Pseudorabies virus deletion mutants involving the EPO and LLT genes

Abstract

An attenuated pseudorabies virus (PRV) having a reduced ability to reactivate from latency is produced by introducing (1) a genomic modification in the early protein 0 (EP0) gene whereby said virus is characterized by the inability to express the early protein 0; or (2) a genomic modification in the large latency transcript (LLT) gene whereby said virus is characterized by disruption of the synthesis of said large latency transcript; or (3) the genomic modifications described in both (1) and (2). The attenuated virus is useful in a vaccine for psuedorabies-susceptible animals, particularly swine. Swine vaccinated with a deletion mutant in the EP0/LLT overlap region displayed reduced virus shedding and fewer clinical signs than animals inoculated with a wild type virus. The deletion mutant-vaccinated swine also harbored less PRV DNA in the nervous tissue and showed reduced ability to reactivate the virus.

Description

BACKGROUND OF THE INVENTION

1. Field of the Invention

Pseudorabies (Aujeszky's disease) is caused by a herpesvirus belonging to the alphaherpesvirus subfamily. It is a contagious and sometimes fatal disease of swine. Infection during gestation can result in fetal death and abortion. It is estimated that annual losses to the swine industry due to pseudorabies is as high as 60 million dollars in the United States. This economic impact has resulted in a decision by the swine industry and regulatory officials to eradicate the pseudorabies virus (PRV). The virus also infects cattle, sheep, canines, and felines.

During the initial phase of the acute disease, PRV replicates in the upper respiratory tract. Virus can then disseminate by vascular, lymphoid and nervous tissues [D. P. Gustafson, In Diseases of Swine, ed. by A. D. Leman, et al., 6th edition, pp. 274-289, Iowa State University Press, Ames, IA]. Infectious virus and/or viral genome can be detected from lung, tonsil, brain stem, trigeminal ganglia and peripheral blood lymphocytes [F. Wang et al., J. Leukocyte Biol. 43: 256-264 (1988); G. Wittmann et al., Arch. Virol. 66: 227-240 (1980); H. J. Rhiza In Latent Herpes Virus Infections in Veterinary Medicine, ed. by G. Wittman et al., Martinus Nijhoff publishers, The Hague pp. 429-444 (1984); H. J. Rhiza et al., In Proc. 14th International Herpes Workshop, Nyborg, Denmark, p. 55 (1989)]. Clinical symptoms include intense pruritis, violent excitement, fits, paralysis, and eventually death. Upon cessation of clinical signs and recovery from infection, the virus is not eliminated from the animal and persists with the animal indefinitely. Sometimes, the infection is subclinical and goes unnoticed. The animal also becomes a carrier of pseudorabies. In either case, the virus exists in various cell types of the animal in a noninfectious form and is commonly known as a latent infection. The complete viral genome is present but fails to replicate fully to produce infectious virus. The latent virus can reactivate spontaneously or be induced to reactivate by exogenous stimuli, the carrier animal disseminates infectious virus to susceptible animals which may result in death of the animal or establishment of new PRV carriers. Thus, the latent virus is the source and reservoir of the disease and is regarded as an obstacle to the successful control and eradication of PRV.

This invention relates to a PRV deletion mutant vaccine characterized by a high degree of immunogenicity and yet a significant attenuation and reduced level of latency as compared to field strains of the virus.

2. Description of the Prior Art

A. The PRY Genome and Transcription Products

The PRV genome is a linear, duplex DNA molecule with a molecular weight of approximately 90.times.10.sup.6 [T. Ben-Porat et al., "Molecular Biology of Pseudorabies Virus," In B. Roizman (ed.), The Herpesviruses, Vol. 3, Plenum Publishing Corporation, NY, pp. 105-173 (1985)]. The genome is organized into the unique long (U.sub.L), internal repeat (I.sub.R), unique short (U.sub.S), and terminal repeat (T.sub.R) sequences.

It is estimated that the genetic material is capable of coding for 50 to 100 viral genes. The transcription pattern of PRV in infected cells is extremely complex; however, the genes are expressed in a coordinated, and temporally regulated manner [L. T. Feldman et al., Virology 116: 250-263 (1982); Virology 97: 316-327 (1979); S. Ihara et al., Virology 131: 437-454 (1983); and T. Rakusanova et al., Virology 46: 877-889 (1971)]. In general, herpesvirus genes are categorized into three classes: immediate-early (IE), early, and late genes. The IE genes are transcribed immediately upon infection and do not require de novo protein synthesis. Transcription of early genes depends on IE protein expression and occurs before viral DNA replication. The late genes are transcribed after the onset of viral protein and DNA synthesis.

During herpesvirus latency, a restricted region of the viral genome is transcriptionally active. RNAs denoted as latency-associated transcripts (LATs) are detectable in animals latently infected with the virus [Stevens et al., Science 235: 1056-1059 (1987)]. For pseudorabies virus, the LATs are located downstream of the immediate-early (IE180) gene and in the antiparallel orientation. Since the pseudorabies LATs are the only genetic elements present during latency, it is expected that they play a role in the establishment, maintenance and/or reactivation of the latent virus.

PRV is similar in genomic structure and function to herpes simplex virus type 1 (HSV-1), which is also an alphaherpesvirinae.

On the one hand, many gene homologs have been reported between the two viruses; on the other hand, some genes present in HSV-1 are not present in PRV. There are five HSV-1 immediate-early genes (infected cell polypeptide 0 [ICP0], ICP4, ICP22, ICP27, and ICP47) and only one PRV immediate-early gene (IE180). Analysis of the DNA and deduced amino acid sequences showed that HSV-1 ICP4 and PRV IE180 share extensive homology at two specific regions of the polypeptide [A. K. Cheung, Nucleic Acids Res. 17: 4637-4646 (1989); Cheung et al., Virus Genes,4: 261-265 (1990); Vicek et al., Virus Genes, 2: 335-346 (1989)]. Biologically, these two viruses also exhibit many common characteristics, one of which is their ability to establish latency in their respective hosts.

The HSV-1 LATs, 2 kb or less, are transcribed in the opposite sense with respect to ICP0, and they overlap the 3' end of the ICP0 mRNA. They are not polyadenylated at the 3' end, and a protein product encoded by the LATs has not been identified. Recent reports suggested that there may be a polyadenylated 8.5-kb LAT [Dokson et al., J. Virol, 63: 3844-3851 (1989); Zwaagstra et al., Virus Genes, 64: 5019-5028 (1990)]; however, the exact nature of this transcript has not been fully elucidated. This RNA, designated the large latency transcript (LLT), has been proposed to overlap the entire ICP0 in the opposite orientation but does not overlap ICP4. It has been suggested that the LATs are stable introns derived from the 8.5-kb LLT.

The LATs of PRV were first localized to the 3' end of the immediate-early gene IE180 [A. K. Cheung, J. Virol., 63: 2908-2913 (1989)], a homolog of HSV-1 (ICP4 and not ICP0). They are transcribed in the antiparallel orientation with respect to IE180. Recent reports [Lokensgard et al, Arch. Virol., 110: 129-136 (1990); Priola et al., J. Virol., 64: 4755-4760 (1990)] indicated that PRV LATs are encoded by DNA sequences that extend over 14 kb of the viral genome. Several RNA species (0.95, 2.0, and 5.0 kb) have been reported, and apparently, contradictory results have been obtained regarding the poly(A) nature of the LATs.

B. PRY Vaccines

It is generally known that the herpesviruses genome contains nonessential regions, which can be modified to attenuate the virus. The extent of modification must be carefully controlled. A virus which is insufficiently attenuated will either retain pathogenicity or revert to virulent state. One which is too extensively attenuated will fail to elicit an adequate immune response. Appropriately attenuated viruses will manifest the safety of subunit vaccines and efficacy of live virus vaccines.

European Patent Publication No. 0 141 458 entitled "Deletion Mutant of a Herpesvirus and Vaccine Containing Same" contemplates the construction of attenuated PRV having deletions in the U.sub.S region or in the repeat sequences. Little information is given on attenuation by deletion in the repeat sequences.

U.S. Pat. No. 4,514,497, entitled "Modified Live Pseudorabies Viruses" teaches temperature resistant PRV having deletions in the thymidine kinase (Tk) gene located in the U.sub.L region.

Pat. No. PCT/US86/01804 entitled "Pseudorabies Virus Deletion Mutants and Vaccines Containing Same" assigned to Syntrovet Incorporation has indicated the importance of the junction region between the unique long and internal repeat region for the attenuation of PRV. However, there is no description of its involvement in PRV latency. This is not surprising, since the latency-associated transcripts for herpes simplex virus were first described in 1987, and those for PRV were not described until 1989 [first by Cheung, J. Virol. 63: 2908-2913 (July 1989); then by Lokengard et al., Arch. Virol. 110: 129-136 (1990)].

Kit et al., U.S. Pat. No. 4,711,850, herein incorporated by reference, teach the construction of PRV mutants containing deletion and/or insertion mutations in a major viral glycoprotein gene, g92, such that no antigenic polypeptides encoded by the viral gene are produced. Animals vaccinated with the routants can be distinguished from animals infected with PRV field strains and known PRV vaccines. A comprehensive discussion of PRV disease, the development of vaccines to control the disease, the genomes of PRV strains, and PRV envelope proteins is given in columns 1-11 of this patent.

SUMMARY OF THE INVENTION

As a prelude to this invention, Cheung [Journal of Virology, 65: 5260-5271 (1991)] has identified and sequenced an 8.5-kb PRV-specific poly(A)RNA species in the trigeminal ganglia of a latently infected swine. This mRNA, referred to herein as "PRV LLT", has an open reading frame (ORF) capable of encoding a 200-kDa protein. Cheung, supra, has also identified a PRV early polypeptide homologous to the HSV-1 ICP0, designated early protein 0 (EP0). The gene for PRV EP0 is transcribed to a 1.75 kb polyadenylated mRKA. The direction of transcription of the LLT gene is antiparallel to that of the IE180 gene and the EP0 gene. The latency transcript overlaps the entire IE180 gene and most of the EP0 gene.

In conjunction with these findings, we have discovered a novel region of the PRV genome suitable as a target for modification in the construction of an attenuated virus which has reduced ability to reactivate from latency. Attentuation can be achieved by functionally disabling the expression of the EP0 gene, or by disrupting the synthesis of the LLT, or both. In the preferred embodiment of the invention described below, a substantial portion of the EP0 gene and complementary portion of the overlapping LLT gene are deleted. The resultant virus is characterized by a significant level of attentuation and substantially reduced latency potential as compared to the field strains of the virus. Moreover, the deletion mutant retains the immunogenicity of the field strain.

In accordance with this discovery, it is an object of the invention to correlate the novel EP0 gene and the LLT with PRV virulence.

It is also an object of the invention to identify a strategy for disabling the EP0 gene and thereby blocking expression of the EP0 protein in PRV.

Another object of the invention is to produce an attenuated, PRV capable of eliciting a strong immune response in animals susceptible to the disease.

A further object of the invention is to provide a novel, nonpathogenic and highly protective PRV swine vaccine comprising the PRV having a substantial portion of the EP0 gene deleted.

Other objects and advantages of the invention will become readily apparent from the ensuing description.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 comprises: (A) a schematic diagram of the PRV genome and its BamHI restriction enzyme map; (B) an expanded diagram of BamHI-G, -P, -J, -I, and -E and KpnI-F and -E restriction fragments in this region; (C) a diagram of available genomic DNA nucleotide sequences of three different strains of PRV and the location of PRV IE180; (D) a diagram of six overlapping cDNA clones; (E) a diagram of the PRV LLT and three possible open reading frames thereof; (F) the intron boundaries of the LLT gene; and (G) a diagram depicting the localization of a cDNA clone and its corresponding EP0 transcript.

FIGS. 2a and 2b show the nucleotide sequence of the PRV LLT and predicted amino acid sequence of ORF-2.

FIG. 3 shows the nucleotide and deduced amino acid sequences of the EP0 gene.

FIG. 4 is a comparison of the deduced homologous protein domain of PRV EP0 with the protein domains of HSV-1 ICP0 and varicella-zoster gene 61.

FIG. 5 outlines a strategy to delete a portion of the latency gene and the EP0 gene simultaneously. The figure includes: (A) map unit and BamHI fragments of the PRV genome; (B) location of the LLT transcript and the immediately early gene (IE180) transcript; and (C) location of the EP0 transcript.

FIG. 6 is a schematic diagram showing the starting materials (plasmids ZAP38, plasmid Syntro A and wild type PRV DNA) and the procedures to generate a recombinant virus in which the 800 bp Stu-NcoI fragment of BamHI-P is replaced by the E. coli beta-galactosidase gene.

FIGS. 7a and 7b are a graphical depiction of the comparative body temperature profiles of swine following Indiana-Funkhauser (InFh) and EL.beta.-001 virus infection.

DETAILED DESCRIPTION OF THE INVENTION

"Vaccine" is defined herein in its broad sense to refer to any type of biological agent in an administrable form capable of stimulating an immune response in an animal inoculated with the vaccine. For purposes of this invention, the vaccine may comprise either the mutant virus itself or an immunogenic (antigenic) component thereof.

The basic strategy for constructing the vaccines of the invention is to first clone target PRV DNA sequences in a plasmid, and then to modify the cloned DNA prior to reinserting it into the viral genome. As previously mentioned and as discussed in further detail below, the modification should be sufficient to functionally disable the expression of the EP0 gene, to disrupt the synthesis of the LLT, or both. These genes are present in naturally-occurring and all commercial vaccine pseudorabies viruses. The modification may be in the form of a deletion, an insertion, or both. In the case of producing a deletion mutant, a hybrid plasmid containing the viral DNA and a selectable marker is treated with a restriction enzyme known to cause the desired deletion. The modified DNA is then reinserted into the viral genome for the purpose of rendering the virus nonpathogenic. The conventional technique for reinsertion is to co-transfect animal cells with both the modified viral DNA-containing plasmid and also wild type intact virus. The animal cells are cultured under suitable conditions to permit recombination of the modified viral DNA with the viral genome. The mutated virus is thereafter selected and recovered.

FIG. 1 depicts the relationship between the PRV genome fragments and transcripts pertinent to the ensuing discussion.

FIG. 1 (A) is a schematic diagram of the PRV genome and BamHI restriction enzyme map. The genome is organized into the unique long (U.sub.L), internal repeat (I.sub.R), unique short (U.sub.S), and terminal repeat (T.sub.R) sequences. FIG. 1 (B) is an expanded diagram of BamHI-G, -P, -J, -I, and -E and KpnI-F and -E restriction fragments in this region. FIG. 1 (C) shows available genomic DNA nucleotide sequences of three different strains of PRV (InFh, Ka, and Becker) and the location of PRV IE180. The direction of IE180 transcription is indicated by an arrow (leftward), and the poly(A) tail is indicated by a squiggle. Shaded areas represent the coding sequence. FIG. 1 (D) depicts six overlapping cDNA clones. The cDNA library was constructed with total cellular RNAs from the trigeminal ganglia of a latently infected swine. The standard method with oligo(dT) primer was used for cDNA synthesis [Gubler et al., Gene, 25: 263-269 (1983)] and the cDNA was cloned into the lambda gt10 vector system [Huyah et al., In D. M. Glover (ed.), vol I, IRL Press, Oxford, 49-78 (1985)]. Nick-translated probes derived from BamHI-P, -J, and -I were used to screen for PRV-specific clones. DNA inserts were exercised and subcloned into Bluescript plasmids (Stratagene), and the DNA sequences were determined by the dideoxy-chain termination method [Sanger et al., Proc. Natl. Acad. Sci. USA74: 5463-5467 (1977)]. Areas for which nucleotide sequences have been determined are stippled. Dotted lines indicate splicing. FIG. 1 (E) is the LLT. Points of interest are indicated by the first nucleotide of the element. The direction of transcription is rightward, with a poly(A) tail at the 3' end. Three possible ORFs are shaded; the coordinates for the coding sequences (based on PRV-InFh and -Ka) are also indicated. In FIG. 1 (F) intron boundaries are shown. The nucleotide sequence and deduced amino acid residues (in single-letter code) in the vicinity of the splice junctions are shown. The consensus dinucleotides present at the intron boundaries are underlined. Nucleotide 1510(+), together with nucleotides 6164 and 6165, codes for the glycine residue. FIG. 1 (G) identifies the localization of a cDNA clone (Zap28) and its corresponding EP0 transcript. Arrows indicate the direction of transcription, dotted lines indicate splicing, and squiggles indicate poly(A) tracks. Shaded areas indicate ORFs.

The PRV latency gene is encoded by DNA sequences present in the BamHI-G, -P, -J, -I add -E fragments of the virus genome. The nucleotide sequence (SEQ ID No. 1) of the complete PRV LLT and predicted amino acid sequence (SEQ ID NO. 2) of ORF-2 are given in FIG. 2. The basic sequence is derived from PRV-InFh (from nucleotides 1 to 7013) and PRV-Ka (from nucleotides 7014 to 8425). In FIG. 2, PRV-Becker nucleotides that differ from the prototype are indicated in small letters above the basic sequence, the corresponding amino acid residue changes are presented at the third position of the codon, deletions are indicated by parentheses with dots on top, and insertions are indicated above the basic sequence in brackets. Nucleotide coordinates after the splice junction at nucleotide 1511 apply only to LLT. DNA nucleotide sequences of the TATA box and the poly(A) signal and the amino acid sequences of the histidine-rich, acidic residue-rich, and cysteine-rich regions of the polypeptide are underlined. The RNA cap site, poly(A) addition site, and termination codon are indicated by asterisks.

As mentioned earlier, the latency gene transcript (LLT) overlaps and is transcribed in the opposite orientation with respect to the EP0 and the immediately early gene (IE180). EP0 is nonessential for replication, the latency gene is the only gene expressed during PRV latency, and the IE180 gene is absolutely necessary for PRV replication. However, two copies of IE180 are present in the genome (one in the internal repeat and one in the terminal repeat). It is expected that PRV lacking one of the IE180 copies is viable. Therefore, deletion in the non-overlapping regions of these 3 genes will generate single deletion routants, while deletions in overlapping regions will generate double deletion mutants.

The nucleotide sequence (SEQ ID NO. 3) and the deduced amino acid sequence (SEQ ID NO. 4) of EP0 are given in FIG. 3. The DNA nucleotide sequence was determined by the dideoxy-chain termination method [Sanger et al. supra]. The first six nucleotides of this sequence constitute a BamHI restriction site, which is located between BamHI-P and BamHI-J in FIG. 1; transcription is leftward, as indicated by the arrow. The potential cap site and the termination codon are indicated by asterisks. The cysteine-rich zinc finger motif and the polyadenylation signal are underlined. The actual poly(A) addition site is located at the last nucleotide of the sequence.

The most important domain of the EP0 gene is likely to be the cysteine-rich zinc-finger domain from amino acid 40 to amino acid 100, since this region is conserved among other herpesviruses (e.g. herpes simplex virus type 1 and varicella-zoster virus). FIG. 4 is a comparison of the deduced homologous protein domain of PRV EP0 (SEQ ID NO. 5) with the protein domains of HSV-1 ICPO (SEQ ID NO. 6) and varicella-zoster gene 61 (SEQ ID NO. 7). The coordinates indicate the positions of the amino acid residues in their respective polypeptides. Gaps are introduced into the sequence (in dashes) for best alignment. Identical residues are indicated by asterisks between the sequences. Cysteine residues that are part of the zinc finger motif are overlined. The DNA sequence encoding this cysteine-rich domain also encodes an amino acid sequence specific to the latency gene in the opposite orientation. In fact, deletion in the EP0 gene other than the first 200 bp of EP0 will automatically delete some of the DNA sequences encoding the latency gene. The important domain of LLT has not been elucidated at present, but the latency gene is expected to play a role in the establishment, maintenance, or reactivation of PRV latency. The deletion may be totally comprised of a portion of EP0 sequence or a portion of the LLT sequence. Furthermore, a sequence nonessential for replication may be deleted from beth EP0 and LLT sequences, from beth of the LLT and IE180 sequences, or from a portion of each of EP0, LLT and IE180. Though disablement of a gene can be accomplished by single point mutation, the risk of reversion is minimized with more extensive modification. Accordingly, it is preferred that the deletion comprise at least 100 base pairs, and more preferably several hundred base pairs. Moreover, in the design of a commercial pseudorabies vaccine, it may be desirable to incorporate the aforementioned modifications in conjunction with other functional modifications currently in use in commercial vaccines. For example, it may be advantageous to also incorporate one or more of the gp1, gpX or TK deletions.

In an embodiment of the invention illustrated in the Examples, below, a nonessential sequence comprising about 800 base pairs present in beth the EP0 and the LLT sequences have been deleted and replaced by the E. coli .beta.-galactosidase gene in an attenuated PRV virus. The strategy for this double deletion is outlined in FIG. 5. FIG. 5A shows the map unit and BamHI fragments of the PRV genome. The location of the LLT transcript and the IE180 transcript are shown in FIG. 5B. FIG. 5C depicts the location of the EP0 transcripts. In the expanded BamHI, G, -P, -J, -I, -E diagram of FIG. 5A, the region represented by the stippled box in BamHI-P (nucleotide 810 to 1638), when deleted, will yield deletions both in the LLT and in the EP0 transcripts. The deleted DNA sequences will be replaced by the .beta.-galactosidase gene under the control of the PRV gX gene promoter. A schematic diagram for constructing this virus, designated EL.beta.-001, is depicted in FIG. 6. EL.beta.-001 does not grow as well in tissue culture as the field strain viruses in that it yields smaller plaque size and reduced titer. It also exhibits reduced virulence in animal experiments when compared to the parent InFh virus.

The modified virus of the invention is prepared for administration by formulation in an effective immunization dosage with a pharmaceutically acceptable carrier or diluent, such as physiological saline. The expression "effective immunization dosage" is defined as being that amount which will induce immunity in a vaccinated animal against challenge by a virulent strain of PRV. Immunity is considered as having been induced in a population of animals when the level of protection for the population is significantly higher than that of an unvaccinated control group. Typically, the vaccine will contain at least about 10.sup.3 PFU (plaque-forming units) of the virus, and preferably between 10.sup.4 and 10.sup.6 PFU.

Appropriate adjuvants as known in the art may also be included in the vaccine formulation. In many cases, the vaccinal efficacy can be enhanced by combining the deletion mutant virus with other viral agents into bivalent or polyvalent vaccines.

The vaccines of this invention may be administered by any conventional route as recognized in the art. For example, the vaccine may be administered intranasally, orally, or by injection. The modes of injection contemplated include intramuscular, subcutaneous, interperitoneal and intravenous injection.

Animals vaccinated with the modified viruses prepared in accordance with this invention will have reduced fever, reduced virus shedding and fewer clinical signs of the pseudorabies disease. The virus is effective in eliciting an immune response capable of protecting swine from a lethal PRV challenge. Swine vaccinated with PRV lacking the EP0 gene and latency gene harbors less PRV DNA in the nervous tissue, and these animals showed reduced ability to yield reactivatable virus.

Notwithstanding the aforementioned similarities between the PRV EP0 and the HSV ICP0, EP0 is an early protein gene whereas ICP0 is an immediately early gene. Also, ICP0 is located in the repeat sequence, but EP0 is not. There is only limited and patchy homology between the amino acid sequence of EP0 and that of ICP0.

The following examples are intended only to further illustrate the invention and are not intended to limit the scope of the invention which is defined by the claims.

Materials and Methods

In the ensuing example, the starting wild-type PRV was the virulent, InFh strain. The virus was propagated in Madin-Darby bovine kidney cells (MDBK). The PRV DNA was prepared by the method described in Paul et al. [Arch. Virol. 73: 193-198 (1982)]. Plasmid DNA was prepared by the method of Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1982)]. DNA fragments were purified from agarose gels following electrophoretic resolution according to the "Gene Clean Kit" purchased from Bio 101, Inc. DNA was transformed into E. coli strain XL-1 Blue by methods described by Maniatis, supra; and DNA was transfected into animal cells using the lipofectin reagents purchased from Bethesda Research Laboratories (BRL).

Viruses obtained from tissue culture monolayers infected with pseudorabies recombinant viruses were selected for the presence of the .beta.-galactosidase gene in Bluo-gal (BRL)-containing agar plates.

Restriction fragments of DNA were rendered blunt using S1 nuclease or the Klenow fragment of E. coli DNA polymerase, and terminal phosphate residues were removed by digestion with calf-intestine phosphatase, all as described in Maniatis, supra.

EXAMPLE 1

Construction of EL.beta.-001

Deletions were concurrently introduced into the EP0 and latency genes of the InFn strain of PRV as described, below, in reference to FIG. 6.

A contiguous nucleotide sequence containing the right hand most 400 base pairs of BamHI-G, the complete BamHI-P, and the left hand most 200 base pairs of BamHI-J of PRV InFh strain was cloned into the Bluescript plasmid resulting in plasmid ZAP38. Contained within this region is a 800 base pairs StuI-NcoI fragment which encodes a portion of the latency gene (rightward orientation) and a portion of the EP0 gene (leftward orientation). Plasmid ZAP38 was cut with StuI and NcoI enzymes, blunt-ended, BglII linker added, digested with BglII and religated to create a deletion of 800 base pairs with the addition of a new BglII site (plasmid .DELTA.ZAP38). Plasmid Syntro A that contains the .beta.-galactosidase gene with PRV gX DNA sequences (1140 base pairs at the 5' end and 2900 base pairs at the 3' end) was cut with NaeI and NarI enzymes, blunt ended, BamHI linker added, digested with BamHI and religated into Bluescript vector to yield plasmid A/N-N. Plasmid A/N-N has shorter PRV sequence at the 5' end (270 bp) and the 3' end (86 bp). The BamHI fragment containing the .beta.-galactosidase gene in plasmid A/N-N was then inserted into the BglII site of plasmid .DELTA.ZAP38 to generate plasmid pEI.beta.. Plasmid pEL.beta. was used in a transfection experiment in the presence of wild type pseudorabies virus DNA in MDBK cells. Recombinant viruses were generated via homologous recombination and the recombinant viruses were selected in the presence of Bluo-gal that yielded blue color plaques.

Candidate recombinant viruses (V) were isolated from wild type PRV by plaque purification DNA from the candidate recombinants was analyzed by restriction digestion and Southern blotting to establish the presence of a deletion in the viral genome. By this procedure, a PRV mutant having a confirmed deletion in BamHI-P has been isolated and is hereafter referred to as EL.beta.-001. Viral DNA isolated from the parent InFh virus and EL.beta.-001 gave similar BamHI restriction enzyme patterns. However, hybridization of the blots with BamHI-P probe showed that the regular size BamHI-P fragment in the InFh genome and a BamHI-P clone was replaced by a higher molecular weight fragment in EL.beta.-001. Hybridization with the .beta.-galactosidase DNA probe showed the EL.beta.-001 genome contains the .beta.-galactosidase gene while the parent virus does not. Furthermore, the .beta.-galactosidase gene was inserted into the BamHI-P fragment of EL.beta.-001. Hybridization with the 800 StuI-NcoI fragment probe showed that this DNA sequence is present in the InFh genome but deleted in the EL.beta.-001 genome. Thus EL.beta.-001 had suffered a deletion in both the EP0 and latency genes but acquired the .beta.-galactosidase gene which is expressed during replication. The .beta.-galactosidase gene is a selectable marker and is not critical for PRV attenuation or latency.

EXAMPLE 2

Animal Trials with EL.beta.-001

Animal studies with young (5-day-old) and weaned (4-week-old) piglets were initiated to compare the safety (degree of virulence) of EL.beta.-001 with that of the parent wild-type PRV, InFh. The level of antigenicity as measured by the humoral immune response, and the degree of protection from a fatal challenge dose of InFh was also determined. All piglets used in these studies were first shown to be negative for PRV antibody by the latex agglutination test.

Four-week-old Piglets

Initial experiments were conducted with two groups (R and F) of 4-week-old, weaned piglets (eight piglets in a group). These animals were infected intranasally with 1.4.times.10.sup.6 PFU of either EL.beta.-001 (R group) or InFh (F group) virus. Nasal swabs were taken daily to measure virus shedding (Table 3), daily body temperatures were determined (FIG. 7) and the pigs were observed for clinical signs. Blood samples were taken at designated times and the serum was tested for antibody to PRV. At predetermined times post-inoculation, pigs were euthanized and trigeminal ganglia removed to test for the presence of PRV virus genomes (Table 6).

The results indicate the EL.beta.-001 replicates in 4-week-old piglets and causes minimum clinical signs; only a slightly elevated temperature was detected (FIG. 7). Serum antibody could be detected in all R-group and F-group piglets by 7 to 8 days post-inoculation. One piglet in each group had a weak antibody response by the latex agglutination test while four piglets in each group developed a strong antibody response. No clinical signs were observed for the R-group piglets whereas sneezing, inappetence, shivering, and huddling, depression and CNS signs were observed in the F group animals. Two of five control F group piglets showed CNS signs, and two of five died by day 7 post-inoculation (Table 3).

Daily temperatures and nasal swabs of the R- and F-group piglets indicate the EL.beta.-001 replicates less than InFh virus in 4-week-old piglets. Only one R-group piglet (R-6) had an elevated temperature [above 104.degree. C. F.)] lasting for more than a single day (FIG. 7A). In contrast, all of the F-group piglets had elevated temperatures lasting for 4-6 days post-inoculation (FIG. 7B). Moreover, the replication of EL.beta.-001 virus in the nasal cavity of these piglets was reduced compared to that of InFh virus (Table 3). InFh virus was recovered easily from all F-group piglets between 7 and 8 days post-inoculation. For the R-group piglets, the amount and duration of virus shedding was significantly less. The results indicate that EL.beta.-001 is less virulent for weaned piglets.

Five-Day-Old Piglets

To compare the effect of EL.beta.-001 and InFh in younger animals and to determine the dose response to these viruses a total of 43 piglets (5 days old) were used. Initially, two groups of 10 and 9 piglets were infected intranasally with 1.4.times.10.sup.6 PFU of EL.beta.-001 (B-group) or 1.4.times.10.sup.6 PFU of InFh (T-group) virus. Both nasal (Table 2) and pharangeal (Table 1) swabs were taken for 8 days post-inoculation. Similar to the older piglets, the EL.beta.-001 virus replicated less extensively in the 5-day-old piglets. Virus was recovered from all the B-group piglets, although some animals were shedding at a very low level. InFh virus replicated extensively in these piglets (T-group) and by day 5 had killed all of these piglets. At this dosage, only 3 of 7 piglets survived the EL.beta.-001 inoculation (Table 4).

Three lower doses were used to determine the effect of EL.beta.-001 and InFh on the 5-day-old piglets. At the low doses, all of the EL.beta.-001 infected piglets survived; whereas, with InFh, only the piglets inoculated with 5.times.10.sup.3 PFU survived (Table 4). Piglets infected with 5.times.10.sup.3 PFU EL.beta.-001 showed no clinical signs of pseudorabies virus disease; at 5.times.10.sup.4 PFU, two piglets were normal and two piglets were off feed and depressed; and at 5.times.10.sup.4 all four of the EL.beta.-001 infected piglets were inappetent, depressed and had some diarrhea (Table 5). These results show that EL.beta.-001 is more pathogenic for 5-day-old piglets than for 4-week-old piglets but, this deletion mutant is still significantly less virulent than InFh for 5-day-old piglets.

Protection

The piglets infected with EL.beta.-001 at 5 days of age were positive for PRV antibody by 17 days post-inoculation (Table 5). When these piglets were 3 weeks old, the groups infected with 5.times.10.sup.3 PFU (four piglets), 5.times.10.sup.4 PFU (four piglets), and 1.4.times.10.sup.6 PFU (three surviving piglets) of EL.beta.-001 were challenged with 10.sup.7 PFU per nostril of InFh. All 11 vaccinated piglets survived the challenge virus exposure without notable clinical signs (Table 5). Even the group of piglets free of clinical signs with the lowest dose of EL.beta.-001 (5.times.10.sup.3 PFU) was also solidly protected. Twelve control piglets (3 weeks of age), negative for PRV antibody, all were anorexic and depressed, some showed CNS signs and all died within a range of 5 to 8 days post-challenge (Table 5). These experiments indicate that EL.beta.-001 induces solid protective immunity even when challenged with wild-type PRV at a young age.

Virus Reactivation and Genome Detection

Studies were also conducted to examine the ability of EL.beta.-001 to reactivate from infected swine after induction with dexamethasone and to determine the amount of EL.beta.-001 or InFh genome harbored in the trigeminal ganglia of these infected animals. The results (Table 6) showed that the parent InFh virus reactivated more readily and harbored more DNA genome in comparison with EL.beta.-001 infected animals.

TABLE 1______________________________________Virus shedding patterns (pharyngeal) in 5-day-old pigletsinfected with EL.beta.-001 and InFhDays Post-infectionPig No. 1 2 3 4 5 6 7 8______________________________________B1.sup.a 69 87 175 0B2.sup.b 42 3 74 5 5B3.sup.b 0 3 0 2 1 0 0 0B4 3 7 0 0 3 1 0 0B5.sup.b 25 15 0 0 0B6 8 144 42 2 0 51 166 3B7.sup.a 6 136B8 1 2 15 0 4 16 TNTC 1B9.sup.b 0 0 0 1 0 0 0 0B10.sup.a 56T1.sup.a TNTCT2.sup.b TNTC TNTC TNTCT3.sup.b TNTC TNTC TNTCT4.sup.b TNTC TNTC TNTC TNTCT5.sup.b 121 TNTC TNTCT6.sup.b 8 TNTC TNTC TNTCT7.sup.b TNTC TNTC TNTC TNTCT8.sup.b TNTC TNTC 0T9.sup.a 80 TNTC______________________________________ B = EL.beta.-001. T = InFh virus. TNTC = Too numerous to count. .sup.a Euthanized. .sup.b Dead TABLE 2______________________________________Virus shedding patterns (nasal) in 5-day-old piglets infectedwith EL.beta.-001 and InFhDays Post-infectionPig No. 1 2 3 4 5 6 7 8______________________________________B1.sup.a 0 0 0 3B2.sup.b 0 0 0 2 0B3.sup.b 0 0 0 2 0 0 0 0B4 0 0 0 1 0 1 0 0B5.sup.b 0 0 0 0 0B6 0 0 0 0 0 24 0 0B7.sup.a 0 0B8 0 0 0 4 0 1 0 1B9.sup.b 0 0 0 0 6 0 0 1B10.sup.a 0T1.sup.a 1T2.sup.b 0 41 4T3.sup.b 15 1 17T4.sup.b 0 3 9 44T5.sup.b 1 5 11T6.sup.b 10 36 106 TNTCT7.sup.b 7 2 300 TNTCT8.sup.b 3 97 87T9.sup.a 3 98______________________________________ B = EL.beta.-001. T = InFh virus. TNTC = Too numerous to count. .sup.a Euthanized. .sup.b Dead TABLE 3__________________________________________________________________________Virus shedding patterns (nasal) in 4-week-old piglets infected withInFh or EL.beta.-001Days Post-infectionPig No. 1 2 3 4 5 6 7 8__________________________________________________________________________R1.sup.a 4 0 0 0R2 2 0 0 0 0 0 0 0R3 0 TNTC 0 46 72 188 251 0R4 0 0 0 0 0 0 0 0R5 2 7 1 0 0 0 0 0R6 0 0 7 TNTC TNTC TNTC 3 0R7.sup.a 0 0R8.sup.a 6F1.sup.a 1 TNTC TNTC TNTCF2 0 TNTC 43 TNTC TNTC TNTC 2 3F3 0 231 55 TNTC TNTC TNTC 23 1F4 16 TNTC TNTC TNTC TNTC TNTC TNTC TNTCF5.sup.b 0 TNTC TNTC TNTC TNTC TNTCF6.sup.b 54 42 TNTCF7.sup.a 1 TNTCF8.sup.a 70__________________________________________________________________________ F = InFh virus. R = EL.beta.-001. TNTC = Too numerous to count. .sup.a Euthanized. .sup.b Dead TABLE 4______________________________________Comparative virulence of InFh and EL.beta.-001 virusesfor 5-day-old and 4-week-old piglets. EL.beta.-001 InFhAge Inoculum.sup.a Survivors/Total Survivors/Total______________________________________5-days 5 .times. 10.sup.3 4/4 4/4 5 .times. 10.sup.4 4/4 1/4 5 .times. 10.sup.5 4/4 0/4 1.4 .times. 10.sup.6 3/7 0/74-wks 1.4 .times. 10.sup.6 .sup. 5/5.sup.b .sup. 3/5.sup.c______________________________________ .sup.a PFU/nostril .sup.b No clinical signs .sup.c Clinical signs: sneezing, inappetent, huddling, lethargic, CNS signs TABLE 5__________________________________________________________________________Responses and protection of 5-day old piglets vaccinatedwith EL.beta.-001 POST-VACCINATION POST-CHALLENGEDose.sup.a Pig Response Pig ResponseGroup of EL.beta. # Antibody.sup.b Clinical.sup.c # Antibody.sup.b Clinical.sup.c__________________________________________________________________________A 5 .times. 10.sup.3 1 + N NT N 2 + N + N 3 + N + N 4 + N + NB 5 .times. 10.sup.4 5 + A NT N 6 + N + N 7 + A + N 8 + N + NC 5 .times. 10.sup.5 9 NT.sup.d A Not challenged 10 NT A,S 11 NT A,S 12 NT A,SD 1.4 .times. 10.sup.6 B2 NT A,S,D -- -- B3 + A,S,D -- -- B4 + A,S NT N B5 NT A,S,D -- -- B6 ++ A,S NT N B8 + A,S NT N B9 NT A,S,D -- --E Challenge controls (3 wk old pigs) C1 D C2 D.sup.f C3 D.sup.f C4 D C5 D C6 D.sup.f C7 D C8 D C9 D C10 D C11 D C12 D__________________________________________________________________________ .sup.a PFU/nostril .sup.b Latex agglutination test; + = weak positive; ++ = strong positive .sup.c N = normal; A = anorexic/depressed; S = scours; D = dead .sup.d NT = not tested. .sup.e Challenge dose = 10.sup.7 PFU InFh/nostil .sup.f CNS signs TABLE 6__________________________________________________________________________Reactivation of InFh and EL.beta.-001 viruses in swine Acute infection Post-dexamethasone treatment No. of Virus (PRV gennome/ (PRV gennome/Group.sup.a pigs isolation mg DNA).sup.b Virus isolation mg DNA).sup.b__________________________________________________________________________I 3 YES (euthanized) >200 N/A N/A 5 YES N/A NO <20II 3 YES (euthanized) >200 N/A N/A 2 YES (died) >200 N/A N/A 3 YES N/A YES >200III 1 NT (euthanized) >200 NT N/A 5 NT N/A NT <20IV 1 NT (euthanized) >200 NT N/A 1 NT (died) >200 NT N/A 4 NT N/A NT >200__________________________________________________________________________ N/A = Not applicable NT = Not Tested .sup.a Experiment I Group I and Group II swine were infected with 1.4 .times. 10.sup.6 PFU/nostril of EL.beta.-001 and InFh, respectively. Experiment II Group III swine were initially infected with 2 .times. 10.sup.4 PFU/nostril and 5 days later with 2 .times. 10.sup.6 PFU/nostri of EL.beta.-001, while Group IV swine were infected with 2 .times. 10.sup.6 PFU/nostril of InFh. For Group III, euthanasia was carried out o day 6 before the second dose of EL.beta.-001 .sup.b Trigeminal ganglion __________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 7(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 8438 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Pseudorabies virus(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 622..6495(ix) FEATURE:(A) NAME/KEY: variation(B) LOCATION: replace(1099, "g")(ix) FEATURE:(A) NAME/KEY: variation(B) LOCATION: replace(1267, "t")(ix) FEATURE:( A) NAME/KEY: variation(B) LOCATION: replace(1381, "c")(ix) FEATURE:(A) NAME/KEY: variation(B) LOCATION: replace(1566, "c")(ix) FEATURE:(A) NAME/KEY: variation(B) LOCATION: replace(7010, "g")(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:TATATAATCCCCGGTCCGCGCTCCGCCCACCCATCACAGCAGCCGCGGACGCTG CGCGCC60GGAGCGGTCCATCTCGCCAGCCAGCCAACCAGCCGAGCCGCCCAGCCGACCCGAGAGCCC120CGAGAGCCAGACTCCCTCAGCCATAGAAGACACCGGGCGGGAGAGACGGACTGAAAAAAT180ATATCTTTTTTTATTTTGTCTGGGCCTGGAG ACCCGCAGCAGGAGCGGAGGTGGGTGCGG240GGCCGGGAGCCGGAGCAGGACCGGGAACAGGAACAGGAACAGGAACAGGAACAGGAGTGG300GGCCGGGAGCAGGAGCAGGAGCGGGAGCCGAAGTGGGGGCAGGAGCGGCGGCGGCCGCAG360CAGCAACAG GGTCGCCCCAGTCCGCGGCGAGGAAGAGGGAGCTCAGTCGTCGTCCTGGGT420GAGGTCGATGAAGATGGTAGCGGAGCGGGGGGATCCCGACGAGCTAGACGCCGGAGGCCC480GCCCCGGGGGGCGGCGGTCTCGGGGGCAGAGGCAGAGGGCGACGGGCGCCGCAT CGAGGA540GGAGGGTGAAGACGAGGGGGAGGAGCGAGCCGAAGCGGCGGTGTTCGCCGACCCCGGGCC600GGCCCCGGCCCCCGAGGCACCATGCTGCGCAGAGGACCCCTCGCCGGACGA651MetLeuAr gArgGlyProLeuAlaGlyArg1510TGGCGCCTCCGGAGTCTCGCCCTGGGCCTGTCCGCCCGTCCGGCCGCG699TrpArgLeuArgSerLeuAlaL euGlyLeuSerAlaArgProAlaAla152025TCGCAGGCACCGGGTCCGTCTCTGCTCGCGCCTCAGCACGGCCGCCCG747SerGlnAlaProGlyProSer LeuLeuAlaProGlnHisGlyArgPro303540TCGGGCCCTGCGCGGGGAGCGCCTGGGCGCCGGCCTCTGGTCGTCCGC795SerGlyProAlaArgGlyAlaPro GlyArgArgProLeuValValArg455055GGACTCGGAGGCCTCCGTCAGATCCTCCGTGTGCACCCCGCTGCTCGA843GlyLeuGlyGlyLeuArgGlnIleLeuAr gValHisProAlaAlaArg606570GGCGCCCGAGTCTTCCTCGTCGGGGGAAGACACCTCAGAGTCAGAGTG891GlyAlaArgValPheLeuValGlyGlyArgHisLeuA rgValArgVal75808590TGCCTCGGACTCGGACGTGTCGATATAGTTCACACCCTGGTGGCTCAT939CysLeuGlyLeuGlyArgValAspIleValHis ThrLeuValAlaHis95100105CGGGGCTCGCCTCTGCATCCGCCGCATCCACTGCGCCGATATGTCAAA987ArgGlySerProLeuHisProProHisProLeu ArgArgTyrValLys110115120CAGCGTATCGACGAGGGCGTGGGTGTTTGCCCCAAACATGGGGAGCAT1035GlnArgIleAspGluGlyValGlyValCysProLy sHisGlyGluHis125130135GGCCTCGGTCACGCGCTGGCGGTTCATCCCGTGCTCCTGGATAATCTC1083GlyLeuGlyHisAlaLeuAlaValHisProValLeuLeuA spAsnLeu140145150GACGATGTTGTCCACTACGGCCTCGCGGATGGGGTCGCTCTCGATGAC1131AspAspValValHisTyrGlyLeuAlaAspGlyValAlaLeuAspAsp 155160165170CGTCGAGACCTGCCCATAAAGCCAGTTGAAGACGGGGACTCTGGGGCG1179ArgArgAspLeuProIleLysProValGluAspGlyAspSerGly Ala175180185GGCGCGAGACCCAGACCCGGAGCCCTGCCCTTCGGCCTCCTCGTGGCG1227GlyAlaArgProArgProGlyAlaLeuProPheGlyLeuLeuVa lAla190195200CACCTCCTCGGTATAGTCTTCACCCCAGATGACCGCGAAGCCCCCCCC1275HisLeuLeuGlyIleValPheThrProAspAspArgGluAlaProP ro205210215TACCGGCTCATCCTCTTCCCCGTCGACATCCGTCGCCCCCTCCACGGG1323TyrArgLeuIleLeuPheProValAspIleArgArgProLeuHisGly 220225230CGTCTCCACAAACGAAGCGTCGCTGTCCACGTGGTGGAGGATGGAGGT1371ArgLeuHisLysArgSerValAlaValHisValValGluAspGlyGly235 240245250GACGCGGGCATTGCACAGCGGGCAGGCGGTGCTCGTCAGGGTCCAGCG1419AspAlaGlyIleAlaGlnArgAlaGlyGlyAlaArgGlnGlyProAla 255260265CTGGATGCAGTCCAGACAGAACTTGTGCATGCACGGCAGCGTCTGCGC1467LeuAspAlaValGlnThrGluLeuValHisAlaArgGlnArgLeuArg 270275280CTCGGTGGCCGCGACGTCCAGGCAGATGGGGCAGTCCATGACGGACCA1515LeuGlyGlyArgAspValGlnAlaAspGlyAlaValHisAspGlyPro285 290295CCATCGTCTAACTCCCACCCGGGACCACCGGGACCCTCGGGACCATCT1563ProSerSerAsnSerHisProGlyProProGlyProSerGlyProSer300 305310ACATCCCACCAGGACCCGCCGGGACCACCAACACCGTCCACCTCCCAC1611ThrSerHisGlnAspProProGlyProProThrProSerThrSerHis315320 325330CACCACCATCATCATCAAGGACCCCCAACATCCCCAAGACCCTCTACT1659HisHisHisHisHisGlnGlyProProThrSerProArgProSerThr335 340345TCTTCCCACCAAGACCCTCCAGGAGGAGGACCCCCATCTGCTGAGACC1707SerSerHisGlnAspProProGlyGlyGlyProProSerAlaGluThr350 355360CACCACCACCACCACCAAGACCCACCAGGAGGAGGACCCCCATCCACT1755HisHisHisHisHisGlnAspProProGlyGlyGlyProProSerThr365 370375TCTTCCCATCACCACCACCAAGACCCTCCAGGAGGAGGACCCCCGTCA1803SerSerHisHisHisHisGlnAspProProGlyGlyGlyProProSer380385 390CCCCCACCAAGACCCTCCACCTCTTCTTCTTCCTCCCACCAGGGACCC1851ProProProArgProSerThrSerSerSerSerSerHisGlnGlyPro395400405 410CCATCCACAAGACCACCTCCACCCCAGAGACCACCGCCAAGATGGCCG1899ProSerThrArgProProProProGlnArgProProProArgTrpPro415420 425CCTCCATCTCCCCAAAAAATCTCAGAGACTCGGGCTGGTTCAGAAAAT1947ProProSerProGlnLysIleSerGluThrArgAlaGlySerGluAsn430435 440ACAGCACAAACTTTATTTTCTCACTCTGAAAATAAACTCTTTTCTCAC1995ThrAlaGlnThrLeuPheSerHisSerGluAsnLysLeuPheSerHis445450 455CCGATGGGAGAAGGAGGAGAAGGGGACCGGGGGACCGCGGGAGGAGAA2043ProMetGlyGluGlyGlyGluGlyAspArgGlyThrAlaGlyGlyGlu460465470GGGGACCGGGACGATCCTCGGCCGCCGAGCCCTCCGCCGCGGCCGCCG2091GlyAspArgAspAspProArgProProSerProProProArgProPro475480485 490CCGCCGCTTCCACCACCGCCGCCACCTCCGCCGCCGCCGCAGCCACCT2139ProProLeuProProProProProProProProProProGlnProPro495500 505CCGGCCGGGGGATCCGCGCGGAGGAGAAGGAGAGGAGGAGGAGGAGGG2187ProAlaGlyGlySerAlaArgArgArgArgArgGlyGlyGlyGlyGly5105155 20CCACCGGGCCGGGGAGGCAGGCGCCGGGGAGGCAAGCGCCGCCGGGCC2235ProProGlyArgGlyGlyArgArgArgGlyGlyLysArgArgArgAla525530535GA GGGGACCGAGGCCGCCGCCGCGGACGCAGAGGAGGAGGAGGACGGG2283GluGlyThrGluAlaAlaAlaAlaAspAlaGluGluGluGluAspGly540545550GACGAGGACG AGGACGAGGACCGGGCCGAGGACGAGGGGAGAGAAGAC2331AspGluAspGluAspGluAspArgAlaGluAspGluGlyArgGluAsp555560565570GGAGGA GAAGGGCCTCGAGGAGCCGGTGGAGGGGCCGGAGAGTCAGAG2379GlyGlyGluGlyProArgGlyAlaGlyGlyGlyAlaGlyGluSerGlu575580585TCAGAG TCAGAGTCCAGCCGGGCCGAGGGGGCGCCCCGCTCAGCGGAG2427SerGluSerGluSerSerArgAlaGluGlyAlaProArgSerAlaGlu590595600CAGCAGGT AGGGGTTGCCGGCGTCCTCGGCCTCCTCGTCGTCCGAGAT2475GlnGlnValGlyValAlaGlyValLeuGlyLeuLeuValValArgAsp605610615GGCCTCCACCTTG ATGGGCCCGAGCGGGCCGCGGGGCCGGCCGTCGCC2523GlyLeuHisLeuAspGlyProGluArgAlaAlaGlyProAlaValAla620625630GCCGCGGAAGCCGACGATCTC CACCGCGGCAGAGTCCTCCCCGTCCTC2571AlaAlaGluAlaAspAspLeuHisArgGlyArgValLeuProValLeu635640645650GCCGGGCCCCCGGGCGCC CGAGGGCCGGTGGGTCTCCACGGCGCCGCC2619AlaGlyProProGlyAlaArgGlyProValGlyLeuHisGlyAlaAla655660665GGCGGCGGCGCGGACGC TGGTCTCGAAGGGCGCAAAGTCCCAGCGCAC2667GlyGlyGlyAlaAspAlaGlyLeuGluGlyArgLysValProAlaHis670675680GGCCGGCGGGGCGCCCGCG GCCGCGAGGGCGCCCGGGGCCAGCACCAG2715GlyArgArgGlyAlaArgGlyArgGluGlyAlaArgGlyGlnHisGln685690695CGGGGCGGCCTCGGCGTCGGGCTC CAGCAGCGCCGCGGCGCAGAAGGC2763ArgGlyGlyLeuGlyValGlyLeuGlnGlnArgArgGlyAlaGluGly700705710GCGCAGCTCGGCCGGCAGGCCCTCGGGGCCGCG GAGCTCGGCGAGGCC2811AlaGlnLeuGlyArgGlnAlaLeuGlyAlaAlaGluLeuGlyGluAla715720725730CCGGCGGCCGCAGGAGACGAAGACGGGCC GCAGCGGGGCGCCGAGCCC2859ProAlaAlaAlaGlyAspGluAspGlyProGlnArgGlyAlaGluPro735740745CCAGCGGTTGGCCGCGCGGTGCCCGAAG GCGGCGCCCGCGTCAAAGTC2907ProAlaValGlyArgAlaValProGluGlyGlyAlaArgValLysVal750755760CGGGTCCCCGAGCCCGAGCGCGGAGCGCTG GCGGGCCATGTCCTTGCA2955ArgValProGluProGluArgGlyAlaLeuAlaGlyHisValLeuAla765770775GCCGTCCACGGTGGGGAGCACGCGCTCGCGGTAGGC GCGCGGCGGCAG3003AlaValHisGlyGlyGluHisAlaLeuAlaValGlyAlaArgArgGln780785790CGGGACCGGGGTCCGGGGCCCGGCGCGGGTGCTCACCGTGTAGC GCAC3051ArgAspArgGlyProGlyProGlyAlaGlyAlaHisArgValAlaHis795800805810GTTGTCCTGGCGGCAGAGGCGCAGCGGCTCGGCCCCGGGG TGCAGGCG3099ValValLeuAlaAlaGluAlaGlnArgLeuGlyProGlyValGlnAla815820825GGCGAAGGAGGCCTCCACGCGGGCGAAGCAGGCCGGGCC CACGATGGA3147GlyGluGlyGlyLeuHisAlaGlyGluAlaGlyArgAlaHisAspGly830835840GCTCGAGTCCAGGACGGCCGCGCGGAGCTCGCGGCACTCGGG CCAGCG3195AlaArgValGlnAspGlyArgAlaGluLeuAlaAlaLeuGlyProAla845850855CACGGCGCACTGGGCGGCCGGGTCCAGGCGGGCGCGGACGTAGACGT G3243HisGlyAlaLeuGlyGlyArgValGlnAlaGlyAlaAspValAspVal860865870GTAGTCCCCCACGGCCGGGCCGTCCGCGGGCCAGTCCTCGATGGTGTC3291 ValValProHisGlyArgAlaValArgGlyProValLeuAspGlyVal875880885890CAGCACGATGAGCCGGCGCCGCGCCGCGCCGAGCCGCGAGCAGAGGTA 3339GlnHisAspGluProAlaProArgArgAlaGluProArgAlaGluVal895900905CTCGACGGCGCCGGCGAAGCCGAGGTCCCGCGCCGAGAGCAGCAGCAC 3387LeuAspGlyAlaGlyGluAlaGluValProArgArgGluGlnGlnHis910915920CCCCTGGGCGTTGAGGCGGCCGATGTCGGGGCGCCCGGTCCAGTTCCC34 35ProLeuGlyValGluAlaAlaAspValGlyAlaProGlyProValPro925930935GGCCCAGGCGTGCGAGTCCGGCGTGCAGAGGCGGTGGGCGAAGGCGGC3483Gly ProGlyValArgValArgArgAlaGluAlaValGlyGluGlyGly940945950GAGCAGCGCCGAGAGGCCGCCGCGGCGCGGGTCCCAGGCCGGGCGCGG3531GluGlnArgAr gGluAlaAlaAlaAlaArgValProGlyArgAlaArg955960965970GGCGCCCTCGGCGGGCTCGGCGCAGAGCTCCTCGTGGGGCAGCGGGTC3579GlyAlaL euGlyGlyLeuGlyAlaGluLeuLeuValGlyGlnArgVal975980985GTAGAGCACCACCACGCGCACGTCCTCGGGGTCGGCTATCTGCCGCAT3627ValGlu HisHisHisAlaHisValLeuGlyValGlyTyrLeuProHis9909951000CCAGGCGGCGCGGCGGCGGAGCGGGGCGCCCGCGGCCCCGCGGCGCGC3675ProGlyGl yAlaAlaAlaGluArgGlyAlaArgGlyProAlaAlaArg100510101015GGCGATGTGCGCCAGGGCGGCCGGGTCGAAGGTGAGCGCCGGGCGCCA3723GlyAspValArg GlnGlyGlyArgValGluGlyGluArgArgAlaPro102010251030GAGTTCGGGGAAGACCTCCTGGTCCACGAGGGCGCGGGCCACCTCGGG3771GluPheGlyGluAspLeuLe uValHisGluGlyAlaGlyHisLeuGly1035104010451050CGGGCAGTAGGCGGCGAGGGCCGCGGCGGAGGGCCGCGGCGTGTGGGT3819ArgAlaValGlyGly GluGlyArgGlyGlyGlyProArgArgValGly105510601065CTCGCCGGCCGGGACGCGGCGGAAGCCGCCGTCGGGCGCGGGGTGCTC3867LeuAlaGlyArgAs pAlaAlaGluAlaAlaValGlyArgGlyValLeu107010751080GGGCATGGGCCCGAGCGGGCGCCGGAGCCGGTCGTCCTCGGAGGAGGA3915GlyHisGlyProGlu ArgAlaProGluProValValLeuGlyGlyGly108510901095GGAGGAGGAGGAGGAGGACACGAGCGCGGGAGCGGGGTCCGGAGCGGG3963GlyGlyGlyGlyGlyGlyHi sGluArgGlySerGlyValArgSerGly110011051110CCCGAGTCCGAGGGAGCGGCGCTTGCGCCGGGGCCCCCGGTCCTCTTC4011ProGluSerGluGlyAlaAlaLeuAla ProGlyProProValLeuPhe1115112011251130GTCGTCGCGGTGGCCGTGGCCGTCCCCGCGGAGGGCCGAGCCGGAGAG4059ValValAlaValAlaValAlaVa lProAlaGluGlyArgAlaGlyGlu113511401145CCCCTCGTCCTCCTCGCCGTCCCCGGGGCGGCGGGCCCCGGGCGCGCG4107ProLeuValLeuLeuAlaVal ProGlyAlaAlaGlyProGlyArgAla115011551160GCGCTTCTTCTTGCGCCGCTCGGGCGCTGGGTCCGGGCCGGCGGCGGG4155AlaLeuLeuLeuAlaProLeuGl yArgTrpValArgAlaGlyGlyGly116511701175GGAGCTGGCGTAGCCGGAGGAGCCGGAGAGGCCGGACTTGGTGCCGGA4203GlyAlaGlyValAlaGlyGlyAlaGly GluAlaGlyLeuGlyAlaGly118011851190GCTGGACTTGGTGCTGGAGCCGGACTTGGTGCTGGCGGGGCTGGAGGG4251AlaGlyLeuGlyAlaGlyAlaGlyLeuGlyAlaGl yGlyAlaGlyGly1195120012051210CCCGGAGCCGGGGAGGCCGGAGGGGGCGCCCGCCGCCGCCGGCGCCGG4299ProGlyAlaGlyGluAlaGlyGlyGlyAla ArgArgArgArgArgArg121512201225CGCTGGGACGACGAGGCCGGGCTGCTCGGGCCAGAGCGGGGGCAGGCC4347ArgTrpAspAspGluAlaGlyLeuLeuGl yProGluArgGlyGlnAla123012351240GGGCGCGGGCTCCGCGGGCCCGGGCCGCGCGGCGGCCTCGGCGAGCCG4395GlyArgGlyLeuArgGlyProGlyProArg GlyGlyLeuGlyGluPro124512501255GGCCCCGGCCACGTTGGCCGGGGCGAAGAGGGCCGCGGCGTAGGTCCA4443GlyProGlyHisValGlyArgGlyGluGluGlyAr gGlyValGlyPro126012651270GGCGGCCTCGCGGGCGCGGGCCCCGTCCACGCTGTAGCGCACCAGCGG4491GlyGlyLeuAlaGlyAlaGlyProValHisAlaValAlaHis GlnArg1275128012851290CGCCACGGTGCGGGCGACGAGGGCGACAGAGTCCGCGGCCTGCTGCCG4539ArgHisGlyAlaGlyAspGluGlyAspArgValArgGl yLeuLeuPro129513001305CTCGGCCGGGCCGGCCCCGGGGATCGCGTCGCGGAGCGCGAGCAGCGC4587LeuGlyArgAlaGlyProGlyAspArgValAlaGlu ArgGluGlnArg131013151320GGCGGTCACCTCCTCGAGGCAGGCGGGCCCGAGGGCGGCCGGGGCGCG4635GlyGlyHisLeuLeuGluAlaGlyGlyProGluGlyGl yArgGlyAla132513301335GGCGGGCGCGGGCAGCCGGAGCGGGCAGGGCAGCAGGCGCTCGAGGAC4683GlyGlyArgGlyGlnProGluArgAlaGlyGlnGlnAlaLeu GluAsp134013451350GCCGCGGCAGGCCAGGACGCAGGCGTCCGCCAGCTCGCGGGGCACGCG4731AlaAlaAlaGlyGlnAspAlaGlyValArgGlnLeuAlaGlyHisAla1 355136013651370GCCGGGCTGCGCGGCGGCGAAGGCGGCGCGGACGCGGGCGCAGAGGGC4779AlaGlyLeuArgGlyGlyGluGlyGlyAlaAspAlaGlyAlaGlu Gly137513801385CTCGACGGTCGCCTCCCCGGCGCGGGGGTCCGCGGCGCGGCCCGGGTA4827LeuAspGlyArgLeuProGlyAlaGlyValArgGlyAlaAlaAr gVal139013951400GGCCATGTCGGCGTAGGCCCGGCGGAGGCTCTGCAGGATGAAGGTCTT4875GlyHisValGlyValGlyProAlaGluAlaLeuGlnAspGluGly Leu140514101415CTGGGTGCGATCGTAGCGGCGGCTCATGGCCACGGCGCTCACCGCGTG4923LeuGlyAlaIleValAlaAlaAlaHisGlyHisGlyAlaHisArgVal 142014251430CGGCAGGGCCCAGAGCGGGTCCTGGGCGGCCATGGCGTCCCCGATGTG4971ArgGlnGlyProGluArgValLeuGlyGlyHisGlyValProAspVal1435 144014451450CGGCAGCGGCGGGGTCACGCTGCCGGTGATGAAGGAGCCGTGGCCGTG5019ArgGlnArgArgGlyHisAlaAlaGlyAspGluGlyAlaValAlaVal 145514601465GGGCGCGTGGACCCGGCGCTGGCAGAACTGGTTGAAGCGCTGGTCGGG5067GlyArgValAspProAlaLeuAlaGluLeuValGluAlaLeuValGly 147014751480GGCCTGCATCCGCGGGTTCTGCAGCCAGGACATGGCCTCGCCGGCGGC5115GlyLeuHisProArgValLeuGlnProGlyHisGlyLeuAlaGlyGly 148514901495CCCGCTGTAGATGAGGCGCACGAGGGCCTCGTGCTGCTTCCTCGAGTC5163ProAlaValAspGluAlaHisGluGlyLeuValLeuLeuProArgVal1500 15051510CCCCATCTCCGGGATGAAGACGGGCACGGGCCCGGCCGCGGCGCGGTA5211ProHisLeuArgAspGluAspGlyHisGlyProGlyArgGlyAlaVal15151 52015251530GCGGGCCGCGGCCTGGCGGACGTCGTCCTCGTCCCAGAGCCCCTCGCG5259AlaGlyArgGlyLeuAlaAspValValLeuValProGluProLeuAla 153515401545GGAGTCCCCGGCGCCGCCGTAGCGGACGCGGCCGTCGGCCGGAGGGTC5307GlyValProGlyAlaAlaValAlaAspAlaAlaValGlyArgArgVal1 55015551560GGAGCCGGGCCAGGGCTCCCCGAGCGGGGTGAGCAGCGGCCCGTCGGT5355GlyAlaGlyProGlyLeuProGluArgGlyGluGlnArgProValGly1565 15701575CGGCGGGGGCCCGTCGGCCATGAGCGAGAGGTGGTTGTTGGTGGAGCG5403ArgArgGlyProValGlyHisGluArgGluValValValGlyGlyAla1580 15851590GCGCTTCCTGCGCGGGGGCCGGGCGGGCTCCGGGGCCGGGGCCGGGGA5451AlaLeuProAlaArgGlyProGlyGlyLeuArgGlyArgGlyArgGly15951600 16051610GGCCGCGGCGGAGGAGGAGGTGGCGGAGGCGGAGGAGGCCGAGGGCCG5499GlyArgGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyGlyArgGlyPro1615 16201625CGGGGCCGCGGCGGGCGCCGGCGGAGACGGTGGCGGCCCGGCGCGGGC5547ArgGlyArgGlyGlyArgArgArgArgArgTrpArgProGlyAlaGly1630 16351640GAGTGGGGCGCCGGGCCGGACTCCTTCGTCTTCTTCTCCCTCGGAGGA5595GluTrpGlyAlaGlyProAspSerPheValPhePheSerLeuGlyGly1645 16501655GGACGAGGACGAGGAGGACGAGGAGGACGAGGACGAGGAGGAGGCCGA5643GlyArgGlyArgGlyGlyArgGlyGlyArgGlyArgGlyGlyGlyArg16601665 1670GCGCCGCGCGGCGGCGGCGGCGGCGGCGGGGGCCCGGGGGGCGGAGGG5691AlaProArgGlyGlyGlyGlyGlyGlyGlyGlyProGlyGlyGlyGly167516801 6851690CGAGCGGGCCGGGGAGAGGTCCGAGTCGCTGCCGCCGCTGCTGGAGCT5739ArgAlaGlyArgGlyGluValArgValAlaAlaAlaAlaAlaGlyAla1695 17001705GCTGAAGCCGCGGCCGCGGCGGAGGGCGCCCTCTCCGGCGCGGCGCCG5787AlaGluAlaAlaAlaAlaAlaGluGlyAlaLeuSerGlyAlaAlaPro17101 7151720GCGGGGCTGTCTCTGCAGGGGCGCCCCGCCGTCCCCGGCGAGGCCGAG5835AlaGlyLeuSerLeuGlnGlyArgProAlaValProGlyGluAlaGlu17251730 1735TCCGTCCTCGTCCTTCTCGGGGCCGCGGGCGACGGGCTCGACGGCGAC5883SerValLeuValLeuLeuGlyAlaAlaGlyAspGlyLeuAspGlyAsp17401745 1750GGTGGTGGTGGAGCTGGAGCTGGAGTTGGGGTTGGAGGAGACGGGGCT5931GlyGlyGlyGlyAlaGlyAlaGlyValGlyValGlyGlyAspGlyAla175517601765 1770CCGGGCGCCAAGCGGCCGAGGATCGAGCCGCCTCGCGGCGGCGGGCTC5979ProGlyAlaLysArgProArgIleGluProProArgGlyGlyGlyLeu17751780 1785GTCGAGCAGGGGCTCGCGGTGCTGGTGATGGTGACGACCGCGGTCCCC6027ValGluGlnGlyLeuAlaValLeuValMetValThrThrAlaValPro17901795 1800TCCGCCGGAGGGGGCGCCGCCGCCGCCGGGCGCCGAGACCGGCCCGGC6075SerAlaGlyGlyGlyAlaAlaAlaAlaGlyArgArgAspArgProGly18051810 1815GGCGGGGGAGGCTGGGGAAGCGGGCCCCCGCCGTGCCGGCGCTGCGGC6123GlyGlyGlyGlyTrpGlySerGlyProProProCysArgArgCysGly182018251830 CACCGCTGCTGGCTGTGCTGGTGGCGCCGGGGTCCGAGGCCGCGCCGC6171HisArgCysTrpLeuCysTrpTrpArgArgGlyProArgProArgArg1835184018451 850CGGCCCGGGCTCACCGACCGGGTCCCCCCTCGCGGGGGACCATCTCCG6219ArgProGlyLeuThrAspArgValProProArgGlyGlyProSerPro18551860 1865CGGGGCCGCCGAGGGGCCGGGGGAGCCGGAGGAGCCGGAGGAGCCGGA6267ArgGlyArgArgGlyAlaGlyGlyAlaGlyGlyAlaGlyGlyAlaGly187018751 880GGAGGAGGAGGCCGGGGAGGCTGCGGAGGGGGACGAGCGCCCGGGGCC6315GlyGlyGlyGlyArgGlyGlyCysGlyGlyGlyArgAlaProGlyAla188518901895 GCCGGGGGCCCCGGCCTCTGCCGCTGCGAGTGCTGCCGGGGTCGGCGG6363AlaGlyGlyProGlyLeuCysArgCysGluCysCysArgGlyArgArg190019051910CCGGGGCC CGGAGCCGGCCCGGGACCGGGGCCCGAGGACGAGGTGACC6411ProGlyProGlyAlaGlyProGlyProGlyProGluAspGluValThr1915192019251930GTG CTCGGAGCCCTGATGGAGAGCCCGACCGGGGGACCCGGCGGCCGG6459ValLeuGlyAlaLeuMetGluSerProThrGlyGlyProGlyGlyArg193519401945GG ACCCGGGCTCGTCCTCCTCCTCGTCTTCGTCGTCTAGCACCACG6505GlyProGlyLeuValLeuLeuLeuValPheValVal19501955ATCTCGCCCGAGCCCCGGCGGGCGTGCCGCTGCTGCT GGGCCGAAGGAGGACGGGGCGGC6565CTCGTGGCTCCGGCCGCGGCCGCGAGGACGGCGGCCTCGGCCTCGGCGGCGTCGTCGGAG6625AAGAGGCCGCCCGGGCCGAAGAGGAGATCCTCGCCGGAGGAGCCGCGGCGCCGGGAGCCC6685TGGCTGCCGCCGTC GGGGCCGGACGCGATGCCCTCTTCCTCGGCCGCGGCGGCGGCGGCC6745GCCAGGAGCTGGCTGAAGTTGCCCTCGGTCTCGATGAAGTCAAAGAGATCGTCGGCCATG6805GTCTCGATCGGGGTCTTTCTGCCTGAGCGAGGCCGGGCGCCGAGCGCGGAGAGCGGGCGG 6865CGGAGAAGAAGGAGGAAGGCGGCCGGAGGAGGAGAAGAAGACTCTTCTCTGGTGGGCCGA6925GAGCCTCTGTGGGTCGGGCGTCCGTCGAGGGCTGATAGCCGCCGGAGAGCCGGAGTCTTC6985AGAGTCCGCGCCGGAGCGGAGACGATCGGATCCCCTC GGGTTGGCAGAGAACGATGCTGT7045CCGTACCTGCACCGCAGTGAAGTGCTACGATGGAGACCGCGCTTATAAGCGCCCCGAGGA7105GAGCCCGCCCCCAGGTAAGCGGACCAATGGCCGATTTTCGCCGCGGACTTCCCCGACGGC7165CGGCCAATGGGATT TTTCTCGCCCGCTTCCTCTCGCGTCTGCTTTGCATGCCCGGCCCAA7225GATGGCGGCCGCCGGCCAATGGGATTTCGCGAGGAACTTCCTCGCGAGGACCATTTGCAT7285GCCCGGCCCCCGCGGCGGCCATCTTGCCCACTCGACGGCCAATGGGATTTCTCTCGCCCA 7345CTTCCTCTCGCGTCTACTTTGCATGTCCGGCCCCGAGGGCGCCATCTTGGCCCCTCGACG7405GCCAATGGGATTTCTCTCCCTACTTCCTCTCGCGTCTACTTTGCATGTCCGGCCCCCGCG7465GCGGCCATCTCGGCTCGCCCGGGCCAATGGGCGCGCG GAGGCGTCTCCCGCGCGCCTCTG7525ATTTGCATGCCCGGCCCGCTCTGCGGCCATCTTGGCCGCGGGCGGCCAATGAGATTGTCC7585GAAAATCCCTCGCGCGGGCGCGAGGCGCATGCTCGGCACGCGACCCACCCCCGTGGTGCT7645AGCGAGCCAATCAG ATGATTTTCGGGGAAGCTTCCGTGTGCACGTCATTTGCATGCTCGC7705CCCACGTGGCCGCCCTCGGCCAATGGGGCCTCACGGTGCAAGCTTCCGTGTGTCTGCACG7765TGGTCCGCATGTGTTGTGGTGGTCTCTGTGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGG 7825TCTCTGTGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGGTCT7885CTGTGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGGTCTCTG7945TGTTGTGTGGTGGTCTCTGTGTTGTGTGGTGGTATCA CCGCCTCCCCCTGCCACTCGCGA8005GACCCCGAGACCCCCGTTTCCCCCTCCTCGAGACCCCTGAGACCCCCGAGACCCTCCCGC8065GACCCCCGCGGTCGCCCCACCCGCGCCTCGCGCTCGGCGCGCGCTCCGAGGGCGCCCCAG8125CCGGTCGGAGAGAC GAGCGGAACCGCCGTCGGACCGGGGACCGGCGACCGGACCCGAACC8185GGGAAGCGACGCCGGGGCGGGAGAACCGGACCCGAACCTCGAGCCCGGACCCGCCCGGAC8245CCGGAAGGAAGGAGCCGGACAGCCACGCCTTGGATACTTTTGTCGCCCACCCACCCCCTC 8305CTCTCCCCCACCCCTCTATCTCTCTCTCCCGGTCCCCCCTCCCACCCCACGAGACACGCC8365CCAGAGTGAAAAAAAAAATAAAAGTTGTTCTCGTTGCACCGTCTTCCGGCTCGTGTCGTC8425CTTCCGCGGTACC 8438(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1958 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetLeuArgArgGlyProLeuAlaGlyArgTrpArgLeuArg SerLeu151015AlaLeuGlyLeuSerAlaArgProAlaAlaSerGlnAlaProGlyPro202530SerLe uLeuAlaProGlnHisGlyArgProSerGlyProAlaArgGly354045AlaProGlyArgArgProLeuValValArgGlyLeuGlyGlyLeuArg50 5560GlnIleLeuArgValHisProAlaAlaArgGlyAlaArgValPheLeu65707580ValGlyGlyArgHisLeuArgValArgValC ysLeuGlyLeuGlyArg859095ValAspIleValHisThrLeuValAlaHisArgGlySerProLeuHis100105 110ProProHisProLeuArgArgTyrValLysGlnArgIleAspGluGly115120125ValGlyValCysProLysHisGlyGluHisGlyLeuGlyHisAlaLeu130 135140AlaValHisProValLeuLeuAspAsnLeuAspAspValValHisTyr145150155160GlyLeuAlaAspGlyValAl aLeuAspAspArgArgAspLeuProIle165170175LysProValGluAspGlyAspSerGlyAlaGlyAlaArgProArgPro18018 5190GlyAlaLeuProPheGlyLeuLeuValAlaHisLeuLeuGlyIleVal195200205PheThrProAspAspArgGluAlaProProTyrArgLeuIleL euPhe210215220ProValAspIleArgArgProLeuHisGlyArgLeuHisLysArgSer225230235240ValAlaVal HisValValGluAspGlyGlyAspAlaGlyIleAlaGln245250255ArgAlaGlyGlyAlaArgGlnGlyProAlaLeuAspAlaValGlnThr260 265270GluLeuValHisAlaArgGlnArgLeuArgLeuGlyGlyArgAspVal275280285GlnAlaAspGlyAlaValHisAspGlyProPr oSerSerAsnSerHis290295300ProGlyProProGlyProSerGlyProSerThrSerHisGlnAspPro30531031532 0ProGlyProProThrProSerThrSerHisHisHisHisHisHisGln325330335GlyProProThrSerProArgProSerThrSerSerHisGlnAspPro 340345350ProGlyGlyGlyProProSerAlaGluThrHisHisHisHisHisGln355360365AspProProGlyGlyGlyPro ProSerThrSerSerHisHisHisHis370375380GlnAspProProGlyGlyGlyProProSerProProProArgProSer385390395 400ThrSerSerSerSerSerHisGlnGlyProProSerThrArgProPro405410415ProProGlnArgProProProArgTrpProProProSerPr oGlnLys420425430IleSerGluThrArgAlaGlySerGluAsnThrAlaGlnThrLeuPhe435440445SerHisSer GluAsnLysLeuPheSerHisProMetGlyGluGlyGly450455460GluGlyAspArgGlyThrAlaGlyGlyGluGlyAspArgAspAspPro465470 475480ArgProProSerProProProArgProProProProLeuProProPro485490495ProProProProProProProGlnProPro ProAlaGlyGlySerAla500505510ArgArgArgArgArgGlyGlyGlyGlyGlyProProGlyArgGlyGly515520525ArgArgArgGlyGlyLysArgArgArgAlaGluGlyThrGluAlaAla530535540AlaAlaAspAlaGluGluGluGluAspGlyAspGluAspGluAspGlu545 550555560AspArgAlaGluAspGluGlyArgGluAspGlyGlyGluGlyProArg565570575GlyAlaGlyGlyGlyAla GlyGluSerGluSerGluSerGluSerSer580585590ArgAlaGluGlyAlaProArgSerAlaGluGlnGlnValGlyValAla595600 605GlyValLeuGlyLeuLeuValValArgAspGlyLeuHisLeuAspGly610615620ProGluArgAlaAlaGlyProAlaValAlaAlaAlaGluAlaAspAsp62 5630635640LeuHisArgGlyArgValLeuProValLeuAlaGlyProProGlyAla645650655ArgGlyP roValGlyLeuHisGlyAlaAlaGlyGlyGlyAlaAspAla660665670GlyLeuGluGlyArgLysValProAlaHisGlyArgArgGlyAlaArg675 680685GlyArgGluGlyAlaArgGlyGlnHisGlnArgGlyGlyLeuGlyVal690695700GlyLeuGlnGlnArgArgGlyAlaGluGlyAlaGlnLeu GlyArgGln705710715720AlaLeuGlyAlaAlaGluLeuGlyGluAlaProAlaAlaAlaGlyAsp725730 735GluAspGlyProGlnArgGlyAlaGluProProAlaValGlyArgAla740745750ValProGluGlyGlyAlaArgValLysValArgValProGluProGlu 755760765ArgGlyAlaLeuAlaGlyHisValLeuAlaAlaValHisGlyGlyGlu770775780HisAlaLeuAlaValGlyAlaArgArgG lnArgAspArgGlyProGly785790795800ProGlyAlaGlyAlaHisArgValAlaHisValValLeuAlaAlaGlu805810 815AlaGlnArgLeuGlyProGlyValGlnAlaGlyGluGlyGlyLeuHis820825830AlaGlyGluAlaGlyArgAlaHisAspGlyAlaArgValGln AspGly835840845ArgAlaGluLeuAlaAlaLeuGlyProAlaHisGlyAlaLeuGlyGly850855860ArgValGlnAlaGlyAl aAspValAspValValValProHisGlyArg865870875880AlaValArgGlyProValLeuAspGlyValGlnHisAspGluProAla885 890895ProArgArgAlaGluProArgAlaGluValLeuAspGlyAlaGlyGlu900905910AlaGluValProArgArgGluGlnGlnHisP roLeuGlyValGluAla915920925AlaAspValGlyAlaProGlyProValProGlyProGlyValArgVal930935940ArgArg AlaGluAlaValGlyGluGlyGlyGluGlnArgArgGluAla945950955960AlaAlaAlaArgValProGlyArgAlaArgGlyAlaLeuGlyGlyLeu 965970975GlyAlaGluLeuLeuValGlyGlnArgValValGluHisHisHisAla980985990HisValLeuGlyValGlyTy rLeuProHisProGlyGlyAlaAlaAla99510001005GluArgGlyAlaArgGlyProAlaAlaArgGlyAspValArgGlnGly10101015 1020GlyArgValGluGlyGluArgArgAlaProGluPheGlyGluAspLeu1025103010351040LeuValHisGluGlyAlaGlyHisLeuGlyArgAlaValGlyGl yGlu104510501055GlyArgGlyGlyGlyProArgArgValGlyLeuAlaGlyArgAspAla106010651070AlaGl uAlaAlaValGlyArgGlyValLeuGlyHisGlyProGluArg107510801085AlaProGluProValValLeuGlyGlyGlyGlyGlyGlyGlyGlyGly1090 10951100HisGluArgGlySerGlyValArgSerGlyProGluSerGluGlyAla1105111011151120AlaLeuAlaProGlyProProValLeuPh eValValAlaValAlaVal112511301135AlaValProAlaGluGlyArgAlaGlyGluProLeuValLeuLeuAla11401145 1150ValProGlyAlaAlaGlyProGlyArgAlaAlaLeuLeuLeuAlaPro115511601165LeuGlyArgTrpValArgAlaGlyGlyGlyGlyAlaGlyValAlaGly 117011751180GlyAlaGlyGluAlaGlyLeuGlyAlaGlyAlaGlyLeuGlyAlaGly1185119011951200AlaGlyLeuGlyAl aGlyGlyAlaGlyGlyProGlyAlaGlyGluAla120512101215GlyGlyGlyAlaArgArgArgArgArgArgArgTrpAspAspGluAla1220 12251230GlyLeuLeuGlyProGluArgGlyGlnAlaGlyArgGlyLeuArgGly123512401245ProGlyProArgGlyGlyLeuGlyGluProGlyPr oGlyHisValGly125012551260ArgGlyGluGluGlyArgGlyValGlyProGlyGlyLeuAlaGlyAla1265127012751280GlyProValHisAlaValAlaHisGlnArgArgHisGlyAlaGlyAsp128512901295GluGlyAspArgValArgGlyLeuLeuProLeuGlyArgAlaGlyPro 130013051310GlyAspArgValAlaGluArgGluGlnArgGlyGlyHisLeuLeuGlu131513201325AlaGlyGlyProGluGlyGl yArgGlyAlaGlyGlyArgGlyGlnPro133013351340GluArgAlaGlyGlnGlnAlaLeuGluAspAlaAlaAlaGlyGlnAsp134513501355 1360AlaGlyValArgGlnLeuAlaGlyHisAlaAlaGlyLeuArgGlyGly136513701375GluGlyGlyAlaAspAlaGlyAlaGluGlyLeuAspGl yArgLeuPro138013851390GlyAlaGlyValArgGlyAlaAlaArgValGlyHisValGlyValGly139514001405ProAl aGluAlaLeuGlnAspGluGlyLeuLeuGlyAlaIleValAla141014151420AlaAlaHisGlyHisGlyAlaHisArgValArgGlnGlyProGluArg14251430 14351440ValLeuGlyGlyHisGlyValProAspValArgGlnArgArgGlyHis144514501455AlaAlaGlyAspGluGlyAlaVa lAlaValGlyArgValAspProAla146014651470LeuAlaGluLeuValGluAlaLeuValGlyGlyLeuHisProArgVal14751480 1485LeuGlnProGlyHisGlyLeuAlaGlyGlyProAlaValAspGluAla149014951500HisGluGlyLeuValLeuLeuProArgValProHisLeuArgAspGlu1505 151015151520AspGlyHisGlyProGlyArgGlyAlaValAlaGlyArgGlyLeuAla152515301535AspValVa lLeuValProGluProLeuAlaGlyValProGlyAlaAla154015451550ValAlaAspAlaAlaValGlyArgArgValGlyAlaGlyProGlyLeu1555 15601565ProGluArgGlyGluGlnArgProValGlyArgArgGlyProValGly157015751580HisGluArgGluValValValGlyGlyAlaAlaLeuPr oAlaArgGly1585159015951600ProGlyGlyLeuArgGlyArgGlyArgGlyGlyArgGlyGlyGlyGly16051610 1615GlyGlyGlyGlyGlyGlyGlyArgGlyProArgGlyArgGlyGlyArg162016251630ArgArgArgArgTrpArgProGlyAlaGlyGluTrpGlyAlaGlyPro 163516401645AspSerPheValPhePheSerLeuGlyGlyGlyArgGlyArgGlyGly165016551660ArgGlyGlyArgGlyArgGlyGl yGlyArgAlaProArgGlyGlyGly1665167016751680GlyGlyGlyGlyGlyProGlyGlyGlyGlyArgAlaGlyArgGlyGlu1685 16901695ValArgValAlaAlaAlaAlaAlaGlyAlaAlaGluAlaAlaAlaAla170017051710AlaGluGlyAlaLeuSerGlyAlaAlaProAlaGl yLeuSerLeuGln171517201725GlyArgProAlaValProGlyGluAlaGluSerValLeuValLeuLeu173017351740GlyAlaAl aGlyAspGlyLeuAspGlyAspGlyGlyGlyGlyAlaGly1745175017551760AlaGlyValGlyValGlyGlyAspGlyAlaProGlyAlaLysArgPro 176517701775ArgIleGluProProArgGlyGlyGlyLeuValGluGlnGlyLeuAla178017851790ValLeuValMetValThrTh rAlaValProSerAlaGlyGlyGlyAla179518001805AlaAlaAlaGlyArgArgAspArgProGlyGlyGlyGlyGlyTrpGly18101815 1820SerGlyProProProCysArgArgCysGlyHisArgCysTrpLeuCys1825183018351840TrpTrpArgArgGlyProArgProArgArgArgProGlyLeuTh rAsp184518501855ArgValProProArgGlyGlyProSerProArgGlyArgArgGlyAla186018651870GlyGl yAlaGlyGlyAlaGlyGlyAlaGlyGlyGlyGlyGlyArgGly187518801885GlyCysGlyGlyGlyArgAlaProGlyAlaAlaGlyGlyProGlyLeu1890 18951900CysArgCysGluCysCysArgGlyArgArgProGlyProGlyAlaGly1905191019151920ProGlyProGlyProGluAspGluValTh rValLeuGlyAlaLeuMet192519301935GluSerProThrGlyGlyProGlyGlyArgGlyProGlyLeuValLeu19401945 1950LeuLeuValPheValVal1955(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1683 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: double(D) TOPOLOGY: linear(ii) MOLECULE TYPE: DNA (genomic)(iii) HYPOTHETICAL: NO(iv) ANTI-SENSE: NO(vi) ORIGINAL SOURCE:(A) ORGANISM: Pseudorabies virus(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 211..1440(D) OTHER INFORMATION: /product="early protein 0"(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:GGATCCGCAGCGCCGCTTTCAGACCCAGGAGCCGTCGACCCACCGCGGGAGGGCCCGCTT60CCCACGACGGCGCGCCC GGGCCATCGTCCCGGGACGGCCCGAGGGGGCGGGGGGAGCCCC120GACGGGGCGGGCGGAAGGGGGCGTGGACGCCCCGGGCGAAGACAAACAAAGGGGCCGGGC180ACCCGGTTAAAAAACGGGGCCCTCGACACCATGGGCTGCACGGTCTCTCGGAGA 234MetGlyCysThrValSerArgArg15CGGACGACCACCGCCGAGGCTTCCAGCGCCTGGGGGATCTTTGGCTTC282ArgThrThrThrAlaGluAlaSerSerAlaTrpGlyIlePheGlyPhe101520TACCGCCCCAGAAGCCCCTCGCCACCGCCGCAGCGCCTGTCACTGCCA330TyrArgP roArgSerProSerProProProGlnArgLeuSerLeuPro25303540CTCACCGTCATGGACTGCCCCATCTGCCTGGACGTCGCGGCCACCGAG378Leu ThrValMetAspCysProIleCysLeuAspValAlaAlaThrGlu455055GCGCAGACGCTGCCGTGCATGCACAAGTTCTGTCTGGACTGCATCCAG426Ala GlnThrLeuProCysMetHisLysPheCysLeuAspCysIleGln606570CGCTGGACCCTGACGAGCACCGCCTGCCCGCTGTGCAATGCCCGCGTC474ArgTr pThrLeuThrSerThrAlaCysProLeuCysAsnAlaArgVal758085ACCTCCATCCTCCACCACGTGGACAGCGACGCTTCGTTTGTGGAGACG522ThrSerIleL euHisHisValAspSerAspAlaSerPheValGluThr9095100CCCGTGGAGGGGGCGACGGATGTCGACGGGGAAGAGGATGAGCCGGTA570ProValGluGlyAlaThr AspValAspGlyGluGluAspGluProVal105110115120GGGGGGGGCTTCGCGGTCATCTGGGGTGAAGACTATACCGAGGAGGTG618GlyGlyGlyPheAla ValIleTrpGlyGluAspTyrThrGluGluVal125130135CGCCACGAGGAGGCCGAAGGGCAGGGCTCCGGGTCTGGGTCTCGCGCC666ArgHisGluGluAl aGluGlyGlnGlySerGlySerGlySerArgAla140145150CGCCCCAGAGTCCCCGTCTTCAACTGGCTTTATGGGCAGGTCTCGACG714ArgProArgValProV alPheAsnTrpLeuTyrGlyGlnValSerThr155160165GTCATCGAGAGCGACCCCATCCGCGAGGCCGTAGTGGACAACATCGTC762ValIleGluSerAspProIle ArgGluAlaValValAspAsnIleVal170175180GAGATTATCCAGGAGCACGGGATGAACCGCCAGCGCGTGACCGAGGCC810GluIleIleGlnGluHisGlyMetAsnArg GlnArgValThrGluAla185190195200ATGCTCCCCATGTTTGGGGCAAACACCCACGCCCTCGTCGATACGCTG858MetLeuProMetPheGlyAlaAsnTh rHisAlaLeuValAspThrLeu205210215TTTGACATATCGGCGCAGTGGATGCGGCGGATGCAGAGGCGAGCCCCG906PheAspIleSerAlaGlnTrpMetA rgArgMetGlnArgArgAlaPro220225230ATGAGCCACCAGGGTGTGAACTATATCGACACGTCCGAGTCCGAGGCA954MetSerHisGlnGlyValAsnTyrIle AspThrSerGluSerGluAla235240245CACTCTGACTCTGAGGTGTCTTCCCCCGACGAGGAAGACTCGGGCGCC1002HisSerAspSerGluValSerSerProAspGlu GluAspSerGlyAla250255260TCGAGCAGCGGGGTGCACACGGAGGATCTGACGGAGGCCTCCGAGTCC1050SerSerSerGlyValHisThrGluAspLeuThrGluAlaSe rGluSer265270275280GCGGACGACCAGAGGCCGGCGCCCAGGCGCTCCCCGCGCAGGGCCCGA1098AlaAspAspGlnArgProAlaProArgArgSerProA rgArgAlaArg285290295CGGGCGGCCGTGCTGAGGCGCGAGCAGAGACGGACCCGGTGCCTGCGA1146ArgAlaAlaValLeuArgArgGluGlnArgArgThr ArgCysLeuArg300305310CGCGGCCGGACGGGCGGACAGGCCCAGGGCGAGACTCCGGAGGCGCCA1194ArgGlyArgThrGlyGlyGlnAlaGlnGlyGluThrPro GluAlaPro315320325TCGTCCGGCGAGGGGTCCTCTGCGCAGCATGGTGCCTCGGGGGCCGGG1242SerSerGlyGluGlySerSerAlaGlnHisGlyAlaSerGlyAl aGly330335340GCCGGCCCGGGGTCGGCGAACACCGCCGCTTCGGCTCGCTCCTCCCCC1290AlaGlyProGlySerAlaAsnThrAlaAlaSerAlaArgSerSerPro345 350355360TCGTCTTCACCCTCCTCCTCGATGCGGCGCCCGTCGCCCTCTGCCTCT1338SerSerSerProSerSerSerMetArgArgProSerProSerAlaSer 365370375GCCCCCGAGACCGCCGCCCCCCGGGGCGGGCCTCCGGCGTCTAGCTCG1386AlaProGluThrAlaAlaProArgGlyGlyProProAlaSerSerSer380385390TCGGGATCCCCCCGCTCCGCTACCATCTTCATCGACCTCACCCAGGAC1434SerGlySerProArgSerAlaThrIlePheIleAspLeuThrGlnAsp 395400405GACGACTGAGCTCCCTCTTCCTCGCCGCGGACTGGGGCGACCCTGTTGCTGCTGCG1490AspAsp410GCCGCCGCCGCTCCTGCCCCCACTTCGGCTCCCGCTCCTGCTCCTGCTCC CGGCCCCACT1550CCTGTTCCTGTTCCTGTTCCTGTTCCTGTTCCTGTTCCCGGTCCTGCTCCGGCTCCCGGC1610CCCGCACCCACCTCCGCTCCTGCTGCGGGTCTCCAGGCCCAGACAAAATAAAAAAAGATA1670TATTTTTTCAGTC 1683(2) INFORMATION FOR SEQ ID NO:4:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 410 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:MetGlyCysThrValSerArgArgArgThrThrT hrAlaGluAlaSer151015SerAlaTrpGlyIlePheGlyPheTyrArgProArgSerProSerPro2025 30ProProGlnArgLeuSerLeuProLeuThrValMetAspCysProIle354045CysLeuAspValAlaAlaThrGluAlaGlnThrLeuProCysMetHis50 5560LysPheCysLeuAspCysIleGlnArgTrpThrLeuThrSerThrAla65707580CysProLeuCysAsnAlaArgVa lThrSerIleLeuHisHisValAsp859095SerAspAlaSerPheValGluThrProValGluGlyAlaThrAspVal100105 110AspGlyGluGluAspGluProValGlyGlyGlyPheAlaValIleTrp115120125GlyGluAspTyrThrGluGluValArgHisGluGluAlaGluGlyG ln130135140GlySerGlySerGlySerArgAlaArgProArgValProValPheAsn145150155160TrpLeuTyrGly GlnValSerThrValIleGluSerAspProIleArg165170175GluAlaValValAspAsnIleValGluIleIleGlnGluHisGlyMet180 185190AsnArgGlnArgValThrGluAlaMetLeuProMetPheGlyAlaAsn195200205ThrHisAlaLeuValAspThrLeuPheAspIleSe rAlaGlnTrpMet210215220ArgArgMetGlnArgArgAlaProMetSerHisGlnGlyValAsnTyr225230235240 IleAspThrSerGluSerGluAlaHisSerAspSerGluValSerSer245250255ProAspGluGluAspSerGlyAlaSerSerSerGlyValHisThrGlu 260265270AspLeuThrGluAlaSerGluSerAlaAspAspGlnArgProAlaPro275280285ArgArgSerProArgArgAlaArg ArgAlaAlaValLeuArgArgGlu290295300GlnArgArgThrArgCysLeuArgArgGlyArgThrGlyGlyGlnAla305310315 320GlnGlyGluThrProGluAlaProSerSerGlyGluGlySerSerAla325330335GlnHisGlyAlaSerGlyAlaGlyAlaGlyProGlySerAlaAs nThr340345350AlaAlaSerAlaArgSerSerProSerSerSerProSerSerSerMet355360365ArgArgProSer ProSerAlaSerAlaProGluThrAlaAlaProArg370375380GlyGlyProProAlaSerSerSerSerGlySerProArgSerAlaThr385390 395400IlePheIleAspLeuThrGlnAspAspAsp405410(2) INFORMATION FOR SEQ ID NO:5:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 67 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(iii) HYPOTHETICAL: NO(v) FRAGMENT TYPE: internal(vi) ORIGINAL SOURCE:(A) ORGANISM: Pseudorabies virus(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:LeuThrValMetAspCysProIleCysLeuAspValAlaAlaThrGlu1510 15AlaGlnThrLeuProCysMetHisLysPheCysLeuAspCysIleGln202530ArgTrpThrLeuThrSerThrAlaCysProLeuCys LysAlaArgVal354045ThrSerIleLeuHisHisValAspSerAspAlaSerPheValGluThr505560 ProValGlu65(2) INFORMATION FOR SEQ ID NO:6:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 69 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(v) FRAGMENT TYPE: internal(vi) ORIGINAL SOURCE:(A) ORGANISM: Herpes simplex virus(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:AspGluGly AspValCysAlaValCysThrAspGluIleAlaProHis151015LeuArgCysAspThrPheProCysMetHisArgPheCysIleProCys 202530MetLysThrTrpMetGlnLeuArgAsnThrCysProLeuCysAsnAla354045LysLeuValTyr LeuIleValGlyValThrProSerGlySerPheSer505560ThrIleProIleVal65(2) INFORMATION FOR SEQ ID NO:7:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 67 amino acids(B) TYPE: amino acid (D) TOPOLOGY: linear(ii) MOLECULE TYPE: peptide(v) FRAGMENT TYPE: internal(vi) ORIGINAL SOURCE:(A) ORGANISM: Varicella-zoster virus(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:AlaSerAspAsnThrCysThrIleCysMetSerThrValSerAspLeu15 1015GlyLysThrMetProCysLeuHisAspPheCysPheValCysIleArg202530AlaTrpThrSerThrSerValGlnCy sProLeuCysArgCysProVal354045GlnSerIleLeuHisLysIleValSerAspThrSerTyrLysGluTyr5055 60GluValHis65 PG,30

Claims

1. A pseudorabies virus having a genomic modification selected from the group consisting of a deletion, and insertion or both in: (1) the early protein 0 gene whereby said virus is characterized by the inability to express the early protein 0; or (2) the large latency transcript gene whereby said virus is characterized by the inability to express said large latency transcript, with the provision that the modification to the large latency transcript is in conjunction with another modification which serves to attenuate the virus.

2. A pseudorabies virus as described in claim 1 wherein said modification is in an overlapping region of the early protein 0 gene and the large latency transcript gene.

3. A pseudorabies virus as described in claim 1 wherein said modification is in an overlapping region of the large latency transcript gene and the immediately-early 180 gene.

4. A pseudorabies virus as described in claim 1 wherein said modification comprises a deletion.

5. A pseudorabies virus as described in claim 1 wherein said modification comprises a deletion in the overlapping region of the early protein 0 gene and the large latency transcript gene.

6. A pseudorabies virus as described in claim 5 wherein said virus is EL.beta.-001.

7. A vaccine comprising the virus of claim 1 in an effective immunization dosage with a pharmaceutically acceptable carrier or diluent.

8. A vaccine comprising the virus of claim 2 in an effective immunization dosage with a pharmaceutically acceptable carrier or diluent.

9. A vaccine comprising the virus of claim 5 in an effective immunization dosage with a pharmaceutically acceptable carrier or diluent.

10. A vaccine comprising the virus of claim 6 in an effective immunization dosage with a pharmaceutically acceptable carrier or diluent.

11. A method of immunizing an animal against psuedorabies comprising administering to said animal a vaccine comprising a pseudorabies virus having a genomic modification selected from the group consisting of a deletion, and insertion or both in: (1) the early protein 0 gene whereby said virus is characterized by the inability to express the early protein 0; or (2) the large latency transcript gene whereby said virus is characterized by the inability to express said large latency transcript with the provision that the modification to the large latency transcript is in conjunction with another modification which serves to attenuate the virus.

12. A method as described in claim 11 wherein said modification is in an overlapping region of the early protein 0 gene and the large latency transcript gene.

13. A method as described in claim 11 wherein said modification is in an overlapping region of the large latency transcript gene and the immediately-early 180 gene.

14. A method as described in claim 11 wherein said modification is a deletion.

15. A method as described in claim 11 wherein said modification is a deletion in the overlapping region of the early protein 0 gene and the large latency transcript gene.

16. A method as described in claim 15 wherein said virus is EL.beta.-001.

17. A method as described in claim 11, wherein said animal is a swine.

18. A method as described in claim 11 wherein said virus is present in said vaccine at level of 10.sup.3 -10.sup.6 PFU per dose.

19. A method for producing a pseudorabies virus deletion mutant comprising the steps:

(a) constructing a hybrid plasmid comprising a cloning vector, a selectable marker, and a DNA fragment of pseudorabies virus containing substantially all of the pseudorabies virus EP0 gene and flanking sequences thereof;

(b) deleting DNA sequences from the hybrid plasmid such that the early protein 0 is not expressed, while retaining pseudorabies virus DNA sequences adjacent to each side of the deletion;

(c) replacing the deleted sequences from step (b) with the selectable marker;

(d) co-transfecting in pseudorabies virus host cells the resulting plasmid from step (b) with infectious psuedorabies virus DNA; and

(e) selecting by means of the selectable marker psuedorabies virus deletion mutants which are characterized by the inability to express the early protein 0.