Patent Application
20250177509
This application claims that benefit of priority from China's prior application no. 2020106427453, filed on Jul. 6, 2020; Priority to that prior application file in China, application no. 2020106427538, filed on Jul. 6, 2020; Priority to that prior application file in China, application no. 2021106145678, on Jul. 6, 2020; Priority is claim to that prior application of China, application no. 2020106427449, on Jul. 6, 2020; This application claim that benefit of priority from China's prior application no. 2020106427542, on Jul. 6, 2020; All of which form a part of the present invention.
This application includes an electronically submitted sequence listing in .txt format. The .txt file contains a sequence listing entitled “0256_0195PUS1_ST25.txt” created on Jan. 3, 2025 and is 361,575 bytes in size.
The sequence listing contained in this .txt file is part of the specification and is hereby incorporated by reference herein in its entirety.
The invention relates to the technical field of gene engineering and the field of immunology, in particular to a recombinant adenovirus vaccine of African swine fever virus and a construction method thereof.
African swine fever (ASF) is a highly infectious porcine virus disease. It can lead to a high mortality rate of close to 100% in domestic pigs. ASF is caused by African swine fever virus (ASFV). ASFV is a large double-stranded DNA virus that mainly replicates in the cytoplasm of macrophages. It has a 20-sided structure, with a diameter of 175-215 nm, and a genome length of 170-190 kb. It contains 151 open reading frames, encodes 150-200 proteins, and is a double-stranded linear DNA virus with a capsular sac. The structural proteins that constitute the ASFV virus particles include P30, P72, P49, P54, P220, P62, pB602L, CD2v protein, etc. Up to now, vaccines based on one or two subunits have failed to induce immunity strong enough to have a significant protective effect on the vaccinator.
ASF outbreak was discovered in China in 2018, which caused huge direct and indirect economic losses. Therefore, there is an urgent need to develop vaccines against ASFV. It has been reported that previous studies on ASFV vaccines mainly focused on inactivated vaccines and attenuated vaccines. However, inactivated vaccines do not induce an effective protective response; The biosafety of attenuated vaccine is the main limiting factor for its use, and attenuated strains are not allowed to be studied in China. However, in the absence of viable viral experiments at this stage, it is necessary to provide a vaccine to elicit an immune response against as many antigens as possible.
Therefore, new ASFV vaccines need to be developed. A potential candidate vaccine is a live vector vaccine. Compared with other vaccines, the live vector vaccine has the following advantages: (1) It can actively infect target tissues or cells, improving the efficiency of exogenous genes into the cells; (2) The vector itself has adjuvant effect, and can induce the production of cytokines and chemokines; (3) Most of them can induce long-term immune response. Advantageously, it is desirable to deliver as much pathogen protein as possible with as few live vectors as possible.
A live vector vaccine refers to the cloning of a protein-encoding gene of a pathogen into a live viral vector, which is then used to immunize an animal and express the protein in the animal to induce an immune response against the protein. As a vector for expressing african swine fever antigen protein, adenovirus type 5 has a plurality of advantages as follows: {circle around (1)} the adenovirus expression vector is replication defective and can only be produced and prepared in a unique complementary cell line, and the adenovirus does not integrate into a host cell genome, a target gene is expressed in a free state outside the host cell genome, the possibility of integrated mutation carcinogenesis is small, the gene toxicity is low, and the prepared vaccine is good in safety; {circle around (2)} the recombinant adenovirus vector can obtain higher titer, is beneficial to large-scale production, has high industrialized efficiency and low production cost; {circle around (3)} At present, the structure, characteristics and function of adenovirus type 5 have been studied in depth. The adenovirus vector is easy to copy and easy to operate, which is conducive to research; {circle around (4)} The common first-generation adenovirus vector genome knocks out 6K genes, can insert foreign genes 7.5 k, and has relatively large capacity; {circle around (5)} Adenovirus is relatively stable and can be prepared by purification, concentration and preservation.
Previous studies report some live vector vaccines. For example, ASFV P30, P54, P72 and pp62 genes are respectively recombined into a human adenovirus Ad5 vector for ‘cocktail’ immunity, and good antigen-specific CTL reaction is obtained; Then they recombined ASFV A151R, B119L, B602L, EP402R, EP153R, B438L and K205R-A104R into a replication-defective adenovirus vector, and after mixed immunity in a “cocktail” mode, they were able to induce strong humoral and cellular immune responses. However, for “cocktail” immunization, each ASFV antigen gene must be recombined into a replication-defective adenovirus vector, so a very large number of vectors are needed and there is a risk of immune response against adenovirus vector during the immune process. CN108504686A and CN108504687A provide recombinant adenovirus vectors expressing the EP153R and EP402R genes of ASFV, respectively. CN109652449A discloses a recombinant adenovirus vector for co-expression of two antigenic genes of EP153R and EP402R, and CN109735567A discloses a recombinant adenovirus vector for co-expression of two antigenic genes of EP153R and P54.
However, in order to further enhance the specific immune response to ASF, the antigenic gene capacity of the adenovirus vector needs to be further increased, and as much pathogen protein as possible needs to be delivered with as few live vectors as possible to elicit an immune response against as many antigens as possible.
CN110269932A discloses that 5-7 antigen genes of ASFV such as A104R, A151R, B119L, B602L, CD2v, K205R, P49 and the like are fused together based on an adenovirus vector for preparing a live vector vaccine. However, the fusion of multiple antigen genes has the risk of reducing immunogenicity and possibly leading to immune failure. Therefore, to improve the vaccine activity, it is necessary to express completely independent antigen genes in each adenovirus vector.
P30 protein of ASFV is an important structural protein encoded by CP204L gene. Studies have found that P30 can induce host cells to produce neutralizing antibodies that inhibit intracellular internalization, thus delaying the onset of disease or even protecting cells against viral infection. Therefore, P30 plays an important role in blocking virus-cell interaction. P30, as an early protein of virus, is mainly distributed in the cytoplasm after infected cells, and can be detected in the cytoplasm four hours after infection. P30 is also one of the most antigenic ASFV proteins with strong immunogenicity, which can induce the body to produce virus neutralizing antibodies in infected animals, so it is usually used as a diagnostic antigen. The P54 protein of ASFV is encoded by E183L gene, and its antibody has certain virus neutralization ability. In addition, P30 protein and P54 protein can interact with two different receptors or binding sites on susceptible cells to alleviate the disease course. P72 protein is one of the main detected antigens of ASFV, with a size of about 75 kd. Good stability and small variation. A series of detection products have been developed with P72 protein as antigen. PB602L protein encoded by B602L gene can stimulate the matrix to produce high-level antibody. However, in all of the previous studies, there is no recombinant adenovirus vector for co-expression of four antigen genes, and there is no recombinant adenovirus vector for co-expression of four antigen genes P72, B602L, P30 and P54 of ASFV to be applied to the development of live vector vaccines. And there is no combination of two molecular adjuvants simultaneously cloned into the vector and coexpressed with a group of ASFV antigens.
In order to solve the problems, the invention provides an african swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector co-expressing four antigen genes of the african swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells. There are five groups of four antigen genes of the african swine fever virus are designed in total, and the four antigen genes of any group can be used for preparing a recombinant adenovirus vector co-expressing the four antigen genes of the african swine fever virus, namely the african swine fever virus vaccine. The invention can greatly improve the capacity of the adenovirus vector vaccine and enhance the specific immune response to the african swine fever virus by simultaneously expressing four group independent antigens of the african swine fever inonly one adenovirus vector.
There are more than 160 antigen genes of African swine fever virus in total, and the inventor selects 20 antigen genes with stronger immune effect from the 160 antigen genes through a large number of screening experiments, namely as: P72, B602L, P30, P54, CP129R, MGF5L6L, CP312R, MGF110-4L, L8L, I215L, I73R, E146L, EP402R, EP153R, I177L, K205R, F317L, A15MR, P34 and pp62. The 20 antigen genes are divided into five groups according to that size of the gene fragment and the protein structure, and four antigen genes in each group can be co-expressed in the recombinant adenovirus vector pAd5LCL3 provided by the invention, that is, four antigen genes can be completely and independently expressed in the same vector. The five groups of antigen gene vaccines (including five recombinant adenovirus vectors pAd5LCL3) form a complete African swine fever virus vaccine and obtain very good immune effect. In the five groups of antigen gene vaccines, four antigen genes of each group can be well matched and assembled in the same recombinant adenovirus vector, so that the four antigen genes can be completely and independently expressed.
In one aspect, the invention provides a recombinant adenovirus vector pAd5LCL3 capable of simultaneously expressing a plurality of antigen genes, wherein the recombinant adenovirus vector pAd5LCL3 is missed E1, E3, E4 and E2a genes and has E1 regions and E4 regions capable of respectively simultaneously expressing one or more exogenous antigen genes in the E1 and E4 regions. The antigen gene may be an antigen gene of an appropriate size from any source.
Further, the E1 region and E4 region of the recombinant adenovirus vector pAd5LCL3 can express four antigen genes of different or the same origin.
Further, the sequences of ORF1 to ORF7 of the E4 region of the recombinant adenovirus vector pAd5LCL3 is missed.
Further, the E2a region (also known as DNA Binding Protein (DBP)) of the recombinant adenovirus vector pAd5LCL3 is delelted.
Further, the E4 promoter, ORF6, ORF7, and polyA sequences of the E4 region of the recombinant adenovirus vector pAd5LCL3 are placed at the E2a position.
Furthermore, the E1 region of the recombinant adenovirus vector pAd5LCL3 is placed with a SwaI restriction site.
Further, an I-sceI restriction site is preset in the E4 region of the recombinant adenovirus vector pAd5LCL3.
The study found that the genes related to adenovirus replication were E1, E2, E3, and E4. The deletion of these genes did not affect the expression of adenovirus structural proteins, but it prevented adenovirus from being replicated and packaged. Therefore, the construction of these replication-related cell lines enables replication-defective adenovirus vectors with knockout replication genes to be replicated and packaged in cell lines specific to them. At the same time, the study found that as long as the ORF6 or ORF3 in the E4 gene expressing adenovirus can replace the entire E4 gene, the adenovirus with the knockout E4 can be replicated and packaged. Through further research and analysis on the sequences of E4 and E2a genes, E4 gene can be expressed at E2a. Therefore, the invention carries out sequence analysis on the E4 gene, finds out the basic elements of promoter, ORF6/7 and polyA of E4, integrates the basic elements into a complete expression frame, constructs the complete expression frame at the sequence position where the E2a gene is knocked out, enables the ORF6 and ORF7 genes to be normally expressed, and finally obtains a replication defective adenovirus type 5 vector pAd5LCL3 which knocks out E1, E3, E4 and E2a and places the E4 expression frame at the E2a position, and can be subjected to replication and packaging in 293TD37 cells containing DBP sequences.
The study found that the E4 gene contained seven expression frames of ORF1, 2, 3, 4, 5, 6 and 7, of which, ORF6-7 could not be deleted, and once deleted (ORF6-7), it would significantly affect the adenovirus packaging and antigen gene expression. So ORF6-7 needed to be supplemented back and can not be moved out. At the same time, in order to obtain a larger vector space, ORF6-7 needed to be expressed at E2a, so as to prepare an adenovirus vector with larger capacity and better expression effect.
Further, the recombinant adenovirus vector pAd5LCL3 capable of simultaneously expressing four antigen genes can only be packaged by 293TD37 cells constructed by pcDNA3.1+(hyg)-ORF6-IRES-DBP, and the cell strain storage number of the 293TD37 cells is CCTCC NO:C201996, which is deposited in the China Type Culture Collection.
Ordinary 293 cells contain E1 gene of adenovirus type 5. Adenoviruses with knockout of E1 and E3 can be replicated in this cell line, but adenoviruses with knockout of E4 and E2a genes cannot be replicated in 293 cells.
The 293TD37 cell strain is invented by some inventgors of the present invention, and has filed the invention patent with the filing no. CN201911033247.2, which is deposited with the China Type Culture Collection on May 8, 2019 with the deposition number CCTCC NO:C201996, and is classified as human embryonic kidney transformed cell AY293-TD-37. The cell strain comprises an adenovirus E2a-DBP gene and an E4-ORF6/7 gene. It can be used for packaging the E2a-DBP gene and E4 gene-deficient second-generation adenovirus to form complete infectious second-generation adenovirus particles, the probability of RCA of the second-generation adenovirus is greatly reduced compared with that of the first-generation adenovirus, and a foundation is laid for preparing a live vector vaccine.
The invention provides a construction method of a recombinant adenovirus vector pAd5LCL3, which mainly utilizes CRISPR/cas9 technology to knock out E1, E3, E4 and E2a genes of an adenovirus vector plasmid, and puts an ORF6f7 expression frame of an E4 region at a sequence position of an E2a region that is knocked out.
The construction method of the recombinant adenovirus vector pAd5LCL3 capable of simultaneously expressing four antigen genes comprises the following steps:
Step: 1) knocking out the E1 gene of the adenovirus carrier plasmid by CRISPR/cas9 technology, introducing a SwaI restriction enzyme cutting site, seamlessly cloning the fused fragment and the carrier; knocking out the E3 gene by CRISPR/cas9 technology, and then connecting in a seamless cloning mode to obtain the adenovirus carrier plasmid pAd5 without E1 and E3 genes;
On the basis that E1 and E3 genes are knocked out, the E4 gene is knocked out further, so that the capacity of the adenovirus vector is increased, and the immunogenicity is reduced. Meanwhile, an exogenous gene can be inserted into the E4 region, and the exogenous gene can be abundantly expressed at the E4 position but without affecting the packaging of the adenosis vector. The expression of the exogenous gene at the regions of E1 and E4 genes can avoid mutual interference of the expression of a plurality of exogenous genes in the same region, is more favorable for expression, and also simultaneously reduces unnecessary E4 related genes. That reduces the immunogenicity of the adenovirus, enables the adenovirus to exist in a host cell for a longer time, and enables the exogenous gene to be expressed for a longer time.
E4 region gene plays a key role in immunogenicity. The expression of a large number of E4 region genes will lead to a relatively strong immune response of the host and induce the production of antibodies. E4 is not conducive to the long-term expression of the target protein in the host by the adenovirus vector. Therefore, knocking out the unnecessary genes in the E4 region can reduce the immunogenicity of the adenovirus vector, so that the vector can be expressed for a longer time.
In order to completely knock out the gens in the E4 region and facilitate the connection of large vector plasmids, the CRISPR/cas9 method is used to knock out the upstream Fibro gene in the E4 region and the gene in E4, a PCR method is used to amplify part of the Fibro and introduce an I-sceI single restriction site, and then Gibson's seamless cloning method is used to connect the extra excised fragment to the vector to obtain the vector plasmid in which the I-sceI single restriction site is introduced in E4 knockdown. The vector plasmid was linearized using I-sceI, and the shuttle plasmid in the E4 region was constructed so that the foreign gene was recombined into the E4 region and abundantly expressed in the E4 region.
In one some embodiment, it further comprise step 3): knocking out the E2a gene of the adenovirus vector plasmid pAd5ΔE4 by CRISPR/cas9 technology, placing an ORF6f1 expression frame of an E4 region at the position where the E2a region is knocked out, and then using a seamless cloning method to obtain the adenovirus vector plasmid pAd5LCL3 without E1, E3, E4 and E2a genes.
The sequences from ORF1˜ORF5 in the E4 region are knocked out, and the E4 promoter, ORF6, ORF7, and polyA sequences are retained but that are inserted into the E2a position, so that the E4 position can be used for expressing the foreign gene. The DBP sequence of the E2a region is also knocked out. Adenovirus E2a gene is a DNA binding protein, which is related to the replication of adenovirus. Knocking out this gene does not affect the structural protein of adenovirus or its packaging. DBP deletions can prevent or greatly reduce reverse mutations. The knockout of the E2a and E4 partial sequences increases the carrier capacity by about 3 kb.
The shuttle plasmid is commonly used in the construction of existing adenovirus vectors, and a single restriction site needs to be found. In the invention, CRISPR/cas9 is creatively adopted to construct the recombinant adenovirus vector, appropriate E1, E3, E4 and E2a knockout sites are selected through comparison, the CRISPR site is selected according to the positions of E1, E3, E4 and E2a sequences and the number of knockout gene bases, and the optimal gRNA is designed, so that the construction of the recombinant adenovirus vector is completed.
In yet another aspect, the present invention provides a recombinant adenovirus vaccine comprising a target gene of interest that is inserted into the E1 and E4 regions of pAd5LCL3.
Studies have shown that the expression level of exogenous protein in E3 region is not high, while the expression of antigen gene in E1 and E4 regions is higher, so the four antigens can be expressed in E1 and E4 regions separately.
Because E3 genes is associated with replication, that is need to knock out and let its replication defects; the role of E3 is related to the immune escape of adenovirus; knocking out the E3 region can increase the capacity of the adenovirus vector; and enable that adenovirus vector to be normally packaged.
Further, the target gene of interest is a gene or gene fragment of a virus, bacterium, or tumor.
Further, the target gene is an african swine fever virus gene.
In another aspect, the invention provides an african swine fever virus vaccine, which is characterized in that the vaccine is obtained by constructing a recombinant adenovirus vector co-expressing four antigen genes of the african swine fever virus and packaging the recombinant adenovirus vector by 293TD37 cells.
Further, the recombinant adenovirus vector co-expressing the four antigen genes of the African swine fever virus needs to be packaged by a recombinant adenovirus of 293TD37 cells constructed by pcDNA3.1+(hyg)-ORF6-IRES-DBP, and the cell strain storage number of the 293TD37 cells is CCTCC NO:C201996, which is deposited in the China Type Culture Collection.
Further, the four antigen genes are any one of the following five groups of antigen genes, respectively: a group 1: P72, B602L, P30, and P54: Group 2: CP129Rubiqutin, MGF5L6L, CP312R, and MGF110-4L: Group 3: L8Lubiqutin, I215L, I73RHBsAg, and E146L: Group 4: EP402R, EP153R, I177L, and K205Rubiqutin: Group 5: F317L, A151R, P34, and pp62.
In some embodiments, the first group, P72 and B602L are expressed in the E1 region and P30 and P54 are expressed in the E4 region, constituting a recombinant adenovirus vector pAd5LCL3-P72-B602L-P30-P54 in which four antigen genes are co-expressed.
In second group, the CP129Rubiqutin is obtain by adding the molecular adjuvant ubiquitin on the CP129R, the CP129Rubiqutin and the MGF5L6L are express in an E1 region, the CP312R and the MGF110-4L are expressed in an E4 region, and a recombinant adenovirus vector pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L for co-expression of four antigen genes is formed.
In that third group, L8Lubiqutin is obtain by adding the molecular adjuvant ubiquitin to L8L, I73RHBsAg is obtain by adding the molecular adjuvant HBsAg to 173R, L8Lubiqutin and I215L are expressed in an E1 region, I73RHBsAg and E146L are expressed in an E4 region, and a recombinant adenovirus vector pAd5LCL3-L8 Lubiqutin-I215L-I73R HBsAg-E146L for co-expression of four antigen gene is formed.
In that fourth group, the K205Rubiqutin is obtain by adding the molecular adjuvant ubiqutin on the K205R, the EP402R and the EP153R are express in the E1 region, the I177L and the K205Rubiqutin are expressed in the E4 region, and a recombinant adenovirus vector pAd5LCL3-EP402R-EP153R-I177L-K205rubiqutin for co-expression of four antigen genes.
In the fifth group, F317L and A151R are expressed in the E1 region, and P34 and pp62 are expressed in the E4 region, forming a recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-PP62 in which four antigen genes are co-expressed.
Through a large number of screening experiments, the inventors of the present invention selects 20 antigen genes with stronger immune effect from more than 160 african swine fever virus antigen genes, the 20 antigen genes are divided into five groups according to gene fragment size and protein structure, and the four antigen genes of each group can be co-expressed in the recombinant adenovirus vector pAd5LCL3 provided by the invention, namely, the four antigen genes can be completely and independently expressed in the same vector.
The four antigenic genes of African swine fever virus in each group were Group1, P72, B602L, P30 and P54: respectively. Group2, CP129Rubiqutin, MGF5L6L, CP312R, and MGF110-4L: Group3, L8Lubiqutin, I215L, I73RHBsAg and E146L: Group4, EP402R, EP153R, I177L, and K205Rubiqutin: Group5, F317L, A151R, P34, and pp62.
Further, the P72, B602L, P30, P54 and pAd5LCL3-P72-B602L-P30-P54 have nucleotide sequences shown in Seq ID NO.1, Seq ID NO.2, Seq ID NO.3, Seq ID NO.4 and Seq ID NO.6, respectively, in a sequence table. The CP129R, ubiqutin, MGF5L6L, CP312R, MGF110-4L, pAd5LCL3-CP129R ubiqutin-MGF5L6L-CP312R-MGF110-4L respectively have nucleotide sequences shown in Seq ID NO.14, Seq ID NO.15, Seq ID NO.16, Seq ID NO.17, Seq ID NO.18 and Seq ID NO.19 in a sequence table. The LSL, the ubiqutin, the I215L, the I73R, the HBsAg, the E146L and the pAd5LCL3-L8L ubiqutin-I215L-I73R HBsAg-E146L respectively have nucleotide sequences shown in Seq ID NO.20, Seq ID NO.21, Seq ID NO.22, Seq ID NO.23, Seq ID NO.24, Seq ID NO.25 and Seq ID NO.26 in a sequence table. The EP402R, the EP153R, the I177L, the K205R, the ubiqutin, and the pAd5LCL3-EP402R-EP153R-I177L-K205R ubiqutin respectively have nucleotide sequences shown in Seq ID NO.27, Seq ID NO.28, Seq ID NO.29, Seq ID NO.30, Seq ID NO.31 and Seq ID NO.32 in a sequence table. The F317L, AM51R, P34, pp62, and pAd5LCL3-F317L-A151R-P34-pp62 have nucleotide sequences shown in Seq ID NO.33, Seq ID NO.34, Seq ID NO.36, Seq ID NO.36 and Seq ID NO.37, respectively, in a sequence table.
In yet another aspect, the present invention provides a construction method of an african swine fever virus vaccine as described above, mainly comprising the steps of:
Further, the adenovirus vector plasmid described in step 1) is derived from wild-type human adenovirus type 5 virus amplified in A549 cells, virus liquid is collected and concentrated, an adenovirus type 5 genome is extracted by HirtViral DNA Extract method, and a linear adenovirus type 5 genome is constructed into an adenovirus vector plasmid by a cosmid method.
Further, the ORF6/7 expression frame gene in step 3) has a nucleotide sequence shown in Seq ID NO.7 in a sequence table; Step 4) the IRES has a nucleotide sequence shown in Seq ID NO.8 in a sequence table; and 2A in step 5) has the nucleotide sequence shown in Seq ID NO.9 in a sequence table.
Further, the shuttle plasmid pS5E1 skeleton described in step 4) adopts puc origin, amp basic elements, Ad5 left arm ITR partial sequence, right arm PIX, PIVa2 partial sequence, and CMV-MCS SV40 early polyA: The skeleton of the E4 region shuttle plasmid pS5E4-EGFP in step 5) adopts puc origin, amp basic elements, a left arm ITR sequence in the Ad5E4 region, a right arm partial fiber gene sequence and an EF1α-EGFP-HBV polyA gene; Wherein that basic element of puc origin and amp have the nucleotide sequence shown in Seq ID NO.10 in the sequence table, and the EF1α-EGFP-HBV polyA gene has the nucleotide sequence shown in Seq ID NO.11 in the sequence table.
The skeleton of shuttle plasmid pS5E1 was synthesized by Beijing BoMed Gene Technology Co., Ltd. using puc origin, amp and other basic elements (2796 bp), partial sequence of ITR in Ad5 left arm (400 bp), partial sequence of PIX and PIVa2 in her right arm (2100 bp), and CMV-MCS (944 bp) SV40 Early Polya (160 bp) in synthesis. After PCR amplification and gene fragment purification, seamless clonal connection was performed, and the connection product was converted to competent cells, coated with ampicillin resistance plate, and positive clones were selected for restriction enzyme digestion verification after culture to obtain adenovirus E1 region shuttle plasmid pS5E1.
The skeleton of the shuttle plasmid pS5E4 was composed of basic elements such as puc origin and amp, the ITR sequence of the left arm (370 bp), the partial fiber gene sequence of the right arm (1746 bp) in the Ad5E4 region, and the EF1α-EGFP-HBV polyA gene. After PCR amplification and gene fragment purification, seamless clone connection was performed, the connection product was converted to competent cells, an ampicillin resistance plate was coated, and positive clones were selected for restriction enzyme digestion verification after culture to obtain adenovirus E4 region shuttle plasmid pS5E4-EGFP.
Further, in step 6), the E1 region shuttle plasmid is homologously recombined with the adenovirus vector plasmid pAd5LCL3, and the shuttle plasmid and the adenovirus vector plasmid pAd5LCL3 are subjected to enzyme digestion by PacI and SwaI, dephosphorylation of an enzyme digestion product, gel recovery of a carrier and fragments by OMEGA Ultra-Sep Gel Extraction Kit, coating of a plate with a conversion product, and picking of colonies for XhoI enzyme digestion verification.
Further, in step 7), the E4 region shuttle plasmid is homologously recombined with the adenovirus vector plasmid, and the E4 region shuttle plasmid and the adenovirus vector plasmid are subjected to enzyme digestion by PacI and I-sceI, the enzyme digestion product is dephosphorylated, the omega ultra-sepge1 extract kit carries out gel recovery carrier and fragments, the conversion product is coated on a plate, colonies are picked, and the XhoI enzyme digestion verification is carried out.
In another aspect, the invention provides a packaging method of a recombinant adenovirus vector, which mainly comprises the following steps of: respectively packaging a first group of the recombinant adenovirus vaccines, namely, pAd5LCL3-P72-B602L-P30-P54; The second group: pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L; The third group: pAd5LCL3-L8LUBIQUTIN-I215L-I73RHBsAg-E146L; The fourth group: pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin; The fifth group: pAd5LCL3-F317L-A151R-P34-PP62; using PacI enzyme digestion, the linearized plasmid is used for transfection; 293TD37 cells constructed from pcDNA3.1+(hyg)-ORF6-IRES-DBP were transfected and cell suspension was collected.
The 293TD37 cell strain is deposited in the China Type Culture Collection on May 8, 2019 with the deposition number of CCTCC NO:C201996 and is classified as human embryonic kidney transformed cell AY293-TD37. The cell strain comprises adenovirus E2a and E4-ORF6/7 genes and is obtained by genetically engineering HEK293 cells and can be used for packaging second-generation recombinant adenovirus lacking E2a and E4 genes to form infectious second-generation adenovirus particles.
Further, the packaging method of the recombinant adenovirus vector is mainly prepared from the following steps:
In yet another aspect, that present invention provide the use of 293TD37 cells for package recombinant adenovirus vectors co-expressing four antigenic genes of african swine fever virus, the four antigenic genes bee respectively a first group: P72, B602L, P30 and P54: Group 2: CP129Rubiqutin, MGF5L6L, CP312R, and MGF110-4L: Group 3: L8Lubiqutin, I215L, I73RHBsAg, and E146L: Group 4: EP402R, EP153R, I177L, and K205Rubiqutin: Group 5: F317L, A15MR, P34, and pp62: In the first group, P72 and B602L are expressed in the E1 region, and P30 and P54 are expressed in the E4 region, forming a recombinant adenovirus vector pAd5LCL3-P72-B602L-P30-P54 for co-expression of four antigen genes; In that second group, the CP129Rubiqutin is obtain by adding the molecular adjuvant ubiquitin on the CP129R, the CP129Rubiqutin and the MGF5L6L are express in an E1 region, the CP312R and the MGF110-4L are expressed in an E4 region, and a recombinant adenovirus vector pAd5LCL3-CP129R ubiqutin-MGF5L6L-CP312R-MGF110-4L for co-expression of four antigen genes is formed; In that third group, L8Lubiqutin is obtain by adding the molecular adjuvant ubiquitin to L8L, I73RHBsAg is obtain by adding the molecular adjuvant HBsAg to 173R, L8Lubiqutin and I215L are expressed in an E1 region, I73RHBsAg and E146L are expressed in an E4 region, and a recombinant adenovirus vector pAD5 LCL3-L8 Lubiqutin-I215L-I73R HBsAg-E146L for co-expression of four antigen gene is formed. In that fourth group, the K205Rubiqutin is obtain by adding the molecular adjuvant ubiqutin on the K205R, the EP402R and the EP153R are express in the E1 region, the I177L and the K205Rubiqutin are expressed in the E4 region, and a recombinant adenovirus vector pAd5LCL3-EP402R-EP153R-I177L-K205rubiqutin for co-expression of four antigen genes is for; In the fifth group, F317L and A151R are expressed in the E1 region, and P34 and pp62 are expressed in the E4 region, forming a recombinant adenovirus vector pAd5LCL3-F317L-A151R-P34-PP62 in which four antigen genes are co-expressed;
Wherein, the 293TD37 cell is constructed by pcDNA3.1+(hyg)-ORF6-IRES-DBP, and the cell strain preservation number is CCTCC NO:C201996, which is deposited in the China Type Culture Collection.
The invention provides an african swine fever virus vaccine, which is obtained by constructing a recombinant adenovirus vector co-expressing four antigen genes of the african swine fever virus and packaging by 293TD37 cells. Wherein five groups of four antigen genes of the african swine fever virus are designed in total, and the four antigen genes of any group can be used for preparing a recombinant adenovirus vector co-expressing the four antigen genes of the african swine fever virus, namely the african swine fever virus vaccine. The construction of the recombinant adenovirus vector for co-expression of four antigen genes of the african swine fever virus mainly comprises the following steps of: knocking out E1, E3, E2a and E4 genes of the adenovirus vector by CRISPR/cas9 technology, and constructing shuttle plasmids in E1 and E4 regions for respectively expressing four antigen genes, thereby obtaining a completely new adenovirus vector. The invention has the beneficial effects that:
(1) a novel construction method of adenovirus type 5 vector is provided, the optimal knockout site and gRNA are independently designed, and the problem that a single restriction site needs to be found due to the knockout by shuttle plasmid in the past vector construction is avoided.
(2) as the E4 region gene plays a key role in immunogenicity, the expression of a large number of E4 region genes can lead a host to generate a relatively strong immune response and induce the generation of antibodies, which is not favorable for the adenovirus vector to express a target protein in the host for a long time.
(3) in the invention, the sequences of orf1 to orf5 in the E4 region are knocked out, and the E4 promoter, ORF6, ORF7 and polyA sequences are retained and inserted into the E2a position, so that the E4 position can be used for expressing foreign genes.
(4) The invention further knocks out the DBP(E2a) sequence, and the deletion of DBP can prevent or greatly reduce the reversion mutation. The partial sequence knockout of E2a and E4 increases the vector capacity by about 3 kb relative to the first-generation vector.
(5) E2a and E4 of the adenovirus vector are knocked out, and E4promoter-ORF6f7-polyA is placed in the E2a region, so that a cell line complementary to E2a(DBP sequence) can be used for rescue; meanwhile, foreign genes can be simultaneously expressed in the E1 and E4 regions without mutual interference; and at present, the adenovirus vaccine is rescued in a complementary cell line-293TD37 cell line constructed by our company, and the cell line can permanently express DBP protein.
(6) the invention constructs shuttle plasmids of E1 and E4 regions for expressing exogenous genes of E1 and E4 regions.
(7) the titer of the recombinant adenovirus virus prepared by packaging the 293TD37 cell line is higher.
Based on the above principles, the invention can greatly improve the capacity of the vaccine of the adenovirus vector, enhances the specific immune response to the african swine fever virus by simultaneously expressing four independent antigens of the african swine fever on one adenovirus vector, and can lead the domestic pigs to obtain better immune protection.
Fig. Western Blot analysis of the expression of P54 and P72 in the recombinant adenovirus vaccine pAd5LCL3-P72-B602L-P30-P54 of African swine fever in example 11, wherein M was Marker; Lane 1, P54 antibody serum; Lane 2, P72 antibody serum; Lane 3: 293TD37 cell control.
Preferred embodiments of the present invention are described in further detail below with reference to the accompanying drawings, and it should be noted that the embodiments described below are intended to facilitate an understanding of the present invention and are not intended to limit the same in any way.
The wild-type human adenovirus type 5 (ATCC® VR-1516, gene sequence AC_000008.1) virus was amplified in A549 cells (ATCC® CCL-185), and the virus liquid was collected and concentrated. The adenovirus genome was extracted by HirtVirual DNA extraction. The linear hAd5 genome was constructed into a circular supercos-Ad5 vector plasmid by a cosmid method. The E1 region of hAd5 adenovirus was excised(deleted) by CRISPR/cas9technology. The designed gRNA was as follows:
Designing a gRNA site at the upstream and downstream of the hAd5 E1 region, recovering a large fragment vector after cutting, designing a primer, respectively inserting the ITR and PIX sequences into the upstream and the downstream by fusion PCR and introducing a SwaI restriction enzyme cutting site, and then performing seamless cloning on the fused fragment and the vector to obtain an supercos-ad5ΔE1 adenovirus vector wherein E1 is knockout.
And then performing E3 region excision on the supercos-ad5ΔE1 plasmid, and designing the gRNA as follows:
A gRNA site was designed upstream and downstream of the hAd5 E3 region, and the large fragment vector was recovered after cutting. Primers were then designed to perform fusion PCR on excessive excised Fiber and pVIII sequences upstream and downstream of E3, and seamless cloning was used for ligation to obtain the adenovirus vector plasmid pAd5 with E1 and E3 genes deletion and introducing the SwaI restriction site.
By adopting the vector plasmid pAd5 obtained in example 1 with the knocked out E1 and E3 genes, and further knocking out the E4 gene. The capacity of the adenovirus vector can be increased, and the immunogenicity can be reduced; and a part of fiber was amplified by a PCR method and a restriction site of NdeI was introduced, and then an extra excised fragment was connected to the vector by a seamless cloning method of Gibson to obtain the vector plasmid pAd5ΔE4 with the E1, E3 and E4 genes deletion, and the restriction sites of SwaI and I-sceI were introduced.
The detail steps are:
The first 400 bp of fiber gene were input using GeneArt™ CRISPR Search and Design tool(thermofisher.com/crispresign) software from Thermo Fisher Scientific. The software automatically analyzed the sequence of the 400 bp and provided six potential CRISPR target sequences. Considering the length of the knockout sequence of E4 gene and the requirement of constructing a live vector, GCTACTAAACAATTCCITCC (SEQ ID NO: 164) was selected as the targeting sequence, and the finally obtained gRNA was named Ad5-E4-up-gRNA, with the cleavage site and PAM site shown in
Using the software of GeneArt™ CRISPR Search and Design Tool (thermofisher.com/crisprdesign) in Thermo Fisher Scientific, 300 bp downstream of E4 were input, which was automatically analyzed by the software to provide six potential CRISPR target sequences. AGGTTCGCGTGCGGTTTCT (SEQ ID NO: 165) was selected as the target sequence, and the finally obtained gRNA was named Ad5-E4-down-gRNA, with the cleavage site and PAM site shown in
The upstream and downstream primers were designed for PCR amplification of the DNA template of Ad5-E4-up-gRNA and the DNA template of Ad5-E4-down-gRNA, respectively, and amplified using the Gene Art™ Precision gRNA Synthesis Kit.
10 μM Ad5-E4-up-gRNA-Forward primer 3 ul, 10 μM Ad5-E4-up-gRNA-Reverse primer 3 ul, and fill with water up to 100 ul.
10 μM Ad5-E4-down-gRNA-Forward primer 3 ul, 10M Ad5-E4-down-gRNA-Reverse primer 3 ul, fill with water to 100 ul.
The PCR reaction system for DNA template amplification of Ad5-E4-up-gRNA was: Phusion™ High-Fidelity PCR Master Mix (2×) 12.5 uL, Tracr Fragment+T7 Primer Mix 1 ul, and 0.3 μM AD5-E4-UP-gRNA-Forward/Reverse primer mixture 1 ul, filled with water to 25 ul.
The PCR reaction system for DNA template amplification of Ad5-E4-down-gRNA was: Phusion™ High-Fidelity PCR Master Mix (2λ) 12.5 uL, Tracr Fragment+T7 Primer Mix 1 ul, and 0.3 μM AD5-E4-DOWN-gRNA-Forward/Reverse primer mixture working solution 1 ul, filled with water to 25 ul.
Initial denaturation 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 55° C. for 15 sec and 32 cycles; Extension at 72° C. for 1 min and 1 cycle; Maintain 4° C.
In vitro transcription of the template DNA was performed using TranscriptAid™ EnzymeMix to obtain Ad5-E4-up-gRNA and Ad5-E4-down-gRNA.
The reaction system for obtaining Ad5-E4-up-gRNA through in vitro transcription was as follows: NTP mix 8 ul, E1A-gRNA DNA template 6 ul, 5×TranscriptAid™ Reaction Buffer 4 uL, TranscriptAid™ Enzyme Mix 2 uL. After incubation at 37° C. for 4 hours, add 1 ul of DNase I and incubate at 37° C. for 15 minutes.
The reaction system for obtaining Ad5-E4-down-gRNA through in vitro transcription is as follows: NTP mix 8 ul, E1B-gRNA DNA template 6 ul, 5×TranscriptAid™ Reaction Buffer 4 uL, and TranscriptAid™ Enzyme Mix 2 uL. After incubation at 37° C. for 4 hours, add 1 ul of DNase I and incubate at 37° C. for 15 minutes.
Ad5-E4-up-gRNA, Ad5-E4-down-gRNA were obtained by in vitro transcription
Among them, Wash Buffer1 and Wash Buffer2 were both reagents from TranscriptAid™ EnzymeMix kit. The RNA sequences of Ad5-E4-up-gRNA and Ad5-E4-down-gRNA obtained by transcription were as follows:
The vector plasmid obtained in Example 1 was double-digested with Ad5-E4-up-gRNA, Ad5-E4-down-gRNA, and cas9 in a reaction system of 3 pg Cas9 protein, Ad5-E4-up-gRNA 6 pg, Ad5-E4-down-gRNA 6 pg, pAd5-REBP vector plasmid 3 pg, NEB buffer 3.1 5 ul, and supplemented with water to 50 ul.
The enzyme digestion reaction was incubated overnight at 37° C. 3 uL samples were taken for agarose gel verification, and the electrophoresis diagram of the experimental results was shown in
8: Obtaining a Fiber Fragment Containing a Partial Knockout and an ITR Fragment and Introducing an I-SceI Restriction Site, Using a Primer Containing the Knockout Partial Fiber for Knockout, Amplifying the Fiber Fragment and Introducing an I-SceI Restriction Site.
The amplification sequence was:
The amplification system was as follows: 10 μM Fiber-RH-F primer 1 ul; 10 μM Fiber-ISceI-ITR-R primer 1 ul; Template pAd5 (100 ng/uL) 0.5 uL; Q5 high-fidelity enzyme 25 ul; fill with water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 10 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. The electrophoresis diagram of amplification results was shown in
The amplification sequence was:
The amplification system was as follows: 10 μM ISceI-ITR-F primer 1 ul; 10 μM ITR-RH-R primer 1 ul; Template pAd5 (100 ng/uL) 0.5 uL; Q5 high-fidelity enzyme 25 ul; fill with water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 10 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. The amplification results were shown in
The amplification systems were as follows: 1 ul of 10 μM Fiber-RH-F primer, 1 ul of 10μ 10 μM Fiber-ISceI-ITR-R ITR primer, 0.5 uL of template pAd5 (100 ng/uL), and 25 ul of Q5 high-fidelity enzyme, and fill with water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 20 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. The amplification results were shown in
The Fiber-ITR fragment was connected to the vector plasmid by Gibson Assembly® Cloning Kit after the E4 is knocked out, and the connection system was as follows: 100 ng of the gel recovery product vector plasmid fragment, 50 ng of the gel recovery product fiber-ITR fragment, and 10 ul of Gibson premix solution, supplemented with water to 20 ul. Incubate at 50° C. for 40 minutes.
Thawa tube of the prepared NEB 10β competent cells on ice for 10 minutes, add 10 ul of connecting product, carefully flick the tube 4-5 times to mix cells and DNA and put on ice for 30 minutes; The tube was placed in a 42° C. water bath and heat shock for 90 seconds. Spread 50-100 μl of each dilution onto Kanamycin selection plate and incubate 8-12 hours to overnight at 37° C.
The transformants were subjected to colony PCR.
Design downstream primers for colony PCR
The reaction system was as follows: 1 ul of 10 μM E4-cexu-F primer, 1 ul of 10 μM E4-cexu-R primer, 10 ul of Q5 high-fidelity enzyme, and supplementing water to 20 ul. A single colony was selected into the reaction system. The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec, Extension at 72° C., 20 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. Agarose gel electrophoresis was performed as shown in
Four positive clonal colonies were selected to culture, the plasmids were extracted, and the digestion tests of BamHI and XhoI were performed. The digestion results were shown in
1) Selection of CRISPR Target Sequence of 100 k Gene at upstream of E2a Gene
The first 400 bp of 100 k gene were input by GeneArt™ CRISPR Search and Design tool (thermofisher.com/crispresign) software from Thermo Fisher Scientific. The software automatically analyzed the sequence of the 400 bp and provided six potential CRISPR target sequences. Considering the length of the knockout sequence of E2a gene and the requirement of constructing a live vector, ATAGGTGGCGTTCGTAGGCA (SEQ ID NO: 166) was selected as the targeting sequence, and the finally obtained gRNA was named as 100 k-gRNA, with the cleavage site and PAM site shown in
The 300 bp downstream of E4 were input by GeneArt™ CRISPR Search and Design tool(thermofisher.com/crisprdesign) software from Thermo Fisher Scientific, and the software was automatically analyzed to provide six potential CRISPR target sequences. TACCCCGGTAATAAGGTTCA (SEQ ID NO: 167) was selected as the target sequence, and the finally obtained gRNA was named as protease-gRNA, with the cleavage site and PAM site shown in
2. DNA Amplification of 100 k-gRNA and Protease-gRNA
3. Design of Upstream and Downstream Primers for Amplifying the DNA Templates of 100 k-gRNA and Protease-gRNA
Upstream and downstream primers were designed for PCR amplification of the 100 k-gRNA DNA template and protease-gRNA DNA template, respectively, and GeneArt™ Precision gRNA Synthesis Kit was used for amplification.
2) Amplification of the DNA Templates of 100 k-gRNA and Protease-gRNA
{circle around (1)} Prepare 0.3 μM mixed working solution of 100 k-gRNA-Forward/Reverse primer, including 10 μM 100K-GrNA-forward primer 3 ul, 10 μM 100 k-gRNA-Reverse primer 3 ul, and supplement water to 100 ul.
{circle around (2)} Prepare 0.3 μM mixed working solution of protease-gRNA-Forward/reverse primer, including 10 μM Protease-grna-forward primer 3 ul, 10 μM protease-gRNA-Reverse primer 3 ul, and supplement water to 100 ul.
{circle around (3)} PCR reaction system
The PCR reaction system for DNA template amplification of 100 k-gRNA was as follows: Phusion™ High-Fidelity PCR Master Mix (2×) 12.5 uL, Tracr Fragment+T7 Primer Mix 1 ul, and 0.3 μM 100 k-gRNA-Forward/Reverse primer mixture working solution 1 ul, and water supplementing to 25 ul.
The PCR reaction system for DNA template amplification of protease-gRNA was as follows: Phusion™ High-Fidelity PCR Master Mix (2×) 12.5 uL, Tracr Fragment+T7 Primer Mix 1 ul, and 0.3 μM Protease-GrNA-Forward/Reverse primer mixture working solution 1 ul, and the water supplementing amount was up to 25 ul.
{circle around (4)} PCR Program
Initial denaturation 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 55° C. for 15 sec and 32 cycles; Extension at 72° C. for 1 min and 1 cycle; Maintain 4° C.
4. In Vitro Transcription to Obtain 100 k-gRNA and Protease-gRNA
In vitro transcription of template DNA was performed by TranscriptAid™ EnzymeMix to obtain 100 k-gRNA and protease-gRNA.
1) In Vitro Transcription to Obtain 100 k-gRNA, Protease-gRNA
The reaction systems for obtaining 100 k-gRNA by in vitro transcription were as follows: NTP mix 8 ul, 100 k-gRNA DNA template 6 ul, 5× TranscriptAid™ Reaction Buffer 4 uL, and TranscriptAid™ Enzyme Mix 2 ul. After incubation at 37° C. for 4 hours add 1 ul of DNase I and incubate at 37° C. for 15 minutes.
The reaction systems for obtaining protease-gRNA by in vitro transcription were as follows: NTP mix 8 ul, protease-gRNA DNA template 6 ul, 5× TranscriptAid™ Reaction Buffer 4 uL, and TranscriptAid™ Enzyme Mix 2 ul. After incubation at 37° C. for 4 hours add 1 ul of DNase I and incubate at 37° C. for 15 minutes.
{circle around (7)} 14,000×g air separation for 60 seconds, all eluents were completely removed, and the empty tube was placed in a 1.5 mL collection tube;
{circle around (8)} Add 10 ul of nuclease-free water to the center of the column and centrifuge at 14000×g for 60 seconds to collect gRNA.
Among them, Wash Buffer1 and Wash Buffer2 were both reagents from TranscriptAid™ EnzymeMix kit. The RNA sequences of 100 k-gRNA and protease-gRNA obtained by transcription were as follows:
The adenovirus vector plasmid with E1, E3, and E4 genes deletion obtained in Example 2 was double-digested with 100 k-gRNA, protease-gRNA, and cas9 in a reaction system of 3 μg Cas9 protein; 100 k-gRNA 6 μg; protease-gRNA 6 μg; 3 μg; of the vector plasmid obtained in example 2; NEB buffer 3.1 5 ul; Replenish water to 50 ul.
The above enzymatic reactions were incubated overnight at 37° C. 3 ul samples were taken for agarose gel verification, and the experimental results were shown in
{circle around (1)} Partial knockout 100 k amplification primers:
The amplification system was as follows: 10 μM 100 k-F primer 1 ul; 10 μM 100k-ORF6/7-R primer 1 ul; Template pAd5ΔE4 (100 ng/uL) 0.5 uL; Q5 high-fidelity enzyme 25 ul; Replenish water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 20 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C.
{circle around (2)} E4 ORF6/7 expression frame amplification primers:
The amplification system was as follows: ORF6/7-F primer 1 ul; 10 μM ORF6/7-R primer 1 uL; Template ORF6/7 expression cassette gene (100 ng/uL) 0.5 uL; Q5 high-fidelity enzyme 25 ul; Replenish water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 10 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C.
{circle around (3)} Amplification of partially knockout protease fragments
The amplification system was as follows: 10 M ORF6/7-Protease-F primer 1 μL; 10 μM Protease-R primer 1 ul; Template PD5ΔE4 (100 ng/uL) 0.5 uL; Q5 high-fidelity enzyme 25 ul; Replenish water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 10 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C.
{circle around (4)} the results of 100 k, E4 ORF6/7 expression frame and protease PCR amplification were shown in
It could be seen that the amplification results were correct. The fragments were separately purified by gel recovery by an Axygen™ gel extraction kit.
The amplification system was as follows: 10 μM 100 k-F primer 1 ul; 10 μM Protease-R primer 1 ul; Template 100 k recovered product (50 ng/ul) 1 ul template E4 ORF6/7 expression framer recovered product (50 ng/ul) 1 ul template E4 ORF6/7 expression framer recovered product (50 ng/uL) 1 uL; Q5 high-fidelity enzyme 25 ul; Replenish water to 50 ul.
The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 50 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. The amplification results were shown in
The fragments were purified by an Axygen™ gel extraction kit.
8. connection
Using Gibson of NEB, the 100 k, E4 ORF6/7 expression frame and protease fusion PCR gel recovery products were connected to the vector after E2a was knocking out in Step 4. The connection system was as follows: 100 ng of the vector fragment after knocking out E2a with the gel recovery product, 100k of the gel recovery product, 50 ng of the E4 ORF6/7 expression frame and protease fusion PCR fragment, 10 ul of Gibson premix solution, and water supplementing to 20 uL. Incubate at 50° C. for 40 minutes.
Taking out the Kana resistance culture medium plate, putting the prepared NEB 10β competent cells on ice for melting, adding 10 ul of connecting product, gently sucking and uniformly beating by a pipette, and putting on ice for 30 minutes; The centrifuge tube was placed in a 42° C. water bath and hot-struck for 90 seconds to screen transformants by kanamycin resistance.
The transformants were subjected to colony PCR.
The reaction system was as follows: 1 ul of 10 μM DBP-upstream-F primer, 1 ul of 10 μM DBP-downstream-R primer, 10 ul of Q5 high-fidelity enzyme, and supplementing water to 20 ul. Monoclonal colonies were selected into the reaction system. The PCR procedure was as follows: initial denaturation at 98° C., 10 sec, 1 cycle; Denaturation 98° C., 5 sec; Annealing at 60° C. for 30 sec; Extension at 72° C., 20 sec, 35 cycle; Extension at 72° C. for 5 min and 1 cycle; Maintain 4° C. Agarose gel electrophoresis verification was performed, and as shown in
Four positive clone colonies of No. 9, No. 18, No. 21, and No. 24 were picked out, and the plasmid was extracted for XhoI restriction endonuclease verification. The restriction endonuclease results were shown in
The skeleton of shuttle plasmid pS5E1 was composed of puc origin, amp and other basic elements (2796 bp) (the pS5E1 skeleton was synthesized by Beijing BioMed Gene Technology Co., Ltd.), HAd5 partial sequence of ITR in the left arm (355 bp), PIX in the right arm and PIVa2 partial sequence (2100 bp), and CMV-MCS (Seq ID No. 12) (944 bp) SV40 Early Polya (Seq ID No. 13) (160 bp).
{circle around (1)} The MCS fragment of CMV promoter of pSSE1 shuttle plasmid was amplified using pCDNA3.1(+) as the template (the plasmid was purchased from Thermo Fisher Scientific Co., Ltd.) and CMV-F and CMV-SV40-R as the primers; Amplification system: pCDNA3.1(+) plasmid 50 ng, 10 uM CMV-F primer 1 ul, 10 uM CMV-SV40-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 1 min, 35 cycles; 72° C., 5 min.
{circle around (2)} The SV40-earlypolyA fragment of the pSSE1 shuttle plasmid was amplified using pCDNA3.1(+) as the template (the plasmid was purchased from Thermo Fisher Scientific Co., Ltd.) and SV40-F and SV40-R as the primers; Amplification system: pCDNA3.1(+) plasmid 50 ng, 10 uM SV40-F primer 1 ul, 10 uM SV40-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 10 sec, 35 cycles; 72° C., 5 min.
Agarose validation of that amplification product was shown in
{circle around (3)} Purification was performed by an Axygen™ gel extraction kit.
{circle around (4)} pSSE1 shuttle plasmid backbone was amplified by PCR using pSSE1 backbone plasmid synthesized by BoMed Co. as the template and puc-F and puc-R as the primers. The amplification system consisted of pSSE1 backbone plasmid of 50 μg, 10 μM PUC-F primer of 1 ul, 10 μM PUC-R primer of 1 ul, and Q5 high-fidelity enzyme of 20 ul; Replenish water to 40 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 1 min 20 sec, 35 cycles; 72° C., 5 min.
{circle around (5)} The left arm of pSSE1 shuttle plasmid was amplified using pAd5LCL3 plasmid as a template and SV40-Ad5-left arm-F and Ad5-left arm-puc-R as primers. The amplification system: pAd5LCL3 plasmid 50 ng, 10 uM SV40-Ad5-left arm-F primer 1 ul, 10 uM Ad5-left arm-puc-R primer 1 ul, Q5 high-fidelity enzyme 20 ul, and water replenishment to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min.
{circle around (6)} The right arm of pSSE1 shuttle plasmid was amplified using pAd5LCL3 plasmid as the template and puc-Ad5-right arm-F and Ad5-right arm-CMV-R as the primers. The amplification system: pAd5LCL3 plasmid 50 ng, 10 uM puc-Ad5-right arm-F primer 1 ul, 10 uM Ad5-right arm-CMV-R primer 1 ul, and Q5 high-fidelity enzyme 20 ul. The water was replenished to 40 uL. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 15s, 35 cycles; 72° C., 5 min.
{circle around (7)} CMV-MCS-SV40 Early Polya fragment of pSSE1 shuttle plasmid was amplified using CMV-MCS, a recovered gel product, as a template and CMV-F and SV40-R as primers. The amplification system consisted of pAd5LCL3 plasmid of 50 ng, 10 μM CMV-F primer of 1 ul, 10 μM SV40-R primer of 1 ul, and Q5 high-fidelity enzyme of 20 ul, supplemented with water to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min.
Agarose validation of that amplification product was shown in
The fragments were purified by an Axygen™ gel extraction kit, and the four fragments, pSSE1 skeleton, HAd5 left arm, HAd5 right arm, and CMV-MCS-SV40 earlypolyA, were connected by a BMD seamless cloning kit. The ligation system was 2×Smealess Cloning Mix 10 ul, pSSE1 skeletal fragment 50 ng, HAd5 left arm 50 ng, HAd5 right arm 50 ng, CMV-MCS-SV40 polyA 50 ng, supplemented water to 20 ul, and incubated at 50 C for 40 minutes to obtain the ligated product plasmid pS5E1. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (1)} Colony PCR
Colonies were selected for agarose gel validation and shown in
{circle around (2)} Enzyme Digestion Verification
The selected positive clones were cultured in 5 mL LB liquid medium containing ampicillin resistance for 12-15 hours, and the plasmid was extracted for restriction endonuclease validation. The electrophoresis results were shown in
2. Construction of Shuttle Plasmid pS5E1-P72-IRES-B602L of African Swine Fever Human Adenovirus Type 5 Vector.
1) Ligation of pS5E1 Fragment to the IRES Fragment
{circle around (1)} Primer synthesis
{circle around (2)} amplifying IRES fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of 10 uM primer IRES-ECORV-F, 1 uL of 10 uM primer IRES-NOTI-R, 2 ul of template IRES, and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. The electrophoretic detection of amplification results was shown in
{circle around (3)} IRES fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} Excision of the target fragment IRES with the pSSE1 vector
Enzyme digestion reaction system: the vector pS5E1, IRES fragment ˜2 ug, and each of EcoRV and NotI was 1 uL; 10×cut smart buffer 5 ul; Replenish water to 50 ul; Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min; Recovery and purification of gum. The electrophoresis detection of the enzyme-cleaved product was shown in
{circle around (5)} pSSE1 vector was connected with IRES fragment
Ligation system: pSSE1 (100 ng); IRES fragment (vector:fragment=1:5, molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM primer IRES-EcoRV-F 1 ul, and 10 uM primer IRES-NotI-R 1 ul, and supplementing water to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid NotI and EcoRV restriction enzyme digestion verification: 2 and 6 were selected for plasmid extraction and restriction enzyme digestion verification, and the results were shown in
2) Ligation of pS5E1-IRES to P72 Fragment 0 primer synthesis
{circle around (2)} PCR amplification of P72 fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of 10 uM primer P72-BamHI-F, 1 uL of 10 uM primer P72-His-ECORV-R, 1 uL of template P72, and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min.
{circle around (3)} The P72 fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} The target fragment P72 was digested with pS5E1-IRES vector
Enzyme digestion reaction system: the vector pS5E1-IRES, P72 fragment −2 ug, and each of EcoRV and BamHI was 1 μL; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} The target fragment P72 was connected with pS5E1-IRES
Ligation system: PS5E1-IRES (100 ng); P72 fragment (vector:fragment=1:5, molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: Q5 enzyme 10 ul, 10 uM primer P72-BamHI-F 1 ul, 10 uM primer P72-his-EcoRV-R 1 ul, and water supplement to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid restriction endonuclease assay (BamHI&EcoRV), select 2 and 5 for plasmid extraction and restriction endonuclease assay. The result was shown in
3) Ligation of pS5E1-P72-IRES to Fragment B602L
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of B602L fragment
Amplification system: 25 ul of Q5 enzyme, B602L-NotI-F 1 ul of 10 uM primers, B602L-XhoI-R 1 ul of 10 uM primers, and P72 1 ul of template and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min.
{circle around (3)} The B602L fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} The target fragment B602L was digested with pS5E1-P72-IRES vector
Enzyme digestion reaction system: vectors pS5E1-P72-IRES, B602L fragment 2 ug, NotI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} ligation of pS5E1-P72-IRES vector to B602L fragment
Linkage system: pS5E1-P72-IRES 100 ng; B602L fragment 50 ng; T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: Q5 enzyme 10 ul, 10 uM primer B602L-NotI-F 1 ul, 10 uM primer B602L-XhoI-R 1 ul, supplementing water to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min; Electrophoresis verification was performed, as shown in
{circle around (7)} Plasmid NotI and XhoI enzyme digestion verification: 1, 2, 4 and 6 were selected for plasmid extraction and enzyme digestion verification. The results were shown in
The skeleton of the shuttle plasmid pS5E4 was composed of basic elements such as puc origin and amp, the ITR sequence of the left arm (370 bp), the partial fiber gene sequence of the right arm (1746 bp) in the Ad5E4 region, and the EF1α-EGFP-HBV polyA gene.
1) Gene Synthesis: The EF1α-EGFP-HBV polyA Gene was Synthesized by BoMed.
{circle around (1)} A Using the synthetic fragment of EF1α-EGFP-HBV gene as the template and EF1α-F and EF1α-R as the primers, the EF1α-EGFP-HBV polyA fragment of the pS5E4-EGFP shuttle plasmid was amplified; Amplification system: the synthetic fragment of EF1α-EGFP-HBV gene was 50 μg, 10 μM EF1α-F primer was 1 ul, 10 μM EF1α-R primer was 1 ul, and Q5 high-fidelity enzyme was 20 ul; Replenish water to 40 ul. PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} The left arm fragment of pS5E1 shuttle plasmid was amplified using pAd5LCL3 as the template and puc-Ad5E4-left arm-F and Ad5E4-left arm-EF1α-R as the primers. Amplification system: pAd5LCL3 plasmid 50 ng, 10 uM puc-Ad5E4-left arm-F primer 1 ul, 10 uM Ad5E4-left arm-EF1α-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 10 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} The right arm fragment of the pS5E4-EGFP shuttle plasmid was amplified using pAd5LCL3 as the template and EF1α-Ad5E4-right arm-F and Ad5E4-right arm-puc-R as the primers; Amplification system: pAd5LCL3 plasmid 50 ng, 10 uM EF1α-Ad5E4-right arm-F primer 1 ul, 10 uM Ad5E4-right arm-puc-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul.
PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
{circle around (4)} PCR amplification of the pS5E4-EGFP shuttle plasmid backbone using pS5E1 plasmid as the template and puc-F and puc-R as the primers; Amplification system: pS5E1 framework plasmid of 50 ng, 10 uM puc-F primer of 1 ul, 10 uM puc-R primer of 1 ul, Q5 high-fidelity enzyme of 20 ul; Replenish water to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 1 min 20 sec, 35 cycles; 72° C., 5 min. Agarose validation of that amplification product was shown in
The four fragment of pS5E4-EGFP shuttle plasmid left arm, pS5E4-EGFP shuttle plasmid right arm, EF1α-EGFP-HBV, and pS5E4-EGFP shuttle plasmid skeleton were connected by use that bode seamless cloning kit. The ligation system consisted of 2×Smealess Cloning Mix 10 ul, pS5E4-EGFP shuttle plasmid left arm segment 50 ng, pS5E4-EGFP shuttle plasmid right arm segment 50 ng, EF1α-EGFP-HBV segment 50 ng, pS5E4-EGFP shuttle plasmid backbone segment 50 ng, water replenishment to 20 ul, and incubation at 50 C for 40 minutes. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (1)} colony PCR
The target fragment was amplified by PCR using the primer puc-Ad5E4-left arm-F/ER1α-R as the primer colony, and validated by agarose gel assay. The results were shown in
{circle around (2)} enzyme digestion verification
The positive clones No. 3, 4, 5 and 6 were picked and placed in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and the plasmids were extracted for restriction enzyme digestion verification. The electrophoresis results were shown in
2. Construction of African Swine Fever Human Adenovirus Type 5 Vector E4 Region Shuttle Plasmid pSSE4-P30-2A-P54
{circle around (1)} The P30 fragment was amplified using the P30 gene synthetic fragment as the template and P30-BamHI-F and P30-2A-R as the primers; Amplification system: P30 gene synthetic fragment 50 μg, 10 μM p30-BamHI-F primer 1 ul, 10 μM p30-2A-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} The P54 fragment was amplified using the P54 synthetic fragment as the template and 2A-P54-F and P54-XhoI-R as the primers; Amplification system: P54 gene synthesis fragment 50 ng, 10 uM 2A-P54-F primer 1 ul, 10 uM P54-XhoI-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} Using the synthetic fragment of 2A gene as a template and P2A-F and P2A-R as primers, we amplified the 2A fragment; Amplification system: synthetic fragment of 2A gene (50 μg), 10 μM P2A-F primer (1 ul), 10 μM P2A-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
The amplification results were shown in
Amplification system: 50 ng recovered fragment of P30 gel, 50 ng recovered fragment of P54, 50 ng recovered fragment of P2A, 1 ul of 10 uM P30-BamHI-F primer, 1 ul of 10 uM P54-XhoI-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 50 sec, 35 cycles; 72° C., 5 min. The fusion results were shown in
5) Excision of the Target Fragment P30-2A-P54 with the pS5E4-EGFP Vector
Enzyme digestion reaction system: the vectors were pS5E4-EGFP, P30-2A-P54 fragment (2 ug), BamHI and XhoI (1 ul; each). 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification. The enzyme digestion results were shown in
6) Ligation and Transformation of pSSE4 Vector to P30-2A-P54 Fragment
Ligation system: pSSE4 (100 ng), P30-2A-P54 fragment (50 ng), T4 DNA ligase 1 ul, 10×ligase buffer 1 ul, supplemented to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (2)} colony PCR
Using primers P30-BamHI-F and P54-XhoI-R as primers, the target fragment was amplified by colony PCR and verified by agarose gel assay, the results were shown in
{circle around (2)} enzyme digestion verification
Selecte positive clones No. 2 and No. 19, culture in 5 mL LB liquid medium containing ampicillin resistance for 12-15 hours, extracting plasmid for double enzyme digestion verification of BmHI and XhoI; The enzyme digestion results were shown in
1. Autologous Recombination of Shuttle Plasmid pS5E1-P72-IRES-B602L and Adenovirus Vector Plasmid pAd5LCL3
1) PacI and SwaI perform enzyme digestion on shuttle plasmid pS5E1-P72-IRES-B602L and adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system was as follows:
Reaction condition was 37° C. for 1 h; Inactivated at 65° C. for 20 min.
Two uL of agarose gel were verified as shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 ul of enzyme digestion reaction solution; Dephosphorylase 1 uL; Dephosphorylated buffer 5 ul; Replenish water to 50 ul. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid pS5E1-P72-IRES-B602L and 100 ng of the purified adenovirus vector pAd5LCL3were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) The colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) The No. 1 positive plasmid was converted into DH5α competent state, a colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The restriction enzyme digestion result was shown in
2. Autologous recombination of shuttle plasmid pS5E4-P30-2A-P54 and adenovirus vector plasmid pAd5LCL3-P72-IRES-B602L to obtain pAd5LCL3-P72-B602L-P54
1) PacI and I-sceI perform enzyme digestion on shuttle plasmid pS5E4-P30-2A-P54 and adenovirus vector plasmid pAd5LCL3-P72-IRES-B602L, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid PSSE4-P30-2A-P54 3 s g; PacI 2 ul; 10×cutsmart buffer 4 ul; Replenish water to 40 ul.
B. Adenovirus vector plasmid pAd5LCL3-P72-IRES-b602L3 ug; I-sceI 2 ul; Buffer cutsmart 4 ul; Replenish water to 40 ul.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation and the results were shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 ul of enzyme digestion reaction solution; Dephosphorylase 1 uL; Dephosphorylated buffer 5 ul; Replenish water to 50 ul. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJS183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) Eight colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) transform that No. 4 positive plasmid into DH5a competence; One colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The results of enzyme digestion were shown in
Packaging the pAd5LCL3-P72-B602L-P30-P54 plasmid with 293TD37 cells as follows steps:
Preparation of 293TD37 cells: The cells were prepared one day before transfection. The 293TD37 cells to be transfected were inoculated into a 6-well plate with 0.5×106 viable cells/well and incubated at 37° C. with 5% CO2 for 24 hours. The cells showed 40-50% confluency on the day of transfection.
Linearization of plasmid pAd5LCL3-P72-B602L-P30-P54: The plasmid to be transfected was digested with PacI enzyme, incubated at 37° C. for 40 min, and inactivated at 65° C. for 20 min.
Transfection: The linearized 2 pg plasmid and PEI were diluted with 100 ul serum-free medium, respectively. The plasmid diluent was added into the PEI diluent, and repeatedly aspirated for 5 times or vortexed for 10 seconds to be mixed evenly, and incubated for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture medium was gently aspirated from the plates, 2 mL of fresh growth medium was added, and after 10 minutes the transfection complex was added to the cells in fresh medium.
Cell culture: the transfected 293TD37 cells were incubated at 37° C. for 72-96 hours in a 5% CO2 incubator; 6-well plate cell suspensions were collected in 1.5 ml centrifuge tubes, TP0, 72-96 hours after viral plasmid transfection.
Continuous inoculation: The collected cell suspension was repeatedly frozen and thawed at −80° C. for 3 times, centrifuged at 2000 g at 4 C for 10 minutes, 500 ul of supernatant was collected to infect 293TD37 cells (293TD37 cells need to be prepared one day in advance), incubated at 37° C. with 5% CO2 for 60 minutes, supplemented with 2 mL of FBS medium, and cultured at 37° C. with 5% CO2 for 72 hours, to collect cell suspension, namely TP1. The previous steps were repeated again and the cell suspension, namely TP2, was collected. The exposure was continued until the TP4 cells became diseased.
Cytopathic effect: When the 293TD37 cells were cultured from TP0 to TP4, the cells gradually became diseased until the 293TD37 cells were completely diseased at TP4. The cytopathic effects caused by TP0 to TP4 were shown in
The 293TD37 cells were prepared. The cells with good growth in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin, and then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, which was then blown, mixed, inoculated into 6-well plates (5×105/mL, 2 ml per well), and allowed to stand for culture in a 37° C. 5% CO2 incubator. After 24 hours, when the cells adhered to grow into single-layer cells, the culture medium was discarded, and the recombinant adenovirus was continuously diluted 10-3 to 10-6 times with serum-free DMEM maintenance solution, and two wells were inoculated with each dilution degree at 250 uL per well. After one hour of infection, the supernatant was discarded to supplement the complete culture medium, and then the medium was allowed to stand for culture in a 5% carbon dioxide incubator at 37° C. After 24 h, the supernatant was discarded and the cells were washed with PBS (1 mL per well). After PBS was discarded, 1 mL of cold formaldehyde was added into each well for fixation, and formaldehyde was discarded at room temperature for 10 min. Then the cells were washed with PBS (1 mL per well), followed by adenovirus antibody-FITC (1 ml per well). After 1 h at room temperature, the cells were washed with PBS again (1 mL per well). After two times, 1 mL of PBS was added into each well and counted under fluorescence microscope (200 times, 10 continuous fields). Calculation: Virus titer (FFU/mL)=Mean×1013×4×10(−n). The FFU of the pAd5LCL3P72-B602L-P30-P54 virus was 2×108 FFU/mL with a high titer.
The 293TD37 cells were prepared. The cells that grew well in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin. Then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, and then the cells were blown and mixed evenly. The 293TD37 cells were planted into 6-well plates (5×105 cells/mL, 2 mL/well), incubated for 1 hour at room temperature to adhere to the wall, and incubated for microscopic observation of its attachment degree. pAd5LCL3-P72-B602L-P30-P54 virus particles were used for infection, and the titer of infection was 5 MOI/well. After the 293TD37 cells developed lesions 48 hours later, the cells were collected, repeatedly frozen and thawed for three times, and then centrifuged at 2000 g; the collected supernatant was detected for FFU, and then new 293TD37 cells were reinfected until the 30th generation. The collected virus solutions of passages 5, 10, 15, 20, 25 and 30 were tested and found that the genome of the virus was still intact, indicating that the replication-defective pAd5LCL3-P72-B602L-P30-P54 virus could be stably packaged in 293TD37 cells.
PAd5LCL3-P72-B602L-P30-P54 virus RCA detection, detection method was as follows:
1. Prepare pAd5LCL3-P72-B602L-P30-P54 virus solution, measure its virus titer and determine the concentration of virus particles. The DNA of the host cell is digested in the virus solution with 1% Benzonase (Benzonase 7.5-15 units/mL virus solution) in a water bath of 37° C. for 40 min. The virus particles were collected using a 300Kd ultrafiltration centrifuge tube after centrifugation at 1000 g for 30 min, followed by elution with 1×PBS. A260 was measured as the particle concentration=A260×1.1×1012 VP/mL.
2. For virus infection, 12-well plates of A549 cells were prepared, with each well cell being 2.5×105/well, the culture medium was discarded and PBS was used for one time. Adenovirus was inoculated according to 1×109 VP/well/0.5 ml to infect A549 cells. Wild-type human adenovirus type 5 was used as the positive control at 37° C. and 5% CO2. After 1 h, the virus solution was discarded and made up of 5% complete culture medium and cultured at 37° C. and 5% CO2 for 48 h.
3. Immunostaining was performed, and the cell supernatant was discarded. The cells were surface washing cells in PBS, fixed with ice formaldehyde, placed at −20 C for 20 min, and washed with 1×PBS for three times, each time for 5 min. Then 2 ml 1% BSA-PBS solution was added into each well, placed in a shaker, and incubated for 1 h. After the supernatant was discarded, human adenovirus type 5 fluorescent antibody (1:500 dilution) was added and incubated for 1 h, followed by washing with 1×PBS for three times, 5 min each time.
RCA was calculated using the equation as observed under a 10-fold fluorescence microscope
The judging standard was that the level of RCA was less than 1RCA/3×1010 vp. Through statistics, the RCA level of the pAd5LCL3-P72-B602L-P30-P54 is less than 1 RCA/3*1010 VP, which indicates that the replication-defective pAd5LCL3-P72-B602L-P30-P54 virus prepared by the invention can be stably packaged in 293TD37 cells and has low probability of not being converted into wild type or wild type.
The 293TD37 cells were prepared one day in advance and placed in a 12-well cell culture plate. The 293TD37 cells were infected with the African swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-P72-B602L-P30-P54 virus, and the cells became diseased 48 hours later. All 1 ml of cells were collected, washed with PBS, and prepared for Western Blot detection. The target protein was detected by antibodies of P30, which were rabbit serum immunized with prokaryotic expression of P30 protein. The experimental results were shown in
Twenty SPF-grade mice (6-8 weeks of age) were randomly divided into four groups, five for each group. Mice were immunized with pAd5LCL3-P72-B602L-P30-P54 according to the groupings shown in Table 1. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
The blood was collected 14 days after immunization, and the serum was isolated. The IgG antibody titers against the African swine fever target proteins P72 and P30 in the serum were detected by indirect ELISA. The test results were shown in
As shown in
Ten SPF-grade mice (6-8 weeks of age) were randomly divided into two groups, five for each group. Mice were immunized with pAd5LCL3-P72-B602L-P30-P54 according to the groupings shown in Table 2. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
The mice were sacrificed 14 days after immunization, and the splenic lymphocytes were isolated. PK15 cells transfected with the shuttle plasmids pS5E1-P72-IRES-B602L and pS5E4-P30-2A-P54 were stimulated and cultured for 6 hours, while protein secretion blockers were added to block cytokine secretion. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after the cells were fixed and perforated. Cell surface markers included CD4 and CD8, and intracellular cytokines included IFNγ and IL2. The expression levels of IFNγ and IL2 in CD4+T cells and CD8+T cells stimulated by the target protein were analyzed by flow cytometry (CyExpert).
The CD8+T cell and CD4+T cell immune responses induced by pAd5LCL3-P72-B602L-P30-P54 were shown in
pAd5LCL3-P72-B602L-P30-P54 recombinant adenovirus has strong immunogenicity and can induce mice to produce high levels of serum IgG antibodies. High doses of 1*108 FFU and medium doses of 1*107 FFU resulted in high immunologically induced titers. Since the P72 and B602L antigens, P30 and P54 antigens were respectively regulated and expressed by the same expression elements, the serum IgG antibodies of P72 and P30 can represent that all four antigens have high immunogenicity. The results of cellular immune response showed that intramuscular injection of the adenovirus vector vaccine of 1*107 FFU could induce specific cellular immune response in the immunized mice.
Animal immunization with the African swine fever multiantigen recombinant adenovirus pAd5LCL3-P72-B602L-P30-P54 vaccine: Three-yuan pigs were immunized with the pAd5LCL3-P72-B602L-P30-P54 vaccine of 1*109 FFU. Four weeks later, blood samples were collected and serum was isolated from the pigs. The immunized serum samples were tested by the IDVET African Swine Fever Assay Kit. The specific immune mode was shown in Table 3:
There were five immune experimental groups and two blank control groups in total. The immune experimental results were shown in Table 4.
Where for each sample the percent S/P (S/P %), S/P %=(OdSample−ODNC)/(ODPC−ODNC)*100 was calculated, S/P % was calculated for each sample, when S/P %≤30 was negative, 30%<S/P %<40% was suspected, and S/P %≥40% was positive.
Experimental validity determination: the experiment was valid under the following conditions:
(1) The mean net OD of the positive control was greater than 0.350; ODPC >0.350
(2) The average net OD value ratio of the positive control to the negative control is greater than 3; OD PC/ODNC >3
The experimental results showed that the recombinant adenovirus pAd5LCL3-P72-B602L-P30-P54 vaccine could induce sufficient immune response in the Sanyuan pig immune test.
13.2 Cytotoxic t Cell (CTL) Killing Experiment Induced by African Swine Fever Multiantigen Recombinant Adenovirus pAd5LCL3-P72-B602L-P30-P54 Vaccine
Animal immunization with African swine fever multiantigen recombinant adenovirus pAd5LCL3-P72-B602L-P30-P54 vaccine: Three-yuan pigs were immunized with 1×108 FFU of pAd5LCL3-P72-B602L-P30-P54 vaccine. After four weeks, blood samples were collected. Porcine peripheral blood lymphocyte separation: The porcine peripheral blood lymphocyte separation kit of Tianjin HaoyangHuake Biotechnology Co., Ltd. was used for lymphocyte separation of the collected porcine blood sample, and the effector cells were counted by a counter. Cytotoxic T cell (CTL) killing assay: A lactate dehydrogenase cytotoxicity assay kit (purchased from Beyotime) was used to detect the cytotoxic T cell (CTL) killing assay. Specific steps: 1. PK15 cells (purchased from the Cell Resource Center of Institute of Basic Medical Science, China Academy of Medical Sciences) were prepared one night in advance and infected with African swine fever pAd5LCL3-P72-B602L-P30-P54 vaccine and adenovirus vector control vaccine (25MOI, 18 hours in advance).
2. Before the experiment, the infected PK15 cells were digested with trypsin and diluted to 1×105/ml by suspension culture in serum-free medium as the target cells. At the bottom of the 96 holes cell culture Target cells were added to the plates, with 100 ul added to each well. The natural release control wells for the three effector cells were treated with 100 ul of culture medium without adding target cells.
3. Add 100 ul effector cells to each well, and the ratio of effector cells to target cells was 50:1. Only 100 ul of culture medium was added to the natural release wells without adding effector cells. Meanwhile, a maximum release control hole was arranged, and a cell release reagent is added.
4. The samples were incubated at 37° C. for 4 hours in a carbon dioxide incubator with 5% CO2.
5. The plates were centrifuged to 250 g for 10 minutes. One hundred and forty 140 ul of supernatant was aspirated from each well and correspondingly added to another 96-well ELISA plate prepared according to the instructions of the lactate dehydrogenase cytotoxicity test kit and sixty μ 0 was added. The absorbance value of OD490 was detect.
The experimental results were shown in
1. Construction of the shuttle plasmid in the E1 region of the human adenovirus type 5 vector according to the construction method described in Example 4.
2. Construction of shuttle plasmid pS5E1-P72-IRES-B602L of African swine fever human adenovirus type 5 vector
1) Ligation of pS5E1 Fragment to the IRES Fragment
{circle around (1)} primer synthesis
{circle around (2)} amplifying IRES fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of 10 uM primer IRES-EcoRV-F, 1 uL of 10 uM primer IRES-NOTI-R, 2 ul of template IRES, and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. The electrophoretic detection of amplification results was shown in
{circle around (3)} IRES fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} Excision of the target fragment IRES with the pS5E1 vector
Enzyme digestion reaction system: the vector pS5E1, IRES fragment ˜2 ug, and each of EcoRV and NotI was 1 uL; 10×cutsmart buffer 5 ul; Replenish water to 50 ul; Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min; Recovery and purification of gum. The electrophoretic detection of the digested products was shown in
{circle around (5)} pS5E1 vector was connected with IRES fragment
Ligation system: pS5E1 (100 ng); IRES fragment (vector:fragment=1:5, molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM primer IRES-EcoRV-F 1 ul, and 10 uM primer IRES-NotI-R 1 ul, and supplementing water to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid NotI and EcoRV restriction enzyme digestion verification: 2 and 6 were selected for plasmid extraction and restriction enzyme digestion verification, and the results were shown in
2) Ligation of pS5E1-IRES to the MGF5L6L Fragment
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of MGF5L6L fragment
Amplification system: 25 ul of Q5 enzyme, 10 uM primer MGF5L6L-NotI-F 1 ul, 10 uM primer MGF5L6L-XhoI-R 1 ul, and template MGF5L6L 1 ul, supplemented with water to 50 ul; PCR program: 98° C., 10 s; 98° C., 5 s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min.
{circle around (3)} The MGF5L6L fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} The target fragment MGF5L6L was digested with pS5E1-IRES vector
Enzyme digestion reaction system: vectors pS5E1-IRES, MGF5L6L fragment ˜2 ug, NotI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the digested product was shown in
{circle around (5)} The target fragment MGF5L6L was connected with pS5E1-IRES
Ligation system: pSSE1-IRES (100 ng); MGF5L6L fragment (vector:fragment=1: 3 molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM primer MGF5L6L-NotI-F 1 ul, and 10 uM primer MGF5L6L-XhoI-R 1 ul were replenished to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 30s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid restriction endonuclease assay (NotI and XhoI), colonies 2, 9 and 11 were selected for plasmid extraction and restriction endonuclease assay. The results were as shown in
3) Ligation of pS5E1-IRES-MGF5L6L to Fragment CP129Rubiqutin
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of CP129Rubiqutin fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of primer CP 129R-BamHI-F, 1 uL of primer CP129R-ubiquitin-R, and 2 uL of template CP129R; the water supplementing amount was up to 50 ul; Reaction condition: 98° C. for 30 s; 98° C. for 10 s, 68° C. for 30 s, 72° C. for 15 s, 35 cycles; 72° C. 5 min.
Amplification system: 25 ul of Q5 enzyme, 1 uL of primer ubiqutin-F, 1 uL of primer ubiqutin-EcoRV-R, and 2 uL of template ubiqutin, and supplementing water to 50 ul; Reaction condition: 98° C. for 30 s; 98° C. for 10 s, 68° C. for 30 s, 72° C. for 15 s, 35 cycles; 72° C. 5 min.
Amplification system: 25 ul of Q5 enzyme, upstream primer CP129R-BamHI-F, downstream primer ubiqutin-EcoRV-R, template fragment CP129R and fragment ubiqutin 50 ng each, and supplementing water to 50 ul; Reaction condition: 98° C.; 98° C. for 5 s, 68° C. for 30 s, 72° C. for 30 s, 35 cycles; 72° C. 7 min.
{circle around (3)} The CP129Rubiqutin fragment was purified by an Axygen™ PCR purification kit.
{circle around (4)} The target fragment CP129Rubiqutin was digested with pSSE1-IRES-MGF5L6L vector
Enzyme digestion reaction system: the vector pSSE1-IRES-MGF5L6L, CP129Rubiqutin fragment 2 ug, and each of EcoRV and BamHI 1 ul; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme-cleaved product was shown in
{circle around (5)} The pS5E1-IRES-MGF 5L6L vector was connected with the CP129Rubiqutin fragment
Ligation system: pS5E1-IRES-MGF 5L6L100N g; CP129Rubiqutin fragment 50 ng; T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM primer CP 129R-BAMH-F 1 uL, and 10 uM primer ubiqutin-EcoRV-R 1 ul were replenished to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 30s, 35 cycles; 72° C., 5 min; Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid BamHI and EcoRV restriction enzyme digestion verification: The No. 1 and No. 2 colonies were selected for plasmid extraction and restriction enzyme digestion verification. The results were shown in
The skeleton of the shuttle plasmid pS5E4 was composed of basic elements such as puc origin and amp, the ITR sequence of the left arm (370 bp), the partial fiber gene sequence of the right arm (1746 bp) in the hAd5E4 region, and the EF1α-EGFP-HBV polyA gene.
The EF1α-EGFP-HBV polyA gene was synthesized by BoMed.
{circle around (1)} Using the synthetic fragment of EF1α-EGFP-HBV gene as the template and EF1α-F and EF1α-R as the primers, the EF1α-EGFP-HBV polyA fragment of the pS5E4-EGFP shuttle plasmid was amplified; Amplification system: the synthetic fragment of EF1α-EGFP-HBV gene was 50 μg, 10 μM EF1α-F primer was 1 ul, 10 μM EF1α-R primer was 1 ul, and Q5 high-fidelity enzyme was 20 ul; Replenish water to 40 ul. PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} The left arm fragment of pS5E1 shuttle plasmid was amplified using pAd5LCL3 as the template and puc-Ad5E4-left arm-F and Ad5E4-left arm-EF1α-R as the primers. Amplification system: pAd5LCL3 plasmid 50 ng, 10 uM puc-Ad5E4-left arm-F primer 1 ul, 10 uM Ad5E4-left arm-EF1α-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 10 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} The right arm fragment of the pS5E4-EGFP shuttle plasmid was amplified using pAd5LCL3 as the template and EF1α-Ad5E4-right arm-F and Ad5E4-right arm-puc-R as the primers; Amplification system: pAd5LCL3 plasmid 50 ng, 10 uM EF1α-Ad5E4-right arm-F primer 1 ul, 10 uM Ad5E4-right arm-puc-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul.
PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
{circle around (4)} QPCR amplification of the pS5E4-EGFP shuttle plasmid backbone using pS5E1 plasmid as the template and puc-F and puc-R as the primers; Amplification system: pS5E1 skeletal plasmid 50 ng, 10 uM puc-F primer 1 ul, 10 uM puc-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 1 min 20 sec, 35 cycles; 72° C., 5 min. Agarose validation of that amplification product was shown in
The four fragments of pS5E4-EGFP shuttle plasmid left arm, pS5E4-EGFP shuttle plasmid right arm, EF1α-EGFP-HBV, and pS5E4-EGFP shuttle plasmid skeleton were connected by use that bode seamless cloning kit. The ligation system consisted of 10 μL of 2×Smealess Cloning Mix, 50 ng of the pS5E4-EGFP shuttle plasmid left arm fragment, 50 ng of the pS5E4-EGFP shuttle plasmid right arm fragment, 50 ng of the EF1α-EGFP-HBV fragment, 50 ng of the pS5E4-EGFP shuttle plasmid backbone fragment, and 20 μl of water replenishment, incubated at 50° C. for 40 minutes. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (1)} colony PCR
Colony PCR amplification of the target fragment using the primer puc-Ad5E4-left arm-F/EF1α-R as the primer and agarose gel verification revealed a positive band as shown in
{circle around (2)} enzyme digestion verification
The positive clones No. 3, 4, 5 and 6 were picked and placed in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and the plasmids were extracted for restriction endonuclease verification.
The electrophoresis results were shown in
2. Construction of the E4 Region Shuttle Plasmid pS5E4-CP312R-2A-MGF5L6L of African Classical Swine Fever Human Adenovirus Type 5 Vector
{circle around (1)} The synthetic fragment of CP312R gene was used as the template and PS5E4-CP312R-HamHI-F and CP312R-2A-R as the primers to amplify the CP312R fragment; Amplification system: synthetic fragment of CP312R gene (50 μg, 10 μM PS5E4-CP312R-Hamhi-F primer (1 ul), 10 μM CP312R-2A-R primer (1 ul), Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} Using the synthetic fragment of MGF110-4L gene as a template and MGF110-4L-F and MGF110-4L-XhoI-R as primers to amplify the MGF110-4L fragment; Amplification system: MGF110-4L gene synthetic fragment 50 ng, 10 uM MGF110-4L-F primer 1 ul, 10 uM MGF110-4L-XhoI-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} The synthetic fragment of 2A gene was used as the template and CP312R-2A-F and 2A-MGF110-4L-R as the primers to amplify the 2A fragment; Amplification system: synthetic fragment of 2A gene (50 ug), 10 μM CP 312R-2A-F primer (1 ul), 10 μM 2A-MGF 110-4 L-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
The amplification results were shown in
4) amplifying the CP312R-2A-MGF110-4L fragment by fusion PCR
Amplification system: 50 ng of CP312R gel recovery fragment, 50 ng of 2A gel recovery fragment, 50 ng of MGF110-4L gel recovery fragment, 1 ul of 10 uM PS5E4-CP312R-HamHI-F primer, 1 ul of 10 uM MGF110-4L-XhoI-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 50 sec, 35 cycles; 72° C., 5 min. The fusion results were shown in
5) Enzyme Digestion with pS5E4-EGFP Vector
Enzyme digestion reaction system: vector pS5E4-EGFP 2 ug, BamHI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification. The gel recovery results were shown in
6) Seamless Clone Connection and Transformation of pS5E4 Vector and CP312R-2A-MGF110-4L Fragment
Ligation system: recovery products of pS5E4-EGFP vector(100 ng), CP312R-2A-MGF110-4L fragment (50 ng), 2×Smealess Cloning Mix 5 ul, replenished to 10 ul. Reaction condition: 50° C., 40 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (2)} colony PCR
Using EF1α2(d)-F and HBV(jd)-R as primers, the target fragment was amplified by colony PCR and verified by agarose gel assay as shown in
{circle around (2)} enzyme digestion verification
The No. 1, No. 2, No. 3 and No. 4 positive clone were picked and place in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and plasmids were extract for double enzyme digestion verification by BmHI and XhoI; The enzyme digestion results were shown in
1. Homologous Recombination of Shuttle Plasmid pSSE1-CP129Rubiqutin-IRES-MGF5L6L and adenovirus vector plasmid pAd5LCL3
1) PacI and SwaI perform enzyme digestion on the shuttle plasmid pSSE1-CP129Rubiqutin-IRES-MGF 5L6L and the adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system was as follows: A. Shuttle plasmid pSSE1-CP129Rubiqutin-IRES-MGF 5L6L3 μg; PacI 2 μl; buffer cutsmart 4 μl; Replenish water to 40 μl.
B, adenovirus vector plasmid pAd5LCL3 3 μg; SwaI 2 μl; Buffer 3.1 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation and the results were shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) The colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) The No. 4 positive plasmid was converted to DH5a competent state, one colony was picked out and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The restriction enzyme digestion results were shown in
2. The shuttle plasmid pS5E4-CP312R-2A-MGF110-4L was homologously recombined with the adenovirus vector plasmid pAd5LCL3-C19Rubiqutin-IRES-MGF5L6L to obtain pAd5LCL3-C19Rubiqutin-MGF5L6L-CP312R-MGF110-4L.
1) PacI and I-sceI perform enzyme digestion on the shuttle plasmid pS5E4-CP312R-2A-MGF110-4L and the adenovirus vector plasmid pAd5LCL3-CP129Rubiqutin-IRES-MGF 5L6L, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid pS5E4-CP312R-2A-MGF110-4L3p g; PacI 2 μl; 10×cutsmart buffer 4 μl; Replenish water to 40 μl.
B. Adenovirus vector plasmid pAd5LCL3-CP129rubiqutin-IRES-MGF5L6L3 ug; I-sceI 2 μl; Buffer cutsmart 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation and the results were shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJS183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) Six colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) transform that No. 3 positive plasmid into DH5a competence; One colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The enzyme digestion results were shown in
Wrap the plasmid pAd5LCL3-CP129Rubiqutin-MGF 5L6L-CP312R-MGF 110-4L with 293TD37 cells as follows:
Preparation of 293TD37 cells: The cells were prepared one day before transfection. The 293TD37 cells to be transfected were inoculated into a 6-well plate at 0.5×106/well, and incubated at 37° C. with 5% CO2 for 24 hours. On the day of transfection, the cells showed 40-50% confluency.
Linearization of plasmid pAd5LCL3-C129Rubiqutin-MGF5L6L-CP312R-MGF110-4L: The plasmid to be transfected was digested with PacI enzyme, incubated at 37° C. for 40 min, and inactivated at 65° C. for 20 min.
Transfection: The linearized 2 pg plasmid and PEI were diluted with 100 μl serum-free medium, respectively. The plasmid diluent was added into the PEI diluent, and repeatedly aspirated for 5 times or vortexed for 10 seconds to be mixed evenly, and incubated for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture medium was gently aspirated from the plates, 2 mL of fresh growth medium was added, and after 10 minutes the transfection complex was added to the cells in fresh medium.
Cell culture: the transfected 293TD37 cells were incubated at 37° C. for 72-96 hours in a 5% CO2 incubator; 6-well plate cell suspensions were collected in 1.5 ml centrifuge tubes, TP0, 72-96 hours after viral plasmid transfection.
Continuous inoculation: The collected cell suspension was repeatedly frozen and thawed at −80° C. for 3 times, centrifuged at 2000 g for 10 minutes at 4 C, and 500 μl of supernatant was collected to infect 293TD37 cells (293TD37 cells need to be prepared one day in advance). The cells were incubated at 37° C. with 5% CO2 for 60 minutes, followed by the addition of 2 mL of FBS medium, followed by culture at 37° C. with 5% CO2 for 72 hours, and the cell suspension, namely TP1; was collected. The previous steps were repeated and the cell suspension, TP2, was collected. The drug was continued until the cells became diseased.
Cytopathic effect: When the 293TD37 cells were cultured from TP0 to TP4, the cells gradually became diseased until the 293TD37 cells became completely diseased. The cytopathic effects caused by TP0 to TP4 were shown in
The 293TD37 cells were prepared. The cells with good growth in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin, and then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, which was then blown, mixed, inoculated into 6-well plates (5×105/mL, 2 ml per well), and allowed to stand for culture in a 37° C. 5% CO2 carbon dioxide incubator. After 24 hours, when the cells adhered to grow into single-layer cells, the culture medium was discarded, and the recombinant adenovirus was continuously diluted 10-3 to 10-6 times with serum-free DMEM maintenance solution, and two wells were inoculated with each dilution degree at 250 uL per well. After one hour of infection, the supernatant was discarded to supplement the complete culture medium, and then the medium was allowed to stand for culture in a 5% carbon dioxide incubator at 37° C. After 24 h, the supernatant was discarded and the cells were washed with PBS (1 mL per well). After PBS was discarded, 1 mL of cold formaldehyde was added into each well for fixation, and formaldehyde was discarded at room temperature for 10 min. Then the cells were washed with PBS (1 mL per well), followed by adenovirus antibody-FITC (1 ml per well). After 1 h at room temperature, the cells were washed with PBS again (1 mL per well). After two times, 1 mL of PBS was added into each well and counted under fluorescence microscope (200 times, 10 continuous fields). Calculation: Virus titer (FFU/mL)=Mean×1013×4×10(−n). The FFU of the pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus was 1.9×108FFU/mL, with a high titer.
Vaccine pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L
The 293TD37 cells were prepared. The cells that grew well in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin. Then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, and then the cells were blown and mixed evenly. The 293TD37 cells were planted into 6-well plates (5×105 cells/mL, 2 mL/well), incubated for 1 hour at room temperature to adhere to the wall, and incubated for microscopic observation of its attachment degree. The infection was carried out with pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L viral particles and the titer of infection was 5 MOI/well. After the 293TD37 cells developed lesions 48 hours later, the cells were collected, repeatedly frozen and thawed for three times, and then centrifuged at 2000 g; the collected supernatant was detected for FFU, and then new 293TD37 cells were reinfected until the 30th generation. The collected virus solutions of passages 5, 10, 15, 20, 25 and 30 were tested, and the genome of the virus was found to be still intact, indicating that the replication-defective pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus could be stably packaged in 293TD37 cells.
pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus RCA detection, detection method was as follows:
1. Prepare pAd5LCL3-CP129 Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus solution, and measure the virus titer and determine the concentration of virus particles. The DNA of the host cell shall be digested with 1% Universal Nuclease (7.5-15 units/mL virus solution) in the virus solution and water bath at 37° C. for 40 min. Using a 300Kd ultrafiltration centrifuge tube, the virus particles were collected after centrifugation at 1000 g for 30 min, followed by elution with 1×PBS. A260 was measured, and the particle concentration=A260*1.1*10 12 VP/mL.
2. Virus infection: A 6-well plate of A549 cells was prepared, with each well cell being 2.5×105/well. The medium was discarded and washed with PBS once. Adenovirus was inoculated with virus at 1×109 vp/well to infect A549 cells. Wild-type human adenovirus type 5 was used as the control at 37° C. and 5% CO2. After 1 h, the virus solution was discarded and supplemented with 5% complete medium. The cells were cultured at 37° C. and 5% CO2 for 48 h.
3. Immunostaining was performed, and the cell supernatant was discarded. The cells were surface washing cells in PBS, fixed with ice formaldehyde, placed at −20 C for 20 min, and washed with 1×PBS for three times, each time for 5 min. Then 2 ml 1% BSA-PBS solution was added into each well, placed in a shaker, and incubated for 1 h. After the supernatant was discarded, human adenovirus type 5 fluorescent antibody (1:500 dilution) was added and incubated for 1 h, followed by washing with 1×PBS for three times, 5 min each time.
RCA was calculated using the equation as observed under a 10-fold fluorescence microscope
The judging standard was that the level of RCA was less than 1RCA/3×1010 vp. According to statistics, the RCA level of the pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L was less than 1RCA/3×1010 vp, which indicates that the replication-defective pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus prepared by the invention can be stably packaged in 293TD37 cells and has low probability of not being converted into wild type or wild type.
The 293TD37 cells were prepared one day in advance and placed in a 12-well cell culture plate. The 293TD37 cells were infected with the African swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L virus. After 48 hours, the cells became diseased, and 1 ml of cells were collected. The cells were washed with PBS, and samples were prepared for Western Blot detection. The antibody of HA was used to detect the target protein, and the antibody of HA was purchased from Abcam. Wherein, CP129Rubiquitin, MGF5L6L and CP312R have HA tags, wherein the size of the CP129Rubiquitin fusion protein was 34kda, the size of the MGF5L6L protein was 25kda, and the size of the CP312R protein was 35kda. The experimental results were shown in
Ten SPF-grade mice (6-8 weeks of age) were randomly divided into two groups, five for each group. Mice were immunized with pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4L according to the groupings shown in Table 5. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100u1.
The mice were sacrificed 14 days after immunization, and the splenic lymphocytes were isolated. PK15 cells transfected with the shuttle plasmids pS5E1-CP129Rubiqutin-MGF5L6L and pS5E4-CP312R-MGF110-4L were stimulated and cultured for 6 hours, while protein secretion blockers were added to block cytokine secretion. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after the cells were fixed and perforated. Cell surface markers included CD4 and CD8, and intracellular cytokines included IFNγ and IL2. The expression levels of IFNγ and IL2 in CD4+T cells and CD8+T cells stimulated by the target protein were analyzed by flow cytometry (CyExpert).
The immune responses of CD8+T cells and CD4+T cells induced by pAd5LCL3-CP129Rubiqutin-MGF5L6L-CP312R-MGF110-4Lwere shown in
1. Construction of shuttle plasmid in E1 region of human adenovirus type 5 vector. The construction was conducted in the same way as in Example 4 to obtain shuttle plasmid pS5E1.
2. Construction of African swine fever human adenovirus type 5 vector shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L
1) Ligation of pS5E1 to the IRES fragment
The ligation of pS5E1 and IRES fragments was performed according to the method provided in Example 4 to construct pS5E1-IRES.
2) Ligation of pS5E1-IRES to the I215L fragment
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of I215L fragment
Amplification system: 25 ul of Q5 enzyme, I215L-NotI-F 1 ul of 10 μM primer, I215L-XhoI-R 1 ul of 10 μM primer, and I215L 1 ul of template, and water supplementing to 50 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min.
{circle around (3)} The I215L fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} The target fragment I215L was digested with pS5E1-IRES vector
Enzyme digestion reaction system: vectors pS5E1-IRES, I215L fragment −2 ug, NotI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} The target fragment I215L was connected with pS5E1-IRES
Ligation system: PS5E1-IRES (100 ng); An I215L fragment (vector:fragment=1: 3 molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM universal primer CMV-F 1 ul, and 10 uM primer I215L-XhoI-R 1 ul, and supplementing water to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 30s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid restriction endonuclease assay (NotI and XhoI), colonies 5, 6, 7 and 8 were selected for plasmid extraction and restriction endonuclease assay. The results were as shown in
3) Ligation of pS5E1-IRES-MGF5L6L to fragment L8Lubiqutin
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of L8Lubiqutin fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of primer L8L-BAMHI-F, 1 uL of primer L8L-ubiquitin-R, and 2 uL of template L8L; water supplementation was conducted to 50 ul; Reaction condition: 98° C. for 30 s; 98° C. for 10 s, 68° C. for 30 s, 72° C. for 15 s, 35 cycles; 72° C., 5 min.
Amplification system: 25 ul of Q5 enzyme, 1 uL of primer UBIQUTIN-F, 1 uL of primer ubiqutin—EcoRV-R, and 2 uL of template UBIQUTIN, and supplementing water to 50 ul; Reaction condition: 98° C. for 30 s; 98° C. for 10 s, 68° C. for 30 s, 72° C. for 15 s, 35 cycles; 72° C. 5 min.
The L8L and ubiqutin fragments were purified by an Axygen™ gel extraction and purification kit.
Amplification system: 25 ul of Q5 enzyme, 50 ng of upstream primer L8L-BamHI-F, downstream primer ubiqutin-EcoRV-R template fragment L8L and fragment ubiqutin respectively, and water supplementing to 50 ul; Reaction condition: 98° C.; 98° C. for 5 s, 68° C. for 30 s, 72° C. for 30 s, 35 cycles; 72° C. 7 min.
{circle around (3)} The L8Lubiqutin fragment was purified by Axygen™ PCR purification kit, and the fused L8Lubiqutin fragment was shown in
{circle around (4)} The target fragment L8Lubiqutin was digested with pS5E1-IRES-I215L vector
Enzyme digestion reaction system: the vectors were pS5E1-IRES-I215L, L8Lubiqutin fragment −2 ug, and each of EcoRV and BamHI was 1 uL; l0 xcutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} pS5E1-IRES-I215L vector was connected with L8Lubiqutin fragment
Ligation system: pS5E1-IRES-I215L 100 ng; L8Lubiqutin fragment 50 ng; T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM universal primer CMV-F 1 ul, and 10 uM primer ubiqutin-EcoRV-R 1 ul were replenished to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 40s, 35 cycles; 72° C., 5 min; Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid digestion verification of BamHI and EcoRV: The colonies of 4, 6, 9, 14, 17 and 18 were selected for plasmid extraction and digestion verification. The results were shown in
1, human adenovirus type 5 vector E4 region shuttle plasmid construction
The human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-EGFP was successfully constructed according to the method provided in Example 5.
2. Construction of African swine fever human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-I73RHBsAg-2A-E146L
1) Primer design
2) Amplification of target fragments I73R, HBsAg, 2A, E146L
{circle around (1)} The I73R fragment was amplified using the I73R gene synthetic fragment as the template and pS5E4-I73R-BamHI-F and I73-HBsAg-R as the primers; Amplification system: synthetic fragment of 173 gene (50 μg, 10 μMpS5E4-173R-BamHI-F primer (1 ul), 10 μM I73-HBsAg-R primer (1 ul), Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} Using the HBsAg gene synthetic fragment as a template and HBsAg-F and HBsAg-2A-R as primers, amplifying the HBsAg fragment; Amplification system: HBsAg gene synthetic fragment 50 ng, 10 uM HBsAg-F primer 1 ul, 10 uM HBsAg-2A-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} Using the synthetic fragment of 2A gene as a template and 2A-F and 2A-E146L-R as primers, the 2A fragment was amplified; Amplification system: synthetic fragment of 2A gene (50 μg), 10 μM 2A-F primer (1 ul), 10 μM 2A-E146L-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (4)} Using the synthetic fragment of E146L gene as the template and E146L-F and E146L-pS5E4-XhoI-R as the primers, the E146L fragment was amplified. Amplification system: synthetic fragment of E146L gene (50 μg), 10 μM E146L-F primer (1 ul), 10 μM E146L-pSSE4-XhoI-R primer (1 ul), and high-fidelity enzyme (Q5) (20 ul). Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 30 sec, 35 cycles; 72° C., 5 min.
The fragments of interest were purified by an Axygen™ gel extraction kit.
4) Amplifying the I73RHBsAg fragment by fusion PCR Amplification system: 50 μg of recovered I73R gel fragment, 50 μg of recovered HBsAg gel fragment, 1 ul of 10 μM pS5E4-I73R-Hamhi-F primer, 1 ul of 10 μM HBsAg-2A-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
5) Amplifying the 2A-E146L fragment by fusion PCR
Amplification system: 50 ng of recovered 2A gel fragment and 50 ng of recovered E146L gel fragment, 1 ul of 10 uM 2A-F primer, 1 ul of 10 uM E146L-pSSE4-XhoI-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 30 sec, 35 cycles; 72° C., 5 min. The fusion results were shown in
6) Enzyme digestion with pSSE4-EGFP vector
Enzyme digestion reaction system: vector pS5E4-EGFP 2 ug, BamHI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification.
7) Purifying the vector fragment by an Axygen™ gel extraction kit;
The recovery products were shown in
8) recovery products of pS5E4-EGFP vector and I73RHBsAg fragment, 2A-E146L seamless clone connection and transformation
Ligation system: pS5E4-EGFP gel recovery (100 ng), I73RHBsAg fragment (50 ng), 2A-E146L fragment (50 ng), 2×Smealess Cloning Mix 5 ul, replenished to 10 ul. Reaction condition: 50° C., 40 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
9) Plasmid validation
{circle around (1)} colony PCR
Using EF1α2(d)-F and HBV(jd)-R as primers, the target fragment was amplified by colony PCR and verified by agarose gel assay as shown in
{circle around (2)} enzyme digestion verification
The No. 1, No. 2 and No. 3 positive clone were picked and place in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and that plasmids were extract for double enzyme digestion verification of BamHI and XhoI; The enzyme digestion results were shown in
1. Autologous recombination of shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and adenovirus vector plasmid pAd5LCL3
1) PacI and SwaI perform enzyme digestion on the shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L and the adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid pS5E1-L8Lubiqutin-IRES-I215L3 μg; PacI 2 ul; buffer cutsmart 4 ul; Replenish water to 40 ul.
B, adenovirus vector plasmid pAd5LCL3 3 ug; SwaI 2 ul; Buffer 3.1 4 ul; Replenish water to 40 ul.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
Two uL of agarose gel were used for validation, and the results were shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 ul; of enzyme digestion reaction solution; Dephosphorylase 1 uL; Dephosphorylated buffer 5 ul; Replenish water to 50 ul. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) The colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) The No. 6 positive plasmid was converted into DH5a competent state, a colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the extracted plasmid was subjected to XhoI restriction endonuclease verification again. The restriction endonuclease result was shown in
2. Autologous recombination of shuttle plasmid pS5E4-I73RHBsAg-2A-E146L and adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L to obtain pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L.
1) PacI and I-sceI perform enzyme digestion on the shuttle plasmid pS5E4-I73RHBsAg-2A-E146L and the adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid pS5E4-I73RHBsAg-2A-E146L3p g; PacI 2 ul; 10×cutsmart buffer 4 ul; Replenish water to 40 ul.
B. Adenovirus vector plasmid pAd5LCL3-L8Lubiqutin-IRES-I215L3 ug; I-sceI 2 ul; Buffer cutsmart 4 ul; Replenish water to 40 ul.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation, and the results were shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 ul; of enzyme digestion reaction solution; Dephosphorylase 1 uL; Dephosphorylated buffer 5 ul; Replenish water to 50 ul. Reaction condition were 37.0° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJS183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) Six colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) transform that No. 2 positive plasmid into DH5a competence; One colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The enzyme digestion result was shown in
Wrap the pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L plasmid in 293TD37 cells as follows: Preparation of 293TD37 cells: The cells were prepared one day before transfection. The 293TD37 cells to be transfected were inoculated into a 6-well plate at 0.5×106/well, and incubated at 37° C. with 5% CO2 for 24 hours. On the day of transfection, the cells showed 40-50% confluency.
Linearization of plasmid pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L: The plasmid to be transfected was digested with PacI enzyme, incubated for 40 min at 37° C., and inactivated for 20 min at 65° C.
Transfection: The linearized 2 pg plasmid and PEI were diluted with 100 ul serum-free medium, respectively. The plasmid diluent was added into the PEI diluent, and repeatedly aspirated for 5 times or vortexed for 10 seconds to be mixed evenly, and incubated for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture medium was gently aspirated from the plates, 2 mL of fresh growth medium was added, and after 10 minutes the transfection complex was added to the cells in fresh medium.
Cell culture: the transfected 293TD37 cells were incubated at 37° C. for 72-96 hours in a 5% CO2 incubator; 6-well plate cell suspensions were collected in 1.5 ml centrifuge tubes, TP0, 72-96 hours after viral plasmid transfection.
Continuous inoculation: The collected cell suspension was repeatedly frozen and thawed at −80° C. for 3 times, centrifuged at 2000 g at 4 C for 10 minutes, 500 ul of supernatant was collected to infect 293TD37 cells (293TD37 cells need to be prepared one day in advance), incubated at 37° C. with 5% CO2 for 60 minutes, supplemented with 2 mL of FBS medium, and cultured at 37° C. with 5% CO2 for 72 hours, to collect cell suspension, namely TP1. The previous steps were repeated and the cell suspension, TP2, was collected. The drug was continued until the cells became diseased.
Cytopathic effect: When the 293TD37 cells were cultured from TP0 to TP4, the cells gradually became diseased until the 293TD37 cells were completely diseased at TP4. The cytopathic effects caused by TP0 to TP4 were shown in
The 293TD37 cells were prepared. The cells with good growth in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin, and then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, which was then blown, mixed, inoculated into 6-well plates (5×105/mL, 2 ml per well), and allowed to stand for culture in a 37° C. 5% CO2 incubator. After 24 hours, when the cells adhered to grow into single-layer cells, the culture medium was discarded, and the recombinant adenovirus was continuously diluted 10-3 to 10-6 times with serum-free DMEM maintenance solution, and two wells were inoculated with each dilution degree at 250 uL per well. After one hour of infection, the supernatant was discarded to supplement the complete culture medium, and then the medium was allowed to stand for culture in a 5% carbon dioxide incubator at 37° C. After 24 h, the supernatant was discarded and the cells were washed with PBS (1 mL per well). After PBS was discarded, 1 mL of cold formaldehyde was added into each well for fixation, and formaldehyde was discarded at room temperature for 10 min. Then the cells were washed with PBS (1 mL per well), followed by adenovirus antibody-FITC (1 ml per well). After 1 h at room temperature, the cells were washed with PBS again (1 mL per well). After two times, 1 mL of PBS was added into each well and counted under fluorescence microscope (200 times, 10 continuous fields). Calculation: Virus titer (FFU/mL)=Mean×1013×4×10(−n). The FFU for the pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L virus was 2.2×108FFU/mL, with a high titer.
The 293TD37 cells were prepared. The cells that grew well in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin. Then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, and then the cells were blown and mixed evenly. The 293TD37 cells were planted into 6-well plates (5×105 cells/mL, 2 mL/well), incubated for 1 hour at room temperature to adhere to the wall, and incubated for microscopic observation of its attachment degree. The infection was carried out with the pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146 viral particle and the titer of infection was 5MOI/well. After the 293TD37 cells developed lesions 48 hours later, the cells were collected, repeatedly frozen and thawed for three times, and then centrifuged at 2000 g; the collected supernatant was detected for FFU, and then new 293TD37 cells were reinfected until the 30th generation. The collected virus solutions of passages 5, 10, 15, 20, 25 and 30 were tested, and the genome of the virus was found to be still intact, indicating that the replication-defective pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146 virus could be stably packaged in 293TD37 cells.
pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L virus RCA detection method was as follows:
1. Prepare a solution of pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146 virus, and measure the virus titer and determine the concentration of virus particles. The DNA of the host cell shall be digested with 1% Universal Nuclease (7.5-15 units/mL virus solution) in the virus solution and water bath at 37° C. for 40 min. Using a 300Kd ultrafiltration centrifuge tube, the virus particles were collected after centrifugation at 1000 g for 30 min, followed by elution with 1×PBS. A260 was measured, and the particle concentration=A260 *1.1*1012 VP/mL.
2. Virus infection: A 6-well plate of A549 cells was prepared, with each well cell being 2.5×105/well. The medium was discarded and washed with PBS once. Adenovirus was inoculated with virus at 1×109 vp/well to infect A549 cells. Wild-type human adenovirus type 5 was used as the control at 37° C. and 5% CO2. After 1 h, the virus solution was discarded and supplemented with 5% complete medium. The cells were cultured at 37° C. and 5% CO2 for 48 h.
3. Immunostaining was performed, and the cell supernatant was discarded. The cells were surface washing cells in PBS, fixed with ice formaldehyde, placed at −20 C for 20 min, and washed with 1×PBS for three times, each time for 5 min. Then 2 ml 1% BSA-PBS solution was added into each well, placed in a shaker, and incubated for 1 h. After the supernatant was discarded, human adenovirus type 5 fluorescent antibody (1:500 dilution) was added and incubated for 1 h, followed by washing with 1×PBS for three times, 5 min each time.
RCA was calculated using the equation as observed under a 10-fold fluorescence microscope
The judging standard was the level of RCA <1 RCA/3×1010 VP. Through counting that the RCA level of the pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L was less than 1 RCA/3*1010 VP, the replication-defective pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L virus prepared by the invention can be stably packaged in 293TD37 cells and cannot be converted into wild type or has low probability of being converted into wild type.
The 293TD37 cells were prepared one day in advance and placed in a 12-well cell culture plate. The 293TD37 cells were infected with the African swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-L8Lubiqutin-I215L-173R HBsAg-E146L virus. After 48 hours, the cells became diseased, and 1 ml of cells were collected. The cells were washed with PBS, and samples were prepared for Western Blot detection. The antibody of HA was used to detect the target protein, and the antibody of HA was purchased from Abcam. Among them, L8Lubiquitin fusion protein, and I215L protein have HA tag, and the protein size was 32kda and 26kda. The experimental results were shown in
Ten SPF-grade mice (6-8 weeks of age) were randomly divided into two groups, five for each group. Mice were immunized with pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L according to the groupings shown in Table 6. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
The mice were sacrificed 14 days after immunization, and the splenic lymphocytes were isolated. PK15 cells transfected with the shuttle plasmids pS5E1-L8Lubiqutin-I215L and pS5E4-I73RHBsAg-E146L were stimulated and cultured for 6 hours, while protein secretion blockers were added to block cytokine secretion. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after the cells were fixed and perforated. Cell surface markers included CD4 and CD8, and intracellular cytokines included IFNγ and IL2. The expression levels of IFNγ and IL2 in CD4+T cells and CD8+T cells stimulated by the target protein were analyzed by flow cytometry (CyExpert).
pAd5LCL3-L8Lubiqutin-I215L-I73RHBsAg-E146L-induced CD8+T cell and CD4+T cell immune response was shown in
1. Construction of human adenovirus type 5 vector E1 region shuttle plasmid
The human adenovirus type 5 vector E1 region shuttle plasmid pS5E1 was successfully constructed according to the method provided in Example 4.
2. Construction of shuttle plasmid pSSE1-EP402R-IRES-EP153R of African swine fever human adenovirus type 5 vector
1) ligation of pSSE1 to the IRES fragment
pS5E1-IRES was successfully constructed according to the method provided in Example 4.
2) ligation of pSSE1-IRES to the EP402R fragment
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of EP402R fragment
Amplification system: 25 ul of Q5 enzyme, 10 μM primer EP402R-BamHI-F 1 ul, 10 μM primer EP402R-EcoRV 1 ul, template EP402R 1 ul, and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 45s, 35 cycles; 72° C., 5 min.
{circle around (3)} The EP402R fragment was purified by an Axygen™ PCR purification kit.
{circle around (4)} The target fragment EP402R was digested with pS5E1-IRES vector
Enzyme digestion reaction system: the vector pS5E1-IRES, EP402R fragment −2 ug, and each of EcoRV and BamHI was 1 ul; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Gum is recovered and predicated. The electrophoretic detection of the digested products was shown in
{circle around (5)} The target fragment EP402R was connected with pS5E1-IRES
Ligation system: PS5E1-IRES (100 ng); Fragment of EP402R (vector:fragment=1: 3 molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 μM primer EP 402R-BAMH-F 1 uL, and 10 μM primer EP402R-EcoRV-R 1 ul were replenished to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 1 min, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid restriction endonuclease assay (BamHI&EcoRV), colony 1, 2 and 4 were selected for plasmid extraction and restriction endonuclease assay. The results were as shown in
3) ligation of pS5E1-EP402R-IRES to fragment EP153R
{circle around (1)} primer synthesis
{circle around (1)} PCR amplification of EP153R fragment
Amplification system: 25 ul of Q5 enzyme, 10 μM primer EP153R-NotI-F 1 ul, 10 μM primer EP153R-XhoI-R 1 ul, and template EP153R 1 ul were replenished to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min.
{circle around (3)} the EP153R fragment was purified by an Axygen™ PCR purification kit.
{circle around (4)} The target fragment EP153R was digested with pS5E1-EP402R-IRES vector
Enzyme digestion reaction system: vectors pS5E1-EP402R-IRES, EP153R fragment ˜2 ug, and 1 uL for NotI and XhoI respectively; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} pS5E1-EP402R-IRES vector was connected with EP153R fragment
Linkage system: PS5E1-EP 402R-IRES 100 ng; EP153R fragment 50 ng; T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: 10 ul of Q5 enzyme, 10 uM universal primer CMV-F 1 ul, and 10 uM primer EP153R-XhoI-R 1 ul were replenished to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 2 min 30 s, 35 cycles; 72° C., 5 min; Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid BamHI and XhoI restriction enzyme digestion verification: 1, 2, 3, 11 and 13 were selected for plasmid extraction and restriction enzyme digestion verification. The results were shown in
1. Construction of human adenovirus type 5 vector E4 region shuttle plasmid
The human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-EGFP was successfully constructed according to the method of Example 5.
2. Construction of African swine fever human adenovirus type 5 vector E4 region shuttle plasmid pSSE4-I177L-2A-K205Rubiqutin
1) Primer design
2) Amplification of the target fragment I177L-K205Rubiqutin
{circle around (1)} The I177L fragment was amplified using the I177L gene synthesis fragment as the template and EF1α-BamHI-II77L-F and I177L-R as the primers; Amplification system: synthetic fragment of I177L gene of 50 ng, 10 μM EF1α-BamHI-I177L-F primer of 1 ul, 10 μM I177L-R primer of 1 ul, and Q5 high-fidelity enzyme of 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 30 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} Using the synthetic fragment of 2A gene as a template and I177L-2A-F and 2A-K205R-R as primers, we amplified the 2A fragment; Amplification system: synthetic fragment of 2A gene (50 μg), 10 μM I177L-2A-F primer (1 ul), 10 μM 2A-K205R-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} The K205R fragment was amplified using the K205R gene synthesis fragment as the template and K205R-F and K205R-ubiquitin-R as the primers; Amplification system: synthetic fragment of K205R gene (50 g, 10 μM K205R-F primer (1 ul), 10 μM K205R-ubiquitin-R primer (1 ul), and high-fidelity enzyme Q5 (20 ul). Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 30 sec, 35 cycles; 72° C., 5 min.
{circle around (4)} Using the synthetic fragment of ubiquitin gene as the template and ubiquitin-F and ubiquitin-XhoI-HBV-R as the primers, the ubiquitin fragment was amplified. Amplification system: ubiqutin gene synthetic fragment 50 ng, 10 uM ubiqutin-F primer 1 ul, 10 uM ubiqutin-XhoI-HBV-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
3) The target fragment was purified by an Axygen™ gel extraction kit.
4) Amplifying the I177L-2A fragment and the K205Rubiqutin fragment by fusion PCR
Amplification system: 50 ng of I177L gel recovery fragment, 50 ng of 2A gel recovery fragment, 1 ul of 10 μM EF1α-BAMHI-I177L-F primer, 1 ul of 10 μM 2A-K205R-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
Amplification system: 50 ng of K205R recovered fragment, 50 ng of ubiqutin recovered fragment, 1 ul of 10 uM K205R-F primer, 1 ul of 10 uM 2A-K205R-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
The electrophoretic detection of the PCR product was shown in
5) Enzyme digestion with pSSE4-EGFP vector
Enzyme digestion reaction system: vector pSSE4-EGFP 2 ug, BamHI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification.
6) Purifying the Vector Fragment by an Axygen™ Gel Extraction Kit
The gel recovery results were shown in
7) seamless clonal connection and transformation of pS5E4-EGFP gel recovery vector with I177L-2A fragment and K205Rubiqutin
Ligation system: pS5E4-EGFP gel recovery product (100 ng), I177L-2A fragment (50 ng), K205Rubiqutin fragment (50 ng), 2×Smealess Cloning Mix 5 ul, replenished to 10 ul. Reaction condition: 50° C., 40 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
8) plasmid validation
{circle around (1)} colony PCR
Using EF1α2(d)-F and HBV(jd)-R as primers, the target fragment was amplified by colony PCR and verified by agarose gel assay. The results were shown in
{circle around (2)} enzyme digestion verification
The No. 1, No. 2 and No. 3 positive clone were picked and place in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and that plasmids were extract for double enzyme digestion verification of BmHI and XhoI; The enzyme digestion results were shown in
1. Homologous recombination of shuttle plasmid pS5E1-EP402R-IRES-EP153R with adenovirus vector plasmid pAd5LCL3
1) PacI and SwaI perform enzyme digestion on the shuttle plasmid pS5E1-EP402R-IRES-EP153R and the adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid pS5E1-EP 402R-IRES-EP 153R 3p g; PacI 2 μl; buffer cutsmart 4 μl; Replenish water to 40 μl.
B, adenovirus vector plasmid pAd5LCL3 3 ug; SwaI 2 μl; Buffer 3.1 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
Two uL of agarose gel were verified as shown in
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) The colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) The No. 2 positive plasmid was converted into DH5α competent state, a colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The restriction enzyme digestion result was shown in FIG. 141, which shows that lane 1 was plasmid XhoI restriction enzyme digestion of pAd5LCL3-EP402R-IRES-EP153R; The plasmid PacI digestion of pAd5LCL3-EP402R-IRES-EP153R in lane 2 and the plasmid BamHI digestion of pAd5LCL3-EP402R-IRES-EP153R in lane 3 showed the correct digestion results. The adenovirus vector pAd5LCL3-EP402R-IRES-EP153R was successfully constructed.
2. Autologous recombination of shuttle plasmid pS5E4-I177L-2A-K205Rubiqutin with adenovirus vector plasmid pAd5LCL3-EP402R-IRES-EP153R to obtain pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin
1) Enzymatic cleavage by 1) PacI and I-sceI of the shuttle plasmid pS5E4-I177L-2A-K205Rubiqutin and the adenovirus vector plasmid pAd5LCL3-EP402R-IRES-EP153R in the following reaction system:
A. The shuttle plasmid pS5E4-I177L-2A-K205Rubiqutin 3 pg; PacI 2 μl; 10×cutsmart buffer 4 μl; Replenish water to 40 μl.
B. Adenovirus vector plasmid pAd5LCL3-EP402R-IRES-EP153R 3 ug; I-sceI 2 μl; Buffer cutsmart 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2) Dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) Six colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) transform that No. 1 positive plasmid into DH5α competence; One colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The digestion results were shown in
Wrap the plasmid pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin in 293TD37 cells as follows:
Preparation of 293TD37 cells: The cells were prepared one day before transfection. The 293TD37 cells to be transfected were inoculated into a 6-well plate at 0.5 ×106/well, and incubated at 37° C. with 5% CO2 for 24 hours. On the day of transfection, the cells showed 40-50% confluency.
Linearization of plasmid pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin: The plasmid to be transfected was digested with PacI enzyme, incubated for 40 min at 37 C, and inactivated for 20 min at 65° C.
Transfection: The linearized 2 pg plasmid and PEI were diluted with 100 μl serum-free medium, respectively. The plasmid diluent was added into the PEI diluent, and repeatedly aspirated for 5 times or vortexed for 10 seconds to be mixed evenly, and incubated for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture medium was gently aspirated from the plates, 2 mL of fresh growth medium was added, and after 10 minutes the transfection complex was added to the cells in fresh medium.
Cell culture: the transfected 293TD37 cells were incubated at 37° C. for 72-96 hours in a 5% CO2 incubator; 6-well plate cell suspensions were collected in 1.5 ml centrifuge tubes, TP0, 72-96 hours after viral plasmid transfection.
Continuous inoculation: The collected cell suspension was repeatedly frozen and thawed at −80° C. for 3 times, centrifuged at 2000 g for 10 minutes at 4 C, and 500 μl of supernatant was collected to infect 293TD37 cells (293TD37 cells need to be prepared one day in advance). The cells were incubated at 37° C. with 5% CO2 for 60 minutes, followed by the addition of 2 mL of FBS medium, followed by culture at 37° C. with 5% CO2 for 72 hours, and the cell suspension, namely TP1, was collected. The previous steps were repeated and the cell suspension, TP2, was collected. The drug was continued until the cells became diseased.
Cytopathic effect: When the 293TD37 cells were cultured from TP0 to TP4, the cells gradually became diseased until the TP4293TD37 cells became completely diseased. The cytopathic effects caused by TP0 to TP4 were shown in
The 293TD37 cells were prepared. The cells with good growth in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin, and then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, which was then blown, mixed, inoculated into 6-well plates (5×105/mL, 2 ml per well), and allowed to stand for culture in a 37° C. 5% CO2 incubator. After 24 hours, when the cells adhered to grow into single-layer cells, the culture medium was discarded, and the recombinant adenovirus was continuously diluted 10-3 to 10-6 times with serum-free DMEM maintenance solution, and two wells were inoculated with each dilution degree at 250 uL per well. After one hour of infection, the supernatant was discarded to supplement the complete culture medium, and then the medium was allowed to stand for culture in a 5% carbon dioxide incubator at 37° C. After 24 h, the supernatant was discarded and the cells were washed with PBS (1 mL per well). After PBS was discarded, 1 mL of cold formaldehyde was added into each well for fixation, and formaldehyde was discarded at room temperature for 10 min. Then the cells were washed with PBS (1 mL per well), followed by adenovirus antibody-FITC (1 ml per well). After 1 h at room temperature, the cells were washed with PBS again (1 mL per well). After two times, 1 mL of PBS was added into each well and counted under fluorescence microscope (200 times, 10 continuous fields). Calculation: Virus titer (FFU/mL)=Mean×1013×4×10(−n). The FFU of the pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus was 1.8×108FFU/mL, with a high titer.
The 293TD37 cells were prepared. The cells that grew well in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin. Then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, and then the cells were blown and mixed evenly. The 293TD37 cells were planted into 6-well plates (5×105cells/mL, 2 mL/well), incubated for 1 hour at room temperature to adhere to the wall, and incubated for microscopic observation of its attachment degree. The infection was carried out with the pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus particle and the titer of infection was 5 MOI/well. After the 293TD37 cells developed lesions 48 hours later, the cells were collected, repeatedly frozen and thawed for three times, and then centrifuged at 2000 g; the collected supernatant was detected for FFU, and then new 293TD37 cells were reinfected until the 30th generation. The collected virus solutions from passages 5, 10, 15, 20, 25, and 30 were tested and the virus genome was found to be still intact, indicating that the replication-defective pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus could be stably packaged in 293TD37 cells.
pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin recovery mutation (RCA) pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus RCA detection method is as follows:
1. Prepare pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus solution, test the virus titer and determine the concentration of virus particles. The DNA of the host cell shall be digested with 1% Universal Nuclease (7.5-15 units/mL virus solution) in the virus solution and water bath at 37° C. for 40 min. Using a 300Kd ultrafiltration centrifuge tube, the virus particles were collected after centrifugation at 1000 g for 30 min, followed by elution with 1×PBS. A260 was measured, and the particle concentration=A260*1.1*10 12 VP/mL. 2. Virus infection: A 6-well plate of A549 cells was prepared, with each well cell being 2.5×105/well. The medium was discarded and washed with PBS once. Adenovirus was inoculated with virus at 1×109 vp/well to infect A549 cells. Wild-type human adenovirus type 5 was used as the control at 37° C. and 5% CO2. After 1 h, the virus solution was discarded and supplemented with 5% complete medium. The cells were cultured at 37° C. and 5% CO2 for 48 h.
3. Immunostaining was performed, and the cell supernatant was discarded. The cells were surface washing cells in PBS, fixed with ice formaldehyde, placed at −20° C. for 20 min, and washed with 1×PBS for three times, each time for 5 min. Then 2 ml 1% BSA-PBS solution was added into each well, placed in a shaker, and incubated for 1 h. After the supernatant was discarded, human adenovirus type 5 fluorescent antibody (1:500 dilution) was added and incubated for 1 h, followed by washing with 1×PBS for three times, 5 min each time.
RCA was calculated using the equation as observed under a 10-fold fluorescence microscope
The judging standard was that the level of RCA was less than 1RCA/3×1010 vp. According to statistics, the RCA level of pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin was less than 1RCA/3×1010 vp, which indicates that the replication-defective pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus prepared by the invention can be stably packaged in 293TD37 cells and cannot be converted into wild type or the probability of conversion into wild type was low.
The 293TD37 cells were prepared one day in advance and placed in a 12-well cell culture plate. The 293TD37 cells were infected with the African swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin virus. The cells became diseased 48 hours later, and 1 ml of cells was collected. The cells were washed with PBS, and samples were prepared for Western Blot detection. The target protein was detected using our EP153R mouse antiserum, which was obtained by immunizing mice with EP153R protein expressed systemically in E. coli. The size of the EP153R protein was 15kda. The experimental results were shown in
At the same time, the target protein was detected by our EP153R mouse antiserum, which was obtained by immunizing mice with EP153R protein expressed systematically in E. coli. The size of the EP153R protein was 15 kda.
Twenty SPF-grade mice (6-8 weeks of age) were randomly divided into four groups, five for each group. Mice were immunized with pAd5LCL3-EP 402R-EP 153R-I177L-K205Rubiqutin according to the groupings shown in Table 7. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
Blood was collected from the mice 14 days after immunization, serum was isolated, and IgG antibody titers against the African swine fever target protein EP402R (obtained after our company prepared and immunized the mice in insect cells) in serum were detected by indirect ELISA. The test results were shown in
Ten SPF-grade mice (6-8 weeks of age) were randomly divided into two groups, five for each group. Mice were immunized with pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin according to the groupings shown in Table 8. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
The mice were sacrificed 14 days after immunization, and the splenic lymphocytes were isolated. PK15 cells transfected with the shuttle plasmids pSE1-EP402R-IRES-EP153R and pSE4-I177L-2A-K205Rubiqutin were stimulated for 6 hours and protein secretion blockers were added to block cytokine secretion. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after the cells were fixed and perforated. Cell surface markers included CD4 and CD8, and intracellular cytokines included IFNγ and IL2. The expression levels of IFNγ and IL2 in CD4+T cells and CD8+T cells stimulated by the target protein were analyzed by flow cytometry (CyExpert).
pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin induced CD8+T cell and CD4+T cell immune response was shown in
The recombinant adenovirus pAd5LCL3-EP402R-EP153R-I177L-K205Rubiqutin was immunogenic and induced high levels of serum IgG antibodies in mice. High doses of 1*108 FFU and medium doses of 1*107 FFU resulted in high immunologically induced titers. The results of cellular immune response showed that intramuscular injection of the adenovirus vector vaccine of 1*107FFU could induce specific cellular immune response in the immunized mice.
1. Construction of human adenovirus type 5 vector E1 region shuttle plasmid
The human adenovirus type 5 vector E1 region shuttle plasmid pS5E1 was successfully constructed according to the method provided in Example 4.
2. Construction of shuttle plasmid pSSE1-F317L-IRES-A151R of African swine fever human adenovirus type 5 vector
1) ligation of pS5E1 to the IRES fragment
pS5E1-IRES was successfully constructed according to the method provided in Example 4.
2) ligation of pS5E1-IRES to F317L fragment
{circle around (1)} primer synthesis
{circle around (2)} PCR amplification of F317L fragment
Amplification system: 25 ul of Q5 enzyme, 1 uL of 10 uM primer F317L-BamHI-F, 1 uL of 10 uM primer F317L-EcoRVR, 1 uL of template F317L, and water supplementing to 50 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min.
{circle around (3)} The F317L fragment was purified by Axygen™ PCR purification kit.
{circle around (4)} The target fragment F317L was digested with pSSE1-IRES vector
Enzyme digestion reaction system: vectors pSSE1-IRES, F317L fragment ˜2 ug, BamHI and EcoRV 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the digested product was shown in
{circle around (5)} The target fragment F317L was connected with pSSE1-IRES
Ligation system: PSSE1-IRES (100 ng); F317L fragment (vector:fragment=1: 3 molar ratio); T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: Q5 enzyme 10 ul, 10 uM primer F317L-BamHI-F 1 uL, 10 uM primer IRES-NotI-R 1 ul, and supplementing water to 20 ul. PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min. Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid digestion verification (BamHI and EcoRV), 9 and 10 colonies were selected for plasmid extraction and digestion verification. The results were as shown in
3) ligation of pS5E1-F317L-IRES to fragment A151R
{circle around (1)} primer synthesis
{circle around (3)} PCR amplification of A151R fragment
Amplification system: 25 ul of Q5 enzyme, 1 μL of primer A151R-NotI-F, 1 μL of primer A151R-6 His-XHOI-R, and 50 ul; of template A151R; Reaction condition: 98° C. for 30 s; 98° C. for 10 s, 68° C. for 30 s, 72° C. for 30 s, 35 cycles; 72° C. 5 min.
{circle around (3)} The A151R fragment was purified by an Axygen™ PCR purification kit.
{circle around (4)} The target fragment A15IR was digested with pSSE1-F317L-IRES vector
Enzyme digestion reaction system: vectors pSSE1-F317L-IRES, A151R fragment ˜2 ug, NotI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification of gum. The electrophoresis detection of the enzyme digestion product was shown in
{circle around (5)} pS5E1-F317L-IRES vector was connected with A151R fragment
Linkage system: pS5E1-F317L-IRES 100 ng; A151R fragment 50 ng; T4 DNA ligase 1 ul; 10×ligase buffer 1 ul; Replenish water to 10 ul. Reaction condition: room temperature, 30 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
{circle around (6)} colony PCR
Amplification system: Q5 enzyme 10 ul, 10 uM primer IRES-EcoRV-F 1 ul, 10 uM primer A151R-6His-XhoI-R 1 ul, and water supplement to 20 ul; PCR program: 98° C., 10 s; 98° C., 5s, 60° C., 30s, 72° C., 20s, 35 cycles; 72° C., 5 min; Electrophoresis verification was performed as shown in
{circle around (7)} Plasmid digestion verification of BamHI and XhoI: The colonies of 4, 15, 23 and 24 were selected for plasmid extraction and digestion verification. The results were shown in
1. human adenovirus type 5 vector E4 region shuttle plasmid construction
The human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-EGFP was successfully constructed according to the method provided in Example 5.
2. Construction of African swine fever human adenovirus type 5 vector E4 region shuttle plasmid pS5E4-P34-2A-pp62
1) primer design
2) amplifying the target fragments P34, 2A and pp62
{circle around (1)} A The P34 fragment was amplified using the P34 gene synthetic fragment as the template and EF1α-BamHI-P34-F and P34-2A-R as the primers; Amplification system: P34 gene synthetic fragment 50 ng, 10 uM EF1α-BamHI-P34-F primer 1 ul, 10 uM P34-2A-R primer 1 ul, Q5 high-fidelity enzyme 20 ul; Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
{circle around (2)} The synthetic fragment of 2A gene was used as the template, and P34-2A-F and 2A-pp62-R were used as the primers to amplify the 2A fragment; Amplification system: synthetic fragment of 2A gene (50 μg), 10 μM p34-2A-F primer (1 ul), 10 μM 2A-PP62-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul); Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 20 sec, 35 cycles; 72° C., 5 min.
{circle around (3)} The synthetic fragment of pp62 gene was used as the template and pp62-F and pp62-XhoI-pS5E4-R as the primers to amplify fragment 2A; Amplification system: synthetic fragment of pp62 gene (50 μg), 10 μM PP62-F primer (1 ul), 10 μM PP62-XhoI-pS5E4-R primer (1 ul), and Q5 high-fidelity enzyme (20 ul). Replenish water to 40 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min.
The electrophoretic detection of the PCR product was shown in
3) The target fragment was purified by an Axygen™ gel extraction kit.
4) Amplifying P34-2A fragments by fusion PCR
Amplification system: 50 ng of recovered fragment of P34 gel, 50 ng of recovered fragment of 2A gel, 1 ul of 10 μM EF1α-BamHI-p34-F primer, 1 ul of 10 μM 2A-PP62-R primer, and 25 ul; of Q5 high-fidelity enzyme; Replenish water to 50 ul; PCR procedure: 98° C., 10 sec; 98° C., 5 sec, 60° C., 30 sec, 72° C., 40 sec, 35 cycles; 72° C., 5 min. The fusion results were shown in
5) Enzyme digestion with pS5E4-EGFP vector
Enzyme digestion reaction system: vector pS5E4-EGFP 2 ug, BamHI and XhoI 1 uL each; 10×cutsmart buffer 5 ul; Replenish water to 50 ul. Reaction condition: 37° C., 30 min; Inactivated at 65° C. for 20 min. Recovery and purification.
6) purifying the vector fragment by an Axygen™ gel extraction kit;
The gel recovery results were shown in
7) seamless clone connection and transformation of pS5E4-EGFP glue recovery vector with P34-2A fragment and pp62
Ligation system: pS5E4-EGFP gel recovery (100 ng), P34-2A fragment (50 ng), pp62 fragment (50 ng), 2×Smealess Cloning Mix 5 ul, replenished to 10 ul. Reaction condition: 50° C., 40 min. The ligated products were transformed into DH5α competent cells, plated on plates containing ampicillin resistance and incubated at 37° C. for 12-16 hours.
8) plasmid validation
{circle around (1)} colony PCR
Using EF1α2(d)-F and HBV(jd)-R as primers, the target fragment was amplified by colony PCR and verified by agarose gel assay, as shown in
{circle around (2)} enzyme digestion verification
The No. 1, No. 2, No. 9 and No. 11 positive clone were picked and place in 5 mL LB liquid medium containing ampicillin resistance for culture for 12-15 hours, and plasmids were extract for double enzyme digestion verification of BmHI and XhoI; The enzyme digestion results were shown in
1. Autologous recombination of shuttle plasmid pSSE1-F317L-IRES-A151R and adenovirus vector plasmid pAd5LCL3
1) PacI and SwaI perform enzyme digestion on the shuttle plasmid pS5E1-F317L-IRES-A151R and the adenovirus vector plasmid pAd5LCL3, and the enzyme digestion reaction system was as follows:
A, the shuttle plasmid pSSE1-F317L-IRES-A151R3 s g; PacI 2 μl; buffer cutsmart 4 μl; Replenish water to 40 μl.
B, adenovirus vector plasmid pAd5LCL3 3 ug; SwaI 2 μl; Buffer 3.1 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation and the results were shown in
2) dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) The colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) The No. 3 positive plasmid was converted into DH5α competent state, a colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI enzyme digestion verification again. The enzyme digestion result was shown in
2. Autologous recombination of shuttle plasmid pS5E4-P34-2A-pp62 and adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R to obtain pAd5LCL3-F317L-A151R-P34-PP62
1) PacI and I-sceI perform enzyme digestion on shuttle plasmid pS5E4-P34-2A-pp62 and adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R, and the enzyme digestion reaction system was as follows:
A. Shuttle plasmid PS5E4-P34-2A-PP623p g; PacI 2 μl; 10×cutsmart buffer 4 μl; Replenish water to 40 μl.
B, adenovirus vector plasmid pAd5LCL3-F317L-IRES-A151R3 ug; I-sceI 2 μl; Buffer cutsmart 4 μl; Replenish water to 40 μl.
Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 20 min.
2 ul of agarose gel was used for validation and the results were shown in
2) dephosphorylation of that enzyme digestion product
Reaction system: 37.5 μL enzyme digestion reaction solution; 1 μL dephosphorylase; Dephosphorylated buffer 5 μL; Refill water to 50 μL. Reaction condition were 37° C. for 1 h; Inactivated at 65° C. for 5 min.
3) Use OMEGA Ultra-Sep Gel Extraction Kit to recover the vectors and fragments.
4) 100 ng of the purified shuttle plasmid and 100 ng of the purified adenovirus vector were co-transformed into BJ5183 competent cells, and the transformed product was coated with an LB plate containing Kan and cultured at 37° C. for 12-16 h.
5) Six colonies were selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmids were extracted for XhoI enzyme digestion verification. The results were shown in
6) transform that No. 2 positive plasmid into DH5α competence; One colony was selected and cultured in 5 mL LB liquid medium containing Kan under shaking at 37° C. for 12-16 h, and the plasmid was extracted for XhoI restriction enzyme digestion verification again. The enzyme digestion result was shown in
Package the pAd5LCL3-F317L-A151R-P34-pp62 plasmid with 293TD37 cells as follows:
Preparation of 293TD37 cells: The cells were prepared one day before transfection. The 293TD37 cells to be transfected were inoculated into a 6-well plate at 0.5×106/well, and incubated at 37° C. with 5% CO2 for 24 hours. On the day of transfection, the cells showed 40-50% confluency.
Linearization of plasmid pAd5LCL3-F317L-A151R-P34-pp62: The plasmid to be transfected was digested with PacI enzyme, incubated at 37° C. for 40 min, and inactivated at 65° C. for 20 min.
Transfection: The linearized 2 pg plasmid and PEI were diluted with 100 μl serum-free medium, respectively. The plasmid diluent was added into the PEI diluent, and repeatedly aspirated for 5 times or vortexed for 10 seconds to be mixed evenly, and incubated for 10 minutes at room temperature to form a transfection complex. During incubation, cell culture medium was gently aspirated from the plates, 2 mL of fresh growth medium was added, and after 10 minutes the transfection complex was added to the cells in fresh medium.
Cell culture: the transfected 293TD37 cells were incubated at 37° C. for 72-96 hours in a 5% CO2 incubator; 6-well plate cell suspensions were collected in 1.5 ml centrifuge tubes, TP0, 72-96 hours after viral plasmid transfection.
Continuous inoculation: The collected cell suspension was repeatedly frozen and thawed at −80° C. for 3 times, centrifuged at 2000 g for 10 minutes at 4 C, and 500 μl of supernatant was collected to infect 293TD37 cells (293TD37 cells need to be prepared one day in advance). The cells were incubated at 37° C. with 5% CO2for 60 minutes, followed by the addition of 2 mL of FBS medium, followed by culture at 37° C. with 5% CO2 for 72 hours, and the cell suspension, namely TP1, was collected. The previous steps were repeated and the cell suspension, TP2, was collected. The drug was continued until the cells became diseased.
Cytopathic effect: When the 293TD37 cells were cultured from TP0 to TP4, the cells gradually became diseased until the 293TD37 cells were completely diseased at TP4. The cytopathic effects caused by TP0 to TP4 were shown in
The 293TD37 cells were prepared. The cells with good growth in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin, and then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, which was then blown, mixed, inoculated into 6-well plates (5×105/mL, 2 ml per well), and allowed to stand for culture in a 37° C. 5% CO2 incubator. After 24 hours, when the cells adhered to grow into single-layer cells, the culture medium was discarded, and the recombinant adenovirus was continuously diluted 103 to 106 times with serum-free DMEM maintenance solution, and two wells were inoculated with each dilution degree at 250 uL per well. After one hour of infection, the supernatant was discarded to supplement the complete culture medium, and then the medium was allowed to stand for culture in a 5% carbon dioxide incubator at 37° C. After 24 h, the supernatant was discarded and the cells were washed with PBS (1 mL per well). After PBS was discarded, 1 mL of cold formaldehyde was added into each well for fixation, and formaldehyde was discarded at room temperature for 10 min. Then the cells were washed with PBS (1 mL per well), followed by adenovirus antibody-FITC (1 ml per well). After 1 h at room temperature, the cells were washed with PBS again (1 mL per well). After two times, 1 mL of PBS was added into each well and counted under fluorescence microscope (200 times, 10 continuous fields). Calculation: Virus titer (FFU/mL)=Mean×1013×4×10(−n). The FFU of the pAd5LCL3-F317L-A151R-P34-PP62 virus was 2.4×108FFU/mL, with a high titer.
The 293TD37 cells were prepared. The cells that grew well in T75 culture flask were taken, the supernatant was discarded, the cells were washed with PBS, and digested with 0.25% trypsin. Then 10 mL of fresh DMEM medium containing 10% fetal bovine serum was added to stop the digestion, and then the cells were blown and mixed evenly. The 293TD37 cells were planted into 6-well plates (5×105 cells/mL, 2 mL/well), incubated for 1 hour at room temperature to adhere to the wall, and incubated for microscopic observation of its attachment degree. pAd5LCL3-F317L-A151R-P34-pp62 virus particles were used for infection, and the titer of infection was 5 MOI/well. After the 293TD37 cells developed lesions 48 hours later, the cells were collected, repeatedly frozen and thawed for three times, and then centrifuged at 2000 g; the collected supernatant was detected for FFU, and then new 293TD37 cells were reinfected until the 30th generation. The collected virus solutions of passages 5, 10, 15, 20, 25 and 30 were tested, and the genome of the virus was found to be still intact, indicating that the replication-defective pAd5LCL3-F317L-A151R-P34-pp62 virus could be stably packaged in 293TD37 cells.
PAd5LCL3-F317L-A151R-P34-pp62 virus RCA detection, detection method was as follows:
1. Prepare pAd5LCL3-F317L-A151R-P34-pp62 virus solution, measure its virus titer and determine the concentration of virus particles. The virus solution was mixed with 1% Universal Nuclease (7.5-15 units/mL virus solution) to digest the DNA of the host cell, and water-bath was conducted at 37° C. for 40 min. Using a 300Kd ultrafiltration centrifuge tube, the virus particles were collected after centrifugation at 1000 g for 30 min, followed by elution with 1×PBS. A260 was measured, and the particle concentration=A260*1.1*1012 VP/mL.
2. Virus infection: A 6-well plate of A549 cells was prepared, with each well cell being 2.5×105/well. The medium was discarded and washed with PBS once. Adenovirus was inoculated with virus at 1×109 vp/well to infect A549 cells. Wild-type human adenovirus type 5 was used as the control at 37° C. and 5% CO2. After 1 h, the virus solution was discarded and supplemented with 5% complete medium. The cells were cultured at 37° C. and 5% CO2 for 48 h.
3. Immunostaining was performed, and the cell supernatant was discarded. The cells were surface washing-plated with PBS and fixed with iced methanol. The cells were placed at −20° C. for 20 min and washed by 1×PBS for three times, each time for 5 min. Then 2 ml 1% BSA-PBS solution was added into each well, and the cells were placed in a shaking table for incubation for 1 h. After the supernatant was discarded, human adenovirus type 5 fluorescent antibody (1:500 dilution) was added and incubated for 1 h, followed by washing with 1×PBS for three times, 5 min each time.
RCA was calculated using the equation as observed under a 10-fold fluorescence microscope
The judging standard was that the level of RCA was less than 1RCA/3×1010 vp. Through counting that the RCA level of the pAd5LCL3-F317L-A151R-P34-PP62 was less than 1 RCA/3*1010 VP, the replication-defective pAd5LCL3-F317L-A151R-P34-PP62 virus prepared by the invention can be stably packaged in 293TD37 cells and was not converted into wild type or has low probability of being converted into wild type.
The 293TD37 cells were prepared one day in advance and placed in a 12-well cell culture plate. The 293TD37 cells were infected with the African swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 virus, and the cells became diseased 48 hours later. All 1 ml of cells were collected, washed with PBS, and prepared for Western Blot detection. The target protein was detected by self-made pp62 mouse antiserum. The pp62 mouse antiserum was obtained by immunizing mice with pp62 protein expressed by the insect SF9 system. The size of pp62 protein was 60 kda.
The experimental results were shown in
Example 49 immunologic evaluation of african swine fever multiantigen recombinant adenovirus vaccine pAd5LCL3-F317L-A151R-P34-pp62 in a murine model
Twenty SPF-grade mice (6-8 weeks of age) were randomly divided into four groups, five for each group.
Mice were immunized with pAd5LCL3-F317L-A151R-P34-PP62 according to the groupings shown in Table 9. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
Blood was collected 14 days after immunization, and the serum was isolated. The titer of pp62 antibody against the African swine fever target protein (pp62 protein prepared by us and expressed in insect cells) was detected by indirect ELISA. The test results were shown in
Ten SPF-grade mice (6-8 weeks of age) were randomly divided into two groups, five for each group. Mice were immunized with pAd5LCL3-F317L-A151R-P34-PP62 according to the groupings shown in Table 10. The injection method was as follows: intramuscular injection was performed on the medial aspect of the posterior thigh. Injection dose: 100 ul.
The mice were sacrificed 14 days after immunization, and the splenic lymphocytes were isolated. PK15 cells transfected with the shuttle plasmids pS5E1-P72-IRES-B602L and pS5E4-P30-2A-P54 were stimulated and cultured for 6 hours, while protein secretion blockers were added to block cytokine secretion. After 6 hours, Fc receptors were blocked, dead cells and cell surface molecular markers were stained, and intracellular cytokines were stained after the cells were fixed and perforated. Cell surface markers included CD4 and CD8, and intracellular cytokines included IFNγ and IL2. The expression levels of IFNγ and IL2 in CD4+T cells and CD8+T cells stimulated by the target protein were analyzed by flow cytometry (CyExpert).
The CD8+T cell and CD4+T cell immune responses induced by pAd5LCL3-P72-B602L-P30-P54 were shown in
PAd5LCL3-F317L-A151R-P34-pp62 recombinant adenovirus has strong immunogenicity and can induce mice to produce high levels of serum IgG antibodies. High doses of 1*108 FFU and medium doses of 1*107 FFU resulted in high immunologically induced titers. The results of cellular immune response test showed that intramuscular injection of the adenovirus vector vaccine of 1*107FFU could induce specific cellular immune response in the immunized mice.
Although the present invention has been disclosed as above, the present invention was not limited thereto. Various changes and modifications may be made by those skilled in the art without departing from the spirit and scope of the present invention, and the scope of the present invention should be determined by the scope of the appended claims.
| Number | Date | Country | Kind |
|---|---|---|---|
| 202010642744.9 | Jul 2020 | CN | national |
| 202010642745.3 | Jul 2020 | CN | national |
| 202010642753.8 | Jul 2020 | CN | national |
| 202010642754.2 | Jul 2020 | CN | national |
| 202010642755.7 | Jul 2020 | CN | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/CN2021/104793 | 7/6/2021 | WO |
