RNA transformation vectors derived from a single-component RNA virus and contain an intervening sequence between the cap and the 5′ end

Abstract

This invention is directed to a plus strand RNA viral vector for transformation of a host organism with a foreign RNA, and expression of said foreign RNA. The foreign RNA is inserted into an infective RNA viral segment containing cis-acting viral replication elements, and allowed to infect the host organism. The RNA vector is modified to obtain infectivity by including an intervening sequence between the cap and the 5′ end. The modified RNA is able to tolerate the exogeneous RNA segment without disrupting the replication of the modified RNA, in the absence of a trans-acting viral replication element in a single component plant virus host cell.

Description

FIELD OF THE INVENTION

This invention relates to the field of plant viruses, more particularly to plus-sense RNA plant virus, and to modifications, made according to the teachings herein, which permit insertion of an exogenous RNA segment into the viral genome. The recombinant plant viral nucleic acid construct derived from insertion of an exogenous RNA segment into the viral genome can then be introduced into a host cell in order to modify the cell.

BACKGROUND OF THE INVENTION

RNA viruses whose genome is composed of a single RNA strand capable of replication in the cytoplasm of a host by direct RNA replication are widespread, many varieties of which are known to infect plants. Such viruses are sometimes termed “(+) strand RNA viruses” since the infective RNA strand, that normally found encapsidated in the virus particle, is a messenger-sense strand, capable of being directly translated, and also capable of being replicated under the proper conditions by a direct process of RNA replication. Viruses belonging to this group include “single component (+) strand RNA viruses”, which replicate in the absence of trans-acting viral replication elements. These viruses may include, but are not limited to any of the representatives of the following virus groups, Carlavirus, Closteroviridae, Luteoviridae, Potexvirus, Potyviridae, Tombusviridae, Tobamovirus and Tymovinis. (Similar viruses, which in the host cell produce a trans-acting replication element, are not included in this group.) In these cases, the entire virus genome is contained within a single RNA molecule, while in the multicomponent RNA plant viruses, the total genome of the virus consists of two or more distinct RNA segments, each separately encapsidated. For general review, see General Virology, S. Luria and J. Darnell; Plant Virology 2nd ed., R. E. F. Matthews, Academic Press (1981). For a general review of (+) strand RNA replication, see Davies and Hull (1982) J. Gen. Virol. 61:1.

Despite the well-documented diversity between virus groups, recent studies have shown striking similarities between the proteins, which function in RNA replication. Sequence homologies have been reported between the cowpea mosaic virus, poliovirus and foot-and-mouth disease virus, (Franssen, H. (1984) EMBO Journal 3,855). Sequence homologies have been reported between non-structural proteins encoded by alfalfa mosaic virus, brome mosaic virus and tobacco mosaic virus, Haseloff, J. et al. (1984), Proc. Nat. Acad. Sci. USA 81, 4358, and between non-structural proteins encoded by sindbis virus, Ahlquist, P. et al. (1985) J. Virol. 53, 536. Evidence of such substantial homology in proteins related to the replication functions indicate that the viruses share mechanistic similarities in their replication strategies and may actually be evolutionarily related. Ahlquist et al., in U.S. Pat. No. 5,500,360 made modifications to the genomic RNA of a (+) strand RNA virus of a multipartite Brome mosaic virus. The modified RNA was used to transfer a desired RNA segment into a targeted host plant protoplast, and to replicate that segment and express its function within the host protoplast.

In contrast to the Brome mosaic virus (BMV), the tobacco mosaic virus (TMV) is one member of a class of plant viruses characterized by a single RNA genome. The genetic material of the virus is RNA, and the total genetic information required for replication and productive infection is contained in one discrete RNA molecule. Infection of a host plant cell occurs when the single RNA component of the viral genome has infected the cell, for example by exposing a plant to a virus preparation. Infection may also be achieved by exposing a plant cell or protoplast to a virus preparation. TMV does not require coat protein for infection. The RNA component is both necessary and sufficient for replication and productive infection. The TMV genome is a single messenger-sense RNA. The term “messenger-sense” denotes that the viral RNAs can be directly translated to yield viral proteins, without the need for an intervening transcription step.

Complete cDNA copies of the genetic component of TMV have been cloned. Construction of a library of subgenomic cDNA clones of TMV has been described in Dawson et al., Proc. Natl. Acad. Sci. USA 83:1832-1836 (1986) and Ahlquist et al., Proc. Natl. Acad. Sci. USA 81:7066-7070 (1984). Several examples of TMV transcription vectors are described below. DNA from each of the TMV cDNA-containing plasmids can be cleaved. The linear DNA thus produced can be transcribed in vitro in a reaction catalyzed by RNA polymerase. A T7 promoter in the transcription vector allows RNA synthesis to initiate at the 5′ terminus of each TMV sequence, and transcription continues to the end of the DNA template. The 5′ terminus of tobacco mosaic virus (TMV) RNA, was identified as m 7 G 5′ ppp 5′ Gp. Zimmern, D., Nucleic Acid Res. 2:1189-1201 (1975). Keith, J. and fraenkel-Conrat, H. FEBS Lett. 57:31-33 (1975). Ahlquist, U.S. Pat. No. 5,500,360, working with Brome mosaic virus, reported that when transcription is carried out in the presence of a synthetic cap structure, m 7 GpppG, as described by Contreras, R., et al. Nucleic Acids Res. 10:6353, (1982), RNA transcripts are produced with the same capped 5′ ends as authentic BMV RNAs. Ahlquist concluded that these RNAs are active messengers in in vitro translation systems and direct production of proteins with the same electrophoretic mobilities as those translated from authentic BMV RNAs. However, Ahlquist found that, “if the cap analog was omitted during in vitro transcription, no infection was detected, even if inoculum concentration was increased 20-fold.” Further, Ahlquist taught only a viral vector having “no extraneous nonviral sequences between the cap and the 5′ terminus of the viral sequence.” In Ahlquist's work on BMV, U.S. Pat. No. 5,500,360, a transcription vector was employed which preserved the exact 5′ terminal nucleotide sequence of viral RNA. It is now generally accepted that capping is necessary for infectivity and that no intervening sequence can be present between the cap and the 5′ terminus of the viral sequence.

The work of Ahlquist leaves us with difficult problems to overcome if we are to obtain a workable viral vector or a commercially viable viral vector. One such problem is the cost of using capping structures and cap analogs. Another such problem is that multipartite viral vectors are difficult to use relative to a single component viral vector. Multipartite viruses require more than one unit to infect and achieve replication in a host plant, and multipartite viruses require a trans acting replication element to achieve replication. No one has yet found a way to unite the multiple strands of a multipartite virus into an RNA molecule comprising the entire genome of a (+) strand RNA virus as suggested and claimed by Ahlquist.

Therefore, there is a need for a viral vector that can accept an intervening base or intervening sequence of bases between the cap and the 5′ terminus of the viral sequence and undergo transcription and replication. There is also a need for a viral vector that can undergo transcription and replication in the absence of a capping structure.

Here we teach solutions to the problem by demonstrating:

1. Infection of a host and replication of a viral vector in vivo in the presence of a base or a sequence of bases placed 5′ to the origin of replication in the absence of a capping structure or cap analog.

2. Infection of a host and replication of a viral vector in vivo in the absence of a capping structure or a cap analog, and in the absence of a base or a sequence of bases placed 5′ to the origin of replication.

3. Infection of a host and replication of a viral vector in vivo in the presence of an intervening base or an intervening sequence of bases placed 5′ to the origin of replication and in the presence of a capping structure or cap analog.

The viral vectors demonstrated here have utility in discovery the function of genes, and in production of therapeutic proteins.

SUMMARY OF THE INVENTION

The For the sake of brevity, the term “RNA virus” is used herein to mean (+) strand replicating RNA viruses. Most single component RNA viruses have the advantage over multicomponent RNA viruses of having a single RNA structure. Because they have a single RNA structure, the function of an exogenous RNA segment can be expressed in a host cell in the absence of a trans-acting replication element. Further, the single component RNA virus does not express the 3a movement gene that is indigenous to the Brome mosaic virus.

The invention is based on the discovery that the 5′ end of a single component RNA viral vector can be modified by leaving out the capping structure so that the virus transcript is uncapped. The invention is also based on the discovery that the 5′ end of a single component RNA viral vector can be modified by inserting a base or a sequence of bases ahead of the 5′ terminus of the viral sequence. The invention is also based on the discovery that the 5′ end of a single component RNA viral vector can be modified by inserting an intervening base or an intervening sequence of bases between the cap and the 5′ terminus of the viral sequence. The genome of a virus, modified in each of these three ways, can be further modified to include an exogenous RNA segment. The further modified RNA can be introduced into a host cell where it will replicate and express the exogenous RNA segment. The recipient cell is thereby phenotypically transformed and may contribute to a genotypically transformed organism, as well.

Phenotypically transformed plants and plant cells can be modified in vivo, in planta, in tissue culture, in cell culture or in the form of protoplasts. The exemplified embodiment of the invention is useful for producing phenotypically transformed plants under field or greenhouse growth conditions. Traits desirable for introduction in this manner include, but are not limited to, pest resistance, pathogen resistance, herbicide tolerance or resistance, modified growth habit and modified metabolic characteristics, such as the production of commercially useful peptides or pharmaceuticals in plants. The modifications can be applied at any time during the growth cycle, depending on the need for the trait. For example, resistance to a pest could be conferred only if the crop were at risk for that pest, and at the time when the crop was most likely to be affected by the pest. Other traits can be used to enhance secondary properties, for example to increase the protein content of post-harvest forage. Any plant variety susceptible to infection by a single component RNA virus can be phenotypically transformed. The choice of virus and the details of modification will be matters of choice depending on parameters known and understood by those of ordinary skill in the art. Other uses for cells and organisms phenotypically or genotypically modified by means of a modified RNA derived from an RNA virus will be readily apparent to those skilled in the art, given a wide range of RNA viruses to modify and a wide range of susceptible host cell types. Other uses for transformed animal cells, bacterial cells and the like can be readily envisioned but are not demonstrated here.

Generally, the steps of a process for phenotypically transforming a cell or organism are:

forming a full-length cDNA transcript of the RNA virus;

cloning the cDNA in a transcription vector;

modifying the cDNA by inserting a non-viral DNA segment in a region able to tolerate such insertion without disrupting RNA replication thereof;

transcribing the modified cDNA corresponding to the RNA component of the single component virus;

infecting virus-susceptible protoplasts, cells, tissues or whole plants with transcribed RNA, either in solution or encapsidated, of the modified RNA comprising messenger-sense RNA containing an exogenous RNA segment.

From this point, the steps to be followed will vary, depending on the type of material infected and the route of infection. Protoplasts, cells and tissues of plants can be propagated vegetatively, regenerated to yield whole plants by means of any technique suitable to the particular plant variety infected, and transplanted to the field. Whole plants can be infected in situ. Infected plants and plant cells can produce many copies per cell of the modified viral RNA containing the exogenous RNA segment. If desired and if suitably inserted, by means of principles and processes known in the art, the exogenous RNA segment can be caused to carry out a function within the cell. Such a function could be a coding function, translated within the cell to yield a desired peptide or protein, or it could be a regulatory function, increasing, decreasing, and turning on or off the expression of certain genes within the cell. In principle, any function, which a segment of RNA is capable of providing, can be expressed within the cell. The exogenous RNA segment thus expressed confers a new phenotypic trait to the transformed organism, plant, cells, protoplasts or tissues.

The invention is exemplified herein by the modification of TMV RNA to contain a structural gene encoding green fluorescent protein (GFP) and the phenotypic modification of Nicotiana plants and protoplasts therewith, yielding plants and protoplasts synthesizing GFP. The data presented herein are believed to represent the first instance of phenotypic modification of a cell by means of an RNA virus which is uncapped and which has no base at the 5′ end of the uncapped viral sequence.

The data presented herein are believed to represent the first instance of phenotypic modification of a cell by means of an RNA virus which is uncapped and which has a single base or a sequence of bases at the 5′ end of an uncapped viral sequence. The data presented herein are believed to represent the first instance of phenotypic modification of a cell by means of an RNA virus which contains an intervening base or intervening sequence of bases between the cap and the 5′ end of the viral sequence.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows the sequence of pBTI 30BGFPc3 (p1037)(SEQ ID NO: 22).

FIG. 2 shows the sequence of pBTI SBS60 (SEQ ID NO: 23).

FIG. 3 shows the sequence of pBTI SBS60-29 (SEQ ID NO: 24).

FIG. 4 shows the sequence of pBTI1056 (SEQ ID NO: 25).

FIG. 5 shows the sequence of pBTI SBS5 (p1057) (SEQ ID NO: 26).

FIG. 6 shows the sequence of pBTI1056-GTN28 (SEQ ID NO: 27).

DETAILED DESCRIPTION OF THE INVENTION

In order to facilitate understanding of the invention, certain terms used throughout are herein defined.

Base—The term base means adenine, thymidine, guanine, and cytosine, which in the form of a nucleotide can bond with other bases to form a nucleotide sequence. As used herein, a “base sequence” or a “sequence of bases” refers to a nucleotide sequence. The bases used herein are DNA bases, because all base or base sequence manipulations are performed on plasmid DNA prior to transcription. Base might be used interchangeably with “nucleotide”.

RNA virus—The term as used herein means a virus whose genome is RNA in single-stranded form, the single strand being a (+) strand, or messenger-sense strand. Replication of the viral (+) strand in a virus-infected cell occurs by a process of direct RNA replication and is therefore distinguishable from the replication mechanism of retroviruses which undergo an intermediate step of reverse transcription in the host cell.

Cis-acting replication element—This term denotes that portion of the RNA genome of an RNA virus which must be present in cis, that is, present as part of each viral strand as a necessary condition for replication. Virus replication of a single component virus such as TMV has only cis-acting replication elements in its RNA. The cis-acting replication element is composed of one or more segments of viral RNA, which must be present on any RNA molecule that is to be replicated within a host cell by RNA replication. The segment will most likely be the 5′ terminal portion of the viral RNA molecule, and may include other portions as well. As is demonstrated herein, using the example of TMV, substantial portions of an RNA virus molecule may be modified, by deletion, insertion, or by a combination of deletion and insertion, without disrupting replication.

Trans-acting replication element—In contrast to the single component (unipartite) virus, virus replication of a multipartite virus such as BMV presumably depends upon the existence of one or more trans (diffusible) elements which interact with the cis-acting element to carry out RNA replication. While trans-acting elements are necessary for replication of a multipartite virus such as BMV, they need not be present or coded for on the modified RNA provided they are made available within the infected cell by some other means. For example, in the case of a multipartite RNA virus, the trans-acting functions may be provided by other, unmodified components of the viral genome used to transform the cells simultaneously with the modified RNA. The target cell may also be modified in a previous step to provide constitutive expression of the trans-acting functions. In the case of a multipartite virus, the cis-acting element is therefore defined in functional terms: any modification which destroys the ability of the RNA to replicate in a cell known to contain the requisite trans-acting elements, is deemed to be a modification in the cis-acting replication element. Conversely, any modification, such as an insertion in a sequence region, which is able to tolerate such insertion without disrupting replication, is a modification outside the cis-acting replication element.

The term “derived from” is used to identify the viral source of an RNA segment, which comprises part of the modified RNA. For example, for the modified RNAs described herein, substantial portions thereof are derived from TMV. The manner of deriving, whether by direct recombination at the RNA level, by transcription or by reverse transcription does not matter for the purpose of the invention. Indeed, it is contemplated that modifications may be made within the cis-acting replication element and elsewhere for example to modify the rate or amount of replication that is obtained. In the case of modified RNAs exemplified herein, a transcription vector was employed which, preserved the exact 5′ terminal nucleotide sequence of viral RNA, but a) left the capping structure off, or b) left the capping structure off and added a single base to the 5′ terminal nucleotide sequence of the viral cDNA, or c) left the capping structure off and added a sequence of bases to the 5′ terminal nucleotide sequence of the viral cDNA, or d) inserted a single intervening base between the cap and the 5′ terminal nucleotide sequence of the viral eDNA, or e) inserted an intervening sequence of bases between the cap and the 5′ terminal nucleotide sequence. The use of such a vector in transcribing viral RNA from will be preferred if preservation of the exact nucleotide sequence at the 5′ end is desired. The use of such a vector in transcribing viral RNA from will be preferred if the objective is to only remove the cap without further objectives with respect to the 5′ end of the virus. An RNA segment which has been derived from a given source virus may, but need not be, identical in sequence to that segment as it exists in the virus. It will be understood that a cis-acting replicating element derived from a given RNA virus may have minor modifications in the nucleotide sequence thereof without substantially interfering with RNA replication.

Exogenous RNA segment is a term used to describe a segment of RNA to be inserted into the virus RNA to be modified, the source of the exogenous RNA segment being different from the RNA virus itself. The source may be another virus, a living organism such as a plant, animal, bacteria, virus or fungus, the exogenous RNA may be a chemically synthesized RNA or it may be a combination of the foregoing. The exogenous RNA segment may provide any function that is appropriate and known to be provided by an RNA segment. Such functions include, but are not limited to, a coding function in which the RNA acts as a messenger RNA encoding a sequence which, translated by the host cell, results in synthesis of a peptide or protein having useful or desired properties. The RNA segment may also be structural, as for example in ribosomal RNA, it may be regulatory, as for example with small nuclear RNAs or anti-sense RNA, or it may be catalytic. A particularly interesting function is provided by anti-sense RNA, sometimes termed (−) strand RNA, which is in fact a sequence complementary to another RNA sequence present in the target cell which can, through complementary base pairing, bind to and inhibit the function of the RNA in the target cell. An exogenous RNA segment can be a complete or partial coding sequence.

Various aspects of the stages outlined in the Summary section can be modified as needed, depending upon specific aspects of the virus selected as the transforming agent and of the RNA segment to be inserted. For example, if the inserted gene is in the form of messenger-sense RNA to be directly translated by the transformed cell, the gene must be free of intervening, nontranslated sequences, such as introns. On the other hand, the inserted gene need not be a naturally occurring gene, but it may be modified, it may be a composite of more than one coding segment, or it may encode more than one protein. Combining insertions and deletions in order to control the total length or other properties of the modified RNA molecule may also modify the RNA. The inserted non-viral gene may be either prokaryotic or eukaryotic in origin as long as it is in a form which can be directly translated by the translation machinery of the recipient cell. Eukaryotic genes containing introns within the coding sequence must therefore be inserted in the form of a cDNA copy of the eukaryotic messenger RNA encoding the gene. The inserted gene may contain its own translation start signals, for example, a ribosomal binding site and start (AUG) codon, or it may be inserted in a manner which takes advantage of one or more of these components preexisting in the viral RNA to be modified. Certain structural constraints must be observed to preserve correct translation of the inserted sequence, according to principles well understood in the art. For example, if it is intended that the exogenous coding segment be combined with an endogenous coding segment, the coding segment to be inserted must be inserted in reading frame phase therewith and in the same translational direction.

Host

A cell, tissue or organism capable of being infected by and capable of replicating a nucleic acid such as a plant viral nucleic acid and which is capable of being infected by a virus containing the viral vector or viral nucleic acid. As used herein, host is intended to include generally whole plant, plant protoplast, plant cell, and plant tissues, plant organ or plant part such as root, stem leaf, flower or seed.

Infection

The ability of a virus to transfer its nucleic acid to a host or introduce a viral nucleic acid into a host, wherein the viral nucleic acid is replicated, viral proteins are synthesized, and new viral particles assembled. In this context, the terms “transmissible” and “infective” are used interchangeably herein. The term is also meant to include the ability of a selected nucleic acid sequence to integrate into a genome, chromosome or gene of a target organism.

The term “non-viral” is used here in a special sense to include any RNA segment which is not normally contained within the virus whose modification is exploited for effecting gene transfer and is therefore used synonymously with “exogenous”. Therefore, a gene derived from a different virus species than that modified is included within the meaning of the terms “non-viral” and “exogenous” for the purposes of describing the invention. For example, a non-viral gene as the term is used herein could include a gene derived from a bacterial virus, an animal virus, or a plant virus of a type distinguishable from the virus modified to effect transformation. In addition, a non-viral gene may be a structural gene derived from any prokaryotic or eukaryotic organism. It will be understood by those ordinarily skilled in the art that there may exist certain genes whose transfer does not result in obvious phenotypic modification of the host cell. A phenotypic modification may occur, for example, if the translation product of the non-viral gene is toxic to the host cell, is degraded or processed in a manner which renders it non-functional or possesses structural features which render it impossible for the host cell to translate in sufficient quantities to confer a detectable phenotype on the transformed cells. However, the invention does not depend upon any specific property of an RNA segment or gene being transferred. Therefore, the possible existence of RNA segments or genes which fail to confer a readily observable phenotypic trait on recipient cells or plants is irrelevant to the invention and in any case will be readily recognizable by those of ordinary skill in the art without undue experimentation.

Plant host

A cell, tissue or organism capable of replicating a nucleic acid such as a plant viral nucleic acid and which is capable of being infected by a virus containing the viral vector or viral nucleic acid. As used herein, plant host is intended to include whole plant, plant cell, and plant tissues, plant organ or plant part such as root, stem leaf, flower or seed.

Phenotypic Trait

An observable, measurable or detectable property resulting from the expression or suppression of a gene or genes. Phenotype includes both easily observable traits and biochemical processes.

Plant Cell

The structural and physiological unit of plants, consisting of a protoplast and the cell wall.

Plant Organ

A distinct and visibly differentiated part of a plant, such as root, stem, leaf or embryo.

Plant Tissue

Any tissue of a plant in planta or in culture. This term is intended to include a whole plant, plant cell, plant organ, protoplast, cell culture, or any group of plant cells organized into a structural and functional unit.

Positive-sense Inhibition

A type of gene regulation based on inhibition of gene expression believed to be due to the presence in a cell of an RNA molecule substantially homologous to at least a portion of the mRNA being translated. The RNA molecule can be an exogenous coding sequence carried by an RNA viral vector of the type discussed herein.

Promoter

The 5′-flanking, non-coding sequence substantially adjacent a coding sequence which is involved in the initiation of transcription of the coding sequence.

Protoplast

As used herein means an isolated plant cell without some or all of its cell wall.

Single component virus

Is a virus having a single nucleic acid sequence; unipartite. The single component virus is contrasted with the multicomponent virus, which has more than one nucleic acid component. Each component of a multicomponent virus is individually encapsidated, separate from the other(s).

Subgenomic Promoter

A promoter of a subgenomic mRNA of a viral nucleic acid. Plant viral nucleic acid can be modified to contain an exogenous nucleic acid sequence under the control of a subgenomic promoter.

Systemic Infection

Denotes infection throughout a substantial part of an organism including mechanisms of spread other than mere direct cell inoculation but rather including transport from one infected cell to additional cells either nearby or distant.

Viral Vector

A self-replicating RNA or DNA molecule derived from a virus which transfers an RNA or DNA segment between cells, such as bacteria, yeast, plant, or animal cells and contains an exogenous DNA or RNA segment to be expressed in the host.

A first embodiment demonstrates a capped viral vector having a single base inserted at the 5′ terminus of the viral sequence.

Another embodiment demonstrates a capped viral vector having a sequence of bases inserted at the 5′ terminus of the viral sequence.

In another embodiment, a host cell is infected by a capped viral vector which has a single base inserted at the 5′ terminus of the viral sequence. The capped viral vector is able to infect, to reproduce, to systemically infect the host plant, and to express an exogenous RNA segment.

In another embodiment, a host cell is infected by a capped viral vector having a sequence of bases inserted at the 5′ terminus of the viral sequence. The capped viral vector is able to infect the host cell, to reproduce, to systemically infect the host plant, and to express an exogenous RNA segment.

Another embodiment demonstrates an uncapped viral vector.

In another embodiment, a host cell is infected by an uncapped viral vector. The uncapped viral vector is able to reproduce, to systemically infect the host and to express an exogenous RNA segment.

Another embodiment demonstrates an uncapped viral vector having a single base inserted at the 5′ terminus of the viral sequence.

In another embodiment, a host cell is infected by an uncapped viral vector having a single base inserted at the 5′ terminus of the viral sequence. The uncapped viral vector is able to reproduce, to systemically infect the host and to express an exogenous RNA segment.

Another embodiment demonstrates an uncapped viral vector having a sequence of bases inserted at the 5′ terminus of the viral sequence.

In another embodiment, a host cell is infected by an uncapped viral vector having a sequence of bases inserted at the 5′ terminus of the viral sequence. The uncapped viral vector is able to reproduce, to systemically infect the host and to express an exogenous RNA segment.

An exogenous RNA segment may be inserted at any convenient insertion site provided the insertion does not disrupt a sequence essential for replication of the RNA within the host cell. For example, Dual Heterologous Subgenomic Promoter Expression System (DHSPES) in a plus stranded RNA vector has two subgenomic promoters. An exogenous RNA segment can be expressed in this system by inserting the exogenous gene at the 3′ end of one of the subgenomic promoters. This system is described in U.S. Pat. Nos. 5,316,931, 5,811,653, 5,589,367 and 5,866,785, the disclosure of which is incorporated by reference. An exogenous RNA segment under the control of a subgenomic promoter will be expressed in the host plant. Each heterologous subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. One or more non-native nucleic acids may be inserted adjacent to the native plant viral subgenomic promoter or the native and non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. Moreover, it is specifically contemplated that two or more heterologous non-native subgenomic promoters may be used. The exogenous RNA segment may be transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the products of the exogenous RNA segment.

A virus, whose coat protein is not essential for replication, an exogenous RNA segment may be inserted within or substituted for the region, which normally codes for coat protein. As desired, regions which contribute to undesirable host cell responses may be deleted or inactivated, provided such changes do not adversely effect the ability of the RNA to be replicated in the host cell. For many single component viruses, a reduction in the rate of normal RNA replication is tolerable and will in some instances be preferred, since the amount of RNA produced in a nonnal infection is more than enough to saturate the ribosomes of the transformed cell.

The transformation process itself can be carried out by any means whereby RNA can be introduced into cells, whole plants, plant tissues or protoplasts. The RNA alone or encapsidated in a virus particle can infect host cells, except that the modified viral RNA containing a non-viral RNA segment is substituted for its counterpart in a normal infection. Any other suitable means for introducing RNA into target cells such as microinjection may be used. Other variables of the infection process, such as pretreatment of the recipients, use of encapsidated or unencapsidated RNA, are matters of choice which those of ordinary skill in the art will be able to manipulate to achieve desired transformation efficiency in a given situation. For instance, the choice of single component plant RNA virus to be modified to achieve gene expression in a given plant variety will depend upon known host range properties of single component plant RNA viruses. For example, TMV infects a variety of Nicotiana species and their related domesticated relatives.

Plant cells, which are infected in culture, will normally remain transformed as the cells grow and divide since the RNA components are able to replicate and thus become distributed to daughter cells upon cell division. Plants regenerated from phenotypically modified cells, tissues or protoplasts remain phenotypically modified. Similarly, plants transformed as seedlings remain transformed during growth. Timing of application of the transforming components will be governed by the result that is intended and by variations in susceptibility to the transforming virus or viral RNA during various stages of plant growth.

Using the various embodiments of the invention, an exogenous segment RNA sequence can be expressed in a host by adapting the invention to any of a variety of embodiments set forth below for expressing an exogenous RNA segment. In one embodiment, an exogenous RNA segment is introduced into a plant host by way of a viral nucleic acid which comprises a native plant viral subgenomic promoter, a plant viral coat protein coding sequence, and at least one exogenous RNA segment under the control of a non-native subgenomic promoter.

In a second embodiment, plant viral nucleic acid sequences used in the method of the present invention are characterized by the deletion of the native coat protein coding sequence in favor of a non-native plant viral coat protein coding sequence for the purpose of increasing host range. A non-native promoter, which could be the subgenomic promoter of the non-native coat protein coding sequence, controls expression of the non-native coat protein coding sequence. The non-native coat protein coding sequence is capable of expression in the plant host, of packaging the recombinant plant viral nucleic acid, and ensuring a systemic infection of a permissive host by the recombinant plant viral nucleic acid. The recombinant plant viral nucleic acid may contain one or more additional native or non-native subgenomic promoters.

In a third embodiment, plant viral nucleic acids are used in the present invention wherein the native coat protein coding sequence is placed adjacent to a non-native subgenomic promoter.

In a fourth embodiment, plant viral nucleic acids are used in the present invention wherein the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that the sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the product of the non-native nucleic acid. Alternatively, a non-native coat protein coding sequence may replace the native coat protein coding sequence.

In another embodiment, a viral expression vector contains an exogenous RNA segment encoding a polyprotein. At least one protein of the polyprotein is non-native to the vector. The non-native protein is released from the polyprotein by proteolytic processing catalyzed by at least one protease in the polyprotein. The vector comprises: a) at least one promoter; b) cDNA having a sequence which codes for at least one polyprotein from a polyprotein-producing virus; c) at least one unique restriction site flanking a 3′ terminus of the cDNA; and a cloning vehicle.

Additional embodiments use a viral expression vector encoding at least one protein non-native to the vector that is released from at least one polyprotein expressed by the vector by proteolytic processing. The vector comprises at least one promoter, cDNA having a sequence which codes for at least one polyprotein from a polyprotein-producing virus, may contain at least one restriction site flanking a 3′ terminus of said cDNA and a cloning vehicle. Preferred embodiments include using a potyvirus as the polyprotein-producing virus, and especially preferred embodiments may use TEV (tobacco etch virus). A more detailed description of such vectors useful according to the method of the present invention may be found in U.S. Pat. Nos. 5,491,076 and 5,766,885 to James C. Carrington et al. which are incorporated herein by reference.

In yet other embodiments, recombinant plant viruses are used which encode for the expression of a fusion between a plant viral coat protein and the amino acid product of the exogenous RNA of interest. Such a recombinant plant virus provides for high level expression of a nucleic acid of interest. The location or locations where the viral coat protein is joined to the amino acid product of the nucleic acid of interest may be referred to as the fusion joint. A given product of such a construct may have one or more fusion joints. The fusion joint may be located at the carboxyl terminus of the viral coat protein or the fusion joint may be located at the amino terminus of the coat protein portion of the construct. In instances where the nucleic acid of interest is located internal with respect to the 5′ and 3′ residues of the nucleic acid sequence encoding for the viral coat protein, there are two fusion joints. That is, the nucleic acid of interest may be located 5′, 3′, upstream, downstream or within the coat protein. In some embodiments of such recombinant plant viruses, a “leaky” start or stop codon may occur at a fusion joint which sometimes does not result in translational termination. A more detailed description of some recombinant plant viruses according to this embodiment of the invention may be found in U.S. Pat. No. 5,977,438, the disclosure of which is incorporated herein by reference.

In another embodiment an exogenous gene can be introduced into the site of the coat protein gene of Potato virus X. Alternatively, an exogenous gene can be added to the PVX genome by partial duplication of the viral genome, so that expression of the exogenous gene is under the control of the same promoter sequence that controls production of the coat protein gene. Chapman, S. et al., The Plant Journal (1992) 2(4): 549-557.

Those skilled in the art will understand that these embodiments are representative only of many constructs which may be useful to produce localized or systemic expression of nucleic acids in host organisms such as plants. All such constructs are contemplated and intended to be within the scope of the present invention.

The following examples illustrate the principles of the invention as applied to modification of TMV and the use of modified TMV containing a gene coding for green fluorescent protein (GFP) in the phenotypic transformation of Nicotiana plants and protoplasts. The following examples utilize many techniques well known and accessible to those skilled in the arts of molecular biology, cloning, plant cell biology, plant virology and plant tissue culture. Such methods are fully described in one or more of the cited references if not described in detail herein. Unless specified otherwise, enzymes were obtained from commercial sources and were used according to the vendor's recommendations or other variations known to the art. Those in the art also know reagents, buffers and culture conditions and reaction conditions for various enzyme-catalyzed reactions. Reference works containing such standard techniques include the following: R. Wu, ed. (1979) Meth. Enzymol. 68; R. Wu et al., eds. (1983) Meth. Enzymol. 100, 101; L. Grossman and K. Moldave, eds. (1980) Meth. Enzymol. 65; J. H. Miller (1972) Experiment's in Molecular Genetics; R. Davis et al. (1980) Advanced Bacterial Genetics; R. F. Schleif and P. C. Wensink (1982) Practical Methods in Molecular Biology; and T. Maniatis et al. (1982) Molecular Cloning.

Textual use of the name of a restriction endonuclease in isolation, e.g., “EcoRV” or “SphI” refers to use of that enzyme in an enzymatic digestion, except in a diagram where it can refer to the site of a sequence susceptible to action of that enzyme, e.g., a restriction site. In the text, restriction sites are indicated by the additional use of the word “site”, e.g., “EcoRV site”. The additional use of the word “fragment”, indicates a linear double-stranded DNA molecule having ends generated by action of the named enzyme (e.g., a restriction fragment). A phrase such as, “EcoRV/SphI” fragment” indicates that the restriction fragment was generated by the action of two different enzymes, here EcoRV and SphI, the two ends resulting from the action of different enzymes. Note that the ends will have the characteristics of being either sticky (i.e., having a single strand of protrusion capable of base pairing with a complementary single-stranded oligonucleotide) or blunt (i.e., having no single-stranded protrusion). The specificity of a sticky end will be determined by the sequence of nucleotides comprising the single-stranded protrusion, which in turn is determined by the specificity of the enzyme, which produces it.

All plasmids are designated by a sequence of letters and numbers prefaced by a lower case “p”, for example, pBTI1037, pBTI1056, pBTI1057, pBTI SBS60, pBTI SBS60-29, or pBTI1056-GTN 28. Certain steps of cloning, selection and vector increase employed strains of E. Coli. While the strains used herein have been designated, there are many equivalent strains, available to the public that may be employed. The use of a particular microorganism as a substitute for a strain designated herein is a matter of routine choice available to those of ordinary skill in the art, according to well-known principles.

EXAMPLES

Example 1

Infectivity of Uncapped and Capped Transcripts

This example demonstrates the production of highly infectious viral vector transcripts containing 5′ nucleotides with reference to the virus vector.

1. Insertion of base or base sequence at the 5′ end of the TMV cDNA.

Nucleotides were added between the transcriptional start site for in vitro transcription, in this case the T7 promoter, and the start of the cDNA of TMV in order to maximize transcription product yield and possibly obviate the need to cap virus transcripts to insure infectivity. The relevant sequence is the T7 promoter indicated in shorthand as TATA , followed by the transcription start site “G”, followed by TATTTT . . . , which is the continuation of the cDNA of TMV. These are put together as . . . TATA G{circumflex over ( )}TATTTT . . . (SEQ ID NO: 1). The base preceding the “{circumflex over ( )}” is the start site for transcription of the cDNA. The bolded letter is the first base followed by TATTTT . . . of the TMV cDNA. Three approaches were taken:

1) addition of G, GG or GGG between the start site of transcription and the first base of the cDNA (as in . . . TATA G{circumflex over ( )}GTATTTT . . . and associated sequences);

(SEQ ID NO: 1)
I.	starting point	... TATA G {circumflex over ( )}TATTTT...
(SEQ ID NO: 2)
II.	addition of G	... TATA G{circumflex over ( )} G TATTTT...
(SEQ ID NO: 3)
III.	addition of GG	... TATA G{circumflex over ( )}G G TATTTT...
(SEQ ID NO: 4)
IV.	addition of GGG	... TATA G{circumflex over ( )}GG G TATTTT...

2) addition of G and a random base (GN). As used herein, [N=A, T, C, or G]. VI represents addition of two random bases (N2). VII represents a G and two random bases (GNN). VIII represents three random bases (N3) between the start site of transcription and the TMV cDNA.

(SEQ ID NO: 5)
V.	addition of GN	... TATA G{circumflex over ( )}N G TATTTT...
(SEQ ID NO: 6)
VI.	addition of N2	... TATA GN{circumflex over ( )} N NTATTTT...
(SEQ ID NO: 7)
VII.	addition of GNN	... TATA G{circumflex over ( )}NN G TATTTT...
(SEQ ID NO: 8)
VIII.	addition of NNN	... TATA GN{circumflex over ( )}N N TATTTT...
(SEQ ID NO: 9)
IX.	addition of GNG	... TATA GG{circumflex over ( )}N G TATTT...

3) addition of a GT and a single random base ( GTN ) between the start site of transcription and the TMV cDNA ( . . . TATAG{circumflex over ( )}TNGTATTTT, SEQ ID NO: 10 . . . and associated sequences).

X.	addition of GTN	... TATA G{circumflex over ( )}TN G TATTTT...	(SEQ ID NO:11)
XI.	addition of GTC,	... TATA G{circumflex over ( )}TC G TATTTT...	(SEQ ID NO:12)
XII.	addition of (GTN) 2	... TATA G{circumflex over ( )}TNGTN G TATTTT...	(SEQ ID NO:13)
XIII.	addition of (GTN) 4	... TATA G{circumflex over ( )}TNGTNGTNGTN G TATTTT...	(SEQ ID NO:14)
XIV.	addition of GTATTT	... TATA G{circumflex over ( )}TATTT G TATTTT,...	(SEQ ID NO:15)

The use of random bases was based on the hypothesis that a particular base may be best suited for an additional nucleotide attached to the cDNA, since it will be complementary to the normal nontemplated base incorporated at the 3′-end of the TMV (−) strand RNA. This allows for more ready mis-initiation and restoration of wild type sequence. The GTN would allow the mimicking of two potential sites for initiation, the added and the native sequence, and facilitate more ready mis-initiation of transcription in vivo to restore the native TMV cDNA sequence. Approaches included cloning GFP expressing TMV vector sequences into vectors containing:

1) an extra G,

2) an extra GG or

3) an extra GGG bases using standard molecular biology techniques.

Likewise, full length PCR of TMV expression clone 1056 was done to add

4) N2,

5) N3 and

6) GTN bases between the T7 promoter and the TMV cDNA.

Construction of Plasmid

DNA oligonucleotide primers were synthesized to contain a 5′ EcoRV site, an entire T7 RNA polymerase promoter, any extra nucleotides, and the 5′-terminal 20 bases of the TMV cDNA. These primers contain in the position for extra nucleotides, either none for constructs with sequence . . . TATAG{circumflex over ( )}TATTT . . . , a “G” for constructs with sequence . . . TATAG{circumflex over ( )}GTATTT . . . , a “GN” for constructs with sequence . . . TATAG{circumflex over ( )}NGTATTT . . . or a “GTN” for constructs with sequence . . . TATAG{circumflex over ( )}TNGTATTT . . . , where {circumflex over ( )} indicates the base preceding is the start site for transcription.

Examples of 5′ primers used to construct variant TMV constructs:

5′ GGCGATATC TAATACGACTCACTATA GTNGTATTTTTACAACAATTACC   (SEQ ID NO:16)

5′ GGCGATATC TAATACGACTCACTATA GNGTATTTTTACAACAATTACC   (SEQ ID NO:17)

5′ GGCGATATC TAATACGACTCACTATA GNNGTATTTTTACAACAATTACC   (SEQ ID NO:18)

5′ GGCGATATC TAATACGACTCACTATA GNNNGTATTTTTACAACAATTACC   (SEQ ID NO:19)

5′GGCGATATC TAATACGACTCACTATA GTNGTNGTATTTTTACAACAATTAC   (SEQ ID NO:20)

GATATC is the EcoRV restriction enzyme recognition site. Underlined is the T7 RNA polymerase promoter. The added bases between the T7 promoter and the TMV cDNA are in bold. The 5′ 20 bases of TMV cDNA are shown following the added bases.

We used the following 3′-primer, which anneals to TMV nucleotides 1034 to 1056:

5′ CACTATCTACACTTTTATGGGCC   (SEQ ID NO:21).

These 5′ primers and a 3′ primer containing sequences in the TMV cDNA surrounding the SphI site at position 445 were used to amplify a portion of the TMV cDNA (˜500 bp in length) by the polymerase chain reaction (PCR). The PCR products were purified by agarose gel elcctrophoresis and standard gel extraction procedures and digested with EcoRV and SphI. The DNA fragments were then ligated into a plasmid digested with EcoRV and SphI. The digestion removed the identical portion of the genome and replaced it with the PCR fragment. The recombinants were analyzed by agarose gel electrophoresis and by DNA sequencing of the 5′ end of the TMV cDNA and T7 promoter junction. These plasmids were then used for in vitro transcription using T7 RNA polymerase.

In vitro Transcription

Several TMV-based virus expression vectors were initially used in these studies. Vector pBTI 1056 contains the T7 promoter (underlined) followed directly by the virus cDNA sequence ( . . . TATA GTATT . . . ), and vector pBTI SBS60-29 contains the T7 promoter followed by an extra guanine residue, then by the virus cDNA sequence ( . . . TATA GGTATT . . . ). Both expression vectors express an exogenous cycle 3 shuffled green fluorescent protein (GFPc3) in localized infection sites and systemically infected tissue of infected plants.

Transcriptions of each plasmid were carried out in the absence of cap analogue (uncapped) or in the presence of 8-fold greater concentration of RNA cap analogue than rGTP (capped). “r” means ribosomal.

Cap Transcriptions

1.2 μl 20 mM rATP, rCTP, rUTP, 2 mM rGTP solution

2 μl 10 mM RNA cap analogue (New England Biolabs catalog #1404, methylated cap analogue)

1 μl Rnase Inhibitor 20 U (Promega N2511)

1 μl T7 RNA polymerase 30 U (Ambion 2085)

2 μl T7 RNA polymerase buffer (Ambion ñ supplied with enzyme)

0.5 mg of transcriptional plasmid DNA

Raise volume to 20 μl

Incubate at 37° C. for 1.5 hours

Analyze by agarose gel electrophoresis of 0.5 μl solution.

Non-Cap Transcriptions

1.2 μl 20 mM rATP, rCTP, rUTP

4.3 μl 20 mM rGTP

1 μl Rnase Inhibitor 20 U (Promega N2511)

1 μl T7 RNA polymerase 30 U (Ambion 2085)

2 μl T7 RNA polymerase buffer (Ambion, supplied with enzyme)

0.5 mg of transcriptional plasmid DNA

Raise volume to 20 μl

Incubate at 37° C. for 1.5 hours.

Analyze by agarose gel electrophoresis of 0.5 μl solution.

There are other methods for transcription. This method is not intended to be limiting. The volume of rGTP is also not limiting. Other volumes can be used. While methylated cap is used in these experiments, for purposes of this invention, unmethylated cap, New England Biolabs catalog #1407, may also be used if cap is desired.

Description of Vectors pBTI SBS5, pBTI 1056, pBTI SBS60, pBTI SBS60-29, and pBTI 1056 GTN-28

Vector p30BGFPc3 is the base vector or starting point. Each clone comparison is outlined below. pBTI SBS5, pSBS60 and p1056 are compared with p30BGFPc3. P1056GTN-28 is compared with p1056 and pSBS60-29 s compared with pSBS60. “nt” means nucleotide. “aa” means amino acid.

1. pBTI SBS5 (pBTI 1057) SEQ DATA vs pBTI 30BGFPc3 (pBTI 1037)
8 nt changes	4 aa changes
nt 1138	pBTI SB	S5 A to G mutation	(E to G change of aa 357
			of 126K protein)
nt 1268		T to C	(silent)
nt 2382	pBTI SBS5	A to G mutation	(K to E change of aa 772
			of 126K protein)
nt 3120		T to C mutation	(silent)
nt 3632	pBTI SBS5	G to A mutation	(silent)
nt 5213		C to T mutation	(T to I change of aa 104
			of 30K protein)
nt 5303	pBTI SBS5	A to G mutation	(K to R change of aa 134
			of 30K protein)
nt 5896		C to A mutation	(silent)
2. pBTI SBS60 SEQ DATA vs. pBTI 30BGFPc3 (pBTI 1037)
6 nt changes	1 aa change
nt 1268		T to C	(silent)
nt 3120		T to C mutation	(silent)
nt 4100	pBTI SBS60	T to C mutation	(silent)
nt 5213		C to T mutation
		(T to I change of aa
		104 of 30K protein,
		shared with pBTI SBS5)
nt 5634	pBTI SBS60	A to G mutation	(silent)
nt 5896		C to A mutation	(silent)

There is no nucleotide “nt” sequence inserted between the T7 promoter sequence and the 5′ most base of the TMV U1 cDNA to form ( . . . TATA GTATTTT . . . ). In the short hand used herein . . . TATA represents the T7 promoter, there is no base or sequence of bases inserted between the T7 promoter and the GTATTTT . . . represents the 5′ most bases of the TMV U1 cDNA.

3. pBTI 1056 SEQ DATA vs. pBTI 30BGFPc3 (pBTI 1037)
2 nt changes            2 aa change
nt 5213 C to T mutation (T to I change of aa 104 of 30 k)
nt 5402 G to A mutation (R to K change of aa 167 of 30 k)

There is no nt sequence inserted between the T7 promoter sequence and the 5′ most base of the TMV U1 cDNA to form ( . . . TATA GTATTTT . . . ). In the short hand used herein . . . TATA represents the T7 promoter, there is no base or sequence of bases inserted between the T7 promoter and the GTATTTT . . . represents the 5′ most bases of the TMV U1 cDNA. pBTI1056.

4. pBTI 1056 GTN-28 SEQ DATA vs. pBTI 1056

nt sequence is GTC inserted between the T7 promoter sequence and the 5′ most base of the TMV U1 cDNA to form ( . . . TATA GTCGTATTTT . . . ). In the short hand used herein . . . TATA represents the T7 promoter, GTC is the inserted sequence of nucleotides, and GTATTTT . . . represents the 5′ most bases of the TMV U1 cDNA

5. pBTI SBS 60-29 SEQ DATA vs. pBTI SBS60

nt G is inserted between the T7 promoter sequence and the 5′ most base of the TMV U1 cDNA to form ( . . . TATA GGTATTTT . . . ). In the short hand used herein . . . TATA represents the T7 promoter, G is the inserted nucleotide, and GTATTTT . . . represents the 5′ most bases of the TMV U1 cDNA.

Table 1 summarizes the vectors and host plants used in the following experiments; the nucleotide sequence of each vector which contains the T7 promoter and the start of the cDNA of TMV is listed in the Table.

TABLE 1
Viral		Cap	Host	Foreign	Plant
Vector	5′ nucleotide sequence	+, −	Plant	Gene	tissue
pBTI1056	TATA GTATTTT	+ and	NB and	GFPc3	leaf
		−	NB30K
pBTISBS60-	TATA GGTATTTT	+ and	NB and	GFPc3	leaf
29		−	NB30K
pBTISBS60	TATA GTATTTT	+ and	NB	GFPc3	proto-
		−			plasts
pBTI1056-	TATA GTCGTATTTT	+ and	NB and	GFPc3	leaf
GTN28		−	NB30K

Data of Cap and Non-cap Transcriptions of pBTI1056 and PBTI SBS60-29

Nicotiana tabacum plants were infected with either capped or uncapped transcriptions (as described above) of pBTI 1056 and pBTI SBS60-29. Transcriptions were mixed with abrasive and inoculated on expanded older leaves of a wild type Nicotiana benthamiana (Nb) plant and a Nb plant expressing a TMV U1 30 k movement protein transgene (Nb 30K). Four days post inoculation (dpi), long wave UV light was used to judge the number of infection sites on the inoculated leaves of the plants. Systemic, noninoculated tissues were monitored from 4 dpi on for appearance of systemic infection indicating vascular movement of the inoculated virus. Table 2 shows the results of one representative experiment. An extra G, . . . TATAG{circumflex over ( )}GTATTTT . . . is found to be well tolerated as an additional 5′ nucleotide on the 5′ end of TMV vector RNA transcripts. Both capped and uncapped transcripts are infectious. Extra guanine residues located between the T7 promoter and the first base of a virus cDNA as demonstrated by pBTISBS60-29 lead to an increased amount of RNA transcript.

	TABLE 2
	Local		Systemic
	infection sites		Infection
	Construct	Nb	Nb 30K	Nb	Nb 30K
	pBTI1056
	Capped	5	6	yes	yes
	Uncapped	0	5	no	yes
	pBTI SBS60-29
	Capped	6	6	yes	yes
	Uncapped	1	5	yes	yes

Results of Cap and Non-cap Transcriptions of pBTI SBS60

Nicotiana tabacum protoplasts were infected with either capped or uncapped transcriptions (as described above) of pBTI SBS60 which contains the T7 promoter followed directly by the virus cDNA sequence ( TATA GTATT . . . ). This expression vector also expresses the GFPc3 gene in infected cells and tissues. Nicotiana tabacum protoplasts were transfected with 1 l of each transcription. Approximately 36 hours post infection transfected protoplasts were viewed under UV illumination and cells showing GFPc3 expression. Approximately 80% of cells transfected with the capped pBTI SBS60 transcripts showed GFP expression while 5% of cells transfected with uncapped transcripts showed GFP expression. These experiments were repeated with higher amounts of uncapped inoculum. In this case a higher proportion of cells, >30% were found to be infected at this time with uncapped transcripts, where >90% of cells infected with greater amounts of capped transcripts were scored infected.

Data of Cap and Non-cap Transcriptions of pBTI1056 GTN-28

TMV-based virus expression vector pBTI 1056 GTN-28 contains the T7 promoter (underlined) followed GTC bases (bold) then the virus cDNA sequence ( . . . TATA GTCGTATT, SEQ ID NO: 10, . . . ). This expression vector expresses the exogenous cycle 3 shuffled green fluorescent protein (GFPc3) in localized infection sites and systemically infected tissue of infected plants. This vector was transcribed in vitro in the presence (capped) and absence (uncapped) of cap analogue as described above. Transcriptions were mixed with abrasive and inoculated on expanded older leaves of a wild type Nicotiana benthamiana (Nb) plant and a Nb plant expressing a TMV U1 30k movement protein transgene (Nb 30K). Four days post inoculation (dpi) long wave UV light was used to judge the number of infection sites on the inoculated leaves of the plants. Systemic, non-inoculated tissues were monitored from 4 dpi on for appearance of systemic infection indicating vascular movement of the inoculated virus. Table 3 shows data from two representative experiments at 11 dpi.

	TABLE 3
	Local		Systemic
	infection sites		Infection
	Construct	Nb	Nb 30K	Nb	Nb
	30K
	Experiment 1
	pBTI1056 GTN-28
	Capped	18	25	yes	yes
	Uncapped	2	4	yes	yes
	Experiment 2
	pBTI1056 GTN-28
	Capped	8	12	yes	yes
	Uncapped	3	7	yes	yes

Extra GTN such as GTC residues located between the T7 promoter and the first base of a virus cDNA (pBTI 1056 GTN-28) lead to increased amount of RNA transcript as predicted by previous work with phage polymerases. These polymerases tend to initiate more efficiently at . . . TATA GTNG or . . . TATA GTCG than . . . TATA G. This has an indirect effect on the relative infectivity of uncapped transcripts in that greater amounts are synthesized per reaction resulting in enhanced infectivity.

Discussion and Conclusions

The foregoing examples demonstrate that, contrary to the practiced art in scientific literature and in issued patents (Ahlquist et al., U.S. Pat. No. 5,500,360), uncapped transcripts for virus expression vectors are infective in both whole plants and in plant cells, however with much lower specific infectivity. Therefore, capping is not a prerequisite for establishing an infection of a virus expression vector in plants; capping just increases the efficiency of infection. This reduced efficiency can be overcome, to some extent, by providing excess in vitro transcription product in an infection reaction for plants or plant cells. These data further support the claims concerning the utility of uncapped transcripts to initiate infections by plant virus expression vectors and further demonstrates that the introduction of extra, non-viral nucleotides at the 5′-end of in vitro transcripts does not preclude infectivity of uncapped transcripts. We conclude that while many similarities between plant viruses can be cited, there are specific differences between the Brome mosaic virus and the Tobamovirus group which provide specific advantages to using a single-component Tobamovirus-derived vector. The results also show that reduced efficiency can be overcome, to some extent, by using a transgenic host plant or transgenic host plant cell, which expresses one or more RNA binding viral proteins. The expression of the 30K movement protein of TMV in transgenic plants also has the unexpected effect of equalizing the relative specific infectivity of uncapped verses capped transcripts. The mechanism behind this effect is not fully understood.

Further modifications and improvements following and embodying the teachings and disclosures herein are deemed to be within the scope of the invention, as set forth in the appended claims.

Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications could be made without departing from the spirit of the invention. Further modifications and improvements following and embodying the teachings and disclosures herein are deemed to be within the scope of the invention, as set forth in the appended claims.

27 1 11 DNA Tobacco mosaic virus 1tatagtattt t 11 2 12 DNA Tobacco mosaic virus 2tataggtatt tt 12 3 13 DNA Tobacco mosaic virus 3tatagggtat ttt 13 4 13 DNA Tobacco mosaic virus 4tatagggtat ttt 13 5 13 DNA Tobacco mosaic virus misc_feature (1)...(13) N= A, T, C or G 5tatagngtat ttt 13 6 13 DNA Tobacco mosaic virus misc_feature (1)...(13) N= A, T, C or G 6tatagnntat ttt 13 7 14 DNA Tobacco mosaic virus misc_feature (1)...(14) N= A, T, C or G 7tatagnngta tttt 14 8 14 DNA Tobacco mosaic virus misc_feature (1)...(14) N= A, T, C or G 8tatagnnnta tttt 14 9 13 DNA Tobacco mosaic virus misc_feature (1)...(13) N= A, T, C or G 9tataggngta ttt 13 10 17 DNA Tobacco mosaic virus misc_feature (1)...(17) N= A, T, C or G 10tatagtngtn gtatttt 17 11 14 DNA Tobacco mosaic virus misc_feature (1)...(14) N= A, T, C or G 11tatagtngta tttt 14 12 14 DNA Tobacco mosaic virus misc_feature (1)...(14) N= A, T, C or G 12tatagtcgta tttt 14 13 17 DNA Tobacco mosaic virus misc_feature (1)...(17) N= A, T, C or G 13tatagtngtn gtatttt 17 14 23 DNA Tobacco mosaic virus misc_feature (1)...(23) N= A, T, C or G 14tatagtngtn gtngtngtat ttt 23 15 17 DNA Tobacco mosaic virus 15tatagtattt gtatttt 17 16 45 DNA Tobacco mosaic virus misc_feature (1)...(45) N= A, T, C OR G 16ggcgatatct aatacgacta tagtngtatt tttacaacaa ttacc 45 17 48 DNA Tobacco mosaic virus misc_feature (1)...(48) N= A, T, C OR G 17ggcgatatct aatacgactc actatagngt atttttacaa caattacc 48 18 50 DNA Tobacco mosaic virus misc_feature (1)...(50) N= A, T, C OR G 18ggcgatatct aatacgactc actatagnng tatttttaca acaatttacc 50 19 50 DNA Tobacco mosaic virus misc_feature (1)...(50) N= A, T, C OR G 19ggcgatatct aatacgactc actatagnnn gtatttttac aacaattacc 50 20 51 DNA Tobacco mosaic virus misc_feature (1)...(51) N= A, T, C OR G 20ggcgatatct aatacgactc actatagtng tngtattttt acaacaatta c 51 21 23 DNA Tobacco mosaic virus 21cactatctac acttttatgg gcc 23 22 7685 DNA Tobacco mosaic virus 22gtatttttac aacaattacc aacaacaaca aacaacagac aacattacaa ttactattta 60caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600tctgtcacaa tactttccag acatgcgaac atcagccgat gcagcaatca ggcagagtgt 660atgccattgc gctacacagc atatatgaca taccagccga tgagttcggg gcggcactct 720tgaggaaaaa tgtccatacg tgctatgccg ctttccactt ctccgagaac ctgcttcttg 780aagattcatg cgtcaatttg gacgaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840tgaccttttc ttttgcatca gagagtactc ttaattactg tcatagttat tctaatattc 900ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080acgcatggca ttacaaaaag actcttgcaa tgtgcaacag cgagagaatc ctccttgagg 1140attcatcatc agtcaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200tcgacatttc tttggagact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260tcgtgtttac agtgcttaac cacattcgaa cataccaggc gaaagctctt acatacgcaa 1320atgttttgtc cttcgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740atgcactttc agaattatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800cccagatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920cgctagcttt acaggatcaa gagaaggctt cagaaggtgc attggtagtt acctcaagag 1980aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040ttgctggaga tcatccggaa tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100agtttcatat ggcgacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340ccaagagtca tgcatggggt gttgttgaaa cccacgcgag gaagtatcat gtggcgcttt 2400tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgttagct 2460ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgcttcgaa 2520acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580gaaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880catacatcaa tagagtttca ggattcccgt accccgccca ttttgccaaa ttggaagttg 2940acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatct 3120tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240caccggtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420aattacagat tgactcggtg ttcaaaggtt ccaatctttt tgttgcagcg ccaaagactg 3480gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600gcatattgga tatgtctaag tctgttgctg cgcctaagga tcaaatcaaa ccactaatac 3660ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720cgatgattaa aagaaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780ctgcatcttt ggttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900aacaggtaac aataggccag ctcgcagatt ttgattttgt ggatttgcca gcagttgatc 3960agtacagaca catgattaaa gcacaaccca aacaaaagtt ggacacttca atccaaacgg 4020agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atattcggcc 4080cgttgtttag tgagcttact aggcaattac tggacagtgt tgattcgagc agatttttgt 4140ttttcacaag aaagacacca gcgcagattg aggatttctt cggagatctc gacagtcatg 4200tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260actgtgcagt agaatacgag atctggcgaa gattgggttt cgaagacttc ttgggagaag 4320tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680tctcgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040aatgagtcat tgtcaggggt gaaccttctt aaaggagtta agcttattga tagtggatac 5100gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cactctcgga 5220tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280ataaccaccc aggacgcgat gaaaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400agaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580agtagtgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tggaggaatg 5640agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760ttaaatggct agcaaaggag aagaactttt cactggagtt gtcccaattc ttgttgaatt 5820agatggtgat gttaatgggc acaaattttc tgtcagtgga gagggtgaag gtgatgctac 5880atacggaaag cttaccctta aatttatttg cactactgga aaactacctg ttccatggcc 5940aacacttgtc actactttct cttatggtgt tcaatgcttt tcccgttatc cggatcatat 6000gaaacggcat gactttttca agagtgccat gcccgaaggt tatgtacagg aacgcactat 6060atctttcaaa gatgacggga actacaagac gcgtgctgaa gtcaagtttg aaggtgatac 6120ccttgttaat cgtatcgagt taaaaggtat tgattttaaa gaagatggaa acattctcgg 6180acacaaactc gagtacaact ataactcaca caatgtatac atcacggcag acaaacaaaa 6240gaatggaatc aaagctaact tcaaaattcg ccacaacatt gaagatggat ccgttcaact 6300agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 6360ccattacctg tcgacacaat ctgccctttc gaaagatccc aacgaaaagc gtgaccacat 6420gggccttctt gagtttgtaa ctgctgctgg gattacacat ggcatggatg agctctacaa 6480ataatgacac tcgaggggta gtcaagatgc ataataaata acggattgtg tccgtaatca 6540cacgtggtgc gtacgataac gcatagtgtt tttccctcca cttaaatcga agggttgtgt 6600cttggatcgc gcgggtcaaa tgtatatggt tcatatacat ccgcaggcac gtaataaagc 6660gaggggttcg ggtcgaggtc ggctgtgaaa ctcgaaaagg ttccggaaaa caaaaaagag 6720agtggtaggt aatagtgtta ataataagaa aataaataat agtggtaaga aaggtttgaa 6780agttgaggaa attgaggata atgtaagtga tgacgagtct atcgcgtcat cgagtacgtt 6840ttaatcaata tgccttatac aatcaactct ccgagccaat ttgtttactt aagttccgct 6900tatgcagatc ctgtgcagct gatcaatctg tgtacaaatg cattgggtaa ccagtttcaa 6960acgcaacaag ctaggacaac agtccaacag caatttgcgg atgcctggaa acctgtgcct 7020agtatgacag tgagatttcc tgcatcggat ttctatgtgt atagatataa ttcgacgctt 7080gatccgttga tcacggcgtt attaaatagc ttcgatacta gaaatagaat aatagaggtt 7140gataatcaac ccgcaccgaa tactactgaa atcgttaacg cgactcagag ggtagacgat 7200gcgactgtag ctataagggc ttcaatcaat aatttggcta atgaactggt tcgtggaact 7260ggcatgttca atcaagcaag ctttgagact gctagtggac ttgtctggac cacaactccg 7320gctacttagc tattgttgtg agatttccta aaataaagtc actgaagact taaaattcag 7380ggtggctgat accaaaatca gcagtggttg ttcgtccact taaatataac gattgtcata 7440tctggatcca acagttaaac catgtgatgg tgtatactgt ggtatggcgt aaaacaacgg 7500aaaagtcgct gaagacttaa aattcagggt ggctgatacc aaaatcagca gtggttgttc 7560gtccacttaa aaataacgat tgtcatatct ggatccaaca gttaaaccat gtgatggtgt 7620atactgtggt atggcgtaaa caacggagag gttcgaatcc tcccctaacc gcgggtagcg 7680gccca 7685 23 7686 DNA Tobacco mosaic virus 23gtatttttac aacaattacc aacaacaaca aacaacagac aacattacaa ttactattta 60caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600tctgtcacaa tactttccag acatgcgaac atcagccgat gcagcaatca ggcagagtgt 660atgccattgc gctacacagc atatatgaca taccagccga tgagttcggg gcggcactct 720tgaggaaaaa tgtccatacg tgctatgccg ctttccactt ctccgagaac ctgcttcttg 780aagattcatg cgtcaatttg gacgaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840tgaccttttc ttttgcatca gagagtactc ttaattactg tcatagttat tctaatattc 900ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080acgcatggca ttacaaaaag actcttgcaa tgtgcaacag cgagagaatc ctccttgagg 1140attcatcatc agtcaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200tcgacatttc tttggagact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260tcgtgttcac agtgcttaac cacattcgaa cataccaggc gaaagctctt acatacgcaa 1320atgttttgtc cttcgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740atgcactttc agaattatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800cccagatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920cgctagcttt acaggatcaa gagaaggctt cagaaggtgc attggtagtt acctcaagag 1980aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040ttgctggaga tcatccggaa tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100agtttcatat ggcgacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340ccaagagtca tgcatggggt gttgttgaaa cccacgcgag gaagtatcat gtggcgcttt 2400tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgttagct 2460ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgcttcgaa 2520acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580gaaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880catacatcaa tagagtttca ggattcccgt accccgccca ttttgccaaa ttggaagttg 2940acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatcc 3120tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240caccggtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420aattacagat tgactcggtg ttcaaaggtt ccaatctttt tgttgcagcg ccaaagactg 3480gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600gcatattgga tatgtctaag tctgttgctg cgcctaagga tcaaatcaaa ccactaatac 3660ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720cgatgattaa aagaaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780ctgcatcttt ggttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900aacaggtaac aataggccag ctcgcagatt ttgattttgt ggatttgcca gcagttgatc 3960agtacagaca catgattaaa gcacaaccca aacaaaagtt ggacacttca atccaaacgg 4020agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atattcggcc 4080cgttgtttag tgagcttacc aggcaattac tggacagtgt tgattcgagc agatttttgt 4140ttttcacaag aaagacacca gcgcagattg aggatttctt cggagatctc gacagtcatg 4200tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260actgtgcagt agaatacgag atctggcgaa gattgggttt cgaagacttc ttgggagaag 4320tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680tctcgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040aatgagtcat tgtcaggggt gaaccttctt aaaggagtta agcttattga tagtggatac 5100gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cattctcgga 5220tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280ataaccaccc aggacgcgat gaaaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400agaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580agtagtgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tgggggaatg 5640agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760ttaaatggct agcaaaggag aagaactttt cactggagtt gtcccaattc ttgttgaatt 5820agatggtgat gttaatgggc acaaattttc tgtcagtgga gagggtgaag gtgatgctac 5880atacggaaag cttacactta aatttatttg cactactgga aaactacctg ttccatggcc 5940aacacttgtc actactttct cttatggtgt tcaatgcttt tcccgttatc cggatcatat 6000gaaacggcat gactttttca agagtgccat gcccgaaggt tatgtacagg aacgcactat 6060atctttcaaa gatgacggga actacaagac gcgtgctgaa gtcaagtttg aaggtgatac 6120ccttgttaat cgtatcgagt taaaaggtat tgattttaaa gaagatggaa acattctcgg 6180acacaaactc gagtacaact ataactcaca caatgtatac atcacggcag acaaacaaaa 6240gaatggaatc aaagctaact tcaaaattcg ccacaacatt gaagatggat ccgttcaact 6300agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 6360ccattacctg tcgacacaat ctgccctttc gaaagatccc aacgaaaagc gtgaccacat 6420ggtccttctt gagtttgtaa ctgctgctgg gattacacat ggcatggatg agctctacaa 6480ataatgacac tcgaggggta gtcaagatgc ataataaata acggattgtg tccgtaatca 6540cacgtggtgc gtacgataac gcatagtgtt tttccctcca cttaaatcga agggttgtgt 6600cttggatcgc gcgggtcaaa tgtatatggt tcatatacat ccgcaggcac gtaataaagc 6660gaggggttcg ggtcgaggtc ggctgtgaaa ctcgaaaagg ttccggaaaa caaaaaagag 6720agtggtaggt aatagtgtta ataataagaa aataaataat agtggtaaga aaggtttgaa 6780agttgaggaa attgaggata atgtaagtga tgacgagtct atcgcgtcat cgagtacgtt 6840ttaatcaata tgccttatac aatcaactct ccgagccaat ttgtttactt aagttccgct 6900tatgcagatc ctgtgcagct gatcaatctg tgtacaaatg cattgggtaa ccagtttcaa 6960acgcaacaag ctaggacaac agtccaacag caatttgcgg atgcctggaa acctgtgcct 7020agtatgacag tgagatttcc tgcatcggat ttctatgtgt atagatataa ttcgacgctt 7080gatccgttga tcacggcgtt attaaatagc ttcgatacta gaaatagaat aatagaggtt 7140gataatcaac ccgcaccgaa tactactgaa atcgttaacg cgactcagag ggtagacgat 7200gcgactgtag ctataagggc ttcaatcaat aatttggcta atgaactggt tcgtggaact 7260ggcatgttca atcaagcaag ctttgagact gctagtggac ttgtctggac cacaactccg 7320gctacttagc tattgttgtg agatttccta aaataaagtc actgaagact taaaattcag 7380ggtggctgat accaaaatca gcagtggttg ttcgtccact taaatataac gattgtcata 7440tctggatcca acagttaaac catgtgatgg tgtatactgt ggtatggcgt aaaacaacgg 7500aaaagtcgct gaagacttaa aattcagggt ggctgatacc aaaatcagca gtggttgttc 7560gtccacttaa aaataacgat tgtcatatct ggatccaaca gttaaaccat gtgatggtgt 7620atactgtggt atggcgtaaa acaacggaga ggttcgaatc ctcccctaac cgcgggtagc 7680ggccca 7686 24 7687 DNA Tobacco mosaic virus 24ggtattttta caacaattac caacaacaac aaacaacaga caacattaca attactattt 60acaattacaa tggcatacac acagacagct accacatcag ctttgctgga cactgtccga 120ggaaacaact ccttggtcaa tgatctagca aagcgtcgtc tttacgacac agcggttgaa 180gagtttaacg ctcgtgaccg caggcccaag gtgaactttt caaaagtaat aagcgaggag 240cagacgctta ttgctacccg ggcgtatcca gaattccaaa ttacatttta taacacgcaa 300aatgccgtgc attcgcttgc aggtggattg cgatctttag aactggaata tctgatgatg 360caaattccct acggatcatt gacttatgac ataggcggga attttgcatc gcatctgttc 420aagggacgag catatgtaca ctgctgcatg cccaacctgg acgttcgaga catcatgcgg 480cacgaaggcc agaaagacag tattgaacta tacctttcta ggctagagag aggggggaaa 540acagtcccca acttccaaaa ggaagcattt gacagatacg cagaaattcc tgaagacgct 600gtctgtcaca atactttcca gacatgcgaa catcagccga tgcagcaatc aggcagagtg 660tatgccattg cgctacacag catatatgac ataccagccg atgagttcgg ggcggcactc 720ttgaggaaaa atgtccatac gtgctatgcc gctttccact tctccgagaa cctgcttctt 780gaagattcat gcgtcaattt ggacgaaatc aacgcgtgtt tttcgcgcga tggagacaag 840ttgacctttt cttttgcatc agagagtact cttaattact gtcatagtta ttctaatatt 900cttaagtatg tgtgcaaaac ttacttcccg gcctctaata gagaggttta catgaaggag 960tttttagtca ccagagttaa tacctggttt tgtaagtttt ctagaataga tacttttctt 1020ttgtacaaag gtgtggccca taaaagtgta gatagtgagc agttttatac tgcaatggaa 1080gacgcatggc attacaaaaa gactcttgca atgtgcaaca gcgagagaat cctccttgag 1140gattcatcat cagtcaatta ctggtttccc aaaatgaggg atatggtcat cgtaccatta 1200ttcgacattt ctttggagac tagtaagagg acgcgcaagg aagtcttagt gtccaaggat 1260ttcgtgttca cagtgcttaa ccacattcga acataccagg cgaaagctct tacatacgca 1320aatgttttgt ccttcgtcga atcgattcga tcgagggtaa tcattaacgg tgtgacagcg 1380aggtccgaat gggatgtgga caaatctttg ttacaatcct tgtccatgac gttttacctg 1440catactaagc ttgccgttct aaaggatgac ttactgatta gcaagtttag tctcggttcg 1500aaaacggtgt gccagcatgt gtgggatgag atttcgctgg cgtttgggaa cgcatttccc 1560tccgtgaaag agaggctctt gaacaggaaa cttatcagag tggcaggcga cgcattagag 1620atcagggtgc ctgatctata tgtgaccttc cacgacagat tagtgactga gtacaaggcc 1680tctgtggaca tgcctgcgct tgacattagg aagaagatgg aagaaacgga agtgatgtac 1740aatgcacttt cagaattatc ggtgttaagg gagtctgaca aattcgatgt tgatgttttt 1800tcccagatgt gccaatcttt ggaagttgac ccaatgacgg cagcgaaggt tatagtcgcg 1860gtcatgagca atgagagcgg tctgactctc acatttgaac gacctactga ggcgaatgtt 1920gcgctagctt tacaggatca agagaaggct tcagaaggtg cattggtagt tacctcaaga 1980gaagttgaag aaccgtccat gaagggttcg atggccagag gagagttaca attagctggt 2040cttgctggag atcatccgga atcgtcctat tctaagaacg aggagataga gtctttagag 2100cagtttcata tggcgacggc agattcgtta attcgtaagc agatgagctc gattgtgtac 2160acgggtccga ttaaagttca gcaaatgaaa aactttatcg atagcctggt agcatcacta 2220tctgctgcgg tgtcgaatct cgtcaagatc ctcaaagata cagctgctat tgaccttgaa 2280acccgtcaaa agtttggagt cttggatgtt gcatctagga agtggttaat caaaccaacg 2340gccaagagtc atgcatgggg tgttgttgaa acccacgcga ggaagtatca tgtggcgctt 2400ttggaatatg atgagcaggg tgtggtgaca tgcgatgatt ggagaagagt agctgttagc 2460tctgagtctg ttgtttattc cgacatggcg aaactcagaa ctctgcgcag actgcttcga 2520aacggagaac cgcatgtcag tagcgcaaag gttgttcttg tggacggagt tccgggctgt 2580ggaaaaacca aagaaattct ttccagggtt aattttgatg aagatctaat tttagtacct 2640gggaagcaag ccgcggaaat gatcagaaga cgtgcgaatt cctcagggat tattgtggcc 2700acgaaggaca acgttaaaac cgttgattct ttcatgatga attttgggaa aagcacacgc 2760tgtcagttca agaggttatt cattgatgaa gggttgatgt tgcatactgg ttgtgttaat 2820tttcttgtgg cgatgtcatt gtgcgaaatt gcatatgttt acggagacac acagcagatt 2880ccatacatca atagagtttc aggattcccg taccccgccc attttgccaa attggaagtt 2940gacgaggtgg agacacgcag aactactctc cgttgtccag ccgatgtcac acattatctg 3000aacaggagat atgagggctt tgtcatgagc acttcttcgg ttaaaaagtc tgtttcgcag 3060gagatggtcg gcggagccgc cgtgatcaat ccgatctcaa aacccttgca tggcaagatc 3120ctgactttta cccaatcgga taaagaagct ctgctttcaa gagggtattc agatgttcac 3180actgtgcatg aagtgcaagg cgagacatac tctgatgttt cactagttag gttaacccct 3240acaccggtct ccatcattgc aggagacagc ccacatgttt tggtcgcatt gtcaaggcac 3300acctgttcgc tcaagtacta cactgttgtt atggatcctt tagttagtat cattagagat 3360ctagagaaac ttagctcgta cttgttagat atgtataagg tcgatgcagg aacacaatag 3420caattacaga ttgactcggt gttcaaaggt tccaatcttt ttgttgcagc gccaaagact 3480ggtgatattt ctgatatgca gttttactat gataagtgtc tcccaggcaa cagcaccatg 3540atgaataatt ttgatgctgt taccatgagg ttgactgaca tttcattgaa tgtcaaagat 3600tgcatattgg atatgtctaa gtctgttgct gcgcctaagg atcaaatcaa accactaata 3660cctatggtac gaacggcggc agaaatgcca cgccagactg gactattgga aaatttagtg 3720gcgatgatta aaagaaactt taacgcaccc gagttgtctg gcatcattga tattgaaaat 3780actgcatctt tggttgtaga taagtttttt gatagttatt tgcttaaaga aaaaagaaaa 3840ccaaataaaa atgtttcttt gttcagtaga gagtctctca atagatggtt agaaaagcag 3900gaacaggtaa caataggcca gctcgcagat tttgattttg tggatttgcc agcagttgat 3960cagtacagac acatgattaa agcacaaccc aaacaaaagt tggacacttc aatccaaacg 4020gagtacccgg ctttgcagac gattgtgtac cattcaaaaa agatcaatgc aatattcggc 4080ccgttgttta gtgagcttac caggcaatta ctggacagtg ttgattcgag cagatttttg 4140tttttcacaa gaaagacacc agcgcagatt gaggatttct tcggagatct cgacagtcat 4200gtgccgatgg atgtcttgga gctggatata tcaaaatacg acaaatctca gaatgaattc 4260cactgtgcag tagaatacga gatctggcga agattgggtt tcgaagactt cttgggagaa 4320gtttggaaac aagggcatag aaagaccacc ctcaaggatt ataccgcagg tataaaaact 4380tgcatctggt atcaaagaaa gagcggggac gtcacgacgt tcattggaaa cactgtgatc 4440attgctgcat gtttggcctc gatgcttccg atggagaaaa taatcaaagg agccttttgc 4500ggtgacgata gtctgctgta ctttccaaag ggttgtgagt ttccggatgt gcaacactcc 4560gcgaatctta tgtggaattt tgaagcaaaa ctgtttaaaa aacagtatgg atacttttgc 4620ggaagatatg taatacatca cgacagagga tgcattgtgt attacgatcc cctaaagttg 4680atctcgaaac ttggtgctaa acacatcaag gattgggaac acttggagga gttcagaagg 4740tctctttgtg atgttgctgt ttcgttgaac aattgtgcgt attacacaca gttggacgac 4800gctgtatggg aggttcataa gaccgcccct ccaggttcgt ttgtttataa aagtctggtg 4860aagtatttgt ctgataaagt tctttttaga agtttgttta tagatggctc tagttgttaa 4920aggaaaagtg aatatcaatg agtttatcga cctgacaaaa atggagaaga tcttaccgtc 4980gatgtttacc cctgtaaaga gtgttatgtg ttccaaagtt gataaaataa tggttcatga 5040gaatgagtca ttgtcagggg tgaaccttct taaaggagtt aagcttattg atagtggata 5100cgtctgttta gccggtttgg tcgtcacggg cgagtggaac ttgcctgaca attgcagagg 5160aggtgtgagc gtgtgtctgg tggacaaaag gatggaaaga gccgacgagg ccattctcgg 5220atcttactac acagcagctg caaagaaaag atttcagttc aaggtcgttc ccaattatgc 5280tataaccacc caggacgcga tgaaaaacgt ctggcaagtt ttagttaata ttagaaatgt 5340gaagatgtca gcgggtttct gtccgctttc tctggagttt gtgtcggtgt gtattgttta 5400tagaaataat ataaaattag gtttgagaga gaagattaca aacgtgagag acggagggcc 5460catggaactt acagaagaag tcgttgatga gttcatggaa gatgtcccta tgtcgatcag 5520gcttgcaaag tttcgatctc gaaccggaaa aaagagtgat gtccgcaaag ggaaaaatag 5580tagtagtgat cggtcagtgc cgaacaagaa ctatagaaat gttaaggatt ttgggggaat 5640gagttttaaa aagaataatt taatcgatga tgattcggag gctactgtcg ccgaatcgga 5700ttcgttttaa atagatctta cagtatcact actccatctc agttcgtgtt cttgtcatta 5760attaaatggc tagcaaagga gaagaacttt tcactggagt tgtcccaatt cttgttgaat 5820tagatggtga tgttaatggg cacaaatttt ctgtcagtgg agagggtgaa ggtgatgcta 5880catacggaaa gcttacactt aaatttattt gcactactgg aaaactacct gttccatggc 5940caacacttgt cactactttc tcttatggtg ttcaatgctt ttcccgttat ccggatcata 6000tgaaacggca tgactttttc aagagtgcca tgcccgaagg ttatgtacag gaacgcacta 6060tatctttcaa agatgacggg aactacaaga cgcgtgctga agtcaagttt gaaggtgata 6120cccttgttaa tcgtatcgag ttaaaaggta ttgattttaa agaagatgga aacattctcg 6180gacacaaact cgagtacaac tataactcac acaatgtata catcacggca gacaaacaaa 6240agaatggaat caaagctaac ttcaaaattc gccacaacat tgaagatgga tccgttcaac 6300tagcagacca ttatcaacaa aatactccaa ttggcgatgg ccctgtcctt ttaccagaca 6360accattacct gtcgacacaa tctgcccttt cgaaagatcc caacgaaaag cgtgaccaca 6420tggtccttct tgagtttgta actgctgctg ggattacaca tggcatggat gagctctaca 6480aataatgaca ctcgaggggt agtcaagatg cataataaat aacggattgt gtccgtaatc 6540acacgtggtg cgtacgataa cgcatagtgt ttttccctcc acttaaatcg aagggttgtg 6600tcttggatcg cgcgggtcaa atgtatatgg ttcatataca tccgcaggca cgtaataaag 6660cgaggggttc gggtcgaggt cggctgtgaa actcgaaaag gttccggaaa acaaaaaaga 6720gagtggtagg taatagtgtt aataataaga aaataaataa tagtggtaag aaaggtttga 6780aagttgagga aattgaggat aatgtaagtg atgacgagtc tatcgcgtca tcgagtacgt 6840tttaatcaat atgccttata caatcaactc tccgagccaa tttgtttact taagttccgc 6900ttatgcagat cctgtgcagc tgatcaatct gtgtacaaat gcattgggta accagtttca 6960aacgcaacaa gctaggacaa cagtccaaca gcaatttgcg gatgcctgga aacctgtgcc 7020tagtatgaca gtgagatttc ctgcatcgga tttctatgtg tatagatata attcgacgct 7080tgatccgttg atcacggcgt tattaaatag cttcgatact agaaatagaa taatagaggt 7140tgataatcaa cccgcaccga atactactga aatcgttaac gcgactcaga gggtagacga 7200tgcgactgta gctataaggg cttcaatcaa taatttggct aatgaactgg ttcgtggaac 7260tggcatgttc aatcaagcaa gctttgagac tgctagtgga cttgtctgga ccacaactcc 7320ggctacttag ctattgttgt gagatttcct aaaataaagt cactgaagac ttaaaattca 7380gggtggctga taccaaaatc agcagtggtt gttcgtccac ttaaatataa cgattgtcat 7440atctggatcc aacagttaaa ccatgtgatg gtgtatactg tggtatggcg taaaacaacg 7500gaaaagtcgc tgaagactta aaattcaggg tggctgatac caaaatcagc agtggttgtt 7560cgtccactta aaaataacga ttgtcatatc tggatccaac agttaaacca tgtgatggtg 7620tatactgtgg tatggcgtaa aacaacggag aggttcgaat cctcccctaa ccgcgggtag 7680cggccca 7687 25 7685 DNA Tobacco mosaic virus 25gtatttttac aacaattacc aacaacaaca aacaacagac aacattacaa ttactattta 60caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600tctgtcacaa tactttccag acatgcgaac atcagccgat gcagcaatca ggcagagtgt 660atgccattgc gctacacagc atatatgaca taccagccga tgagttcggg gcggcactct 720tgaggaaaaa tgtccatacg tgctatgccg ctttccactt ctccgagaac ctgcttcttg 780aagattcatg cgtcaatttg gacgaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840tgaccttttc ttttgcatca gagagtactc ttaattactg tcatagttat tctaatattc 900ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080acgcatggca ttacaaaaag actcttgcaa tgtgcaacag cgagagaatc ctccttgagg 1140attcatcatc agtcaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200tcgacatttc tttggagact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260tcgtgtttac agtgcttaac cacattcgaa cataccaggc gaaagctctt acatacgcaa 1320atgttttgtc cttcgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740atgcactttc agaattatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800cccagatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920cgctagcttt acaggatcaa gagaaggctt cagaaggtgc attggtagtt acctcaagag 1980aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040ttgctggaga tcatccggaa tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100agtttcatat ggcgacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340ccaagagtca tgcatggggt gttgttgaaa cccacgcgag gaagtatcat gtggcgcttt 2400tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgttagct 2460ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgcttcgaa 2520acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580gaaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880catacatcaa tagagtttca ggattcccgt accccgccca ttttgccaaa ttggaagttg 2940acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatct 3120tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240caccggtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420aattacagat tgactcggtg ttcaaaggtt ccaatctttt tgttgcagcg ccaaagactg 3480gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600gcatattgga tatgtctaag tctgttgctg cgcctaagga tcaaatcaaa ccactaatac 3660ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720cgatgattaa aagaaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780ctgcatcttt ggttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900aacaggtaac aataggccag ctcgcagatt ttgattttgt ggatttgcca gcagttgatc 3960agtacagaca catgattaaa gcacaaccca aacaaaagtt ggacacttca atccaaacgg 4020agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atattcggcc 4080cgttgtttag tgagcttact aggcaattac tggacagtgt tgattcgagc agatttttgt 4140ttttcacaag aaagacacca gcgcagattg aggatttctt cggagatctc gacagtcatg 4200tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260actgtgcagt agaatacgag atctggcgaa gattgggttt cgaagacttc ttgggagaag 4320tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680tctcgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040aatgagtcat tgtcaggggt gaaccttctt aaaggagtta agcttattga tagtggatac 5100gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cattctcgga 5220tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280ataaccaccc aggacgcgat gaaaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400aaaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580agtagtgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tggaggaatg 5640agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760ttaaatggct agcaaaggag aagaactttt cactggagtt gtcccaattc ttgttgaatt 5820agatggtgat gttaatgggc acaaattttc tgtcagtgga gagggtgaag gtgatgctac 5880atacggaaag cttaccctta aatttatttg cactactgga aaactacctg ttccatggcc 5940aacacttgtc actactttct cttatggtgt tcaatgcttt tcccgttatc cggatcatat 6000gaaacggcat gactttttca agagtgccat gcccgaaggt tatgtacagg aacgcactat 6060atctttcaaa gatgacggga actacaagac gcgtgctgaa gtcaagtttg aaggtgatac 6120ccttgttaat cgtatcgagt taaaaggtat tgattttaaa gaagatggaa acattctcgg 6180acacaaactc gagtacaact ataactcaca caatgtatac atcacggcag acaaacaaaa 6240gaatggaatc aaagctaact tcaaaattcg ccacaacatt gaagatggat ccgttcaact 6300agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 6360ccattacctg tcgacacaat ctgccctttc gaaagatccc aacgaaaagc gtgaccacat 6420gggccttctt gagtttgtaa ctgctgctgg gattacacat ggcatggatg agctctacaa 6480ataatgacac tcgaggggta gtcaagatgc ataataaata acggattgtg tccgtaatca 6540cacgtggtgc gtacgataac gcatagtgtt tttccctcca cttaaatcga agggttgtgt 6600cttggatcgc gcgggtcaaa tgtatatggt tcatatacat ccgcaggcac gtaataaagc 6660gaggggttcg ggtcgaggtc ggctgtgaaa ctcgaaaagg ttccggaaaa caaaaaagag 6720agtggtaggt aatagtgtta ataataagaa aataaataat agtggtaaga aaggtttgaa 6780agttgaggaa attgaggata atgtaagtga tgacgagtct atcgcgtcat cgagtacgtt 6840ttaatcaata tgccttatac aatcaactct ccgagccaat ttgtttactt aagttccgct 6900tatgcagatc ctgtgcagct gatcaatctg tgtacaaatg cattgggtaa ccagtttcaa 6960acgcaacaag ctaggacaac agtccaacag caatttgcgg atgcctggaa acctgtgcct 7020agtatgacag tgagatttcc tgcatcggat ttctatgtgt atagatataa ttcgacgctt 7080gatccgttga tcacggcgtt attaaatagc ttcgatacta gaaatagaat aatagaggtt 7140gataatcaac ccgcaccgaa tactactgaa atcgttaacg cgactcagag ggtagacgat 7200gcgactgtag ctataagggc ttcaatcaat aatttggcta atgaactggt tcgtggaact 7260ggcatgttca atcaagcaag ctttgagact gctagtggac ttgtctggac cacaactccg 7320gctacttagc tattgttgtg agatttccta aaataaagtc actgaagact taaaattcag 7380ggtggctgat accaaaatca gcagtggttg ttcgtccact taaatataac gattgtcata 7440tctggatcca acagttaaac catgtgatgg tgtatactgt ggtatggcgt aaaacaacgg 7500aaaagtcgct gaagacttaa aattcagggt ggctgatacc aaaatcagca gtggttgttc 7560gtccacttaa aaataacgat tgtcatatct ggatccaaca gttaaaccat gtgatggtgt 7620atactgtggt atggcgtaaa caacggagag gttcgaatcc tcccctaacc gcgggtagcg 7680gccca 7685 26 7686 DNA Tobacco mosaic virus 26gtatttttac aacaattacc aacaacaaca aacaacagac aacattacaa ttactattta 60caattacaat ggcatacaca cagacagcta ccacatcagc tttgctggac actgtccgag 120gaaacaactc cttggtcaat gatctagcaa agcgtcgtct ttacgacaca gcggttgaag 180agtttaacgc tcgtgaccgc aggcccaagg tgaacttttc aaaagtaata agcgaggagc 240agacgcttat tgctacccgg gcgtatccag aattccaaat tacattttat aacacgcaaa 300atgccgtgca ttcgcttgca ggtggattgc gatctttaga actggaatat ctgatgatgc 360aaattcccta cggatcattg acttatgaca taggcgggaa ttttgcatcg catctgttca 420agggacgagc atatgtacac tgctgcatgc ccaacctgga cgttcgagac atcatgcggc 480acgaaggcca gaaagacagt attgaactat acctttctag gctagagaga ggggggaaaa 540cagtccccaa cttccaaaag gaagcatttg acagatacgc agaaattcct gaagacgctg 600tctgtcacaa tactttccag acatgcgaac atcagccgat gcagcaatca ggcagagtgt 660atgccattgc gctacacagc atatatgaca taccagccga tgagttcggg gcggcactct 720tgaggaaaaa tgtccatacg tgctatgccg ctttccactt ctccgagaac ctgcttcttg 780aagattcatg cgtcaatttg gacgaaatca acgcgtgttt ttcgcgcgat ggagacaagt 840tgaccttttc ttttgcatca gagagtactc ttaattactg tcatagttat tctaatattc 900ttaagtatgt gtgcaaaact tacttcccgg cctctaatag agaggtttac atgaaggagt 960ttttagtcac cagagttaat acctggtttt gtaagttttc tagaatagat acttttcttt 1020tgtacaaagg tgtggcccat aaaagtgtag atagtgagca gttttatact gcaatggaag 1080acgcatggca ttacaaaaag actcttgcaa tgtgcaacag cgagagaatc ctccttgggg 1140attcatcatc agtcaattac tggtttccca aaatgaggga tatggtcatc gtaccattat 1200tcgacatttc tttggagact agtaagagga cgcgcaagga agtcttagtg tccaaggatt 1260tcgtgttcac agtgcttaac cacattcgaa cataccaggc gaaagctctt acatacgcaa 1320atgttttgtc cttcgtcgaa tcgattcgat cgagggtaat cattaacggt gtgacagcga 1380ggtccgaatg ggatgtggac aaatctttgt tacaatcctt gtccatgacg ttttacctgc 1440atactaagct tgccgttcta aaggatgact tactgattag caagtttagt ctcggttcga 1500aaacggtgtg ccagcatgtg tgggatgaga tttcgctggc gtttgggaac gcatttccct 1560ccgtgaaaga gaggctcttg aacaggaaac ttatcagagt ggcaggcgac gcattagaga 1620tcagggtgcc tgatctatat gtgaccttcc acgacagatt agtgactgag tacaaggcct 1680ctgtggacat gcctgcgctt gacattagga agaagatgga agaaacggaa gtgatgtaca 1740atgcactttc agaattatcg gtgttaaggg agtctgacaa attcgatgtt gatgtttttt 1800cccagatgtg ccaatctttg gaagttgacc caatgacggc agcgaaggtt atagtcgcgg 1860tcatgagcaa tgagagcggt ctgactctca catttgaacg acctactgag gcgaatgttg 1920cgctagcttt acaggatcaa gagaaggctt cagaaggtgc attggtagtt acctcaagag 1980aagttgaaga accgtccatg aagggttcga tggccagagg agagttacaa ttagctggtc 2040ttgctggaga tcatccggaa tcgtcctatt ctaagaacga ggagatagag tctttagagc 2100agtttcatat ggcgacggca gattcgttaa ttcgtaagca gatgagctcg attgtgtaca 2160cgggtccgat taaagttcag caaatgaaaa actttatcga tagcctggta gcatcactat 2220ctgctgcggt gtcgaatctc gtcaagatcc tcaaagatac agctgctatt gaccttgaaa 2280cccgtcaaaa gtttggagtc ttggatgttg catctaggaa gtggttaatc aaaccaacgg 2340ccaagagtca tgcatggggt gttgttgaaa cccacgcgag ggagtatcat gtggcgcttt 2400tggaatatga tgagcagggt gtggtgacat gcgatgattg gagaagagta gctgttagct 2460ctgagtctgt tgtttattcc gacatggcga aactcagaac tctgcgcaga ctgcttcgaa 2520acggagaacc gcatgtcagt agcgcaaagg ttgttcttgt ggacggagtt ccgggctgtg 2580gaaaaaccaa agaaattctt tccagggtta attttgatga agatctaatt ttagtacctg 2640ggaagcaagc cgcggaaatg atcagaagac gtgcgaattc ctcagggatt attgtggcca 2700cgaaggacaa cgttaaaacc gttgattctt tcatgatgaa ttttgggaaa agcacacgct 2760gtcagttcaa gaggttattc attgatgaag ggttgatgtt gcatactggt tgtgttaatt 2820ttcttgtggc gatgtcattg tgcgaaattg catatgttta cggagacaca cagcagattc 2880catacatcaa tagagtttca ggattcccgt accccgccca ttttgccaaa ttggaagttg 2940acgaggtgga gacacgcaga actactctcc gttgtccagc cgatgtcaca cattatctga 3000acaggagata tgagggcttt gtcatgagca cttcttcggt taaaaagtct gtttcgcagg 3060agatggtcgg cggagccgcc gtgatcaatc cgatctcaaa acccttgcat ggcaagatcc 3120tgacttttac ccaatcggat aaagaagctc tgctttcaag agggtattca gatgttcaca 3180ctgtgcatga agtgcaaggc gagacatact ctgatgtttc actagttagg ttaaccccta 3240caccggtctc catcattgca ggagacagcc cacatgtttt ggtcgcattg tcaaggcaca 3300cctgttcgct caagtactac actgttgtta tggatccttt agttagtatc attagagatc 3360tagagaaact tagctcgtac ttgttagata tgtataaggt cgatgcagga acacaatagc 3420aattacagat tgactcggtg ttcaaaggtt ccaatctttt tgttgcagcg ccaaagactg 3480gtgatatttc tgatatgcag ttttactatg ataagtgtct cccaggcaac agcaccatga 3540tgaataattt tgatgctgtt accatgaggt tgactgacat ttcattgaat gtcaaagatt 3600gcatattgga tatgtctaag tctgttgctg cacctaagga tcaaatcaaa ccactaatac 3660ctatggtacg aacggcggca gaaatgccac gccagactgg actattggaa aatttagtgg 3720cgatgattaa aagaaacttt aacgcacccg agttgtctgg catcattgat attgaaaata 3780ctgcatcttt ggttgtagat aagttttttg atagttattt gcttaaagaa aaaagaaaac 3840caaataaaaa tgtttctttg ttcagtagag agtctctcaa tagatggtta gaaaagcagg 3900aacaggtaac aataggccag ctcgcagatt ttgattttgt ggatttgcca gcagttgatc 3960agtacagaca catgattaaa gcacaaccca aacaaaagtt ggacacttca atccaaacgg 4020agtacccggc tttgcagacg attgtgtacc attcaaaaaa gatcaatgca atattcggcc 4080cgttgtttag tgagcttact aggcaattac tggacagtgt tgattcgagc agatttttgt 4140ttttcacaag aaagacacca gcgcagattg aggatttctt cggagatctc gacagtcatg 4200tgccgatgga tgtcttggag ctggatatat caaaatacga caaatctcag aatgaattcc 4260actgtgcagt agaatacgag atctggcgaa gattgggttt cgaagacttc ttgggagaag 4320tttggaaaca agggcataga aagaccaccc tcaaggatta taccgcaggt ataaaaactt 4380gcatctggta tcaaagaaag agcggggacg tcacgacgtt cattggaaac actgtgatca 4440ttgctgcatg tttggcctcg atgcttccga tggagaaaat aatcaaagga gccttttgcg 4500gtgacgatag tctgctgtac tttccaaagg gttgtgagtt tccggatgtg caacactccg 4560cgaatcttat gtggaatttt gaagcaaaac tgtttaaaaa acagtatgga tacttttgcg 4620gaagatatgt aatacatcac gacagaggat gcattgtgta ttacgatccc ctaaagttga 4680tctcgaaact tggtgctaaa cacatcaagg attgggaaca cttggaggag ttcagaaggt 4740ctctttgtga tgttgctgtt tcgttgaaca attgtgcgta ttacacacag ttggacgacg 4800ctgtatggga ggttcataag accgcccctc caggttcgtt tgtttataaa agtctggtga 4860agtatttgtc tgataaagtt ctttttagaa gtttgtttat agatggctct agttgttaaa 4920ggaaaagtga atatcaatga gtttatcgac ctgacaaaaa tggagaagat cttaccgtcg 4980atgtttaccc ctgtaaagag tgttatgtgt tccaaagttg ataaaataat ggttcatgag 5040aatgagtcat tgtcaggggt gaaccttctt aaaggagtta agcttattga tagtggatac 5100gtctgtttag ccggtttggt cgtcacgggc gagtggaact tgcctgacaa ttgcagagga 5160ggtgtgagcg tgtgtctggt ggacaaaagg atggaaagag ccgacgaggc cattctcgga 5220tcttactaca cagcagctgc aaagaaaaga tttcagttca aggtcgttcc caattatgct 5280ataaccaccc aggacgcgat gagaaacgtc tggcaagttt tagttaatat tagaaatgtg 5340aagatgtcag cgggtttctg tccgctttct ctggagtttg tgtcggtgtg tattgtttat 5400agaaataata taaaattagg tttgagagag aagattacaa acgtgagaga cggagggccc 5460atggaactta cagaagaagt cgttgatgag ttcatggaag atgtccctat gtcgatcagg 5520cttgcaaagt ttcgatctcg aaccggaaaa aagagtgatg tccgcaaagg gaaaaatagt 5580agtagtgatc ggtcagtgcc gaacaagaac tatagaaatg ttaaggattt tggaggaatg 5640agttttaaaa agaataattt aatcgatgat gattcggagg ctactgtcgc cgaatcggat 5700tcgttttaaa tagatcttac agtatcacta ctccatctca gttcgtgttc ttgtcattaa 5760ttaaatggct agcaaaggag aagaactttt cactggagtt gtcccaattc ttgttgaatt 5820agatggtgat gttaatgggc acaaattttc tgtcagtgga gagggtgaag gtgatgctac 5880atacggaaag cttacactta aatttatttg cactactgga aaactacctg ttccatggcc 5940aacacttgtc actactttct cttatggtgt tcaatgcttt tcccgttatc cggatcatat 6000gaaacggcat gactttttca agagtgccat gcccgaaggt tatgtacagg aacgcactat 6060atctttcaaa gatgacggga actacaagac gcgtgctgaa gtcaagtttg aaggtgatac 6120ccttgttaat cgtatcgagt taaaaggtat tgattttaaa gaagatggaa acattctcgg 6180acacaaactc gagtacaact ataactcaca caatgtatac atcacggcag acaaacaaaa 6240gaatggaatc aaagctaact tcaaaattcg ccacaacatt gaagatggat ccgttcaact 6300agcagaccat tatcaacaaa atactccaat tggcgatggc cctgtccttt taccagacaa 6360ccattacctg tcgacacaat ctgccctttc gaaagatccc aacgaaaagc gtgaccacat 6420ggtccttctt gagtttgtaa ctgctgctgg gattacacat ggcatggatg agctctacaa 6480ataatgacac tcgaggggta gtcaagatgc ataataaata acggattgtg tccgtaatca 6540cacgtggtgc gtacgataac gcatagtgtt tttccctcca cttaaatcga agggttgtgt 6600cttggatcgc gcgggtcaaa tgtatatggt tcatatacat ccgcaggcac gtaataaagc 6660gaggggttcg ggtcgaggtc ggctgtgaaa ctcgaaaagg ttccggaaaa caaaaaagag 6720agtggtaggt aatagtgtta ataataagaa aataaataat agtggtaaga aaggtttgaa 6780agttgaggaa attgaggata atgtaagtga tgacgagtct atcgcgtcat cgagtacgtt 6840ttaatcaata tgccttatac aatcaactct ccgagccaat ttgtttactt aagttccgct 6900tatgcagatc ctgtgcagct gatcaatctg tgtacaaatg cattgggtaa ccagtttcaa 6960acgcaacaag ctaggacaac agtccaacag caatttgcgg atgcctggaa acctgtgcct 7020agtatgacag tgagatttcc tgcatcggat ttctatgtgt atagatataa ttcgacgctt 7080gatccgttga tcacggcgtt attaaatagc ttcgatacta gaaatagaat aatagaggtt 7140gataatcaac ccgcaccgaa tactactgaa atcgttaacg cgactcagag ggtagacgat 7200gcgactgtag ctataagggc ttcaatcaat aatttggcta atgaactggt tcgtggaact 7260ggcatgttca atcaagcaag ctttgagact gctagtggac ttgtctggac cacaactccg 7320gctacttagc tattgttgtg agatttccta aaataaagtc actgaagact taaaattcag 7380ggtggctgat accaaaatca gcagtggttg ttcgtccact taaatataac gattgtcata 7440tctggatcca acagttaaac catgtgatgg tgtatactgt ggtatggcgt aaaacaacgg 7500aaaagtcgct gaagacttaa aattcagggt ggctgatacc aaaatcagca gtggttgttc 7560gtccacttaa aaataacgat tgtcatatct ggatccaaca gttaaaccat gtgatggtgt 7620atactgtggt atggcgtaaa acaacggaga ggttcgaatc ctcccctaac cgcgggtagc 7680ggccca 7686 27 7688 DNA Tobacco mosaic virus 27gtcgtatttt tacaacaatt accaacaaca acaaacaaca gacaacatta caattactat 60ttacaattac aatggcatac acacagacag ctaccacatc agctttgctg gacactgtcc 120gaggaaacaa ctccttggtc aatgatctag caaagcgtcg tctttacgac acagcggttg 180aagagtttaa cgctcgtgac cgcaggccca aggtgaactt ttcaaaagta ataagcgagg 240agcagacgct tattgctacc cgggcgtatc cagaattcca aattacattt tataacacgc 300aaaatgccgt gcattcgctt gcaggtggat tgcgatcttt agaactggaa tatctgatga 360tgcaaattcc ctacggatca ttgacttatg acataggcgg gaattttgca tcgcatctgt 420tcaagggacg agcatatgta cactgctgca tgcccaacct ggacgttcga gacatcatgc 480ggcacgaagg ccagaaagac agtattgaac tatacctttc taggctagag agagggggga 540aaacagtccc caacttccaa aaggaagcat ttgacagata cgcagaaatt cctgaagacg 600ctgtctgtca caatactttc cagacatgcg aacatcagcc gatgcagcaa tcaggcagag 660tgtatgccat tgcgctacac agcatatatg acataccagc cgatgagttc ggggcggcac 720tcttgaggaa aaatgtccat acgtgctatg ccgctttcca cttctccgag aacctgcttc 780ttgaagattc atgcgtcaat ttggacgaaa tcaacgcgtg tttttcgcgc gatggagaca 840agttgacctt ttcttttgca tcagagagta ctcttaatta ctgtcatagt tattctaata 900ttcttaagta tgtgtgcaaa acttacttcc cggcctctaa tagagaggtt tacatgaagg 960agtttttagt caccagagtt aatacctggt tttgtaagtt ttctagaata gatacttttc 1020ttttgtacaa aggtgtggcc cataaaagtg tagatagtga gcagttttat actgcaatgg 1080aagacgcatg gcattacaaa aagactcttg caatgtgcaa cagcgagaga atcctccttg 1140aggattcatc atcagtcaat tactggtttc ccaaaatgag ggatatggtc atcgtaccat 1200tattcgacat ttctttggag actagtaaga ggacgcgcaa ggaagtctta gtgtccaagg 1260atttcgtgtt tacagtgctt aaccacattc gaacatacca ggcgaaagct cttacatacg 1320caaatgtttt gtccttcgtc gaatcgattc gatcgagggt aatcattaac ggtgtgacag 1380cgaggtccga atgggatgtg gacaaatctt tgttacaatc cttgtccatg acgttttacc 1440tgcatactaa gcttgccgtt ctaaaggatg acttactgat tagcaagttt agtctcggtt 1500cgaaaacggt gtgccagcat gtgtgggatg agatttcgct ggcgtttggg aacgcatttc 1560cctccgtgaa agagaggctc ttgaacagga aacttatcag agtggcaggc gacgcattag 1620agatcagggt gcctgatcta tatgtgacct tccacgacag attagtgact gagtacaagg 1680cctctgtgga catgcctgcg cttgacatta ggaagaagat ggaagaaacg gaagtgatgt 1740acaatgcact ttcagaatta tcggtgttaa gggagtctga caaattcgat gttgatgttt 1800tttcccagat gtgccaatct ttggaagttg acccaatgac ggcagcgaag gttatagtcg 1860cggtcatgag caatgagagc ggtctgactc tcacatttga acgacctact gaggcgaatg 1920ttgcgctagc tttacaggat caagagaagg cttcagaagg tgcattggta gttacctcaa 1980gagaagttga agaaccgtcc atgaagggtt cgatggccag aggagagtta caattagctg 2040gtcttgctgg agatcatccg gaatcgtcct attctaagaa cgaggagata gagtctttag 2100agcagtttca tatggcgacg gcagattcgt taattcgtaa gcagatgagc tcgattgtgt 2160acacgggtcc gattaaagtt cagcaaatga aaaactttat cgatagcctg gtagcatcac 2220tatctgctgc ggtgtcgaat ctcgtcaaga tcctcaaaga tacagctgct attgaccttg 2280aaacccgtca aaagtttgga gtcttggatg ttgcatctag gaagtggtta atcaaaccaa 2340cggccaagag tcatgcatgg ggtgttgttg aaacccacgc gaggaagtat catgtggcgc 2400ttttggaata tgatgagcag ggtgtggtga catgcgatga ttggagaaga gtagctgtta 2460gctctgagtc tgttgtttat tccgacatgg cgaaactcag aactctgcgc agactgcttc 2520gaaacggaga accgcatgtc agtagcgcaa aggttgttct tgtggacgga gttccgggct 2580gtggaaaaac caaagaaatt ctttccaggg ttaattttga tgaagatcta attttagtac 2640ctgggaagca agccgcggaa atgatcagaa gacgtgcgaa ttcctcaggg attattgtgg 2700ccacgaagga caacgttaaa accgttgatt ctttcatgat gaattttggg aaaagcacac 2760gctgtcagtt caagaggtta ttcattgatg aagggttgat gttgcatact ggttgtgtta 2820attttcttgt ggcgatgtca ttgtgcgaaa ttgcatatgt ttacggagac acacagcaga 2880ttccatacat caatagagtt tcaggattcc cgtaccccgc ccattttgcc aaattggaag 2940ttgacgaggt ggagacacgc agaactactc tccgttgtcc agccgatgtc acacattatc 3000tgaacaggag atatgagggc tttgtcatga gcacttcttc ggttaaaaag tctgtttcgc 3060aggagatggt cggcggagcc gccgtgatca atccgatctc aaaacccttg catggcaaga 3120tcttgacttt tacccaatcg gataaagaag ctctgctttc aagagggtat tcagatgttc 3180acactgtgca tgaagtgcaa ggcgagacat actctgatgt ttcactagtt aggttaaccc 3240ctacaccggt ctccatcatt gcaggagaca gcccacatgt tttggtcgca ttgtcaaggc 3300acacctgttc gctcaagtac tacactgttg ttatggatcc tttagttagt atcattagag 3360atctagagaa acttagctcg tacttgttag atatgtataa ggtcgatgca ggaacacaat 3420agcaattaca gattgactcg gtgttcaaag gttccaatct ttttgttgca gcgccaaaga 3480ctggtgatat ttctgatatg cagttttact atgataagtg tctcccaggc aacagcacca 3540tgatgaataa ttttgatgct gttaccatga ggttgactga catttcattg aatgtcaaag 3600attgcatatt ggatatgtct aagtctgttg ctgcgcctaa ggatcaaatc aaaccactaa 3660tacctatggt acgaacggcg gcagaaatgc cacgccagac tggactattg gaaaatttag 3720tggcgatgat taaaagaaac tttaacgcac ccgagttgtc tggcatcatt gatattgaaa 3780atactgcatc tttggttgta gataagtttt ttgatagtta tttgcttaaa gaaaaaagaa 3840aaccaaataa aaatgtttct ttgttcagta gagagtctct caatagatgg ttagaaaagc 3900aggaacaggt aacaataggc cagctcgcag attttgattt tgtggatttg ccagcagttg 3960atcagtacag acacatgatt aaagcacaac ccaaacaaaa gttggacact tcaatccaaa 4020cggagtaccc ggctttgcag acgattgtgt accattcaaa aaagatcaat gcaatattcg 4080gcccgttgtt tagtgagctt actaggcaat tactggacag tgttgattcg agcagatttt 4140tgtttttcac aagaaagaca ccagcgcaga ttgaggattt cttcggagat ctcgacagtc 4200atgtgccgat ggatgtcttg gagctggata tatcaaaata cgacaaatct cagaatgaat 4260tccactgtgc agtagaatac gagatctggc gaagattggg tttcgaagac ttcttgggag 4320aagtttggaa acaagggcat agaaagacca ccctcaagga ttataccgca ggtataaaaa 4380cttgcatctg gtatcaaaga aagagcgggg acgtcacgac gttcattgga aacactgtga 4440tcattgctgc atgtttggcc tcgatgcttc cgatggagaa aataatcaaa ggagcctttt 4500gcggtgacga tagtctgctg tactttccaa agggttgtga gtttccggat gtgcaacact 4560ccgcgaatct tatgtggaat tttgaagcaa aactgtttaa aaaacagtat ggatactttt 4620gcggaagata tgtaatacat cacgacagag gatgcattgt gtattacgat cccctaaagt 4680tgatctcgaa acttggtgct aaacacatca aggattggga acacttggag gagttcagaa 4740ggtctctttg tgatgttgct gtttcgttga acaattgtgc gtattacaca cagttggacg 4800acgctgtatg ggaggttcat aagaccgccc ctccaggttc gtttgtttat aaaagtctgg 4860tgaagtattt gtctgataaa gttcttttta gaagtttgtt tatagatggc tctagttgtt 4920aaaggaaaag tgaatatcaa tgagtttatc gacctgacaa aaatggagaa gatcttaccg 4980tcgatgttta cccctgtaaa gagtgttatg tgttccaaag ttgataaaat aatggttcat 5040gagaatgagt cattgtcagg ggtgaacctt cttaaaggag ttaagcttat tgatagtgga 5100tacgtctgtt tagccggttt ggtcgtcacg ggcgagtgga acttgcctga caattgcaga 5160ggaggtgtga gcgtgtgtct ggtggacaaa aggatggaaa gagccgacga ggccattctc 5220ggatcttact acacagcagc tgcaaagaaa agatttcagt tcaaggtcgt tcccaattat 5280gctataacca cccaggacgc gatgaaaaac gtctggcaag ttttagttaa tattagaaat 5340gtgaagatgt cagcgggttt ctgtccgctt tctctggagt ttgtgtcggt gtgtattgtt 5400tataaaaata atataaaatt aggtttgaga gagaagatta caaacgtgag agacggaggg 5460cccatggaac ttacagaaga agtcgttgat gagttcatgg aagatgtccc tatgtcgatc 5520aggcttgcaa agtttcgatc tcgaaccgga aaaaagagtg atgtccgcaa agggaaaaat 5580agtagtagtg atcggtcagt gccgaacaag aactatagaa atgttaagga ttttggagga 5640atgagtttta aaaagaataa tttaatcgat gatgattcgg aggctactgt cgccgaatcg 5700gattcgtttt aaatagatct tacagtatca ctactccatc tcagttcgtg ttcttgtcat 5760taattaaatg gctagcaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga 5820attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc 5880tacatacgga aagcttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg 5940gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcccgtt atccggatca 6000tatgaaacgg catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac 6060tatatctttc aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga 6120tacccttgtt aatcgtatcg agttaaaagg tattgatttt aaagaagatg gaaacattct 6180cggacacaaa ctcgagtaca actataactc acacaatgta tacatcacgg cagacaaaca 6240aaagaatgga atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca 6300actagcagac cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga 6360caaccattac ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca 6420catgggcctt cttgagtttg taactgctgc tgggattaca catggcatgg atgagctcta 6480caaataatga cactcgaggg gtagtcaaga tgcataataa ataacggatt gtgtccgtaa 6540tcacacgtgg tgcgtacgat aacgcatagt gtttttccct ccacttaaat cgaagggttg 6600tgtcttggat cgcgcgggtc aaatgtatat ggttcatata catccgcagg cacgtaataa 6660agcgaggggt tcgggtcgag gtcggctgtg aaactcgaaa aggttccgga aaacaaaaaa 6720gagagtggta ggtaatagtg ttaataataa gaaaataaat aatagtggta agaaaggttt 6780gaaagttgag gaaattgagg ataatgtaag tgatgacgag tctatcgcgt catcgagtac 6840gttttaatca atatgcctta tacaatcaac tctccgagcc aatttgttta cttaagttcc 6900gcttatgcag atcctgtgca gctgatcaat ctgtgtacaa atgcattggg taaccagttt 6960caaacgcaac aagctaggac aacagtccaa cagcaatttg cggatgcctg gaaacctgtg 7020cctagtatga cagtgagatt tcctgcatcg gatttctatg tgtatagata taattcgacg 7080cttgatccgt tgatcacggc gttattaaat agcttcgata ctagaaatag aataatagag 7140gttgataatc aacccgcacc gaatactact gaaatcgtta acgcgactca gagggtagac 7200gatgcgactg tagctataag ggcttcaatc aataatttgg ctaatgaact ggttcgtgga 7260actggcatgt tcaatcaagc aagctttgag actgctagtg gacttgtctg gaccacaact 7320ccggctactt agctattgtt gtgagatttc ctaaaataaa gtcactgaag acttaaaatt 7380cagggtggct gataccaaaa tcagcagtgg ttgttcgtcc acttaaatat aacgattgtc 7440atatctggat ccaacagtta aaccatgtga tggtgtatac tgtggtatgg cgtaaaacaa 7500cggaaaagtc gctgaagact taaaattcag ggtggctgat accaaaatca gcagtggttg 7560ttcgtccact taaaaataac gattgtcata tctggatcca acagttaaac catgtgatgg 7620tgtatactgt ggtatggcgt aaacaacgga gaggttcgaa tcctccccta accgcgggta 7680gcggccca 7688

Claims

1. A capped RNA molecule capable of infecting a host plant cell comprising:a) a viral sequence comprising a cis-acting viral replication element derived from a single component (+) strand RNA plant virus; b) a sequence of one to three intervening bases located between a cap and the 5′ terminus of the viral sequence; c) an exogenous RNA segment capable of expressing its function in a plant host cell; wherein said exogenous RNA segment is located in a region of said capped RNA molecule able to tolerate said exogenous RNA segment without disrupting RNA replication of said capped RNA molecule; and wherein said capped RNA molecule is capable of replication in the absence of a trans-acting viral replication element.

2. The RNA of claim 1, wherein the exogenous RNA segment codes for a peptide or protein.

3. The RNA of claim 1, wherein the exogenous RNA segment comprises an antisense RNA.

4. The RNA of claim 1, wherein the exogenous RNA segment comprises a structural RNA.

5. The RNA of claim 1, wherein the exogenous RNA segment comprises a regulatory RNA.

6. The RNA of claim 1, wherein the exogenous RNA segment comprises a RNA having catalytic properties.

7. The RNA molecule of claim 1, wherein the cis-acting viral replication element is derived from a tobacco mosaic virus.

8. The RNA molecule of claim 1, encapsidated with viral coat protein.

9. The capped RNA molecule of claim 1, comprising a single intervening base located between the cap and the 5′ terminus of the viral sequence.

10. The capped RNA molecule of claim 1, comprising a sequence of two intervening bases located between the cap and the 5′ terminus of the viral sequence.

11. The capped RNA molecule of claim 1, comprising a sequence of three intervening bases located between the cap and the 5′ terminus of the viral sequence.

12. The capped RNA molecule of claim 1, wherein said (+) strand RNA plant virus is a tobamovirus.

13. The capped RNA molecule of claim 1, wherein said plant host is Nicotiana.

14. A DNA transcription vector comprising cDNA having one strand complementary to a capped RNA molecule capable of infecting a host plant cell, said capped RNA molecule comprising:a) a viral sequence comprising a cis-acting viral replication element derived from a single component (+) strand RNA plant virus; b) a sequence of one to three intervening bases located between the cap and the 5′ terminus of the viral sequence; and c) an exogenous RNA segment capable of expressing its function in a plant host cell in a region of said capped RNA molecule able to tolerate said exogenous RNA segment without disrupting RNA replication of said capped RNA molecule; and wherein said capped RNA molecule is capable of replication in the absence of a trans-acting viral replication element.

15. A DNA transcription vector selected from the group consisting of pBTI1037, pBTI SBS60, pBTI SBS60-29, pBTI1056, pBTI1057, and pBTI1056-GTN28.

16. A method of modifying a host plant cell phenotypically, said method comprising introducing into the cell a capped RNA molecule capable of infecting said host cell, wherein said capped RNA molecule comprises:a) a cis-acting viral replication element derived from a single component single component (+) strand RNA plant virus; b) the same capped 5′ end as said virus; c) a sequence of one to three intervening bases located between the cap and the 5′ terminus of the viral sequence, and an exogenous RNA segment in a region of said capped RNA molecule able to tolerate said exogenous RNA segment without disrupting RNA replication of said capped RNA molecule, and wherein said capped RNA molecule is capable of replication in the absence of a trans-acting viral replication element; whereby the exogenous RNA segment confers a detectable trait in the host cell, thereby modifying said host cell.

17. The method of claim 16, wherein the exogenous RNA segment codes for a peptide or protein.

18. The method of claim 16, wherein the exogenous RNA segment comprises an antisense RNA.

19. The method of claim 16, wherein the exogenous RNA segment comprises a structural RNA.

20. The method of claim 16, wherein the exogenous RNA segment comprises a regulatory RNA.

21. The method of claim 16, wherein the exogenous RNA segment comprises a RNA having catalytic properties.

22. The method of claim 16, wherein the cis-acting viral replication element is derived from tobacco mosaic virus.

23. The method of claim 16, wherein the host plant cell is a dicotyledonous plant cell.

24. A capped RNA molecule capable of infecting a host plant cell, said capped RNA molecule having a sequence of one to three intervening bases located between the cap and the 5′ terminus of the viral sequence, said capped RNA molecule comprising:(a) the entire genome of a single component (+) strand RNA virus, said (+) strand RNA virus chosen from the group consisting of Carlavirus, Closteroviridae, Luteoviridae, Potexvirus, Potyviridae, Tombusviridae, Tymovirus and Tobamovirus, and (b) an exogenous RNA segment, capable of expressing its function in a host plant cell, said exogenous RNA segment inserted into said genome of the (+) strand RNA virus under the control of a subgenomic promoter.

25. A method of modifying a host plant cell phenotypically, said method comprises introducing to the cell a capped RNA molecule capable of infecting a host plant cell, said capped RNA molecule having a sequence of one to three intervening bases located between the cap and the 5′ terminus of the viral sequence, said capped RNA molecule comprising:(a) the entire genome of a single component (+) strand RNA virus, said (+) strand RiA virus chosen from the group consisting of Carlavirus, Closteroviridae, Luteoviridae, Potexvirus, Potyviridae, Tombusviridae, Tymovirus and Tobamovirus; and (b) an exogenous RNA segment, capable of expressing its function in a host plant cell, said exogenous RNA segment inserted into said genome of the (+) strand RNA virus under the control of a subgenomic promoter; whereby the exogenous RNA segment confers a detectable trait in the host plant cell, thereby modifying said host plant cell.

26. A DNA transcription vector comprising DNA having one strand complementary to a capped RNA molecule capable of infecting a host plant cell, said capped RNA molecule having a sequence of one to three intervening bases located between the cap and the 5′ terninus of the viral sequence, said capped RNA molecule comprising:(a) the entire genome of a single component (+) strand RNA virus, said (+) strand RNA virus chosen from the group consisting of Carlavirus, Closteroviridae, Luteoviridac, Potexvirus, Potyviridae, Tombusviridae, Tymovirus and Tobamovirus, and (b) an exogenous RNA segment, capable of expressing its function in a host plant cell, said exogenous RNA segment inserted into said genome of the (+) strand RNA virus under the control of a subgenomic promoter.