The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on Dec. 7, 2023, is named 2011271-0254_SL.xml and is 2,670,424 bytes in size.
One major problem with targeted integration strategies for the generation of genetically engineered cells is that successful targeted integration events can be rare, especially when using double-stranded DNA (dsDNA) as a template where knock-in efficiencies are often below 5%. There is therefore typically a requirement for a screening or selection strategy that enriches for cellular clones that harbor a successfully integrated allele or gene. Many selection strategies have been devised to identify correctly targeted clones, e.g., by co-integration of reporter genes that confer fluorescence, antibiotic resistance, etc. However, these selection strategies are time consuming, inefficient and not desirable for use in a therapeutic context. Indeed, even for a single targeted integration, it can be necessary to screen hundreds, sometimes thousands, of clones in order to identify a successfully targeted clone. In situations where multiple edits are desired it can be necessary to screen tens of thousands of clones or more.
The present disclosure provides strategies, systems, compositions, and methods for genetically engineering cells via targeted integration that do not require external selection markers, such as fluorescent or antibiotic resistance markers, while yielding a high frequency of correctly targeted clones. In general, the strategies, systems, compositions, and methods for genetically engineering cells via targeted integration provided herein feature a targeted break in an essential gene mediated by a nuclease, and integration of an exogenous knock-in cassette that, if inserted correctly, results in a functional variant of the essential gene and also includes an expression construct harboring a cargo sequence.
In one aspect, the disclosure features a method of editing the genome of a cell (e.g., a cell in a population of cells), the method comprising contacting the cell (or the population of cells) with: (i) a nuclease that causes a break within an endogenous coding sequence of an essential gene in the cell, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, wherein the knock-in cassette is integrated into the genome of the cell by homology-directed repair (HDR) of the break, resulting in a genome-edited cell that expresses: (a) the gene product of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable cells of the population of cells are genome-edited cells, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 80% of the viable cells of the population of cells are genome-edited cells, and about 20% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 60% of the viable cells of the population of cells are genome-edited cells, and about 40% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 90% of the viable cells of the population of cells are genome-edited cells, and about 10% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 95% of the viable cells of the population of cells are genome-edited cells, and about 5% or less of the population of cells lacking an integrated knock-in cassette are viable cells.
In some embodiments, if the knock-in cassette is not integrated into the genome of the cell by homology-directed repair (HDR) in the correct position or orientation, the cell no longer expresses the gene product encoded by the essential gene, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the essential gene. In some embodiments, the break is located within the last exon of the essential gene. In some embodiments, the break is located within the penultimate exon of the essential gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of cells contacted with the nuclease. In some embodiments, the nuclease is capable of introducing indels (insertions or deletions) in at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of cells contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the cell (or the population of cells) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the nuclease is a CRISPR/Cas nuclease selected from Table 5. In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide molecule binds to and mediates CRISPR/Cas cleavage at a location within the essential gene that is necessary for function (e.g., functional gene expression or protein function). In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell, e.g., less than 99%, less than 95%, less than 90%, less than 85%, or less than 80% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is 80% to 99% identical to the corresponding endogenous coding sequence of the essential gene of the cell, e.g., 85% to 95% or 90% to 99% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the cell, or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11. In some embodiments, the essential gene is a gene selected from Table 3, Table 4, or Table 17.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited cell comprises knock-in cassettes at one or both alleles of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest from the same allele of an essential gene, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest from different alleles of the essential gene, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the method comprises contacting the cell (or the population of cells) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, the genome-edited cell comprises the first knock-in cassette at a first allele of the essential gene and the second knock-in cassette at the second allele of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the method comprises contacting the cell (or the population of cells) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a first essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited cell comprises the first knock-in cassette at one or both alleles of the first essential gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene products encoded by the first and second essential genes required for survival and/or proliferation of the cell, or a functional variant thereof.
In another aspect, the disclosure features a genetically modified cell comprising a genome with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of a coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, and wherein at least part of the coding sequence of the essential gene comprises an exogenous coding sequence.
In some embodiments, the exogenous coding sequence of the essential gene comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the essential gene.
In some embodiments, the exogenous coding sequence of the essential gene encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, the exogenous coding sequence of the essential gene is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence of the essential gene has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence of the essential gene includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the cell's genome comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the cell's genome comprises an IRES or 2A element located between the coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the cell's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the cell's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features an engineered cell comprising a genomic modification, wherein the genomic modification comprises an insertion of an exogenous knock-in cassette within an endogenous coding sequence of an essential gene in the cell's genome, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, wherein the knock-in cassette comprises an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene, or a functional variant thereof, and wherein the cell expresses the gene product of interest and the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof, optionally wherein the gene product of interest and the gene product encoded by the essential gene are expressed from the endogenous promoter of the essential gene.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the essential gene.
In some embodiments, wherein the exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the cell's genome comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the cell's genome comprises an IRES or 2A element located between the coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the cell's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the cell's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited cell comprises knock-in cassettes at one or both alleles of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the engineered cell comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, the engineered cell comprises the first knock-in cassette and the second knock-in cassette at a first allele of the essential gene, optionally wherein the engineered cell also comprises the first knock-in cassette and the second knock-in cassette at a second allele of the essential gene. In some embodiments, the engineered cell comprises the first knock-in cassette at a first allele of the essential gene and the second knock-in cassette at the second allele of the essential gene. In some embodiments, the engineered cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the engineered cell comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a first essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the engineered cell comprises the first knock-in cassette at one or both alleles of the first essential gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene products encoded by the first and second essential genes required for survival and/or proliferation of the cell, or a functional variant thereof.
In another aspect, the disclosure features any of the cells described herein for use as a medicament and/or for use in the treatment of a disease, disorder or condition, e.g., a disease, disorder or condition described herein, e.g., a cancer, e.g., a cancer described herein.
In another aspect, the disclosure features a cell, or a population of cells, produced by any of the methods described herein, or progeny thereof.
In another aspect, the disclosure features a system for editing the genome of a cell (or a cell in a population of cells), the system comprising the cell (or the population of cells), a nuclease that causes a break within an endogenous coding sequence of an essential gene of the cell, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, and a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene.
In some embodiments, after contacting the population of cells with the nuclease and the donor template, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable cells of the population of cells are genome-edited cells, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, after contacting the population of cells with the nuclease and the donor template, at least about 80% of the viable cells of the population of cells are genome-edited cells, and about 20% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, after contacting the population of cells with the nuclease and the donor template, at least about 60% of the viable cells of the population of cells are genome-edited cells, and about 40% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, after contacting the population of cells with the nuclease and the donor template, at least about 90% of the viable cells of the population of cells are genome-edited cells, and about 10% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, after contacting the population of cells with the nuclease and the donor template, at least about 95% of the viable cells of the population of cells are genome-edited cells, and about 5% or less of the population of cells lacking an integrated knock-in cassette are viable cells.
In some embodiments, after contacting the cell or population of cells with the nuclease and the donor template, if the knock-in cassette is not integrated into the genome of the cell by homology-directed repair (HDR) in the correct position or orientation, the cell no longer expresses the gene product encoded by the essential gene, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the essential gene. In some embodiments, the break is located within the last exon of the essential gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of cells contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the cell (or the population of cells) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the cell, or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, after contacting the population of cells with the nuclease and the donor template, the genome-edited cell comprises knock-in cassettes at one or both alleles of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the system comprises a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, after contacting the population of cells with the nuclease and the donor templates, the genome-edited cell comprises the first knock-in cassette at a first allele of the essential gene and the second knock-in cassette at the second allele of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the system comprises a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a first essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, after contacting the population of cells with the nuclease and the donor templates, the genome-edited cell comprises the first knock-in cassette at one or both alleles of the first essential gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene products encoded by the first and second essential genes required for survival and/or proliferation of the cell, or a functional variant thereof.
In another aspect, the disclosure features a donor template comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell.
In some embodiments, the donor template is for use in editing the genome of a cell by homology-directed repair (HDR).
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the cell. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the cell. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the cell, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the cell.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the cell, or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In one aspect, the disclosure features a method of producing a population of modified cells, the method comprising contacting cells with: (i) a nuclease that causes a break within an endogenous coding sequence of an essential gene in a plurality of the cells, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cells, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, wherein the knock-in cassette is integrated into the genome of a plurality of the cells by homology-directed repair (HDR) of the break, resulting in genome-edited cells that expresses: (a) the gene product of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the plurality of cells, or a functional variant thereof, and wherein following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable cells are genome-edited cells, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the cells lacking an integrated knock-in cassette are viable cells, thereby producing a population of modified cells. In some embodiments, following the contacting step, at least about 80% of the viable cells are genome-edited cells, and about 20% or less of the cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 60% of the viable cells are genome-edited cells, and about 40% or less of the cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 90% of the viable cells are genome-edited cells, and about 10% or less of the cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 95% of the viable cells are genome-edited cells, and about 5% or less of cells lacking an integrated knock-in cassette are viable cells.
In some embodiments, if the knock-in cassette is not integrated into the genome of the cell by homology-directed repair (HDR) in the correct position or orientation, the cell no longer expresses the gene product encoded by the essential gene, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the essential gene. In some embodiments, the break is located within the last exon of the essential gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of cells contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the cell (or the population of cells) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the cell, or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited cells comprise knock-in cassettes at one or both alleles of the essential gene. In some embodiments, the genome-edited cells expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cells, or a functional variant thereof.
In some embodiments, the method comprises contacting the cells (or the population of cells) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, the genome-edited cells comprise the first knock-in cassette at a first allele of the essential gene and the second knock-in cassette at the second allele of the essential gene. In some embodiments, the genome-edited cells expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cells, or a functional variant thereof.
In some embodiments, the method comprises contacting the cells (or the population of cells) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a first essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited cells comprise the first knock-in cassette at one or both alleles of the first essential gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited cells expresses (a) the first and second gene products of interest, and (b) the gene products encoded by the first and second essential genes required for survival and/or proliferation of the cells, or a functional variant thereof.
In another aspect, the disclosure features a method of selecting and/or identifying a cell comprising a knock-in of a gene product of interest within an endogenous coding sequence of an essential gene in the cell, the method comprising contacting a population of cells with: (i) a nuclease that causes a break within an endogenous coding sequence of an essential gene in a plurality of the cells, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cells, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, wherein the knock-in cassette is integrated into the genome of a plurality of the cells by homology-directed repair (HDR) of the break, and identifying a genome-edited cell within the population of cells that expresses: (a) the gene product of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable cells of the population of cells are genome-edited cells, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 80% of the viable cells of the population of cells are genome-edited cells, and about 20% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 60% of the viable cells of the population of cells are genome-edited cells, and about 40% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 90% of the viable cells of the population of cells are genome-edited cells, and about 10% or less of the population of cells lacking an integrated knock-in cassette are viable cells. In some embodiments, following the contacting step, at least about 95% of the viable cells of the population of cells are genome-edited cells, and about 5% or less of the population of cells lacking an integrated knock-in cassette are viable cells.
In some embodiments, if the knock-in cassette is not integrated into the genome of the cell by homology-directed repair (HDR) in the correct position or orientation, the cell no longer expresses the gene product encoded by the essential gene, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the essential gene. In some embodiments, the break is located within the last exon of the essential gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of cells contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the cell (or the population of cells) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the essential gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the cell, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the cell.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell. In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the cell, or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the essential gene is GAPDH, TBP, E2F4, G6PD, or KIF11.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited cell comprises knock-in cassettes at one or both alleles of the essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the method comprises contacting the population of cells with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, the genome-edited cells comprises the first knock-in cassette at a first allele of the essential gene and the second knock-in cassette at the second allele of the essential gene. In some embodiments, the genome-edited cells expresses (a) the first and second gene products of interest, and (b) the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof.
In some embodiments, the method comprises contacting the population of cells with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a first essential gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited cells comprises the first knock-in cassette at one or both alleles of the first essential gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited cell expresses (a) the first and second gene products of interest, and (b) the gene products encoded by the first and second essential genes required for survival and/or proliferation of the cell, or a functional variant thereof.
In another aspect, the disclosure features a method of editing the genome of an induced pluripotent stem cell (iPSC) (e.g., an iPSC in a population of iPSCs), the method comprising contacting the iPSC (or the population of iPSCs) with: (i) a nuclease that causes a break within an endogenous coding sequence of a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene in the iPSC, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of the iPSC by homology-directed repair (HDR) of the break, resulting in a genome-edited iPSC that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSCs by homology-directed repair (HDR) in the correct position or orientation, the iPSCs no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the iPSC (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In another aspect, the disclosure features a genetically modified iPSC comprising a genome with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of a coding sequence of a GAPDH gene, and wherein at least part of the coding sequence of the GAPDH gene comprises an exogenous coding sequence.
In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence of the GAPDH gene encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence of the GAPDH gene is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence of the GAPDH gene has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence of the GAPDH gene includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features an engineered iPSC comprising a genomic modification, wherein the genomic modification comprises an insertion of an exogenous knock-in cassette within an endogenous coding sequence of a GAPDH gene in the iPSC's genome, wherein the knock-in cassette comprises an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence encoding GAPDH, or a functional variant thereof, and wherein the iPSC expresses the gene product of interest and GAPDH, or a functional variant thereof, optionally wherein the gene product of interest and GAPDH are expressed from the endogenous GAPDH promoter.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence encoding GAPDH includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the engineered iPSC comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the engineered iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the engineered iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In another aspect, the disclosure features an immune cell (e.g., an iNK cell or T cell) differentiated from an iPSC described herein.
In another aspect, the disclosure features any of the iPSCs (or iNK or T cell differentiated from an iPSC) described herein for use as a medicament and/or for use in the treatment of a disease, disorder or condition, e.g., a disease, disorder or condition described herein, e.g., a cancer, e.g., a cancer described herein.
In another aspect, the disclosure features an iPSC, or a population of iPSCs, produced by any of the methods described herein, or progeny thereof.
In another aspect, the disclosure features a system for editing the genome of an iPSC (or an iPSC in a population of iPSCs), the system comprising the iPSC (or the population of iPSC), a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene of the iPSC, and a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene.
In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, after contacting the iPSC or population of iPSCs with the nuclease and the donor template, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the system comprises a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor templates, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In another aspect, the disclosure features a donor template comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene.
In some embodiments, the donor template is for use in editing the genome of an iPSC by homology-directed repair (HDR).
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features a method of producing a population of modified iPSCs, the method comprising contacting iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, resulting in genome-edited iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, and wherein following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the iPSCs lacking an integrated knock-in cassette are viable iPSCs, thereby producing a population of modified iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs are genome-edited iPSCs, and about 20% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs are genome-edited iPSCs, and about 40% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs are genome-edited iPSCs, and about 10% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs are genome-edited iPSCs, and about 5% or less of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSCs comprise knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting iPSCs (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In another aspect, the disclosure features a method of selecting and/or identifying an iPSC comprising a knock-in of a gene product of interest within an endogenous coding sequence of a GAPDH gene in the iPSC, the method comprising contacting a population of iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, and identifying a genome-edited iPSC within the population of iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the population of iPSCs with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In another aspect, the disclosure features a method of editing the genome of an induced pluripotent stem cell (iPSC) (e.g., an iPSC in a population of iPSCs), the method comprising contacting the iPSC (or the population of iPSCs) with: (i) a nuclease that causes a break within an endogenous coding sequence of a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene in the iPSC, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of the iPSC by homology-directed repair (HDR) of the break, resulting in a genome-edited iPSC that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSCs by homology-directed repair (HDR) in the correct position or orientation, the iPSCs no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the iPSC (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSC comprises multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR. In some embodiments, the genome-edited iPSC comprises bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR.
In some embodiments, the method comprises contacting the iPSC (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited iPSC comprises the first knock-in cassette at one or both alleles of the GAPDH gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, (b) GAPDH, and (c) the gene product encoded by the second essential gene required for survival and/or proliferation of the iPSC, or a functional variant thereof. In some embodiments, the second essential gene is a gene listed in Table 3 or 4. In some embodiments, the second essential gene is TBP.
In another aspect, the disclosure features a genetically modified iPSC comprising a genome with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of a coding sequence of a GAPDH gene, wherein at least part of the coding sequence of the GAPDH gene comprises an exogenous coding sequence, and wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence of the GAPDH gene encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence of the GAPDH gene is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence of the GAPDH gene has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence of the GAPDH gene includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features an engineered iPSC comprising a genomic modification, wherein the genomic modification comprises an insertion of an exogenous knock-in cassette within an endogenous coding sequence of a GAPDH gene in the iPSC's genome, wherein the knock-in cassette comprises an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence encoding GAPDH, or a functional variant thereof, wherein the iPSC expresses the gene product of interest and GAPDH, or a functional variant thereof, optionally wherein the gene product of interest and GAPDH are expressed from the endogenous GAPDH promoter, and wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence encoding GAPDH includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the engineered iPSC comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the engineered iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the engineered iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the engineered iPSC comprises multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR. In some embodiments, the engineered iPSC comprises bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR.
In some embodiments, engineered iPSC comprises the first knock-in cassette at one or both alleles of the GAPDH gene and the second knock-in cassette at one or both alleles of a second essential gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, (b) GAPDH, and (c) the gene product encoded by the second essential gene required for survival and/or proliferation of the iPSC, or a functional variant thereof. In some embodiments, the second essential gene is a gene listed in Table 3 or 4. In some embodiments, the second essential gene is TBP.
In another aspect, the disclosure features an immune cell (e.g., an iNK cell or T cell) differentiated from an iPSC described herein.
In another aspect, the disclosure features any of the iPSCs (or iNK or T cell differentiated from an iPSC) described herein for use as a medicament and/or for use in the treatment of a disease, disorder or condition, e.g., a disease, disorder or condition described herein, e.g., a cancer, e.g., a cancer described herein.
In another aspect, the disclosure features an iPSC, or a population of iPSCs, produced by any of the methods described herein, or progeny thereof.
In another aspect, the disclosure features a system for editing the genome of an iPSC (or an iPSC in a population of iPSCs), the system comprising the iPSC (or the population of iPSC), a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene of the iPSC, and a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, after contacting the iPSC or population of iPSCs with the nuclease and the donor template, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the system comprises a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor templates, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template or templates, the iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR. In some embodiments, the iPSCs comprise bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR.
In some embodiments, the iPSCs comprise the first knock-in cassette at one or both alleles of the GAPDH gene and the second knock-in cassette at one or both alleles of a second essential gene. In some embodiments, the IPSCs express (a) the first and second gene products of interest, (b) GAPDH, and (c) the gene product encoded by the second essential gene required for survival and/or proliferation of the iPSC, or a functional variant thereof. In some embodiments, the second essential gene is a gene listed in Table 3 or 4. In some embodiments, the second essential gene is TBP.
In another aspect, the disclosure features a donor template comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene, wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, the donor template is for use in editing the genome of an iPSC by homology-directed repair (HDR).
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features a method of producing a population of modified iPSCs, the method comprising contacting iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, resulting in genome-edited iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof, and wherein following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the iPSCs lacking an integrated knock-in cassette are viable iPSCs, thereby producing a population of modified iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs are genome-edited iPSCs, and about 20% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs are genome-edited iPSCs, and about 40% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs are genome-edited iPSCs, and about 10% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs are genome-edited iPSCs, and about 5% or less of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSCs comprise knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting iPSCs (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR. In some embodiments, the genome-edited iPSCs comprise bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR.
In some embodiments, the method comprises contacting iPSCs (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited iPSC comprises the first knock-in cassette at one or both alleles of the GAPDH gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, (b) GAPDH, and (c) the gene product encoded by the second essential gene required for survival and/or proliferation of the iPSC, or a functional variant thereof. In some embodiments, the second essential gene is a gene listed in Table 3 or 4. In some embodiments, the second essential gene is TBP.
In another aspect, the disclosure features a method of selecting and/or identifying an iPSC comprising a knock-in of a gene product of interest within an endogenous coding sequence of a GAPDH gene in the iPSC, the method comprising contacting a population of iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, and identifying a genome-edited iPSC within the population of iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is a chimeric antigen receptor (CAR), a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof.
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the population of iPSCs with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR. In some embodiments, the genome-edited iPSCs comprise bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: CD16+IL15; IL15+CD16; CD16+CAR; CAR+CD16; IL15+CAR; CAR+IL15; CD16+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CD16; IL15+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+IL15; CAR+(HLA-E or HLA-G or CD47); (HLA-E or HLA-G or CD47)+CAR.
In some embodiments, the method comprises contacting iPSCs (or population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a second essential gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at one or both alleles of the GAPDH gene and the second knock-in cassette at one or both alleles of the second essential gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, (b) GAPDH, and (c) the gene product encoded by the second essential gene required for survival and/or proliferation of the iPSCs, or a functional variant thereof. In some embodiments, the second essential gene is a gene listed in Table 3 or 4. In some embodiments, the second essential gene is TBP.
In another aspect, the disclosure features a method of editing the genome of an induced pluripotent stem cell (iPSC) (e.g., an iPSC in a population of iPSCs), the method comprising contacting the iPSC (or the population of iPSCs) with: (i) a nuclease that causes a break within an endogenous coding sequence of a glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene in the iPSC, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of the iPSC by homology-directed repair (HDR) of the break, resulting in a genome-edited iPSC that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSCs by homology-directed repair (HDR) in the correct position or orientation, the iPSCs no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the iPSC (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSC comprises multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: PD-L1+CD47; or CD47+PD-L1. In some embodiments, the genome-edited iPSC comprises bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of the following pairs of gene products of interest: PD-L1+CD47.
In another aspect, the disclosure features a genetically modified iPSC comprising a genome with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of a coding sequence of a GAPDH gene, wherein at least part of the coding sequence of the GAPDH gene comprises an exogenous coding sequence, and wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence of the GAPDH gene comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence of the GAPDH gene encodes a C-terminal fragment of a protein encoded by the GAPDH gene. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence of the GAPDH gene is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence of the GAPDH gene has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence of the GAPDH gene includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features an engineered iPSC comprising a genomic modification, wherein the genomic modification comprises an insertion of an exogenous knock-in cassette within an endogenous coding sequence of a GAPDH gene in the iPSC's genome, wherein the knock-in cassette comprises an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence encoding GAPDH, or a functional variant thereof, wherein the iPSC expresses the gene product of interest and GAPDH, or a functional variant thereof, optionally wherein the gene product of interest and GAPDH are expressed from the endogenous GAPDH promoter, and wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH comprises about 200 base pairs of the coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence encoding GAPDH has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of a nuclease, e.g., a Cas. In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence encoding GAPDH includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the iPSC's genome comprises a regulatory element that enables expression of the gene product encoded by the GAPDH gene and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the iPSC's genome comprises an IRES or 2A element located between the coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, the iPSC's genome comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the iPSC's genome does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the engineered iPSC comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the engineered iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the engineered iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the engineered iPSC comprises multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: PD-L1+CD47; CD47+PD-L1. In some embodiments, the engineered iPSC comprises bi-allelic knock-ins (e.g., a first gene product of interest at a first allele of GAPDH gene, and a second gene product of interest at a second allele of GAPDH gene) of PD-L1+CD47.
In another aspect, the disclosure features an immune cell (e.g., an iNK cell or T cell) differentiated from an iPSC described herein.
In another aspect, the disclosure features any of the iPSCs (or iNK or T cell differentiated from an iPSC) described herein for use as a medicament and/or for use in the treatment of a disease, disorder or condition, e.g., a disease, disorder or condition described herein, e.g., a cancer, e.g., a cancer described herein.
In another aspect, the disclosure features an iPSC, or a population of iPSCs, produced by any of the methods described herein, or progeny thereof.
In another aspect, the disclosure features a system for editing the genome of an iPSC (or an iPSC in a population of iPSCs), the system comprising the iPSC (or the population of iPSC), a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene of the iPSC, and a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, after contacting the iPSC or population of iPSCs with the nuclease and the donor template, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the system comprises a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, after contacting the population of iPSCs with the nuclease and the donor templates, the genome-edited iPSC comprises the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, after contacting the population of iPSCs with the nuclease and the donor template or templates, the iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: PD-L1+CD47; CD47+PD-L1.
In another aspect, the disclosure features a donor template comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of a GAPDH gene, wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, the donor template is for use in editing the genome of an iPSC by homology-directed repair (HDR).
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of a target site in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of a target site in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 10 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In another aspect, the disclosure features a method of producing a population of modified iPSCs, the method comprising contacting iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, resulting in genome-edited iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47), and wherein following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the iPSCs lacking an integrated knock-in cassette are viable iPSCs, thereby producing a population of modified iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs are genome-edited iPSCs, and about 20% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs are genome-edited iPSCs, and about 40% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs are genome-edited iPSCs, and about 10% or less of the iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs are genome-edited iPSCs, and about 5% or less of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSCs comprise knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting iPSCs (or the population of iPSCs) with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: PD-L1+CD47; CD47+PD-L1.
In another aspect, the disclosure features a method of selecting and/or identifying an iPSC comprising a knock-in of a gene product of interest within an endogenous coding sequence of a GAPDH gene in the iPSC, the method comprising contacting a population of iPSCs with: (i) a nuclease that causes a break within an endogenous coding sequence of a GAPDH gene in a plurality of the iPSCs, and (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, wherein the knock-in cassette is integrated into the genome of a plurality of the iPSCs by homology-directed repair (HDR) of the break, and identifying a genome-edited iPSC within the population of iPSCs that expresses: (a) the gene product of interest, and (b) GAPDH, or a functional variant thereof, wherein the gene product of interest is PD-L1 or leukocyte surface antigen cluster of differentiation CD47 (CD47).
In some embodiments, following the contacting step, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and/or about 40% or less, about 35% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, of the population of iPSCs lacking an integrated knock-in cassette are iPSCs. In some embodiments, following the contacting step, at least about 80% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 20% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 60% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 40% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 90% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 10% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs. In some embodiments, following the contacting step, at least about 95% of the viable iPSCs of the population of iPSCs are genome-edited iPSCs, and about 5% or less of the population of iPSCs lacking an integrated knock-in cassette are viable iPSCs.
In some embodiments, if the knock-in cassette is not integrated into the genome of the iPSC by homology-directed repair (HDR) in the correct position or orientation, the iPSC no longer expresses GAPDH, or a functional variant thereof.
In some embodiments, the break is a double-strand break.
In some embodiments, the break is located within the last 2000, 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last 200 base pairs of the endogenous coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is highly efficient, e.g., capable of editing at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or more, of iPSCs contacted with the nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease. In some embodiments, the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the iPSC (or the population of iPSCs) with a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a Cas9 or a Cas12a nuclease, or a variant thereof (e.g., a nuclease comprising the amino acid sequence of any one of SEQ ID NOs: 58-66). In some embodiments, the guide molecule comprises a targeting domain sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule comprises a targeting domain sequence that differs by no more than 3 nucleotides from a sequence that is complementary to a portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule specifically binds to the portion of the endogenous coding sequence of the GAPDH gene. In some embodiments, the guide molecule does not bind to an endogenous coding sequence of another gene, e.g., a different essential gene. In some embodiments, the guide comprises a nucleotide sequence of any one of SEQ ID NOs: 94-157 and 225-1885.
In some embodiments, the donor template is a donor DNA template, optionally wherein the donor DNA template is double-stranded. In some embodiments, the donor DNA template is a plasmid, optionally wherein the plasmid has not been linearized.
In some embodiments, the donor template comprises homology arms on either side of the knock-in cassette. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC. In some embodiments, the donor template comprises a 5′ homology arm comprising a sequence homologous to a sequence located 5′ of the break in the genome of the iPSC, and the donor template comprises a 3′ homology arm comprising a sequence homologous to a sequence located 3′ of the break in the genome of the iPSC.
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of GAPDH and the gene product of interest as separate gene products, optionally, wherein at least one of the gene products is a protein and the regulatory element enables expression of that protein separate from the other gene product. In some embodiments, the knock-in cassette comprises an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the GAPDH gene and the exogenous coding sequence for the gene product of interest. In some embodiments, the 2A element is a T2A element (e.g., EGRGSLLTCGDVEENPGP (SEQ ID NO: 29)), a P2A element (e.g., ATNFSLLKQAGDVEENPGP (SEQ ID NO: 30)), a E2A element (e.g., QCTNYALLKLAGDVESNPGP (SEQ ID NO: 31)), or an F2A element (e.g., VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 32)). In some embodiments, the knock-in cassette further comprises a sequence encoding a linker peptide upstream of the 2A element. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest, and, if a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the exogenous partial coding sequence of the GAPDH gene in the knock-in cassette encodes a C-terminal fragment of GAPDH. In some embodiments, the C-terminal fragment is less than about 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the C-terminal fragment is less than about 25 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the GAPDH gene that spans the break.
In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC. In some embodiments, the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette has been codon optimized relative to the corresponding endogenous coding sequence of the GAPDH gene of the iPSC to remove a target site of the nuclease, to reduce the likelihood of homologous recombination after integration of the knock-in cassette into the genome of the iPSC, or to increase expression of GAPDH and/or the gene product of interest after integration of the knock-in cassette into the genome of the iPSC.
In some embodiments, the nuclease is a Cas (e.g., Cas9 or Cas12a), the exogenous coding sequence or partial coding sequence of the GAPDH gene in the knock-in cassette includes at least one PAM site for the Cas, and the at least one PAM site (or all PAM sites) has been codon optimized or saturated with silent and/or missense mutations.
In some embodiments, the donor template does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, the knock-in cassette is a multi-cistronic (e.g., bi-cistronic) knock-in cassette comprising exogenous coding sequences for two or more gene products of interest. In some embodiments, the knock-in cassette comprises a first exogenous coding sequence for a first gene product of interest, a linker (e.g., T2A, P2A, and/or IRES), and a second exogenous coding sequence for a second gene product of interest. In some embodiments, the genome-edited iPSC comprises knock-in cassettes at one or both alleles of the GAPDH gene. In some embodiments, the genome-edited iPSC expresses (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the method comprises contacting the population of iPSCs with a first a donor template that comprises a first knock-in cassette comprising a first exogenous coding sequence for a first gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene, and with a second donor template that comprises a second knock-in cassette comprising a second exogenous coding sequence for a second gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the GAPDH gene. In some embodiments, the genome-edited iPSCs comprise the first knock-in cassette at a first allele of the GAPDH gene and the second knock-in cassette at the second allele of the GAPDH gene. In some embodiments, the genome-edited iPSCs express (a) the first and second gene products of interest, and (b) GAPDH, or a functional variant thereof.
In some embodiments, the genome-edited iPSCs comprise multi-cistronic knock-ins (e.g., at one or both alleles of GAPDH gene) of two or more gene products of interest, e.g., one or more of the following gene products of interest, in order: PD-L1+CD47; CD47+PD-L1.
In another aspect, the disclosure features a method of generating a genetically modified mammalian cell comprising a coding sequence for a gene product of interest at a pre-determined genomic position, comprising: providing at least one donor template comprising the coding sequence for a gene product of interest flanked by a first homologous arm and a second homology arm, wherein the first and second homology arms are essentially homologous to a first genomic region (GR) and a second GR, respectively, wherein the first GR and the second GR are adjacent to and flank a pre-determined genomic position in an exon of an essential gene in a mammalian cell, wherein the cell becomes inviable if the exon is disrupted; providing a gene editing system containing a nuclease that is targeted to the pre-determined genomic position; introducing the at least one donor template and the gene editing system into a population of mammalian cells; culturing the population of mammalian cells; and identifying a surviving cell that comprises the coding sequence for the gene product of interest, wherein the identified surviving cell is a genetically modified mammalian cell comprising the coding sequence for the gene product of interest at the pre-determined genomic position. In another aspect, the disclosure features a method of selecting a mammalian cell comprising a coding sequence for a gene product of interest that has integrated precisely at a pre-determined genomic position, comprising: providing at least one donor template comprising the coding sequence for the gene product of interest flanked by a first homology arm and a second homology arm, wherein the first and second homology arms are essentially homologous to a first genomic region (GR) and a second GR, respectively, wherein the first GR and the second GR are adjacent to and flank a pre-determined genomic position in an exon of an essential gene in a mammalian cell, wherein the cell becomes inviable if the exon is disrupted; providing a gene editing system containing a nuclease that is targeted to the pre-determined genomic position; introducing the donor template and the gene editing system into a population of mammalian cells; culturing the population of mammalian cells; and identifying a surviving cell that comprises the coding sequence for a gene product of interest, wherein the identified surviving cell comprises the coding sequence for a gene product of interest integrated precisely at the pre-determined genomic position.
In some embodiments, the exon is the last or penultimate exon of the essential gene if the essential gene has more than one exon. In some embodiments, the pre-determined genomic position in the exon of the essential gene is within about 200 bps upstream of a stop codon, or within about 200 bps downstream of a start codon, of the essential gene.
In some embodiments, the gene editing system is a meganuclease based system, a zinc finger nuclease (ZFN) based system, a transcription activator-like effector based nuclease (TALEN) system, a CRISPR based system, or a NgAgo based system.
In some embodiments, the gene editing system is a CRISPR based system comprising a nuclease, or an mRNA or DNA encoding a nuclease, and a guide RNA (gRNA) that targets the pre-determined genomic position, optionally wherein the gene editing system is a ribonucleoprotein (RNP) complex comprising the nuclease and the gRNA.
In some embodiments, the nuclease is Cas5, Cas6, Cas7, Cas9 (optionally saCas9 or spCas9), Cas12a, or Csm1.
In some embodiments, the essential gene is selected from the gene loci listed in Table 3 or 4. In some embodiments, the essential gene is GAPDH, RPL13A, RPL7, or RPLP0 gene.
In some embodiments, the first homology arm and/or the second homology arm comprise a silent PAM blocking mutation or a codon modification that prevents cleavage of the donor template by the nuclease such that the essential gene locus, once modified, is not cleaved by the nuclease.
In some embodiments, the coding sequence for the gene product of interest is linked in frame to the essential gene sequence through a coding sequence for a self-cleaving peptide, or the coding sequence for the gene product of interest contains an internal ribosomal entry site (IRES) at the 5′ end.
In some embodiments, the gene product of interest is a therapeutic protein (optionally an antibody, an engineered antigen receptor, or an antigen-binding fragment thereof), an immunomodulatory protein, a reporter protein, or a safety switch signal.
In some embodiments, the method further comprises contacting the population of mammalian cells with an inhibitor of non-homologous end joining.
In some embodiments, the population of mammalian cells are human cells. In some embodiments, the populations of mammalian cells are pluripotent stem cells (PSCs). In some embodiments, the PSCs are embryonic stem cells or induced PSCs (iPSCs).
In some embodiments, the method comprises providing more than one donor template. In some embodiments, each donor template is targeted to the essential gene. In some embodiments, each donor template comprises a different genomic sequence. In some embodiments, each donor template comprises coding sequence for more than one gene product of interest.
In some embodiments, the genomic sequences from one donor template are incorporated into one allele of the essential gene and the genomic sequences from the other donor template are incorporated into the other allele of the essential gene. In some embodiments, each donor template comprises coding sequence for more than one gene product of interest.
In some embodiments, each donor template comprises at least one safety switch. In some embodiments, each donor template comprises at least one component of a safety switch. In some embodiments, the safety switch requires dimerization to function as a suicide switch.
In some embodiments, the method further comprising the additional steps of providing to the surviving cells, the gene editing system containing a nuclease that is targeted to the pre-determined genomic position; optionally reintroducing the at least one donor template, to obtain a second population of mammalian cells; culturing the second population of mammalian cells; and identifying a surviving cell from the second population of mammalian cells that comprises the coding sequences for gene products of interest from the donor templates; wherein the identified surviving cell from the second population of mammalian cells is a genetically modified mammalian cell comprising the coding sequences for gene products of interest from donor templates at the pre-determined genomic position.
In some embodiments, the percentage of surviving cells from the second culturing step comprising the coding sequences for gene products of interest is enriched at least four-fold from the surviving cells from the first culturing step comprising the coding sequences for gene products of interest. In some embodiments, the percentage of surviving cells from the second culturing step comprising the coding sequences for gene products of interest from the donor templates is at least 2%.
In some embodiments, the method further comprises separating a mammalian cell comprising the coding sequences for gene products of interest from the donor templates. In some embodiments, the method further comprises growing the mammalian cell comprising the coding sequences for gene products of interest from the donor templates into a plurality of cells comprising the coding sequences for gene products of interest from the donor templates.
In some embodiments, the population of mammalian cells are PSCs. In some embodiments, the PSCs are embryonic stem cells or iPSCs.
In another aspect, the disclosure features a genetically engineered cell obtainable by any of the methods described herein. In some embodiments, the genetically engineered cell is a PSC. In some embodiments, the genetically engineered cell is an iPSC.
In another aspect, the disclosure features a method of obtaining a differentiated cell, comprising culturing a genetically engineered iPSC obtainable by any of the methods described herein in a culture medium that allows differentiation of the iPSC into the differentiated cell, or a genetically modified differentiated cell obtained by such method. In some embodiments, the differentiated cell is an immune cell, optionally selected from a T cell, a T cell expressing a chimeric antigen receptor (CAR), a suppressive T cell, a myeloid cell, a dendritic cell, and an immunosuppressive macrophage; a cell in the nervous system, optionally selected from dopaminergic neuron, a microglial cell, an oligodendrocyte, an astrocyte, a cortical neuron, a spinal or oculomotor neuron, an enteric neuron, a Placode-derived cell, a Schwann cell, and a trigeminal or sensory neuron; a cell in the ocular system, optionally selected from a retinal pigment epithelial cell, a photoreceptor cone cell, a photoreceptor rod cell, a bipolar cell, and a ganglion cell; a cell in the cardiovascular system, optionally selected from a cardiomyocyte, an endothelial cell, and a nodal cell; or a cell in the metabolic system, optionally selected from a hepatocyte, a cholangiocyte, and a pancreatic beta cell. In some embodiments, the differentiated cell is a human cell.
In another aspect, the disclosure features a pharmaceutical composition comprising any of the cells described herein. In another aspect, the disclosure features a method of treating a human patient in need thereof, comprising introducing the pharmaceutical composition to the patient, wherein the pharmaceutical composition comprises differentiated human cells. In another aspect, the disclosure features the pharmaceutical composition for use in treating a human patient in need thereof, wherein the pharmaceutical composition comprises differentiated human cells. In another aspect, the disclosure features use of the pharmaceutical composition for the manufacture of a medicament in treating a human patient in need thereof, wherein the pharmaceutical composition comprises differentiated human cells. In some embodiments, the differentiated human cells are autologous or allogenic cells.
In another aspect, the disclosure features a system for editing the genome of a mammalian cell, the system comprising a population of mammalian cells, a nuclease that causes a break within an endogenous coding sequence of an essential gene of the mammalian cell, and a plurality of donor templates each comprising a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene, and wherein after contacting the population of mammalian cells with the nuclease and the donor templates, and optionally contacting the population of mammalian cells with the nuclease and optionally the donor templates a second time, at least about 2% of the viable cells of the population of mammalian cells are genome-edited cells that expresses the gene products of interest from the plurality of donor templates. In some embodiments, the essential gene is GAPDH.
In some embodiments, the mammalian cell is a PSC. In some embodiments, the mammalian cell is an iPSC.
In some embodiments, the break is a double-strand break. In some embodiments, the break is located within the last 1000, 500, 400, 300, 200, 100 or 50 base pairs of the coding sequence of the GAPDH gene. In some embodiments, the break is located within the last exon of the GAPDH gene.
In some embodiments, the nuclease is a CRISPR/Cas nuclease and the system further comprises a guide molecule for the CRISPR/Cas nuclease. In some embodiments, the nuclease is a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) or a meganuclease.
In some embodiments, the donor templates are donor DNA templates, optionally wherein the donor DNA templates are double-stranded. In some embodiments, the donor templates comprise homology arms on either side of the exogenous coding sequences. In some embodiments, the homology arms correspond to sequences located on either side of the break in the genome of the mammalian cell.
The teachings described herein will be more fully understood from the following description of various exemplary embodiments, when read together with the accompanying drawing. It should be understood that the drawing described below is for illustration purposes only and is not intended to limit the scope of the present teachings in any way.
Unless otherwise specified, each of the following terms have the meaning set forth in this section.
The indefinite articles “a” and “an” refer to at least one of the associated noun, and are used interchangeably with the terms “at least one” and “one or more.” The conjunctions “or” and “and/or” are used interchangeably as non-exclusive disjunctions.
The term “cancer” (also used interchangeably with the term “neoplastic”), as used herein, refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Cancerous disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, e.g., malignant tumor growth, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state, e.g., cell proliferation associated with wound repair.
The terms “CRISPR/Cas nuclease” as used herein refer to any CRISPR/Cas protein with DNA nuclease activity, e.g., a Cas9 or a Cas12 protein that exhibits specific association (or “targeting”) to a DNA target site, e.g., within a genomic sequence in a cell in the presence of a guide molecule. The strategies, systems, and methods disclosed herein can use any combination of CRISPR/Cas nuclease disclosed herein, or known to those of ordinary skill in the art. Those of ordinary skill in the art will be aware of additional CRISPR/Cas nucleases and variants suitable for use in the context of the present disclosure, and it will be understood that the present disclosure is not limited in this respect.
The term “differentiation” as used herein is the process by which an unspecialized (“uncommitted”) or less specialized cell acquires the features of a specialized cell such as, for example, a blood cell. In some embodiments, a differentiated or differentiation-induced cell is one that has taken on a more specialized (“committed”) position within the lineage of a cell. For example, an iPS cell (iPSC) can be differentiated into various more differentiated cell types, for example, a hematopoietic stem cell, a lymphocyte, and other cell types, upon treatment with suitable differentiation factors in the cell culture medium. Suitable methods, differentiation factors, and cell culture media for the differentiation of pluri- and multipotent cell types into more differentiated cell types are well known to those of skill in the art. In some embodiments, the term “committed”, is applied to the process of differentiation to refer to a cell that has proceeded through a differentiation pathway to a point where, under normal circumstances, it would or will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type (other than a specific cell type or subset of cell types) nor revert to a less differentiated cell type.
The terms “differentiation marker,” “differentiation marker gene,” or “differentiation gene,” as used herein refers to genes or proteins whose expression are indicative of cell differentiation occurring within a cell, such as a pluripotent cell. In some embodiments, differentiation marker genes include, but are not limited to, the following genes: CD34, CD4, CD8, CD3, CD56 (NCAM), CD49, CD45, NK cell receptor (cluster of differentiation 16 (CD16)), natural killer group-2 member D (NKG2D), CD69, NKp30, NKp44, NKp46, CD158b, FOXA2, FGF5, SOX17, XIST, NODAL, COL3A1, OTX2, DUSP6, EOMES, NR2F2, NROB1, CXCR4, CYP2B6, GAT A3, GATA4, ERBB4, GATA6, HOXC6, INHA, SMAD6, RORA, NIPBL, TNFSF11, CDH11, ZIC4, GAL, SOX3, PITX2, APOA2, CXCL5, CER1, FOXQ1, MLL5, DPP10, GSC, PCDH10, CTCFL, PCDH20, TSHZ1, MEGF10, MYC, DKK1, BMP2, LEFTY2, HES1, CDX2, GNAS, EGR1, COL3A1, TCF4, HEPH, KDR, TOX, FOXA1, LCK, PCDH7, CD1D FOXG1, LEFTY1, TUJI, T gene (Brachyury), ZIC1, GATA1, GATA2, HDAC4, HDAC5, HDAC7, HDAC9, NOTCHI, NOTCH2, NOTCH4, PAX5, RBPJ, RUNX1, STAT1 and STAT3.
The terms “differentiation marker gene profile,” or “differentiation gene profile,” “differentiation gene expression profile,” “differentiation gene expression signature,” “differentiation gene expression panel,” “differentiation gene panel,” or “differentiation gene signature” as used herein refer to expression or levels of expression of a plurality of differentiation marker genes.
The term “nuclease” as used herein refers to any protein that catalyzes the cleavage of phosphodiester bonds. In some embodiments the nuclease is a DNA nuclease. In some embodiments the nuclease is a “nickase” which causes a single-strand break when it cleaves double-stranded DNA, e.g., genomic DNA in a cell. In some embodiments the nuclease causes a double-strand break when it cleaves double-stranded DNA, e.g., genomic DNA in a cell. In some embodiments the nuclease binds a specific target site within the double-stranded DNA that overlaps with or is adjacent to the location of the resulting break. In some embodiments, the nuclease causes a double-strand break that contains overhangs ranging from 0 (blunt ends) to 22 nucleotides in both 3′ and 5′ orientations. As discussed herein, CRISPR/Cas nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and meganucleases are exemplary nucleases that can be used in accordance with the strategies, systems, and methods of the present disclosure.
The term “embryonic stem cell” as used herein refers to pluripotent stem cells derived from the inner cell mass of the embryonic blastocyst. In some embodiments, embryonic stem cells are pluripotent and give rise during development to all derivatives of the three primary germ layers: ectoderm, endoderm and mesoderm. In some such embodiments, embryonic stem cells do not contribute to the extra-embryonic membranes or the placenta, i.e., are not totipotent.
The term “endogenous,” as used herein in the context of nucleic acids refers to a native nucleic acid (e.g., a gene, a protein coding sequence) in its natural location, e.g., within the genome of a cell.
The term “essential gene” as used herein with respect to a cell refers to a gene that encodes at least one gene product that is required for survival and/or proliferation of the cell. An essential gene can be a housekeeping gene that is essential for survival of all cell types or a gene that is required to be expressed in a specific cell type for survival and/or proliferation under particular culture conditions, e.g., for proper differentiation of iPS or ES cells or expansion of iPS- or ES-derived cells. Loss of function of an essential gene results, in some embodiments, in a significant reduction of cell survival, e.g., of the time a cell characterized by a loss of function of an essential gene survives as compared to a cell of the same cell type but without a loss of function of the same essential gene. In some embodiments, loss of function of an essential gene results in the death of the affected cell. In some embodiments, loss of function of an essential gene results in a significant reduction of cell proliferation, e.g., in the ability of a cell to divide, which can manifest in a significant time period the cell requires to complete a cell cycle, or, in some preferred embodiments, in a loss of a cell's ability to complete a cell cycle, and thus to proliferate at all.
The term “exogenous,” as used herein in the context of nucleic acids refers to a nucleic acid (whether native or non-native) that has been artificially introduced into a man-made construct (e.g., a knock-in cassette, or a donor template) or into the genome of a cell using, for example, gene editing or genetic engineering techniques, e.g., HDR based integration techniques.
The term “guide molecule” or “guide RNA” or “gRNA” when used in reference to a CRISPR/Cas system is any nucleic acid that promotes the specific association (or “targeting”) of a CRISPR/Cas nuclease, e.g., a Cas9 or a Cas12 protein to a DNA target site such as within a genomic sequence in a cell. While guide molecules are typically RNA molecules it is well known in the art that chemically modified RNA molecules including DNA/RNA hybrid molecules can be used as guide molecules.
The terms “hematopoietic stem cell,” or “definitive hematopoietic stem cell” as used herein, refer to CD34-positive (CD34+) stem cells. In some embodiments, CD34-positive stem cells are capable of giving rise to mature myeloid and/or lymphoid cell types. In some embodiments, the myeloid and/or lymphoid cell types include, for example, T cells, natural killer (NK) cells and/or B cells.
The terms “induced pluripotent stem cell”, “iPS cell” or “iPSC” as used herein to refer to a stem cell obtained from a differentiated somatic (e.g., adult, neonatal, or fetal) cell by a process referred to as reprogramming (e.g., dedifferentiation). In some embodiments, reprogrammed cells are capable of differentiating into tissues of all three germ or dermal layers: mesoderm, endoderm, and ectoderm. iPSCs are not found in nature.
The terms “iPS-derived NK cell” or “iNK cell” or as used herein refers to a natural killer cell which has been produced by differentiating an iPS cell, which iPS cell may or may not have a genetic modification.
The terms “iPS-derived T cell” or “iT cell” or as used herein refers to a T which has been produced by differentiating an iPS cell, which iPS cell may or may not have a genetic modification.
The term “multipotent stem cell” as used herein refers to a cell that has the developmental potential to differentiate into cells of one or more germ layers (ectoderm, mesoderm and endoderm), but not all three germ layers. Thus, in some embodiments, a multipotent cell may also be termed a “partially differentiated cell.” Multipotent cells are well-known in the art, and examples of multipotent cells include adult stem cells, such as for example, hematopoietic stem cells and neural stem cells. In some embodiments, “multipotent” indicates that a cell may form many types of cells in a given lineage, but not cells of other lineages. For example, a multipotent hematopoietic cell can form the many different types of blood cells (red, white, platelets, etc.), but it cannot form neurons. Accordingly, in some embodiments, “multipotency” refers to a state of a cell with a degree of developmental potential that is less than totipotent and pluripotent.
The term “pluripotent” as used herein refers to ability of a cell to form all lineages of the body or soma (i.e., the embryo proper) or a given organism (e.g., human). For example, embryonic stem cells are a type of pluripotent stem cells that are able to form cells from each of the three germs layers, the ectoderm, the mesoderm, and the endoderm. Generally, pluripotency may be described as a continuum of developmental potencies ranging from an incompletely or partially pluripotent cell (e.g., an epiblast stem cell or EpiSC), which is unable to give rise to a complete organism to the more primitive, more pluripotent cell, which is able to give rise to a complete organism (e.g., an embryonic stem cell or an induced pluripotent stem cell).
The term “pluripotency” as used herein refers to a cell that has the developmental potential to differentiate into cells of all three germ layers (ectoderm, mesoderm, and endoderm). In some embodiments, pluripotency can be determined, in part, by assessing pluripotency characteristics of the cells. In some embodiments, pluripotency characteristics include, but are not limited to: (i) pluripotent stem cell morphology; (ii) the potential for unlimited self-renewal; (iii) expression of pluripotent stem cell markers including, but not limited to SSEA1 (mouse only), SSEA3/4, SSEA5, TRA1-60/81, TRA1-85, TRA2-54, GCTM-2, TG343, TG30, CD9, CD29, CD133/prominin, CD140a, CD56, CD73, CD90, CD105, OCT4 (also known as POU5F1), NANOG, SOX2, CD30 and/or CD50; (iv) ability to differentiate to all three somatic lineages (ectoderm, mesoderm and endoderm); (v) teratoma formation consisting of the three somatic lineages; and (vi) formation of embryoid bodies consisting of cells from the three somatic lineages.
The term “pluripotent stem cell morphology” as used herein refers to the classical morphological features of an embryonic stem cell. In some embodiments, normal embryonic stem cell morphology is characterized as small and round in shape, with a high nucleus-to-cytoplasm ratio, the notable presence of nucleoli, and typical intercell spacing.
The term “polycistronic” or “multicistronic” when used herein with reference to a knock-in cassette refers to the fact that the knock-in cassette can express two or more proteins from the same mRNA transcript. Similarly, a “bicistronic” knock-in cassette is a knock-in cassette that can express two proteins from the same mRNA transcript.
The term “polynucleotide” (including, but not limited to “nucleotide sequence”, “nucleic acid”, “nucleic acid molecule”, “nucleic acid sequence”, and “oligonucleotide”) as used herein refer to a series of nucleotide bases (also called “nucleotides”) in DNA and RNA, and mean any chain of two or more nucleotides. In some embodiments, polynucleotides, nucleotide sequences, nucleic acids, etc. can be chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. In some such embodiments, modifications can occur at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization parameters, etc. In general, a nucleotide sequence typically carries genetic information, including, but not limited to, the information used by cellular machinery to make proteins and enzymes. In some embodiments, a nucleotide sequence and/or genetic information comprises double- or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotide, and/or sense and/or antisense polynucleotides. In some embodiments, nucleic acids containing modified bases.
Conventional IUPAC notation is used in nucleotide sequences presented herein, as shown in Table 1, below (see also Cornish-Bowden, Nucleic Acids Res. 1985; 13(9):3021-30, incorporated by reference herein). It should be noted, however, that “T” denotes “Thymine or Uracil” in those instances where a sequence may be encoded by either DNA or RNA, for example in certain CRISPR/Cas guide molecule targeting domains.
The terms “potency” or “developmental potency” as used herein refer to the sum of all developmental options accessible to the cell (i.e., the developmental potency), particularly, for example in the context of cellular developmental potential. In some embodiments, the continuum of cell potency includes, but is not limited to, totipotent cells, pluripotent cells, multipotent cells, oligopotent cells, unipotent cells, and terminally differentiated cells.
The terms “prevent,” “preventing,” and “prevention” as used herein refer to the prevention of a disease in a mammal, e.g., in a human, including (a) avoiding or precluding the disease; (b) affecting the predisposition toward the disease; or (c) preventing or delaying the onset of at least one symptom of the disease.
The terms “protein,” “peptide” and “polypeptide” as used herein are used interchangeably to refer to a sequential chain of amino acids linked together via peptide bonds. The terms include individual proteins, groups or complexes of proteins that associate together, as well as fragments or portions, variants, derivatives and analogs of such proteins. Unless otherwise specified, peptide sequences are presented herein using conventional notation, beginning with the amino or N-terminus on the left, and proceeding to the carboxyl or C-terminus on the right. Standard one-letter or three-letter abbreviations can be used.
The term “gene product of interest” as used herein can refer to any product encoded by a gene including any polynucleotide or polypeptide. In some embodiments the gene product is a protein which is not naturally expressed by a target cell of the present disclosure. In some embodiments the gene product is a protein which confers a new therapeutic activity to the cell such as, but not limited to, a chimeric antigen receptor (CAR) or antigen-binding fragment thereof, a T cell receptor or antigen-binding portion thereof, a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof. It is to be understood that the methods and cells of the present disclosure are not limited to any particular gene product of interest and that the selection of a gene product of interest will depend on the type of cell and ultimate use of the cells.
The term “reporter gene” as used herein refers to an exogenous gene that has been introduced into a cell, e.g., integrated into the genome of the cell, that confers a trait suitable for artificial selection. Common reporter genes are fluorescent reporter genes that encode a fluorescent protein, e.g., green fluorescent protein (GFP) and antibiotic resistance genes that confer antibiotic resistance to cells.
The terms “reprogramming” or “dedifferentiation” or “increasing cell potency” or “increasing developmental potency” as used herein refer to a method of increasing potency of a cell or dedifferentiating a cell to a less differentiated state. For example, in some embodiments, a cell that has an increased cell potency has more developmental plasticity (i.e., can differentiate into more cell types) compared to the same cell in the non-reprogrammed state. That is, in some embodiments, a reprogrammed cell is one that is in a less differentiated state than the same cell in a non-reprogrammed state. In some embodiments, “reprogramming” refers to de-differentiating a somatic cell, or a multipotent stem cell, into a pluripotent stem cell, also referred to as an induced pluripotent stem cell, or iPSC. Suitable methods for the generation of iPSCs from somatic or multipotent stem cells are well known to those of skill in the art.
The term “subject” as used herein means a human or non-human animal. In some embodiments a human subject can be any age (e.g., a fetus, infant, child, young adult, or adult). In some embodiments a human subject may be at risk of or suffer from a disease, or may be in need of alteration of a gene or a combination of specific genes. Alternatively, in some embodiments, a subject may be a non-human animal, which may include, but is not limited to, a mammal. In some embodiments, a non-human animal is a non-human primate, a rodent (e.g., a mouse, rat, hamster, guinea pig, etc.), a rabbit, a dog, a cat, and so on. In certain embodiments of this disclosure, the non-human animal subject is livestock, e.g., a cow, a horse, a sheep, a goat, etc. In certain embodiments, the non-human animal subject is poultry, e.g., a chicken, a turkey, a duck, etc.
The terms “treatment,” “treat,” and “treating,” as used herein refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress, ameliorate, reduce severity of, prevent or delay the recurrence of a disease, disorder, or condition or one or more symptoms thereof, and/or improve one or more symptoms of a disease, disorder, or condition as described herein. In some embodiments, a condition includes an injury. In some embodiments, an injury may be acute or chronic (e.g., tissue damage from an underlying disease or disorder that causes, e.g., secondary damage such as tissue injury). In some embodiments, treatment, e.g., in the form of an iPSC-derived NK cell or a population of iPSC-derived NK cells as described herein, may be administered to a subject after one or more symptoms have developed and/or after a disease has been diagnosed. Treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, in some embodiments, treatment may be administered to a susceptible subject prior to the onset of symptoms (e.g., in light of genetic or other susceptibility factors). In some embodiments, treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence. In some embodiments, treatment results in improvement and/or resolution of one or more symptoms of a disease, disorder or condition.
The term “variant” as used herein refers to an entity such as a polypeptide or polynucleotide that shows significant structural identity with a reference entity but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared with the reference entity. In many embodiments, a variant also differs functionally from its reference entity. In general, whether a particular entity is properly considered to be a “variant” of a reference entity is based on its degree of structural identity with the reference entity. As used herein, the terms “functional variant” refer to a variant that confers the same function as the reference entity, e.g., a functional variant of a gene product of an essential gene is a variant that promotes the survival and/or proliferation of a cell. It is to be understood that a functional variant need not be functionally equivalent to the reference entity as long as it confers the same function as the reference entity.
In one aspect, the present disclosure provides methods of editing the genome of a cell. In certain embodiments, the method comprises contacting the cell with a nuclease that causes a break within an endogenous coding sequence of an essential gene in the cell wherein the essential gene encodes at least one gene product that is required for survival and/or proliferation of the cell. The cell is also contacted with (i) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene and/or (ii) a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and upstream (5′) of an exogenous coding sequence or partial coding sequence of the essential gene (
If the knock-in cassette is not properly integrated into the genome of the cell, undesired editing events that result from the break, e.g., NHEJ-mediated creation of indels, may produce a non-functional, e.g., out of frame, version of the essential gene. This produces a “knock-out” cell when the editing efficiency of the nuclease is high enough to disrupt both alleles. In certain embodiments, this produces a “knock-out” cell when the editing efficiency of the nuclease is high enough to disrupt one allele. Without sufficient functional copies of the essential gene these “knock-out” cells are unable to survive and do not produce any progeny cells.
Since the “knock-in” cells survive and the “knock-out” cells do not survive, the method automatically selects for the “knock-in” cells when it is applied to a population of starting cells. Significantly, in certain embodiments, the method does not require high knock-in efficiencies because of this automatic selection aspect. It is therefore particularly suitable for methods where the donor template is a dsDNA (e.g., a plasmid) where knock-in efficiencies are often below 5%. As noted in the exemplary method of
In some embodiments, the nuclease causes a double-strand break. In some embodiments the nuclease causes a single-strand break, e.g., in some embodiments the nuclease is a nickase. In some embodiments the nuclease is a prime editor which comprises a nickase domain fused to a reverse transcriptase domain. In some embodiments the nuclease is an RNA-guided prime editor and the gRNA comprises the donor template. In some embodiments a dual-nickase system is used which causes a double-strand break via two single-strand breaks on opposing strands of a double-stranded DNA, e.g., genomic DNA of the cell.
In some embodiments, the present disclosure provides methods suitable for high-efficiency knock-in (e.g., a high proportion of a cell population comprises a knock-in allele), overcoming a major manufacturing challenge. Historically, gene of interest knock-in using plasmid vectors results in efficiencies typically between 0.1 and 5% (see e.g., Zhu et al., CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Stem Cell Reports. 2015; 4(6):1103-1111), this low knock-in efficiency can result in a need for extensive time and resources devoted to screening potentially edited clones.
In some embodiments, a gene of interest knocked into a cell may have a role in effector function, specificity, stealth, persistence, homing/chemotaxis, and/or resistance to certain chemicals (see for example, Saetersmoen et al., Seminars in Immunopathology, 2019).
In certain embodiments, the present disclosure provides methods for creation of knock-in cells that maintain high levels of expression regardless of age, differentiation status, and/or exogenous conditions. For example, in some embodiments, an integrated cargo is expressed at an optimal level with a desired subcellular localization as a function of an insertion site. In some embodiments, the present disclosure provides such cells.
In one aspect the present disclosure provides systems for editing the genome of a cell. In some embodiments, the system comprises the cell, a nuclease that causes a break within an endogenous coding sequence of an essential gene of the cell, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, and a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene.
In some embodiments, the nuclease causes a double-strand break. In some embodiments the nuclease causes a single-strand break, e.g., in some embodiments the nuclease is a nickase. In some embodiments the nuclease is a prime editor which comprises a nickase domain fused to a reverse transcriptase domain. In some embodiments the nuclease is an RNA-guided prime editor and the gRNA comprises the donor template. In some embodiments a dual-nickase system is used which causes a double-strand break via two single-strand breaks on opposing strand of a double-stranded DNA, e.g., genomic DNA of the cell.
Genome editing systems can be implemented (e.g., administered or delivered to a cell or a subject) in a variety of ways, and different implementations may be suitable for distinct applications. For instance, a genome editing system is implemented, in certain embodiments, as a protein/RNA complex (a ribonucleoprotein, or RNP). In certain embodiments, a genome editing system is implemented as one or more nucleic acids encoding an RNA-guided nuclease and guide RNA components described herein (optionally with one or more additional components); in certain embodiments, a genome editing system is implemented as one or more vectors comprising such nucleic acids, for instance a viral vector such as an adeno-associated virus; and in certain embodiments, a genome editing system is implemented as a combination of any of the foregoing. Additional or modified implementations that operate according to the principles set forth herein will be apparent to the skilled artisan and are within the scope of this disclosure.
In some embodiments, methods as described herein include performing certain steps in at least duplicate. For example, in some embodiments, integration of certain gene products of interest, particularly including multiple genes of interest or a large number of exogenous gene sequences, may result in an initial selection round that results in a lower than desired level of targeted integration. In certain embodiments, a lower than desirable levels of nuclease activity and/or of knock-in cassette targeted integration may result in a lower than desirable percentage of surviving cells and/or cells comprising the knock-in cassette; this may make identifying a cell with the genetic payload difficult. In some embodiments, to further enrich for the population of edited cells, cells were optionally expanded and then re-edited by providing the pool of edited cells with either both RNP and donor templates (e.g., one or more RNP particles targeting one or more loci, and one or more donor templates designed for targeted integration at one or more loci), or just RNP alone (e.g., one or more RNP that utilize residual donor template).
In some embodiments, where multiple rounds of RNP and/or donor template editing is performed, enrichment is affected by: i) removing cells that have not incorporated the genetic payload and/or ii) creating more cells with incorporated knock-in cassette. In some embodiments, the effectiveness of an additional enrichment steps, depending on the cargo, depending on whether multiple constructs are used, the target within the essential gene, or other factors, can lead to at least about two-fold, three-fold, four-fold, five-fold, or higher improvement in the percentage of cells incorporating the knock-in cassette from the donor template. In some embodiments, such enrichment can lead to uptake of the “cargo” within the essential gene of mammalian cells of greater than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or greater than 95%.
In some embodiments, donor templates (e.g., donor nucleic acid constructs) comprise the transgene flanked by a first homologous region (HR) e.g., a homology arm, and a second HR, e.g., a second homology arm, designed to anneal to a first genomic region (GR) and a second GR within an essential gene of a cell. To be able to anneal, the HRs and GRs need not be perfectly homologous. In some embodiments, examples include a non-inhibitory small number (less than 6 and as few as 1) of mutations in the PAM 5′ of the transgene in the knock-in cassette. In some embodiments, other non-inhibitory changes include codon optimization, wherein unnecessary nucleotides in the wildtype exon are removed from the nucleotide sequence in the knock-in cassette. In some embodiments, other such silent PAM blocking mutations or a codon modifications that prevents cleavage of the donor nucleic acid construct by the nuclease are further contemplated. In some embodiments, at least about 90% homology is sufficient for functional annealing for purposes of the examples herein. In some embodiments, the level of homology between the HR and GR is more than 90%, more than 92%, more than 94%, more than 96%, more than 98%, or more than 99%. Other embodiments and the concepts set forth in this paragraph are contemplated and subsumed in the term “essentially homologous.”
In one aspect the present disclosure provides genetically modified cells or engineered cells including populations of such cells and progeny of such cells.
In some embodiments, the cell is produced by a method of the present disclosure, e.g., a method that comprises contacting the cell with a nuclease that causes a break within an endogenous coding sequence of an essential gene in the cell wherein the essential gene encodes at least one gene product that is required for survival and/or proliferation of the cell. The cell is also contacted with a donor template that comprises a knock-in cassette comprising an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. The knock-in cassette is integrated into the genome of the cell by homology-directed repair (HDR) of the break, resulting in a genome-edited cell that expresses the gene product of interest and the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof. This is illustrated in
In some embodiments, the cell comprises a genome with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of a coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell.
In some embodiments, the cell comprises a genome with an exogenous coding sequence for a gene product of interest in frame with and upstream (5′) of a coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell.
In some embodiments, the cell comprises a genomic modification, wherein the genomic modification comprises an insertion of an exogenous knock-in cassette within an endogenous coding sequence of an essential gene in the cell's genome, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell, wherein the knock-in cassette comprises an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence encoding the gene product of the essential gene, or a functional variant thereof, and wherein the cell expresses the gene product of interest and the gene product encoded by the essential gene that is required for survival and/or proliferation of the cell, or a functional variant thereof. In some embodiments, the gene product of interest and the gene product encoded by the essential gene are expressed from the endogenous promoter of the essential gene.
In one aspect the present disclosure provides a donor template comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell.
In one aspect the present disclosure provides an impetus for designing donor templates comprising a knock-in cassette with an exogenous coding sequence for a gene product of interest in frame with and upstream (5′) of an exogenous coding sequence or partial coding sequence of an essential gene, wherein the essential gene encodes a gene product that is required for survival and/or proliferation of the cell; see e.g.,
In some embodiments, the donor template is for use in editing the genome of a cell by homology-directed repair (HDR).
Donor template design is described in detail in the literature, for instance in PCT Publication No. WO2016/073990A1. Donor templates can be single-stranded or double-stranded and can be used to facilitate HDR-based repair of double-strand breaks (DSBs), and are particularly useful for inserting a new sequence into the target sequence, or replacing the target sequence altogether. In some embodiments, the donor template is a donor DNA template. In some embodiments the donor DNA template is double-stranded.
Whether single-stranded or double stranded, donor templates generally include regions that are homologous to regions of DNA within or near (e.g., flanking or adjoining) a target sequence to be cleaved. These homologous regions are referred to herein as “homology arms,” and are illustrated schematically below relative to the knock-in cassette (which may be separated from one or both of the homology arms by additional spacer sequences that are not shown):
[5′ homology arm]-[knock-in cassette]-[3′ homology arm].
The homology arms can have any suitable length (including 0 nucleotides if only one homology arm is used), and 5′ and 3′ homology arms can have the same length, or can differ in length. The selection of appropriate homology arm lengths can be influenced by a variety of factors, such as the desire to avoid homologies or microhomologies with certain sequences such as Alu repeats or other very common elements. For example, a 5′ homology arm can be shortened to avoid a sequence repeat element. In other embodiments, a 3′ homology arm can be shortened to avoid a sequence repeat element. In some embodiments, both the 5′ and the 3′ homology arms can be shortened to avoid including certain sequence repeat elements.
In some embodiments, more than one donor template can be administered to a cell population. In some embodiments, the more than one donor templates are different, for example, each donor template facilitates knock-in of “cargo” sequences encoding different gene products of interest. In some embodiments, the more than one donor templates can be provided at the same time and their payloads incorporated into the same essential gene (e.g., one incorporated at one allele, the other incorporated at the other allele). In some embodiments, this may be particularly advantageous when a particular transgene system and/or gene product of interest has functional sequences that require them to be separated into different alleles of an essential gene. Further, in some embodiments, having multiple copies of gene targets of interest that are different but accomplish a similar goal, e.g., copies of safety switches, can be helpful to assure the functionality and creation of a corresponding phenotype. In some embodiments, more than one copy of a safety switch can ensure elimination of cells when necessary. Further, in some embodiments, certain safety switches requires dimerization to function as a suicide switch system (e.g., as described herein). In some embodiments, when more than one donor template is administered to a cell population, such donor templates may be designed to integrate at the same genetic locus, or at different genetic loci.
A donor template can be a nucleic acid vector, such as a viral genome or circular double-stranded DNA, e.g., a plasmid. Nucleic acid vectors comprising donor templates can include other coding or non-coding elements. For example, a donor template nucleic acid can be delivered as part of a viral genome (e.g., in an AAV, adenoviral, Sendai virus, or lentiviral genome) that includes certain genomic backbone elements (e.g., inverted terminal repeats, in the case of an AAV genome). In some embodiments, a donor template is comprised in a plasmid that has not been linearized. In some embodiments, a donor template is comprised in a plasmid that has been linearized. In some embodiments, a donor template is comprised within a linear dsDNA fragment. In some embodiments, a donor template nucleic acid can be delivered as part of an AAV genome. In some embodiments, a donor template nucleic acid can be delivered as a single stranded oligo donor (ssODN), for example, as a long multi-kb ssODN derived from m13 phage synthesis, or alternatively, short ssODNs, e.g., that comprise small genes of interest, tags, and/or probes. In some embodiments, a donor template nucleic acid can be delivered as a Doggybone™ DNA (dbDNA™) template. In some embodiments, a donor template nucleic acid can be delivered as a DNA minicircle. In some embodiments, a donor template nucleic acid can be delivered as a Integration-deficient Lentiviral Particle (IDLV). In some embodiments, a donor template nucleic acid can be delivered as a MMLV-derived retrovirus. In some embodiments, a donor template nucleic acid can be delivered as a piggyBac™ sequence. In some embodiments, a donor template nucleic acid can be delivered as a replicating EBNA1 episome.
In certain embodiments, the 5′ homology arm may be about 25 to about 1,000 base pairs in length, e.g., at least about 100, 200, 400, 600, or 800 base pairs in length. In certain embodiments, the 5′ homology arm comprises about 50 to 800 base pairs, e.g., 100 to 800, 200 to 800, 400 to 800, 400 to 600, or 600 to 800 base pairs. In certain embodiments, the 3′ homology arm may be about 25 to about 1,000 base pairs in length, e.g., at least about 100, 200, 400, 600, or 800 base pairs in length. In certain embodiments, the 3′ homology arm comprises about 50 to 800 base pairs, e.g., 100 to 800, 200 to 800, 400 to 800, 400 to 600, or 600 to 800 base pairs. In certain embodiments, the 5′ and 3′ homology arms are symmetrical in length. In certain embodiments, the 5′ and 3′ homology arms are asymmetrical in length.
In certain embodiments, a 5′ homology arm is less than about 3,000 base pairs, less than about 2,900 base pairs, less than about 2,800 base pairs, less than about 2,700 base pairs, less than about 2,600 base pairs, less than about 2,500 base pairs, less than about 2,400 base pairs, less than about 2,300 base pairs, less than about 2,200 base pairs, less than about 2,100 base pairs, less than about 2,000 base pairs, less than about 1,900 base pairs, less than about 1,800 base pairs, less than about 1,700 base pairs, less than about 1,600 base pairs, less than about 1,500 base pairs, less than about 1,400 base pairs, less than about 1,300 base pairs, less than about 1,200 base pairs, less than about 1,100 base pairs, less than about 1,000 base pairs, less than about 900 base pairs, less than about 800 base pairs, less than about 700 base pairs, less than about 600 base pairs, less than about 500 base pairs, or less than about 400 base pairs.
In certain embodiments, e.g., where a viral vector is utilized to introduce a knock-in cassette through a method described herein, a 5′ homology arm is less than about 1,000 base pairs, less than about 900 base pairs, less than about 800 base pairs, is less than about 700 base pairs, less than about 600 base pairs, less than about 500 base pairs, less than about 400 base pairs, or less than about 300 base pairs. In certain embodiments, e.g., where a viral vector is utilized to introduce a knock-in cassette through a method described herein, a 5′ homology arm is about 400-600 base pairs, e.g., about 500 base pairs.
In certain embodiments, a 3′ homology arm is less than about 3,000 base pairs, less than about 2,900 base pairs, less than about 2,800 base pairs, less than about 2,700 base pairs, less than about 2,600 base pairs, less than about 2,500 base pairs, less than about 2,400 base pairs, less than about 2,300 base pairs, less than about 2,200 base pairs, less than about 2,100 base pairs, less than about 2,000 base pairs, less than about 1,900 base pairs, less than about 1,800 base pairs, less than about 1,700 base pairs, less than about 1,600 base pairs, less than about 1,500 base pairs, less than about 1,400 base pairs, less than about 1,300 base pairs, less than about 1,200 base pairs, less than about 1,100 base pairs, less than 1,000 base pairs, less than about 900 base pairs, less than about 800 base pairs, less than about 700 base pairs, less than about 600 base pairs, less than about 500 base pairs, or less than about 400 base pairs.
In certain embodiments, e.g., where a viral vector is utilized to introduce a knock-in cassette through a method described herein, a 3′ homology arm is less than about 1,000 base pairs, less than about 900 base pairs, less than about 800 base pairs, less than about 700 base pairs, less than about 600 base pairs, less than about 500 base pairs, less than about 400 base pairs, or less than about 300 base pairs. In certain embodiments, e.g., where a viral vector is utilized to introduce a knock-in cassette through a method described herein, a 3′ homology arm is about 400-600 base pairs, e.g., about 500 base pairs.
In certain embodiments, the 5′ and 3′ homology arms flank the break and are less than 100, 75, 50, 25, 15, 10 or 5 base pairs away from an edge of the break. In certain embodiments, the 5′ and 3′ homology arms flank an endogenous stop codon. In certain embodiments, the 5′ and 3′ homology arms flank a break located within about 500 base pairs (e.g., about 500 base pairs, about 450 base pairs, about 400 base pairs, about 350 base pairs, about 300 base pairs, about 250 base pairs, about 200 base pairs, about 150 base pairs, about 100 base pairs, about 50 base pairs, or about 25 base pairs) upstream (5′) of an endogenous stop codon, e.g., the stop codon of an essential gene. In certain embodiments, the 5′ homology arm encompasses an edge of the break.
Knock-In Cassette
In some embodiments, a knock-in cassette within the donor template comprises an exogenous coding sequence for the gene product of interest in frame with and downstream (3′) of an exogenous coding sequence or partial coding sequence of the essential gene. In some embodiments, a knock-in cassette within a donor template comprises an exogenous coding sequence for the gene product of interest in frame with and upstream (5′) of an exogenous coding sequence or partial coding sequence of an essential gene. In some embodiments, the knock-in cassette is a polycistronic knock-in cassette. In some embodiments, the knock-in cassette is a bicistronic knock-in cassette. In some embodiment the knock-in cassette does not comprise a reporter gene, e.g., a fluorescent reporter gene or an antibiotic resistance gene.
In some embodiments, a single essential gene locus will be targeted by two knock-in cassettes comprising different “cargo” sequences. In some embodiments, one allele will incorporate one knock-in cassette, while the other allele will incorporate the other knock-in cassette. In some embodiments, a gRNA utilized to generate an appropriate DNA break may be the same for each of the two different knock-in cassettes. In some embodiments, gRNAs utilized to generate appropriate DNA breaks for each of the two different knock-in cassettes may be different, such that the “cargo” sequence is incorporated at a different position for each allele. In some embodiments, such a different position for each allele may still be within the ultimate exons coding region. In some embodiments, such a different position for each allele may be within the penultimate exon (second to last), and/or ultimate (last) exons coding region. In some embodiments, such a different position for at least one of the alleles may be within the first exon. In some embodiments, such a different position for at least one of the alleles may be within the first or second exon.
In order to properly restore the essential gene coding region in the genetically modified cell (so that a functioning gene product is produced) the knock-in cassette does not need to comprise an exogenous coding sequence that corresponds to the entire coding sequence of the essential gene. Indeed, depending on the location of the break in the endogenous coding sequence of the essential gene it may be possible to restore the essential gene by providing a knock-in cassette that comprises a partial coding sequence of the essential gene, e.g., that corresponds to a portion of the endogenous coding sequence of the essential gene that spans the break and the entire region downstream of the break (minus the stop codon), and/or that corresponds to a portion of the endogenous coding sequence of the essential gene that spans the break and the entire region upstream of the break (up to and optionally including the start codon).
In order to minimize the size of the knock-in cassette it may in fact be advantageous, in some embodiments, to have the break located within the last 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of the endogenous coding sequence of the essential gene, i.e., towards the 3′ end of the coding sequence. In some embodiments, a base pair's location in a coding sequence may be defined 3′-to-5′ from an endogenous translational stop signal (e.g., a stop codon). In some embodiments, as used herein, an “endogenous coding sequence” can include both exonic and intronic base pairs, and refers to gene sequence occurring 5′ to an endogenous functional translational stop signal. In some embodiments, a break within an endogenous coding sequence comprises a break within one DNA strand. In some embodiments, a break within an endogenous coding sequence comprises a break within both DNA strands. In some embodiments, a break is located within the last 1000 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 750 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 600 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 500 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 400 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 300 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 250 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 200 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 150 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 100 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 75 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 50 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the last 21 base pairs of the endogenous coding sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes a C-terminal fragment of a protein encoded by the essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette is codon optimized. In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette is codon optimized to eliminate at least one PAM site. In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette is codon optimized to eliminate more than one PAM site. In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette is codon optimized to eliminate all relevant nuclease specific PAM sites. In some embodiments, a C-terminal fragment of a protein encoded by the essential gene is about 140 amino acids in length. In some embodiments, a C-terminal fragment of a protein encoded by the essential gene is about 130 amino acids in length. In some embodiments, a C-terminal fragment of a protein encoded by the essential gene is about 120 amino acids in length. In some embodiments, the C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break. In some embodiments, a C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 1 exon of the essential gene. In some embodiments, a C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 2 exons of the essential gene. In some embodiments, a C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 3 exons of the essential gene. In some embodiments, a C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 4 exons of the essential gene. In some embodiments, a C-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 5 exons of the essential gene.
In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a C-terminal fragment of a protein encoded by an essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, or 7 amino acids in length. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 20 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 19 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 18 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 17 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 16 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 1 amino acid C-terminal fragment of a protein encoded by an essential gene.
In some embodiments, e.g., when the essential gene includes many exons as shown in the exemplary method of
In order to minimize the size of the knock-in cassette it may in fact be advantageous, in some embodiments, to have the break located within the first 1500, 1000, 750, 500, 400, 300, 200, 100, or 50 base pairs of an endogenous coding sequence of the essential gene, i.e., starting from the 5′ end of a coding sequence. In some embodiments, a base pair's location in a coding sequence may be defined 5′-to-3′ from an endogenous translational start signal (e.g., a start codon). In some embodiments, as used herein, an “endogenous coding sequence” can include both exonic and intronic base pairs, and refers to gene sequence occurring 3′ to an endogenous functional translational start signal. In some embodiments, a break within an endogenous coding sequence comprises a break within one DNA strand. In some embodiments, a break within an endogenous coding sequence comprises a break within both DNA strands. In some embodiments, a break is located within the first 1000 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 750 base pairs of a endogenous coding sequence. In some embodiments, a break is located within the first 600 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 500 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 400 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 300 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 250 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 200 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 150 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 100 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 75 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 50 base pairs of the endogenous coding sequence. In some embodiments, a break is located within the first 21 base pairs of the endogenous coding sequence.
In some embodiments, the exogenous partial coding sequence of the essential gene in the knock-in cassette encodes an N-terminal fragment of a protein encoded by the essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 15 or 10 amino acids in length. In some embodiments, an N-terminal fragment of a protein encoded by the essential gene is about 140 amino acids in length. In some embodiments, an N-terminal fragment of a protein encoded by the essential gene is about 130 amino acids in length. In some embodiments, an N-terminal fragment of a protein encoded by the essential gene is about 120 amino acids in length. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence of the essential gene that spans the break. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 1 exon of the essential gene. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 2 exons of the essential gene. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 3 exons of the essential gene. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 4 exons of the essential gene. In some embodiments, an N-terminal fragment includes an amino acid sequence that is encoded by a region of the endogenous coding sequence within 5 exons of the essential gene.
In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes an N-terminal fragment of a protein encoded by an essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, or 7 amino acids in length. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 20 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 19 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 18 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 17 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 16 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette encodes a 1 amino acid N-terminal fragment of a protein encoded by an essential gene.
In some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is less than 100% identical to the corresponding endogenous coding sequence of the essential gene of the cell, e.g., less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55% or less than 50% (i.e., when the two sequences are aligned using a standard pairwise sequence alignment tool that maximizes the alignment between the corresponding sequences). For example, in some embodiments, the exogenous coding sequence or partial coding sequence of the essential gene in the knock-in cassette is codon optimized relative to the corresponding endogenous coding sequence of the essential gene of the cell, e.g., to prevent further binding of a nuclease to the target site. Alternatively or additionally it may be codon optimized to reduce the likelihood of recombination after integration of the knock-in cassette into the genome of the cell and/or to increase expression of the gene product of the essential gene and/or the gene product of interest after integration of the knock-in cassette into the genome of the cell.
In some embodiments, a knock-in cassette comprises one or more nucleotides or base pairs that differ (e.g., are mutations) relative to an endogenous knock-in site. In some embodiments, such mutations in a knock-in cassette provide resistance to cutting by a nuclease. In some embodiments, such mutations in a knock-in cassette prevent a nuclease from cutting the target loci following homologous recombination. In some embodiments, such mutations in a knock-in cassette occur within one or more coding and/or non-coding regions of a target gene. In some embodiments, such mutations in a knock-in cassette are silent mutations. In some embodiments, such mutations in a knock-in cassette are silent and/or missense mutations.
In some embodiments, such mutations in a knock-in cassette occur within a target protospacer motif and/or a target protospacer adjacent motif (PAM) site. In some embodiments, a knock-in cassette includes a target protospacer motif and/or a PAM site that are saturated with silent mutations. In some embodiments, a knock-in cassette includes a target protospacer motif and/or a PAM site that are approximately 30%, 40%, 50%, 60%, 70%, 80%, or 90% saturated with silent mutations. In some embodiments, a knock-in cassette includes a target protospacer motif and/or a PAM site that are saturated with silent and/or missense mutations. In some embodiments, a knock-in cassette includes a target protospacer motif and/or a PAM site that comprise at least one mutation, at least 2 mutations, at least 3 mutations, at least 4 mutations, at least 5 mutations, at least 6 mutations, at least 7 mutations, at least 8 mutations, at least 9 mutations, at least 10 mutations, at least 11 mutations, at least 12 mutations, at least 13 mutations, at least 14 mutations, or at least 15 mutations.
In some embodiments, certain codons encoding certain amino acids in a target site cannot be mutated through codon-optimization without losing some portion of an endogenous proteins natural function. In some embodiments, certain codons encoding certain amino acids in a target site cannot be mutated through codon-optimization.
In some embodiments, the knock-in cassette is codon optimized in only a portion of the coding sequence. For example, in some embodiments, a knock-in cassette encodes a C-terminal fragment of a protein encoded by an essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, or 7 amino acids in length. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 20 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 19 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 18 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 17 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 16 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 15 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 14 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 13 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 12 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 11 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 10 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 9 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 8 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 7 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 6 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 5 amino acid C-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes an amino acid C-terminal fragment that is less than 5 amino acids of a protein encoded by an essential gene.
In some embodiments, the knock-in cassette is codon optimized in only a portion of the coding sequence. For example, in some embodiments, a knock-in cassette encodes an N-terminal fragment of a protein encoded by an essential gene, e.g., a fragment that is less than 500, 250, 150, 125, 100, 75, 50, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, or 7 amino acids in length. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 20 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 19 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 18 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 17 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 16 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 15 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 14 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 13 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 12 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 11 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 10 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 9 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 8 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 7 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 6 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes a 5 amino acid N-terminal fragment of a protein encoded by an essential gene. In some embodiments, the exogenous partial coding sequence of an essential gene in a knock-in cassette that has been codon optimized encodes an amino acid N-terminal fragment that is less than 5 amino acids of a protein encoded by an essential gene.
In some embodiments, the knock-in cassette comprises one or more sequences encoding a linker peptide, e.g., between an exogenous coding sequence or partial coding sequence of the essential gene and a “cargo” sequence and/or a regulatory element described herein. Such linker peptides are known in the art, any of which can be included in a knock-in cassette described herein. In some embodiments, the linker peptide comprises the amino acid sequence GSG.
In some embodiments, the knock-in cassette comprises other regulatory elements such as a polyadenylation sequence, and optionally a 3′ UTR sequence, downstream of the exogenous coding sequence for the gene product of interest. If a 3′UTR sequence is present, the 3′UTR sequence is positioned 3′ of the exogenous coding sequence and 5′ of the polyadenylation sequence.
In some embodiments, the knock-in cassette comprises other regulatory elements such as a 5′ UTR and a start codon, upstream of the exogenous coding sequence for the gene product of interest. If a 5′UTR sequence is present, the 5′UTR sequence is positioned 5′ of the “cargo” sequence and/or exogenous coding sequence.
Exemplary Homology Arms (HA)
In certain embodiments, a donor template comprises a 5′ and/or 3′ homology arm homologous to region of a GAPDH locus. In some embodiments, a donor template comprises a 5′ homology arm comprising or consisting of the sequence of SEQ ID NO:1, 2, or 3. In some embodiments, a 5′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 1, 2, or 3. In some embodiments, a donor template comprises a 3′ homology arm comprising or consisting of the sequence of SEQ ID NO:4 or 5. In certain embodiments, a 3′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 4 or 5.
In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 1, and a 3′ homology arm comprising SEQ ID NO: 4. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 2, and a 3′ homology arm comprising SEQ ID NO: 4. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 3, and a 3′ homology arm comprising SEQ ID NO:5.
In some embodiments, a stretch of sequence flanking a nuclease cleavage site may be duplicated in both a 5′ and 3′ homology arm. In some embodiments, such a duplication is designed to optimize HDR efficiency. In some embodiments, one of the duplicated sequences may be codon optimized, while the other sequence is not codon optimized. In some embodiments, both of the duplicated sequences may be codon optimized. In some embodiments, codon optimization may remove a target PAM site. In some embodiments, a duplicated sequence may be no more than: 100 bp in length, 90 bp in length, 80 bp in length, 70 bp in length, 60 bp in length, 50 bp in length, 40 bp in length, 30 bp in length, or 20 bp in length.
In some embodiments, a donor template comprises a 5′ and/or 3′ homology arm homologous to a region of a TBP locus. In some embodiments, a donor template comprises a 5′ homology arm comprising or consisting of the sequence of SEQ ID NO:6, 7, or 8. In some embodiments, a 5′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 6, 7, or 8. In some embodiments, a donor template comprises a 3′ homology arm comprising or consisting of the sequence of SEQ ID NO:9, 10, or 11. In certain embodiments, a 3′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 9, 10, or 11.
In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 6, and a 3′ homology arm comprising SEQ ID NO: 9. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 7, and a 3′ homology arm comprising SEQ ID NO: 10. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 8, and a 3′ homology arm comprising SEQ ID NO: 11.
In some embodiments, a donor template comprises a 5′ and/or 3′ homology arm homologous to a region of a G6PD locus. In some embodiments, a donor template comprises a 5′ homology arm comprising or consisting of the sequence of SEQ ID NO:12. In some embodiments, a 5′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 12. In some embodiments, a donor template comprises a 3′ homology arm comprising or consisting of the sequence of SEQ ID NO:13. In certain embodiments, a 3′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO:13.
In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 12, and a 3′ homology arm comprising SEQ ID NO: 13.
In some embodiments, a donor template comprises a 5′ and/or 3′ homology arm homologous to a region of a E2F4 locus. In some embodiments, a donor template comprises a 5′ homology arm comprising or consisting of the sequence of SEQ ID NO: 14, 15, or 16. In some embodiments, a 5′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 14, 15, or 16. In some embodiments, a donor template comprises a 3′ homology arm comprising or consisting of the sequence of SEQ ID NO: 17, 18, or 19. In certain embodiments, a 3′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 17, 18, or 19.
In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 14, and a 3′ homology arm comprising SEQ ID NO: 17. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 15, and a 3′ homology arm comprising SEQ ID NO: 18. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 16, and a 3′ homology arm comprising SEQ ID NO: 19.
In some embodiments, a donor template comprises a 5′ and/or 3′ homology arm homologous to a region of a KIF11 locus. In some embodiments, a donor template comprises a 5′ homology arm comprising or consisting of the sequence of SEQ ID NO: 20, 21, or 22. In some embodiments, a 5′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 20, 21, or 22. In some embodiments, a donor template comprises a 3′ homology arm comprising or consisting of the sequence of SEQ ID NO: 23, 24, or 25. In certain embodiments, a 3′ homology arm comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NO: 23, 24, or 25.
In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 20, and a 3′ homology arm comprising SEQ ID NO: 23. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 21, and a 3′ homology arm comprising SEQ ID NO: 24. In some embodiments, a donor template comprises a 5′ homology arm comprising SEQ ID NO: 22, and a 3′ homology arm comprising SEQ ID NO: 25.
Inverted Terminal Repeats (ITRs)
In certain embodiments, a donor template comprises an AAV derived sequence. In certain embodiments, a donor template comprises AAV derived sequences that are typical of an AAV construct, such as cis-acting 5′ and 3′ inverted terminal repeats (ITRs) (See, e.g., B. J. Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155 168 (1990), which is incorporated in its entirety herein by reference). Generally, ITRs are able to form a hairpin. The ability to form a hairpin can contribute to an ITRs ability to self-prime, allowing primase-independent synthesis of a second DNA strand. ITRs also play a role in integration of AAV construct (e.g., a coding sequence) into a genome of a target cell. ITRs can also aid in efficient encapsidation of an AAV construct in an AAV particle.
In some embodiments, a donor template described herein is included within an rAAV particle (e.g., an AAV6 particle). In some embodiments, an ITR is or comprises about 145 nucleic acids. In some embodiments, all or substantially all of a sequence encoding an ITR is used. In some embodiments, an AAV ITR sequence may be obtained from any known AAV, including presently identified mammalian AAV types. In some embodiments an ITR is an AAV6 ITR.
An example of an AAV construct employed in the present disclosure is a “cis-acting” construct containing a cargo sequence (e.g., a donor template described herein), in which the donor template is flanked by 5′ or “left” and 3′ or “right” AAV ITR sequences. 5′ and left designations refer to a position of an ITR sequence relative to an entire construct, read left to right, in a sense direction. For example, in some embodiments, a 5′ or left ITR is an ITR that is closest to a target loci promoter (as opposed to a polyadenylation sequence) for a given construct, when a construct is depicted in a sense orientation, linearly. Concurrently, 3′ and right designations refer to a position of an ITR sequence relative to an entire construct, read left to right, in a sense direction. For example, in some embodiments, a 3′ or right ITR is an ITR that is closest to a polyadenylation sequence in a target loci (as opposed to a promoter sequence) for a given construct, when a construct is depicted in a sense orientation, linearly. ITRs as provided herein are depicted in 5′ to 3′ order in accordance with a sense strand. Accordingly, one of skill in the art will appreciate that a 5′ or “left” orientation ITR can also be depicted as a 3′ or “right” ITR when converting from sense to antisense direction. Further, it is well within the ability of one of skill in the art to transform a given sense ITR sequence (e.g., a 5′/left AAV ITR) into an antisense sequence (e.g., 3′/right ITR sequence). One of ordinary skill in the art would understand how to modify a given ITR sequence for use as either a 5′/left or 3′/right ITR, or an antisense version thereof.
For example, in some embodiments an ITR (e.g., a 5′ ITR) can have a sequence according to SEQ ID NO: 158. In some embodiments, an ITR (e.g., a 3′ ITR) can have a sequence according to SEQ ID NO: 159. In some embodiments, an ITR includes one or more modifications, e.g., truncations, deletions, substitutions or insertions, as is known in the art. In some embodiments, an ITR comprises fewer than 145 nucleotides, e.g., 127, 130, 134 or 141 nucleotides. For example, in some embodiments, an ITR comprises 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123,124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143 144, or 145 nucleotides.
A non-limiting example of 5′ AAV ITR sequences includes SEQ ID NO: 158. A non-limiting example of 3′ AAV ITR sequences includes SEQ ID NO: 159. In some embodiments, the 5′ and a 3′ AAV ITRs (e.g., SEQ ID NO: 158 and 159) flank a donor template described herein (e.g., a donor template comprising a 5′HA, a knock-in cassette, and a 3′ HA). The ability to modify ITR sequences is within the skill of the art. (See, e.g., texts such as Sambrook et al. “Molecular Cloning. A Laboratory Manual”, 2d ed., Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520 532 (1996), each of which is incorporated in its entirety herein by reference). In some embodiments, a 5′ ITR sequence is at least 85%, 90%, 95%, 98% or 99% identical to a 5′ ITR sequence represented by SEQ ID NO: 158. In some embodiments, a 3′ ITR sequence is at least 85%, 90%, 95%, 98% or 99% identical to a 3′ ITR sequence represented by SEQ ID NO: 159.
Flanking Untranslated Regions, 5′ UTRs and 3′ UTRs
In some embodiments, a knock-in cassette described herein includes all or a portion of an untranslated region (UTR), such as a 5′ UTR and/or a 3′ UTR. UTRs of a gene are transcribed but not translated. A 5′ UTR starts at a transcription start site and continues to the start codon but does not include the start codon. A 3′ UTR starts immediately following the stop codon and continues until the transcriptional termination signal. The regulatory and/or control features of a UTR can be incorporated into any of the knock-in cassettes described herein to enhance or otherwise modulate the expression of an essential target gene loci and/or a cargo sequence.
Natural 5′ UTRs include a sequence that plays a role in translation initiation. In some embodiments, a 5′ UTR comprises sequences, like Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus sequence CCR(A/G)CCAUGG, where R is a purine (A or G) three bases upstream of the start codon (AUG), and the start codon is followed by another “G”. The 5′ UTRs have also been known to form secondary structures that are involved in elongation factor binding. Non-limiting examples of 5′ UTRs include those from the following genes: albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, and Factor VIII.
In some embodiments, a UTR may comprise a non-endogenous regulatory region. In some embodiments, a UTR that comprises a non-endogenous regulatory region is a 3′ UTR. In some embodiments, a UTR that comprises a non-endogenous regulatory region is a 5′ UTR. In some embodiments, a non-endogenous regulatory region may be a target of at least one inhibitory nucleic acid. In some embodiments, an inhibitory nucleic acid inhibits expression and/or activity of a target gene. In some embodiments, an inhibitory nucleic acid is a short interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA (miRNA), an antisense oligonucleotide, a guide RNA (gRNA), or a ribozyme. In some embodiments, an inhibitory nucleic acid is an endogenous molecule. In some embodiments, an inhibitory nucleic acid is a non-endogenous molecule. In some embodiments, an inhibitory nucleic acid displays a tissue specific expression pattern. In some embodiments, an inhibitory nucleic acid displays a cell specific expression pattern.
In some embodiments, a knock-in cassette may comprise more than one non-endogenous regulatory regions, e.g., two, three, four, five, six, seven, eight, nine, or ten regulatory regions. In some embodiments, a knock-in cassette may comprise four non-endogenous regulatory regions. In some embodiments, a construct may comprise more than one non-endogenous regulatory regions, wherein at least one of the more than one non-endogenous regulatory regions are not the same as at least one of the other non-endogenous regulatory regions.
In some embodiments, a 3′ UTR is found immediately 3′ to the stop codon of a gene of interest. In some embodiments, a 3′ UTR from an mRNA that is transcribed by a target cell can be included in any knock-in cassette described herein. In some embodiments, a 3′ UTR is derived from an endogenous target loci and may include all or part of the endogenous sequence. In some embodiments, a 3′ UTR sequence is at least 85%, 90%, 95% or 98% identical to the sequence of SEQ ID NO: 26.
Polyadenylation Sequences
In some embodiments, a knock-in cassette construct provided herein can include a polyadenylation (poly(A)) signal sequence. Most nascent eukaryotic mRNAs possess a poly(A) tail at their 3′ end, which is added during a complex process that includes cleavage of the primary transcript and a coupled polyadenylation reaction driven by the poly(A) signal sequence (see, e.g., Proudfoot et al., Cell 108:501-512, 2002, which is incorporated herein by reference in its entirety). A poly(A) tail confers mRNA stability and transferability (Molecular Biology of the Cell, Third Edition by B. Alberts et al., Garland Publishing, 1994, which is incorporated herein by reference in its entirety). In some embodiments, a poly(A) signal sequence is positioned 3′ to a coding sequence.
As used herein, “polyadenylation” refers to the covalent linkage of a polyadenylyl moiety, or its modified variant, to a messenger RNA molecule. In eukaryotic organisms, most messenger RNA (mRNA) molecules are polyadenylated at the 3′ end. A 3′ poly(A) tail is a long sequence of adenine nucleotides (e.g., 50, 60, 70, 100, 200, 500, 1000, 2000, 3000, 4000, or 5000 (SEQ ID NOS 1886 and 1897-1906, respectively, in order of appearance)) added to the pre-mRNA through the action of an enzyme, polyadenylate polymerase. In some embodiments, a poly(A) tail is added onto transcripts that contain a specific sequence, e.g., a polyadenylation (or poly(A)) signal. A poly(A) tail and associated proteins aid in protecting mRNA from degradation by exonucleases. Polyadenylation also plays a role in transcription termination, export of the mRNA from the nucleus, and translation. Polyadenylation typically occurs in the nucleus immediately after transcription of DNA into RNA, but also can occur later in the cytoplasm. After transcription has been terminated, an mRNA chain is cleaved through the action of an endonuclease complex associated with RNA polymerase. A cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, adenosine residues are added to the free 3′ end at the cleavage site.
As used herein, a “poly(A) signal sequence” or “polyadenylation signal sequence” is a sequence that triggers the endonuclease cleavage of an mRNA and the addition of a series of adenosines to the 3′ end of the cleaved mRNA.
There are several poly(A) signal sequences that can be used, including those derived from bovine growth hormone (bGH) (Woychik et al., Proc. Natl. Acad Sci. US.A. 81(13):3944-3948, 1984; U.S. Pat. No. 5,122,458, each of which is incorporated herein by reference in its entirety), mouse-β-globin, mouse-α-globin (Orkin et al., EMBO J 4(2):453-456, 1985; Thein et al., Blood 71 (2):313-319, 1988, each of which is incorporated herein by reference in its entirety), human collagen, polyoma virus (Batt et al., Mol. Cell Biol. 15(9):4783-4790, 1995, which is incorporated herein by reference in its entirety), the Herpes simplex virus thymidine kinase gene (HSV TK), IgG heavy-chain gene polyadenylation signal (US 2006/0040354, which is incorporated herein by reference in its entirety), human growth hormone (hGH) (Szymanski et al., Mol. Therapy 15(7):1340-1347, 2007, which is incorporated herein by reference in its entirety), the group comprising a SV40 poly(A) site, such as the SV40 late and early poly(A) site (Schek et al., Mol. Cell Biol. 12(12):5386-5393, 1992, which is incorporated herein by reference in its entirety).
The poly(A) signal sequence can be AATAAA. The AATAAA sequence may be substituted with other hexanucleotide sequences with homology to AATAAA and that are capable of signaling polyadenylation, including ATTAAA, AGTAAA, CATAAA, TATAAA, GATAAA, ACTAAA, AATATA, AAGAAA, AATAAT, AAAAAA, AATGAA, AATCAA, AACAAA, AATCAA, AATAAC, AATAGA, AATTAA, or AATAAG (see, e.g., WO 06/12414, which is incorporated herein by reference in its entirety).
In some embodiments, a poly(A) signal sequence can be a synthetic polyadenylation site (see, e.g., the pCl-neo expression construct of Promega that is based on Levitt el al., Genes Dev. 3(7):1019-1025, 1989, which is incorporated herein by reference in its entirety). In some embodiments, a poly(A) signal sequence is the polyadenylation signal of soluble neuropilin-1 (sNRP) (AAATAAAATACGAAATG (SEQ ID NO: 1887)) (see, e.g., WO 05/073384, which is incorporated herein by reference in its entirety). In some embodiments, a poly(A) signal sequence comprises or consists of the SV40 poly(A) site. In some embodiments, a poly(A) signal sequence comprises or consists of SEQ ID NO: 27. In some embodiments, a poly(A) signal sequence comprises or consists of bGHpA. In some embodiments, a poly(A) signal sequence comprises or consists of SEQ ID NO: 28. Additional examples of poly(A) signal sequences are known in the art. In some embodiments, a poly(A) sequence is at least 85%, 90%, 95%, 98% or 99% identical to the sequence of SEQ ID NOs: 27 or 28.
IRES and 2A Elements
In some embodiments, the knock-in cassette comprises a regulatory element that enables expression of the gene product encoded by the essential gene and the gene product of interest as separate gene products, e.g., an IRES or 2A element located between the exogenous coding sequence or partial coding sequence of the essential gene and the exogenous coding sequence for the gene product of interest.
In some embodiments, a knock-in cassette may comprise multiple gene products of interest (e.g., at least two gene products of interest). In some embodiments, gene products of interest may be separated by a regulatory element that enables expression of the at least two gene products of interest as more than one gene product, e.g., an IRES or 2A element located between the at least two coding sequences, facilitating creation of at least two peptide products.
Internal Ribosome Entry Site (IRES) elements are one type of regulatory element that are commonly used for this purpose. As is well known in the art, IRES elements allow for initiation of translation from an internal region of the mRNA and hence expression of two separate proteins from the same mRNA transcript. IRES was originally discovered in poliovirus RNA, where it promotes translation of the viral genome in eukaryotic cells. Since then, a variety of IRES sequences have been discovered—many from viruses, but also some from cellular mRNAs, e.g., see Mokrejs et al., Nucleic Acids Res. 2006; 34 (Database issue):D125-D130.
2A elements are another type of regulatory element that are commonly used for this purpose. These 2A elements encode so-called “self-cleaving” 2A peptides which are short peptides (about 20 amino acids) that were first discovered in picornaviruses. The term “self-cleaving” is not entirely accurate, as these peptides are thought to function by making the ribosome skip the synthesis of a peptide bond at the C-terminus of a 2A element, leading to separation between the end of the 2A sequence and the next peptide downstream. The “cleavage” occurs between the Glycine (G) and Proline (P) residues found on the C-terminus meaning the upstream cistron, i.e., protein encoded by the essential gene will have a few additional residues from the 2A peptide added to the end, while the downstream cistron, i.e., gene product of interest will start with the Proline (P).
Table 2 below lists the four commonly used 2A peptides (an optional GSG sequence is sometimes added to the N-terminal end of the peptide to improve cleavage efficiency). There are many potential 2A peptides that may be suitable for methods and compositions described herein (see e.g., Luke et al., Occurrence, function and evolutionary origins of ‘2A-like’ sequences in virus genomes. J Gen Virol. 2008). Those skilled in the art know that the choice of specific 2A peptide for a particular knock-in cassette will ultimately depend on a number of factors such as cell type or experimental conditions. Those skilled in the art will recognize that nucleotide sequences encoding specific 2A peptides can vary while still encoding a peptide suitable for inducing a desired cleavage event.
Essential Genes
An essential gene can be any gene that is essential for the survival and/or the proliferation of the cell. In some embodiments, an essential gene is a housekeeping gene that is essential for survival of all cell types, e.g., a gene listed in Table 3. See also other housekeeping genes discussed in Eisenberg, Trends in Gen. 2014; 30(3):119-20 and Moein et al., Adv. Biomed Res. 2017; 6:15. Additional genes that are essential for various cell types, including iPSCs/ESCs, are listed in Table 4 (see also the essential genes discussed in Yilmaz et al., Nat. Cell Biol. 2018; 20:610-619 the entire contents of which are incorporated herein by reference).
In some embodiments the essential gene is GAPDH and the DNA nuclease causes a break in exon 9, e.g., a double-strand break. In some embodiments the essential gene is TBP and the DNA nuclease causes a break in exon 7, or exon 8, e.g., a double-strand break. In some embodiments the essential gene is E2F4 and the DNA nuclease causes a break in exon 10, e.g., a double-strand break. In some embodiments the essential gene is G61-D and the DNA nuclease causes a break in exon 13, e.g., a double-strand break. In some embodiments the essential gene is KIF11 and the DNA nuclease causes a break in exon 22, e.g., a double-strand break.
The gene symbols used in herein (including in Tables 3 and 4) are based on those found in the Human Gene Naming Committee (HGNC) which is searchable on the world-wide web at www.genenames.org. Ensembl IDs are provided for each gene symbol and are searchable world-wide web at www.ensembl.org.
The genes provided in Tables 3 and 4 are non-limiting examples of essential genes. Although additional essential genes will be apparent to the skilled artisan based on the knowledge in the art, the suitability of a particular gene for use according to the present disclosure can be determined, e.g., as discussed herein. For example, in some embodiments, a particular essential gene can be selected by analysis of potential off-target sites elsewhere in the genome. In some embodiments, only essential genes with one or more gRNA target sites that are unique in the human genome are selected for methods described herein. In some embodiments, only essential genes with one or more gRNA target sites that are found in only one other locus in the human genome are selected for methods described herein. In some embodiments, only essential genes with one or more gRNA target sites found in only two other loci in the human genome are selected for methods described herein.
Gene Product of Interest
The methods, systems and cells of the present disclosure enable the integration of a gene of interest at an essential gene of a cell. The gene of interest can encode any gene product of interest. In certain embodiments, a gene product of interest comprises an antibody, an antigen, an enzyme, a growth factor, a receptor (e.g., cell surface, cytoplasmic, or nuclear), a hormone, a lymphokine, a cytokine, a chemokine, a reporter, a functional fragment of any of the above, or a combination of any of the above.
In some embodiments, sequence for a gene product of interest can include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, a gene of interest may encode an miRNA, an shRNA, a native polypeptide (i.e. a polypeptide found in nature) or fragment thereof; a variant polypeptide (i.e. a mutant of the native polypeptide having less than 100% sequence identity with the native polypeptide) or fragment thereof; an engineered polypeptide or peptide fragment, a therapeutic peptide or polypeptide, an imaging marker, a selectable marker, a degradation signal, and the like.
In some embodiments, a gene product of interest may be but is not limited to, e.g., a therapeutic protein or a gene product that confers a desired feature to the modified cell. In some embodiments, the transgene encodes a reporter protein, such as a fluorescent protein (e.g., as described herein) and an enzyme (e.g., luciferase and lacZ). In some embodiments, a reporter gene may aid the tracking of therapeutic cells once they are introduced to a subject.
In some embodiments, a gene product of interest may be but is not limited to therapeutic proteins such as a protein deficient in a patient. In some embodiments, for example, therapeutic proteins include, but are not limited to, those deficient in lysosomal storage disorders, such as alpha-L-iduronidase, arylsulfatase A, beta-glucocerebrosidase, acid sphingomyelinase, and alpha- and beta-galactosidase; and those deficient in hemophilia such as Factor VIII and Factor IX. Other examples of therapeutic proteins include, but are not limited to, antibodies or antibody fragments (e.g., scFv) such as those targeting pathogenic proteins (e.g., tau, alpha-synuclein, and beta-amyloid protein) and those targeting cancer cells (e.g., chimeric antigen receptors (CAR) as described herein)
In some embodiments, a gene product of interest may be a protein involved in immune regulation, or an immunomodulatory protein. In some embodiments, for example, such proteins are, PD-L1, CTLA-4, M-CSF, IL-4, IL-6, IL-10, IL-11, IL-13, TGF-01, and various isoforms thereof. By way of example, in some embodiments, a gene product of interest may be an isoform of HLA-G (e.g., HLA-G1, -G2, -G3, -G4, -G5, -G6, or -G7) or HLA-E; allogeneic cells expressing such a nonclassical MHC class I molecule may be less immunogenic and better tolerated when transplanted into a human patient who is not the source of the cells, making “universal” cell therapy possible.
In some embodiments, an exemplary gene product of interest is one that confers therapeutic value, e.g., a new therapeutic activity to the cell. In some embodiments, exemplary gene products of interest are polypeptides such as a chimeric antigen receptor (CAR) or antigen-binding fragment thereof, a T cell receptor or antigen binding fragment thereof, a non-naturally occurring variant of FcγRIII (CD16), interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin-12 receptor (IL-12R) or a variant thereof, human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof. It is to be understood that the methods and cells of the present disclosure are not limited to any particular gene product of interest and that the selection of a gene product of interest will depend on the type of cell and ultimate use of the cells.
In some embodiments, a gene product of interest may be a cytokine. In some embodiments, expression of a cytokine from a modified cell generated using a method as described herein allows for localized dosing of the cytokine in vivo (e.g., within a subject in need thereof) and/or avoids a need to systemically administer a high-dose of the cytokine to a subject in need thereof (e.g., a lower dose of the cytokine may be administered). In some embodiments, the risk of dose-limiting toxicities associated with administering a cytokine is reduced while cytokine mediated cell functions are maintained. In some embodiments, to facilitate cell function without the need to additionally administer high-doses of soluble cytokines, a partial or full peptide of one or more of IL2, IL4, IL6, IL7, IL9, IL10, IL11, IL12, IL15, IL18, IL21, IFN-α, IFN-β and/or their respective receptor is introduced to the cell to enable cytokine signaling with or without the expression of the cytokine itself, thereby maintaining or improving cell growth, proliferation, expansion, and/or effector function with reduced risk of cytokine toxicities. In some embodiments, the introduced cytokine and/or its respective native or modified receptor for cytokine signaling are expressed on the cell surface. In some embodiments, the cytokine signaling is constitutively activated. In some embodiments, the activation of the cytokine signaling is inducible. In some embodiments, the activation of the cytokine signaling is transient and/or temporal. In some embodiments, a gene product if interest can be IL2, IL3, IL4, IL6, IL7, IL9, IL10, IL11, IL12, IL13, IL15, IL21, GM-CSF, IFN-a, IFN-b, IFN-g, erythropoietin, and/or the respective cytokine receptor. In some embodiments, a gene product of interest can be CCL3, TNFα, CCL23, IL2RB, IL12RB2, or IRF7.
In some embodiments, a gene product of interest can be a chemokine and/or the respective chemokine receptor. In some embodiments, a chemokine receptor can be, but is not limited to, CCR2, CCR5, CCR8, CX3C1, CX3CR1, CXCR1, CXCR2, CXCR3A, CXCR3B, or CXCR2. In some embodiments, a chemokine can be, but is not limited to, CCL7, CCL19, or CXL14.
As used herein, the term “chimeric antigen receptor” or “CAR” refers to a receptor protein that has been modified to give cells expressing the CAR the new ability to target a specific protein. Within the context of the disclosure, a cell modified to comprise a CAR or an antigen binding fragment may be used for immunotherapy to target and destroy cells associated with a disease or disorder, e.g., cancer cells. In some embodiments, the CAR can bind to any antigen of interest.
CARs of interest can include, but are not limited to, a CAR targeting mesothelin, EGFR, HER2 and/or MICA/B. To date, mesothelin-targeted CAR T-cell therapy has shown early evidence of efficacy in a phase I clinical trial of subjects having mesothelioma, non-small cell lung cancer, and breast cancer (NCT02414269). Similarly, CARs targeting EGFR, HER2 and MICA/B have shown promise in early studies (see, e.g., Li et al. (2018), Cell Death & Disease, 9(177); Han et al. (2018) Am. J. Cancer Res., 8(1):106-119; and Demoulin 2017) Future Oncology, 13(8); the entire contents of each of which are expressly incorporated herein by reference in their entireties).
CARs are well-known to those of ordinary skill in the art and include those described in, for example: WO13/063419 (mesothelin), WO15/164594 (EGFR), WO13/063419 (HER2), WO16/154585 (MICA and MICB), the entire contents of each of which are expressly incorporated herein by reference in their entireties. In some embodiments, a gene product of interest is any suitable CAR, NK cell specific CAR (NK-CAR), T cell specific CAR, or other binder that targets a cell, e.g., an NK cell, to a target cell, e.g., a cell associated with a disease or disorder, may be expressed in the modified cells provided herein. Exemplary CARs, and binders, include, but are not limited to, bi-specific antigen binding CARs, switchable CARs, dimerizable CARs, split CARs, multi-chain CARs, inducible CARs, CARs and binders that bind BCMA, androgen receptor, PSMA, PSCA, Muc1, HPV viral peptides (i.e., E7), EBV viral peptides, WT1, CEA, EGFR, EGFRvIII, IL13Ra2, GD2, CA125, EpCAM, Mucl6, carbonic anhydrase IX (CAIX), CCR1, CCR4, carcinoembryonic antigen (CEA), CD3, CD5, CD7, CD10, CD19, CD20, CD22, CD23, CD24, CD26, CD30, CD33, CD34, CD35, CD38 CD41, CD44, CD44V6, CD49f, CD56, CD70, CD92, CD99, CD123, CD133, CD135, CD148, CD150, CD261, CD362, CLEC12A, MDM2, CYP1B, livin, cyclin 1, NKp30, NKp46, DNAM1, NKp44, CA9, PD1, PDL1, an antigen of cytomegalovirus (CMV), epithelial glycoprotein-40 (EGP-40), GPRC5D, receptor tyrosine kinases erb-B2,3,4, EGFIR, ERBB folate binding protein (FBP), fetal acetylcholine receptor (AChR), folate receptor-a, ganglioside G3 (GD3) human Epidermal Growth Factor Receptor 2 (HER-2), human telomerase reverse transcriptase (hTERT), ICAM-1, Integrin B7, Interleukin-13 receptor subunit alpha-2 (IL-13Ra2), K-light chain, kinase insert domain receptor (KDR), Lewis A (CA19.9), Lewis Y (Le Y), L1 cell adhesion molecule (LI-CAM), LILRB2, melanoma antigen family A 1 (MAGE-A1), MICA/B, Mucin 16 (Muc-16), NKCSI, NKG2D ligands, c-Met, cancer-testis antigen NYES0-1, oncofetal antigen (h5T4), PRAME, prostate stem cell antigen (PSCA), PRAME prostate-specific membrane antigen (PSMA), tumor-associated glycoprotein 72 (TAG-72), TIM-3, TRBCI, TRBC2, vascular endothelial growth factor R2 (VEGF-R2), Wilms tumor protein (WT-1), a pathogen antigen, or any suitable combination thereof.. Additional suitable CARs and binders for use in the modified cells provided herein will be apparent to those of skill in the art based on the present disclosure and the general knowledge in the art. Such additional suitable CARs include those described in FIG. 3 of Davies and Maher, Adoptive T-cell Immunotherapy of Cancer Using Chimeric Antigen Receptor-Grafted T Cells, Archivum Immunologiae et Therapiae Experimentalis 58(3):165-78 (2010), the entire contents of which are incorporated herein by reference. Additional CARs suitable for methods described herein include: CD171-specific CARs (Park et al., Mol Ther (2007) 15(4):825-833), EGFRvIII-specific CARs (Morgan et al, Hum Gene Ther (2012) 23(10): 1043-1053), EGF-R-specific CARs (Kobold et al, J Natl Cancer Inst (2014) 107(1):364), carbonic anhydrase K-specific CARs (Lamers et al., Biochem Soc Trans (2016) 44(3):951-959), FR-a-specific CARs (Kershaw et al., Clin Cancer Res (2006) 12(20):6106-6015), HER2-specific CARs (Ahmed et al., J Clin Oncol (2015) 33(15)1688-1696; Nakazawa et al., Mol Ther (2011) 19(12):2133-2143; Ahmed et al., Mol Ther (2009) 17(10): 1779-1787; Luo et al., Cell Res (2016) 26(7):850-853; Morgan et al., Mol Ther (2010) 18(4):843-85 1; Grada et al., Mol Ther Nucleic Acids (2013) 9(2):32), CEA-specific CARs (Katz et al., Clin Cancer Res (2015) 21 (14):3149-3159), IL13Ra2-specific CARs (Brown et al., Clin Cancer Res (2015) 21(18):4062-4072), GD2-specific CARs (Louis et al., Blood (2011) 118(23):6050-6056; Caruana et al., Nat Med (2015) 21(5):524-529), ErbB2-specific CARs (Wilkie et al., J Clin Immunol (2012) 32(5): 1059-1070), VEGF-R-specific CARs (Chinnasamy et al., Cancer Res (2016) 22(2):436-447), FAP-specific CARs (Wang et al., Cancer Immunol Res (2014) 2(2): 154-166), MSLN-specific CARs (Moon et al., Clin Cancer Res (2011) 17(14):4719-30), CD19-specific CARs (Axicabtagene ciloleucel (Yescarta®) and Tisagenlecleucel (Kymriah®). See also, Li et al., J Hematol and Oncol (2018) 11(22), reviewing clinical trials of tumor-specific CARs.
As used herein, the term “CD16” refers to a receptor (FcγRIII) for the Fc portion of immunoglobulin G, and it is involved in the removal of antigen-antibody complexes from the circulation, as well as other antibody-dependent responses. In some embodiments, a CD16 protein is an hCD16 variant. In some embodiments an hCD16 variant is a high affinity F158V variant.
In some embodiments, a gene product of interest comprises a high affinity non-cleavable CD16 (hnCD16) or a variant thereof. In some embodiments, a high affinity non-cleavable CD16 or a variant thereof comprises at least any one of the followings: (a) Fl76V and S197P in ectodomain domain of CD16 (see e.g., Jing et al., Identification of an ADAM17 Cleavage Region in Human CD16 (FcγRIII) and the Engineering of a Non-Cleavable Version of the Receptor in NK Cells; PLOS One, 2015); (b) a full or partial ectodomain originated from CD64; (c) a non-native (or non-CD16) transmembrane domain; (d) a non-native (or non-CD16) intracellular domain; (e) a non-native (or nonCD16) signaling domain; (f) a non-native stimulatory domain; and (g) transmembrane, signaling, and stimulatory domains that are not originated from CD16, and are originated from a same or different polypeptide. In some embodiments, the non-native transmembrane domain is derived from CD3D, CD3E, CD3G, CD3s, CD4, CD5, CD5a, CD5b, CD27, CD2S, CD40, CDS4, CD166, 4-1BB, OX40, ICOS, ICAM-1, CTLA-4, PD-1, LAG-3, 2B4, BTLA, CD16, IL7, IL12, IL15, KIR2DL4, KIR2DS1, NKp30, NKp44, NKp46, NKG2C, NKG2D, or T cell receptor (TCR) polypeptide. In some embodiments, the non-native stimulatory domain is derived from CD27, CD2S, 4-1BB, OX40, ICOS, PD-1, LAG-3, 2B4, BTLA, DAPlO, DAP12, CTLA-4, or NKG2D polypeptide. In some other embodiments, the non-native signaling domain is derived from CD3s, 2B4, DAPlO, DAP12, DNAM1, CD137 (41BB), IL21, IL7, IL12, IL15, NKp30, NKp44, NKp46, NKG2C, or NKG2D polypeptide. In some particular embodiments of a hnCD16 variant, the non-native transmembrane domain is derived from NKG2D, the non-native stimulatory domain is derived from 2B4, and the non-native signaling domain is derived from CD3s. In some embodiments, a gene product of interest comprises a high affinity cleavable CD16 (hnCD16) or a variant thereof. In some embodiments, a high affinity cleavable CD16 or a variant thereof comprises at least F176V. In some embodiments, a high affinity cleavable CD16 or a variant thereof does not comprise an S197P amino acid substitution.
As used herein, the term “IL-15/IL15RA” or “Interleukin-15” (IL-15) refers to a cytokine with structural similarity to Interleukin-2 (IL-2). Like IL-2, IL-15 binds to and signals through a complex composed of IL-2/IL-15 receptor beta chain (CD122) and the common gamma chain (gamma-C, CD132). IL-15 is secreted by mononuclear phagocytes (and some other cells) following infection by virus(es). This cytokine induces cell proliferation of natural killer cells. IL-15 Receptor alpha (IL15RA) specifically binds IL-15 with very high affinity, and is capable of binding IL-15 independently of other subunits (see e.g., Mishra et al., Molecular pathways: Interleukin-15 signaling in health and in cancer, Clinical Cancer Research, 2014). It is suggested that this property allows IL-15 to be produced by one cell, endocytosed by another cell, and then presented to a third party cell. IL15RA is reported to enhance cell proliferation and expression of apoptosis inhibitor BCL2L1/BCL2-XL and BCL2. Exemplary sequences of IL-15 are provided in NG_029605.2, and exemplary sequences of IL-15RA are provided in NM_002189.4. In some embodiments, the IL-15R variant is a constitutively active IL-15R variant. In some embodiments, the constitutively active IL-15R variant is a fusion between IL-15R and an IL-15R agonist, e.g., an IL-15 protein or IL-15R-binding fragment thereof. In some embodiments, the IL-15R agonist is IL-15, or an IL-15R-binding variant thereof. Exemplary suitable IL-15R variants include, without limitation, those described, e.g., in Mortier E et al, 2006; The Journal of Biological Chemistry 2006 281: 1612-1619; or in Bessard-A et al., Mol Cancer Ther. 2009 September; 8(9):2736-45, the entire contents of each of which are incorporated by reference herein. In some embodiments, membrane bound trans-presentation of IL-15 is a more potent activation pathway than soluble IL-15 (see e.g., Imamura et al., Autonomous growth and increased cytotoxicity of natural killer cells expressing membrane-bound interleukin-15, Blood, 2014). In some embodiments, IL-15R expression comprises: IL15 and IL15Ra expression using a self-cleaving peptide; a fusion protein of IL15 and IL15Ra; an IL15/IL15Ra fusion protein with intracellular domain of IL15Ra truncated; a fusion protein of IL15 and membrane bound Sushi domain of IL15Ra; a fusion protein of IL15 and IL15Rβ; a fusion protein of IL15 and common receptor γC, wherein the common receptor γC is native or modified; and/or a homodimer of IL15Rβ.
As used herein, the term “IL-12” refers to interleukin-12, a cytokine that acts on T and natural killer cells. In some embodiments, a genetically engineered stem cell and/or progeny cell comprises a genetic modification that leads to expression of one or more of an interleukin 12 (IL12) pathway agonist, e.g., IL-12, interleukin 12 receptor (IL-12R) or a variant thereof (e.g., a constitutively active variant of IL-12R, e.g., an IL-12R fused to an IL-12R agonist (IL-12RA).
In some embodiments, the gene product of interest comprises a protein or polypeptide whose expression within a cell, e.g., a cell modified as described herein, enables the cell to inhibit or evade immune rejection after transplant or engraftment into a subject. In some embodiments, the gene product of interest is HLA-E, HLA-G, CTL4, CD47, or an associated ligand.
In some embodiments, the gene product of interest is a T cell receptor (TCR) or an antigen-binding fragment thereof, e.g., a recombinant TCR. In some embodiments, the recombinant TCR can bind to an antigen of interest, e.g., an antigen selected from, but not limited to, CD279, CD2, CD95, CD152, CD223CD272, TIM3, KIR, A2aR, SIRPa, CD200, CD200R, CD300, LPA5, NY-ESO, PD1, PDL1, or MAGE-A3/A6. In some embodiments, the TCR or antigen-binding fragment thereof can bind to a viral antigen, e.g., an antigen from hepatitis A, hepatitis B, hepatitis C (HCV), human papilloma virus (HPV) (e.g., HPV-16 (such as HPV-16 E6 or HPV-16 E7), HPV-18, HPV-31, HPV-33, or HPV-35), Epstein-Barr virus (EBV), human herpes virus 8 (HHV-8), human T-cell leukemia virus01 (HTLV-1), human T-cell leukemia virus-2 (HTLV-2) or a cytomegalovirus (CMV).
In some embodiments, the gene product of interest comprises a single-chain variable fragment that can bind to CD47, PD1, CTLA4, CD28, OX40, 4-1BB, and ligands thereof.
As used herein, the term “HLA-G” refers to the HLA non-classical class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. HLA-G is a ligand for NK cell inhibitory receptor KIR2DL4, and therefore expression of this HLA by the trophoblast defends it against NK cell-mediated death. See e.g., Favier et al., Tolerogenic Function of Dimeric Forms of HLA-G Recombinant Proteins: A Comparative Study In Vivo PLOS One 2011, the entire contents of which are incorporated herein by reference. An exemplary sequence of HLA-G is set forth as NG_029039.1.
As used herein, the term “HLA-E” refers to the HLA class I histocompatibility antigen, alpha chain E, also sometimes referred to as MHC class I antigen E. The HLA-E protein in humans is encoded by the HLA-E gene. The human HLA-E is a non-classical MHC class I molecule that is characterized by a limited polymorphism and a lower cell surface expression than its classical paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-E binds a restricted subset of peptides derived from the leader peptides of other class I molecules. HLA-E expressing cells escape allogeneic responses and lysis by NK cells. See e.g., Geornalusse-G et al., Nature Biotechnology 2017 35(8), the entire contents of which are incorporated herein by reference. Exemplary sequences of the HLA-E protein are provided in NM_005516.6.
As used herein, the term “CD47,” also sometimes referred to as “integrin associated protein” (IAP), refers to a transmembrane protein that in humans is encoded by the CD47 gene. CD47 belongs to the immunoglobulin superfamily, partners with membrane integrins, and also binds the ligands thrombospondin-1 (TSP-1) and signal-regulatory protein alpha (SIRPα). CD47 acts as a signal to macrophages that allows CD47-expressing cells to escape macrophage attack. See, e.g., Deuse-T, et al., Nature Biotechnology 2019 37: 252-258, the entire contents of which are incorporated herein by reference.
In some embodiments, a gene product of interest comprises a chimeric switch receptor (see e.g., WO2018094244A1—TGFBeta Signal Converter; Ankri et al., Human T cells Engineered to express a programmed death 1/28 costimulatory retargeting molecule display enhanced antitumor activity, The Journal of Immunology, Oct. 15, 2013, 191; Roth et al., Pooled knockin targeting for genome engineering of cellular immunotherapies, Cell. 2020 Apr. 30; 181(3):728-744.e21; and Boyerinas et al., A Novel TGF-β2/Interleukin Receptor Signal Conversion Platform That Protects CAR/TCR T Cells from TGF-β2-Mediated Immune Suppression and Induces T Cell Supportive Signaling Networks, Blood, 2017). In some embodiments, chimeric switch receptors are engineered cell-surface receptors comprising an extracellular domain from an endogenous cell-surface receptor and a heterologous intracellular signaling domain, such that ligand recognition by the extracellular domain results in activation of a different signaling cascade than that activated by the wild type form of the cell-surface receptor. In some embodiments, a chimeric switch receptor comprises an extracellular domain of an inhibitory cell-surface receptor fused to an intracellular domain that leads to the transmission of an activating signal rather than the inhibitory signal normally transduced by the inhibitory cell-surface receptor. In some embodiments, extracellular domains derived from cell-surface receptors known to inhibit immune effector cell activation can be fused to activating intracellular domains. In such an embodiment, engagement of the corresponding ligand may then activate signaling cascades that increase, rather than inhibit, the activation of the immune effector cell. For example, in some embodiments, a gene product of interest is a PD1-CD28 switch receptor, wherein the extracellular domain of PD1 is fused to the intracellular signaling domain of CD28 (See e.g.. Liu et al., Cancer Res 76:6 (2016), 1578-1590 and Moon et al., Molecular Therapy 22 (2014), S201). In some embodiments, encoding gene product of interest is or comprises the extracellular domain of CD200R and the intracellular signaling domain of CD28 (See Oda et al., Blood 130:22 (2017), 2410-2419).
In some embodiments, a gene product of interest is a reporter gene (e.g., GFP, mCherry, etc.). In some embodiments, a reporter gene is utilized to confirm the suitability of a knock-in cassette's expression capacity. In certain embodiments, a gene product of interest may be a colored or fluorescent protein such as: blue/UV proteins, e.g. TagBFP, mTagBFP2, Azurite, EBFP2, mKalamal, Sirius, Sapphire, T-Sapphire; cyan proteins, e.g. ECFP, Cerulean, SCFP3A, mTurquoise, mTurquoise2, monomeric Midoriishi-Cyan, TagCFP, mTFPl; green proteins, e.g. EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, m Wasabi, Clover, mNeonGreen; yellow proteins, e.g. EYFP, Citrine, Venus, SYFP2, TagYFP; orange proteins, e.g. Monomeric Kusabira-Orange, mKOK, mK02, mOrange, mOrange2; red proteins, e.g. mRaspberry, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mRuby2; far-red proteins, e.g. mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP; near-IR proteins, e.g. TagRFP657, IFPl.4, iRFP; long stokes shift proteins, e.g. mKeima Red, LSS-mKatel, LSS-mKate2, mBeRFP; photoactivatible proteins, e.g. PA-GFP, PAmCherryl, PATagRFP; photoconvertible proteins, e.g. Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), mEos3.2 (green), mEos3.2 (red), PSmOrange, PSmOrange, photoswitchable proteins, e.g. Dronpa, and combinations thereof.
In some embodiments, a gene of interest provided herein can optionally include a sequence encoding a destabilizing domain (“a destabilizing sequence”) for temporal and/or spatial control of protein expression. Non-limiting examples of destabilizing sequences include sequences encoding a FK506 sequence, a dihydrofolate reductase (DHFR) sequence, or other exemplary destabilizing sequences.
In the absence of a stabilizing ligand, a protein sequence operatively linked to a destabilizing sequence is degraded by ubiquitination. In contrast, in the presence of a stabilizing ligand, protein degradation is inhibited, thereby allowing the protein sequence operatively linked to the destabilizing sequence to be actively expressed. As a positive control for stabilization of protein expression, protein expression can be detected by conventional means, including enzymatic, radiographic, colorimetric, fluorescence, or other spectrographic assays; fluorescent activating cell sorting (FACS) assays; immunological assays (e.g., enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry).
Additional examples of destabilizing sequences are known in the art. In some embodiments, the destabilizing sequence is a FK506- and rapamycin-binding protein (FKBP12) sequence, and the stabilizing ligand is Shield-1 (Shld1) (Banaszynski et al. (2012) Cell 126(5): 995-1004, which is incorporated in its entirety herein by reference). In some embodiments, a destabilizing sequence is a DHFR sequence, and a stabilizing ligand is trimethoprim (TMP) (Iwamoto et al. (2010) Chem Biol 17:981-988, which is incorporated in its entirety herein by reference). In some embodiments, a destabilizing domain is small molecule-assisted shutoff (SMASh), where a constitutive degron with a protease and its corresponding cleavage site derived from hepatitis C virus are combined. In some embodiments, a destabilizing domain comprises a HaloTag system, dTag system, and/or nanobody (see e.g., Luh et al., Prey for the proteasome: targeted protein degradation—a medicinal chemist's perspective; Angewandte Chemie, 2020).
In some embodiments, a destabilizing sequence can be used to temporally control a cell modified as described herein.
In some embodiments, a gene product of interest may be a suicide gene, (see e.g., Zarogoulidis et al., Suicide Gene Therapy for Cancer—Current Strategies; J Genet Syndr Gene Ther. 2013). In some embodiments, a suicide gene can use a gene-directed enzyme prodrug therapy (GDEPT) approach, a dimerization inducing approach, and/or therapeutic monoclonal antibody mediated approach. In some embodiments, a suicide gene is biologically inert, has an adequate bio-availability profile, an adequate bio-distribution profile, and can be characterized by intrinsic acceptable and/or absence of toxicity. In some embodiments, a suicide gene codes for a protein able to convert, at a cellular level, a non-toxic prodrug into a toxic product. In some embodiments, a suicide gene may improve the safety profile of a cell described herein (see e.g., Greco et al., Improving the safety of cell therapy with the TK-suicide gene; Front Pharmacology. 2015; Jones et al., Improving the safety of cell therapy products by suicide gene transfer; Frontiers Pharmacology, 2014). In some embodiments, a suicide gene is a herpes simplex virus thymidine kinase (HSV-TK). In some embodiments, a suicide gene is a cytosine deaminase (CD). In some embodiments, a suicide gene is an apoptotic gene (e.g., a caspase). In some embodiments, a suicide gene is dimerization inducing, e.g., comprising an inducible FAS (iFAS) or inducible Caspase9 (iCasp9)/AP1903 system. In some embodiments, a suicide gene is a CD20 antigen, and cells expressing such an antigen can be eliminated by clinical-grade anti-CD20 antibody administration. In some embodiments, a suicide gene is a truncated human EGFR polypeptide (huEGFRt) which confers sensitivity to a pharmaceutical-grade anti-EGFR monoclonal antibody, e.g., cetuximab. In some embodiments a suicide gene is a c-myc tag, which confers sensitivity to pharmaceutical-grade anti-cmyc antibodies.
In some embodiments, a gene product of interest may be a safety switch signal. In cell therapy, a safety switch can be used to stop proliferation of the genetically modified cells when their presence in the patient is not desired, for example, if the cells do not function properly, if planned therapeutic interventions change, or if the therapeutic goal has been achieved. In some embodiments, a safety switch may, for example, be a so-called suicide gene, or suicide switch, which upon administration of a pharmaceutical compound to the patient, will be activated or inactivated such that the cells enter apoptosis. Suicide genes, sometimes called suicide switches or safety switches can be triggered or activated by a cellular event, environmental event or chemical agent resulting in a cellular response by cells that have the suicide gene incorporated in their genome. In some embodiments, activation of a safety switch induces cellular apoptosis. In some embodiments, activation of the safety switch inhibits growth of cells incorporated with the safety switch. In some embodiments, a suicide switch may encode an enzyme not found in humans (e.g., a bacterial or viral enzyme) that converts a harmless substance into a toxic metabolite in the human cell. Examples of suicide switch include, without limitation, genes for thymidine kinases, cytosine deaminases, intracellular antibodies, telomerases, toxins, caspases (e.g., iCaspase9) and HSV-TK, and DNases. In some embodiments, the suicide gene may be a thymidine kinase (TK) gene from the Herpes Simplex Virus (HSV) and the suicide TK gene becomes toxic to the cell upon administration of ganciclovir, valganciclovir, famciclovir, or the like to the patient.
In some embodiments, a safety switch may be a rapamycin-inducible human Caspase 9-based (RapaCasp9) cellular suicide switch in which a truncated caspase 9 gene, which has its CARD domain removed, is linked after either the FRB (FKBP12-rapamycin binding) domain of mTOR, or FKBP12 (FK506-binding protein 12). Addition of the drug rapamycin enables heterodimerization of FRB and FKBP12 which subsequently causes homodimerization of truncated caspase 9 and induction of apoptosis. In some embodiments, using a two construct and/or biallelic approach as described herein, FRB and FKBP12 are separated onto different alleles by incorporating two donor constructs, one with one or more transgenes plus FRB, the other with one or more transgenes plus FKBP12. When referring to a safety switch in this application, it should be interpreted to include all components necessary for the function of the safety switch (e.g., FRB domain and FKBP12 domain and truncated caspase 9 gene are all components of, and make up, the safety switch).
In some embodiments, a coding sequence for a single gene product of interest may be included in a knock-in cassette. In some embodiments, coding sequences for two gene products of interest may be included in a single knock-in cassette; in some embodiments, this may be referred to as a bicistronic or multicistronic construct. In some embodiments, coding sequences for more than two gene products of interest may be included in a single knock-in cassette; in some embodiments, this may be referred to as a multicistronic construct. In some embodiments, when more than one coding sequence for more than one gene product of interest is included in a knock-in cassette, these sequences may have a linker sequence connecting them. Linker sequences are generally known in the art, an exemplary linker sequence is identified in SEQ ID NO: 164. In some embodiments, where more than one coding sequence for more than one gene product of interest is included in a knock-in cassette, these sequences may be connected by a linker sequence, an IRES, and/or 2A element.
In some embodiments, an oligonucleotide encoding a gene product of interest comprises or consists of the sequence of any one of SEQ ID NOs: 161, 162, or 164-182. In some embodiments, a gene product of interest comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to any one of SEQ ID NOs: 161, 162, or 164-182.
In some embodiments, a gene product of interest comprises or consists of an amino acid sequence of any one of SEQ ID NOs: 161, 164, or 183-200. In some embodiments, a gene product of interest comprises or consists of an amino acid sequence that is at least 85%, 90%, 95%, 98% or 99% identical to any one of SEQ ID NOs: 161, 164, or 183-200.
AAV Capsids
In some embodiments, the present disclosure provides one or more polynucleotide constructs (e.g., knock-in cassettes) packaged into an AAV capsid. In some embodiments, an AAV capsid is from or derived from an AAV capsid of an AAV2, 3, 4, 5, 6, 7, 8, 9, or 10 serotype, or one or more hybrids thereof. In some embodiments, an AAV capsid is from an AAV ancestral serotype. In some embodiments, an AAV capsid is an ancestral (Anc) AAV capsid. An Anc capsid is created from a construct sequence that is constructed using evolutionary probabilities and evolutionary modeling to determine a probable ancestral sequence. In some embodiments, an AAV capsid has been modified in a manner known in the art (see e.g., Bining and Srivastava, Capsid modifications for targeting and improving the efficacy of AAV vectors, Mol Ther Methods Clin Dev. 2019)
In some embodiments, as provided herein, any combination of AAV capsids and AAV constructs (e.g., comprising AAV ITRs) may be used in recombinant AAV (rAAV) particles of the present disclosure. In some embodiments, an AAV ITR is from or derived from an AAV ITR of AAV2, 3, 4, 5, 6, 7, 8, 9, or 10. For example, wild-type or variant AA6 ITRs and AAV6 capsid, wild-type or variant AAV2 ITRs and AAV6 capsid, etc. In some embodiments of the present disclosure, an AAV particle is wholly comprised of AAV6 components (e.g., capsid and ITRs are AAV6 serotype). In some embodiments, an AAV particle is an AAV6/2, AAV6/8 or AAV6/9 particle (e.g., an AAV2, AAV8 or AAV9 capsid with an AAV construct having AAV6 ITRs).
Exemplary AAV Constructs
In some embodiments, a donor template is included within an AAV construct. In some embodiments, an AAV construct sequence comprises or consists of the sequence of any one of SEQ ID NO: 201-204. In some embodiments, an exemplary AAV construct is represented by SEQ ID NO: 201. In some embodiments, an exemplary AAV construct is represented by SEQ ID NO: 202. In some embodiments, an exemplary AAV construct is represented by SEQ ID NO: 203. In some embodiments, an exemplary AAV construct is represented by SEQ ID NO: 204. In some embodiments, an exemplary AAV construct is at least 80%, 85%, 90%, 95%, 98%, or 99% identical to a sequence represented by SEQ ID NO: 201-204.
Exemplary Donor Template Sequences
In some embodiments, a donor template comprises in 5′ to 3′ order, a target sequence 5′ homology arm (which optionally comprises an optimized sequence that is not a wild type sequence), a second regulatory element that enables expression of a cargo sequence as a separate translational product (e.g., an IRES sequence and/or a 2A element), a cargo sequence (e.g., a gene product of interest), optionally a second regulatory element that enables expression of a cargo sequence as a separate translational product (e.g., an IRES sequence and/or a 2A element), optionally a second cargo sequence (e.g., a gene product of interest), optionally a 3′ UTR, a poly adenylation signal (e.g., a BGHpA signal), and a target sequence 3′ homology arm (which optionally comprises an optimized sequence that is not a wild type sequence).
In some embodiments, a donor template comprises or consists of the sequence of any one of SEQ ID NOs: 38-57 and 205-218. In some embodiments, a donor template comprises or consists of a sequence that is at least 85%, 90%, 95%, 98% or 99% identical to any one of SEQ ID NOs: 38-57 and 205-218.
Any nuclease that causes a break within an endogenous coding sequence of an essential gene of the cell can be used in the methods of the present disclosure. In some embodiments the nuclease is a DNA nuclease. In some embodiments the nuclease causes a single-strand break (SSB) within an endogenous coding sequence of an essential gene of the cell, e.g., in a “prime editing” system. In some embodiments the nuclease causes a double-strand break (DSB) within an endogenous coding sequence of an essential gene of the cell. In some embodiments the double-strand break is caused by a single nuclease. In some embodiments the double-strand break is caused by two nucleases that each cause a single-strand break on opposing strands, e.g., a dual “nickase” system. In some embodiments the nuclease is a CRISPR/Cas nuclease and the method further comprises contacting the cell with one or more guide molecules for the CRISPR/Cas nuclease. Exemplary CRISPR/Cas nucleases and guide molecules are described in more detail herein. It is to be understood that the nuclease (including a nickase) is not limited in any manner and can also be a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, or other nuclease known in the art (or a combination thereof). Methods for designing zinc finger nucleases (ZFNs) are well known in the art, e.g., see Urnov et al., Nature Reviews Genetics 2010; 11:636-640 and Paschon et al., Nat. Commun. 2019; 10(1):1133 and references cited therein. Methods for designing transcription activator-like effector nucleases (TALENs) are well known in the art, e.g., see Joung and Sander, Nat. Rev. Mol. Cell Biol. 2013; 14(1):49-55 and references cited therein. Methods for designing meganucleases are also well known in the art, e.g., see Silva et al., Curr. Gene Ther. 2011; 11(1):11-27 and Redel and Prather, Toxicol. Pathol. 2016; 44(3):428-433.
In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 50%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 55%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 60%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 65%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 70%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 75%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 80%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 85%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 90%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 95%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 96%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 97%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 98%. In some embodiments, a nuclease suitable for methods described herein can have an editing efficiency that is greater than about 99%.
In general, the nuclease can be delivered to the cell as a protein or a nucleic acid encoding the protein, e.g., a DNA molecule or mRNA molecule. The protein or nucleic acid can be combined with other delivery agents, e.g., lipids or polymers in a lipid or polymer nanoparticle and targeting agents such as antibodies or other binding agents with specificity for the cell. The DNA molecule can be a nucleic acid vector, such as a viral genome or circular double-stranded DNA, e.g., a plasmid. Nucleic acid vectors encoding a nuclease can include other coding or non-coding elements. For example, a nuclease can be delivered as part of a viral genome (e.g., in an AAV, adenoviral or lentiviral genome) that includes certain genomic backbone elements (e.g., inverted terminal repeats, in the case of an AAV genome).
A CRISPR/Cas nuclease can be delivered to the cell as a protein or a nucleic acid encoding the protein, e.g., a DNA molecule or mRNA molecule. The guide molecule can be delivered as an RNA molecule or encoded by a DNA molecule. A CRISPR/Cas nuclease can also be delivered with a guide molecule as a ribonucleoprotein (RNP) and introduced into the cell via nucleofection (electroporation).
CRISPR/Cas Nucleases
CRISPR/Cas nucleases according to the present disclosure include, but are not limited to, naturally-occurring Class 2 CRISPR nucleases such as Cas9, and Cpf1 (Cas12a), as well as other Cas12 nucleases and nucleases derived or obtained therefrom. In functional terms, CRISPR/Cas nucleases are defined as those nucleases that: (a) interact with (e.g., complex with) a gRNA; and (b) together with the gRNA, associate with, and optionally cleave or modify, a target region of a DNA that includes (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) an additional sequence referred to as a “protospacer adjacent motif,” or “PAM,” which is described in greater detail below. As the following examples will illustrate, CRISPR/Cas nucleases can be defined, in broad terms, by their PAM specificity and cleavage activity, even though variations may exist between individual CRISPR/Cas nucleases that share the same PAM specificity or cleavage activity. Skilled artisans will appreciate that some aspects of the present disclosure relate to systems and methods that can be implemented using any suitable CRISPR/Cas nuclease having a certain PAM specificity and/or cleavage activity. For this reason, unless otherwise specified, the term CRISPR/Cas nuclease should be understood as a generic term, and not limited to any particular type (e.g., Cas9 vs. Cpf1), species (e.g., S. pyogenes vs. S. aureus) or variation (e.g., full-length vs. truncated or split; naturally-occurring PAM specificity vs. engineered PAM specificity, etc.) of CRISPR/Cas nuclease.
The PAM sequence takes its name from its sequential relationship to the “protospacer” sequence that is complementary to gRNA targeting domains (or “spacers”). Together with protospacer sequences, PAM sequences define target regions or sequences for specific CRISPR/Cas nuclease and gRNA combinations.
Various CRISPR/Cas nucleases may require different sequential relationships between PAMs and protospacers. In general, Cas9s recognize PAM sequences that are 3′ of the protospacer. Cpf1 (Cas12a), on the other hand, generally recognizes PAM sequences that are 5′ of the protospacer.
In addition to recognizing specific sequential orientations of PAMs and protospacers, CRISPR/Cas nucleases can also recognize specific PAM sequences. S. aureus Cas9, for instance, recognizes a PAM sequence of NNGRRT or NNGRRV, wherein the N residues are immediately 3′ of the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes NGG PAM sequences. F. novicida Cpf1 recognizes a TTN PAM sequence. PAM sequences have been identified for a variety of CRISPR/Cas nucleases, and a strategy for identifying novel PAM sequences has been described by Shmakov et al., Molecular Cell 2015; 60:385-397. It should also be noted that engineered CRISPR/Cas nucleases can have PAM specificities that differ from the PAM specificities of reference molecules (for instance, in the case of an engineered CRISPR/Cas nuclease, the reference molecule may be the naturally occurring variant from which the CRISPR/Cas nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to the engineered CRISPR/Cas nuclease).
In addition to their PAM specificity, CRISPR/Cas nucleases can be characterized by their DNA cleavage activity: naturally-occurring CRISPR/Cas nucleases typically form double-strand breaks (DSBs) in target nucleic acids, but engineered variants called “nickases” have been produced that generate only single-strand breaks (SSBs), e.g., those discussed in Ran et al., Cell 2013; 154(6):1380-1389 (“Ran”), or that that do not cut at all.
Cas9
Crystal structures have been determined for S. pyogenes Cas9 (Jinek et al., Science 2014; 343(6176):1247997 (“Jinek 2014”), and for S. aureus Cas9 in complex with a unimolecular guide RNA and a target DNA. See Nishimasu et al., Cell 1024; 156:935-949 (“Nishimasu 2014”); Nishimasu et al., Cell 2015; 162:1113-1126 (“Nishimasu 2015”); and Anders et al., Nature 2014; 513(7519):569-73 (“Anders 2014”).
A naturally occurring Cas9 protein comprises two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe; each of which comprise particular structural and/or functional domains. The REC lobe comprises an arginine-rich bridge helix (BH) domain, and at least one REC domain (e.g., a REC1 domain and, optionally, a REC2 domain). The REC lobe does not share structural similarity with other known proteins, indicating that it is a unique functional domain. While not wishing to be bound by any theory, mutational analyses suggest specific functional roles for the BH and REC domains: the BH domain appears to play a role in gRNA:DNA recognition, while the REC domain is thought to interact with the repeat:anti-repeat duplex of the gRNA and to mediate the formation of the Cas9/gRNA complex.
The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM-interacting (PI) domain. The RuvC domain shares structural similarity to retroviral integrase superfamily members and cleaves the non-complementary (i.e., bottom) strand of the target nucleic acid. It may be formed from two or more split RuvC motifs (such as RuvC I, RuvCII, and RuvCIII in S. pyogenes and S. aureus). The HNH domain, meanwhile, is structurally similar to HNN endonuclease motifs, and cleaves the complementary (i.e., top) strand of the target nucleic acid. The PI domain, as its name suggests, contributes to PAM specificity.
While certain functions of Cas9 are linked to (but not necessarily fully determined by) the specific domains set forth above, these and other functions may be mediated or influenced by other Cas9 domains, or by multiple domains on either lobe. For instance, in S. pyogenes Cas9, as described in Nishimasu 2014, the repeat:antirepeat duplex of the gRNA falls into a groove between the REC and NUC lobes, and nucleotides in the duplex interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem loop structure also interact with amino acids in multiple domains (PI, BH and REC1), as do some nucleotides in the second and third stem loops (RuvC and PI domains).
Cpf1
The crystal structure of Acidaminococcus sp. Cpf1 in complex with crRNA and a dsDNA target including a TTTN PAM sequence has been solved by Yamano et al., Cell. 2016; 165(4):949-962 (“Yamano”). Cpf1, like Cas9, has two lobes: a REC (recognition) lobe, and a NUC (nuclease) lobe. The REC lobe includes REC1 and REC2 domains, which lack similarity to any known protein structures. The NUC lobe, meanwhile, includes three RuvC domains (RuvC-I, -II and -III) and a BH domain. However, in contrast to Cas9, the Cpf1 REC lobe lacks an HNH domain, and includes other domains that also lack similarity to known protein structures: a structurally unique PI domain, three Wedge (WED) domains (WED-I, -II and -III), and a nuclease (Nuc) domain.
While Cas9 and Cpf1 share similarities in structure and function, it should be appreciated that certain Cpf1 activities are mediated by structural domains that are not analogous to any Cas9 domains. For instance, cleavage of the complementary strand of the target DNA appears to be mediated by the Nuc domain, which differs sequentially and spatially from the HNH domain of Cas9. Additionally, the non-targeting portion of Cpf1 gRNA (the handle) adopts a pseudoknot structure, rather than a stem loop structure formed by the repeat:antirepeat duplex in Cas9 gRNAs.
Nuclease Variants
The CRISPR/Cas nucleases described herein have activities and properties that can be useful in a variety of applications, but the skilled artisan will appreciate that CRISPR/Cas nucleases can also be modified in certain instances, to alter cleavage activity, PAM specificity, or other structural or functional features.
Turning first to modifications that alter cleavage activity, mutations that reduce or eliminate the activity of domains within the NUC lobe have been described above. Exemplary mutations that may be made in the RuvC domains, in the Cas9 HNH domain, or in the Cpf1 Nuc domain are described in Ran, Yamano and PCT Publication No. WO 2016/073990A1, the entire contents of each of which are incorporated herein by reference. In general, mutations that reduce or eliminate activity in one of the two nuclease domains result in CRISPR/Cas nucleases with nickase activity, but it should be noted that the type of nickase activity varies depending on which domain is inactivated. As one example, inactivation of a RuvC domain or of a Cas9 HNH domain results in a nickase. Exemplary nickase variants include Cas9 D10A and Cas9 H840A (numbering scheme according to SpCas9 wild-type sequence). Additional suitable nickase variants, including Cas12a variants, will be apparent to the skilled artisan based on the present disclosure and the knowledge in the art. The present disclosure is not limited in this respect. In some embodiments a nickase may be fused to a reverse transcriptase to produce a prime editor (PE), e.g., as described in Anzalone et al., Nature 2019; 576:149-157, the entire contents of which are incorporated herein by reference.
Modifications of PAM specificity relative to naturally occurring Cas9 reference molecules has been described for both S. pyogenes (Kleinstiver et al., Nature 2015; 523(7561):481-5); and S. aureus (Kleinstiver et al., Nat Biotechnol. 2015; 33(12):1293-1298). Modifications that improve the targeting fidelity of Cas9 have also been described (Kleinstiver et al., Nature 2016; 529:490-495). Each of these references is incorporated by reference herein.
CRISPR/Cas nucleases have also been split into two or more parts, as described by Zetsche et al., Nat Biotechnol. 2015; 33(2):139-42, incorporated by reference, and by Fine et al., Sci Rep. 2015; 5:10777, incorporated by reference.
CRISPR/Cas nucleases can be, in certain embodiments, size-optimized or truncated, for instance via one or more deletions that reduce the size of the nuclease while still retaining gRNA association, target and PAM recognition, and cleavage activities. In certain embodiments, RNA guided nucleases are bound, covalently or non-covalently, to another polypeptide, nucleotide, or other structure, optionally by means of a linker. Exemplary bound nucleases and linkers are described by Guilinger et al., Nature Biotech. 2014; 32:577-582, which is incorporated by reference herein.
CRISPR/Cas nucleases also optionally include a tag, such as, but not limited to, a nuclear localization signal, to facilitate movement of CRISPR/Cas nuclease protein into the nucleus. In certain embodiments, the CRISPR/Cas nuclease can incorporate C- and/or N-terminal nuclear localization signals. Nuclear localization sequences are known in the art.
The foregoing list of modifications is intended to be exemplary in nature, and the skilled artisan will appreciate, in view of the instant disclosure, that other modifications may be possible or desirable in certain applications. For brevity, therefore, exemplary systems, methods and compositions of the present disclosure are presented with reference to particular CRISPR/Cas nucleases, but it should be understood that the CRISPR/Cas nucleases used may be modified in ways that do not alter their operating principles. Such modifications are within the scope of the present disclosure.
Exemplary suitable nuclease variants include, but are not limited to, AsCpf1 (AsCas12a) variants comprising an M537R substitution, an H800A substitution, and/or an F870L substitution, or any combination thereof (numbering scheme according to AsCpf1 wild-type sequence). In some embodiments, a nuclease variant is a Cas12a variant, e.g., a Cas12a variant comprising 1, 2, or 3 of the amino acid substitutions selected from M537R, F870L, and H800A. In some embodiments, a Cas12a variant comprises an amino acid sequence having at least about 90%, 95%, or 100% identity to an AsCpf1 sequence described herein.
Other suitable modifications of the AsCpf1 amino acid sequence are known to those of ordinary skill in the art. Some exemplary sequences of wild-type AsCpf1 and AsCpf1 variants are provided below:
Additional suitable nucleases and nuclease variants will be apparent to the skilled artisan based on the present disclosure in view of the knowledge in the art. Exemplary suitable nucleases may include, but are not limited to those provided in Table 5.
Guide RNA (gRNA) Molecules
Guide RNAs (gRNAs) of the present disclosure may be unimolecular (comprising a single RNA molecule, and referred to alternatively as chimeric), or modular (comprising more than one, and typically two, separate RNA molecules, such as a crRNA and a tracrRNA, which are usually associated with one another, for instance by duplexing). gRNAs and their component parts are described throughout the literature, for instance in Briner et al., Molecular Cell 2014; 56(2):333-339 (“Briner”), and in PCT Publication No. WO2016/073990AL.
In bacteria and archaea, type II CRISPR systems generally comprise an CRISPR/Cas nuclease protein such as Cas9, a CRISPR RNA (crRNA) that includes a 5′ region that is complementary to a foreign sequence, and a trans-activating crRNA (tracrRNA) that includes a 5′ region that is complementary to, and forms a duplex with, a 3′ region of the crRNA. While not intending to be bound by any theory, it is thought that this duplex facilitates the formation of—and is necessary for the activity of—the Cas9/gRNA complex. As type II CRISPR systems were adapted for use in gene editing, it was discovered that the crRNA and tracrRNA could be joined into a single unimolecular or chimeric guide RNA, in one non-limiting example, by means of a four nucleotide (e.g., GAAA) “tetraloop” or “linker” sequence bridging complementary regions of the crRNA (at its 3′ end) and the tracrRNA (at its 5′ end). See Mali et al., Science 2013; 339(6121):823-826 (“Mali”); Jiang et al., Nat Biotechnol. 2013; 31(3):233-239 (“Jiang”); and Jinek et al., Science 2012; 337(6096):816-821 (“Jinek 2012”).
Guide RNAs, whether unimolecular or modular, include a “targeting domain” that is fully or partially complementary to a target domain within a target sequence, such as a DNA sequence in the genome of a cell where editing is desired. Targeting domains are referred to by various names in the literature, including without limitation “guide sequences” (Hsu et al., Nat Biotechnol. 2013; 31(9):827-832, (“Hsu”)), “complementarity regions” (PCT Publication No. WO2016/073990A1), “spacers” (Briner) and generically as “crRNAs” (Jiang). Irrespective of the names they are given, targeting domains are typically 10-30 nucleotides in length, and in certain embodiments are 16-24 nucleotides in length (for instance, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and are at or near the 5′ terminus of in the case of a Cas9 gRNA, and at or near the 3′ terminus in the case of a Cpf1 gRNA.
In addition to the targeting domains, gRNAs typically (but not necessarily, as discussed below) include a plurality of domains that may influence the formation or activity of gRNA/Cas9 complexes. For instance, as mentioned above, the duplexed structure formed by first and secondary complementarity domains of a gRNA (also referred to as a repeat:anti-repeat duplex) interacts with the recognition (REC) lobe of Cas9 and can mediate the formation of Cas9/gRNA complexes. See Nishimasu 2014 and 2015. It should be noted that the first and/or second complementarity domains may contain one or more poly-A tracts, which can be recognized by RNA polymerases as a termination signal. The sequence of the first and second complementarity domains are, therefore, optionally modified to eliminate these tracts and promote the complete in vitro transcription of gRNAs, for instance through the use of A-G swaps as described in Briner, or A-U swaps. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.
Along with the first and second complementarity domains, Cas9 gRNAs typically include two or more additional duplexed regions that are involved in nuclease activity in vivo but not necessarily in vitro. See Nishimasu 2015. A first stem-loop one near the 3′ portion of the second complementarity domain is referred to variously as the “proximal domain,” (PCT Publication No. WO2016/073990A1) “stem loop 1” (Nishimasu 2014 and 2015) and the “nexus” (Briner). One or more additional stem loop structures are generally present near the 3′ end of the gRNA, with the number varying by species: S. pyogenes gRNAs typically include two 3′ stem loops (for a total of four stem loop structures including the repeat:anti-repeat duplex), while S. aureus and other species have only one (for a total of three stem loop structures). A description of conserved stem loop structures (and gRNA structures more generally) organized by species is provided in Briner.
While the foregoing description has focused on gRNAs for use with Cas9, it should be appreciated that other CRISPR/Cas nucleases have been (or may in the future be) discovered or invented which utilize gRNAs that differ in some ways from those described to this point. For instance, Cpf1 (“CRISPR from Prevotella and Franciscella 1”) which is also called Cas12a is a CRISPR/Cas nuclease that does not require a tracrRNA to function (see Zetsche et al., Cell 2015; 163:759-771 (“Zetsche I”)). A gRNA for use in a Cpf1 genome editing system generally includes a targeting domain and a complementarity domain (alternately referred to as a “handle”). It should also be noted that, in gRNAs for use with Cpf1, the targeting domain is usually present at or near the 3′ end, rather than the 5′ end as described above in connection with Cas9 gRNAs (the handle is at or near the 5′ end of a Cpf1 gRNA).
Those of skill in the art will appreciate, however, that although structural differences may exist between gRNAs from different prokaryotic species, or between Cpf1 and Cas9 gRNAs, the principles by which gRNAs operate are generally consistent. Because of this consistency of operation, gRNAs can be defined, in broad terms, by their targeting domain sequences, and skilled artisans will appreciate that a given targeting domain sequence can be incorporated in any suitable gRNA, including a unimolecular or chimeric gRNA, or a gRNA that includes one or more chemical modifications and/or sequential modifications (substitutions, additional nucleotides, truncations, etc.). Thus, for economy of presentation in this disclosure, gRNAs may be described solely in terms of their targeting domain sequences.
More generally, skilled artisans will appreciate that some aspects of the present disclosure relate to systems, methods and compositions that can be implemented using multiple CRISPR/Cas nucleases. For this reason, unless otherwise specified, the term gRNA should be understood to encompass any suitable gRNA that can be used with any CRISPR/Cas nuclease, and not only those gRNAs that are compatible with a particular species of Cas9 or Cpf1. By way of illustration, the term gRNA can, in certain embodiments, include a gRNA for use with any CRISPR/Cas nuclease occurring in a Class 2 CRISPR system, such as a type II or type V or CRISPR system, or an CRISPR/Cas nuclease derived or adapted therefrom.
In some embodiments a method or system of the present disclosure may use more than one gRNA. In some embodiments, two or more gRNAs may be used to create two or more double strand breaks in the genome of a cell. In some embodiments, a multiplexed editing strategy may be used that targets two or more essential genes at the same time with two or more knock-in cassettes. In some such embodiments, the two or more knock-in cassettes may comprise different exogenous cargo sequences, e.g., different knock-in cassettes may encode different gene products of interest and thus the edited cells will express a plurality of gene products of interest from different knock-in cassettes targeted to different loci.
In some embodiments using more than one gRNA, a double-strand break may be caused by a dual-gRNA paired “nickase” strategy. In some embodiments for selecting gRNAs, including the determination for which gRNAs can be used for the dual-gRNA paired “nickase” strategy, gRNA pairs should be oriented on the DNA such that PAMs are facing out and cutting with the D10A Cas9 nickase will result in 5′ overhangs.
In some embodiments, a method or system of the present disclosure may use a prime editing gRNA (pegRNA) in conjunction with a prime editor (PE). As is well known in the art, a pegRNA is substantially larger than standard gRNAs, e.g., in some embodiments longer than 50, 100, 150 or 250 nucleotides, e.g., as described in Anzalone et al., Nature 2019; 576:149-157, the entire contents of which are incorporated herein by reference. The pegRNA is a gRNA with a primer binding sequence (PBS) and a donor template containing the desired RNA sequence added at one of the termini, e.g., the 3′ end. The PE:pegRNA complex binds to the target DNA, and the nickase domain of the prime editor nicks only one strand, generating a flap. The PBS, located on the pegRNA, binds to the DNA flap and the edited RNA sequence is reverse transcribed using the reverse transcriptase domain of the prime editor. The edited strand is incorporated into the DNA at the end of the nicked flap, and the target DNA is repaired with the new reverse transcribed DNA. The original DNA segment is removed by a cellular endonuclease. This leaves one strand edited, and one strand unedited. In the newest PE systems, e.g., PE3 and PE3b, the unedited strand can be corrected to match the newly edited strand by using an additional standard gRNA. In this case, the unedited strand is nicked by a nickase and the newly edited strand is used as a template to repair the nick, thus completing the edit.
gRNA Design
Methods for selection and validation of target sequences as well as off-target analyses have been described previously, e.g., in Mali; Hsu; Fu et al., Nat Biotechnol 2014; 32(3):279-84, Heigwer et al., Nat methods 2014; 11(2):122-3; Bae et al., Bioinformatics 2014; 30(10):1473-5; and Xiao et al. Bioinformatics 2014; 30(8):1180-1182. As a non-limiting example, gRNA design may involve the use of a software tool to optimize the choice of potential target sequences corresponding to a user's target sequence, e.g., to minimize total off-target activity across the genome. While off-target activity is not limited to cleavage, the cleavage efficiency at each off-target sequence can be predicted, e.g., using an experimentally-derived weighting scheme. These and other guide selection methods are described in detail in PCT Publication No. WO2016/073990A1.
For example, methods for selection and validation of target sequences as well as off-target analyses can be performed using cas-offinder (Bae et al., Bioinformatics 2014; 30:1473-5). Cas-offinder is a tool that can quickly identify all sequences in a genome that have up to a specified number of mismatches to a guide sequence.
As another example, methods for scoring how likely a given sequence is to be an off-target (e.g., once candidate target sequences are identified) can be performed. An exemplary score includes a Cutting Frequency Determination (CFD) score, as described by Doench et al., Nat Biotechnol. 2016; 34:184-91.
gRNA Modifications
In certain embodiments, gRNAs as used herein may be modified or unmodified gRNAs. In certain embodiments, a gRNA may include one or more modifications. In certain embodiments, the one or more modifications may include a phosphorothioate linkage modification, a phosphorodithioate (PS2) linkage modification, a 2′-O-methyl modification, or combinations thereof. In certain embodiments, the one or more modifications may be at the 5′ end of the gRNA, at the 3′ end of the gRNA, or combinations thereof.
In certain embodiments, a gRNA modification may comprise one or more phosphorodithioate (PS2) linkage modifications.
In some embodiments, a gRNA used herein includes one or more or a stretch of deoxyribonucleic acid (DNA) bases, also referred to herein as a “DNA extension.” In some embodiments, a gRNA used herein includes a DNA extension at the 5′ end of the gRNA, the 3′ end of the gRNA, or a combination thereof. In certain embodiments, the DNA extension may be 1,2, 3,4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DNA bases long. For example, in certain embodiments, the DNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA bases long. In certain embodiments, the DNA extension may include one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In certain embodiments, the DNA extension includes the same DNA bases. For example, the DNA extension may include a stretch of adenine (A) bases. In certain embodiments, the DNA extension may include a stretch of thymine (T) bases. In certain embodiments, the DNA extension includes a combination of different DNA bases.
Exemplary suitable 5′ extensions for Cpf1 guide RNAs are provided in Table 6 below:
In certain embodiments, a gRNA used herein includes a DNA extension as well as a chemical modification, e.g., one or more phosphorothioate linkage modifications, one or more phosphorodithioate (PS2) linkage modifications, one or more 2′-O-methyl modifications, or one or more additional suitable chemical gRNA modification disclosed herein, or combinations thereof. In certain embodiments, the one or more modifications may be at the 5′ end of the gRNA, at the 3′ end of the gRNA, or combinations thereof.
Without wishing to be bound by theory, it is contemplated that any DNA extension may be used with any gRNA disclosed herein, so long as it does not hybridize to the target nucleic acid being targeted by the gRNA and it also exhibits an increase in editing at the target nucleic acid site relative to a gRNA which does not include such a DNA extension.
In some embodiments, a gRNA used herein includes one or more or a stretch of ribonucleic acid (RNA) bases, also referred to herein as an “RNA extension.” In some embodiments, a gRNA used herein includes an RNA extension at the 5′ end of the gRNA, the 3′ end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA bases long. For example, in certain embodiments, the RNA extension may be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases long. In certain embodiments, the RNA extension may include one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC), or uracil (rU), in which the “r” represents RNA, 2′-hydroxy. In certain embodiments, the RNA extension includes the same RNA bases. For example, the RNA extension may include a stretch of adenine (rA) bases. In certain embodiments, the RNA extension includes a combination of different RNA bases. In certain embodiments, a gRNA uised herein includes an RNA extension as well as one or more phosphorothioate linkage modifications, one or more phosphorodithioate (PS2) linkage modifications, one or more 2′-O-methyl modifications, one or more additional suitable gRNA modification, e.g., chemical modification, disclosed herein, or combinations thereof. In certain embodiments, the one or more modifications may be at the 5′ end of the gRNA, at the 3′ end of the gRNA, or combinations thereof. In certain embodiments, a gRNA including a RNA extension may comprise a sequence set forth herein.
It is contemplated that gRNAs used herein may also include an RNA extension and a DNA extension. In certain embodiments, the RNA extension and DNA extension may both be at the 5′ end of the gRNA, the 3′ end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension is at the 5′ end of the gRNA and the DNA extension is at the 3′ end of the gRNA. In certain embodiments, the RNA extension is at the 3′ end of the gRNA and the DNA extension is at the 5′ end of the gRNA.
In some embodiments, a gRNA which includes a modification, e.g., a DNA extension at the 5′ end and/or a chemical modification as disclosed herein, is complexed with a CRISPR/Cas nuclease, e.g., an AsCpf1 nuclease, to form an RNP, which is then employed to edit a target cell, e.g., a pluripotent stem cell or a progeny thereof.
Certain exemplary modifications discussed in this section can be included at any position within a gRNA sequence including, without limitation at or near the 5′ end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5′ end) and/or at or near the 3′ end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3′ end). In some cases, modifications are positioned within functional motifs, such as the repeat-anti-repeat duplex of a Cas9 gRNA, a stem loop structure of a Cas9 or Cpf1 gRNA, and/or a targeting domain of a gRNA.
As one example, the 5′ end of a gRNA can include a eukaryotic mRNA cap structure or cap analog (e.g., a G(5′)ppp(5′)G cap analog, a m7G(5′)ppp(5′)G cap analog, or a 3′-O-Me-m7G(5′)ppp(5′)G anti reverse cap analog (ARCA)), as shown below:
The cap or cap analog can be included during either chemical or enzymatic synthesis of the gRNA.
Along similar lines, the 5′ end of the gRNA can lack a 5′ triphosphate group. For instance, in vitro transcribed gRNAs can be phosphatase-treated (e.g., using calf intestinal alkaline phosphatase) to remove a 5′ triphosphate group.
Another common modification involves the addition, at the 3′ end of a gRNA, of a plurality (e.g., 1-10, 10-20, or 25-200) of adenine (A) residues referred to as a polyA tract. The polyA tract can be added to a gRNA during chemical or enzymatic synthesis, using a polyadenosine polymerase (e.g., E. coli Poly(A)Polymerase).
Guide RNAs can be modified at a 3′ terminal U ribose. For example, the two terminal hydroxyl groups of the U ribose can be oxidized to aldehyde groups and a concomitant opening of the ribose ring to afford a modified nucleoside as shown below:
wherein “U” can be an unmodified or modified uridine.
The 3′ terminal U ribose can be modified with a 2′3′ cyclic phosphate as shown below:
wherein “U” can be an unmodified or modified uridine.
Guide RNAs can contain 3′ nucleotides that can be stabilized against degradation, e.g., by incorporating one or more of the modified nucleotides described herein. In certain embodiments, uridines can be replaced with modified uridines, e.g., 5-(2-amino)propyl uridine, and 5-bromo uridine, or with any of the modified uridines described herein; adenosines and guanosines can be replaced with modified adenosines and guanosines, e.g., with modifications at the 8-position, e.g., 8-bromo guanosine, or with any of the modified adenosines or guanosines described herein.
In certain embodiments, sugar-modified ribonucleotides can be incorporated into a gRNA, e.g., wherein the 2′ OH-group is replaced by a group selected from H, —OR, —R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), halo, —SH, —SR (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar), amino (wherein amino can be, e.g., NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); or cyano (—CN). In certain embodiments, the phosphate backbone can be modified as described herein, e.g., with a phosphothioate (PhTx) group. In certain embodiments, one or more of the nucleotides of the gRNA can each independently be a modified or unmodified nucleotide including, but not limited to 2′-sugar modified, such as, 2′-O-methyl, 2′-O-methoxyethyl, or 2′-Fluoro modified including, e.g., 2′-F or 2′-O-methyl, adenosine (A), 2′-F or 2′-O-methyl, cytidine (C), 2′-F or 2′-O-methyl, uridine (U), 2′-F or 2′-O-methyl, thymidine (T), 2′-F or 2′-O-methyl, guanosine (G), 2′-O-methoxyethyl-5-methyluridine (Teo), 2′-O-methoxyethyladenosine (Aeo), 2′-O-methoxyethyl-5-methylcytidine (m5Ceo), and any combinations thereof.
Guide RNAs can also include “locked” nucleic acids (LNA) in which the 2′ OH-group can be connected, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge, to the 4′ carbon of the same ribose sugar. Any suitable moiety can be used to provide such bridges, including without limitation methylene, propylene, ether, or amino bridges; O-amino (wherein amino can be, e.g., NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy or O(CH2)n-amino (wherein amino can be, e.g., NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino).
In certain embodiments, a gRNA can include a modified nucleotide which is multicyclic (e.g., tricyclo; and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), or threose nucleic acid (TNA, where ribose is replaced with α-L-threofuranosyl-(3′→2′)).
Generally, gRNAs include the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary modified gRNAs can include, without limitation, replacement of the oxygen in ribose (e.g., with sulfur (S), selenium (Se), or alkylene, such as, e.g., methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for example, anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone). Although the majority of sugar analog alterations are localized to the 2′ position, other sites are amenable to modification, including the 4′ position. In certain embodiments, a gRNA comprises a 4′-S, 4′-Se or a 4′-C-aminomethyl-2′-O-Me modification.
In certain embodiments, deaza nucleotides, e.g., 7-deaza-adenosine, can be incorporated into a gRNA. In certain embodiments, O- and N-alkylated nucleotides, e.g., N6-methyl adenosine, can be incorporated into a gRNA. In certain embodiments, one or more or all of the nucleotides in a gRNA are deoxynucleotides.
Guide RNAs can also include one or more cross-links between complementary regions of the crRNA (at its 3′ end) and the tracrRNA (at its 5′ end) (e.g., within a “tetraloop” structure and/or positioned in any stem loop structure occurring within a gRNA). A variety of linkers are suitable for use. For example, guide RNAs can include common linking moieties including, without limitation, polyvinylether, polyethylene, polypropylene, polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyglycolide (PGA), polylactide (PLA), polycaprolactone (PCL), and copolymers thereof.
In some embodiments, a bifunctional cross-linker is used to link a 5′ end of a first gRNA fragment and a 3′ end of a second gRNA fragment, and the 3′ or 5′ ends of the gRNA fragments to be linked are modified with functional groups that react with the reactive groups of the cross-linker. In general, these modifications comprise one or more of amine, sulfhydryl, carboxyl, hydroxyl, alkene (e.g., a terminal alkene), azide and/or another suitable functional group. Multifunctional (e.g. bifunctional) cross-linkers are also generally known in the art, and may be either heterofunctional or homofunctional, and may include any suitable functional group, including without limitation isothiocyanate, isocyanate, acyl azide, an NHS ester, sulfonyl chloride, tosyl ester, tresyl ester, aldehyde, amine, epoxide, carbonate (e.g., Bis(p-nitrophenyl) carbonate), aryl halide, alkyl halide, imido ester, carboxylate, alkyl phosphate, anhydride, fluorophenyl ester, HOBt ester, hydroxymethyl phosphine, O-methylisourea, DSC, NHS carbamate, glutaraldehyde, activated double bond, cyclic hemiacetal, NHS carbonate, imidazole carbamate, acyl imidazole, methylpyridinium ether, azlactone, cyanate ester, cyclic imidocarbonate, chlorotriazine, dehydroazepine, 6-sulfo-cytosine derivatives, maleimide, aziridine, TNB thiol, Ellman's reagent, peroxide, vinylsulfone, phenylthioester, diazoalkanes, diazoacetyl, epoxide, diazonium, benzophenone, anthraquinone, diazo derivatives, diazirine derivatives, psoralen derivatives, alkene, phenyl boronic acid, etc. In some embodiments, a first gRNA fragment comprises a first reactive group and the second gRNA fragment comprises a second reactive group. For example, the first and second reactive groups can each comprise an amine moiety, which are crosslinked with a carbonate-containing bifunctional crosslinking reagent to form a urea linkage. In other instances, (a) the first reactive group comprises a bromoacetyl moiety and the second reactive group comprises a sulfhydryl moiety, or (b) the first reactive group comprises a sulfhydryl moiety and the second reactive group comprises a bromoacetyl moiety, which are crosslinked by reacting the bromoacetyl moiety with the sulfhydryl moiety to form a bromoacetyl-thiol linkage. These and other cross-linking chemistries are known in the art, and are summarized in the literature, including by Greg T. Hermanson, Bioconjugate Techniques, 3rd Ed. 2013, published by Academic Press.
Additional suitable gRNA modifications will be apparent to those of ordinary skill in the art based on the present disclosure. Suitable gRNA modifications include, for example, those described in PCT Publication No. WO2019070762A1 entitled “MODIFIED CPF1 GUIDE RNA;” in PCT Publication No. WO2016089433A1 entitled “GUIDE RNA WITH CHEMICAL MODIFICATIONS;” in PCT Publication No. WO2016164356A1 entitled “CHEMICALLY MODIFIED GUIDE RNAS FOR CRISPR/CAS-MEDIATED GENE REGULATION;” and in PCT Publication No. WO2017053729A1 entitled “NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT THEREOF;” the entire contents of each of which are incorporated herein by reference.
Exemplary gRNAs
Non-limiting examples of guide RNAs suitable for certain embodiments embraced by the present disclosure are provided herein, for example, in the Tables below. Those of ordinary skill in the art will be able to envision suitable guide RNA sequences for a specific nuclease, e.g., a Cas9 or Cpf1 nuclease, from the disclosure of the targeting domain sequence, either as a DNA or RNA sequence. For example, a guide RNA comprising a targeting sequence consisting of RNA nucleotides would include the RNA sequence corresponding to the targeting domain sequence provided as a DNA sequence, and this contain uracil instead of thymidine nucleotides. For example, a guide RNA comprising a targeting domain sequence consisting of RNA nucleotides, and described by the DNA sequence TCTGCAGAAATGTTCCCCGT (SEQ ID NO: 88) would have a targeting domain of the corresponding RNA sequence UCUGCAGAAAUGUUCCCCGU (SEQ ID NO: 89). As will be apparent to the skilled artisan, such a targeting sequence would be linked to a suitable guide RNA scaffold, e.g., a crRNA scaffold sequence or a chimeric crRNA/tracrRNA scaffold sequence. Suitable gRNA scaffold sequences are known to those of ordinary skill in the art. For AsCpf1, for example, a suitable scaffold sequence comprises the sequence UAAUUUCUACUCUUGUAGAU (SEQ ID NO: 90), added to the 5′-terminus of the targeting domain. In the example above, this would result in a Cpf1 guide RNA of the sequence UAAUUUCUACUCUUGUAGAUUCUGCAGAAAUGUUCCCCGU (SEQ ID NO: 91). Those of skill in the art would further understand how to modify such a guide RNA, e.g., by adding a DNA extension (e.g., in the example above, adding a 25-mer DNA extension as described herein would result, for example, in a guide RNA of the sequence ATGTGTTTTTGTCAAAAGACCTTTTrUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArUrUr CrUrGrCrArGrArArArUrGrUrUrCrCrCrCrGrU (SEQ ID NO: 92)). It will be understood that the exemplary targeting sequences provided herein are not limiting, and additional suitable sequences, e.g., variants of the specific sequences disclosed herein, will be apparent to the skilled artisan based on the present disclosure in view of the general knowledge in the art.
It will be understood that the exemplary gRNAs disclosed herein are provided to illustrate non-limiting embodiments embraced by the present disclosure. Additional suitable gRNA sequences will be apparent to the skilled artisan based on the present disclosure, and the disclosure is not limited in this respect.
Methods of the disclosure can be used to edit the genome of any cell. In certain embodiments, the target cell is a stem cell, e.g., an iPS or ES cell. In certain embodiments, the target cell can be an iPS- or ES-derived cell, where the genetic modification is made at any stage during the reprogramming process from donor cell to iPSC, during the iPSC stage, and/or at any stage of the process of differentiating the iPSC or ESC to a specialized cell, or even up to or at the final specialized cell state. In certain embodiments, the target cell can be an iPS-derived NK cell (iNK cell) or iPS-derived T cell (iT cell) where the genetic modification is made at any stage during the reprogramming process from donor cell to iPSC, during the iPSC stage, and/or at any stage of the process of differentiating the iPSC to an iNK or iT state, e.g., at an intermediary state, such as, for example, an iPSC-derived HSC state, or even up to or at the final iNK or iT cell state.
In certain embodiments, a target cell is one or more of a long-term hematopoietic stem cell, a short term hematopoietic stem cell, a multipotent progenitor cell, a lineage restricted progenitor cell, a lymphoid progenitor cell, a myeloid progenitor cell, a common myeloid progenitor cell, an erythroid progenitor cell, a megakaryocyte erythroid progenitor cell, a retinal cell, a photoreceptor cell, a rod cell, a cone cell, a retinal pigmented epithelium cell, a trabecular meshwork cell, a cochlear hair cell, an outer hair cell, an inner hair cell, a pulmonary epithelial cell, a bronchial epithelial cell, an alveolar epithelial cell, a pulmonary epithelial progenitor cell, a striated muscle cell, a cardiac muscle cell, a muscle satellite cell, a neuron, a neuronal stem cell, a mesenchymal stem cell, an induced pluripotent stem (iPS) cell, an embryonic stem cell, a fibroblast, a monocyte-derived macrophage or dendritic cell, a megakaryocyte, a neutrophil, an eosinophil, a basophil, a mast cell, a reticulocyte, a B cell, e.g., a progenitor B cell, a Pre B cell, a Pro B cell, a memory B cell, a plasma B cell, a gastrointestinal epithelial cell, a biliary epithelial cell, a pancreatic ductal epithelial cell, an intestinal stem cell, a hepatocyte, a liver stellate cell, a Kupffer cell, an osteoblast, an osteoclast, an adipocyte, a preadipocyte, a pancreatic islet cell (e.g., a beta cell, an alpha cell, a delta cell), a pancreatic exocrine cell, a Schwann cell, or an oligodendrocyte. In some embodiments, a target cell is a neuronal progenitor cell. In some embodiments, a target cell is a neuron.
In some embodiments, a target cell is a circulating blood cell, e.g., a reticulocyte, megakaryocyte erythroid progenitor (MEP) cell, myeloid progenitor cell (CMP/GMP), lymphoid progenitor (LP) cell, hematopoietic stem/progenitor cell (HSC), or endothelial cell (EC). In some embodiments, a target cell is one or more of a bone marrow cell (e.g., a reticulocyte, an erythroid cell (e.g., erythroblast), an MEP cell, myeloid progenitor cell (CMP/GMP), LP cell, erythroid progenitor (EP) cell, HSC, multipotent progenitor (MPP) cell, endothelial cell (EC), hemogenic endothelial (HE) cell, or mesenchymal stem cell). In some embodiments, a target cell is one or more of a myeloid progenitor cell (e.g., a common myeloid progenitor (CMP) cell or granulocyte macrophage progenitor (GMP) cell). In some embodiments, a target cell is a lymphoid progenitor cell, e.g., a common lymphoid progenitor (CLP) cell. In some embodiments, a target cell is one or more of an erythroid progenitor cell (e.g., an MEP cell). In some embodiments, a target cell is one or more of a hematopoietic stem/progenitor cell (e.g., a long term HSC (LT-HSC), short term HSC (ST-HSC), MPP cell, or lineage restricted progenitor (LRP) cell). In certain embodiments, the target cell is a CD34+ cell, CD34+CD90+ cell, CD34+CD38− cell, CD34+CD90+CD49f+CD38− CD45RA− cell, CD105+ cell, CD31+, or CD133+ cell, or a CD34+CD90+CD133+ cell. In some embodiments, a target cell is one or more of an umbilical cord blood CD34+ HSPC, umbilical cord venous endothelial cell, umbilical cord arterial endothelial cell, amniotic fluid CD34+ cell, amniotic fluid endothelial cell, placental endothelial cell, or placental hematopoietic CD34+ cell. In some embodiments, a target cell is one or more of a mobilized peripheral blood hematopoietic CD34+ cell (after the subject is treated with a mobilization agent, e.g., G-CSF or Plerixafor). In some embodiments, a target cell is a peripheral blood endothelial cell. In some embodiments, a target cell is a peripheral blood natural killer cell.
In certain embodiments, a target cell is a primary cell, e.g., a cell isolated from a human subject. In certain embodiments, a target cell is an immune cell, e.g., a primary immune cell isolated from a human subject. In certain embodiments, a target cell is part of a population of cells isolated from a subject, e.g., a human subject. In some embodiments, the population of cells comprises a population of immune cells isolated from a subject. In some embodiments, the population of cells comprises tumor infiltrating lymphocytes (TILs), e.g., TILs isolated from a human subject. In some embodiments, a target cell is isolated from a healthy subject, e.g., a healthy human donor. In some embodiments, a target cell is isolated from a subject having a disease or illness, e.g., a human patient in need of a treatment.
In certain embodiments, a target cell is an immune cell, e.g., a primary immune cell, e.g., a CD8+ T cell, a CD8+ naïve T cell, a CD4+ central memory T cell, a CD8+ central memory T cell, a CD4+ effector memory T cell, a CD4+ effector memory T cell, a CD4+ T cell, a CD4+ stem cell memory T cell, a CD8+ stem cell memory T cell, a CD4+ helper T cell, a regulatory T cell, a cytotoxic T cell, a natural killer T cell, a CD4+ naïve T cell, a TH17 CD4+ T cell, a TH1 CD4+ T cell, a TH2 CD4+ T cell, a TH9 CD4+ T cell, a CD4+Foxp3+ T cell, a CD4+ CD25+CD127− T cell, or a CD4+CD25+CD127− Foxp3+ T cell. In some embodiments, a target cell is an alpha-beta T cell, a gamma-delta T cell or a Treg. In some embodiments a target cell is macrophage. In some embodiments, a target cell is an innate lymphoid cell. In some embodiments, a target cell is a dendritic cell. In some embodiments, a target cell is a beta cell, e.g., a pancreatic beta cell.
In some embodiments, a target cell is isolated from a subject having a cancer.
In some embodiments, a target cell is isolated from a subject having a cancer, including but not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bile duct cancer; bladder cancer; bone cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma, medulloblastoma); bronchus cancer; carcinoid tumor; cardiac tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ductal carcinoma in situ; ependymoma; endotheliosarcoma (e.g., Kaposi's sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett's adenocarcinoma); Ewing's sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer); hematopoietic cancer (e.g., lymphomas, primary pulmonary lymphomas, bronchus-associated lymphoid tissue lymphomas, splenic lymphomas, nodal marginal zone lymphomas, pediatric B cell non-Hodgkin lymphomas); hemangioblastoma; histiocytosis; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms' tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); melanoma; midline tract carcinoma; multiple endocrine neoplasia syndrome; muscle cancer; mesothelioma; nasopharynx cancer; neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendocrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g., cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); parathyroid cancer; papillary adenocarcinoma; penile cancer (e.g., Paget's disease of the penis and scrotum); pharyngeal cancer; pinealoma; pituitary cancer; pleuropulmonary blastoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g., prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; retinoblastoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; stomach cancer; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thymic cancer; thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; uterine cancer; vaginal cancer; vulvar cancer (e.g., Paget's disease of the vulva), or any combination thereof.
In some embodiments, a target cell is isolated from a subject having a hematological disorder. In some embodiments, a target cell is isolated form a subject having sickle cell anemia. In some embodiments, a target cell is isolated from a subject having 0-thalassemia.
Methods of the disclosure can be used with stem cells. Stem cells are typically cells that have the capacity to produce unaltered daughter cells (self-renewal; cell division produces at least one daughter cell that is identical to the parent cell) and to give rise to specialized cell types (potency). Stem cells include, but are not limited to, embryonic stem (ES) cells, embryonic germ (EG) cells, germline stem (GS) cells, human mesenchymal stem cells (hMSCs), adipose tissue-derived stem cells (ADSCs), multipotent adult progenitor cells (MAPCs), multipotent adult germline stem cells (maGSCs) and unrestricted somatic stem cell (USSCs). Generally, stem cells can divide without limit. After division, the stem cell may remain as a stem cell, become a precursor cell, or proceed to terminal differentiation. A precursor cell is a cell that can generate a fully differentiated functional cell of at least one given cell type. Generally, precursor cells can divide. After division, a precursor cell can remain a precursor cell, or may proceed to terminal differentiation.
Pluripotent stem cells are generally known in the art. The present disclosure provides technologies (e.g., systems, compositions, methods, etc.) related to pluripotent stem cells. In some embodiments, pluripotent stem cells are stem cells that: (a) are capable of inducing teratomas when transplanted in immunodeficient (SCID) mice; (b) are capable of differentiating to cell types of all three germ layers (e.g., can differentiate to ectodermal, mesodermal, and endodermal cell types); and/or (c) express one or more markers of embryonic stem cells (e.g., human embryonic stem cells express Oct-4, alkaline phosphatase, SSEA-3 surface antigen, SSEA-4 surface antigen, nanog, TRA-1-60, TRA-1-81, Sox-2, REX1, etc.). In some aspects, human pluripotent stem cells do not show expression of differentiation markers. In some embodiments, ES cells and/or iPSCs edited using methods of the disclosure maintain their pluripotency, e.g., (a) are capable of inducing teratomas when transplanted in immunodeficient (SCID) mice; (b) are capable of differentiating to cell types of all three germ layers, e.g., can differentiate to ectodermal, mesodermal, and endodermal cell types); and/or (c) express one or more markers of embryonic stem cells.
In some embodiments, ES cells (e.g., human ES cells) can be derived from the inner cell mass of blastocysts or morulae. In some embodiments, ES cells can be isolated from one or more blastomeres of an embryo, e.g., without destroying the remainder of the embryo. In some embodiments, ES cells can be produced by somatic cell nuclear transfer. In some embodiments, ES cells can be derived from fertilization of an egg cell with sperm or DNA, nuclear transfer, parthenogenesis, or by means to generate ES cells, e.g., with homozygosity in the HLA region. In some embodiments, human ES cells can be produced or derived from a zygote, blastomeres, or blastocyst-staged mammalian embryo produced by the fusion of a sperm and egg cell, nuclear transfer, parthenogenesis, or the reprogramming of chromatin and subsequent incorporation of the reprogrammed chromatin into a plasma membrane to produce an embryonic cell. Exemplary human ES cells are known in the art and include, but are not limited to, MAO1, MAO9, ACT-4, No. 3, H1, H7, H9, H14 and ACT30 ES cells. In some embodiments, human ES cells, regardless of their source or the particular method used to produce them, can be identified based on, e.g., (i) the ability to differentiate into cells of all three germ layers, (ii) expression of at least Oct-4 and alkaline phosphatase, and/or (iii) ability to produce teratomas when transplanted into immunocompromised animals. In some embodiments, ES cells have been serially passaged as cell lines.
iPS Cells
Induced pluripotent stem cells (iPSC) are a type of pluripotent stem cell artificially derived from a non-pluripotent cell, such as an adult somatic cell (e.g., a fibroblast cell or other suitable somatic cell), by inducing expression of certain genes. iPSCs can be derived from any organism, such as a mammal. In some embodiments, iPSCs are produced from mice, rats, rabbits, guinea pigs, goats, pigs, cows, non-human primates or humans. iPSCs are similar to ES cells in many respects, such as the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, potency and/or differentiability. Various suitable methods for producing iPSCs are known in the art. In some embodiments, iPSCs can be derived by transfection of certain stem cell-associated genes (such as Oct-3/4 (Pouf51) and Sox-2) into non-pluripotent cells, such as adult fibroblasts. Transfection can be achieved through viral vectors, such as retroviruses, lentiviruses, or adenoviruses. Additional suitable reprogramming methods include the use of vectors that do not integrate into the genome of the host cell, e.g., episomal vectors, or the delivery of reprogramming factors directly via encoding RNA or as proteins has also been described. For example, cells can be transfected with Oct-3/4, Sox-2, Klf4, and/or c-Myc using a retroviral system or with Oct-4, Sox-2, NANOG, and/or LIN28 using a lentiviral system. After 3-4 weeks, small numbers of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and can be isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. In one example, iPSCs from adult human cells are generated by the method described by Yu et al., Science 2007; 318(5854):1224 or Takahashi et al., Cell 2007; 131:861-72. Numerous suitable methods for reprogramming are known to those of skill in the art, and the present disclosure is not limited in this respect.
In some embodiments, a target cell for the editing and cargo integration methods described herein is an iPSC, wherein the edited iPSC is then differentiated, e.g., into an iPSC-derived immune cell. In some embodiments, the differentiated cell is an iPSC-derived immune cell. In some embodiments, the differentiated cell is an iPSC-derived iNK cell, an iPSC-derived T cell (e.g., an iPSC-derived alpha-beta T cell, gamma-delta T cell, Treg, CD4+ T cell, or CD8+ T cell), an iPSC-derived dendritic cell, or an iPSC-derived macrophage. In some embodiments, the differentiated cell is an iPSC-derived pancreatic beta cell.
iNK Cells
In some embodiments, the present disclosure provides methods of generating iNK cells (e.g., genetically modified iNK cells).
In some embodiments, genetic modifications present in an iNK cell of the present disclosure can be made at any stage during the reprogramming process from donor cell to iPSC, during the iPSC stage, and/or at any stage of the process of differentiating the iPSC to an iNK state, e.g., at an intermediary state, such as, for example, an iPSC-derived HSC state, or even up to or at the final iNK cell state.
For example, one or more genomic modifications present in a genetically modified iNK cell of the present disclosure may be made at one or more different cell stages (e.g., reprogramming from donor to iPSC, differentiation of iPSC to iNK). In some embodiments, one or more genomic modifications present in a genetically modified iNK cell provided herein is made before reprogramming a donor cell to an iPSC state. In some embodiments, all edits present in a genetically modified iNK cell provided herein are made at the same time, in close temporal proximity, and/or at the same cell stage of the reprogramming/differentiation process, e.g., at the donor cell stage, during the reprogramming process, at the iPSC stage, or during the differentiation process, e.g., from iPSC to iNK. In some embodiments, two or more edits present in a genetically modified iNK cell provided herein are made at different times and/or at different cell stages of the reprogramming/differentiation process from donor cell to iPSC to iNK. For example, in some embodiments, a first edit is made at the donor cell stage and a second (different) edit is made at the iPSC stage. In some embodiments, a first edit is made at the reprogramming stage (e.g., donor to iPSC) and a second (different) edit is made at the iPSC stage.
A variety of cell types can be used as a donor cell that can be subjected to reprogramming, differentiation, and/or genetic engineering strategies described herein. For example, the donor cell can be a pluripotent stem cell or a differentiated cell, e.g., a somatic cell, such as, for example, a fibroblast or a T lymphocyte. In some embodiments, donor cells are manipulated (e.g., subjected to reprogramming, differentiation, and/or genetic engineering) to generate iNK cells described herein.
A donor cell can be from any suitable organism. For example, in some embodiments, the donor cell is a mammalian cell, e.g., a human cell or a non-human primate cell. In some embodiments, the donor cell is a somatic cell. In some embodiments, the donor cell is a stem cell or progenitor cell. In certain embodiments, the donor cell is not or was not part of a human embryo and its derivation does not involve destruction of a human embryo.
In some embodiments, a genetically modified iNK cell is derived from an iPSC, which in turn is derived from a somatic donor cell. Any suitable somatic cell can be used in the generation of iPSCs, and in turn, the generation of iNK cells. Suitable strategies for deriving iPSCs from various somatic donor cell types have been described and are known in the art. In some embodiments, a somatic donor cell is a fibroblast cell. In some embodiments, a somatic donor cell is a mature T cell.
For example, in some embodiments, a somatic donor cell, from which an iPSC, and subsequently an iNK cell is derived, is a developmentally mature T cell (a T cell that has undergone thymic selection). One hallmark of developmentally mature T cells is a rearranged T cell receptor locus. During T cell maturation, the TCR locus undergoes V(D)J rearrangements to generate complete V-domain exons. These rearrangements are retained throughout reprogramming of a T cells to an iPSC, and throughout differentiation of the resulting iPSC to a somatic cell.
In certain embodiments, a somatic donor cell is a CD8+ T cell, a CD8+ naïve T cell, a CD4+ central memory T cell, a CD8+ central memory T cell, a CD4+ effector memory T cell, a CD4+ effector memory T cell, a CD4+ T cell, a CD4+ stem cell memory T cell, a CD8+ stem cell memory T cell, a CD4+ helper T cell, a regulatory T cell, a cytotoxic T cell, a natural killer T cell, a CD4+ naïve T cell, a TH17 CD4+ T cell, a TH1 CD4+ T cell, a TH2 CD4+ T cell, a TH9 CD4+ T cell, a CD4+Foxp3+ T cell, a CD4+CD25+CD127− T cell, or a CD4+CD25+ CD127−Foxp3+ T cell.
T cells can be advantageous for the generation of iPSCs. For example, T cells can be edited with relative ease, e.g., by CRISPR-based methods or other genetic engineering methods. Additionally, the rearranged TCR locus allows for genetic tracking of individual cells and their daughter cells. For example, if the reprogramming, expansion, culture, and/or differentiation strategies involved in the generation of NK cells a clonal expansion of a single cell, the rearranged TCR locus can be used as a genetic marker unambiguously identifying a cell and its daughter cells. This, in turn, allows for the characterization of a cell population as truly clonal, or for the identification of mixed populations, or contaminating cells in a clonal population. Another potential advantage of using T cells in generating iNK cells carrying multiple edits is that certain karyotypic aberrations associated with chromosomal translocations are selected against in T cell culture. Such aberrations can pose a concern when editing cells by CRISPR technology, and in particular when generating cells carrying multiple edits. Using T cell derived iPSCs as a starting point for the derivation of therapeutic lymphocytes can allow for the expression of a pre-screened TCR in the lymphocytes, e.g., via selecting the T cells for binding activity against a specific antigen, e.g., a tumor antigen, reprogramming the selected T cells to iPSCs, and then deriving lymphocytes from these iPSCs that express the TCR (e.g., T cells). This strategy can allow for activating the TCR in other cell types, e.g., by genetic or epigenetic strategies. Additionally, T cells retain at least part of their “epigenetic memory” throughout the reprogramming process, and thus subsequent differentiation of the same or a closely related cell type, such as iNK cells can be more efficient and/or result in higher quality cell populations as compared to approaches using non-related cells, such as fibroblasts, as a starting point for iNK derivation.
In some embodiments, a donor cell being manipulated, e.g., a cell being reprogrammed and/or undergoing genetic engineering as described herein, is one or more of a long-term hematopoietic stem cell, a short term hematopoietic stem cell, a multipotent progenitor cell, a lineage restricted progenitor cell, a lymphoid progenitor cell, a myeloid progenitor cell, a common myeloid progenitor cell, an erythroid progenitor cell, a megakaryocyte erythroid progenitor cell, a retinal cell, a photoreceptor cell, a rod cell, a cone cell, a retinal pigmented epithelium cell, a trabecular meshwork cell, a cochlear hair cell, an outer hair cell, an inner hair cell, a pulmonary epithelial cell, a bronchial epithelial cell, an alveolar epithelial cell, a pulmonary epithelial progenitor cell, a striated muscle cell, a cardiac muscle cell, a muscle satellite cell, a neuron, a neuronal stem cell, a mesenchymal stem cell, an induced pluripotent stem (iPS) cell, an embryonic stem cell, a fibroblast, a monocyte-derived macrophage or dendritic cell, a megakaryocyte, a neutrophil, an eosinophil, a basophil, a mast cell, a reticulocyte, a B cell, e.g., a progenitor B cell, a Pre B cell, a Pro B cell, a memory B cell, a plasma B cell, a gastrointestinal epithelial cell, a biliary epithelial cell, a pancreatic ductal epithelial cell, an intestinal stem cell, a hepatocyte, a liver stellate cell, a Kupffer cell, an osteoblast, an osteoclast, an adipocyte, a preadipocyte, a pancreatic islet cell (e.g., a beta cell, an alpha cell, a delta cell), a pancreatic exocrine cell, a Schwann cell, or an oligodendrocyte.
In some embodiments, a donor cell is one or more of a circulating blood cell, e.g., a reticulocyte, megakaryocyte erythroid progenitor (MEP) cell, myeloid progenitor cell (CMP/GMP), lymphoid progenitor (LP) cell, hematopoietic stem/progenitor cell (HSC), or endothelial cell (EC). In some embodiments, a donor cell is one or more of a bone marrow cell (e.g., a reticulocyte, an erythroid cell (e.g., erythroblast), an MEP cell, myeloid progenitor cell (CMP/GMP), LP cell, erythroid progenitor (EP) cell, HSC, multipotent progenitor (MPP) cell, endothelial cell (EC), hemogenic endothelial (HE) cell, or mesenchymal stem cell). In some embodiments, a donor cell is one or more of a myeloid progenitor cell (e.g., a common myeloid progenitor (CMP) cell or granulocyte macrophage progenitor (GMP) cell). In some embodiments, a donor cell is one or more of a lymphoid progenitor cell, e.g., a common lymphoid progenitor (CLP) cell. In some embodiments, a donor cell is one or more of an erythroid progenitor cell (e.g., an MEP cell). In some embodiments, a donor cell is one or more of a hematopoietic stem/progenitor cell (e.g., a long term HSC (LT-HSC), short term HSC (ST-HSC), MPP cell, or lineage restricted progenitor (LRP) cell). In certain embodiments, the donor cell is a CD34+ cell, CD34+CD90+ cell, CD34+CD38− cell, CD34+CD90+CD49f+CD38− CD45RA− cell, CD105+ cell, CD31+, or CD133+ cell, or a CD34+CD90+CD133+ cell. In some embodiments, a donor cell is one or more of an umbilical cord blood CD34+ HSPC, umbilical cord venous endothelial cell, umbilical cord arterial endothelial cell, amniotic fluid CD34+ cell, amniotic fluid endothelial cell, placental endothelial cell, or placental hematopoietic CD34+ cell. In some embodiments, a donor cell is one or more of a mobilized peripheral blood hematopoietic CD34+ cell (after the subject is treated with a mobilization agent, e.g., G-CSF or Plerixafor). In some embodiments, a donor cell is a peripheral blood endothelial cell. In some embodiments, a donor cell is a peripheral blood natural killer cell.
In some embodiments, a donor cell is a dividing cell. In some embodiments, a donor cell is a non-dividing cell.
In some embodiments, a genetically modified (e.g., edited) iNK cell resulting from one or more methods and/or strategies described herein, are administered to a subject in need thereof, e.g., in the context of an immuno-oncology therapeutic approach. In some embodiments, donor cells, or any cells of any stage of the reprogramming, differentiating, and/or genetic engineering strategies provided herein, can be maintained in culture or stored (e.g., frozen in liquid nitrogen) using any suitable method known in the art, e.g., for subsequent characterization or administration to a subject in need thereof.
Methods of characterizing cells including characterizing cellular phenotype are known to those of skill in the art. In some embodiments, one or more such methods may include, but not be limited to, for example, morphological analyses and flow cytometry. Cellular lineage and identity markers are known to those of skill in the art. One or more such markers may be combined with one or more characterization methods to determine a composition of a cell population or phenotypic identity of one or more cells. For example, in some embodiments, cells of a particular population will be characterized using flow cytometry (for example, see Ye Li et al., Cell Stem Cell. 2018 Aug. 2; 23(2): 181-192.e5). In some such embodiments, a sample of a population of cells will be evaluated for presence and proportion of one or more cell surface markers and/or one or more intracellular markers. As will be understood by those of skill in the art, such cell surface markers may be representative of different lineages. For example, pluripotent cells may be identified by one or more of any number of markers known to be associated with such cells, such as, for example, CD34. Further, in some embodiments, cells may be identified by markers that indicate some degree of differentiation. Such markers will be known to one of skill in the art. For example, in some embodiments, markers of differentiated cells may include those associated with differentiated hematopoietic cells such as, e.g., CD43, CD45 (differentiated hematopoietic cells). In some embodiments, markers of differentiated cells may be associated with NK cell phenotypes such as, e.g., CD56, NK cell receptor immunoglobulin gamma Fc region receptor III (FcγRIII, cluster of differentiation 16 (CD16)), natural killer group-2 member D (NKG2D), CD69, a natural cytotoxicity receptor, etc. In some embodiments, markers may be T cell markers (e.g., CD3, CD4, CD8, etc.).
A variety of diseases, disorders and/or conditions may be treated through use of cells provided by the present disclosure. For example, in some embodiments, a disease, disorder and/or condition may be treated by introducing genetically modified or engineered cells as described herein (e.g., genetically modified iNK cells) to a subject. Examples of diseases that may be treated include, but are not limited to, cancer, e.g., solid tumors, e.g., of the brain, prostate, breast, lung, colon, uterus, skin, liver, bone, pancreas, ovary, testes, bladder, kidney, head, neck, stomach, cervix, rectum, larynx, or esophagus; and hematological malignancies, e.g., acute and chronic leukemias, lymphomas, multiple myeloma and myelodysplastic syndromes.
In some embodiments, the present disclosure provides methods of treating a subject in need thereof by administering to the subject a composition comprising any of the cells described herein. In some embodiments, a therapeutic agent or composition may be administered before, during, or after the onset of a disease, disorder, or condition (including, e.g., an injury). In some embodiments, the present disclosure provides any of the cells described herein for use in the preparation of a medicament. In some embodiments, the present disclosure provides any of the cells described herein for use in the treatment of a disease, disorder, or condition, that can be treated by a cell therapy.
In particular embodiments, the subject has a disease, disorder, or condition, that can be treated by a cell therapy. In some embodiments, a subject in need of cell therapy is a subject with a disease, disorder and/or condition, whereby a cell therapy, e.g., a therapy in which a composition comprising a cell described herein, is administered to the subject, whereby the cell therapy treats at least one symptom associated with the disease, disorder, and/or condition. In some embodiments, a subject in need of cell therapy includes, but is not limited to, a candidate for bone marrow or stem cell transplant, a subject who has received chemotherapy or irradiation therapy, a subject who has or is at risk of having cancer, e.g., a cancer of hematopoietic system, a subject having or at risk of developing a tumor, e.g., a solid tumor, and/or a subject who has or is at risk of having a viral infection or a disease associated with a viral infection.
Pharmaceutical Compositions
In some embodiments, the present disclosure provides pharmaceutical compositions comprising one or more genetically modified or engineered cells described herein, e.g., a genetically modified iNK cell described herein. In some embodiments, a pharmaceutical composition further comprises a pharmaceutically acceptable excipient. In some embodiments, a pharmaceutical composition comprises isolated pluripotent stem cell-derived hematopoietic lineage cells comprising at least 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs. In some embodiments, a pharmaceutical composition comprises isolated pluripotent stem cell-derived hematopoietic lineage cells comprising about 95% to about 100% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs.
In some embodiments, a pharmaceutical composition of the present disclosure comprises an isolated population of pluripotent stem cell-derived hematopoietic lineage cells, wherein the isolated population has less than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs. In some embodiments, an isolated population of pluripotent stem cell-derived hematopoietic lineage cells has more than about 0.1%, 0.5%, 1%, 2%, 5%, 10%, 15%, 20%, 25%, or 30% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs. In some embodiments, an isolated population of pluripotent stem cell-derived hematopoietic lineage cells has about 0.1% to about 1%, about 1% to about 3%, about 3% to about 5%, about 10%-15%, about 15%-20%, about 20%-25%, about 25%-30%, about 30%-35%, about 35%-40%, about 40%-45%, about 45%-50%, about 60%-70%, about 70%-80%, about 80%-90%, about 90%-95%, or about 95% to about 100% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs.
In some embodiments, an isolated population of pluripotent stem cell-derived hematopoietic lineage cells comprises about 0.1%, about 1%, about 3%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, or about 100% T cells, NK cells, NKT cells, CD34+HE cells or HSCs, e.g., genetically modified (e.g., edited) T cells, NK cells, NKT cells, CD34+HE cells or HSCs.
As one of ordinary skill in the art would understand, both autologous and allogeneic cells can be used in adoptive cell therapies. Autologous cell therapies generally have reduced infection, low probability for GVHD, and rapid immune reconstitution relative to other cell therapies. Allogeneic cell therapies generally have an immune mediated graft-versus-malignancy (GVM) effect, and low rate of relapse relative to other cell therapies. Based on the specific condition(s) of the subject in need of the cell therapy, one of ordinary skill in the art would be able to determine which specific type of therapy(ies) to administer.
In some embodiments, a pharmaceutical composition comprises pluripotent stem cell-derived hematopoietic lineage cells that are allogeneic to a subject. In some embodiments, a pharmaceutical composition comprises pluripotent stem cell-derived hematopoietic lineage cells that are autologous to a subject. For autologous transplantation, the isolated population of pluripotent stem cell-derived hematopoietic lineage cells can be either a complete or partial HLA-match with the subject being treated. In some embodiments, the pluripotent stem cell-derived hematopoietic lineage cells are not HLA-matched to a subject.
In some embodiments, pluripotent stem cell-derived hematopoietic lineage cells can be administered to a subject without being expanded ex vivo or in vitro prior to administration. In particular embodiments, an isolated population of derived hematopoietic lineage cells is modulated and treated ex vivo using one or more agents to obtain immune cells with improved therapeutic potential. In some embodiments, the modulated population of derived hematopoietic lineage cells can be washed to remove the treatment agent(s), and the improved population can be administered to a subject without further expansion of the population in vitro. In some embodiments, an isolated population of derived hematopoietic lineage cells is expanded prior to modulating the isolated population with one or more agents.
In some embodiments, an isolated population of derived hematopoietic lineage cells can be genetically modified according to the methods of the present disclosure to express a recombinant TCR, CAR or other gene product of interest. For genetically engineered derived hematopoietic lineage cells that express a recombinant TCR or CAR, whether prior to or after genetic modification of the cells, the cells can be activated and expanded using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005.
Cancers
Any cancer can be treated using a cell or pharmaceutical composition described herein. Exemplary therapeutic targets of the present disclosure include cancer cells from the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, eye, gastrointestinal system, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus. In addition, a cancer may specifically be of the following non-limiting histological type: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; Leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malig melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; Kaposi sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; Ewing sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin's lymphoma; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
In some embodiments, the cancer is a breast cancer. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is gastric cancer. In some embodiments, the cancer is RCC. In another embodiment, the cancer is non-small cell lung cancer (NSCLC).
In some embodiments, solid cancer indications that can be treated with cells described herein (e.g., cells modified using methods of the disclosure, e.g., genetically modified iNK cells), either alone or in combination with one or more additional cancer treatment modality, include: bladder cancer, hepatocellular carcinoma, prostate cancer, ovarian/uterine cancer, pancreatic cancer, mesothelioma, melanoma, glioblastoma, HPV-associated and/or HPV-positive cancers such as cervical and HPV+ head and neck cancer, oral cavity cancer, cancer of the pharynx, thyroid cancer, gallbladder cancer, and soft tissue sarcomas. In some embodiments, hematological cancer indications that can be treated with cells described herein (e.g., cells modified using methods of the disclosure, e.g., genetically modified iNK cells), either alone or in combination with one or more additional cancer treatment modalities, include: ALL, CLL, NHL, DLBCL, AML, CML, and multiple myeloma (MM).
In some embodiments, examples of cellular proliferative and/or differentiative disorders of the lung that can be treated with cells described herein (e.g., cells modified using methods of the disclosure) include, but are not limited to, tumors such as bronchogenic carcinoma, including paraneoplastic syndromes, bronchioloalveolar carcinoma, neuroendocrine tumors, such as bronchial carcinoid, miscellaneous tumors, metastatic tumors, and pleural tumors, including solitary fibrous tumors (pleural fibroma) and malignant mesothelioma.
In some embodiments, examples of cellular proliferative and/or differentiative disorders of the breast that can be treated with cells described herein (e.g., cells modified using methods of the disclosure) include, but are not limited to, proliferative breast disease including, e.g., epithelial hyperplasia, sclerosing adenosis, and small duct papillomas; tumors, e.g., stromal tumors such as fibroadenoma, phyllodes tumor, and sarcomas, and epithelial tumors such as large duct papilloma; carcinoma of the breast including in situ (noninvasive) carcinoma that includes ductal carcinoma in situ (including Paget's disease) and lobular carcinoma in situ, and invasive (infiltrating) carcinoma including, but not limited to, invasive ductal carcinoma, invasive lobular carcinoma, medullary carcinoma, colloid (mucinous) carcinoma, tubular carcinoma, and invasive papillary carcinoma, and miscellaneous malignant neoplasms. Disorders in the male breast include, but are not limited to, gynecomastia and carcinoma.
In some embodiments, examples of cellular proliferative and/or differentiative disorders involving the colon that can be treated with cells described herein (e.g., cells modified using methods of the disclosure) include, but are not limited to, tumors of the colon, such as non-neoplastic polyps, adenomas, familial syndromes, colorectal carcinogenesis, colorectal carcinoma, and carcinoid tumors.
In some embodiments, examples of cancers or neoplastic conditions, in addition to the ones described above that can be treated with cells described herein (e.g., cells modified using methods of the disclosure), include, but are not limited to, a fibrosarcoma, myosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, gastric cancer, esophageal cancer, rectal cancer, pancreatic cancer, ovarian cancer, prostate cancer, uterine cancer, cancer of the head and neck, skin cancer, brain cancer, squamous cell carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular cancer, small cell lung carcinoma, non-small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma, leukemia, lymphoma, or Kaposi sarcoma.
In some embodiments, cells described herein (e.g., cells modified using methods of the disclosure) are used in combination with one or more cancer treatment modalities. In some embodiments, other cancer treatment modalities include, but are not limited to: chemotherapeutic agents include alkylating agents such as thiotepa and CYTOXAN® cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); delta-9-tetrahydrocannabinol (dronabinol, MARINOL®); beta-lapachone; lapachol; colchicines; betulinic acid; a camptothecin (including the synthetic analogue topotecan (HYCAMTIN®), CPT-11 (irinotecan, CAMPTOSAR®), acetylcamptothecin, scopolectin, and 9-aminocamptothecin); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); podophyllotoxin; podophyllinic acid; teniposide; cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfanide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammalI and calicheamicin omegall (see, e.g., Agnew, Chem. Intl. Ed. Engl., 1994; 33:183-186); dynemicin, including dynemicin A; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including ADRIAMYCIN®, morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, doxorubicin HCl liposome injection (DOXIL®) and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate, gemcitabine (GEMZAR®), tegafur (UFTORAL®), capecitabine (XELODA®), an epothilone, and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; 2-ethylhydrazide; procarbazine; PSK® polysaccharide complex (JHS Natural Products, Eugene, Oreg.); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine (ELDISINE®, FILDESIN®); dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); thiotepa; taxoids, e.g., paclitaxel (TAXOL®), albumin-engineered nanoparticle formulation of paclitaxel (ABRAXANET™), and doxetaxel (TAXOTERE®); chloranbucil; 6-thioguanine; mercaptopurine; methotrexate; platinum analogs such as cisplatin and carboplatin; vinblastine (VELBAN®); platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine (ONCOVIN®); oxaliplatin; leucovovin; vinorelbine (NAVELBINE®); novantrone; edatrexate; daunomycin; aminopterin; cyclosporine, sirolimus, rapamycin, rapalogs, ibandronate; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; CHOP, an abbreviation for a combined therapy of cyclophosphamide, doxorubicin, vincristine, and prednisolone, and FOLFOX, an abbreviation for a treatment regimen with oxaliplatin (ELOXATINTM) combined with 5-FU, leucovovin; anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NOLVADEX® tamoxifen), raloxifene (EVISTA®), droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (FARESTON®); anti-progesterones; estrogen receptor down-regulators (ERDs); estrogen receptor antagonists such as fulvestrant (FASLODEX®); agents that function to suppress or shut down the ovaries, for example, leutinizing hormone-releasing hormone (LHRH) agonists such as leuprolide acetate (LUPRON® and ELIGARD®), goserelin acetate, buserelin acetate and tripterelin; other anti-androgens such as flutamide, nilutamide and bicalutamide; and aromatase inhibitors that inhibit the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)-imidazoles, aminoglutethimide, megestrol acetate (MEGASE®), exemestane (AROMASIN®), formestanie, fadrozole, vorozole (RIVISOR®), letrozole (FEMARA®), and anastrozole (ARIMIDEX®); bisphosphonates such as clodronate (for example, BONEFOS® or OSTAC®), etidronate (DIDROCAL®), NE-58095, zoledronic acid/zoledronate (ZOMETA®), alendronate (FOSAMAX®), pamidronate (AREDIA®), tiludronate (SKELID®), or risedronate (ACTONEL®); troxacitabine (a 1,3-dioxolane nucleoside cytosine analog); aptamers, described for example in U.S. Pat. No. 6,344,321, which is herein incorporated by reference in its entirety; anti HGF monoclonal antibodies (e.g., AV299 from Aveo, AMG102, from Amgen); truncated mTOR variants (e.g., CGEN241 from Compugen); protein kinase inhibitors that block mTOR induced pathways (e.g., ARQ197 from Arqule, XL880 from Exelexis, SGX523 from SGX Pharmaceuticals, MP470 from Supergen, PF2341066 from Pfizer); vaccines such as THERATOPE® vaccine and gene therapy vaccines, for example, ALLOVECTIN® vaccine, LEUVECTIN® vaccine, and VAXID® vaccine; topoisomerase 1 inhibitor (e.g., LURTOTECAN®); rmRH (e.g., ABARELIX®); lapatinib ditosylate (an ErbB-2 and EGFR dual tyrosine kinase small-molecule inhibitor also known as GW572016); COX-2 inhibitors such as celecoxib (CELEBREX®; 4-(5-(4-methylphenyl)-3-(trifluoromethyl)-1H-pyrazol-1-yl) benzenesulfonamide; and pharmaceutically acceptable salts, acids or derivatives of any of the above.
In some embodiments, cells described herein (e.g., cells modified using methods of the disclosure) are used in combination with one or more cancer treatment modalities that facilitate the induction of antibody dependent cellular cytotoxicity (ADCC) (see e.g., Janeway's Immunobiology by K. Murphy and C. weaver). In some embodiments, such a cancer treatment modality is an antibody. In some embodiments, such an antibody is Trastuzumab. In some embodiments, such an antibody is Rituximab. In some embodiments, such an antibody is Rituximab, Palivizumab, Infliximab, Trastuzumab, Alemtuzumab, Adalimumab, Ibritumomab tiuxetan, Omalizumab, Cetuximab, Bevacizumab, Natalizumab, Panitumumab, Ranibizumab, Certolizumab pegol, Ustekinumab, Canakinumab, Golimumab, Ofatumumab, Tocilizumab, Denosumab, Belimumab, Ipilimumab, Brentuximab vedotin, Pertuzumab, Trastuzumab emtansine, Obinutuzumab, Siltuximab, Ramucirumab, Vedolizumab, Blinatumomab, Nivolumab, Pembrolizumab, Idarucizumab, Necitumumab, Dinutuximab, Secukinumab, Mepolizumab, Alirocumab, Evolocumab, Daratumumab, Elotuzumab, Ixekizumab, Reslizumab, Olaratumab, Bezlotoxumab, Atezolizumab, Obiltoxaximab, Inotuzumab ozogamicin, Brodalumab, Guselkumab, Dupilumab, Sarilumab, Avelumab, Ocrelizumab, Emicizumab, Benralizumab, Gemtuzumab ozogamicin, Durvalumab, Burosumab, Lanadelumab, Mogamulizumab, Erenumab, Galcanezumab, Tildrakizumab, Cemiplimab, Emapalumab, Fremanezumab, Ibalizumab, Moxetumomab pasudodox, Ravulizumab, Romosozumab, Risankizumab, Polatuzumab vedotin, Brolucizumab, or any combination thereof (see e.g., Lu et al., Development of therapeutic antibodies for the treatment of diseases. Journal of Biomedical Science, 2020). In some embodiments, cells described herein (e.g., cells modified using methods of the disclosure) are used in combination with one or more cancer treatment modalities that facilitate the induction of antibody dependent cellular cytotoxicity (ADCC), wherein the cancer treatment modality is an antibody or appropriate fragment thereof targeting CD20, TNFα, HER2, CD52, IgE, EGFR, VEGF-A, ITGA4, CTLA-4, CD30, VEGFR2, α4β7 integrin, CD19, CD3, PD-1, GD2, CD38, SLAMF7, PDGFRα, PD-L1, CD22, CD33, IFNγ, CD79β, or any combination thereof.
In some embodiments, cells described herein are utilized in combination with checkpoint inhibitors. Examples of suitable combination therapy checkpoint inhibitors include, but are not limited to, antagonists of PD-1 (Pdcdl, CD279), PDL-1 (CD274), TIM-3 (Havcr2), TIGIT (WUCAM and Vstm3), LAG-3 (Lag3, CD223), CTLA-4 (Ctla4, CD152), 2B4 (CD244), 4-1BB (CD137), 4-1BBL (CD137L), A2aR, BATE, BTLA, CD39 (Entpdl), CD47, CD73 (NT5E), CD94, CD96, CD160, CD200, CD200R, CD274, CEACAMI, CSF-1R, Foxpl, GARP, HVEM, IDO, EDO, TDO, LAIR-1, MICA/B, NR4A2, MAFB, OCT-2 (Pou2f2), retinoic acid receptor alpha (Rara), TLR3, VISTA, NKG2A/HLA-E, inhibitory KIR (for example, 2DL1, 2DL2, 2DL3, 3DL1, and3DL2), or any suitable combination thereof.
In some embodiments, the antagonist inhibiting any of the above checkpoint molecules is an antibody. In some embodiments, the checkpoint inhibitory antibodies may be murine antibodies, human antibodies, humanized antibodies, a camel Ig, a shark heavychain-only antibody (VNAR), Ig NAR, chimeric antibodies, recombinant antibodies, or antibody fragments thereof. Non-limiting examples of antibody fragments include Fab, Fab′, F(ab)′2, F(ab)′3, Fv, single chain antigen binding fragments (scFv), (scFv)2, disulfide stabilized Fv (dsFv), minibody, diabody, triabody, tetrabody, single-domain antigen binding fragments (sdAb, Nanobody), recombinant heavy-chain-only antibody (VHH), and other antibody fragments that maintain the binding specificity of the whole antibody, which may be more cost-effective to produce, more easily used, or more sensitive than the whole antibody. In some embodiments, the one, or two, or three, or more checkpoint inhibitors comprise at least one of atezolizumab (anti-PDL1 mAb), avelumab (anti-PDL1 mAb), durvalumab (anti-PDL1 mAb), tremelimumab (anti-CTLA4 mAb), ipilimumab (anti-CTLA4 mAb), IPH4102 (anti-KIR), IPH43 (anti-MICA), IPH33 (anti-TLR3), lirimumab (anti-KIR), monalizumab (anti-NKG2A), nivolumab (anti-PDl mAb), pembrolizumab (anti-PD 1 mAb), and any derivatives, functional equivalents, or biosimilars thereof.
In some embodiments, the antagonist inhibiting any of the above checkpoint molecules is microRNA-based, as many miRNAs are found as regulators that control the expression of immune checkpoints (Dragomir et al, Cancer Biol Med. 2018, 15(2): 103-115). In some embodiments, the checkpoint antagonistic miRNAs include, but are not limited to, miR-28, miR-15/16, miR-138, miR-342, miR-20b, miR-21, miR-130b, miR-34a, miR-197, miR-200c, miR-200, miR-17-5p, miR-570, miR-424, miR-155, miR-574-3p, miR-513, miR-29c, and/or any suitable combination thereof.
In some embodiments, cells described herein (e.g., cells modified using methods of the disclosure) are used in combination with one or more cancer treatment modalities such as exogenous interleukin (IL) dosing. In some embodiments, an exogenous IL provided to a patient is IL-15. In some embodiments, systemic IL-15 dosing when used in combination with cells described herein is reduced when compared to standard dosing concentrations (see e.g., Waldmann et al., IL-15 in the Combination Immunotherapy of Cancer. Front. Immunology, 2020).
Other compounds that are effective in treating cancer are known in the art and described herein that are suitable for use with the compositions and methods of the present disclosure as additional cancer treatment modalities are described, for example, in the “Physicians' Desk Reference, 62nd edition. Oradell, N.J.: Medical Economics Co., 2008”, Goodman & Gilman's “The Pharmacological Basis of Therapeutics, Eleventh Edition. McGraw-Hill, 2005”, “Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000,” and “The Merck Index, Fourteenth Edition. Whitehouse Station, N.J.: Merck Research Laboratories, 2006”, incorporated herein by reference in relevant parts.
All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
Throughout this specification, unless the context requires otherwise, the words “comprise”, “comprises” and “comprising” will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. By “consisting of” is meant including, and limited to, whatever follows the phrase “consisting of:” Thus, the phrase “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. By “consisting essentially of” is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially” of indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.
These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.
The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. The contents of database entries, e.g., NCBI nucleotide or protein database entries provided herein, are incorporated herein in their entirety. Where database entries are subject to change over time, the contents as of the filing date of the present application are incorporated herein by reference. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.
The disclosure is further illustrated by the following examples. The examples are provided for illustrative purposes only. They are not to be construed as limiting the scope or content of the disclosure in any way.
This example describes the screening of AsCpf1 (AsCas12a) guide RNAs that target the housekeeping gene GAPDH. GAPDH encodes Glyceraldehyde-3-Phosphate Dehydrogenase, an essential protein that catalyzes oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD), an important energy-yielding step in carbohydrate metabolism. The guide RNAs used in this analysis were all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targeting domain sequence]-3′ (SEQ ID NO: 90). For example, the guide RNA denoted RSQ22337 had the following sequence:
where the 21-mer targeting domain sequence is underlined. The guide RNAs with the targeting domain sequences shown in Table 7 were tested to determine how effective they were at editing GAPDH. Cas12a RNPs (RNPs having an engineered Cas12a (SEQ ID NO: 62)), containing each of these guide RNAs were transfected into iPSCs, and then editing levels were assayed three days after transfection (see e.g., Wong, K. G. et al. CryoPause: A New Method to Immediately Initiate Experiments after Cryopreservation of Pluripotent Stem Cells. Stem Cell Reports 9, 355-365 (2017)). The results are shown in
The data in
To test the feasibility of the exemplary selection system illustrated in
The CRISPR/Cas nuclease and guide RNA were introduced into cells by nucleofection (electroporation) of a ribonucleoprotein (RNP) according to known methods. The cells were also contacted with a double stranded DNA donor template (e.g., a dsDNA plasmid) that included a knock-in cassette comprising in 5′-to-3′ order, a 5′ homology arm approximately 500 bp in length (comprising a portion of exon 8, intron 8, and a 5′ codon-optimized coding portion of exon 9 optimized to prevent further binding of the gRNA targeting domain sequence of the guide RNA (RSQ22337)), an in-frame sequence encoding the P2A self-cleaving peptide (“P2A”), an in-frame coding sequence for CD47 (“Cargo”), a stop codon and polyA signal sequence, and a 3′ homology arm approximately 500 bp in length (comprising a coding portion of exon 9 including a stop codon, the 3′ exonic region of exon 9, and a portion of the downstream intergenic sequence) (as shown in
As shown schematically in
The editing efficiency of RNPs containing RSQ22337 were tested at different concentrations (4 μM, 1 μM, 0.25 μM, or 0.0625 μM of RNP) in the absence of double stranded DNA donor template) was first measured at 48 after nucleofection of iPSCs (a time point prior to cell death due to loss of GAPDH gene function). The results show that a concentration of 4 μM resulted in the highest editing levels.
An experiment was then conducted to test the mechanism of the selection system described above by confirming that edited cells containing a successfully knocked-in cargo gene would be more efficiently selected for using a gRNA targeting a protein-coding exonic portion of GAPDH rather than a gRNA targeting an intron.
In an additional set of experiments, iPS cells were contacted with an RNP containing AsCas12a (SEQ ID NO: 62), and RSQ22337 (SEQ ID NO: 95) or RSQ24570 (SEQ ID NO: 108), along with either the PLA1593 (comprising donor template SEQ ID NO: 44) or the PLA1651 (comprising donor template SEQ ID NO: 46) double stranded DNA donor template plasmid, respectively, as described above. Flow cytometry was performed 7 days following nucleofection to detect GFP expression and help determine to what extent each plasmid mediated donor template and knock-in cassette was integrated successfully at its respective GAPDH target site. The GAPDH results in
In some cases, it is desirable to use the selection and cargo knock in strategies disclosed herein to efficiently produce and isolate an edited cell containing two or more different exogenous coding sequences, e.g., two or more different exogenous genes, integrated into a single essential gene locus, such as, e.g., the GAPDH locus.
Experiments were conducted to test the integration strategy depicted in
An experiment was conducted to test the bi-allelic integration strategy depicted in
An additional experiment was conducted to test biallelic insertion of GFP and mCherry in populations of iPSCs. The iPSC populations were transformed as described. The cells were nucleofected with 0.5 μM RNPs comprising Cas12a and RSQ22337 (targeting the GAPDH locus, as described in Examples 1 and 2), and 2.5 μg of donor template (5 trials) or 5 μg of donor template (1 trial), and then sorted 3 or 9 days following nucleofection. An exemplary image of the edited cell populations that were analyzed by flow cytometry analysis is depicted in
The approach described in Example 2 is used to target the B2M gene in NK cells (e.g., by targeting NK cells such as iPS-derived NK cells directly or iPS cells that are then differentiated into NK cells). NK cells that lack a functional B2M gene will not be able to recognize MHC Class I on the surface of one another and will attack each other, depleting the population in a phenomenon known as fratricide. By knocking-out the B2M gene and knocking-in a “cargo” sequence that also restores a functional B2M gene one automatically enriches for the knock-in cell type.
The knock-in integration and selection approach described in Example 2 was evaluated for potential use in targeting other essential genes in cells, e.g., ribosomal genes such as the RPLP0 gene. The RPLP0 gene encodes a ribosomal protein that is a component of the 60S subunit. Ribosomal protein PO is the functional equivalent of E. coli protein L10 and is generally used as a housekeeping gene in RT-qPCR assays.
Exemplary AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the RPLP0 gene are shown in Table 8 below. The guide RNAs are all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targeting domain sequence]-3′ (SEQ ID NO: 90).
However, analysis of potential off-target sites elsewhere in the genome (outside of the RPLP0 locus) for the gRNAs in Table 8 reveal several identical or almost identical target binding sites for the gRNAs in other essential genes associated with ribosomal structure or function, likely due to the highly conserved nature of ribosomal genes (data not shown). Transfecting cells with RNPs containing the gRNAs from Table 8 could potentially kill most of the cells by introducing indels at other essential genes besides RPLP0, even in the presence of a donor plasmid designed to restore the edited RPLP0 gene, as described in Example 2. Additionally, and/or alternatively, off-targets may titrate away RNP complexes from the primary target locus, resulting in a reduced editing rate, and reduction of desired integration events. Thus, these particular gRNA targeting sites in RPLP0 were discounted as possible candidates for a knock-in integration and selection approach as described herein.
The knock-in integration and selection approach described in Example 2 was evaluated for potential use in targeting other essential genes in cells. The RPL13A gene is associated with ribosomes but is not required for canonical ribosome function and has extra-ribosomal functions. It is involved in the methylation of rRNA and is generally used as a housekeeping gene in RT-qPCR assays.
Exemplary AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the RPL13A gene are shown in Table 9 below. The guide RNAs are all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targeting domain sequence]-3′ (SEQ ID NO: 90).
However, analysis of potential off-target sites elsewhere in the genome (outside of the RPL13A locus) for the gRNAs in Table 9 reveal several identical or almost identical target binding sites for the gRNAs in other essential genes associated with ribosomal structure or function, likely due to the highly conserved nature of ribosomal genes (data not shown). Transfecting cells with RNPs containing the gRNAs from Table 9 could potentially kill most of the cells by introducing indels at other essential genes besides RPL13A, even in the presence of a donor plasmid designed to restore the edited RPL13A gene, as described in Example 2. Additionally, and/or alternatively, off-targets may titrate away RNP complexes from the primary target locus, resulting in a reduced editing rate, and reduction of desired integration events. Thus, these particular gRNA targeting sites in RPL13A were discounted as possible candidates for a knock-in integration and selection approach as described herein.
The knock-in integration and selection approach described in Example 2 was evaluated for potential use in targeting other essential genes in cells, e.g., ribosomal genes such as the RPL7 gene in cells. The RPL7 gene encodes a ribosomal protein that is a component of the 60S subunit. This ribosomal protein binds to G-rich structures in 28S rRNA and in mRNA and plays a regulatory role in the translation apparatus.
Exemplary AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the RPL7 gene are shown in Table 10 below. The guide RNAs are all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targeting domain sequence]-3′ (SEQ ID NO: 90).
However, analysis of potential off-target sites elsewhere in the genome (outside of the RPL7 locus) for the gRNAs in Table 10 reveal several identical or almost identical target binding sites for the gRNAs in other essential genes associated with ribosomal structure or function, likely due to the highly conserved nature of ribosomal genes (data not shown). Transfecting cells with RNPs containing the gRNAs from Table 10 could potentially kill most of the cells by introducing indels at other essential genes besides RPL7, even in the presence of a donor plasmid designed to restore the edited RPL7 gene, as described in Example 2. Additionally, and/or alternatively, off-targets may titrate away RNP complexes from the primary target locus, resulting in a reduced editing rate, and reduction of desired integration events. Thus, these particular gRNA targeting sites in RPL7 were discounted as possible candidates for a knock-in integration and selection approach as described herein.
The knock-in integration and selection approach described in Example 2 was used to target the TBP gene in iPSCs. While iPSCs were tested for the purposes of this experiment, the described methods could be applied to other cell types. The TBP gene encodes TATA-box binding protein, a transcriptional regulator that plays a key role in the transcription initiation apparatus. AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the TBP gene are shown in Table 11 below. The guide RNAs are all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targeting domain sequence]-3′ (SEQ ID NO: 90).
RSQ33502, RSQ33503, and RSQ33504 (SEQ ID NO: 148-150) described in Table 11 were each determined to be highly specific to TBP and have minimal off-target sites in the genome (data not shown). The TBP gene was thus considered a good candidate gene target for the cargo integration and selection methods described herein at least in part because there are gRNAs available capable of very specifically targeting a terminal exon (mRNA isoform 1 exon 8, or mRNA isoform 2 exon 7 respectively). However, for any of these gRNAs to be highly suitable for the methods described herein, they need to be highly effective at introducing indels at a location in the TBP locus that would knock out and/or severely reduce gene function.
Each of these gRNAs was then tested to determine whether it could be used to knock-in a cassette comprising a portion of TBP and an in-frame cargo sequence encoding GFP into a terminal exon of the TBP gene of cells, in the process rescuing the lethal phenotype that would otherwise result by introducing RNP-induced indels into the coding region of this essential gene. If the tested gRNA was effective at introducing indels at a location of TBP important for function at a high frequency, then transfected cells that do not undergo HDR to incorporate the knock-in cassette would be expected to die, resulting in a large population of the cells expressing GFP from the TBP locus. Specifically, iPSC cells were contacted with an RNP containing AsCas12a (SEQ ID NO: 62), and RSQ33502, RSQ33503 or RSQ33504 (SEQ ID NOs: 148-150), along with a double stranded DNA donor template (dsDNA plasmid) designed to mediate HDR at each respective gRNA target binding site. The double stranded DNA donor templates included a knock-in cassette with a coding sequence for GFP (“Cargo”) in frame with and downstream (3′) of a codon optimized version of a portion of the final TBP exon coding sequence (mRNA isoform 1 exon 8, or mRNA isoform 2 exon 7 respectively) and a sequence encoding the P2A self-cleaving peptide (“P2A”), similar to the dsDNA plasmid described in Example 2 for GAPDH. The TBP sequence in the double stranded DNA donor templates (PLA1615, PLA1616, or PLA1617; comprising donor template SEQ ID NOs: 47, 49, or 50) was codon optimized to prevent further binding by the accompanying guide RNA molecule (RSQ33502, RSQ33503 or RSQ33504). The knock-in cassette also included 3′ UTR and polyA signal sequences downstream of the Cargo sequence. An RNP containing RSQ33502 was administered with PLA1615 (comprising donor template SEQ ID NO: 47); RSQ33503 was administered with PLA1616 (comprising donor template SEQ ID NO: 49); and RSQ33504 was administered with PLA1617 (comprising donor template SEQ ID NO: 50). Each particular dsDNA plasmid (PLA) contained a donor template with homology arms and a knock-in cassette designed to specifically encompass and render ineffective the particular gRNA target site following knock-in cassette integration.
Flow cytometry was performed 7 days following nucleofection and was used to help determine to what extent each plasmid based knock-in cassette was integrated successfully at its respective TBP target site.
The knock-in integration and selection approach described in Example 2 was used to target the E2F4 gene in iPSCs. While iPSCs were tested for the purposes of this experiment, the described methods could be applied to other cell types. The E2F4 gene encodes E2F Transcription Factor 4. This transcriptional regulator plays a key role in cell cycle regulation. AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the E2F4 gene are shown in Table 12 below. The guide RNAs are all 41-mer RNA molecules with the following design: 5′-UAAUUUCUACUCUUGUAGAU-[21-mer targetin domain sequence]-3′ (SEQ ID NO: 90).
RSQ33505, RSQ33506, and RSQ33507 (SEQ ID NOs: 151-153) were each determined to be highly specific to E2F4 and have minimal off-target sites in the genome (data not shown). The E2F4 gene was thus considered a good candidate gene target for the cargo integration and selection methods described herein at least in part because there are gRNAs available that are capable of very specifically targeting a terminal exon (exon 10). However, for any of these gRNAs to be highly suitable for the methods described herein, they need to be highly effective at introducing indels at a location in the E2F4 locus that would knock out or severely reduce gene function.
The gRNAs RSQ33505, RSQ33506, and RSQ33507 (SEQ ID NOs: 151-153) were then tested to determine whether they could be used to knock-in a cassette comprising a portion of E2F4 and a cargo sequence encoding GFP into a terminal exon of the E2F4 locus of cells, in the process rescuing the lethal phenotype that would otherwise result by introducing RNP-induced indels into the coding region of this essential gene at a high frequency. Specifically, iPSCs were contacted with an RNP containing AsCas12a (SEQ ID NO: 62), and RSQ33505, RSQ33506, or RSQ33507 (SEQ ID NOs: 151-153) along with a double stranded DNA donor template (dsDNA plasmid) designed to mediate HDR at each respective gRNA target binding site. The double stranded DNA donor templates included a knock-in cassette with a coding sequence for GFP (“Cargo”) in frame with and downstream (3′) of a codon optimized version of the final E2F4 exon coding sequence (exon 10) and a sequence encoding the P2A self-cleaving peptide (“P2A”), similar to the dsDNA plasmid described in Example 2 for GAPDH. The E2F4 sequence in the double stranded DNA donor templates (PLA1626, PLA1627, or PLA1628; comprising donor template SEQ ID NOs: 52-54) was codon optimized to prevent further binding by the accompanying guide RNA molecule (RSQ33505, RSQ33506 or RSQ33507; SEQ ID NOs: 151-153). The knock-in cassette also included 3′ UTR and polyA signal sequences downstream of the Cargo sequence. An RNP containing RSQ33505 (SEQ ID NO: 151) was administered with PLA1626 (comprising donor template SEQ ID NO: 52); RSQ33506 (SEQ ID NO: 152) was administered with PLA1627 (comprising donor template SEQ ID NO: 53); and RSQ33507 (SEQ ID NO: 153) was administered with PLA1628 (comprising donor template SEQ ID NO: 54). Each particular dsDNA plasmid (PLA) contained a donor template with homology arms and a knock-in cassette designed to specifically encompass and render ineffective the particular gRNA target site following integration.
Flow cytometry was performed 7 days following nucleofection and was used to help determine to what extent each plasmid based knock-in cassette was integrated successfully at its respective E2F4 target site.
The knock-in integration and selection approach described in Example 2 was used to target the G6PD gene in iPSCs. While iPSCs were tested for the purposes of this experiment, the described methods could be applied to other cell types. The G6PD gene encodes Glucose-6-Phosphate Dehydrogenase. This metabolic enzyme plays a key role in glycolysis and NADPH production. An AsCpf1 (AsCas12a) guide RNA that targets terminal exons of the G6PD gene is shown in Table 13 below.
RSQ33508 (SEQ ID NO: 154) was determined to be highly specific to G6PD and has minimal off-target sites in the genome (data not shown). The G6PD gene was thus considered a good candidate gene target for the cargo integration and selection methods described herein at least in part because there are gRNAs available that are capable of specifically targeting a terminal exon (exon 13).
The gRNA RSQ33508 (SEQ ID NO: 154) was then tested to determine whether it could be used to knock-in a cassette comprising a portion of G6PD and a cargo sequence encoding GFP into a terminal exon of the G6PD locus of cells, in the process rescuing the lethal phenotype that would otherwise result by introducing RNP-induced indels into the coding region of this essential gene at a high frequency. Specifically, iPSCs were contacted with an RNP containing AsCas12a (SEQ ID NO: 62), and RSQ33508 (SEQ ID NO: 154) along with a double stranded DNA donor template (dsDNA plasmid) designed to mediate HDR at the gRNA target binding site. The double stranded DNA donor templates included a knock-in cassette with a coding sequence for GFP (“Cargo”) in frame with and downstream (3′) of a codon optimized version of the final G6PD exon coding sequence (exon 13) and a sequence encoding the P2A self-cleaving peptide (“P2A”), similar to the dsDNA plasmid described in Example 2 for GAPDH. The G6PD sequence in the double stranded DNA donor templates (PLA1618; comprising donor template SEQ ID NO: 51) was codon optimized to prevent further binding by the accompanying guide RNA molecule (RSQ33508). The knock-in cassette also included 3′ UTR and polyA signal sequences downstream of the Cargo sequence. An RNP containing RSQ33508 (SEQ ID NO: 154) was administered with PLA1618 (comprising donor template SEQ ID NO: 51). The dsDNA plasmid (PLA) contained a donor template with homology arms and a knock-in cassette designed to specifically encompass and render ineffective the accompanying gRNA target site following integration.
Flow cytometry was performed 7 days following nucleofection and was used to help determine to what extent the plasmid based knock-in cassette was integrated successfully at its G6PD target site.
The knock-in integration and selection approach described in Example 2 was used to target the KIF11 gene in iPSCs. While iPSCs were tested for the purposes of this experiment, the described methods could be applied to other cell types. The KIF11 gene encodes Kinesin Family Member 11. This enzyme plays a key role in vesicle movement along intracellular microtubules and chromosome positioning during mitosis. AsCpf1 (AsCas12a) guide RNAs that target terminal exons of the KIF11 gene are shown in Table 14 below.
RSQ33509, RSQ33510, and RSQ33511 (SEQ ID NOs: 155-157) were each determined to be highly specific to KIF11 and have minimal off-target sites in the genome (data not shown). The KIF11 gene was thus considered a good candidate gene target for the cargo integration and selection methods described herein at least in part because there are gRNAs available that are capable of very specifically targeting a terminal exon available (exon 22). However, for any of these gRNAs to be highly suitable for the methods described herein, they need to be highly effective at introducing indels at a location in the KIF11 locus that would knock out or severely reduce gene function.
Each of these gRNAs was then tested to determine whether it could be used to knock-in a cassette comprising a portion of KIF11 and a cargo sequence encoding GFP into a terminal exon of the KIF11 locus of cells, in the process rescuing the lethal phenotype that would otherwise result by introducing RNP-induced indels into the coding region of this essential gene at a high frequency. Specifically, iPSC cells were contacted with an RNP containing AsCas12a (SEQ ID NO: 62), and RSQ33509, RSQ33510, or RSQ33511 (SEQ ID NOs: 155-157), along with a double stranded DNA donor template (dsDNA plasmid) designed to mediate HDR at each respective gRNA target binding site. The double stranded DNA donor templates included a knock-in cassette with a coding sequence for GFP (“Cargo”) in frame with and downstream (3′) of a codon optimized version of the final KIF11 exon coding sequence (exon 22) and a sequence encoding the P2A self-cleaving peptide (“P2A”), similar to the dsDNA plasmid described in Example 2 for GAPDH. The KIF11 sequence in the double stranded DNA donor templates (PLA1629, PLA1630, or PLA1631; comprising donor template SEQ ID NOs: 55-57) was codon optimized to prevent further binding by the accompanying guide RNA molecule (RSQ33509, RSQ33510, or RSQ33511; SEQ ID NOs: 155-157). The knock-in cassette also included 3′ UTR and polyA signal sequences downstream of the Cargo sequence. An RNP containing RSQ33509 (SEQ ID NO: 155) was administered with the PLA1629 plasmid (comprising donor template SEQ ID NO: 55); RSQ33510 (SEQ ID NO: 156) was administered with PLA1630 (comprising donor template SEQ ID NO: 56); and RSQ33511 (SEQ ID NO: 157) was administered with PLA1631(comprising donor template SEQ ID NO: 57). Each particular dsDNA plasmid (PLA) contained a donor template with homology arms and a knock-in cassette designed to specifically encompass and render ineffective the particular gRNA target site following integration.
Flow cytometry was performed 7 days following nucleofection and was used to help determine to what extent each plasmid knock-in cassette was integrated successfully at its respective KIF11 target site.
The present example describes use of the gene editing methods described herein comprising viral vector transduction of a cell population.
The target cells described herein are collected from a donor subject or a subject in need to therapy (e.g., a patient). Following an appropriate sorting, culturing, and/or differentiation process, target cells are transduced with at least one AAV vector comprising a nucleotide sequence comprising a gRNA, a suitable nuclease, and/or a suitable rescue construct. Cells are sorted using flow cytometry to determine successful transduction, editing, integration, and/or expression events.
A population of hematopoietic stem cells are transduced with an AAV vector (e.g., AAV6) comprising GAPDH targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ22337 of SEQ ID NO: 95) and PLA1593 (comprising donor template SEQ ID NO: 44). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the GAPDH locus by the RNP and have integrated the knock-in cassette via HDR. A population of hematopoietic stem cells are transduced with an AAV vector (e.g., AAV6) comprising TBP targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ33503 of SEQ ID NO: 149) and PLA1616 (comprising donor template SEQ ID NO: 49). Successful transduction, editing, integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the TBP locus by the RNP and have integrated the knock-in cassette via HDR.
A population of T cells are transduced with an AAV vector (e.g., AAV6) comprising GAPDH targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ22337 of SEQ ID NO: 95) and PLA1593 (comprising donor template SEQ ID NO: 44). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the GAPDH locus by the RNP and have integrated the knock-in cassette via HDR. A population of T cells are transduced with an AAV vector (e.g., AAV6) comprising TBP targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ33503 of SEQ ID NO: 149) and PLA1616 (comprising donor template SEQ ID NO: 49). Successful transduction, editing, integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the TBP locus by the RNP and have integrated the knock-in cassette via HDR.
A population of NK cells are transduced with an AAV vector (e.g., AAV6) comprising GAPDH targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ22337 of SEQ ID NO: 95) and PLA1593 (comprising donor template SEQ ID NO: 44). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the GAPDH locus by the RNP and have integrated the knock-in cassette via HDR. A population of NK cells are transduced with an AAV vector (e.g., AAV6) comprising TBP targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ33503 of SEQ ID NO: 149) and PLA1616 (comprising donor template SEQ ID NO: 49). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the TBP locus by the RNP and have integrated the knock-in cassette via HDR.
A population of tumor-infiltrating lymphocytes (TILs) are transduced with an AAV vector (e.g., AAV6) comprising GAPDH targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ22337 of SEQ ID NO: 95) and PLA1593 (comprising donor template SEQ ID NO: 44). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the GAPDH locus by the RNP and have integrated the knock-in cassette via HDR. A population of tumor-infiltrating lymphocytes (TILs) are transduced with an AAV vector (e.g., AAV6) comprising TBP targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ33503 of SEQ ID NO: 149) and PLA1616 (comprising donor template SEQ ID NO: 49). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the TBP locus by the RNP and have integrated the knock-in cassette via HDR.
A population of neurons are transduced with an AAV vector (e.g., AAV6) comprising GAPDH targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ22337 of SEQ ID NO: 95) and PLA1593 (comprising donor template SEQ ID NO: 44). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the GAPDH locus by the RNP and have integrated the knock-in cassette via HDR. A population of neurons are transduced with an AAV vector (e.g., AAV6) comprising TBP targeting RNP (including Cas12a of SEQ ID NO: 62 and gRNA RSQ33503 of SEQ ID NO: 149) and PLA1616 (comprising donor template SEQ ID NO: 49). Successful transduction, editing, knock-in cassette integration, and/or expression events are determined using flow cytometry, as described herein. Following AAV transduction, a large proportion of the cells are edited at the TBP locus by the RNP and have integrated the knock-in cassette via HDR.
The present example describes gene editing of populations of T cells using methods described herein comprising viral vector transduction of populations of T cells. The methods described herein can be applied to other cell types as well, such as other immune cells.
T cells were thawed in a bead bath as known in the art and were removed from the bath on day two. Cells were electroporated on day four after thawing, in brief 250,000 T cells per well in a Lonza 96-well cuvette were suspended in buffer P2 and electroporated using pulse code CA-137 with varying concentrations of RNP comprising gRNA RSQ22337 (SEQ ID NO: 95) and Cas12a (SEQ ID NO: 62) targeting the GAPDH gene (4 μM RNP, 2 μM RNP, 1 μM RNP, or 0.5 μM RNP). Appropriate media was added to cells immediately after electroporation and cells were allowed to recover for 15 minutes. AAV6 viral particles comprising a donor plasmid construct containing a knock-in cassette with a GFP cargo were then added to T cells at varying multiplicity of infection (MOI) concentrations (5E4, 2.5E4, 1.25E4, 6.25E3, 3.13E3, 1.56E3, or 7.81E2). The donor plasmid was designed as described in Example 2, with a 5′ codon-optimized coding portion of GAPDH exon 9 optimized to prevent further binding of the gRNA targeting domain sequence of the guide RNA (RSQ22337)), an in-frame sequence encoding the P2A self-cleaving peptide (“P2A”), an in-frame coding sequence for GFP (“Cargo”), a stop codon and polyA signal sequence. T cells were split two days later, and then every 48 hours until they were analyzed by flow cytometry. T cells were sorted using flow cytometry seven days post electroporation to determine successful transduction, transformation, editing, knock-in cassette integration, and/or expression events (see
Furthermore, knock-in efficiencies using methods described herein were compared to optimized versions of methods known in the art. In brief, T cell populations were transduced with AAV6 vector comprising a donor template suitable for knock-in of GFP at the GAPDH gene as described herein, and were transformed with gRNA RSQ22337 (SEQ ID NO: 95) and Cas12a (SEQ ID NO: 62) as described above; alternatively, T cell populations were subject to highly optimized GFP knock-in at the TRAC locus using AAV6 vector transduction (see e.g., Vakulskas et al. A high-fidelity Cas9 mutant delivered as a ribonucleoprotein complex enables efficient gene editing in human hematopoietic stem and progenitor cells. Nat Med. 2018; 24(8):1216-1224). Flow cytometry was utilized to measure knock-in efficiency (determined by percentage of T cell population expressing GFP, measured 7 days post-electroporation). Knock-in rates at the TRAC locus were high (˜50%) when compared to publicly described integration frequencies for similar methodologies, however, knock-in efficiency at the GAPDH gene using methods described herein facilitated by AAV6 transduction were significantly (p=0.0022 using unpaired t-test) higher (˜68%) (see
The present example describes use of gene editing methods described herein to create modified immune cells suitable for killing cancer cells.
PSCs were edited using the exemplary system illustrated in
The cargo gene CD16 was successfully integrated into the GAPDH gene of iPSCs at high efficiencies using the selection systems described herein.
From bulk edited cell populations, single cells were propagated to homogenize genotypes. Shown in
Following confirmation of CD16-encoding “cargo” integration at the GAPDH gene, homogenized cell lines were differentiated into Natural Killer (NK) immune cells using spin embryoid body methods as known in the art. In brief, iPSCs were placed in an ultra-low attachment 96-well plate at 5,000 to 6,000 cells per well in order to form embryoid bodies (EBs). On day 11 EBs were transferred to a flask where they remain for the remainder of the experiment (see Ye Li et al., Cell Stem Cell. 2018 Aug. 2; 23(2): 181-192.e5). At day 32 of the differentiation process, cells were analyzed using flow cytometry methods known in the art. Following standard control gating experiments (see Ye Li et al., Cell Stem Cell. 2018 Aug. 2; 23(2): 181-192.e5), the differentiation process was analyzed using expression of markers CD56 and CD45, following this, co-expression of markers CD56 and CD16 was measured. As shown in
These differentiated iNK cells comprising knock-in of the gene of interest (CD16) at the GAPDH gene were then subject to challenge by various cancer cell lines to determine their cytotoxic capacity. An exemplary 3D solid tumor killing assay is depicted in
As shown in
To further elucidate the functionality of the edited iNKs, the cells were subjected to repeated exposure to tumor cells, and the ability of the edited iNKs to kill tumor targets repeatedly over a multiday period was analyzed in an in vitro serial killing assay. Results of this experiment are depicted in
Positive targeted integration events at the GAPDH gene and cellular phenotypes were noted for integration of GFP, CD47, or CD16 as described above in Example 2 and Example 15. Additional or alternative cargo sequences may be incorporated into the GAPDH gene or other suitable essential genes as described herein with high integration rates. The essential gene GAPDH was targeted in iPSC cells using an RNP containing AsCpf1 (SEQ ID NO: 62) and a guide RNA (RSQ22337; SEQ ID NO: 95), resulting in a double-strand break towards the 5′ end of the last exon of GAPDH (exon 9), as described in Example 2. A donor plasmid containing a knock-in cassette with the cargo of interest was also electroporated with the RNP. As shown in
An exemplary ddPCR experiment was used to measure the targeted integration (TI) rates as follows. In brief, TI was measured using a universal set of primers that captures both the 5′ homology arm and 3′ polyA tail for the GAPDH terminal exon region, and can detect cargos independent of the particular sequence of the specific cargo. The 5′ CDN primer and 3′ PolyA primer and FAM fluorophore probes are made in combination. An appropriate reference gene probe is a TTC5 HEX probe. For the reaction, probes, genomic DNA, BioRad master mix, and 2× control buffer were mixed together in ratios consistent with manufacturer recommendations. First, genomic DNA was placed in the BioRad 96 well plate (9.2 μl total genomic DNA+water), next, master mix with primer probes sets (13.8 μl per well) were added. Water controls comprised a 5′ primer probe set master mix in one well, and a 3′ primer probe set master mix in a different well. For blank well controls, a 50/50 mix of 2× control buffer and water (25 μl total) was added. The auto droplet generator was then prepared and run. Once droplets were generated, the ddPCR plates were sealed at 180° C. and then placed in a thermocycler for amplification. 5′ CDN primer: CATCGCATTGTCTGAGTAGGTGTC (SEQ ID NO: 219), 3′ PolyA primer: TGCCCACAGAATAGCTTCTTCC (SEQ ID NO: 220), FAM probe: TCCCCTCCTCACAGTTGCCA (SEQ ID NO: 221), TTC5 reference gene forward primer: GGAGAAAGTGTCCAGGCATAAG (SEQ ID NO: 222), TTC5 reference gene reverse primer: CTCCATCCCACTATGACCATTC, (SEQ ID NO:223), TTC5 FAM probe: AGTTTGTGTCAGGATGGGTGGT (SEQ ID NO: 224).
Next, the cargo integration and selection methods described herein were tested using a number of bicistronic knock-in cassettes that contained CD16 and an NK suitable CAR in different 5′-to-3′ orders (e.g., CD16 followed by the CAR, or the CAR followed by CD16) and separated by a P2A or IRES sequence. The essential gene GAPDH was targeted in iPSC cells using an RNP containing AsCpf1 (AsCas12a, (SEQ ID NO: 62)) and a guide RNA (RSQ22337; SEQ ID NO: 95), resulting in a double-strand break towards the 5′ end of the last exon of GAPDH (exon 9), as described in Example 2. A donor plasmid containing each of the knock-in cassettes depicted in
The present example describes use of gene editing methods described herein to create modified immune cells suitable for cancer cell killing.
PSCs were edited using the exemplary system illustrated in
The cargo gene mbIL-15 (as shown in
Two separate populations of the bulk edited mbIL-15 KI iPSC cells were then differentiated into iNK cells and the TI rates were measured using ddPCR at day 28 of the iNK differentiation process.
At day 39 following the initiation of differentiation from the edited iPSCs into iNKs, cells were challenged in 3D spheroid killing assays as described in Example 14 and depicted in
In addition, mbIL-15 KI iNK cells at later stages of differentiation (day 63 post-differentiation initiation for Set 1 (S1) and day 56 post-differentiation initiation for Set 2 (S2)) were also challenged in 3D spheroid killing assays as described above. Cells were tested in the presence or absence of 10 μg/ml Herceptin and/or 5 ng/mL exogenous IL-15. As shown in Table 16 and
The cumulative results of certain 3D spheroid killing assays for mbIL-15 KI iNKs and control WT iNK cells is depicted in
In addition, the mbIL-15 KI iNK cells at later stages of differentiation (day 63 post-differentiation initiation for Set 1 (S1) and day 56 post-differentiation initiation for Set 2 (S2)) were also challenged with hematological cancer cells (e.g., Raji cells). Two biological replicate populations of mbIL-15 KI NK cells (S1 and S2) were tested in the presence or absence of 10 μg/ml rituximab. As shown in
As described above in Example 2, genes of interest (GOI) may be integrated as a cargo sequence into suitable essential gene loci using methods described herein. In certain embodiments, multiple GOIs may be combined into a bicistronic or multicistronic knock-in cargo sequence.
The knock-in cargo sequences described in
Following TI, transformed iPSCs (edited clones) with KI of PLA1829, PLA1832 or PLA1834 cargo sequences, or control WT parental cells transformed with RNP alone, were analyzed using flow cytometry seven days after transformation (see
The present example describes a method for computationally screening for AsCpf1 (AsCas12a; e.g., as represented by SEQ ID NO: 62) guide RNAs (gRNAs) suitable for methods described herein that target a number of essential housekeeping genes. The results of this screening are summarized in Table 17, these gRNAs facilitate Cas12a cleavage within the last 500 bp of the DNA coding sequences for the listed essential genes.
The essential genes in Table 17 selected for this analysis were identified in a pool of essential genes made by combining the essential genes described in Eisenberg et al., (see e.g., Eisenberg and Levanon, Human housekeeping genes, revisited. Trends Genetics, 2014) and the genes described in Yilmaz et al., (see e.g., Yilmaz et al., Defining essential genes for human pluripotent stem cells by CRISPR-Cas9 screening in haploid cells. Nature Cell Biology, 2018). In brief, essential genes described in Yilmaz et al., with CRISPR Scores less than 0, and FDR of <0.05 were combined with essential genes described in Eisenberg & Levanon to create a list of 4,582 genes in total. These genes were then sorted by their average expression level (mean normalized expression across different tissues, see e.g., RNA consensus tissue gene expression data provided by https://www.proteinatlas.org/download/rna_tissue_consensus.tsv.zip), and the 100 genes with the highest average expression levels across tissues were selected for the analysis. GAPDH was present within this group of genes. TBP, E2F4, G6PD and KIF11 were added to this group, making 104 genes in total, for further analysis.
Potential gRNA target sequences for each of the genes of interest were generated by searching for nuclease specific PAMs with suitable protospacers mapped to a representative coding region (mRNA-201). Transcripts with its name followed by “−201” were selected as the representative for each gene (e.g., GAPDH-201). Gene information (i.e., coding region) was obtained from GENCODE v.37 gene annotation GTF file. Potential gRNAs were first searched within the genomic regions of target genes in the human reference genome (hg38), and those identified gRNAs with their cut sites within 500 bp of the representative coding region's stop site were selected for further analysis. The candidate gRNAs were then aligned to the human reference genome (e.g., hg38) with BWA Aln (maximum mismatch tolerance-n 2). Guides with potential off target binding sites (i.e., aligning to multiple genomic regions; mapping quality MAPQ<30) were filtered out. The resultant gRNAs target highly and/or broadly expressed essential genes within 500 coding base pairs of a representative stop-codon and have no identical off-target binding sites annotated in the human genome. Thus, they are excellent candidate gRNAs for the selection methods described herein.
The present example describes a method for computationally screening for gRNAs more likely to be suitable for use in targeting essential genes using the selection methods herein that are relevant for different RNA-guided nucleases and variants thereof (e.g., variants of Cas12a, such as Mad7), so long as the RNA-guided nucleases exhibit high cutting efficiency. Cas12b, Cas12e, Cas-Phi, Mad7, and SpyCas9 gRNAs targeting essential genes described preceding examples (GAPDH, TBP, E2F4, G6PD, and KIF11) were selected for this analysis, but a similar process could be applied to identify gRNAs for these RNA-guided nucleases in other essential genes as well. The results of this screening are summarized in tables 18-22, these gRNAs facilitate DNA cleavage within the last 500 bp of the coding sequences of the listed essential genes.
Potential target sequences for each of the essential genes in this analysis (GAPDH, TBP, E2F4, G6PD, and KIF11) were generated by searching for nuclease specific PAMs (ATTN, TTCN, TTN, TTN, and NGG for Casl2b, Casl2e, Cas(D, Mad7, and SpyCas9 respectively) with suitable protospacers mapped to a representative coding region (mRNA-201). Transcripts with its name followed by “−201” were selected as the representative for each gene (e.g., GAPDH-201). Gene information (i.e., coding region) was obtained from GENCODE v.37 gene annotation GTF file. Potential gRNAs were first searched within the genomic regions of target genes in the human reference genome (hg38), and those identified gRNAs with their cut sites within 500 bp of the representative coding region stop site were selected for further analysis. The candidate gRNAs were then aligned to the human reference genome (e.g., hg38) with BWA Aln (maximum mismatch tolerance-n 2). Guides with potential off target binding sites (i.e., aligning to multiple genomic regions; mapping quality MAPQ<30) were filtered out. The resultant gRNAs target essential genes within 500 coding base pairs of a representative stop-codon and have no identical off-target binding sites annotated in the human genome. Thus, gRNAs in Tables 18-22, corresponding to SEQ ID NOs: 889-1885, represent excellent candidate gRNAs for applying the selection methods described herein to GAPDH, TBP, E2F4, G6PD, and KIF11.
The present example relates to the introduction of two immunologically relevant genes inserted biallelically, and in a bicistronic manner at the GAPDH gene. Two different donor templates (e.g., donor nucleic acid constructs) one containing the gene sequences for the PDL1 immuno-regulatory molecule and a safety switch as its genetic payload, and the other donor template comprising CD47 immuno-regulatory molecule and the same safety switch as its genetic payload were targeted to the GAPDH locus (
To further enrich for the population of edited cells, cells were expanded and then re-edited by providing the pool of surviving cells with either RNP and both donor templates (e.g., donor nucleic acid constructs) again, or RNP alone. In the sample re-edited with RNP and both donor templates (e.g., donor nucleic acid constructs), the population of PDL1-positive cells increased to ˜63.8%, the population of CD47-positive cells increased to ˜6.5%, and the population of PDL1/CD47-double positive cells increased to ˜18.9%. In the sample re-edited with RNP only, the population of PDL1-positive cells increased to ˜59.0%, the population of CD47-positive cells increased to ˜10.4%, and the population of PDL1/CD47-double positive cells increased to ˜13.4%. There was a decrease of unedited cells from 87.4% to 10.8% with RNP and donor templates, or to 17.3% with RNP alone. In either case, providing a second round of RNP allowed selective removal of non-targeted cells via GAPDH exon cutting, and therefore further enrichment of cells targeted with either or both of the PDL1-based and CD47-based donor templates (e.g., nucleic acid constructs).
In a separate study, the same PDL1-based donor template was used to target PDL1 to the GAPDH locus (
The present example relates to the introduction of two knock-in cassettes each encoding multiple gene products of interest as their genetic payloads. Two different donor templates (e.g., nucleic acid constructs) that contain the PDL1 or CD47 immuno-regulatory molecules were targeted to the GAPDH gene (
After editing of PSCs with GAPDH-targeting RNP and PDL1-based and CD47-based donor templates, surviving cells were allowed to recover and expand, and flow cytometric analysis was performed one week later on a population of PSCs stained with anti-PDL-1 and anti-CD47 antibodies. After cytometric analysis, provision of surviving cells with GAPDH-targeting RNP and two different donor templates (e.g., donor nucleic acid constructs) together (FRB-dCasp9-PDL1 and FKBP12-dCasp9-CD47) resulted in PDL1-positive PSCs (˜11.9%), CD47-positive PSCs (˜9.8%), and cells that were double-positive for PDL1 and CD47 (˜3.5%), indicating that some cells had biallelically integrated the two genetic payloads: both an FRB-dCasp9-PDL1 transgene and an FKBP12-dCasp9-CD47 transgene targeted to the GAPDH gene, which restored the disruption that had been caused by nuclease cutting within the GAPDH exon (e.g., coding region). These results are striking, as cells that are biallelically edited for two different large donor constructs at the same gene locus are usually very rare events when performing homologous recombination experiments in PSCs.
It is to be understood that while the disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application is a continuation of U.S. application Ser. No. 17/923,358, filed Nov. 4, 2022, which is the National Stage of International Application No. PCT/US21/30744 filed May 4, 2021, which claims the benefit of U.S. Provisional Application No. 63/019,950, filed May 4, 2020, the entirety of each of which is incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| 63019950 | May 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 17923358 | Nov 2022 | US |
| Child | 18537754 | US |