Patent Application
20060121462
The invention relates to a screening method for the identification of agents which modulate the activity of a receptor, C5L2, or homologue thereof.
Obesity affects around 58 million people in the USA and contributes to the deaths of approximately 300,000 people annually (New England Journal of Medicine). Obesity adds to the risk of heart attack, stroke, diabetes and some cancers. Consequently, obesity is a severe burden on healthcare in many countries. The control of fat deposition is thought to be influenced by the hormone leptin which is encoded by the Ob gene. The level of leptin in the circulation correlates with the level of fat deposition in fat cells (adipose tissue). High levels of leptin results in greater fat deposition and a tendency to become obese. However, not all obese people have elevated levels of leptin and therefore it is thought that there may be important differences in the cause of obesity. It is thought the principal site of action of leptin is the brain, or more particularly, the hypothalamus, which controls, amongst other things, appetite.
Infection or injury leads to activation of the complement cascade, a part of the innate immune system involved in the inflammation response. For many years it has been known that fragments of the complement proteins C5, C4 and C3 are potent regulators of white blood cell activity but more recently, many non-immune cell types have been shown to respond. Only two cell surface receptors for these six fragments (C5a, C4a, C3a and their corresponding metabolites, C5adR74, C4adR77 and C3adR77) have been well characterised; CD88, which binds C5a and C5adR74 and C3aR, which binds C3a.
The 74 and 77 amino acid complement fragments, C5a and C3a, have wide ranging effects in humans. Although initially described as leukocyte chemoattractants and anaphylatoxins, it is now clear that C5a and C3a are involved in microbial host defense, immune regulation (1) and protection against toxic insult (2-5).
C5a and C3a are also reported to have psychopharmacological effects (6,7) on feeding and drinking behavior.
Both complement fragments are rapidly desarginated by serum carboxypeptidase, which modulates function. Although C5a des-Arg74 retains most of the activity of intact C5a, albeit with a generally lower affinity for the C5a receptor (1CD88), C3a des-Arg77 activity is profoundly reduced relative to C3a. No binding of the des-Arg77 form to the C3a receptor (C3aR) is observed in transfected RBL cells or mouse macrophage/monocytes (8) and, unlike C3a, C3a des-Arg77 does not stimulate eosinophil chemotaxis (9), prostanoid production by guinea pig peritoneal macrophages and rat Kupffer cells (10) or human monocyte-like U937 cell degranulation (11). However, responses to C3a des-Arg77 have been reported: cytotoxicity of NK cells is inhibited by both C3a and C3a des-Arg77 (12); cytokine production by human monocyte/macrophages and PBMC is enhanced by these ligands but inhibited in human tonsil-derived B cells (13,14) and histamine release from rat peritoneal mast cells is stimulated (15).
In addition, triacylglycerol synthesis in adipocytes and preadipocytes is regulated by acylation stimulating protein (ASP), an activity shared by both C3a and C3a des-Arg77 (16). One explanation of this pattern of responses is that cells may express two kinds of receptor: one, probably C3aR, that binds only C3a and another, as yet unidentified, that binds both C3a and C3a des-Arg77.
A novel cbemoattractant binding protein, C5L2, that has a high affinity for C5a and C5a des-Arg74 and a moderate affinity for C3a has recently been disclosed (17). We describe a further interaction that C5L2 also binds C3a des-Arg77/ASP and is expressed in human adipose tissue.
The expression of C5L2 in adipose tissue and its binding to C3a des-Arg77/ASP describes a novel interaction which has utility with respect to the identification of agents which either mimic C3a des-Arg77/ASP activation of C5L2 or inhibit the interaction with a view to providing antagonists of C5L2 activation. Agents obtainable by the method have utility with respect to modulating fat deposition in adipocytes.
According to an aspect of the invention there is provided a screening method for the identification of agents which modulate the activity of the receptor C5L2, or homologue thereof.
According to an aspect of the invention there is provided a screening method for the identification of agents which modulate receptor activity comprising the steps of:
In a preferred method of the invention said preparation includes a second polypeptide encoded by a nucleic acid molecule selected from the group consisting of:
i) a polypeptide encoded by a nucleic acid molecule as represented in
In a preferred method of the invention there is provided a nucleic acid molecule which anneals under stringent hybridisation conditions to the sequences described in (a) and (i) above.
Stringent hybridisation/washing conditions are well known in the art. For example, nucleic acid hybrids that are stable after washing in 0.1×SSC, 0.1% SDS at 60° C. It is well known in the art that optimal hybridisation conditions can be calculated if the sequence of the nucleic acid is known. Typically, hybridisation conditions uses 4-6×SSPE (20×SSPE contains 175.3 g NaCl, 88.2 g NaH2PO4H2O and 7.4 g EDTA dissolved to 1 litre and the pH adjusted to 7.4); 5-10× Denhardts solution (50× Denhardts solution contains 5 g Ficoll (Type 400, Pharmacia), 5 g polyvinylpyrrolidone abd 5 g bovine serum albumen; 100 μg-1.0 mg/ml sonicated salmon/herring DNA; 0.1-1.0% sodium dodecyl sulphate; optionally 40-60% deionised formamide. Hybridisation temperature will vary depending on the GC content of the nucleic acid target sequence but will typically be between 42°-65° C.
In a preferred method of the invention said polypeptide, or active binding fragment thereof, is encoded by a nucleic acid molecule comprising the sequence in
In a preferred method of the invention said polypeptide is modified by deletion, subsitution or addition of at least one amino acid residue of the sequence represented in
In a further preferred method of the invention said second polypeptide is modified by deletion, substitution or addition of at least one amino acid residue of the sequence represented in
A modified or variant, i.e. a fragment polypeptide and reference polypeptide, may differ in amino acid sequence by one or more substitutions, additions, deletions, truncations which may be present in any combination. Among preferred variants are those that vary from a reference polypeptide by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid by another amino acid of like characteristics. The following non-limiting list of amino acids are considered conservative replacements (similar): a) alanine, serine, and threonine; b) glutamic acid and asparatic acid; c) asparagine and glutamine d) arginine and lysine; e) isoleucine, leucine, methionine and valine and f) phenylalanine, tyrosine and tryptophan. Preferred are variants which retain the same biological function and activity as the reference polypeptide from which it varies Alternatively, variants include those with an altered biological function, for example variants which act as antagonists.
Alternatively or in addition, non-conservative substitutions may give the desired biological activity see Cain S A, Williams D M, Harris V, Monk P N. Selection of novel ligands from a whole-molecule randomly mutated C5a library. Protein Eng. 2001 March; 14(3):189-93, which is incorporated by reference.
A functionally equivalent polypeptide according to the invention is a variant wherein one in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues, or one in which one or more amino acid residues includes a substituent group. Conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of the hydroxl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between amide residues Asn and Gln; exchange of the basic residues Lys and Arg; and replacements among aromatic residues Phe and Tyr.
In addition, the invention features polypeptide sequences having at least 75% identity with the polypeptide sequences as hereindisclosed, or fragments and functionally equivalent polypeptides thereof. In one embodiment, the polypeptides have at least 85% identity, more preferably at least 90% identity, even more preferably at least 95% identity, still more preferably at least 97% identity, and most preferably at least 99% identity with the amino acid sequences illustrated herein.
In a further preferred method of the invention said polypeptide and second polypeptide is/are expressed by a cell, preferably a mammalian cell, for example and not by limitation, a CHO cell, a COS cell. Preferably said cell is an adipocyte Preferably said cell is genetically engineered to express said polypeptide.
In a preferred method of the invention said agent is selected from the group consisting of: a polypeptide; a peptide; an aptamer.
In a preferred method of the invention said polypeptide is an antibody.
In a preferred method of the invention said antibody is a polyclonal or monoclonal antibody.
Antibodies, also known as immunoglobulins, are protein molecules which have specificity for foreign molecules (antigens). Immunoglobulins (Ig) are a class of structurally related proteins consisting of two pairs of polypeptide chains, one pair of light (L) (low molecular weight) chain (K or λ), and one pair of heavy (H) chains (γ, α, μ, δ and ε), all four linked together by disulphide bonds. Both H and L chains have regions that contribute to the binding of antigen and that are highly variable from one Ig molecule to another. In addition, H and L chains contain regions that are non-variable or constant.
The L chains consist of two domains. The carboxy-terminal domain is essentially identical among L chains of a given type and is referred to as the “constant” (C) region. The amino terminal domain varies from L chain to L chain and contributes to the binding site of the antibody. Because of its variability, it is referred to as the “variable” (V) region.
The H chains of Ig molecules are of several classes, α, μ, σ, α, and γ (of which there are several sub-classes). An assembled Ig molecule consisting of one or more units of two identical H and L chains, derives its name from the H chain that it possesses. Thus, there are five Ig isotypes: IgA, IgM, IgD, IgE and IgG (with four sub-classes based on the differences in the H chains, i.e., IgG1, IgG2, IgG3 and IgG4). Further detail regarding antibody structure and their various functions can be found in, Using Antibodies: A laboratory manual, Cold Spring Harbour Laboratory Press.
Chimeric antibodies are recombinant antibodies in which all of the V-regions of a mouse or rat antibody are combined with human antibody C-regions. Humanised antibodies are recombinant hybrid antibodies which fuse the complimentarity determining regions from a rodent antibody V-region with the framework regions from the human antibody V-regions. The C-regions from the human antibody are also used. The complimentarity determining regions (CDRs) are the regions within the N-terminal domain of both the heavy and light chain of the antibody to where the majority of the variation of the V-region is restricted. These regions form loops at the surface of the antibody molecule. These loops provide the binding surface between the antibody and antigen.
Antibodies from non-human animals provoke an immune response to the foreign antibody and its removal from the circulation. Both chimeric and humanised antibodies have reduced antigenicity when injected to a human subject because there is a reduced amount of rodent (i.e. foreign) antibody within the recombinant hybrid antibody, while the human antibody regions do not illicit an immune response. This results in a weaker immune response and a decrease in the clearance of the antibody. This is clearly desirable when using therapeutic antibodies in the treatment of human diseases. Humanised antibodies are designed to have less “foreign” antibody regions and are therefore thought to be less immunogenic than chimeric antibodies.
It will be apparent that the antibody could be specific for C5L2 or C3a des-Arg77/ASP. Furthermore said antibodies can be agonistic or antagonistic.
In a preferred method of the invention said peptide is an oligopeptide. Preferably, said oligopeptide is at least 10 amino acids long. Preferably said oligopeptide is at least 20, 30, 40, 50 amino acids in length.
In a further preferred method of the invention said peptide is a modified peptide.
Peptides or protein fragments can be derived from the receptor, or the intact receptor expressed in a suitable cell line as a means of selecting novel oligopeptide ligands from peptide libraries see, [Faibrother W J, Christinger H W, Cochran A G, Fuh G, Keenan C J, Quan C, Shriver S K, Tom J Y, Wells J A, Cunningham B C. Novel peptides selected to bind vascular endothelial growth factor target the receptor-binding site. Biochemistry. 1998 Dec. 22; 37(51):17754-64.] or mutant complement fragment libraries displayed on phage [Cain S A, Williams D M, Harris V, Monk P N. Selection of novel ligands from a whole-molecule randomly mutated C5a library. Protein Eng. 2001 March;14(3):189-93.]
It will be apparent to one skilled in the art that modified amino acids include, by way of example and not by way of limitation, 4-hydroxyproline, 5-hydroxylysine, N6-acetyllysine, N6-methyllysine, N6,N6-dimethyllysine, N6,N6,N6-trimethyllysine, cyclohexyalanine, D-amino acids, ornithine. Other modifications include amino acids with a C2, C3 or C4 alkyl R group optionally substituted by 1, 2 or 3 substituents selected from halo (eg F, Br, I), hydroxy or C1-C4 alkoxy.
Alternatively said peptide is modified by acetylation and/or amidation.
In a preferred method of the invention the polypeptides or peptides are modified by cyclisation. Cyclisation is known in the art, (see Scott et al Chem Biol (2001), 8:801-815; Gellerman et al J. Peptide Res (2001), 57: 277-291; Dutta et al J. Peptide Res (2000), 8: 398-412; Ngoka and Gross J Amer Soc Mass Spec (1999), 10:360-363).
In a further preferred method of the invention said agent is an aptamer.
Nucleic acids and proteins have both linear sequence structure, as defined by their base or amino acid sequence, and also a three dimensional structure which in part is determined by the linear sequence and also the environment in which these molecules are located. Conventional therapeutic molecules are small molecules, for example, peptides, polypeptides, or antibodies, which bind target molecules to produce an agonistic or antagonistic effect. It has become apparent that nucleic acid molecules also have potential with respect to providing agents with the requisite binding properties which may have therapeutic utility. These nucleic acid molecules are typically referred to as aptamers. Aptamers are small, usually stabilised, nucleic acid molecules which comprise a binding domain for a target molecule.
In a further preferred method of the invention said aptamer comprises at least one modified nucleotide base.
The term “modified nucleotide base” encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3′ position and other than a phosphate group at the 5′ position. Thus modified nucleotides may also include 2′ substituted sugars such as 2′-O-methyl-; 2-O-alkyl; 2-O-allyl; 2′-S-alkyl; 2′-S-allyl; 2′-fluoro-; 2′-halo or 2; azido-ribose, carbocyclic sugar analogues a-anomeric sugars; epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.
Modified nucleotides are known in the art and include by example and not by way of limitation; alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4, N4-ethanocytosine; 8-hydroxy-N-6-methyladenine; 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5-bromouracil; 5-carboxymethylaminomethyl-2-thiouracil; 5-carboxymethylaminomethyl uracil; dihydrouracil; inosine; N6-isopentyl-adenine; 1-methyladenine; 1-methylpseudouracil; 1-methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3-methylcytosine; 5-methylcytosine; N6-methyladenine; 7-methylguanine; 5-methylaminomethyl uracil; 5-methoxy amino methyl-2-thiouracil; β-D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N-6-isopentenyladenine; uracil-5-oxyacetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5-oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil;]-methylguanine; 1-methylcytosine;
The aptamers of the invention are synthesized using conventional phosphodiester linked nucleotides and synthesized using standard solid or solution phase synthesis techniques which are known in the art. Linkages between nucleotides may use alternative linking molecules. For example, linking groups of the formula P(O)S, (thioate); P(S)S, (dithioate); P(O)NR′2; P(O)R′; P(O)OR6; CO; or CONR′2 wherein R is H (or a salt) or alkyl (1-12C) and R6 is alkyl (1-9C) is joined to adjacent nucleotides through —O— or —S—.
In a further preferred method of the invention said agent is an inhibitory RNA (RNAi) molecule.
A technique to specifically ablate gene function is through the introduction of double stranded RNA, also referred to as inhibitory RNA (RNAi), into a cell which results in the destruction of mRNA complementary to the sequence included in the RNAi molecule. The RNAi molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double stranded RNA molecule. The RNAi molecule is typically derived from exonic or coding sequence of the gene which is to be ablated.
Preferably said RNAi molecule is derived from the nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of;
Recent studies suggest that RNAi molecules ranging from 100-1000 bp derived from coding sequence are effective inhibitors of gene expression. Surprisingly, only a few molecules of RNAi are required to block gene expression which implies the mechanism is catalytic. The site of action appears to be nuclear as little if any RNAi is detectable in the cytoplasm of cells indicating that RNAi exerts its effect during mRNA synthesis or processing.
The exact mechanism of RNAi action is unknown although there are theories to explain this phenomenon. For example, all organisms have evolved protective mechanisms to limit the effects of exogenous gene expression. For example, a virus often causes deleterious effects on the organism it infects. Viral gene expression and/or replication therefore needs to be repressed. In addition, the rapid development of genetic transformation and the provision of transgenic plants and animals has led to the realisation that transgenes are also recognised as foreign nucleic acid and subjected to phenomena variously called quelling (Singer and Selker, 1995), gene silencing (Matzke and Matzke, 1998), and co-suppression (Stam et. al., 2000).
Initial studies using RNAi used the nematode Caenorhabditis elegans. RNAi injected into the worm resulted in the disappearance of polypeptides corresponding to the gene sequences comprising the RNAi molecule (Montgomery et al., 1998; Fire et al., 1998). More recently the phenomenon of RNAi inhibition has been shown in a number of eukaryotes including, by example and not by way of limitation, plants, trypanosomes (Shi et al., 2000) Drosophila spp. (Kennerdell and Carthew, 2000). Recent experiments have shown that RNAi may also function in higher eukaryotes. For example, it has been shown that RNAi can ablate c-mos in a mouse ooctye and also E-cadherin in a mouse preimplanation embryo (Wianny and Zemicka-Goetz, 2000).
More preferably said RNAi molecule according has a length of between 10 nucleotide bases (nb)-1000 nb. Even more preferably said RNAi molecule has a length of 10 nb; 20 nb; 30 nb; 40 nb; 50 nb; 60 nb; 70 nb; 80 nb; 90 nb; or 100 bp. Even more preferably still said RNAi molecule is 21 nb in length.
Even more preferably still the RNAi molecule comprises the nucleic acid sequence AAGAAATCCACCAGCCATGAC.
Even more preferably still the RNAi molecule consists of the nucleic acid sequence AAGAAATCCACCAGCCATGAC
The RNAi molecule may comprise modified nucleotide bases.
In a still further preferred method of the present invention an antisense oligonucleotide is provided which is capable of hybridising to the nucleic acid molecule encoding the C5L2 receptor.
Even more preferably this antisense oligonucleotide is capable of hybridising to the nucleic acid molecule encoding the human C5L2 receptor. Preferably said antisense oligonucleotide comprises a nucleic acid sequence selected from the group consisting of;
Alternatively, said antisense oligonucleotide consists a nucleic acid sequence selected from the group consisting of;
In a further preferred embodiment of the present invention, said antisense oligonucleotide is capable of hybridising to the nucleic acid molecule encoding the mouse C5L2 receptor. Preferably said antisense oligonucleotide comprises a nucleic acid sequence selected from the group consisting of;
Alternatively, said antisense oligonucleotide consists a nucleic acid sequence selected from the group consisting of;
As used herein, the term “antisense oligonucleotide” or “antisense” describes an oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes under physiological conditions to DNA comprising a particular gene or to an mRNA transcript of that gene and thereby, inhibits the transcription of that gene and/or the translation of that mRNA. The antisense molecules are designed so as to interfere with transcription or translation of a target gene upon hybridization with the target gene. Those skilled in the art will recognize that the exact length of the antisense oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence.
It is preferred that the antisense oligonucleotide be constructed and arranged so as to bind selectively with the target under physiological conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological conditions.
In order to be sufficiently selective and potent for inhibition, such antisense oligonucleotides should comprise at least 7 (Wagner et al., Nature Biotechnology 14:840-844, 1996) and more preferably, at least 15 consecutive bases which are complementary to the target. Most preferably, the antisense oligonucleotides comprise a complementary sequence of 20-30 bases.
Although oligonucleotides may be chosen which are antisense to any region of the gene or mRNA transcripts, in preferred embodiments the antisense oligonucleotides correspond to N-terminal or 5′ upstream sites such as translation initiation, transcription initiation or promoter sites. In addition, 3′-untranslated regions may be targeted. The 3′-untranslated regions are known to contain cis acting sequences which act as binding sites for proteins involved in stabilising mRNA molecules. These cis acting sites often form hair-loop structures which function to bind said stabilising proteins. A well known example of this form of stability regulation is shown by histone mRNA's, the abundance of which is controlled, at least partially, post-transcriptionally.
The term “antisense oligonucleotides” is to be construed as materials manufactured either in vitro using conventional oligonucleotide synthesising methods which are well known in the art or oligonucleotides synthesised recombinantly using expression vector constructs.
The present invention, thus, contemplates pharmaceutical preparations containing natural and/or modified antisense molecules that are complementary to and hybridizable with, under physiological conditions, nucleic acids encoding proteins the regulation of results in beneficial therapeutic effects, together with pharmaceutically acceptable carriers (eg polymers, liposomes/cationic lipids).
Antisense oligonucleotides may be administered as part of a pharmaceutical composition. Such a pharmaceutical composition may include the antisense oligonucleotides in combination with any standard physiologically and/or pharmaceutically acceptable carriers which are known in the art (eg liposomes). The compositions should be sterile and contain a therapeutically effective amount of the antisense oligonucleotides in a unit of weight or volume suitable for administration to a patient. The term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term “physiologically acceptable” refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism.
According to a further aspect of the invention there is provided an agent obtainable by the method according to the invention.
Preferably said agent is an agonist of C5L2 receptor activation. Alternatively said agent is an antagonist of C5L2 receptor activation.
In a preferred embodiment of the invention there is provided the use of said agent as a pharmaceutical.
In a further preferred embodiment of the invention there is provided the use of an agent according to the invention for the manufacture of a medicament for use in the treatment of obesity.
According to a further aspect of the invention there is provided a method to treat obesity comprising administering to an animal, preferably a human, an agent according to the invention.
According to a still further aspect of the present invention there is provided the use of a PI-3 inhibitor for the manufacture of a medicament for use in the treatment of obesity. Preferably this PI-3 inhibitor is wortmanin or a functional variant thereof.
An embodiment of the invention will now be described by example only and with reference to the following figures:
Cell Lines and Culture Conditions
RBL-2H3 and HEK 293 cells were routinely cultured in Dulbecco's modified Eagle's medium+10% (v/v) fetal calf serum at 37° C., 5% CO2. The media was supplemented with 400 mg/L G-418 for stably transfected cells.
Stable Transfection of RBL Cells.
C5L2, C3aR and CD88-transfected RBL cells were produced as described (17). G16 was cloned from human monocytes mRNA and authenticated by sequencing. Human G16 and either C5L2 or CD88 were ligated into the bicistronic expression vector pIRES (Qiagen). Stable transfection of RBL-2H3 cells with pIRES constructs was achieved by electroporation (18). Cells underwent three rounds of fluorescence-activated cell sorting using anti-CD88 antibody (clone S5/1; Serotec) or anti-hemagglutinin peptide antibody (Roćhe Molecular Biochemicals, clone 12CA5), selecting the top 5% of receptor-positive cells in each round.
Transient Transfection of HEK 293 Cells
HEK 293 cells were seeded into 6-well plates at 1×106 cells/well the day before transfection. C5L2 in vector pEE6hCMV.neo (Celltech) or C3aR in vector pcDNA1/AMP (Invitrogen) at 2 μg DNA/well were transfected with Lipofectamine2000 (5 μl/well) (Invitrogen) according to the manufacturer's protocol. Cells were assayed for binding/uptake three days post-transfection.
Production of Anaphylatoxins
Expression and purification of the recombinant His6-tagged C5a, C5a des-Arg74 and C3a was performed under denaturing conditions as described (19). Recombinant C4a, C4a des-Arg77 and C3a des-Arg77 were expressed and purified under non-denaturing conditions by sonication in the presence of BugBuster Protein Extraction Reagent (Novagen) using manufacturer's conditions. Plasma ASP (C3a des-Arg77) and plasma C3a were purified as previously described (16).
Fluorescent Labelling of ASP and C3a
ASP or C3a was labelled with FLUOS (Roche Biochemicals) at a molar ratio of 1:10 (ligand:FLUOS) for two hours according to the manufacturer's recommendations. Labelled ligand was separated from free FLUOS on a Sephadex G25M column and stored in aliquots at −80° C.
Cellular Activation Assays
Cellular activation was measured as the release of -hexosaminidase from intracellular granules (20). In the enhancement of degranulation assay, cells were treated with 1 μg/ml IgEDNP (21) overnight, then with chemoattractants or peptides for 10 min prior to stimulation with 100 ng/ml DNP-HSA (Sigma) for 15 minutes. EC50 and standard error values were obtained by iterative curve fitting using GraphPad Prism 2.0.
Radiolabelled Ligand Competition Receptor Binding Assays
Competition binding assays were performed using 50 pM 125I-C5a or 125I-C3a (NEN) on adherent C5aR-transfected or C5L2-transfected RBL cells in 96-well microtiter plates (55 000/well) at 4° C. as described previously (22). Competition curves were generated by pre-incubating adherent cells with increasing concentrations of unlabelled complement fragments. The IC50, standard error values and linear regression analyses were obtained by using GraphPad Prism 2.0.
Fluorescent Ligand Binding/Uptake Assays
Cells were incubated with the indicated concentrations of FLUOS-labelled ASP or C3a for 30 minutes at 37° C. in binding buffer (23) and washed three times with cold binding buffer. Cells were then detached with 0.25% trypsin/0.02% EDTA in PBS, fixed with 1% paraformaldehyde, washed with PBS, and assayed by fluorescence-activated cell scanning.
Human Adipose Tissue and Murine 3T3-L1 Preadipocyte RT-PCR
Total RNA was isolated by Trizol extraction from freshly isolated samples of human adipose tissue or cultured 3T3-L1 cells. cDNA was produced from 3 μg of RNA by reverse transcriptase, and 4% of the reaction was amplified by PCR with 1.5 nM MgCl2 and 0.01 mM tetramethyl ammonium chloride, under the following protocol: 1 min at 94° C., 1 min at 60° C., 2 min at 72° C. for 35 cycles. Primers for human C5L2 were: sense 5′-CCTGGTGGTCTACGGITCAG-3′ and antisense 5′-GGGCAGGATTTGTGTCTGTT-3′. Primers for murine C5L2 (Ensembl gene ID: ENSMUSG00000041388) were: sense 5′-ATGGCCGACTTGCTTTGT-3′ and antisense 5′-CCTTGGTCACCGCACTTTC-3′. Reaction products were separated on a 7.5% polyacrylamide gel and detected by silver staining (BioRad), and a 100 bp ladder (NEB) was used as standard. For sequencing, the PCR product was purified from a 1.2% agarose gel.
We have previously shown that C5L2 has binding sites for C5a, C5a des-Arg74, C4a and C3a (17). Here we show that the des-Arg77 forms of C4a and C3a are also ligands for this receptor (
Recombinant C3a des-Arg77 can clearly compete with 125I-C3a for binding to C5L2, so we then directly measured the affinity of C3a des-Arg77 for C5L2, using protein purified from human plasma as ASP. ASP and purified human C3a were labelled with FLUOS. Increasing concentrations of ASP were incubated with HEK 293 cells transiently transfected with C5L2 and binding and uptake assessed by flow cytometry (
C3a des-Arg77 binding enhances IgE-receptor-mediated degranulation in C5L2-transfected RBL cells. We have previously shown that C5a, C5a des-Arg74, C4a and C3a binding to C5L2 does not stimulate an increase in intracellular [Ca2+] nor the degranulation of transfected RBL cells, possibly due to weak coupling to endogenous Gi-like G proteins (17). However, addition of anaphylatoxic ligands does significantly enhance the secretory response to cross-linkage of the high affinity IgE receptor with IgE and antigen (17). As neither recombinant nor purified C3a des-Arg77 (or any other ligand) is able to directly stimulate degranulation in C5L2-transfected RBL cells (data not shown), we have used the degranulation-enhancement assay to derive the dose-response relationship for C3a des-Arg77 in RBL cells. Intact complement fragments can enhance the IgE-mediated degranulation response (
Both CD88 and C5L2 can couple through Gαi and Gα16. The C5a receptor CD88 can couple effectively to the pertussis toxin (PT)-sensitive G proteins Gi2 and Gi3 (25) and also to toxin-insensitive Gq-family member, G16 (26,27). We reasoned that the weak stimulus-secretion coupling by C5L2 could be due to the absence of G16 from RBL cells, which we tested by co-transfecting cells with human Gα16 and either CD88 or C5L2. The bicistronic vector pIRES was used, to increase the likelihood that equal amounts of receptor and G protein would be expressed in transfected cells. With transfection of CD88 alone, increasing concentrations of PT inhibited the degranulation response (
The enhancement of degranulation by purified human ASP/C3a des-Arg77 in cells transfected with C5L2 alone can be inhibited by pre-treating cells with pertussis toxin (
C5L2 mRNA is expressed in human adipose tissue and murine 3T3-L1 preadipocytes. Although C3a des-Arg77 is regarded as biologically inactive in most myeloid systems, the acylation stimulating properties of this complement fragment are well documented (28). We therefore investigated the expression of C5L2 in human and murine adipose tissue, since both adipocytes and preadipocytes are known to respond to ASP/C3a des-Arg77 by an increase in triglyceride synthesis (16). We used RT-PCR to detect expression using species-specific sets of primers to human and mouse adipose tissue mRNA. Both primer sets produced a band as seen on polyacrylamide electrophoresis gels at the size expected for a C5L2 transcript (
Stable transfection of the receptor reconstitutes activity in a non-responsive cell.
Using a plasmid that expresses C5L2, we have stably transfected this into HEK cells, cells which do not normally express C5L2. Using an antibody designed against the N terminal component of C5L2, we can demonstrate that this receptor is highly expressed in stably transfected HEK cells by FACSCAN (
As shown in
Reconstituted activity can again be blocked using a signal transduction inhibitor that also blocks ASP activity in an endogenously expressing cell (3T3).
Previous work has demonstrated that that the ASP pathway involves intracellular signaling mediated via the protein kinase C pathway. Recently, we have demonstrated that PI-3 kinase is also involved in mediating ASP action, and addition of wortmanin, a PI-3 kinase inhibitor, not only blocks ASP action in normally responsive cells, but blocks ASP response in HEK-C5L2 stable transfectants (also shown in
Down regulation of endogenous expression using antisense oligonucleotides or interfering RNA (RNAi) also decreases C5L2 expression and response to ASP in normally responsive cells.
In order to evaluate C5L2 expression in endogenously expressing cells, we have used the antibody to evaluate endogenous expression, using non-immune serum to determine background. As shown in
Treatment of cells with a final concentration of 1, 2 or 4 μg/ml of various RNAi's, can reduce the expression of C5L2 to background levels (
Using various antisense oligonucleotides targeted to different regions of the mRNA at a final concentration of 0.2 or 0.24 μM, we can also reduce the response to ASP as assessed by triglyceride synthesis. As shown in
28. Cianflone, K., Maslowska, M., and Sniderman, A. D. (1999) Semin Cell Dev Biol 10, 31-41
1pD2 = −log IC50;
2IC50 = concentration of unlabelled ligand resulting in 50% of maximal radioligand binding;
3n = number of separate experiments performed in triplicate;
4ND = assay not done.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/GB03/02278 | 5/27/2003 | WO | 12/22/2005 |
