may comprise up-regulating the activity or stability of the isoform B or down-regulating the activity or stability of the isoform A in order to increase the ratio. In that embodiment, the isoform can also be encoded by a recombinant nucleic acid. In the method described herein, the cell may be in an animal and the animal may be a human. In yet another embodiment, the method further comprises down-regulating c-Myc activity in the treated.
According to another aspect, the present application also provides a method of increasing the proliferation of a cell. The method comprises lowering the ratio of an isoform B to an isoform A in said cell, thereby increasing the proliferation of a cell. This modulation can be done by either up-regulating the isoform A and/or downregulating the isoform B. In an embodiment, the cell is from a gastro-intestinal tract, the colon for example. In yet another embodiment, the method further comprises over-expressing a nucleic acid encoding the isoform A or limiting the expression of a nucleic acid encoding the isoform B for decreasing the ratio. In a further embodiment, the nucleic acid is a recombinant nucleic acid. In another embodiment, the method can comprise over-transcribing or increasing the stability an mRNA encoding the isoform A or lowering the expression or stability of an mRNA encoding the isoform B so as to decrease the ratio. In an embodiment, the mRNA is encoded by a recombinant nucleic acid. In yet another embodiment, the method may comprise up-regulating the activity or stability of the isoform A or downregulating the activity or stability of the isoform B in order to decrease the ratio. In that embodiment, the isoform can be encoded by a recombinant nucleic acid. In the method described herein, the cell may be in an animal and the animal may be a human. In yet another embodiment, the method further comprises up-regulating c-Myc activity in the treated cell.
According to yet another aspect, the present application provides a method of diagnosing an hyperproliferative state in an individual. The method comprises determining a ratio between an isoform B and an isoform A of an integrin α6 subunit in a cell from said individual, wherein a ratio being lower than a control ratio is indicative of the presence of the hyperproliferative state in said individual. In an embodiment, the ratio between the isoform B and the isoform A of the integrin α6 subunit is determined by quantifying the mRNA specific for the isoform B and the mRNA specific for the isoform A in said cell. In still another embodiment, the determination can be done by PCR and/or real-time PCR. In another embodiment, wherein the ratio between the isoform B and the isoform A of the integrin α6 subunit is determined by quantifying the polypeptide specific for the isoform B and the polypeptide specific for the isoform A in said cell. In yet another embodiment, the determination can be done with an antibody and/or an ELISA assay. In an embodiment, the control ratio is a ratio between the isoform B and the isoform A of an integrin α6 subunit in a cell from a healthy control patient or a healthy tissue free of hyperproliferation (e.g. abnormally elevated proliferation). In still another embodiment, the control ratio is of about 1.5. In yet another embodiment, the hyperproliferative state is cancer, such as a cancer associated with a gastro-intestinal tract, a carcinoma and/or a colon cancer.
According to still another aspect, the present application provides the use of a reduction of the ratio between an isoform B to an isoform A of an integrin α6 subunit for the inhibition of the proliferation of a cell and/or the use of a reduction of the ratio between an isoform B to an isoform A in the manufacture of a medicament for the inhibition of the proliferation of a cell. Generally, in order to reduce the ratio, the isoform B is up-regulated and/or the isoform A is down regulated. In an embodiment, the cell is from a gastro-intestinal tract, the colon for example. In another embodiment, the cell is a malignant cell. In yet another embodiment, the use can comprise over-expressing a nucleic acid encoding the isoform B or limiting the expression of a nucleic acid encoding the isoform A for increasing the ratio. In a further embodiment, the nucleic acid is a recombinant nucleic acid. In another embodiment, the use can comprise over-transcribing or increasing the stability an mRNA encoding the isoform B or lowering the transcription or the stability of an mRNA encoding the isoform A so as to increase the ratio. In an embodiment, the mRNA is encoded by a recombinant nucleic acid. In yet another embodiment, the use may comprise up-regulating the activity or stability of the isoform B or downregulating the activity or stability of the isoform A in order to increase the ratio. In that embodiment, the isoform can be encoded by a recombinant nucleic acid. In the use described herein, the cell may be in an animal and the animal may be a human. In yet another embodiment, the use further comprises down-regulating c-Myc activity in the treated.
According to yet another aspect, the present application comprises the use of an increase in the ratio of an isoform B to an isoform A of an integrin α6 subunit for the promotion of proliferation in a cell and/or the use of an increase in the ratio of an isoform B to an isoform A of an integrin α6 subunit in the manufacture of a medicament for the promotion of proliferation in a cell. In order to increase this ratio, the isoform B is usually down-regulated and the isoform A is usually up-regulated. In an embodiment, the cell is from a gastro-intestinal tract, the colon for example. In yet another embodiment, the use further comprises over-expressing a nucleic acid encoding the isoform A or limiting the expression of the isoform B for decreasing the ratio. In a further embodiment, the nucleic acid is a recombinant nucleic acid. In another embodiment, the use can comprise over-transcribing or increasing the stability an mRNA encoding the isoform A or lowering the expression and stability of the isoform B so as to decrease the ratio. In an embodiment, the mRNA is encoded by a recombinant nucleic acid. In yet another embodiment, the use may comprise up-regulating the activity or stability of the isoform A or down-regulating the activity or stability of the isoform B in order to decrease the ratio. In that embodiment, the isoform can be encoded by a recombinant nucleic acid. In the use described herein, the cell may be in an animal and the animal may be a human. In yet another embodiment, the method further comprises up-regulating c-Myc activity in the treated cell.
According to still another embodiment, the present application also comprises an agent capable of increasing a ratio of an isoform B to an isoform A of an integrin α6 subunit for the inhibition of the proliferation of a cell, an agent capable of increasing a ratio of an isoform B to an isoform A of an integrin α6 subunit in the manufacture of a medicament, an agent capable of decreasing a ratio of an isoform B to an isoform A of an integrin α6 for the promotion of the proliferation of a cell, an agent capable of decreasing a ratio of an isoform B to an isoform A of an integrin α6 for the manufacture of a medicament.
According to yet another embodiment, the present application further comprises a method of screening for an agent useful in the treatment of an hyperproliferative disease, said method comprising: (i) contacting the agent with a cell or a cell extract comprising an an isoform B and an isoform A of an integrin α6; and (ii) determining if the agent increases or decreases the ratio between the isoform B and the isoform A; wherein if the ratio is increased, it is indicative that the agent is useful in the treatment of an hyperproliferative disease.
In accordance with the present invention, it has been shown that the ratio between the B and A isoforms of the integrin α6 subunit is tied to cellular proliferation. This ratio is elevated in quiescent (e.g. differentiated) cells and low in proliferative (e.g. malignant) cells and thus can be used for the evaluation of cellular proliferation. This ratio can also be modulated to decrease or increase cellular proliferation.
The ITGA6 protein product is the integrin alpha chain alpha 6. Alpha 6 integrin subunit may combine with beta 4 in the integrin referred to as TSP180, or with beta 1 in the integrin VLA-6. It is mostly expressed in epithelial cells. Two transcript variants encoding different isoforms have been found for this gene: the B isoform (e.g. coding sequence accession number NM—000210 or SEQ ID NO: 1; polypeptide sequence accession number NP—000201 or SEQ ID NO: 2) and the A isoform (e.g. coding sequence accession number NM—001079818 or SEQ ID NO: 3; polypeptide sequence accession number NP—001073286 or SEQ ID NO: 4). Even though the ITGA6 protein has been shown to be upregulated in cancer, the present application provides suprising evidence that the ratio of the B and A isoforms is also modulated during cellular proliferation and can be modified to induce cellular proliferation or cellular quiescence. The present application also shows that the ratio between the two isoforms is an indicator of cellular proliferation and could successfully be used in the diagnosis of cancer or any other hyperproliferative state.
Various conditions are associated with either an hyperproliferative (such as cancer, psoriasis) or an hypoproliferative state of a cell. As indicated above, since the ratio between the B and A isoforms of the α6 integrin subunit is tightly linked to the ability of a cell to proliferate or enter into quiescence, the ratio can be successfully used to treat the above-noted conditions. Since the α6 integrin subunit is mostly expressed in epithelial cells, it is contemplated that the modulation of the B:A ratio in those cells will be particularly useful.
According to one aspect, the present application provides a method of limiting the proliferation of a cell. As used herein, the term “inhibiting” refers to the ability of the method to lower or slow down the proliferation of a cell. In certain embodiments, the method is also capable of halting the proliferation of a cell by allowing the cell to exit the cellular cycle (e.g. G1 exit). As used herein, the term “proliferation” refers to the ability of a cell to complete a cell cycle. In an embodiment, the proliferation of a cell can be assessed by determining the proliferation rate of a cell, e.g. the number of cell cycles completed by a cell in a definite amount of time (e.g. hours, days, weeks). Since the proliferation rate is not uniform between every cell type, care should be taken to determine if an “inhibition of the proliferation of a cell” has occurred by comparing the proliferation rate of the cell before and after the treatment or to a similar cell that has not been treated.
In order to inhibit the proliferation of a cell, the method comprises increasing the ratio B:A ratio of the α6 integrin in the cell. In an embodiment, this is achieved by increasing the net amount of the B isoform of the integrin α6 subunit in the cell. In another embodiment, this can also be achieved by overexpressing the mRNA encoding the B isoform and/or increasing the stability of the mRNA encoding the B isoform in a cell. It can also be done by increasing the activity of the B isoform. It can further be achieved by reducing the amounts of the A isoform.
The modulation of expression of the B and A isoforms can be achieved using genetic engineering means. Such genetic means can be an vector appropriate for gene therapy that, when introduced in a cell, favors the expression of one isoform and consequently increases the B:A ratio balance of the α6 integrins in the cell. Another genetic means can be a vector appropriate for gene therapy that, when introduced in a cell, limits the expression of one isoform and consequently increases the B:A ratio balance of the α6 integrins in the cell (shRNA methodology for example). A combination of both types of vectors is also contemplated herein.
The modulation of expression of the B and A isoforms can be also be achieved using a small molecule (e.g. agent) that is capable of favoring or inhibiting the expression of one of the two (or both) isoforms or the activity of one (or both) isoforms.
In still another embodiment, and as shown below, the increase of the B:A ratio of the isoform of integrin α6 subunit can also lead to the down-regulation of the activity of c-Myc in the treated cell. The c-Myc oncogene is a transcription factor that is upregulated in various hyperproliferative state, such as cancer. As such, the methods presented herein can advantageously be used in cells (or conditions related thereto) overexpressing c-Myc or having an enhanced c-Myc activity (with respect to a control healthy cell or control healthy tissue) to lower c-Myc expression and/or activity.
The method described herein should be preferably applied to cells (from human or animal origin) that express (either endogenously or recombinantly) the A and β isoforms of the integrin α6 subunit. As indicated above, some epithelial cells endogenously express both isoform and can be advantageously used in this method.
Epithelial cells compose the epithelium, a tissue that lines the cavities and surfaces of structures throughout the body. Epithelial cells usually lie on top of connective tissue, and the two layers are separated and linked by a basement membrane. Epithelial tissue can be divided into two groups depending on the number of layers of which it is composes. Epithelial tissue which is only one cell thick is known as simple epithelium. If it is two or more cells thick, it is known as stratified epithelium. Simple epithelium can be subdivided according to the shape and function of its cells:
In an embodiment, the methods described herein are applied to cells derived from the gastro-intestinal tract such as, for example, those of the colon. Even though the methods described herein can be applied to any type of cells, because a low B:A ratio is indicative of an hyperproliferative state, the treatment method described herein can be advantageously used for the inhibition of proliferation of a malignant cell. The malignant cell can be from either a primary tumor or a metastasis.
As indicated above and shown below, a low B:A ratio of the α6 integrin is associated with an hyperproliferative state. As such, in cells where proliferation rate should be increased to return or achieve to homeostasis, the present application also provides a method of increasing the proliferation of a cell. In an embodiment, this method comprises decreasing the ratio B:A ratio of the α6 integrin. In an embodiment, this is achieved by expressing preferably the A isoform of the integrin α6 subunit in the cell. In another embodiment, this can also be achieved by increasing the stability of the mRNA encoding the A of the integrin α6 subunit in a cell.
The modulation of expression of the B and A isoforms can be achieved using genetic engineering means. Such genetic means can be an vector appropriate for gene therapy that, when introduced in a cell, favors the expression of one isoform and consequently decreases the B:A ratio balance of the α6 integrins in the cell. Another genetic means can be a vector appropriate for gene therapy that, when introduced in a cell, limits the expression of one isoform and consequently decreases the B:A ratio balance of the α6 integrins in the cell. A combination of both types of vectors is also contemplated herein.
The modulation of expression of the B and A isoforms can be also be achieved using a small molecule (e.g. agent) that is capable of favoring or inhibiting the expression of one of the two (or both) isoforms or the activity of one (or both) isoforms.
Cells (animal or human) having a specific need for augmenting their proliferation rate can be submitted to the method described herein. Care should be taken in applying this methods not to dysregulate cellular proliferation and cause a cancer or augment the predisposition of cancer to the treated cells. It is also contemplated that the method described herein may favor the up-regulation of the activity of c-Myc in the treated cells.
In order to augment the proliferation of a cell, the method contemplates either overstranscribing or increasing the stability an mRNA encoding the isoform A so as to increase the expression of the isoform A of the integrin α6 subunit. In an embodiment, the mRNA is encoded by a recombinant nucleic acid that can, optionally, be introduced into the cell. In another embodiment, the method also contemplates increasing the activity or stability of the isoform A so as to increase the expression of the isoform A (endogenous or recombinantly introduced) of the integrin α6 subunit.
Also contemplated herein is the use of an agent capable of increasing the expression or transcription of the B isoform for the inhibition of proliferation as well as for the manufacture of a medicament for the inhibition of proliferation of a cell. Such agent augments the ratio between the B and A isoforms. In addition, the use of an agent capable of increasing the expression or transcription of the A isoform for the promotion of proliferation as well as for the manufacture of a medicament for the promotion of proliferation of a cell is also contemplated. In that embodiment, the agent preferably lowers the ratio between the B and A isoforms.
Since the B:A ration of the isoforms of the integrin α6 subunit is linked to the proliferation state of a cell, it can also be successfully used to as an indicator of cellular proliferation (e.g. proliferative state vs. quiescence). In return, this indicator can be used to determine the risk associated with the onset of an hyperproliferative cellular condition (such as cancer).
As such, in an embodiment, a method of diagnosing an hyperproliferative state in an individual is contemplated herewith. In a first step, the method comprises determining a ratio between the isoform B and the isoform A of an integrin α6 subunit in a cell (such as an epithelial cell) from the individual. This determination can either be made at the genomic level, transcript level and/or at the polypeptide level. In an embodiment, the determination can be made at a first level (transcript of polypeptide) and confirmed at a second level (transcript or polypeptide).
This diagnostic method can be embodied in a diagnostic system designed to perform the required steps. This diagnostic system comprises at least two modules: a first module for performing the determination of the ratio between the α6B and α6A isoforms and a second module for correlating the ratio to an hyperproliferative or an hypoproliferative state. The first module can comprise a detection module for determining the amount of α6B and α6A isoforms as well as a processor to calculate the ratio between the isoforms. As indicated above, this detection can be made either at the RNA level and/or the polypeptide level. The detection module relies on the addition of a label to the sample and the quantification of the signal from the label for determining the amount of the α6B and α6A isoforms. The signal of the label is quantified by the detection module and is linked to the amount of the α6B and α6A isoforms. This label can directly or indirectly be linked to a quantifier specific for the two isoforms. The detection module then processes the amounts obtained to generate a ratio of the two isoforms. The information (e.g. amount and ratio) gathered by the detection module is then processed by the second module for determining the correlation. This second module can use a processor for comparing the ratio obtained with the first module to a reference or control ratio (predetermined or obtained from an individual (or group of individuals) that are not afflicted with a proliferative disease and are thus considered healthy). The correlation module can then determine if the ratio obtained from the determination module is more likely associated with hyperproliferation, hypoproliferation or homeostasis and as such, the individual's susceptibility of having or developing the disease associated with proliferation.
As indicated above, the determination of the ratio can include the addition of a quantifier to the sample from the individual. The quantifier is a physical entity that enables the sample to be quantified. The sample can be purified or isolated prior to the addition of the quantifier. The quantifier can be, for example, an oligonucleotide specific for the isoform to be quantified, an antibody specific for the polypeptide to be quantified or a ligand specific for the enzyme to be quantified. The addition of the quantifier generates a quantifiable sample that can then be submitted to an assay for the determination of the quantity of nucleic acid and/or polypeptide. The quantifier is either directly linked to a label or adapted to be indirectly linked to a label for its processing in the detection module.
Once the concentration or amount of both isoforms has been determined, a ratio between the B and A isoform can be calculated and compared to a control ratio between the B and A isoform. A control ratio between the B and A isoform of the α6 integrin is either a value of about 1.5 (e.g. between 1.3 and 1.7) or the B:A ratio that has been determined in a cell type similar to the one of the cells of the sample and that is considered to have a normal proliferation rate. For example, a control ratio of epithelial cells can be calculated by first determining the amount or concentration of the B and A isoforms of the α6 integrin in a sample of a cell derived from a healthy individual known not be afflicted with a hyperproliferative state such as cancer (e.g. an individual free of cancer). Optionally or alternatively, the control ratio could also be calculated in cells/tissues from an individual experiencing cancer but derived from a healthy section of a tissue which is not associated with an hyperpoliferative disease (such as a resection margin). A B:A ratio associated with an hyperproliferative disease, especially for colon cancer cells, is lower than 1.5 and is usually of about 1.1 (e.g. between 0.9 and 1.3).
This diagnostic method is particularly useful in the determination of cancer and, in an embodiment, carcinoma (cancer associated with epithelial cells). The diagnostic method described herein is not limited to any type of cancer. However, it can be successfully used in the diagnosis of cancers associated with the gastro-intestinal tract, such as colon cancer.
The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope.
Tissues. Primary tissues of healthy adult ileum were obtained from Quebec Transplant (Quebec, Canada). Primary extracts of fully differentiated villus enterocytes were obtained according to a previously published protocol (Perreault and Beaulieu, 1998). All tissues were obtained in accordance with protocols approved by the local Institutional Human Research Review Committee. The preparation and embedding of tissues for cryosectioning and RNA extraction was performed as described previously (Ni et al., 2005). Primary antibodies. An antibody recognizing both splice variants of integrin α6 (G0H3) (Sonnenberg et al., 1987) and antibodies recognizing α6A (1A10) and α6B (6B4) (Hogervorst et al., 1993) were obtained from Dr. A. Sonnenberg (Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam). Subsequently, these antibodies were obtained from Santa Cruz™ (Santa Cruz, Calif.; G0H3), Chemicon™ (Temecula, Calif.; 1A10) and MUbio Products™ (Maastricht, The Netherlands; 6B4). A rabbit polyclonal α6A (α6-cytoA) (de Curtis and Reichardt, 1993) was obtained from Dr. de Curtis (Department of Molecular Pathology and Medicine, San Raffaele Scientific Institute, Milan, Italy), anti-Ki67 (KiS5, Chemicon™), anti-lysozyme (DAKOCytomation™) and anti β-actin (C4, Chemicon™) were also used.
Indirect immunofluorescence. Cryosections were fixed in 2% paraformaldehyde for the detection of α6, α6A, Ki67 and lysozyme or in −20° C. ethanol for the detection of α6B and processed as described previously (Ni et al., 2005). In all cases, no immunofluorescent staining was observed when a mix of mouse and rabbit non-immune sera replaced primary antibodies.
Western blot. Western blots were performed as SDS-PAGE under non-denaturing conditions as previously described (Ni et al., 2005). After transfer of the separated samples to a nitrocellulose membrane (BioRad™, Hercules, Calif.) unspecific protein binding to the membrane was blocked by 2% BSA/0.1% Tween™ followed by incubation with the α6A 1A10 monoclonal antibody. Following detection, the membrane was stripped of antibody by incubation in stripping solution (50 mM Tris (pH 6.8), 2% SDS, 100 mM β-mercaptoethanol) at 50° C. for 20 minutes after which the membrane was reprobed with the α6B 6B4 antibody using 2% BSA/0.1% Tween™ as blocking solution. Finally, the membrane was restripped and reprobed with a β-actin antibody in 5% skim milk powder/0.1% Tween™ as an input control.
Plasmids and plasmid construction. The β-catenin/TCF4 responsive luciferase reporter plasmid, TOPFlash™ (Upstate, Charlottesville, Va.) has been characterized elsewhere (Korinek et al., 1997). Firefly luciferase reporter plasmids carrying promoters of the differentiation markers lactase-phlorizin hydrolase (pGL3-LPH1085-13910T) (Troelsen et al., 2003), intestinal alkaline phosphatase (pALPI—566) (Olsen et al., 2005) and sucrase-isomaltase (pSI-202/+54) (Boudreau et al., 2002) have been characterized elsewhere. The dipeptidyl peptidase IV (DPPIV) promoter plasmid was generated in our lab by PCR-amplification of 1382 by of the immediate 5′ promoter of DPPIV (sense primer: 5′-CGGGGTACCTTGGAAGAGGGAGGAGGAG-3′ (SEQ ID NO: 5), antisense primer: 5′-GAAGATCTAGTCACTCGCCGCTGGCA-3′ (SEQ ID NO: 6)) followed by Kpn I and Bgl II (underlined sequences) mediated insertion into pGL3, yielding the plasmid pGL3/Prom.dppIV. An expression vector containing the cDNA of integrin α6A, pRc/CMV-α6A (Delwel et al., 1993), was obtained from Dr. Sonnenberg (Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands). For α6B, the cDNA encoding the cytoplasmic tail of the integrin α6A subunit in pRc/CMV-α6A was replaced by the cDNA encoding the cytoplasmic tail of the integrin α6B subunit by Xbal digestion of the recipient (pRc/CMV-α6A) and donor (pPCR-Script-α6B) vectors followed by ligation, generating pRc/CMV-α6B.
Cell culture. The crypt-like human intestinal epithelial HIEC cells and Caco-2/15 cells were grown as described previously (Basora et al., 1999; Perreault and Beaulieu, 1996; Vachon and Beaulieu, 1995).
RT-PCR. Primers used to co-amplify the α6A and α6B transcripts were sense: 5′-CTAACGGAGTCTCACAACTC-3′ (SEQ ID NO: 7) and antisense: 5′-AGTTAAAACTGTAGGTTCG-3′ (SEQ ID NO: 8). Each cycle was composed of template denaturation at 94° C. for 1 minute, primer annealing at 65° C. for 1 minute and elongation at 72° C. for 1 minute. The primer annealing temperature was decreased by 0.5° C. after each round of amplification for 40 cycles followed by a final 15 cycles at an annealing temperature of 45° C.
Transfection and luciferase measurement. Caco-2/15 cells were transfected using FuGENE™ transfection agent (Roche, Indianapolis, Ind.). Firefly and renilla luciferase activities were measured using the Dual-Luciferase® Reporter Assay System (Promega Corporation, Madison, Wis.) according to the manufacturer's instructions as described previously (Escaffit et al., 2005).
As shown previously for the 134 subunit (Basora et al., 1999), immunodetection of the α6 integrin subunit using an antibody directed against the extracellular domain (G0H3) (Sonnenberg et al., 1987) yielded ubiquitous staining at the base of the epithelial cells in both villus and crypt (
A competitive RT-PCR was then performed using primers that amplify the transcripts of both α6 variants from cDNA originating from the normal crypt-like human cell line HIEC and primary human villus epithelial cells, as well as from the Caco-2/15 cell line that undergoes an intestinal differentiation program at postconfluence. A clear shift from a high α6A/α6B transcript ratio to a low ratio was seen accompanying differentiation at different stages of enterocytic differentiation (
Distinct patterns of expression for the two α6 variants have been reported in different organs during development (de Curtis and Reichardt, 1993; Segat et al., 2002; Thorsteinsdottir et al., 1995) suggesting a functional importance of the expression ratio of the two forms. The exclusive expression of α6A in a rapidly dividing cellular compartment is known from the epidermis (Hogervorst et al., 1993). Interestingly, it has been suggested that the ratio of the two variants can determine cellular behavior and that a proper cellular response is dependent on the presence of both variants rather than a substitution of one with the other (Segat et al., 2002). As shown herein, a modulation of the α6A/α6B ratio in intestinal cells was observed rather than the replacement of one α6 variant with the other.
In order to verify whether the reduction of the α6A/α6B ratio was related to differentiation, Caco-2/15 cells were co-transfected with reporter vectors carrying promoters of the enterocytic differentiation markers sucrase-isomaltase, intestinal alkaline phosphatase, lactase-phlorizin hydrolase or dipeptidyl peptidase IV (DPPIV) and expression vectors encoding α6A (pRc/CMV-α6A) or α6B (pRc/CMV-α6B). As illustrated with DPPIV (
The ability of the two variants to differentially affect intracellular pathways associated with enterocytic proliferation was performed by co-transfecting the two integrin α6 variants with a reporter plasmid responding to β-catenin/TCF (TOPFlash™) activity. This activity is associated with cell-cycle progression (Korinek et al., 1997). The β-catenin/TCF complex was found to be significantly and specifically stimulated by α6A (
It was previously demonstrated that the α6β4 integrin is the only α6 containing integrin in the human intestine (Basora et al., 1999). In this context, it is noteworthy that there is substantial evidence for the differential capacity of the α6Aβ1 and α6Bβ1 integrins to initiate intracellular signaling (Shaw et al., 1995; Wei et al., 1998) and facilitate migration on laminin (Shaw and Mercurio, 1995). However, no study has ever demonstrated a functional difference between the α6Aβ4 and α6Bβ4 integrins. The finding that the α6Aβ4 integrin is predominant in intestinal proliferative cells both in the intact intestine and in established intestinal cell lines suggests that the α6A/α6B ratio plays an important role in intestinal homeostasis.
Tissues. Samples of adult colon were obtained from patients between the ages of 49 and 86 years who had undergone surgical treatment for colon adenocarcinoma. For each patient, samples from the primary tumor and from non-diseased areas (at least 10 cm distant from the lesion) corresponding to the resection margin were obtained. Diagnoses of adenocarcinoma were confirmed by pathologists. Staging of the carcinomas was according to Astler and Cotler (1954). Resection margins of colon specimens obtained from patients undergoing surgery for pathologies other than colon cancer (bowel obstructions, diverticulosis, etc.) were also used for immunofluorescence. All tissues were obtained in accordance with protocols approved by the local Institutional Human Research Review Committee for the use of human material. The preparation and embedding of tissues for cryosectioning and RNA extraction was performed as described previously (Beaulieu, 1992). Additional paired samples (resection margin and confirmed carcinomas) were obtained from the Cooperative Human Tissue Network (Midwestern Division, Ohio State University, OH, USA), which is funded by the National Cancer Institute.
Indirect immunofluorescence. Cryosections 3 μm thick were fixed in 2% paraformaldehyde (α6A, Ki67 and Rbm19) or −20° C. ethanol (α6B). Nonspecific protein-protein interactions were blocked for one hour at room temperature by immersion of slides in 10% goat serum (α6A) or 2% BSA (α6B) in PBS followed by incubation with the primary antibodies diluted 1:200 in their respective blocking solutions overnight at room temperature. Following extensive washing in PBS, the slides were incubated with either FITC or rhodamine conjugated secondary antibodies raised against mouse and rabbit IgG (Chemicon™) respectively, for one hour at room temperature before being washed in PBS. The slides were stained with Evans Blue (0.01% in PBS) before being mounted in glycerol:PBS (9:1) containing 0.1% paraphenylenediamine and observed for fluorescence with a Leica Reichart Polyvar 2™ microscope (Leica Canada, Saint-Laurent, QC) equipped with a Leica DFC300 FX™ digital color camera. In all cases, no immunofluorescent staining was observed when a mix of mouse and rabbit non-immune sera replaced primary antibodies.
Primary antibodies. Two antibodies recognizing integrin α6A (1A10) and α6B (6B4) (Hogervost et al., 1993) were obtained from Dr. A. Sonnenberg (Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands). Subsequently, these antibodies were obtained from Chemicon™ (Temecula, Calif.; 1A10) and MUbio Products™ (Maastricht, The Netherlands; 6B4). Mabs 1A10 and 6B4 were used for western blots and co-immunoprecipitation. For indirect immunofluorescence, 6B4 and a rabbit polyclonal α6A (α6-cytoA) (de Curtis and Reichardt, 1993) antibody was obtained and employed in place of 1A10. This antibody was obtained from Dr. de Curtis (Department of Molecular Pathology and Medicine, San Raffaele Scientific Institute, Milan, Italy). The anti-Ki67 monoclonal antibody KiS5 and the polyclonal anti-lysozyme antiserum were from Chemicon™ and DAKOCytomation™ (Glostrup, Denmark). The anti-progenitor cells Rbm19 antibody (Lorenzen et al., 2005) was obtained from Dr. Alan M. Mayer (Department of Pediatrics, Medical College of Wisconsin, Wis.). Bin1 was detected using 99D from Santa Cruz™ (Santa Cruz, Calif.). To probe for β-actin, the antibody C4 from Chemicon™ was employed.
Plasmids and plasmid construction. The c-Myc responsive luciferase reporter plasmid, pMyc-TA-Luc™ (Clontech, Mountain View, Calif.), carrys six c-Myc binding sequences in front of the minimal TATA box from the herpes simplex thymidine kinase (HSV-TK) promoter. An Rb responsive luciferase reported plasmid, pRb-TA-Luc™ (Clontech) was also used. An expression vector containing the cDNA of integrin α6A, pRc/CMV-α6A (Delwel et al., 1993), was obtained from Dr. Sonnenberg (Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands). The α6A cDNA was subcloned into the viral expression vector pLPCX™ (BD Bioscience Clontech, Mississauga, ON) by a non-directional strategy using HindIII. Correct orientation was verified by restriction enzyme analysis. cDNA originating from a preparation of fetal epithelial enterocytes separated from the mesenchyme using Matrisperse™ (BD Biosciences, Mississauga, ON) as described previously (Perreault and Beaulieu, 1998) was used as a template for PCR amplification of the cytoplasmic tail of the α6B subunit using Pwo Polymerase™ (Roche, Laval, QC). The upstream primer (5′ TGCTGAAAGAAAATACCAGA 3′ (SEQ ID NO: 9)) spanned an endogenous Xbal site, while the downstream primer (5′GCTCTAGAGAAAAAGCAGTTTGGGTACT 3′ (SEQ ID NO: 10)) introduced another (underlined sequence). The amplified DNA was ligated into pPCR-Script™ (Stratagene, La Jolla, Calif.) and verified for fidelity by sequencing. Subsequently, the cDNA encoding the cytoplasmic tail of the integrin α6A subunit in pRc/CMV-α6A was replaced by the cDNA encoding the cytoplasmic tail of the integrin α6B subunit by Xbal digestion of the recipient (pRc/CMV-α6A) and donor (pPCR-Script-α6B) vectors followed by ligation, generating pRc/CMV-α6B. The cDNA encoding the integrin α6B subunit was subcloned into the pLPCX vector using the same strategy as for α6A. A mammalian episomal expression vector, pEEP1™, was used to generate populations of Caco-2/15 cells over-expressing the two integrin α6 splice variants. Integrin α6A or α6B subunit cDNA was excised from pRc/CMV-α6A and pRc/CMV-α6B, respectively, using HindIII, Klenow filled and blunt-end ligated into a Klenow filled Notl site in pEEP1, generating pEEP1-α6A and pEEP1-α6B.
Cell culture and generation of colon cancer cells over-expressing α6A and α6B. The colon cancer cell line, Caco-2/15 was grown in DMEM™ (GIBCO, Burlington, ON) supplemented with 10% fetal bovine serum (ICN Biomedicals, Aurora, Ohio), 1% HEPES and 1% Glutamax™ (both from GIBCO, Burlington, ON) as described previously (Beaulieu and Quaroni, 1991). The colon cancer cell lines HT-29, COLO 201, DLD-1, HCT 116, T84, SW480 and SW620 were grown in accordance with instructions provided by the ATCC (Rockville, Md.). All cells were grown in an atmosphere of 95% air and 5% CO2 at 37° C.
The pEEP1-α6A and pEEP1-α6B plasmids were introduced into 1×106 Caco-2/15 cells by nucleofection using the Amaxa Biosystem Nucleofection Kit™ (ESBE Scientific, St.-Laurent, QC) using the T-20 setting. Immediately following nucleofection, the cells were seeded onto collagen coated cell culture dishes (Falcon, Franklin Lakes, N.J.). 24 hours post-nucleofection the cells were subjected to hygromycin (Multicell, St.-Bruno, QC) selection at a concentration of 200 μg/ml. This selection pressure was maintained throughout the experimental period to ensure continuous replication and transfer of the episomal plasmid. Forced expression of the α6A and α6B subunits was monitored by western blot.
BrdU incorporation and staining. BrdU incorporation and staining was performed according to the manufacturer's (Roche Applied Science, Laval, QC) instructions. Briefly, 24 hours after plating of cells in LabTeks™ (Nalgene Nunc, Rochester, N.Y.) the cells were incubated for two hours with normal medium containing BrdU then immediately subjected to BrdU and DAPI staining. For each condition, two random fields per well were counted for DAPI and BrdU positive cells and the BrdU positive cell population was determined as a percentage of total DAPI positive cells. All experiments were performed in quadruplicate and repeated three times.
Western blot and immunoprecipitation. Western blots were performed as SDS-PAGE under non-denaturing conditions using 120 μg of whole cell lysate per lane. After transfer of the separated samples to a nitrocellulose membrane (BioRad, Hercules, Calif.) unspecific protein binding to the membrane was blocked by 5% skim milk-powder in PBS-0.1% Tween™ followed by incubation with the α6A 1A10 monoclonal antibody. Following detection, the membrane was stripped of antibody by incubation in stripping solution (50 mM Tris (pH 6.8), 2% SDS, 100 mM 3-mercaptoethanol) at 50° C. for 20 minutes after which the membrane was reprobed with the α6B 6B4 antibody using 2% BSA/0.1% Tween™ as blocking solution. Finally, the membrane was restripped and reprobed with an β-actin antibody as an input control.
For immunoprecipitation of α6β4 and α6β1, newly confluent Caco-2/15 cells and keratinocytes (obtained from Dr L. Germain, LOEX, Université Laval, Québec, QC) were metabolically labeled using Promix™ [35S]methionine and cystine (Amersham Pharmacia Biotech), 200 μCi/ml for 6 h. Cells were lysed and processed as previously described (Basora et al., 1999) for immunoprecipitation of α6-containing integrins with the antibody G0H3 and Protein-G Sepharose™ (Invitrogen). Radioactive samples were analyzed under reduced and nonreduced conditions by SDS PAGE (Basora et al., 1999).
RT-PCR. First strand cDNA synthesis was performed with 2 pg total RNA using oligo(dT)12-18™ (Amersham Pharmacia, Bay d'Urfé, QC) as primer and Omniscript reverse Transcriptase™ (Qiagen, Mississauga, ON) for synthesis. Primers used to co-amplify the α6A and α6B transcripts using 1/50 of the synthesized cDNA above were sense: 5′-CTAACGGAGTCTCACAACTC-3′(SEQ ID NO: 7) and antisense: 5′-AGTTAAAACTGTAGGTTCG-3′ (SEQ ID NO: 8). Each cycle was composed of template denaturation at 94° C. for 1 minute, primer annealing at 65° C. for 1 minute and elongation at 72° C. for 1 minute. The primer annealing temperature was decreased by 0.5° C. after each round of amplification for 40 cycles followed by a final 15 cycles at an annealing temperature of 45° C.
Real-time quantitative RT-PCR. Quantitative RT-PCR was performed as previously described (Dydensborg et al., 2006). Three different primer pairs for the integrin α6 subunit were tested for amplification efficiency and fidelity. The primer pair termed α6PD-2 was chosen for amplification of cDNA coding for the integrin α6 subunit based on a superior amplification efficiency and lack of primer dimer formation as assessed by melting curve analysis. The Ct-values were converted into relative expression values compared to a pooled RNA standard (QPCR Human Reference Total RNA™, Stratagene, La Jolla, Calif.) before normalization of α6 expression against a weighted average of three normalizing genes (B2M, MTR & MAN1B1) using the geNorm applet (Vandesompele et al., 2002). Briefly, this algorithm normalizes a gene of interest against several normalizing genes, rather than against a single gene, thus obtaining an analysis of expression that is less likely to be impacted by any random fluctuations in the expression level of the normalizing gene(s). The sequences of the α6PD-2 primer pairs were: sense 5′ TGGGATATGCCTCCAGGTT 3′ (SEQ ID NO: 11), antisense 5′ TGTAGCCACAGGGTTTCCTC 3′ (SEQ ID NO: 12). Primer pairs for B2M, MAN1B1, and MTR have been described previously (Dydensborg et al., 2006). The annealing temperatures of the reactions were 57° C. (α6) or 58° C. (B2M, MAN1B1 and MTR) and the amplification efficiencies of the reactions were 100.7%, 105.7%, 98.9% and 96.8% for α6, B2M, MTR and MAN1B1, respectively, as determined by standard curve analysis.
Transfection and luciferase measurement. Caco-2/15 cells were seeded in 24-well plates (Falcon, Franklin Lakes, N.J.) and grown to 40-60% confluence before being transiently transfected in serum-free medium using FuGENE™ transfection agent (Roche, Indianapolis, Ind.) in a μg DNA to μl transfection agent ratio of 1:9. Cells were kept under normal growth conditions after transfection. All transfections were performed as co-transfections using a renilla luciferase expression plasmid to establish an internal control for transfection efficiency. Promoter activities of the various reporter plasmids were expressed using the arbitrary unit “RLU” (relative luciferase units). Numeric values of CMV promoters in control transfections (empty vector) were kept equal to experimental (α6A and α6B) numeric values by adjusting the absolute level of plasmid as measured by μg. DNA concentrations in transfections were kept constant with the addition of pBluescript SK+™ (Stratagene, Cedar Creek, Tex.). Equal amounts (25 ng) of reporter plasmid and expression vector (pRc/CMV-α6A and pRc/CMV-α6B) were cotransfected with 2 ng of pCMV-Renilla per well. Firefly and renilla luciferase activity was measured using the Dual-Luciferase® Reporter Assay System (Promega Corporation, Madison, Wis.) according to the manufacturer's instructions using an Orion microplate Luminometer™ from Berthold (Montreal Biotech, Kirkland, QC) for detection of the chemiluminescent signal. Individual experimental results were normalized to the average of the RLU of the empty vector cotransfectant in the corresponding experiment.
Expression of α6 subunit variants in the normal colon. The ubiquitous presence of the α6 dimerization partner β4 along the glandular unit of the human colon has already been shown (Ni et al., 2005). The delineation of the specific expression patterns of the α6A and α6B splice variants in the normal human adult colonic mucosa was thus performed (
α6 is up-regulated in colon cancer cells and undergoes a shift away from the α6B variant. The α6β4 integrin is frequently up-regulated in several cancer types (Guo and Giancotti, 2004). Using quantitative PCR, it was observed that a significant up-regulation of total α6 expression in paired primary tumor samples versus patient matched normal resection margins (RM) (
It was next investigated if the relative α6A and α6B levels in 6 well established colon cancer cell lines to see if this characteristic was conserved. All six cell lines tested predominantly expressed the A-variant (
α6B inhibits proliferation in colon cancer cells. The well-characterized colon cancer cell line Caco-2/15 which has the ability to constitutively deposit significant amounts of laminins (Vachon and Beaulieu, 1995) (the α6β4 ligand), was used to evaluate the hypothesis that an altered α6A/α6B ratio could be of functional importance for the proliferative status of colon cancer cells. The creation of a stable cell lines overexpressing α6A and α6B was attempted. However, the maintenance of the α6B cells in long term cultures was not possible, suggesting that overexpression of the α6B variant impaired cell proliferation. The nature of the mRNA splicing events underlying the formation of the two variants (exon exclusion leads to formation of the α6B variant) unfortunately precluded the specific depletion of the α6B variant by RNAi. Studies on the nucleofected cell populations were performed shortly following the 10-day antibiotic selection period ensuring that all cells expressed their respective episomal vectors (
α6B inhibits c-Myc activity in colon cancer cells. Colon cancer cells and glandular proliferative cells require the activity of the proto-oncogene c-Myc for proliferation (van de Wetering et al., 2002). The ability of the α6B subunit to modulate c-Myc activity was then evaluated by performing co-transfections of the two integrin α6 variants with a luciferase reporter plasmid responding to c-Myc activity (pMyc-Ta-Luc). Experiments performed in colon cancer cells (Caco-2/15) demonstrated that pMyc-TA-luc activity was significantly down-regulated by α6B overexpression (
The functional importance of the instructive interactions between the epithelial cell compartment with the surrounding extracellular milieu has long been recognized in the intestinal tract (Beaulieu, 1997; Teller and Beaulieu, 2001). Observations that the α6A and α6B splice variants are differentially expressed in progenitor and mature cells of the colonic epithelium, located in the lower and upper half of the glands respectively (Babyatsky and Podolsky, 1995), are consistent with previous findings showing the existence of distinct microenvironments between the proliferative and differentiation compartments in the gut (Chung and Mercurio, 2004; Basora et al., 1997). More importantly, it suggests that the intrinsic role of each α6 variant is distinct. The finding that the α6B variant exclusively repressed proliferation concurs with its low level of expression in the proliferative zone and its predominance in the non-proliferative compartments of the colon as shown herein, as well as in the small intestine (Dysenborg et al., 2009).
Colon cancer is the third leading cause of cancer related mortality in the United States (Jemal et al., 2008). The occurrence and development of most colon cancers follows a stereotypical pattern of a progressive accumulation of gain- and loss of function mutations of oncogenes and tumor suppressor genes (Radke and Clevers, 2005). It is also clear that neoplastic cells tend to up-regulate the expression of integrins favoring their migration, survival and proliferation during the complex multistep generation of tumors (Guo and Giancotti, 2004). The mechanistic and biochemical roles of the α6β4 integrin in carcinoma biology are well documented (Mercurio and Rabinovitz, 2001) and the up-regulation in primary colon carcinomas of the β4 (Ni et al., 2005) and, as shown here, the α6 subunit reflects the importance of this integrin in colon cancer progression. The results presented herein describe novel aspects of the biology of the α6β4 integrin variants in colon cancer. Thus, after having identified that distinct forms of the integrin β4 subunit were expressed in normal intestinal proliferative vs cancer cells (Ni et al., 2005), it was observed that there is a shift in α6 variant expression from a predominantly high α6B/α6A ratio in the normal colon to a predominantly low α6B/α6A ratio in primary tumors.
c-Myc is a key player in cancer formation and progression due to the numerous roles it plays in proliferation control and apoptosis (Adhikary and Eilers, 2005). Indeed, c-Myc expression has been demonstrated to be upregulated in 70% of colon cancers (Erisman et al., 1985) and its well documented effects include stimulation of cyclinD expression, inhibition of p21CIP1 and p27KIP1 expression and inactivation of Rb, leading to enhanced G1 to S-phase transition (Adhikary and Eilers, 2005). Given the central role of c-Myc in the control of critical cellular events, its transcriptional functions are tightly regulated by several molecular pathways (Cole and Nikiforov, 2006). Prototypically, the control of cellular c-Myc levels are largely attributed to the canonical activity of the Wnt-pathway (Clevers, 2006). However, the activity and expression levels of c-Myc are regulated by several other molecular mechanisms including distinct signaling pathways and interaction with binding partners (Adhikary and Eilers, 2005, Sakamuro and Prendergast, 1999). For instance, the nucleoshuttling scaffold protein Bridging Integrator-1 (Bin1) has been shown to strongly inhibit c-Myc transcriptional activity in a Wnt-pathway independent manner (Elliot et al, 1999; Kinney et al., 2008). Interestingly, Bin1 can selectively interact with the cytoplasmic domain of the α6B integrin subunit in yeast two-hybrid studies (Wixler et al., 1999) and its expression has been reported to be associated with the non-proliferative cell population in the normal intestine (DuHadaway et al., 2003) suggesting a possible mechanism for the inhibitory effect of α6Bβ4 on c-Myc activity.
While there is substantial evidence for the differential capacity of the α6Aβ1 and α6Bβ1 integrins to initiate intracellular signalling (Shaw et al., 1995; Wei et al., 1998) and facilitate migration on laminin (Shaw et al., 1995), these studies have all found that the α6Aβ1 integrin functions as the “active” integrin, whereas the α6Bβ1 integrin appears to have no major active role in these events (Shaw et al., 1995; Wei et al., 1998; Ferletta et al., 2003; Shaw et al., 1995; Guimond et al, 1998). In this context it is noteworthy that overexpression of the α6A variant in colon cancer cells did not stimulate proliferation as compared to the control cells, but rather the α6B variant actively inhibited proliferation and c-Myc activity. It is furthermore noteworthy that the α6A/B splice variants can dimerize with both the β1 and the β4 subunits to form two distinct functional integrins, α6β1 and α6β4, but that the α6 subunit preferentially dimerizes with the β4 subunit (Basora et al., 1999; Hogervost et al., 1993; Hemler et al., 1989), as confirmed herein. Thus, the specific ability of the α6B subunit to inhibit proliferation, in accordance with its predominant expression in the quiescent compartment of the normal colon and its down regulation in primary colon cancers and adenocarcinoma cell lines, strongly suggests that the expression and ratio of the α6A and α6B splice variants are inherent to normal intestinal homeostasis and exploited by colon cancer cells.
Caco-2/15 cells have been infected with a lentiviral-based system (MISSION™ from Sigma) containing the shRNA sequence GATCATTATGATGCCACATATC (SEQ ID NO: 13) for silencing exon A of the α6A isoform (Shα6A cells) or a control lentivirus (Shc cells). The TCF/β-catenin activity of these cells was then assessed using the TOP/FOP flash luciferase assay as described in Example II. Proliferation of these cells was also quantified with the BrdU assay, as described in Example II. In addition, these cells have been injected into immuno-compromised mice and the size of the tumor they generate has been measured as a function of time.
As shown in
Silencing exon A of the alpha6 isoform in four other colon cancer cell lines (HT-29, T84, SW480 and SW620) using same lentiviral infection procedure resulted in significant reduction of proliferation in three of the four cell lines as quantified with the BrdU assay (data not shown).
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims.
This application claims priority on U.S. applications 61/121,337 filed Dec. 10, 2008 and 61/177,398 filed May 12, 2009, the entire content of both application is hereby incorporated by reference.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CA2009/001802 | 12/10/2009 | WO | 00 | 8/26/2011 |
| Number | Date | Country | |
|---|---|---|---|
| 61121337 | Dec 2008 | US | |
| 61177398 | May 2009 | US |
