Claims
- 1. A ribozyme library comprising a collection of ribozyme genes encoding a hammerhead structure and flanking sequences of random nucleotides cloned at least once into an expression cassette for ribozyme expression, wherein said expression cassette contains a T7 promoter proximal to the 5' end of said cassette, an adenoviral va-RNA-gene adjacent to said promoter, and a loop region located in the central part of said gene, said loop region defined as a series of adjacent nucleotides between a first nucleotide and a second nucleotide, said first nucleotide further linked on either side to adjacent nucleotides other than the second nucleotide, and the second nucleotide further linked on either side to adjacent nucleotides other than the first nucleotide.
- 2. The ribozyme library of claim 1, wherein the library contains from about 10.sup.9 to about 10.sup.11 ribozyme genes.
- 3. The ribozyme library of claim 1, wherein said hammerhead structure comprises a double stranded DNA having the sequence CTGATGAGTCCGTGAGGACGAAAC (Seq. Id. No. 1).
- 4. A process for identifying and isolating a ribozyme, comprising
- incubating with a ribozyme library a DNA or RNA sequence having a predetermined target sequence, said ribozyme library comprising a collection of ribozyme genes encoding a hammerhead structure and flanking sequences of random nucleotides cloned at least once into an expression cassette for ribozyme expression,
- identifying the resulting cleaved targets, and
- isolating the cleaving ribozyme.
- 5. The process of claim 4, wherein said DNA or RNA sequence is an in vitro transcribed RNA, a total-RNA, or a cytoplasmic cell RNA, and said incubating is carried out in the presence of 100 .mu.m of a Mg salt.
- 6. The process of claim 5, wherein said process for identifying is carried out by a PCR reaction with gene-specific primers, and the isolation of the cleaved targets is carried out by electrophoresis in a gel.
- 7. The process of claim 5, wherein the ribozyme target RNA is isolated from the cleaved target gel, and identified by sequencing of the cleavage sites.
- 8. The process of claim 4, wherein a preselected ribozyme is isolated from the library by hybridization with two oligonucleotides that are specific for the preselected ribozyme, and the isolated ribozyme is employed as an expression clone.
Priority Claims (2)
Number |
Date |
Country |
Kind |
44 24 761 |
Jul 1994 |
DEX |
|
44 24 762 |
Jul 1994 |
DEX |
|
Parent Case Info
This application is a continuation-in-part of U.S. Ser. No. 08/712,803, filed Sep. 12, 1996 (now abandoned), which is a continuation of U.S. Ser. No. 08/314,587, filed Sep. 28, 1994 (now abandoned); and is also a continuation-in-part of U.S. Ser. No. 08/314,588, filed Sep. 28, 1994, now U.S. Pat. No. 5,695,992.
US Referenced Citations (3)
Number |
Name |
Date |
Kind |
5254678 |
Haseloff et al. |
Oct 1993 |
|
5496698 |
Draper et al. |
Mar 1996 |
|
5695992 |
Lieber et al. |
Dec 1997 |
|
Foreign Referenced Citations (1)
Number |
Date |
Country |
2687411 |
Aug 1993 |
FRX |
Non-Patent Literature Citations (1)
Entry |
J. Cell Biochem Sppl. O, vol. 17, No. E, 1993 "Design of Quasi-random Ribme Expression Vectors". |
Continuations (1)
|
Number |
Date |
Country |
Parent |
314587 |
Sep 1994 |
|
Continuation in Parts (2)
|
Number |
Date |
Country |
Parent |
712803 |
Sep 1996 |
|
Parent |
314588 |
Sep 1994 |
|