Patent Grant
10323235
This invention relates to the field of molecular and protein biology including polypeptides and modified polypeptides. This application also relates to the field of protein purification. The present invention also relates generally to the field of protein preparation, protein recovery and protein purification.
Inteins are naturally occurring, self-splicing protein subdomains that are capable of excising out their own protein subdomain from a larger protein structure while simultaneously joining the two formerly flanking peptide regions (“exteins”) together to form a mature host protein.
The interesting behavior of inteins has led to an emerging area of research regarding the structural, mechanistic, and biological features of inteins. For instance, a variety of x-ray crystal structures, computational models, and mutational studies have led to a general consensus that inteins are distinct from common proteolytic enzymes in that they do not degrade peptide bonds other than the two bonds linking the intein to the flanking “exteins.” This is highly useful because unwanted proteolytic damage to other proteins is mitigated when inteins are used as transient coupling elements within fusion proteins.
What is needed is a method for selectively and reversibly inactivating an intein. Such an approach could allow for affinity based purification of a wide variety of proteins. The availability of such a generic protein recovery and purification system would have significant applications in the areas of rapid anti-infectious disease vaccine manufacture, bioterrorism defense, and personalized anti-cancer antigen generation, as well as contributing to the acceleration of new drug evaluation and optimization.
Disclosed herein are polypeptides, compositions, and methods of making and use of said polypeptides and compositions.
A critical application of inteins has been the development of self-cleaving affinity tags for protein purification. In these applications, the inteins are modified to exhibit isolated cleaving of the intein-extein bonds at either their N- or C-terminus, or both. By replacing one extein with an affinity tag, and the other extein with a desired target protein, the target protein can be easily purified by the tag, where tag removal is subsequently facilitated by the intein self-cleaving activity. Critical to this application, however, is the ability to suppress cleaving during expression of the tagged target protein, but induce rapid self-cleaving of the intein from the purified target protein. This ability had proven elusive, and is critical to the application of inteins to general protein purification methods of using affinity tags for protein purification. In this case critical application of inteins has been the development of self-cleaving activity.
Disclosed herein are modified peptides comprising a controllable intervening protein sequence (CIPS) wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein.
Also disclosed herein are modified peptides comprising a CIPS wherein the modified peptides comprise the structure: X1-CIPS-X2, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein, and wherein X2 comprises a protein of interest.
Disclosed herein are controllable intervening protein sequences (CIPSs) comprising an intein and a reversible zinc-binding motif wherein the reversible zinc-binding motif comprises the structure: aa1-aa2-aa3-aa4, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid and aa4 is a positively charged amino acid.
Disclosed herein are CIPSs comprising an intein and a reversible zinc-binding motif wherein the reversible zinc-binding motif comprises the structure: aa1-aa2-aa3-aa4-aa5, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid, aa4 is a positively charged amino acid and aa5 is a non-polar amino acid.
Disclosed herein are isolated nucleic acids capable of encoding the peptides or CIPSs disclosed herein as well as plasmids, vectors, and cell lines comprising nucleic acids capable of encoding the peptides or CIPSs disclosed herein.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: preparing a nucleic acid that encodes one or more peptides comprising a CIPS; transforming a host cell with the nucleic acid; and culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid. Such methods can further comprise isolating the modified peptide comprising a CIPS.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: preparing a nucleic acid that encodes one or more peptides comprising a CIPS; transforming a host cell with the nucleic acid; and culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid and further comprising exposing the modified peptide comprising the CIPS to a chemical reagent which inhibits splicing or cleavage.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: preparing a nucleic acid that encodes one or more peptides comprising a CIPS; transforming a host cell with the nucleic acid; and culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid and further comprising exposing the modified peptide to a chelating agent, a change in pH, a change in temperature, dialysis, or dilution.
Disclosed herein are methods of producing a protein of interest comprising: (a) preparing a nucleic acid that encodes a modified peptide comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS-X2, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein, and wherein X2 comprises the protein of interest; (b) transforming a host cell with the nucleic acid; (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide; (d) exposing the modified peptide to a concentration of zinc which inhibits splicing or cleavage by the CIPS; (e) isolating the modified peptide; and (f) removing the zinc, thereby allowing for splicing or cleavage of the protein of interest from the modified peptide, thereby producing the protein of interest.
Disclosed herein are methods for binding and eluting a phage-displayed polypeptide from a protein of interest comprising: producing a modified peptide comprising the structure X1-CIPS-X2 wherein X1 is an affinity tag, and wherein X2 is a protein of interest; binding the modified peptide to a solid support; contacting a phage-displayed polypeptide with the support-bound modified peptide, thereby permitting binding of the phage-displayed polypeptide with the modified peptide comprising the CIPS; removing unbound phage-displayed polypeptides; and eluting the bound phage-displayed polypeptide by inducing cleavage of the protein of interest by the CIPS.
Disclosed are kits comprising the peptides, vectors, nucleic acids or cells as disclosed herein. The disclosed kits can further comprise zinc.
While aspects of the present invention can be described and claimed in a particular statutory class, such as the system statutory class, this is for convenience only and one of skill in the art will understand that each aspect of the present invention can be described and claimed in any statutory class. Unless otherwise expressly stated, it is in no way intended that any method or aspect set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not specifically state in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, or the number or type of aspects described in the specification.
The accompanying figures and drawings, which are incorporated in and constitute a part of this specification, illustrate several aspects and together with the description serve to explain the principles of the invention. These are non-limiting examples.
Additional advantages of the disclosed compositions and methods will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
All patents, patent applications, and publications cited herein, whether supra or infra, are hereby incorporated by reference in their entireties into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.
It is to be understood that this invention is not limited to specific synthetic methods, or to specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, to specific pharmaceutical carriers, or to particular pharmaceutical formulations or administration regimens, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art.
As used in the specification and the appended claims, the singular forms “a,” “an” and “the” can include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes mixtures of compounds, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.
Ranges may be expressed herein as from “about” one particular value, and/or to “about” another particular value. The term “about” is used herein to mean approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” is used herein to modify a numerical value above and below the stated value by a variance of 20%. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
As used herein, the term “amino acid sequence” refers to a list of abbreviations, letters, characters or words representing amino acid residues. The amino acid abbreviations used herein are conventional one letter codes for the amino acids and are expressed as follows: A, alanine; C, cysteine; D aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; H histidine; I isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine.
“Peptide” as used herein refers to any peptide, oligopeptide, polypeptide, gene product, expression product, or protein. A peptide is comprised of consecutive amino acids. The term “peptide” encompasses naturally occurring or synthetic molecules.
In addition, as used herein, the term “peptide” refers to amino acids joined to each other by peptide bonds or modified peptide bonds, e.g., peptide isosteres, etc. and may contain modified amino acids other than the 20 gene-encoded amino acids. The peptides can be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Modifications can occur anywhere in the peptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. The same type of modification can be present in the same or varying degrees at several sites in a given polypeptide. Also, a given peptide can have many types of modifications. Modifications include, without limitation, linkage of distinct domains or motifs, acetylation, acylation, ADP-ribosylation, amidation, covalent cross-linking or cyclization, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphatidylinositol, disulfide bond formation, demethylation, formation of cysteine or pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pergylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and transfer-RNA mediated addition of amino acids to protein such as arginylation. (See Proteins—Structure and Molecular Properties 2nd Ed., T. E. Creighton, W.H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pp. 1-12 (1983)).
As used herein, “isolated peptide” or “purified peptide” is meant to mean a peptide (or a fragment thereof) that is substantially free from the materials with which the peptide is normally associated in nature. The peptides disclosed herein, or fragments thereof, can be obtained, for example, by extraction from a natural source (for example, a mammalian cell), by expression of a recombinant nucleic acid encoding the peptide (for example, in a cell or in a cell-free translation system), or by chemically synthesizing the peptide. In addition, peptide fragments may be obtained by any of these methods, or by cleaving full length proteins and/or peptides.
The word “or” as used herein means any one member of a particular list and also includes any combination of members of that list.
The phrase “nucleic acid” as used herein refers to a naturally occurring or synthetic oligonucleotide or polynucleotide, whether DNA or RNA or DNA-RNA hybrid, single-stranded or double-stranded, sense or antisense, which is capable of hybridization to a complementary nucleic acid by Watson-Crick base-pairing. Nucleic acids of the invention can also include nucleotide analogs (e.g., BrdU), and non-phosphodiester internucleoside linkages (e.g., peptide nucleic acid (PNA) or thiodiester linkages). In particular, nucleic acids can include, without limitation, DNA, RNA, cDNA, gDNA, ssDNA, dsDNA or any combination thereof.
As used herein, “isolated nucleic acid” or “purified nucleic acid” is meant to mean DNA that is free of the genes that, in the naturally-occurring genome of the organism from which the DNA of the invention is derived, flank the gene. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector, such as an autonomously replicating plasmid or virus; or incorporated into the genomic DNA of a prokaryote or eukaryote (e.g., a transgene); or which exists as a separate molecule (for example, a cDNA or a genomic or cDNA fragment produced by PCR, restriction endonuclease digestion, or chemical or in vitro synthesis). It also includes a recombinant DNA which is part of a hybrid gene encoding additional polypeptide sequences. The term “isolated nucleic acid” also refers to RNA, e.g., an mRNA molecule that is encoded by an isolated DNA molecule, or that is chemically synthesized, or that is separated or substantially free from at least some cellular components, for example, other types of RNA molecules or peptide molecules.
As used herein, “extein” refers to the portion of an intein-modified protein that is not part of the intein and which can be spliced or cleaved upon excision of the intein.
“Intein” refers to an in-frame intervening sequence in a protein. An intein can catalyze its own excision from the protein through a post-translational protein splicing process to yield the free intein and a mature protein. An intein can also catalyze the cleavage of the intein-extein bond at either the intein N-terminus, or the intein C-terminus, or both of the intein-extein termini. As used herein, “intein” encompasses mini-inteins, modified or mutated inteins, and split inteins.
As used herein, “protein of interest” or “peptide of interest” is a protein or peptide sought to be produced, made or purified. A protein or peptide of interest can be attached to an intein in one or more of the peptides disclosed herein comprising a CIPS. A “peptide of interest” can be a protein, such as an enzyme. The terms “protein of interest” and “peptide of interest” can be used interchangeably throughout the specification.
As used herein, “zinc-sensitive” means that a given peptide is responsive to or influenced by the presence of zinc. For example, a “zinc-sensitive” intein responds differently in the presence of zinc than in the absence of zinc.
As used herein, “variant” refers to a molecule that retains a biological activity that is the same or substantially similar to that of the original sequence. The variant may be from the same or different species or be a synthetic sequence based on a natural or prior molecule. Moreover, as used herein, “variant” refers to a molecule having a structure attained from the structure of a parent molecule (e.g., a protein or peptide disclosed herein) and whose structure or sequence is sufficiently similar to those disclosed herein that based upon that similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities compared to the parent molecule. For example, substituting specific amino acids in a given peptide can yield a variant peptide with similar activity to the parent.
Nucleic acids, nucleotide sequences, proteins or amino acid sequences referred to herein can be isolated, purified, synthesized chemically, or produced through recombinant DNA technology. All of these methods are well known in the art.
As used herein, the terms “modified” or “mutated,” as in “modified intein” or “mutated intein,” refer to one or more modifications in either the nucleic acid or amino acid sequence being referred to, such as an intein, when compared to the native, or naturally occurring structure. Such modification can be a substitution, addition, or deletion. The modification can occur in one or more amino acid residues or one or more nucleotides of the structure being referred to, such as an intein.
As used herein, the term “modified peptide”, “modified protein” or “modified protein of interest” or “modified target protein” refers to a protein which has been modified. For example a modified peptide can be a peptide modified by the insertion of a CIPS. A modified peptide can also comprise a CIPS as well as a protein of interest and/or an affinity tag.
As used herein, “operably linked” refers to the association of two or more biomolecules in a configuration relative to one another such that the normal function of the biomolecules can be performed. In relation to nucleotide sequences, “operably linked” refers to the association of two or more nucleic acid sequences, by means of enzymatic ligation or otherwise, in a configuration relative to one another such that the normal function of the sequences can be performed. For example, the nucleotide sequence encoding a pre-sequence or secretory leader is operably linked to a nucleotide sequence for a polypeptide if it is expressed as a pre-protein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence; and a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation of the sequence.
“Sequence homology” can refer to the situation where nucleic acid or protein sequences are similar because they have a common evolutionary origin. “Sequence homology” can indicate that sequences are very similar. Sequence similarity is observable; homology can be based on the observation. “Very similar” can mean at least 70% identity, homology or similarity; at least 75% identity, homology or similarity; at least 80% identity, homology or similarity; at least 85% identity, homology or similarity; at least 90% identity, homology or similarity; such as at least 93% or at least 95% or even at least 97% identity, homology or similarity. The nucleotide sequence similarity or homology or identity can be determined using the “Align” program of Myers et al. (1988) CABIOS 4:11-17 and available at NCBI. Additionally or alternatively, amino acid sequence similarity or identity or homology can be determined using the BlastP program (Altschul et al. Nucl. Acids Res. 25:3389-3402), and available at NCBI. Alternatively or additionally, the terms “similarity” or “identity” or “homology,” for instance, with respect to a nucleotide sequence, are intended to indicate a quantitative measure of homology between two sequences.
Alternatively or additionally, “similarity” with respect to sequences refers to the number of positions with identical nucleotides divided by the number of nucleotides in the shorter of the two sequences wherein alignment of the two sequences can be determined in accordance with the Wilbur and Lipman algorithm. (1983) Proc. Natl. Acad. Sci. USA 80:726. For example, using a window size of 20 nucleotides, a word length of 4 nucleotides, and a gap penalty of 4, and computer-assisted analysis and interpretation of the sequence data including alignment can be conveniently performed using commercially available programs (e.g., Intelligenetics™ Suite, Intelligenetics Inc. CA). When RNA sequences are said to be similar, or have a degree of sequence identity with DNA sequences, thymidine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence. The following references also provide algorithms for comparing the relative identity or homology or similarity of amino acid residues of two proteins, and additionally or alternatively with respect to the foregoing, the references can be used for determining percent homology or identity or similarity. Needleman et al. (1970) J. Mol. Biol. 48:444-453; Smith et al. (1983) Advances App. Math. 2:482-489; Smith et al. (1981) Nuc. Acids Res. 11:2205-2220; Feng et al. (1987) J. Molec. Evol. 25:351-360; Higgins et al. (1989) CABIOS 5:151-153; Thompson et al. (1994) Nuc. Acids Res. 22:4673-480; and Devereux et al. (1984) 12:387-395. “Stringent hybridization conditions” is a term which is well known in the art; see, for example, Sambrook, “Molecular Cloning, A Laboratory Manual” second ed., CSH Press, Cold Spring Harbor, 1989; “Nucleic Acid Hybridization, A Practical Approach”, Hames and Higgins eds., IRL Press, Oxford, 1985; see also
The terms “plasmid” and “vector” and “cassette” refer to an extra chromosomal element often carrying genes which are not part of the central metabolism of the cell and usually in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear or circular, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3′ untranslated sequence into a cell. Typically, a “vector” is a modified plasmid that contains additional multiple insertion sites for cloning and an “expression cassette” that contains a DNA sequence for a selected gene product (i.e., a transgene) for expression in the host cell. This “expression cassette” typically includes a 5′ promoter region, the transgene ORF, and a 3′ terminator region, with all necessary regulatory sequences required for transcription and translation of the ORF. Thus, integration of the expression cassette into the host permits expression of the transgene ORF in the cassette.
Controllable Intervening Protein Sequences
A variety of intein-mediated, affinity tagged intein systems are known in the art but critically suffer from a lack of a sufficient or industrially convenient control approach for the self-release step. Previous approaches have relied on pH or temperature as a triggering mechanism for the activation of intein self-cleavage, but these schemes require expression conditions that are not suitable for commercially relevant mammalian cell culture expression systems. Furthermore, these triggering mechanisms have historically suffered from premature intein activation, lengthened process time due to low temperature growth, incompatibility with certain naturally occurring protein bonds, and suboptimal target protein yields. These deficiencies have limited the practical application of inteins and as a consequence, the promise of the technology has not been fully realized.
Current self-cleaving intein systems fall into two categories: N-terminal cleaving systems, which require high concentrations of thiol compounds to induce cleaving, and C-terminal cleaving inteins, which are controlled by pH and temperature. N-terminal cleaving inteins cannot be used with target proteins that contain disulfide bonds due to the tendency of thiol compounds to break these bonds and destroy the target. C-terminal cleaving inteins are plagued with premature cleaving problems, where the tag self-cleaves before the target can actually be purified. These two limitations have effectively prevented intein technology from being applied to proteins expressed in mammalian cells, and these proteins comprise a large and growing majority of biopharmaceuticals.
Previously, inteins were engineered through the application of directed evolution methods. One of these inteins, derived from the Mtu-RecA intein, commonly referred to as the ΔI-CM mini intein, was optimized to obtain 1) a small physical size, 2) significant cleaving activity, and 3) selective activation under modulated solution temperature and pH conditions. The ΔI-CM intein (
Disclosed herein are controllable intervening protein sequences (CIPS), which comprise an intein engineered to possess an appended (or internal) zinc-binding control sub-domain (also referred to herein as a “zinc-binding motif,” or “ZBM”). These CIPS can be used to modify or in modified peptides and are useful for a variety of methods including, but not limited to, protein production and purification. For example, disclosed herein are modified peptides comprising a CIPS. Also disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein.
Disclosed herein are modified peptides comprising a CIPS. Also disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein, wherein the intein is a naturally occurring intein, a modified intein, Mtu-RecA or one of the inteins listed in Table 2.
Disclosed herein are modified peptides comprising a CIPS.
Disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible ZBM and an intein, wherein the intein comprises additional amino acids at the N-terminus of a naturally occurring intein. For example, the modified intein can comprise four or more additional amino acids at the N-terminus of the naturally occurring intein. In some aspects, the modified intein can comprise four or more additional amino acids at the N-terminus of the naturally occurring intein, wherein the first amino acid at the N-terminal end of the intein is alanine, histidine, cysteine or glycine
Also disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS-X2, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible ZBM and an intein, and wherein X2 comprises a protein of interest.
Additional examples of CIPS can be further found in
Also disclosed herein are splicing-intein variants of the described system that can be used to alter the tropism of viral, bacterial, or yeast vectors through the introduction of interrupting switched inteins into key vector surfaces or targeting proteins, thereby making the vectors inhibited by the presence of zinc and activated by chelating agents which bind zinc.
As discussed herein, the CIPSs disclosed herein comprise a reversible ZBM linked to an intein. The ZBM can be attached to the N-terminus or the C-terminus of the intein, or can be within the intein.
The ZBM can allow for the pulling away of the active site histidine into a metal-nitrogen chelation arrangement such that it is no longer available to activate the labile peptide bond for cission.
Disclosed herein are modified peptides comprising a ZBM which allows for enhanced binding of zinc when compared to an intein without a ZBM in which enhanced binding of zinc allows the bound zinc to interact with one or the other of two critical active site histidine residues.
The ZBM can be reversible. By “reversible” it is meant that the motif binds zinc when it is present, which can alter the behavior of the intein to which the ZBM is attached. This behavior of the intein, however, is reversible when zinc is removed. For example, an intein may cleave or splice when zinc is not present. However, this action can be inhibited in the presence of zinc. When the zinc is removed, however, because the action is reversible, the intein will continue to perform the activity which it would have done, had zinc not been present, such as cleaving or splicing. In some aspects, other divalent metals within the fourth row transition element series, other than zinc, can be used in the disclosed methods. Examples of other divalent metals within the fourth row transition element include, but are not limited to, titanium, vanadium, chromium, nickel, copper, manganese, iron, and cobalt.
The ZBMs disclosed herein can be designed such that when appended to, for example, the N-terminal portion of an intein, such as the Mtu-RecA intein, they introduce a zinc-binding, active-site modulating subdomain capable of reversibly switching the intein off. This sensitivity to zinc has enabled the successful use of the inteins under conditions that are compatible with commercially relevant mammalian cell culture expression platforms. For example, a reversible ZBM can be fused directly to the N-terminal end of the intein, with no linkers or additional amino acids separating the intein from the ZBM.
Disclosed herein are modified peptides comprising a CIPS. Also disclosed herein are peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein.
Disclosed herein are CIPSs comprising an intein and a reversible ZBM, wherein the reversible ZBM comprises the structure: aa1-aa2-aa3-aa4, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid and aa4 is a positively charged amino acid. For example, aa1 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa2 can be aspartic acid or glutamic acid; aa3 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; and aa4 can be arginine or lysine.
Disclosed herein are CIPSs comprising an intein and a reversible ZBM, wherein the reversible ZBM comprises the sequence: G-E-G-H (SEQ ID NO: 1) or G-D-G-H (SEQ ID NO: 2).
Disclosed herein are CIPSs comprising an intein and a reversible ZBM, wherein the reversible ZBM comprises the structure: aa1-aa2-aa3-aa4-aa5, wherein aa1 is a non-polar amino acid, aa2 is a negatively-charged amino acid, aa3 is a non-polar amino acid, aa4 is a positively charged amino acid and aa5 is a non-polar amino acid. For example, aa1 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa2 can be aspartic acid or glutamic acid or cysteine; aa3 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine; aa4 can be arginine or lysine; and aa5 can be glycine, alanine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, or valine.
Disclosed herein are CIPSs comprising an intein and a reversible ZBM, wherein the reversible ZBM comprises the sequence G-E-G-H-H (SEQ ID NO: 3), G-E-G-H-G (SEQ ID NO: 4), G-D-G-H-H (SEQ ID NO: 5), or G-D-G-H-G (SEQ ID NO: 6).
The corresponding nucleic acid sequences for the above ZBMs follow. Note that the underlined portion of the nucleic acid encodes the reversible ZBM, as well as the nucleic acid which codes for the first amino acid of the intein.
GGAGAGGGACATCACCTCGCAGAGGGCACTCGGAT
GGAGAGGGACATTGCCTCGCAGAGGGCACTCGGAT
GGAGAGGGACATCATGCCCTCGCAGAGGGCACTCG
GGAGAGGGACATGGATGCCTCGCAGAGGGCACTCGG
GGAGATGGACATCATGCCCTCGCAGAGGGCACTCGGA
GGAGATGGACATGGATGCCTCGCAGAGGGCACTCGGA
The CIPSs described herein can be engineered to possess an intein wherein the appended zinc-binding motif is placed (1) at a specific location near the intein's enzyme active site or (2) at other similar sites that either can directly or allosterically control the intein's active site dynamics and conformations. In some aspects, the CIPS can be engineered in a way that when the CIPS is exposed to zinc, the splicing rate can be decreased by 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% when compared to an intein which has not been modified to comprise a zinc-binding domain. In the case where a Divalent Cation Binding Motif (DCBM) is used rather than a ZBM, the CIPS can be engineered in a way that when the CIPS is exposed to a divalent metal within the fourth row transition element series, the splicing rate can be decreased by 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% when compared to an intein which has not been modified to comprise a DCBM.
Because the ZBM can be reversible, when the peptide comprising the CIPS is exposed to a chelating agent, a change in pH, dialysis, or dilution, thereby removing zinc, the CIPS can excisise the intein portion out by protein splicing, or cleavage in the absence of splicing. In some aspects, the modified peptide (comprising a CIPS, an affinity tag, and/or a protein of interest) can be subjected to these conditions. The CIPS may also be inserted into a region that substantially inhibits the activity of the protein of interest.
In some aspects, the zinc ion can be removed by a shift to a pH below 7.0, which can cause zinc loss via protonation of the chelating histidine residues. In some aspects, the zinc ion can be removed, for example, by addition of EDTA (Ethylenediaminetetraacetic acid) or EGTA (ethylene glycol tetraacetic acid) to directly chelate the zinc ion. In some aspects, the zinc ion can be removed by dilution to a concentration below that required for intein inhibition, or by dialysis to remove the zinc ion from the intein. In some aspects, the zinc ion can be removed by buffer wash with an immobilized CIPS in a column chromatography format.
In some aspects, a CIPS can be engineered such that when zinc is present at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 750, 800, 850, 900, 1000, 1100, 1200, 1300, 1400, 1500, or more μM, the CIPS splicing activity can be prevented or reduced. One of skill in the art can readily ascertain the appropriate amount of zinc required to prevent specific intein portions of the CIPS from splicing or cleaving.
In some aspects, the CIPSs disclosed herein comprise a reversible DCBM linked to an intein. The DCBM can be attached to the N-terminus or the C-terminus of the intein, or can be within the intein. For example, disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible DCBM and an intein, wherein the intein comprises additional amino acids at the N-terminus of a naturally occurring intein. As used herein, a DCBM can be used instead of a ZBM, thereby allowing for other divalent metal ions to control the intein function.
As discussed herein, the CIPSs disclosed herein can comprise a reversible DCBM linked to an intein. The DCBM can be attached to the N-terminus or the C-terminus of the intein, or can be within the intein.
The DCBM can allow for the pulling away of the active site histidine into a metal-nitrogen chelation arrangement such that it is no longer available to activate the labile peptide bond for cission.
The DCBM can allow for enhanced binding of divalent metals within the fourth row transition element series when compared to an intein without a DCBM in which enhanced binding of a divalent metal within the fourth row transition element series allows the bound divalent metals within the fourth row transition element series to interact with one or the other of two critical active site histidine residues.
As described throughout, the DCBM and the corresponding divalent metal within the fourth row transition element series can be used as described herein for the ZBM and zinc so far as they relate to the methods and compositions described herein.
In Table 1, below, is a list of the various amino acids, their abbreviations, as well as their polarity and charge. Using this table, one of skill in the art can readily ascertain which amino acids can be used in the peptide compositions disclosed herein.
As discussed herein, the CIPSs disclosed herein comprise an intein. One way to control protein activity is through the use of inteins which can allow expression of an intein modified protein with a predefined activity level. As discussed herein, inteins are self-cleaving and self-ligating peptides. The collective attributes of being both self-cleaving and self-ligating are referred to as “self-splicing” or “splicing.” An intein cleaves from the protein and mediates ligation of the protein sequences (exteins) from which it cleaves to splice the protein. An intein may be inserted within the protein sequence or fused terminally to the protein. An intein insertion in a protein may allow control of a protein by yielding a modified protein that has one activity when the intein is present and another activity after intein cleavage or splicing. In some cases, the intein splicing reaction can be controlled by one or more of a variety of induction conditions, such as zinc, when the proper modification has been made to the intein. When an activity normally detrimental to the host is reduced, the intein protects the expression host from detrimental growth, physiological, or yield effects of the protein. After expression of the protein, the activity can be changed by exposing the modified protein to reaction conditions that induce intein splicing (such as removal of zinc by the methods disclosed herein). In one aspect, the modified protein that results after splicing has increased activity. Inteins can also be used in protein purification systems, described below.
Any intein can be used with the compositions and methods disclosed herein. For example, an intein can be used in the context of a CIPS.
Examples of inteins can be found in Perler, F. B. (2002) InBase, the Intein Database. Nucleic Acids Res. 30, 383-384, hereby incorporated by reference in its entirety for teaching examples of inteins that can be used with the compositions and methods disclosed herein. Additional examples of naturally occurring inteins include, but are not limited to, those found in Table 2. In one example, the intein can be Mtu-RecA. In some aspects, the inteins consist of two functionally and structurally distinct domains, a protein-splicing domain and an endonuclease domain.
Acanthomoeba polyphaga Mimivirus
Aspergillus brevipes FRR2439
Ajellomyces capsulatus G186AR
Ajellomyces capsulatus H143
Ajellomyces capsulatus (anamorph:
Histoplasma capsulatum)
Ajellomyces capsulatus NAm1
Ajellomyces dermatitidis ER-3
Ajellomyces dermatitidis SLH14081,
Aspergillus fumigatus var. ellipticus,
Aspergillus fumigatus strain
Aspergillus fumigatus var. ellipticus,
Aspergillus giganteus Strain NRRL
Aspergillus nidulans FGSC A
Aspergillus viridinutans strain
Botrytis cinerea (teleomorph of
Botryotinia fuckeliana B05.10)
Batrachochytrium dendrobatidis
Batrachochytrium dendrobatidis
Batrachochytrium dendrobatidis
Batrachochytrium dendrobatidis
Batrachochytrium dendrobatidis
Botryotinia fuckeliana B05.10
Chlorella virus NY2A infects
Chlorella NC64A, which infects
Paramecium bursaria
Chlorella virus NY2A infects
Chlorella NC64A, which infects
Paramecium bursaria
Costelytra zealandica iridescent virus
Cryptococcus bacillisporus strain
neoformans gattii)
Cryptococcus bacillisporus strain
Chlamydomonas eugametos
Cryptococcus gattii (aka
Cryptococcus bacillisporus)
Candida glabrata
Cryptococcus laurentii strain
Chlamydomonas moewusii, strain
Chlamydomonas moewusii, strain
Filobasidiella neoformans
Cryptococcus neoformans
Cryptococcus neoformans var.
neoformans JEC21
Candida parapsilosis, strain CLIB214
Chlamydomonas reinhardtii
Cafeteria roenbergensis virus BV-
Cafeteria roenbergensis virus BV-
Cafeteria roenbergensis virus BV-
Cafeteria roenbergensis virus BV-
Coelomomyces stegomyiae
Candida tropicalis ATCC750
Candida tropicalis (nucleus)
Candida tropicalis MYA-3404
Dictyostelium discoideum strain
Debaryomyces hansenii CBS767
famata, taxon: 4959
Debaryomyces hansenii CBS767
Emericella nidulans R20 (anamorph:
Aspergillus nidulans)
Emericella nidulans (anamorph:
Aspergillus nidulans) FGSC A4
Floydiella terrestris, strain UTEX
Guillardia theta (plastid)
Heterosigma akashiwo virus 01
Histoplasma capsulatum (anamorph:
Ajellomyces capsulatus)
Kazachstania exigua, formerly
Saccharomyces exiguus, strain
Kluyveromyces lactis, strain CBS683
Kluyveromyces lactis IFO1267
Kluyveromyces lactis NRRL Y-1140
Lodderomyces elongisporus
Microsporum canis CBS 113480
Neosartorya aurata NRRL 4378
Neosartorya fennelliae NRRL 5534
Neosartorya fischeri
Neosartorya glabra FRR2163
Neosartorya glabra FRR1833
Neosartorya quadricincta, strain
Neosartorya spinosa FRR4595
Paracoccidioides brasiliensis Pb01
Paracoccidioides brasiliensis Pb03
Podospora anserina
Podospora anserina
Phycomyces blakesleeanus
Phycomyces blakesleeanus
Paracoccidioides brasiliensis Pb18
Penicillium chrysogenum
Penicillium expansum
Pichia (Candida) guilliermondii
Pichia (Candida) guilliermondii
Phaeosphaeria nodorum SN15
Phaeosphaeria nodorum SN15
Porphyra purpurea (chloroplast)
Pichia stipitis CBS 6054,
Pyrenophora tritici-repentis Pt-1C-
Penicillium vulpinum (formerly
P. claviforme)
Porphyra yezoensis chloroplast,
Spiromyces aspiralis NRRL 22631
Saccharomyces castellii, strain
Saccharomyces castellii, strain
Saccharomyces cariocanus,
Saccharomyces cerevisiae (nucleus)
Saccharomyces cerevisiae strain
Saccharomyces cerevisiae JAY291
Saccharomyces cerevisiae OUT7091
Saccharomyces cerevisiae OUT7112
Saccharomyces cerevisiae strain
Saccharomyces dairenensis, strain
Saccharomyces exiguus,
Stigeoclonium helveticum, strain
Schizosaccharomyces japonicus
Saccharomyces pastorianus
Spizellomyces punctatus
Saccharomyces unisporus, strain
Torulaspora globosa, strain CBS 764
Torulaspora pretoriensis, strain CBS
Uncinocarpus reesii
Vanderwaltozyma polyspora,
Wiseana iridescent virus
Zygosaccharomyces bailii, strain
Zygosaccharomyces bisporus, strain
Zygosaccharomyces rouxii, strain
Acyrthosiphon pisum secondary
Hamiltonella defensa,
Acyrthosiphon pisum,
Hamiltonella defensa strain 5ATac,
pisum
Hamiltonella defensa,
rudbeckiae, taxon: 568991
Actinobacillus
Haemophilus phage Aaphi23
actinomycetemcomitans
Aquifex aeolicus strain VF5
Acidovorax avenae subsp. citrulli
Acidovorax avenae subsp. citrulli
Acidovorax avenae subsp. avenae
Acinetobacter baumannii ACICU
Acidothermus cellulolyticus 11B
Alkalilimnicola ehrlichei MLHE-1
Alkalilimnicola ehrlichei MLHE-1
Alkalilimnicola ehrlichei MLHE-1
Aggregatibacter phage S1249
Aphanothece halophytica
Aphanothece halophytica
Allochromatium vinosum DSM 180
Arthrospira maxima CS-328
Aphanizomenon ovalisporum
Aphanizomenon ovalisporum
Arthrospira platensis
Arthrobacter species FB24
Anabaena species PCC7120, (Nostoc
Anabaena species PCC7120, (Nostoc
Anabaena variabilis ATCC29413
Anabaena variabilis ATCC29413
Azotobacter vinelandii
Burkholderia cenocepacia MC0-3
Burkholderia cenocepacia PC184
Bacillus selenitireducens MLS10
B. subtilis M1918 (prophage)
B. subtilis strain 168 Sp beta c2
B. subtilis taxon 1423. SPbeta
Burkholderia vietnamiensis G4
Corynebacterium phage P1201
glutamicum NCHU
Chlorochromatium aggregatum
Chloroflexus aurantiacus J-10-fl
Clostridium botulinum phage C-St
botulinum type C strain
Clostridium botulinum phage D
botulinum type D strain, 1873,
Coxiella burnetii Dugway 5J108-111
Coxiella burnetii ‘MSU Goat Q177’
Coxiella burnetii RSA 334
Coxiella burnetii RSA 493
Cyanothece sp. ATCC 51142
Chlorobium chlorochromatii CaD3
Cyanothece sp. CCY0110
Cyanothece sp. CCY0110
Cellulomonas flavigena DSM 20109
Carboxydothermus
hydrogenoformans Z-2901
Clostridium kluyveri DSM 555
Cylindrospermopsis raciborskii CS-505
Cylindrospermopsis raciborskii CS-505
Cylindrospermopsis raciborskii CS-505
Cyanothece sp. CCY0110
Cyanothece sp. CCY0110
Cyanothece sp. PCC 7424
Cyanothece sp. PCC7424
Cyanothece sp. PCC 7425
Cyanothece sp. PCC 7822
Cyanothece sp. PCC 8801
Cyanothece sp. PCC 8801
Clostridium thermocellum
Clostridium thermocellum
Clostridium thermocellum DSM
Crocosphaera watsonii WH 8501
Crocosphaera watsonii WH 8501
Crocosphaera watsonii WH 8501
Crocosphaera watsonii WH 8501
Crocosphaera watsonii WH 8501
Candidatus Desulforudis audaxviator
Deinococcus geothermalis
Desulfitobacterium hafniense DCB-2
Desulfitobacterium hafniense Y51
Deinococcus radiodurans R1, TIGR
Deinococcus radiodurans R1, TIGR
Deinococcus radiodurans R1, TIGR
Deinococcus radiodurans R1,
Dictyoglomus thermophilum H-6-12
Desulfovibrio vulgaris subsp.
vulgaris DP4
Frankia alni ACN14a
Frankia species CcI3
Gemmata obscuriglobus UQM2246
Gemmata obscuriglobus UQM2246
Gloeobacter violaceus, PCC 7421
Gloeobacter violaceus, PCC 7421
Gloeobacter violaceus, PCC 7421
Halorhodospira halophila SL1
Kribbella flavida DSM 17836
Kineococcus radiotolerans
Lactococcus phage KSY1
Listonella pelagia phage phiHSIC
Lyngbya sp. PCC 8106
Mycobacterium phage KBG
Microcystis aeruginosa NIES-843
Microcystis aeruginosa NIES-843
Microcystis aeruginosa NIES-843
Micromonospora aurantiaca ATCC
Mycobacterium avium 104
Mycobacterium avium subsp. avium
Mycobacterium avium
Mycobacterium avium subsp.
paratuberculosis str. k10
Mycobacterium bovis subsp. bovis
Mycobacterium bovis subsp. bovis
Mycobacterium bovis subsp. bovis
Mycobacterium bovis BCG Pasteur
Mycobacterium bovis subsp. bovis
Methylococcus capsulatus Bath,
Methylococcus capsulatus Bath
Mycobacterium chitae
Microcoleus chthonoplastes
Microcoleus chthonoplastes
Microcoleus chthonoplastes
Microcoleus chthonoplastes PCC
Microcoleus chthonoplastes PCC
Microcoleus chthonoplastes PCC
Methylobacterium extorquens AM1
Methylobacterium extorquens AM1
Mycobacterium fallax
Mycobacterium flavescens Fla0
Mycobacterium flavescens Fla0
Mycobacterium flavescens,
Mycobacterium flavescens PYR-
Mycobacterium gastri
Mycobacterium gastri
Mycobacterium gastri
Mycobacterium gilvum PYR-GCK
Mycobacterium gilvum PYR-GCK
Mycobacterium gordonae
Mycobacterium intracellulare
Mycobacterium intracellulare ATCC
Mycobacterium kansasii
Mycobacterium kansasii ATCC
Mycobacterium leprae Br4923
Mycobacterium leprae, strain TN
Mycobacterium leprae TN
Mycobacterium leprae, strain TN
Mycobacterium leprae
Mycobacterium malmoense
Magnetospirillum magnetotacticum
Mycobacterium shimodei
Mycobacterium smegmatis MC2 155
Mycobacterium smegmatis MC2 155
Mycobacterium species KMS
Mycobacterium species KMS
Mycobacterium species MCS
Mycobacterium species MCS
Mycobacterium thermoresistibile
Mycobacterium tuberculosis strains
Mycobacterium tuberculosis C
Mycobacterium tuberculosis,
Mycobacterium tuberculosis
Mycobacterium tuberculosis/
Mycobacterium tuberculosis EAS054
Mycobacterium tuberculosis, strain
Mycobacterium tuberculosis H37Ra
Mycobacterium tuberculosis H37Rv
Mycobacterium tuberculosis
Mycobacterium tuberculosis str.
Mycobacterium tuberculosis K85
Mycobacterium tuberculosis ‘98-
Mycobacterium tuberculosis
Mycobacterium tuberculosis T17
Mycobacterium tuberculosis T17
Mycobacterium tuberculosis T46
Mycobacterium tuberculosis T85
Mycobacterium tuberculosis T92
Mycobacterium vanbaalenii PYR-1
Mycobacterium vanbaalenii PYR-1
Myxococcus xanthus DK1622
Mycobacterium xenopi strain
Nostoc azollae 0708
Nostoc azollae 0708
Nocardia farcinica IFM 10152
Nocardia farcinica IFM 10152
Nocardia farcinica IFM 10152
Nodularia spumigena CCY9414
Nostoc punctiforme
Nostoc punctiforme
Nostoc punctiforme PCC73102
Nostoc punctiforme PCC73102
Nocardioides species JS614
Nocardioides species JS614
Nostoc species PCC7120, (Anabaena
Nostoc species PCC7120, (Anabaena
Nostoc species PCC7120, (Anabaena
Nostoc species PCC7120, (Anabaena
Oscillatoria limnetica str. ‘Solar Lake’
Oscillatoria limnetica str. ‘Solar Lake’
Pseudomonas aeruginosa phage
aeruginosa, taxon: 273133
Pseudomonas aeruginosa phage
aeruginosa, taxon: 273133
Pseudomonas aeruginosa phage
aeruginosa, taxon: 273133
Pseudomonas aeruginosa phage
aeruginosa, taxon: 273133
Pseudomonas fluorescens Pf-5
Pelodictyon luteolum DSM 273
Persephonella marina EX-H1
Persephonella marina EX-H1
Polaromonas naphthalenivorans CJ2
Polynucleobacter sp. QLW-
Polaromonas species JS666
Polaromonas species JS666
Pseudomonas species A1-1
Pseudomonas syringae pv. tomato
Raphidiopsis brookii D9
Rhodospirillum centenum SW
Rhodococcus erythropolis SK121
Rhodothermus marinus
Rhodothermus marinus DSM 4252
Rhodothermus marinus DSM 4252
Roseovarius species 217
Salmonella phage SETP12
Salmonella phage SETP3
Salmonella phage SETP3
Salmonella phage SETP5
Salinispora arenicola CNS-205
Streptomyces avermitilis MA-4680
Synechococcus elongatus PCC 6301
Anacystis nudulans
Synechococcus elongatus PC7942
Synechococcus elongatus PC7942
Synechococcus elongatus PC7942
Synechococcus elongatus PCC 6301
Synechococcus sp. PCC
nudulans”
Synechococcus elongatus PCC 6301
Synechococcus sp. PCC
nudulans”
Staphylococcus epidermidis RP62A
Shigella flexneri 2a str. 2457T
Shigella flexneri 2a str. 301
Shigella flexneri 5 str. 8401
Sodalis phage SO-1
glossinidius strain GA-SG,
Glossina austeni (Newstead)”
Spirulina platensis, strain C1
Salinibacter ruber DSM 13855
Salinibacter ruber DSM 13855
Salinibacter ruber DSM 13855
Synechocystis species, strain
Synechocystis species, strain
Synechocystis species, strain
Synechocystis species, strain
Synechocystis species, strain
Synechococcus species JA-2-3B′a(2-13)
Synechococcus species JA-2-3B′a(2-13)
Synechococcus species JA-3-3Ab
Synechococcus species JA-3-3Ab
Synechocystis species, strain PCC
Synechocystis species, strain PCC
Synechococcus sp. PCC 7335
Staphylococcus phage Twort
Sulfurovum sp. NBC37-1
Thermus aquaticus Y51MC23
Thermus aquaticus Y51MC23
Thermomonospora curvata DSM
Thermosynechococcus elongatus BP-1
Thermosynechococcus elongatus BP-1
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Trichodesmium erythraeum IMS101
Thermobifida fusca YX
Thermobifida fusca YX
Thermobifida fusca YX
Thioalkalivibrio sp. K90mix
Thermoanaerobacterium
thermosaccharolyticum DSM 571
Thermus thermophilus HB27
Thermus thermophilus HB27
Thermus thermophilus HB27
Thermus thermophilus HB27
Thermus thermophilus HB8
Thermus thermophilus HB8
Thermus thermophilus HB8
Thermus thermophilus HB8
Thermosynechococcus vulcanus
Thermosynechococcus vulcanus
Thermodesulfovibrio yellowstonii
Thermodesulfovibrio yellowstonii
Aeropyrum pernix K1
Candidatus Methanoregula boonei
Ferroplasma acidarmanus,
Ferroplasma acidarmanus
Ferroplasma acidarmanus type I,
Ferroplasma acidarmanus
Haloarcula marismortui ATCC
Haloarcula marismortui ATCC
Haloarcula marismortui ATCC
Haloarcula marismortui ATCC
Halomicrobium mukohataei DSM
Halomicrobium mukohataei DSM
Halobacterium salinarum R-1
Halobacterium species NRC-1
Halobacterium salinarum NRC-1
Halorhabdus utahensis DSM 12940
Halorhabdus utahensis DSM 12940
Haloferax volcanii DS70
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Haloquadratum walsbyi DSM 16790
Methanococcus aeolicus Nankai-3
Methanococcus aeolicus Nankai-3
Methanococcus aeolicus Nankai-3
Methanococcus aeolicus Nankai-3
Methanococcus aeolicus Nankai-3
Methanococcus aeolicus Nankai-3
Methanocaldococcus infernus ME
Methanocaldococcus infernus ME
Methanoculleus marisnigri JR1
Methanoculleus marisnigri JR1
Methanocaldococcus sp. FS406-22
Methanocaldococcus sp. FS406-22
Methanocaldococcus sp. FS406-22
Methanocaldococcus sp. FS406-22
Methanocaldococcus fervens AG86
Methanocaldococcus fervens AG86
Methanospirillum hungateii JF-1
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanococcus jannaschii
Methanopyrus kandleri AV19
Methanopyrus kandleri AV19
Methanopyrus kandleri AV19
Methanopyrus kandleri AV19
Methanopyrus kandleri AV19
Methanothermobacter
thermautotrophicus
thermoautotrophicum)
Methanocaldococcus vulcanius M7
Methanocaldococcus vulcanius M7
Methanocaldococcus vulcanius M7
Methanocaldococcus vulcanius M7
Methanocaldococcus vulcanius M7
Nanoarchaeum equitans Kin4-M
Nanoarchaeum equitans Kin4-M
Natrialba magadii ATCC 43099
Natrialba magadii ATCC 43099
Natrialba magadii ATCC 43099
Natronomonas pharaonis DSM 2160
Natronomonas pharaonis DSM 2160
Natronomonas pharaonis DSM 2160
Natronomonas pharaonis DSM 2160
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrococcus abyssi
Pyrobaculum arsenaticum DSM
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus furiosus
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus horikoshii OT3
Pyrococcus species GB-D
Picrophilus torridus, DSM 9790
Staphylothermus marinus F1
Staphylothermus marinus F1
Thermoplasma acidophilum, ATCC
Thermoplasma acidophilum,
Thermococcus aggregans
Thermococcus aggregans
Thermococcus aggregans
Thermococcus barophilus MP
Thermococcus fumicolans
Thermococcus fumicolans
Thermococcus hydrothermalis
Thermococcus hydrothermalis
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Pyrococcus/Thermococcus
kodakaraensis KOD1
Pyrococcus/Thermococcus
kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus kodakaraensis KOD1
Thermococcus litoralis
Thermococcus litoralis
Thermococcus marinus
Thermococcus onnurineus NA1
Thermococcus onnurineus NA1
Thermococcus peptonophilus strain
Thermococcus sibiricus MM 739
Thermococcus sibiricus MM 739
Thermococcus sibiricus MM 739
Thermococcus sibiricus MM 739
Thermococcus sp. AM4
Thermococcus sp. AM4
Thermococcus sp. AM4
Thermococcus sp. AM4
Thermococcus species GE8
Thermococcus species GE8
Thermococcus species GT
Thermococcus species GT
Thermococcus sp. OGL-20P
Thermococcus thioreducens
Thermoplasma volcanium GSS1
Thermococcus zilligii
Inteins of the disclosed compositions or that can be used in the disclosed methods can be modified, or mutated, inteins. A modified intein can comprise additional amino acids at the N-terminus of a naturally occurring intein, or can be at the C-terminus, or within the intein. In a non-limiting example, there can be one, two, three, four, five, or more additional amino acids at the N-terminus of the naturally occurring intein. In some aspects, the first amino acid at the N-terminal end of the intein can be alanine, histidine, cysteine or glycine.
In addition to the modification of comprising a reversible ZBM, an intein can also include other modifications that can make it useful for various applications. In other words, an intein with a ZBM can also comprise other modifications. For example, an intein can comprise another tunable motif that is useful for modifying behavior. For example, inteins can be encoded by a temperature-sensitive intein allele (Adam et al. 2002, Mol. Microbiol. Biotechnol. 4 479-487; Cann et al. 2004, Appl. Environ. Microbiol. 70 3158-3162; Zeidler et al. 2004, Nat. Biotechnol. 22 871-876), inteins can incorporate nonnative amino acids whose activity is regulated by photolysis (Cook et al. 1995 Angew. Chem. Int. Ed. Engl. 34 1629-1630), or the activity of inteins can be ligand-controlled (Mills et al. 2001, J. Biol. Chem. 276 10832-10838; Mootz et al. 2002, J. Am. Chem. Soc. 124 9044-9045; Mootz et al. 2003, J. Am. Chem. Soc. 125 10561-10569). It has also been shown that controllable intein splicing in cis can be used for various applications that will be appreciated by those skilled in the art. In the first case, regulation of protein activity was accomplished with the isolation and use of temperature-sensitive variants of the Saccharomyces cerevisiae vacuolar ATPase subunit intein (Zeidler et al. 2004) and, in the second case, with the construction of a novel chimeric intein whose splicing activity is triggered by the addition of 4-hydroxytamoxifen (Buskirk et al. Proc. Natl. Acad. Sci. 101 10505-10510).
Another example of modified inteins is a protein engineering approach for generating inteins whose splicing activity is regulated in vivo by the presence of human thyroid hormone. Designed according to other engineered allosteric enzyme prototypes (Baird et al. 1999, Proc. Natl. Acad. Sci. 96 11241-11246; Doi et al. 1999, FEBS Lett. 453 305-307; Tucker et al. 2001, Nat. Biotechnol. 19 1042-1046; Guntas et al, 2004, J. Mol. Biol. 336 263-273), an artificial intein chimera was created by fusing a thyroid-hormone-binding domain within a previously engineered mini-intein. The insertion of the binding domain abolished the splicing activity of the intein but allowed it to be later restored by addition of thyroid hormone or synthetic analogs. The resulting allosteric intein was then used to conditionally activate a variety of different proteins in Escherichia coli in a dose-dependent manner. Finally, a combination of directed evolution and genetic selection was employed to engineer an additional controllable intein whose splicing activity is inhibited by the presence of an orthogonal set of synthetic estrogen ligands.
Further examples of modified inteins include, but are not limited to, those found in U.S. Pat. No. 7,026,526, such as mutated inteins of Pyrococcus species GB-D DNA polymerase, and those created artificially by removing the endonuclease domains from endonuclease containing inteins (Xu, M-Q & Perler, F. B. EMBO Journal, 1996, 15, 5146-5153; Chong, et al. J. Biol. Chem. 1997, 272, 15587-15590). In a further example, an intein can be selected so that it consists of the minimal number of amino acids needed to perform the splicing function, such as the intein from the Mycobacterium xenopi GyrA protein (Telenti, A., et al., J. Bacteriol. 1997, 179, 6378-6382). In another aspect, an intein without endonuclease activity can be selected, such as the intein from the Mycobacterium xenopi GyrA protein or the Saccharomyces cerevisiae VMA intein that has been modified to remove endonuclease domains (Chong, 1997).
In some aspects, the first residue of the C-terminal extein is engineered to contain a glycine or alanine, a modification that was shown to prevent extein ligation with the Pyrococcus species GB-D DNA polymerase (Xu, M-Q & Perler, F. B. EMBO Journal, 1996, 15, 5146-5153). In this embodiment, preferred C-terminal exteins contain coding sequences that naturally contain a glycine or an alanine residue following the N-terminal methionine in the native amino acid sequence. Fusion of the glycine or alanine of the extein to the C-terminus of the intein can provide the native amino acid sequence after processing of the polypeptide. In another embodiment, an artificial glycine or alanine is created on the C-terminal extein either by altering the native sequence or by adding an additional amino acid residue onto the N-terminus of the native sequence. In this example, the native amino acid sequence of the protein is altered by one amino acid after polypeptide processing.
A further example of a modified intein includes the Pch PRP8 mini-intein of Penicillium chrysogenum, which was modified to include: 1) aminoglycoside phosphotransferase; 2) imidazoleglycerol-phosphate dehydratase, His5 from S. pombe 3) hygromycin B phosphotransferase; and 4) the transcriptional activator LexA-VP16 (Muller et al., BMC Biotechnology 2011, 11:71).
U.S. Pat. No. 5,834,247 teaches that modification of inteins can be accomplished in a number of ways and is hereby incorporated by reference in its entirety for its teaching of methods that can be used to modify inteins. For example, the sequence surrounding the amino acid residue to be modified may be altered to create a biological phosphorylation site allowing it to be a substrate for specific kinases and phosphatases. Examples of protein kinases include, for example, casein kinase II, cAMP-dependent protein kinase, cdc2, and pp60c-src (Pearson and Kemp, Methods in Enzymology 200:62 (1991)). Examples of phosphatases include, for example, protein phosphatase 2A, lambda phosphatase, and the yop phosphatase from Yersinia (Tonks, Current Opinion in Cell Biology, 2:1114 (1990)).
Additionally, critical splice junction residues can be modified chemically such that the splicing reaction is blocked until the modification is reversed. This can be accomplished by using, for example, unnatural amino acid mutagenesis (Noren, et al., Science 244:182 (1989); Ellman, et al., Methods in Enzymology 202:301 (1991)). Using this method, one of the amino acids involved in the splicing reaction can be replaced, during translation, by a synthetic derivative in which the side chain functionality of the side chain is “masked” by a chemically or photolytically removable group.
In another example, certain host cells may not be able to tolerate the gene product of the CIPS, and thus, in some embodiments it may be preferable to inactivate the endonuclease function. It has been shown that protein splicing can occur when the CIPS endonuclease function has been inactivated. Such inactivation can be accomplished in a variety of ways, including for example, random mutagenesis, deletion or insertional inactivation, or site directed mutagenesis. In one example, the endonuclease function is inactivated by site directed mutagenesis. l-Tli-l shares sequence similarity with other “homing endonucleases” in the pair of characteristic dodecapeptide motifs (Cummings et al., Curr. Gent. 16:381 (1989)). Inactivation of endonuclease function has been shown to increase the stability of constructs carrying modified proteins.
Also disclosed in U.S. Pat. No. 6,933,362 (herein incorporated by reference in its entirety for its teaching concerning mutated inteins), are various modified inteins. For example, U.S. Pat. No. 6,933,362 discusses a non-naturally occurring intein having splicing activity and controllable cleavage activity or a non-naturally occurring compound having cleaving and/or cleaving and splicing activity, which is controllable. The intein can comprise a truncated intein. The cleavage activity can be controllable by varying oxidative potential. The intein can be obtained from random mutagenesis of a truncated intein, followed by selection based on growth phenotype. The intein can have C-terminal cleavage. The intein can be a truncated Mtu intein. The intein can have the endonuclease domain deleted. The intein can be a truncated Mtu intein with the endonuclease domain deleted, and V67L and/or D422G mutation(s) (relative to full-length Mtu intein). The intein can contain the C-terminal histidine-asparagine. (The presence of the C-terminal histidine residue is believed to confer pH sensitivity and thus it is advantageous that the C-terminal histidine be present; the final asparagine is believed useful for cleavage activity.)
Furthermore, one of skill in the art can readily discern useful modified inteins by the use of an effective screen for linking intein activity to an easily observable or selectable phenotype. Such screens are known in the art, for example those found in U.S. Pat. No. 6,933,362. Furthermore, the screen can allow for selection of desired traits under conditions that are relevant for the proposed application. An intein derivative exhibiting controllable cleavage activity has been isolated using rational and random mutagenesis followed by a genetic screen.
Affinity Tags
Disclosed herein are modified peptides comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible ZBM and an intein.
Affinity tags can be short peptide sequences or functional protein domains cloned in frame with protein coding sequences that change the protein's behavior. Affinity tags can be appended to the N- or C-terminus of proteins which can be used in methods of purifying a protein from cells. Cells expressing a peptide comprising an affinity tag can be pelleted, lysed, and applied to a column, resin or other solid support that displays a ligand to the affinity tags. The solid support can also be washed several times with buffer to eliminate unbound proteins. A protein of interest, if attached to an affinity tag, can be eluted from the solid support via a buffer that causes the affinity tag to dissociate from the ligand resulting in a purified protein.
Examples of affinity tags can be found in Kimple et al. Curr Protoc Protein Sci 2004 September; Arnau et al. Protein Expr Purif 2006 July; 48(1) 1-13; Azarkan et al. J Chromatogr B Analyt Technol Biomed Life Sci 2007 Apr. 15; 849(1-2) 81-90; and Waugh et al. Trends Biotechnol 2005 June; 23(6) 316-20, all hereby incorporated by reference in their entirety for their teaching of examples of affinity tags.
Examples of affinity include, but are not limited to, maltose binding protein, which can bind to immobilized maltose to facilitate purification of the fused target protein; Chitin binding protein, which can bind to immobilized chitin; Glutathione S transferase, which can bind to immobilized chitin; Poly-histidine, which can bind to immobilized chelated metals; FLAG octapeptide, which can bind to immobilized anti-FLAG antibodies.
Affinity tags can also be used to facilitate the purification of a protein of interest using the disclosed modified peptides through a variety of methods, including, but not limited to, selective precipitation, ion exchange chromatography, binding to precipitation-capable ligands, dialysis (by changing the size and/or charge of the target protein) and other highly selective separation methods.
In some aspects, affinity tags can be used that do not actually bind to a ligand. For example, an ELP tag, protein A or Protein G-binding domains can be used as affinity tags.
Linkers
The CIPSs disclosed herein can be attached to an affinity tag by a variety of means. For example, the CIPSs disclosed herein can be attached to an affinity tag through a linker sequence. The linker sequence can be designed to create distance between the intein and affinity tag, while providing minimal steric interference to the intein cleaving active site. It is generally accepted that linkers involve a relatively unstructured amino acid sequence, and the design and use of linkers are common in the art of designing fusion peptides. There is a variety of protein linker databases which one of skill in the art will recognize. This includes those found in Argos et al. J Mol Biol 1990 Feb. 20; 211(4) 943-58; Crasto et al. Protein Eng 2000 May; 13(5) 309-12; George et al. Protein Eng 2002 November; 15(11) 871-9; Arai et al. Protein Eng 2001 August; 14(8) 529-32; and Robinson et al. PNAS May 26, 1998 vol. 95 no. 11 5929-5934, hereby incorporated by reference in their entirety for their teaching of examples of linkers.
Examples of linkers include, but are not limited to: (1) poly-asparagine linker consisting of 4 to 15 asparagine residues, and (2) glycine-serine linker, consisting of various combinations and lengths of polypeptides consisting of glycine and serine. One of skill in the art can easily identify and use any linker that will successfully link the CIPS with an affinity tag.
Proteins of Interest
Proteins of interest, can include, for example, enzymes, toxins, cytokines, glycoproteins, growth factors, therapeutic proteins, such as antibodies as well as any other protein sought to be purified or used by one of skill in the art. The amino acid and nucleotide sequence of such proteins are easily available through many computer databases, for example, GenBank, EMBL and Swiss-Prot. Alternatively, the nucleotide or amino acid sequence of a protein of interest can be determined using routine procedures known in the art.
In some aspects disclosed herein, a protein of interest can be attached to a CIPS so that it can be purified. This is discussed in more detail herein. In some methods described herein, the protein of interest can be a protein that one wishes to purify and accumulate, such as an antibody.
Plasmids, Vectors, and Cell Lines
Disclosed herein are vectors comprising nucleic acids encoding the CIPSs disclosed herein, as well as cell lines comprising said vectors. Examples of CIPSs that can be encoded in the vectors disclosed herein can be found at least in
As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as those encoding a CIPS and a peptide of interest, and/or an affinity tag, for example, into a cell without degradation and include a promoter yielding expression of the gene in the cells into which they can be delivered. In one example, a CIPS and peptide of interest are derived from either a virus or a retrovirus. Viral vectors can be, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also disclosed are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells. Pox viral vectors are large and have several sites for inserting genes; they are thermostable and can be stored at room temperature. Disclosed herein is a viral vector which has been engineered so as to suppress the immune response of a host organism, elicited by the viral antigens. Vectors of this type can carry coding regions for Interleukin 8 or 10.
Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors contain nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promoter cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
The fusion DNA encoding a modified peptide can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements can be used. For instance, when expressing a modified eukaryotic protein, it can be advantageous to use appropriate eukaryotic vectors and host cells. Expression of the fusion DNA results in the production of a modified protein.
Also disclosed herein are cell lines comprising the vectors or peptides disclosed herein. A variety of cells can be used with the vectors and plasmids disclosed herein. Non-limiting examples of such cells include somatic cells such as blood cells (erythrocytes and leukocytes), endothelial cells, epithelial cells, neuronal cells (from the central or peripheral nervous systems), muscle cells (including myocytes and myoblasts from skeletal, smooth or cardiac muscle), connective tissue cells (including fibroblasts, adipocytes, chondrocytes, chondroblasts, osteocytes and osteoblasts) and other stromal cells (e.g., macrophages, dendritic cells, thymic nurse cells, Schwann cells, etc.). Eukaryotic germ cells (spermatocytes and oocytes) can also be used, as can the progenitors, precursors and stem cells that give rise to the above-described somatic and germ cells. These cells, tissues and organs can be normal, or they can be pathological such as those involved in diseases or physical disorders, including, but not limited to, infectious diseases (caused by bacteria, fungi yeast, viruses (including HIV, or parasites); in genetic or biochemical pathologies (e.g., cystic fibrosis, hemophilia, Alzheimer's disease, schizophrenia, muscular dystrophy, multiple sclerosis, etc.); or in carcinogenesis and other cancer-related processes.
The eukaryotic cell lines disclosed herein can be animal cells, plant cells (monocot or dicot plants) or fungal cells, such as yeast. Animal cells include those of vertebrate or invertebrate origin. Vertebrate cells, especially mammalian cells (including, but not limited to, cells obtained or derived from human, simian or other non-human primate, mouse, rat, avian, bovine, porcine, ovine, canine, feline and the like), avian cells, fish cells (including zebrafish cells), insect cells (including, but not limited to, cells obtained or derived from Drosophila species, from Spodoptera species (e.g., Sf9 obtained or derived from S. frugiperida, or HIGH FIVE™ cells) or from Trichoplusa species (e.g., MG1, derived from T. ni)), worm cells (e.g., those obtained or derived from C. elegans), and the like. It will be appreciated by one of skill in the art, however, that cells from any species besides those specifically disclosed herein can be advantageously used in accordance with the vectors, plasmids, and methods disclosed herein, without the need for undue experimentation.
Examples of useful cell lines include, but are not limited to, HT1080 cells (ATCC CCL 121), HeLa cells and derivatives of HeLa cells (ATCC CCL 2, 2.1 and 2.2), MCF-7 breast cancer cells (ATCC BTH 22), K-562 leukemia cells (ATCC CCL 243), KB carcinoma cells (ATCC CCL 17), 2780AD ovarian carcinoma cells (see Van der Buick, A. M. et al., Cancer Res. 48:5927-5932 (1988), Raji cells (ATCC CCL 86), Jurkat cells (ATCC TIB 152), Namalwa cells (ATCC CRL 1432), HL-60 cells (ATCC CCL 240), Daudi cells (ATCC CCL 213), RPMI 8226 cells (ATCC CCL 155), U-937 cells (ATCC CRL 1593), Bowes Melanoma cells (ATCC CRL 9607), WI-38VA13 subline 2R4 cells (ATCC CLL 75.1), and MOLT-4 cells (ATCC CRL 1582), as well as heterohybridoma cells produced by fusion of human cells and cells of another species. Secondary human fibroblast strains, such as WI-38 (ATCC CCL 75) and MRC-5 (ATCC CCL 171 can also be used. Other mammalian cells and cell lines can be used in accordance with the present invention, including, but not limited to CHO cells, COS cells, VERO cells, 293 cells, PER-C6 cells, M1 cells, NS-1 cells, COS-7 cells, MDBK cells, MDCK cells, MRC-5 cells, WI-38 cells, WEHI cells, SP2/0 cells, BHK cells (including BHK-21 cells); these and other cells and cell lines are available commercially, for example from the American Type Culture Collection (P.O. Box 1549, Manassas, Va. 20108 USA). Many other cell lines are known in the art and will be familiar to the ordinarily skilled artisan; such cell lines therefore can be used equally well.
Also disclosed herein are cell-free protein expression systems comprising the vectors or peptides disclosed herein, and which also include the required cellular components for expression of a protein from isolated DNA or mRNA molecules. A variety of available cell-free expression systems can be used with the vectors and plasmids disclosed herein. Non-limiting examples of such systems include the Thermo Scientific Pierce Human In Vitro Protein Expression System (based on human cells), Rabbit Reticulocyte Lysate Systems (commercially available from Life Technologies and other suppliers and based on rabbit cells), Wheat Germ Extract Systems (available from several suppliers, and based on wheat germ cells), E. coli Cell-Free Systems (based on E. coli cell lysates and available from several suppliers), and the EasyXpress Insect Kit (available from Qiagen, and based on Spodoptera frugiperda insect cell extracts, with other versions also available from other suppliers).
Once obtained, the proteins of interest can be separated and purified by appropriate combination of known techniques. These methods include, for example, methods utilizing solubility such as salt precipitation and solvent precipitation; methods utilizing the difference in molecular weight such as dialysis, ultra-filtration, gel-filtration, and SDS-polyacrylamide gel electrophoresis; methods utilizing a difference in electrical charge such as ion-exchange column chromatography; methods utilizing specific affinity such as affinity chromatography; methods utilizing a difference in hydrophobicity such as reverse-phase high performance liquid chromatography; and methods utilizing a difference in isoelectric point, such as isoelectric focusing electrophoresis. These are discussed in more detail below.
Methods of Purifying a Protein
Disclosed herein are methods of producing or purifying a protein of interest, the method comprising: producing a modified peptide with the structure:
X1-CIPS-X2
wherein X1 is an affinity tag, and X2 comprises a protein of interest. The modified peptide comprising the affinity tag, protein of interest, and CIPS can then be exposed to a concentration of zinc which inhibits splicing or cleavage by the CIPS. The modified peptide can then be isolated, such as by protein purification, and the zinc removed, thereby allowing for splicing or cleavage of the protein of interest, thereby producing the protein of interest. The CIPS can be isolated by using the affinity tag.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: (a) preparing a nucleic acid that encodes one or more peptides comprising a CIPS; (b) transforming a host cell with the nucleic acid; and (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid. Such methods can further comprise isolating the modified peptide comprising a CIPS.
A peptide or protein produced using the methods disclosed herein can be a peptide or protein of interest or a therapeutic peptide or protein. Cell lines that can be used with the methods disclosed herein, include, but are not limited to mammalian cells such as CHO cells.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: (a) preparing a nucleic acid that encodes one or more peptides comprising a CIPS; (b) transforming a host cell with the nucleic acid; and (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid, further comprising the additional step of (d) exposing the modified peptide comprising the CIPS to a chemical reagent which inhibits splicing or cleavage.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: (a) preparing a nucleic acid that encodes one or more peptides comprising a CIPS; (b) transforming a host cell with the nucleic acid; and (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising a CIPS encoded by the nucleic acid, further comprising (d) exposing the modified peptide comprising the CIPS to a chemical reagent, such as zinc, which inhibits splicing or cleavage and (e) exposing the modified peptide to a chelating agent, a change in pH, a change in temperature, dialysis, or dilution, thereby removing the chemical reagent, for instance zinc.
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: (a) forming a nucleic acid encoding a peptide comprising a CIPS; (b) transforming a host cell with the nucleic acid of step (a); and (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide comprising the CIPS.
Disclosed herein are methods of producing a protein of interest comprising: (a) preparing a nucleic acid that encodes a modified peptide comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS-X2, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein, and wherein X2 comprises the protein of interest; (b) transforming a host cell with the nucleic acid; (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide; (d) exposing the modified peptide to a concentration of zinc which inhibits splicing or cleavage by the CIPS; (e) isolating the modified peptide; and (0 removing the zinc, thereby allowing for cleavage of the protein of interest from the modified peptide, thereby producing the substantially purified protein of interest. The protein of interest can be a therapeutic protein.
Disclosed herein are methods of producing a protein of interest comprising: (a) preparing a nucleic acid that encodes a modified peptide comprising a CIPS wherein the modified peptide comprises the structure: X1-CIPS-X2, wherein X1 is an affinity tag, and wherein the CIPS comprises a reversible zinc-binding motif and an intein, and wherein X2 comprises the protein of interest; (b) transforming a host cell with the nucleic acid; (c) culturing the transformed host cell under conditions suitable for the expression of the modified peptide; (d) exposing the modified peptide to zinc at a concentration of 200 μM or greater; (e) isolating the modified peptide; and (0 removing the zinc, thereby allowing for splicing or cleavage of the protein of interest from the modified peptide, thereby producing the substantially purified protein of interest.
Disclosed herein are methods for binding and eluting a phage-displayed polypeptide from a protein of interest comprising: (a) producing a modified peptide with the structure: X1-CIPS-X2, wherein X1 is an affinity tag, the CIPS comprises a reversible zinc-binding motif and an intein and X2 comprises a protein of interest; (b) binding the modified peptide of step (a) to a solid support; (c) contacting a phage-displayed polypeptide with the support-bound peptide of step (b), thereby permitting binding of the phage-displayed polypeptide with the peptide comprising the CIPS; (d) removing unbound phage-displayed polypeptides; and, (e) eluting the bound phage-displayed polypeptide by inducing cleavage of the protein of interest by the CIPS.
Also disclosed herein are methods for binding and eluting a phage-displayed polypeptide from a protein of interest, comprising: producing a modified peptide with the structure:
X1-CIPS-X2
wherein X1 is an affinity tag, the CIPS comprises a reversible zinc-binding motif and an intein and X2 comprises a protein of interest. The modified peptide which comprises the CIPS can then be bound to a solid support. The phage-displayed polypeptide can then be contacted with the support-bound peptide (the peptide with the CIPS), thereby permitting binding of the phage-displayed polypeptide with the peptide comprising the CIPS. Any unbound phage-displayed polypeptide can then be removed, and the bound phage-displayed polypeptide is eluted by inducing cleavage of the protein of interest by the CIPS.
The modified peptide comprising the CIPS can be exposed to a chemical agent, such as zinc, which inhibits splicing or cleavage, until the phage-displayed polypeptide is bound.
The chemical agent (such as zinc) that inhibits splicing or cleavage can be removed by using a chelating agent, changing the temperature, changing the pH, dialysis, or dilution of the chemical agent. The phage-displayed polypeptide can comprise a library of at least two sequence variations of the displayed polypeptides. The phage can also be filamentous.
Fusion protein purification systems are well known to the skilled artisan. See, EPO 0 286 239 and N. M. Sassenfeld, TIBTECH, 8:88-93 (1990). Typically, in such systems, a binding protein and a target protein are joined by a linker having a protease recognition site. The fusion is then purified by affinity chromatography on a substrate having affinity for the binding protein. The binding protein and the target protein are then separated by contact with a protease, e.g., factor Xa. In these systems, in order to obtain a highly purified target protein, the protease must be separated from the target protein, thus adding an additional purification step, as well as the potential for contamination. The method disclosed herein, by using a CIPS, instead of a protease, avoids these and other problems encountered in currently used protein fusion purification systems.
Also disclosed are modified peptides comprising a fusion protein in which a CIPS is between the protein of interest and a protein or peptide having affinity for a substrate (binding protein or binding domain). Techniques for forming such fusion proteins are well known to the skilled artisan. See, EPO 0 286 239 and J. Sambrook, et al., Molecular Cloning: A Laboratory Manual (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. p. 17.29-17.33.
Binding proteins which can be employed in the methods disclosed herein include, for example, sugar binding proteins, such as maltose or arabinose binding protein, receptor binding proteins, amino acid binding proteins and metal binding proteins. Another is a chitin binding protein, or the chitin binding domain of a chitinase. Other binding proteins are well known to the skilled artisan. See, EPO 0 286 239 and N. M. Sassenfeld, TIBTECH, supra.
A modified peptide can then be contacted with a substrate to which the binding protein has specific affinity, e.g., using affinity chromatography. A highly purified protein of interest can be liberated from the column by changing conditions, such as removing zinc, under which cleavage is initiated, for example, between the CIPS and the protein of interest. Alternatively, a purified fusion protein can be eluted from the column and liberated as above.
A CIPS disclosed herein can also be used to isolate modified peptides by use of affinity chromatography with antibodies specific to the CIPS. For example, monoclonal or polyclonal antibodies can be generated having binding affinity to a CIPS using standard techniques. These antibodies can then be utilized in affinity chromatography purification procedures to isolate a modified peptide. After purification, if desired, zinc can be removed, at which time the CIPS will undergo excision.
Methods of Producing a Peptide
Disclosed herein are methods of producing a modified peptide comprising a CIPS, the method comprising: forming a nucleic acid encoding a CIPS, and transforming a host cell with the nucleic acid; and culturing the transformed host cell under conditions suitable for the expression of the peptide comprising the CIPS. The modified protein can comprise a protein of interest, which can be a therapeutic protein, such as an antibody. The modified peptide can also comprise an affinity tag.
The methods disclosed herein can comprise the additional step of exposing the modified peptide comprising the CIPS to a chemical reagent which inhibits splicing or cleavage. This chemical reagent can be zinc, for example, and can be at a concentration below 1000 μM, for example. Additionally, the peptide comprising the CIPS can be exposed to a chelating agent, a change in pH, dialysis, or dilution, thereby removing zinc.
Kits
Disclosed herein are kits comprising a CIPS, or a CIPS linked to an affinity tag and/or a protein of interest. Also disclosed are kits comprising peptides comprising one or more of SEQ ID NOS: 11, 15, 19, 23, 27, or 31. Also disclosed are kits comprising nucleic acids, comprising one or more of SEQ ID NOS: 12, 16, 20, 24, 28, or 32. Also disclosed are kits comprising the vectors, plasmids, and/or the cell lines disclosed herein. In a further example, a kit can comprise zinc. Zinc, for example, can be at a concentration of 1000 μM or less.
The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in ° C. or is at ambient temperature, and pressure is at or near atmospheric.
In Silico Design
Nearly all inteins end with a Histidine-Asparagine Dipeptide (
The tested zinc-binding motifs (ZBMs) are computationally designed to have high potential zinc-binding affinity and to interrupt intein activity through coordination of critical intein active site histidine residue side chains. Considered in the design were (1) the position to insert zinc-binding motif into intein and (2) the sequences to bind zinc with or without using existing residues that occur near the intein active site. Conceptually the intention was to adapt a minimal portion of previously reported ZBMs that did not require cysteine residues (for example 1ZE9). The subdomain was engineered proximal to the activity site. This is substantially different from previously reported work where control attempts were made using insertions into the distal ‘control loop’ region of the intein or through random mutagenesis approaches. A panel of related designs having subtle variations in predicted zinc coordination behaviors was tested.
In a notable design that is exemplary of the six initial designs, the last two naturally occurring intein amino acids were replaced and the short sub-domain/motif ‘xExHH’ was further appended to the intein N-terminus to give for example . . . x(E-2)x(H0)(H1)(L2)AEGT. This form can act through metal-coordination with H439, inhibiting H439's interactions with N440 in the active site. The related motifs subtly alter the orientation and distances of metal coordination bonds within the switch subdomain. The specific amino acid sequences of the six core inventive designs are:
These sequences were subjected to computational modeling using Schrodinger Q-SITE and Impact packages run with explicit solvent and a quantum mechanical simulation set that included the zinc metal ion and the amino acid side chain, separated from the molecular modeling region using hydrogen caps between the alpha and beta carbons (See
Common wisdom predicted that the designs might result in a constitutively inactive intein due to steric and electronic disruption of the active site. However, it was shown that this was not the case for the disclosed amino acid sequences.
In Vitro Testing
Previous attempts to modify the intein cleaving reaction and controllability through modifications to the body of the mini-intein ΔI-CM have been unsuccessful and generally lead to inactive inteins or inteins with very slow cleavage rates. For this reason, the focus of the disclosed inteins was on the sequence immediately preceding the N-terminus of the intein to generate a zinc-binding motif that includes the critical Histidine residue required for cleaving. This was done by appending the computationally designed sequences to the N-terminus of the mini intein ΔI-CM.
Several putative inteins were designed. Once tested, the most promising design was determined to be an intein that was denoted as LN-004b, for experimental purposes. This intein has a much stronger affinity for zinc than the original ΔI-CM intein, and the presence of zinc substantially suppressed the cleaving reaction, as shown in
After extensive testing, it was determined that the zinc concentration required to decrease the cleaving rate by 50% had decreased from 100 μM in the ΔI-CM intein to 17 μM in the LN-004b intein. Thus, the concentration of zinc required to fully suppress intein cleaving also decreased by a factor of approximately 10 (from about 600 μM in
Therapeutic proteins are currently produced in large manufacturing plants using in vitro cell culture, where recombinant cells are grown over multiple days or weeks in >1,000 liter bioreactors. The bioreactors are then harvested and the expressed proteins are recovered, purified, stabilized, and stored as an intermediate bulk drug substance. The drug substance is then formulated, filled into delivery devices and released by a quality assurance organization before shipment to a distribution warehouse for future delivery to the point-of-care. This is an enormously expensive, time consuming, and complex undertaking that takes months to execute. If starting from scratch, process development activities for a single therapeutic would ordinarily require 6 to 8 years per project to complete all of the characterization, process monitoring and validation activities, needed to meet regulatory authority approval. While companies continue to develop in vivo expression platforms for the manufacturing of proteins, there are no systems designed for the flexibility across proteins or the speed necessary for the rapid development of purification methods for arbitrary target proteins to be used in patient therapies. A novel mammalian in vitro protein expression technology and innovative purification technologies combined with advances in microfluidics and microelectronics to produce biologics on site can be used. Specifically, following technologies can be enhanced and integrated:
Protein Expression: Expression of the protein of interest can be made possible with a mammalian cell-free extract similar to the product currently commercialized by Thermo Scientific based on HeLa cell extracts. The Thermo Scientific 1-Step Human High-Yield In Vitro Translation (IVT) is a cell-free protein expression system that provides all of the essential components required for transcription and translation. The kits are optimized with Accessory Proteins and Reaction Mixes that support protein synthesis for up to 24 hours using a DNA template. The 1-Step Human High-Yield IVT Kits, with a continuous-feed device, enable the expression of functional proteins. The current system uses modified HeLa cell extracts to take advantage of the robust human translation machinery and generate functional full length proteins. The advantages of using the 1-Step Thermo High-Yield IVT Kits over traditional in vivo expression systems include (1) the ability to express toxic or insoluble proteins, (2) easily perform protein labeling with modified amino-acids, (3) reduce the time and cost of expressing human proteins in tissue culture cells, (4) 10 to 100 times greater expression than other mammalian IVT expression systems that are based on rabbit reticulocyte lysates, ability to carry out (5) post translational modifications (PTMs) including phosphorylation, and (6) lot-to-lot consistency as a cell culture based product. In this system, protein expression is performed in a proprietary mini dialysis device that allows a continuous supply of nucleotides, amino acids and energy generating substrates into the reaction while removing inhibitors of proteins synthesis.
Purification: A purification process platform can consist of two basic steps: (1) an affinity capture of the target protein and (2) a subsequent polishing step which the impurities present in the eluted product from the affinity step can be reduced to an acceptable level. The affinity capture step can be the use of a fusion product comprising an affinity tag, a self-cleaving intein, and a therapeutic target protein. This fusion is initially adsorbed onto a chromatography column and washed of impurities, after which the target protein is eluted by pH-induced self-cleavage of the intein-affinity tag. For the polishing step the use of membrane chromatography columns incorporating either conventional or mixed mode ligands used together with novel elution conditions can be used. The self-cleaving affinity tag used together with a suitable polishing step in this system represents a new platform for the purification of non-antibody proteins. A platform of this type has never been applied to general recombinant therapeutic proteins.
The intein purification method allows a product to be recovered directly from a cell free reactor and produce a purified therapeutic protein of interest in a form suitable for parenteral administration at a high product yield.
Development of Capture Methods Using an Intein Fusion Product:
In order to accomplish the intein-based affinity capture method proposed here, gene fusions can be constructed using conventional PCR cloning methods. The fusions can include different combinations of affinity tag, self-cleaving intein and target protein. The basic strategy for the intein based method is shown in
Evaluations of the intein performance can rely on small-scale expression and quantification using conventional assays. As stated above, particular attention can be paid to expression level (productivity), premature cleaving and cleaving efficiency during purification (yield), and purity. Assessments can be made using SDS-PAGE for early experiments, and HPLC during later optimization. Final assessments can include specific activity assays and more advanced bioequivalence assays.
Ultimately, a combination of tag and intein can be selected for each target protein such that expression, cleaving and purity are maximized for downstream polishing. Based on previous work, there is potential to acquire greater than 80% yield in the intein-based affinity steps, which combine initial capture and rough purification of the initial target. Specific minimal performance metrics can be determined for each therapeutic target protein, and the optimal designs can be incorporated into the device DNA and methodology libraries.
Background and Significance
The importance of highly purified biopharmaceutical proteins and enzymes cannot be overstated. Well-known blockbuster examples from industry include Remicade® for the treatment of Rheumatoid Arthritis (RA), Avastin® for metastatic cancers, Rituxan® for RA and Non-Hodgkin's Lymphoma, and dozens of other lifesaving recombinant antibodies and glycoproteins. Although some progress has been made in the expression of glycoproteins in microbial and yeast hosts, the vast majority of complex biopharmaceutical glycoproteins are still expressed in mammalian cell culture, where the most commonly used host is Chinese Hamster Ovary (CHO) cells. Further, dramatic increases in mammalian cell culture productivity, due to newly engineered cell lines and well-designed fed-batch processes, are making CHO and other hosts highly efficient for glycoprotein production at both laboratory and manufacturing scales. Monoclonal antibodies, which make up a large percentage of biologics, can be purified using the Protein A affinity platform, but increasingly important non-antibody glycoproteins cannot. These proteins require individual methods to be developed (
This approach is modeled after conventional affinity tag methods used ubiquitously in microbial recombinant protein expression. In this method, an easily purified affinity tag is genetically fused to the target protein to facilitate its purification (
This study seeks to enable the use of tag methods for biopharmaceutical production by generating effective self-cleaving protein modules that can uniquely be used in mammalian cell culture (
Neisseria
meningitides FrpC
Staph aureus
Vibrio cholerae
The disclosed research effort has been the development of self-cleaving purification tags based on C-terminal cleaving inteins (
Intein-tag fusion proteins have been expressed in CHO cells and Pichia pastoris. However, a major obstacle has become premature cleaving of the target protein during expression, which substantially decreases final yields of purified target. This is due to the fact that the cleaving reaction is solely dependent on pH and temperature. This dependence has been an asset in microbial expression hosts, but has become a liability when applying these systems to mammalian cell culture (
Potentially Transformative Aspects
The impact of this work is indicated by the success of two existing related technologies. The first is the use of conventional affinity tags in laboratories throughout the world for the purification of recombinant proteins expressed in microbial hosts. These methods have changed the way molecular biology is studied, and have impacted the development of countless therapeutic proteins on the market today. The second is the universal application of Protein A affinity methods to the manufacture and study of recombinant antibodies produced in mammalian cell culture. The popularity of this expensive, yet powerful method for antibody purification illustrates the appeal of simple affinity methods for the purification of mammalian cell culture products. However, Protein A affinity methods cannot be applied to non-antibody products, and conventional affinity tag methods have yet to penetrate mammalian cell culture processes. Thus, the disclosed work lies at the intersection of these two technologies. It seeks to provide a new platform method, with the compelling appeal of Protein A for purification, but with the universal applicability of conventional microbial affinity tags for virtually any target. The resulting methods can have a similar impact to the now ubiquitous affinity tags used in microbial expression, but applied to the production of complex glycoproteins in mammalian and other eukaryotic hosts.
Development of Self-Cleaving Tags for Mammalian Cell Culture Applications Overall Approach:
Rational active-site redesign can be combined with a yeast display-based evolutionary approach to develop a highly controllable self-cleaving intein for mammalian cell expression systems. This is a deviation from previously published approaches, which have relied on random mutagenesis with in vivo genetic selections for controlled intein cleaving. A critical shortcoming of these previous approaches is that direct selections for inteins sensitive to metal ions, small-molecule ligands, pH changes, strong temperature shifts, or any non-physiological condition, are impossible because these conditions cannot generally be manipulated inside a growing cell. Further, the use of random mutagenesis greatly decreases the probability that critical combinations of mutations will ever be observed. Thus, the disclosed approach derives from the specific focus on residues and structural features that are known to be critical to intein cleaving function, and from the selection of the resulting mutants in a fully flexible in vitro environment. This strategy can generate optimized mutant inteins, designed to be stable and uncleaved at the physiological conditions of a desired expression host, but that cleave rapidly under convenient downstream process conditions in vitro.
Introduction of engineered metal binding sites into the intein active center. Several lines of evidence indicate that intein cleavage can be controlled through the introduction of a metal binding site into the intein active center (
Histidine residues H429 and H439 of the ΔI-CM mini intein (residue numbering is relative to the full-length Mtu RecA intein) are critical to the intein active site. A metal binding site that includes one or both of these residues could sequester the enzymatically active imidazole nitrogens and prevent their interactions with N440, thus interfering with the cleaving reaction. The Synechocystis sp. PCC6803 DnaE intein and the Mtu RecA intein splicing activities are naturally and reversibly inhibited by as little as 2 mM divalent zinc. A crystal structure of a minimized Mtu RecA splicing intein, in complex with divalent zinc, showed cross-protein metal binding interactions with active site residues H429, H439, E424, and the cyclized N440 succinimide (Protein Data Bank: 2IMZ). Interaction of a cleaving intein mutant alone in free solution with Zn2+ was studied using isothermal titration calorimetry. The binding constant for zinc was reported to be 6.8 nM, and likely involves specific metal coordination to H429 and H438. Unfortunately, this naturally occurring zinc binding site recruits ligands from two intein molecules aligned in a dimer within the protein crystal structure. Inteins with a fused N-terminal affinity tag and a C-terminal target protein fail to form this dimer structure and bind zinc efficiently, and thus fail to be inhibited. It is this binding site that can be augmented through protein engineering. In particular, an additional peptide segment with several metal coordinating side chains can be appended onto the N-terminus of the intein sequence, thus taking advantage of the proximity of the N and C-termini of the intein to “graft” on a new metal binding center that includes critical residues of the intein active site (
Results
Rational protein design methods in conjunction with traditional template-driven PCR methods have been used to construct six Mtu RecA mutants in which divalent zinc binding sites recruit at least one critical active site residue. In each case, six or eight amino acids were added to the N-terminus of the intein to introduce the new metal-binding site. Once constructed, these engineered mutants were expressed in E. coli host cells for initial characterization of zinc binding and cleavage activity in vitro. Remarkably, several of these mutants exhibit significantly greater sensitivity to zinc than the original ΔI-CM parent intein. The most promising of these mutants, LN-004b (
Experimental Plan
Stronger zinc binding can be beneficial for mammalian and other expression host applications. A two-pronged approach can be used to the optimization of the engineered intein mutants. The first approach can be to use the knowledge gained from the initial set of designs to inform a second round of rationally engineered metal binding centers. The initial six designed inteins have already been characterized and provide a clearer understanding of the strengths and weaknesses of the computational design methods. A reassuring result is that the LN-004b intein was predicted to have the strongest zinc binding, based on the angles and lengths of the predicted metal coordination bonds. These data indicate that an iterative rational approach, where each iteration is driven by experimental laboratory data, can generate highly optimized mutants. Another approach can be to target random mutagenesis of the residues surrounding the engineered binding center, coupled with the yeast display screen. In this case, beneficial random mutations can be screened, where the computational and structural models can be used to determine the specific residues targeted for mutagenesis.
Evolutionary methods can be applied to the optimization of the rationally designed inteins, as well as inteins designed for altered pH and temperature activity profiles. These approaches can include the development of an effective in vitro intein activity screening system based on yeast surface display, and a targeted mutant library, focused specifically on active site residues associated with control of the intein cleaving.
The impact of self-cleaving purification tags can be much greater if they can be used as a platform for biopharmaceutical manufacturing. To encourage their adoption, their performance can be demonstrated in the context of a cGMP process, with a focus on their incorporation into established conventional unit operations. Because CHO is the primary source of recombinant glycoproteins in the biopharmaceutical industry, it will be one of the primary targets. An important alternative is Pichia pastoris, which has recently been engineered to produce human glycosylation patterns on secreted protein products. The intein fusions can initially be evaluated for overall target expression and suppression of premature cleaving in these cells, with the goal of generating an optimized intein toolbox for various mammalian and eukaryotic host organisms. A critical aspect of this work is the choice of affinity tag. In particular, there are no manufacturing scale bulk sources for practically any conventional affinity resins (such as amylose, chitin or glutathione), largely due to the fact that they are never used at manufacturing scales. Further, these resins have typically not been optimized for binding capacity as conventional biopharmaceutical purification resins have, leaving them unacceptably inefficient at large scale. For this reason, alternate tags, with specific affinities for established industry standard purification resins, are studied. An important candidate tag in this area is the Choline Binding Domain of the major autolysin (C-lytA) from Streptococcus pneumoniae. This tag binds very tightly and specifically to the quaternary amine of choline, imparting it with strong and selective affinity for quaternary amine ion exchange resins. Most importantly, the Choline Binding Domain can bind strongly to Q-sepharose resins, even in the presence of 1.5 M NaCl. Most proteins will not bind Q-sepharose under these conditions, causing the choline binding tag to act effectively as an affinity tag for Q-sepharose, providing a very high degree of purity in a single column process (
Results
In previous work with eukaryotic host cells, expression of intein-tagged fusion proteins in both CHO and Pichia was attempted. The ELP and chitin binding tags were used in these experiments, where they were combined with cleaving and non-cleaving control inteins to determine overall expression levels and product losses due to premature tag cleaving. These experiences (described below) allow for the incorporation of new inteins into the existing characterization framework, as well as the new choline binding tag.
The data shows that in both CHO and Pichia, expression of intein-containing fusion proteins was possible with the original ΔI-CM intein, but unacceptable levels of premature cleaving were observed in both hosts. In CHO, an oncoM secretion leader sequence was used, followed by the ELP tag and intein genes, fused to secreted alkaline phosphatase as the target protein. A constitutive CMV promoter drove expression of the tagged fusion protein in a DG44 cell line, and in later experiments gene expression was amplified by methotrexate (MTX) addition. Gene expression could be amplified, although it typically reached only 10% to 50% of the untagged control protein. The use of a non-cleaving control intein with the ELP tag lead to the lowest observed levels, which were approximately 220 milligrams per liter of fusion protein, when expressed in shaker flask cultures at 400 nM MTX. The cleaving intein delivered approximately 800 mg/liter (by activity) under the same conditions. In Pichia, expression was induced by methanol addition, but no significant product was secreted with the ELP tag fused to either intein (cleaving or non-cleaving).
Chitin binding domain-tagged proteins expressed well in Pichia, and existing self-cleaving chitin-intein tags were used to purify both β-lactamase and β-galactosidase. In particular, the overall recovery of β-galactosidase using this method was 30% (by activity), with a 100-fold purification factor. Significant losses occurred due to excessive premature cleaving, however, leading to unacceptably low overall yields (milligrams per liter).
The choline binding tag exhibits excellent performance as a purification tag when expressed in E. coli, but the binding capacity of the Q-sepharose resins is typically on the order of 2 to 3 mg/ml of bed volume. This is unacceptably low, and additional process conditions to increase this capacity are being performed. The choline binding tag has been combined with several secretion leader sequences and expressed in CHO-S in transient transfection with several control inteins. The results have been mixed, indicating zinc can affect both cleaving and secretion.
It has been established that intein fusions can be expressed in two important biopharmaceutical expression hosts. The ability to express highly tractable test proteins in Pichia and CHO indicates that performance benchmarks will be fairly easy to establish as new inteins become available.
Experimental Plan
Existing ΔI-CM intein and future intein mutants can be adapted for cGMP manufacturing processes. Combining these inteins with the choline binding module and other conventional affinity tags that might be incorporated into a cGMP purification process with minimal validation effort can be performed. Quaternary amine ion exchange resins in particular have been optimized for extremely high binding capacities, and they can be recycled many times. Most notably, Q-resins have an established track record with the FDA, and extensive tests are available to determine their effectiveness for a given target protein. Therefore, this resin can be adapted to an intein process with minimal cGMP validation.
A broad variety of target proteins can be expressed which have been selected based on the availability of convenient activity assays and antibodies for Western blots. These proteins have included β-galactosidase, β-lactamase, secreted alkaline phosphatase, green fluorescent protein, maltose-binding protein, carbonic anhydrase, S824 protein, and others. By expressing these test target proteins in combination with a variety of tags and inteins, the impact of the tag, intein, intein cleaving rate, and expression system on overall process yields can be evaluated. Particular attention can be paid to the impact of the purification tag on protein expression and secretion, which can be evaluated through the use of various tags and untagged target proteins. The rapidly cleaving ΔI-CM intein is also available, along with noncleaving control inteins, to evaluate the effects of the mutant tag-intein fusion combination on overall expression and secretion of the target protein. These experiments in particular, can provide benchmarks on the effects of intein tags on overall protein expression, which will translate directly to the attractiveness of these expression systems and their likely process economics.
Summary
These experiments allow for the ability to directly select for controllable cleaving activity under fully flexible in vitro conditions and allowing selected mutants to be targeted to industrially important protein expression platforms. This is a significant deviation from previously published approaches, where intein reporter and selection systems have been developed for in vivo intein splicing. Additionally, a lack of selectable reporter proteins that are strongly affected by intein cleaving (as opposed to splicing) has resulted in few selection systems for intein cleaving. For these reasons, these previous methods have not been successful in generating fully controllable cleaving. By generating selection systems directly for intein cleaving in vitro, the conditions to which the intein is exposed during selection can be specified. Further, the design of these systems provides a strong and quantitative readout for intein cleaving and cleavage rate, as well as an efficient selection method for isolating desirable mutants. These aspects can allow for unprecedented control over the selection conditions, and therefore the ultimate behavior of the evolved inteins.
This work is focused on developing inteins that are directly relevant to industrially important protein expression systems and downstream processes. First and foremost among these is the CHO cell expression system, which is the main industry workhorse for producing recombinant antibodies and other therapeutic glycoproteins at multi-kilogram scales. Previous approaches have focused been primarily on controllability at laboratory scales, without consideration of eventual large-scale bioprocess development (as with IMPACT system). Although the work proposed here draws on established methods in molecular biology, it is unique in its focus on delivering a directly useful product for large-scale bioprocess engineering.
This work provides a metal binding site design strategy for controlling intein function, and the potential for this strategy to be adapted for other protein targets. In particular, the strategy indicates that an engineered metal binding motif can be used to sequester active site residues in inteins or other target proteins. By establishing a platform for reliably engineering various control mechanisms into the inteins, a means to study a range of potential control methods for additional proteins can be provided, which can also include pH and temperature variations in the presence of metal ions. This knowledge will find utility in many applications, ranging from the development of allosteric proteins for metabolic engineering, to therapeutic proteins that can be activated in situ.
The work in protein purification focused on the development of two self-cleaving tag-based nonchromatographic protein methods. One method is based on the production of polyhydroxybutyrate (PHB) granules in E. coli that act as affinity carriers for a co-expressed, tagged target protein. In this way, the cells provide both the affinity matrix and tagged target protein for purification. Once the granules are recovered and washed, the bound purified target protein is cleaved from their surface by the self-cleaving intein. This method has been demonstrated in E. coli and a highly productive Ralstonia strain. An initial analysis indicates a substantial economical advantage over conventional affinity separations. Another method relies on an intein fusion with an elastin-like peptide (ELP). In this case, the ELP portion of the tag is designed to reversibly precipitate upon gentle heating (about 30° C.) at salt concentrations in the 1M range. This highly specific reversible precipitation forms the basis for the separation, allowing the uncleaved precursor protein to be captured, concentrated and purified by simple cycles of heating and centrifugation or filtration (
This application is a divisional of U.S. patent application Ser. No. 14/418,858, filed Jan. 30, 2015, now U.S. Pat. No. 9,796,967, which is a 371 of PCT/US2013/053195, filed Aug. 1, 2013, which claims benefit of U.S. Provisional Application No. 61/678,303, filed Aug. 1, 2012, and U.S. Provisional Application No. 61/777,068, filed Mar. 12, 2013, each of which are hereby incorporated herein by reference in their entirety.
This invention was made with government support under contract HHSN261200800001E awarded by the National Cancer Institute and the National Institutes of Health. The government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 20060030007 | Byrd et al. | Feb 2006 | A1 |
| 20090098611 | Wood et al. | Apr 2009 | A1 |
| 20110172391 | Liu et al. | Jul 2011 | A1 |
| Number | Date | Country |
|---|---|---|
| 2001012820 | Feb 2001 | WO |
| Entry |
|---|
| International Search Report of the International Searching Authority/US, issued in related application PCT/US2013/053195 dated Mar. 11, 2014. |
| Mills et al., “Reversible Inhibition of Protein Splicing by Zinc Ion”, The J of Biol. Chem. 276:14, 2001, 10832-10838. |
| Number | Date | Country | |
|---|---|---|---|
| 20180346891 A1 | Dec 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| 61678303 | Aug 2012 | US | |
| 61777068 | Mar 2013 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 14418858 | US | |
| Child | 15707588 | US |
