Patent Application
20230332150
The present disclosure relates to compositions and methods for activating expression from the paternally-inherited allele of UBE3A in subjects having Angelman syndrome using short hairpin RNAs.
The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on Apr. 7, 2023, is named “2262-99.xml” and is 674,972 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.
Angelman syndrome (AS) is a neurodevelopmental disorder affecting ˜1/15,000 individuals. Individuals with AS have developmental delay, severe cognitive impairment, ataxic gait, frequent seizures, short attention span, absent speech, and characteristic happy demeanor. Neurons derived from induced pluripotent stem cells (iPSC) from AS patients exhibit a depolarized resting membrane potential, delayed action potential development, and reduced spontaneous synaptic activity. Fink et al., 2017, Nat Commun 8. AS affects a relatively large patient population; a contact registry with >3,000 patients has been established and ˜250 new diagnoses of AS are made each year. Individuals with AS require life-long care.
AS is caused by loss of function from the maternal copy of UBE3A, a gene encoding an E3 ubiquitin ligase. This loss of function mutation can be caused by any type of gene mutation in the maternal allele. UBE3A is expressed exclusively from the maternal allele in neurons. All individuals with AS have a normal paternal UBE3A allele that is epigenetically silenced in neurons in cis by a long, non-coding RNA, called UBE3A antisense transcript (UBE3A-ATS) (Rougeulle et al., 1997, Nat Genet 17, 14-15; Chamberlain and Brannan, 2001, Genomics 73, 316-322). Reactivation of the paternal allele has been shown to restore UBE3A protein expression and alleviate behavioral deficits in an AS mouse model. The restoration of UBE3A expression in humans is expected to ameliorate the disease, especially if it is restored in infants.
Provided herein is a novel treatment for Angelman syndrome by inhibiting the silencing of paternal UBE3A and allowing expression of paternal UBE3A from its native regulatory elements, thus replacing or augmenting missing maternal UBE3A. Increased expression of UBE3A in neurons is accomplished by interfering with transcription of SNORD115 and/or UBE3A-ATS. Since the native regulatory elements control expression, overexpression of UBE3A is prevented. This approach can improve AS symptoms through a single treatment and eliminate the need for multiple treatments.
Provided herein is a polynucleotide sequence including:
Provided herein is a polynucleotide encoding a shRNA including a nucleotide sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to a RNA encoded by any of SEQ ID NOs: 19-360. In embodiments, the polynucleotide is SEQ ID NO: 3. In embodiments, the shRNA causes activation of, or an increase in, expression of paternal UBE3A. In embodiments, the shRNA causes a reduction of expression of paternal SNORD115 and UBE3A-ATS. Expression vectors including the shRNA are provided. In embodiments, the expression vector is an adeno-associated viral (AAV) vector or a lentiviral vector. Pharmaceutical compositions including the foregoing are provided.
Provided herein is a method of treating Angelman syndrome including administering to a patient in need thereof the polynucleotide of SEQ ID NO: 3. In embodiments, the polynucleotide of SEQ ID NO: 3 encodes a shRNA which causes a reduction of expression of paternal SNORD115 and UBE3A-ATS. In embodiments, the polynucleotide of SEQ ID NO: 3 encodes a shRNA which causes activation of, or an increase in, expression of paternal UBE3A gene.
Provided herein is a method of treating Angelman syndrome including administering to a patient in need thereof a polynucleotide encoding a shRNA including a nucleotide sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to a RNA encoded by any of SEQ ID NOs: 19-360. In embodiments, the polynucleotide is SEQ ID NO: 3. In embodiments, the shRNA causes activation of, or an increase in, expression of paternal UBE3A. In embodiments, the shRNA causes a reduction of expression of paternal SNORD115 and UBE3A-ATS.
In embodiments, SEQ ID NO: 3 encodes a shRNA capable of inhibiting the silencing of paternal UBE3A. In embodiments, the SEQ ID NO: 3 is contained within an expression vector. In embodiments, the expression vector is an adeno-associated viral (AAV) vector or a lentiviral vector. In embodiments, a method is provided of inhibiting the silencing of paternal UBE3A gene by the RNA antisense transcript encoded by UBE3A-ATS (SEQ ID NO: 1) and SNORD115 (SEQ ID NO: 2) which includes administering to a patient in need thereof an amount of SEQ ID NO: 3 which is effective to cut the RNA antisense transcript encoded by SEQ ID NO: 2.
In embodiments, a method is provided of inhibiting the silencing of paternal UBE3A gene by the RNA antisense transcript encoded by SEQ ID NO: 1 which includes administering to a patient in need thereof, an amount of a shRNA including a nucleotide sequence that is at least 85%, at least 90%, at least 95%, or 100% complementary to a RNA encoded by any of SEQ ID NOs: 19-360, which is effective to cut the RNA antisense transcript encoded by SEQ ID NO: 2.
In embodiments, a shRNA provided herein is encoded by a portion of SEQ ID NO: 3, e.g., having the bold nucleotides, which has been shortened by one, two, three or four nucleotides at either end of the bold nucleotides. Likewise, in embodiments, the shRNA provided herein can contain a portion of SEQ ID NO: 3, e.g., having the italicized nucleotides, which has been shortened by one, two or three nucleotides at either end of the italicized nucleotides. In embodiments, a shRNA provided herein is encoded by a polynucleotide including any of SEQ ID NOs: 19-360 which has been shortened by one, two, three or four nucleotides at either end.
In embodiments, a polynucleotide sequence is provided as follows:
ATCA-3′, wherein nnnnnnnn can be
In embodiments, a polynucleotide sequence is provided which includes a first portion, a second portion and a third portion, the first portion comprising any of SEQ ID NOs: 19-360, the second portion comprising any of SEQ ID Nos: 362, 363, 364, or 365, and the third portion comprising respective nucleotide sequences complementary to those in SEQ ID NOs: 19-360.
UCSC Genome Browser view of the 15q11-q13 region containing the imprinted SNHG14/UBE3A locus (dashed-line callout). Location of shRNA targets within the SNORD115 snoRNA cluster.
UBE3A is a gene which encodes the E3 ubiquitin ligase. The genomic coordinates for UBE3A are hg19 chr15:25,582,381-25,684,175 on the minus strand. There are three normal isoforms of UBE3A: Isoform 1 (accession number X98032); Isoform 2 (accession number X98031); and isoform 3 (Accession number X98033). In neurons, UBE3A is expressed exclusively from the maternal allele. The paternal UBE3A allele is epigenetically silenced by the long, non-coding RNA UBE3A antisense transcript (UBE3A-ATS) encoded by SEQ ID NO: 1. The genomic coordinates for UBE3A-ATS are hg19 chr15:25,223,730-25,664,609 on the plus strand. The following genomic coordinates are of interest: hg19 chr15:25,522,751-25,591,391 on the plus strand.
UBE3A-ATS/Ube3a-ATS (human/mouse) is the antisense RNA that is transcribed as part of a larger transcript called SNHG14 (SNORNA HOST GENE 14) near the UBE3A locus. Human UBE3A-ATS is expressed as a part of SNHG14 exclusively from the paternal allele in the central nervous system (CNS). The transcript is about 600 kb long, starts at SNURF-SNRPN and extends into the first intron of UBE3A on the opposite strand. See, e.g.,
SNHG14 is located within the Prader-Willi critical region and produces a long, spliced maternally-imprinted RNA that initiates at one of several promoters shared by the SNRPN (small nuclear ribonucleoprotein polypeptide N) and SNURF genes. This transcript serves as a host RNA for the small nucleolar RNA, C/D box 115 and 116 clusters. See, Runte et al., 2001, Hum Mol Genet 10, 2687-2700. This RNA extends in antisense into the region of the UBE3A gene and is thought to regulate imprinted expression of UBE3A in the brain. The main promoter of SNURF-SNRPN is the PWS-IC and about 35 kb upstream of the PWS-IC is the AS-IC. These two regions are thought to control the expression of the entire SNHG14 transcript. Starting at the promoter, the entire transcript can be transcribed and after transcription is further processed and spliced.
SNURF/SNRPN is a bicistronic gene that encodes two protein-coding transcripts, SNURF and SNRPN. Both SNURF and SNRPN proteins localize to the cell nucleus. SNRPN is a small nuclear ribonucleoprotein, and the function of SNURF is unknown. The transcript that begins at SNRPN/SNURF also continues past these genes, and within its introns are sequences for several C/D box snoRNAs. Box C/D small nucleolar RNAs (SNORDs) represent a well-defined family of small non-coding RNAs that exert their regulatory functions via antisense-based mechanisms. Most C/D box snoRNAs function in non-mRNA methylation.
Many orphan SNORDs are generated from two large, imprinted chromosomal domains at human 15q11q13 and 14q32. See, e.g.,
SNORD115 encodes a small nucleolar RNA (snoRNA) that is found clustered with dozens of other similar snoRNAs on chromosome 15. These genes are found mostly within introns of the SNURF-SNRPN/SNHG14 transcript, which is maternally imprinted and expressed from the PWS/AS region. The genomic coordinates for SNORD115 are >hg38_dna range=chr15:25159221-25269858.
The compositions and methods described herein are drawn to targeting SNORD115 and UBE3A-ATS to unsilence the paternal UBE3A allele. Effective inhibition of SNORD115 and UBE3A-ATS by short hairpin RNAs (shRNA) described herein result in a reduction in SNORD115 and UBE3A-ATS expression levels and a concomitant increase in the expression levels of the paternal UBE3A allele. The shRNAs described herein were targeted to cut at single locations or multiple locations within the RNA expressed from the SNORD115 locus and were tested in H9-AS (hESC)-derived neurons engineered to imprint early during neurogenesis. SNORD115 shRNA 3 (SEQ ID NO: 3) is a shRNA that uniquely cleaves an RNA transcript in multiple places, i.e., targeting multiple sequences within the SNORD115 cluster (see,
In embodiments, compositions and methods herein relate to the treatment or prevention of AS. A patient in need of such treatment or prevention has AS or is at risk for developing AS. As used herein, the term “patient in need” includes any mammal in need of these methods of treatment or prophylaxis, including humans. The subject may be male or female. In certain aspects, the patient in need, having AS, treated according to the methods and compositions provided herein may show an improvement in anxiety, learning, balance, motor function, and/or seizures, or the method may return the neuronal resting membrane potential to about −70 mV, ameliorate the action potential development delay, increase spontaneous synaptic activity, and may ameliorate additional alterations in the neuronal phenotype relating to rheobase, action potential characteristics (e.g. shape), membrane current, synaptic potentials, and/or ion channel conductance.
In embodiments, a polynucleotide includes a first nucleotide sequence encoding a short hairpin RNA (shRNA) that interferes with expression of the SNORD115 sequence (SEQ ID NO: 2). In embodiments, a polynucleotide includes a first nucleotide sequence encoding a short hairpin RNA (shRNA) that results in decreased expression of the UBE3A-ATS sequence (SEQ ID NO: 1). For example, a portion of the shRNAs described herein may be complementary to the RNA sequence encoded by SEQ ID NO: 2 or a sequence contained therein. For example, a portion of the shRNAs described herein may be complementary to the RNA sequence encoded by SEQ ID NO: 3 or a sequence contained therein. In embodiments, the shRNAs described herein are RNA polynucleotides encoded by a first nucleotide sequence. The polynucleotide encompassing the first nucleotide sequence may be a DNA polynucleotide suitable for cloning into an appropriate vector (e.g., a plasmid) for culturing and subsequent production of viral particles. In turn, viral particles may contain the DNA polynucleotide with the nucleotide coding sequence in a form suitable for infection. Thus, the first nucleotide sequence may be a DNA sequence cloned into a plasmid for viral particle production or encapsulated in a viral particle. As retroviruses carry nucleotide coding sequences in the form of RNA polynucleotides, retroviral particles (e.g., lentivirus) contain an RNA polynucleotide that includes the first nucleotide sequence as a corresponding RNA sequence.
Disclosed herein are novel shRNAs that cut SNORD115 thereby reducing UBE3A-ATS expression and, in turn activate, the paternally inherited copy of UBE3A in neurons. This provides the UBE3A gene product in a cell type that is missing the protein in Angelman syndrome. There is a potential search space of about −60 kb in the genomic LNCAT sequence which may provide potential shRNA targets. However, not every predicted sequence actually reduces SNORD115 and/or UBE3A-ATS and restores UBE3A. Accordingly, as shown by the certain examples herein, it is difficult to predict which sequences will or will not work. See, e.g.,
The first nucleotide sequence encodes a shRNA. For example, the first nucleotide sequence may be SEQ ID NO: 3
“Reduce expression” refers to a reduction or blockade of the expression or activity of SNORD115 and/or UBE3A-ATS and does not necessarily indicate a total elimination of expression or activity. Mechanisms for reduced expression of the target include hybridization of an operative RNA polynucleotide with a target sequence or sequences transcribed from a sequence or sequences within the larger genomic SNORD115 and/or UBE3A-ATS sequence, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
Without wishing to be bound to a particular theory, the shRNA herein may inhibit the silencing of paternal UBE3A by: (1) cutting the RNA transcript encoded by SEQ ID NO: 2; (2) reducing steady-state levels (i.e., baseline levels at homeostasis) of the RNA transcript encoded by SEQ ID NO: 2; (3) reducing steady-state levels (i.e., baseline levels at homeostasis) of the RNA transcript encoded by SEQ ID NO: 1; (4) terminating transcription of SEQ ID NO: 2, and (5) terminating transcription of SEQ ID NO: 1. For example, cutting and reduction of steady-state levels of the RNA transcript encoded by SEQ ID NO: 2 may occur via a mechanism involving a RNA-induced silencing complex (RISC). shRNA may utilize RISC. Once the vector carrying the genomic material for the shRNA is integrated into the host genome, the shRNA genomic material is transcribed in the host into pri-microRNA. The pri-microRNA is processed by a ribonuclease, such as Drosha, into pre-shRNA and exported from the nucleus. The pre-shRNA is processed by an endoribonuclease such as Dicer to form small interfering RNA (siRNA). The siRNA is loaded into the RISC where the sense strand is degraded and the antisense strand acts as a guide that directs RISC to the complementary sequence in the mRNA. RISC cleaves the mRNA when the sequence has perfect complementary and represses translation of the mRNA when the sequence has imperfect complementary. Thus, the shRNA encoded by the first nucleic acid sequence increases expression of paternal UBE3A by decreasing the steady-state levels of SNORD115 and/or UBE3A-ATS RNA.
As used herein, the term “nucleic acid” refers to molecules composed of monomeric nucleotides. Examples of nucleic acids include ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and short hairpin RNAs (shRNAs) and ASOs. “Nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside. “Oligonucleotide” or “polynucleotide” means a polymer of linked nucleotides each of which can be modified or unmodified, independent one from another.
As used herein, a “short hairpin RNA (shRNA)” includes a conventional stem-loop shRNA, which forms a precursor microRNA (pre-miRNA). “shRNA” also includes micro-RNA embedded shRNAs (miRNA-based shRNAs), wherein the guide strand and the passenger strand of the miRNA duplex are incorporated into an existing (or natural) miRNA or into a modified or synthetic (designed) miRNA. When transcribed, a conventional shRNA (i.e., not a miR-451 shRNA mimic) forms a primary miRNA (pri-miRNA) or a structure very similar to a natural pri-miRNA. The pri-miRNA is subsequently processed by Drosha and its cofactors into pre-shRNA. Therefore, the term “shRNA” includes pri-miRNA (shRNA-mir) molecules and pre-shRNA molecules.
A “stem-loop structure” refers to a nucleic acid having a secondary structure that includes a region of nucleotides which are known or predicted to form a double strand or duplex (stem portion) that is linked on one side by a region of predominantly single-stranded nucleotides (loop portion). It is known in the art that the loop portion is at least 4 nucleotides long, 6 nucleotides long (e.g., the underlined sequence in SEQ ID NO: 3), 8 nucleotides long, or more. The terms “hairpin” and “fold-back” structures are also used herein to refer to stem-loop structures. Such structures are well known in the art and the term is used consistently with its known meaning in the art. For example, CTCGAG (SEQ ID NO: 361), TCAAGAG (SEQ ID NO: 362), TTCG (SEQ ID NO: 363), and GAAGCTTG (SEQ ID NO: 364) are suitable stem-loop structures. As is known in the art, the secondary structure does not require exact base-pairing. Thus, the stem can include one or more base mismatches or bulges. Alternatively, the base-pairing can be exact, i.e., not include any mismatches. In embodiments, a polynucleotide sequence is provided as follows:
In embodiments, shRNAs can include, without limitation, modified shRNAs, including shRNAs with enhanced stability in vivo. Modified shRNAs include molecules containing nucleotide analogues, including those molecules having additions, deletions, and/or substitutions in the nucleobase, sugar, or backbone; and molecules that are cross-linked or otherwise chemically modified. The modified nucleotide(s) may be within portions of the shRNA molecule, or throughout it. For instance, the shRNA molecule may be modified, or contain modified nucleic acids in regions at its 5′ end, its 3′ end, or both, and/or within the guide strand, passenger strand, or both, and/or within nucleotides that overhang the 5′ end, the 3′ end, or both. (See Crooke, U.S. Pat. Nos. 6,107,094 and 5,898,031; Elmen et al., U.S. Publication Nos. 2008/0249039 and 2007/0191294; Manoharan et al., U.S. Publication No. 2008/0213891; MacLachlan et al., U.S. Publication No. 2007/0135372; and Rana, U.S. Publication No. 2005/0020521; all of which are hereby incorporated by reference.)
shRNAs herein include a nucleotide sequence complementary to a RNA nucleotide sequence transcribed from within the full genomic SNORD115 sequence (SEQ ID NO: 2) and inhibit the silencing of paternal UBE3A by UBE3A-ATS. In embodiments, shRNAs include a nucleotide sequence complementary to RNA sequences encoded by SEQ ID NOs: 19-360. In embodiments, a shRNA includes a nucleotide sequence complementary to a RNA sequence encoded by SEQ ID NO: 21 (5′-TGATGATGAGAACCTTATATT-3′). In embodiments, the shRNA is encoded by the nucleotide sequence of SEQ ID NO: 2. In embodiments, the nucleotide sequence included in the shRNA and complementary to the RNA nucleotide sequence transcribed from the SNORD115 gene is 17-21 nucleotides in length. The complementary nucleotides may be contiguous or may be interspersed with non-complementary nucleotides. In embodiments, the complementary nucleotide sequence is 21 nucleotides in length as indicated by the bold sequence in SEQ ID NO: 3. The shRNA may include a nucleotide sequence wherein 17, 18, 19, 20, or 21 nucleotides are complementary to the nucleotides in SEQ ID NOs: 19-360. The 17, 18, 19, 20, or 21 complementary nucleotides may be contiguous or may be interspersed with non-complementary nucleotides. The overall length of the shRNA, including the loop may be 40-50 nucleotides in length, e.g., 44-48 nucleotides, e.g., 48 nucleotides.
Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In embodiments, the shRNA polynucleotides provided herein include a nucleic acid sequence specifically hybridizable with a RNA sequence transcribed from the SNORD115 (SEQ ID NO: 2).
The shRNA may include an RNA polynucleotide containing a region of 17-21 linked nucleotides complementary to the RNA target sequence, wherein the RNA polynucleotide region is at least 85% complementary over its entire length to an equal length region of a SNORD115 RNA nucleic acid sequence. In embodiments, the 17-21 RNA polynucleotide region is at least 90%, at least 95%, or 100% complementary over its entire length to an equal length region of a SNORD115 RNA nucleic acid sequence, e.g., encoded by SEQ ID NOs: 4-18.
The shRNA may include a nucleotide sequence at least 85% complementary to, and of equal length as, a RNA sequence encoded by any of SEQ ID NOs: 19-360, e.g., SEQ ID NO: 21. The shRNA may include a nucleotide sequence at least 90% complementary to, and of equal length as, a RNA sequence encoded by any of SEQ ID NOs: 19-360. The shRNA may include a nucleotide at least 95% complementary to, and of equal length as, a RNA sequence encoded by any of SEQ ID NOs: 19-360. The shRNA or microRNA may encompass a nucleotide sequence 100% complementary to, and of equal length as, a RNA sequence encoded by any of SEQ ID NOs: 19-360.
In embodiments, the shRNA is a single-stranded RNA polynucleotide. In embodiments, the RNA polynucleotide is a modified RNA polynucleotide. A percent complementarity is used herein in the conventional sense to refer to base pairing between adenine and thymine, adenine and uracil (RNA), and guanine and cytosine.
Non-complementary nucleobases between a shRNA and a SNORD115 nucleotide sequence may be tolerated provided that the shRNA remains able to specifically hybridize to a SNORD115 nucleotide sequence. Moreover, a shRNA may hybridize over one or more segments of a SNORD115 nucleotide sequence such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In embodiments, the shRNA provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a SNORD115 RNA nucleotide sequence, a SNORD115 region, SNORD115 segment, or specified portion thereof. Percent complementarity of a shRNA with an SNORD115 nucleotide sequence can be determined using routine methods.
For example, a shRNA in which 18 of 20 nucleobases are complementary to a SNORD115 region and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, a shRNA which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleotide sequence would have 77.8% overall complementarity with the target nucleotide sequence and would thus fall within the subject matter disclosed herein. Percent complementarity of a shRNA with a region of a SNORD115 nucleotide sequence can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
In embodiments, the shRNA provided herein, or specified portions thereof, are fully complementary (i.e., 100% complementary) to a SNORD115 nucleotide sequence, or specified portion of the transcription product of SEQ ID NO: 1 thereof. For example, a shRNA may be fully complementary to a SNORD115 nucleotide sequence, or a region, or a segment or sequence thereof. As used herein, “fully complementary” means each nucleobase of a shRNA is capable of precise base pairing with the corresponding RNA nucleobases transcribed from a SNORD115 nucleotide sequence.
In embodiments, the shRNA provided herein can contain a portion of SEQ ID NO: 3, e.g., having the bold nucleotides, which has been shortened by one, two, three or four nucleotides at either end of the bold nucleotides. Likewise, in embodiments, the shRNA provided herein can contain a portion of SEQ ID NO: 3, e.g., having the italicized nucleotides, which has been shortened by one, two, three or four nucleotides at either end of the italicized nucleotides. For example,
nnnnnnnn for any of the above SEQ ID NOs: 374-365 can be
Similarly, in embodiments, the sequences shown in any of SEQ ID NOs: 19-360 and/or their complements can be shortened by one, two, three or four nucleotides at either end and incorporated into shRNAs as shown, for example, above.
An effective concentration or dose of the shRNA may inhibit the silencing of paternal UBE3A by UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
An effective concentration or dose of the shRNA may terminate transcription of UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
An effective concentration or dose of the shRNA may reduce steady-state levels of UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
An effective concentration or dose of the shRNA cuts SNORD115 and reduces it by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
An effective concentration or dose of the shRNA may reduce expression of UBE3A-ATS by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% and induce expression of paternal UBE3A by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100%.
As used herein, the terms “UBE3A-ATS” and “Ube3A-ATS” can be used interchangeably without capitalization of their spelling referring to any particular species or ortholog. “UBE3A” and “Ube3A” can be used interchangeably without capitalization of their spelling referring to any particular species or ortholog. Additionally, “UBE3A”, “UBE3A”, “Ube3A”, and “Ube3A” can be used interchangeably without italicization referring to nucleic acid or protein unless specifically indicated to the contrary. “SNORD115” and “SNORD115” can be used interchangeably without capitalization of their spelling referring to any particular species or ortholog.
Viral Vector
A “vector” is a replicon, such as a plasmid, phage, or cosmid, into which a DNA segment or an RNA segment may be inserted so as to bring about the replication of the inserted segment. Generally, a vector is capable of replication when associated with the proper control elements. Suitable vector backbones include, for example, those routinely used in the art such as plasmids, plasmids that contain a viral genome, viruses, or artificial chromosomes. The term “vector” includes cloning and expression vectors, as well as viral vectors and integrating vectors.
As will be evident to one of skill in the art, the term “viral vector” is widely used to refer to a nucleic acid molecule (e.g., a transfer plasmid) that includes viral nucleic acid elements that typically facilitate transfer of the nucleic acid molecule to a cell or to a viral particle that mediates nucleic acid sequence transfer and/or integration of the nucleic acid sequence into the genome of a cell.
Viral vectors contain structural and/or functional genetic elements that are primarily derived from a virus. The viral vector is desirably non-toxic, non-immunogenic, easy to produce, and efficient in protecting and delivering DNA or RNA into the target cells. According to the compositions and methods described herein a viral vector may contain the DNA that encodes one or more of the shRNAs described herein. In embodiments, the viral vector is a lentiviral vector or an adeno-associated viral (AAV) vector.
As used herein, the term “lentivirus” refers to a group (or genus) of complex retroviruses. Illustrative lentiviruses include, but are not limited to: HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2); visna-maedi virus (VMV) virus; the caprine arthritis-encephalitis virus (CAEV); equine infectious anemia virus (EIAV); feline immunodeficiency virus (FIV); bovine immune deficiency virus (BIV); and simian immunodeficiency virus (SIV). As used herein, the term “lentivirus” includes lentivirus particles. Lentivirus will transduce dividing cells and postmitotic cells.
The term “lentiviral vector” refers to a viral vector (e.g., viral plasmid) containing structural and functional genetic elements, or portions thereof, including long terminal repeats (LTRs) that are primarily derived from a lentivirus. A lentiviral vector is a hybrid vector (e.g., in the form of a transfer plasmid) having retroviral, e.g., lentiviral, sequences for reverse transcription, replication, integration and/or packaging of nucleic acid sequences (e.g., coding sequences). The term “retroviral vector” refers to a viral vector (e.g., transfer plasmid) containing structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus.
Adenoviral vectors are designed to be administered directly to a living subject. Unlike retroviral vectors, most of the adenoviral vector genomes do not integrate into the chromosome of the host cell. Instead, genes introduced into cells using adenoviral vectors are maintained in the nucleus as an extrachromosomal element (episome) that persists for an extended period of time. Adenoviral vectors will transduce dividing and non-dividing cells in many different tissues in vivo including airway epithelial cells, endothelial cells, hepatocytes, and various tumors (Trapnell, Advanced Drug Delivery, Reviews, 12 (1993) 185-199).
The term “adeno-associated virus” (AAV) refers to a small ssDNA virus which infects humans and some other primate species, not known to cause disease, and causes only a very mild immune response. As used herein, the term “AAV” is meant to include AAV particles. AAV can infect both dividing and non-dividing cells and may incorporate its genome into that of the host cell. These features make AAV an attractive candidate for creating viral vectors for gene therapy, although the cloning capacity of the vector is relatively limited. In embodiments, the vector used is derived from adeno-associated virus (i.e., AAV vector). More than 30 naturally occurring serotypes of AAV are available. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for specific types of target cells. AAV viruses may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of shRNA DNA sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc.
An “expression vector” is a vector that includes a regulatory region. Numerous vectors and expression systems are commercially available from such corporations as Novagen (Madison, Wis.), Clontech (Palo Alto, Calif), Stratagene (La Jolla, Calif.), and Invitrogen/Life Technologies (Carlsbad, Calif). An expression vector may be a viral expression vector derived from a particular virus.
The vectors provided herein also can include, for example, origins of replication, scaffold attachment regions (SARs), and/or markers. A marker gene can confer a selectable phenotype on a host cell. For example, a marker can confer biocide resistance, such as resistance to an antibiotic (e.g., kanamycin, G418, bleomycin, or hygromycin). An expression vector can include a tag sequence designed to facilitate manipulation or detection (e.g., purification or localization) of the expressed polypeptide. Tag sequences, such as green fluorescent protein (GFP), glutathione S-transferase (GST), polyhistidine, c-myc, hemagglutinin, or FIag™ tag (Kodak, New Haven, Conn.) sequences typically are expressed as a fusion with the encoded polypeptide. Such tags can be inserted anywhere within the polypeptide, including at either the carboxyl or amino terminus.
Additional expression vectors also can include, for example, segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of pLK0.1 puro, SV40 and, plasmids such as RP4; phage DNAs, e.g., the numerous derivatives of phage 1, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single stranded phage DNA, vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells, vectors derived from combinations of plasmids and phage DNAs, such as plasmids that have been modified to employ phage DNA or other expression control sequences.
The vector can also include a regulatory region. The term “regulatory region” refers to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5′ and 3′ untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, nuclear localization signals, and introns.
As used herein, the term “operably linked” refers to positioning of a regulatory region and a sequence to be transcribed in a nucleic acid so as to influence transcription or translation of such a sequence. For example, to bring a coding sequence under the control of a promoter, the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter. A promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site or about 2,000 nucleotides upstream of the transcription start site. A promoter typically includes at least a core (basal) promoter. A promoter also may include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). The choice of promoters to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. Modulation of the expression of a coding sequence can be accomplished by appropriately selecting and positioning promoters and other regulatory regions relative to the coding sequence.
Vectors can also include other components or functionalities that further modulate gene delivery and/or gene expression, or that otherwise provide beneficial properties to the targeted cells. As described and illustrated in more detail below, such other components include, for example, components that influence binding or targeting to cells (including components that mediate cell-type or tissue-specific binding); components that influence uptake of the vector nucleic acid by the cell; components that influence localization of the polynucleotide within the cell after uptake (such as agents mediating nuclear localization); and components that influence expression of the polynucleotide. Such components also might include markers, such as detectable and/or selectable markers that can be used to detect or select for cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components can be provided as a natural feature of the vector (such as the use of certain viral vectors which have components or functionalities mediating binding and uptake), or vectors can be modified to provide such functionalities. Other vectors include those described by Chen et al; BioTechniques, 34: 167-171 (2003). A large variety of such vectors are known in the art and are generally available.
A “recombinant viral vector” refers to a viral vector including one or more heterologous gene products or sequences. Since many viral vectors exhibit size-constraints associated with packaging, the heterologous gene products or sequences are typically introduced by replacing one or more portions of the viral genome. Such viruses may become replication-defective, requiring the deleted function(s) to be provided in trans during viral replication and encapsidation (by using, e.g., a helper virus or a packaging cell line carrying gene products necessary for replication and/or encapsidation).
In embodiments, the viral vector used herein will be used, e.g., at a concentration of at least 105 viral genomes per cell.
The selection of appropriate promoters can readily be accomplished. Examples of suitable promoters include RNA polymerase II or III promoters. For example, candidate shRNA sequences may be expressed under control of RNA polymerase III promoters U6 or H1, or neuron-specific RNA polymerase II promoters including neuron-specific enolase (NSE), synapsin I (Syn), or the Ca2+/CaM-activated protein kinase II alpha (CaMKIIalpha).
Other suitable promoters which may be used for gene expression include, but are not limited to, the 763-base-pair cytomegalovirus (CMV) promoter, the Rous sarcoma virus (RSV) (Davis, et al., Hum Gene Ther 4:151 (1993)), the SV40 early promoter region, the herpes thymidine kinase promoter, the regulatory sequences of the metallothionein (MMT) gene, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter; and the animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: myelin basic protein gene control region which is active in oligodendrocyte cells in the brain, and gonadotropic releasing hormone gene control region which is active in the hypothalamus. Certain proteins can be expressed using their native promoter. Other elements that can enhance expression can also be included such as an enhancer or a system that results in high levels of expression such as a tat gene and tar element. The assembly or cassette can then be inserted into a vector, e.g., a plasmid vector such as, pLK0.1, pUC19, pUC118, pBR322, or other known plasmid vectors. See, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory press, (1989). The plasmid vector may also include a selectable marker such as the β-lactamase gene for ampicillin resistance, provided that the marker polypeptide does not adversely affect the metabolism of the organism being treated. The cassette can also be bound to a nucleic acid binding moiety in a synthetic delivery system, such as the system disclosed in WO 95/22618.
Coding sequences for shRNA can be cloned into viral vectors using any suitable genetic engineering technique well known in the art, including, without limitation, the standard techniques of PCR, polynucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, as described in Sambrook et al. (Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, N.Y. (1989)), Coffin et al. (Retroviruses. Cold Spring Harbor Laboratory Press, N.Y. (1997)) and “RNA Viruses: A Practical Approach” (Alan J. Cann, Ed., Oxford University Press, (2000)). In embodiments, the shRNA DNA sequences contain flanking sequences on the 5′ and 3′ ends that are complementary with sequences on the plasmid and/or vector that is cut by a restriction endonuclease. As is well known in the art, the flanking sequences depend on the restriction endonucleases used during the restriction digest of the plasmid and/or vector. Thus, one of skill in the art can select the flanking sequences on the 5′ and 3′ ends of the shRNA DNA sequences accordingly. In embodiments, the target sites can be cloned into vectors by nucleic acid fusion and exchange technologies currently known in the art, including, Gateway, PCR in fusion, Cre-lox P, and Creator.
In embodiments, an expression vector includes a promoter and a polynucleotide including a first nucleotide sequence encoding a shRNA described herein. In embodiments, the promoter and the polynucleotide including the first nucleotide sequence are operably linked. In embodiments, the promoter is a U6 promoter. In embodiments, the first nucleotide sequence included in the expression vector may be SEQ ID NO: 3. In embodiments, the first nucleotide sequence included in the expression vector may also be a modified SEQ ID NO: 3 having the bold nucleotides in SEQ ID NO: 3 replaced by any of SEQ ID NOs: 19-360 and the italicized nucleotides in SEQ ID NO: 3 replaced by nucleotides complementary to those in SEQ ID NOs: 19-360. In embodiments, the first nucleotide sequence included in the expression vector may include any of SEQ ID Nos: 362-365. In embodiments, the first nucleotide sequence included in the expression vector may include any of SEQ ID Nos: 361-381. In embodiments, the polynucleotide including the first nucleotide sequence in the expression vector is a DNA polynucleotide. In embodiments, the first nucleotide sequence of the expression vector is a DNA nucleotide sequence. The shRNA encoded by the first nucleotide sequence of the expression vector may be as described in any of the variations disclosed herein.
As discussed below, recombinant viral vectors are transfected into packaging cells or cell lines, along with elements required for the packaging of recombinant viral particles. Recombinant viral particles collected from transfected cell supernatant are used to infect target cells or organisms for the expression of shRNAs. The transduced cells or organisms are used for transient expression or selected for stable expression.
Virus/Viral Particle
Viral particles are used to deliver coding nucleotide sequences for the shRNAs which target SNORD115 RNA. The terms virus and viral particles are used interchangeably herein. Viral particles will typically include various viral components and sometimes also host cell components in addition to nucleic acid(s). Nucleic acid sequences may be packaged into a viral particle that is capable of delivering the shRNA nucleic acid sequences into the target cells in the patient in need.
The viral particles may be produced by (a) introducing a viral expression vector into a suitable cell line; (b) culturing the cell line under suitable conditions so as to allow the production of the viral particle; (c) recovering the produced viral particle; and (d) optionally purifying the recovered infectious viral particle.
An expression vector containing the nucleotide sequence encoding one or more of the shRNAs herein may be introduced into an appropriate cell line for propagation or expression using well-known techniques readily available to the person of ordinary skill in the art. These include, but are not limited to, microinjection of minute amounts of DNA into the nucleus of a cell (Capechi et al., 1980, Cell 22, 479-488), CaPO4-mediated transfection (Chen and Okayama, 1987, Mol. Cell Biol. 7, 2745-2752), DEAE-dextran-mediated transfection, electroporation (Chu et al., 1987, Nucleic Acid Res. 15, 1311-1326), lipofection/liposome fusion (Feigner et al., 1987, Proc. Natl. Acad. Sci. USA 84, 7413-7417), particle bombardment (Yang et al., 1990, Proc. Natl. Acad. Sci. USA 87, 9568-9572), gene guns, transduction, infection (e.g. with an infective viral particle), and other techniques such as those found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001).
In embodiments, where an expression vector is defective, infectious particles can be produced in a complementation cell line or via the use of a helper virus, which supplies in trans the non-functional viral genes. For example, suitable cell lines for complementing adenoviral vectors include the 293 cells (Graham et al., 1997, J. Gen. Virol. 36, 59-72) as well as the PER-C6 cells (Fallaux et al., 1998, Human Gene Ther. 9, 1909-1917) commonly used to complement the E1 function. Other cell lines have been engineered to complement doubly defective adenoviral vectors (Yeh et al., 1996, J. Virol. 70, 559-565; Krougliak and Graham, 1995, Human Gene Ther. 6, 1575-1586; Wang et al., 1995, Gene Ther. 2, 775-783; Lusky et al., 1998, J. Virol. 72, 2022-2033; WO94/28152 and WO97/04119). The infectious viral particles may be recovered from the culture supernatant but also from the cells after lysis and optionally are further purified according to standard techniques (chromatography, ultracentrifugation in a cesium chloride gradient as described for example in WO 96/27677, WO 98/00524, WO 98/22588, WO 98/26048, WO 00/40702, EP 1016700 and WO 00/50573).
In embodiments, provided herein are host cells which include the nucleic acid molecules, vectors, or infectious viral particles described herein. The term “host cell” should be understood broadly without any limitation concerning particular organization in tissue, organ, or isolated cells. Such cells may be of a unique type of cells or a group of different types of cells and encompass cultured cell lines, primary cells, and proliferative cells.
Host cells therefore include prokaryotic cells, lower eukaryotic cells such as yeast, and other eukaryotic cells such as insect cells, plant and higher eukaryotic cells, such as vertebrate cells and, with a special preference, mammalian (e.g., human or non-human) cells. Suitable mammalian cells include but are not limited to hematopoietic cells (totipotent, stem cells, leukocytes, lymphocytes, monocytes, macrophages, APC, dendritic cells, non-human cells and the like), pulmonary cells, tracheal cells, hepatic cells, epithelial cells, endothelial cells, muscle cells (e.g., skeletal muscle, cardiac muscle or smooth muscle) or fibroblasts. For example, host cells can include Escherichia coli, Bacillus, Listeria, Saccharomyces, BHK (baby hamster kidney) cells, MDCK cells (Madin-Darby canine kidney cell line), CRFK cells (Crandell feline kidney cell line), CV-1 cells (African monkey kidney cell line), COS (e.g., COS-7) cells, chinese hamster ovary (CHO) cells, mouse NIH/3T3 cells, HeLa cells and Vero cells. Host cells also encompass complementing cells capable of complementing at least one defective function of a replication-defective vector utilizable herein (e.g., a defective adenoviral vector) such as those cited above.
In embodiments, the host cell may be encapsulated. Cell encapsulation technology has been previously described (Tresco et al., 1992, ASAJO J. 38, 17-23; Aebischer et al., 1996, Human Gene Ther. 7, 851-860). For example, transfected or infected eukaryotic host cells can be encapsulated with compounds which form a microporous membrane and said encapsulated cells may further be implanted in vivo. Capsules containing the cells of interest may be prepared employing hollow microporous membranes (e.g. Akzo Nobel Faser AG, Wuppertal, Germany; Deglon et al. 1996, Human Gene Ther. 7, 2135-2146) having a molecular weight cutoff appropriate to permit the free passage of proteins and nutrients between the capsule interior and exterior, while preventing the contact of transplanted cells with host cells
Viral particles suitable for use herein include AAV particles and lentiviral particles. AAV particles carry the coding sequences for shRNAs herein in the form of genomic DNA. Lentiviral particles, on the other hand, belong to the class of retroviruses and carry the coding sequences for shRNAs herein in the form of RNA.
Recombinantly engineered viral particles such as AAV particles, artificial AAV particles, self-complementary AAV particles, and lentiviral particles that contain the DNA (or RNA in the case of lentiviral particles) encoding the shRNAs targeting SNORD115 RNA may be delivered to target cells to inhibit the silencing of UBE3A by UBE3A-ATS. The use of AAVs is a common mode of delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. In embodiments, the selected AAV serotype has native neurotropisms. In embodiments, the AAV serotype is AAV9 or AAV10.
A suitable recombinant AAV can be generated by culturing a host cell which contains a nucleotide sequence encoding an AAV serotype capsid protein, or fragment thereof, as defined herein; a functional rep gene; a minigene composed of, at a minimum, AAV inverted terminal repeats (ITRs) and a coding nucleotide sequence; and sufficient helper functions to permit packaging of the minigene into the AAV capsid protein. The components required to be cultured in the host cell to package an AAV minigene in an AAV capsid may be provided to the host cell in trans. Alternatively, any one or more of the required components (e.g., minigene, rep sequences, cap sequences, and/or helper functions) may be provided by a stable host cell which has been engineered to contain one or more of the required components using methods known to those of skill in the art.
Unless otherwise specified, the AAV inverted terminal repeats (ITRs), and other selected AAV components described herein, may be readily selected from among any AAV serotype, including, without limitation, AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVRec3 or other known and unknown AAV serotypes. These ITRs or other AAV components may be readily isolated using techniques available to those of skill in the art from an AAV serotype. Such AAV may be isolated or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, Va.). Alternatively, the AAV sequences may be obtained through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like.
The minigene, rep sequences, cap sequences, and helper functions required for producing a rAAV herein may be delivered to the packaging host cell in the form of any genetic element which transfers the sequences carried thereon. The selected genetic element may be delivered by any suitable method. The methods used to construct embodiments herein are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Similarly, methods of generating rAAV virions are well known and the selection of a suitable method is not a limitation. See, e.g., K. Fisher et al, 1993 J. Viral., 70:520-532 and U.S. Pat. No. 5,478,745, among others. All citations herein are incorporated by reference herein.
Selection of these and other common vector and regulatory elements are conventional and many such sequences are available. See, e.g., Sambrook et al, and references cited therein at, for example, pages 3.18-3.26 and 16.17-16.27 and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989). Of course, not all vectors and expression control sequences will function equally well to express all of the transgenes herein. However, one of skill in the art may make a selection among these, and other, expression control sequences.
Pharmaceutical Compositions and Therapeutic Treatment
The virus including the desired coding sequences for the shRNA, can be formulated for administration to a patient or human in need by any means suitable for administration. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the brain, e.g., by subcranial or spinal injection. Further, more than one shRNA herein may be administered in a combination treatment. In a combination treatment, the different shRNAs may be administered simultaneously, separately, sequentially, and in any order.
Pharmaceutical compositions herein include a carrier and/or diluent appropriate for its delivering by injection to a human or animal organism. Such carrier and/or diluent should be generally non-toxic at the dosage and concentration employed. It can be selected from those usually employed to formulate compositions for parental administration in either unit dosage or multi-dose form or for direct infusion by continuous or periodic infusion. In embodiments, it is isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as provided by sugars, polyalcohols and isotonic saline solutions. Representative examples include sterile water, physiological saline (e.g., sodium chloride), bacteriostatic water, Ringer's solution, glucose or saccharose solutions, Hank's solution, and other aqueous physiologically balanced salt solutions (see for example the most current edition of Remington: The Science and Practice of Pharmacy, A. Gennaro, Lippincott, Williams & Wilkins). The pH of the composition is suitably adjusted and buffered in order to be appropriate for use in humans or animals, e.g., at a physiological or slightly basic pH (between about pH 8 to about pH 9, with a special preference for pH 8.5). Suitable buffers include phosphate buffer (e.g., PBS), bicarbonate buffer and/or Tris buffer. In embodiments, e.g., a composition is formulated in 1M saccharose, 150 mM NaCl, 1 mM MgCl2, 54 mg/l Tween 80, 10 mM Tris pH 8.5. In embodiments, e.g., a composition is formulated in 10 mg/ml mannitol, 1 mg/ml HSA, 20 mM Tris, pH 7.2, and 150 mM NaCl. These compositions are stable at −70° C. for at least six months.
Pharmaceutical compositions herein may be in various forms, e.g., in solid (e.g. powder, lyophilized form), or liquid (e.g. aqueous). In the case of solid compositions, methods of preparation are, e.g., vacuum drying and freeze-drying which yields a powder of the active agent plus any additional desired ingredient from a previously sterile-filtered solution thereof. Such solutions can, if desired, be stored in a sterile ampoule ready for reconstitution by the addition of sterile water for ready injection.
Nebulized or aerosolized formulations are also suitable. Methods of intranasal administration are well known in the art, including the administration of a droplet, spray, or dry powdered form of the composition into the nasopharynx of the individual to be treated from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer (see for example WO 95/11664). Enteric formulations such as gastroresistant capsules and granules for oral administration, suppositories for rectal or vaginal administration may also be suitable. For non-parental administration, the compositions can also include absorption enhancers which increase the pore size of the mucosal membrane. Such absorption enhancers include sodium deoxycholate, sodium glycocholate, dimethyl-beta-cyclodextrin, lauroyl-1-lysophosphatidylcholine and other substances having structural similarities to the phospholipid domains of the mucosal membrane.
The composition can also contain other pharmaceutically acceptable excipients for providing desirable pharmaceutical or pharmacodynamic properties, including for example modifying or maintaining the pH, osmolarity, viscosity, clarity, color, sterility, stability, rate of dissolution of the formulation, modifying or maintaining release or absorption into an the human or animal organism. For example, polymers such as polyethylene glycol may be used to obtain desirable properties of solubility, stability, half-life and other pharmaceutically advantageous properties (Davis et al., 1978, Enzyme Eng. 4, 169-173; Burnham et al., 1994, Am. J. Hosp. Pharm. 51, 210-218). Representative examples of stabilizing components include polysorbate 80, L-arginine, polyvinylpyrrolidone, trehalose, and combinations thereof. Other stabilizing components especially suitable in plasmid-based compositions include hyaluronidase (which is thought to destabilize the extra cellular matrix of the host cells as described in WO 98/53853), chloroquine, protic compounds such as propylene glycol, polyethylene glycol, glycerol, ethanol, 1-methyl L-2-pyrrolidone or derivatives thereof, aprotic compounds such as dimethylsulfoxide (DMSO), diethylsulfoxide, di-n-propylsulfoxide, dimethylsulfone, sulfolane, dimethyl-formamide, dimethylacetamide, tetramethylurea, acetonitrile (see EP 890 362), nuclease inhibitors such as actin G (WO 99/56784) and cationic salts such as magnesium (Mg′) (EP 998 945) and lithium (Lit) (WO 01/47563) and any of their derivatives. The amount of cationic salt in the composition herein preferably ranges from about 0.1 mM to about 100 mM, and still more preferably from about 0.1 mM to about 10 mM. Viscosity enhancing agents include sodium carboxymethylcellulose, sorbitol, and dextran. The composition can also contain substances known in the art to promote penetration or transport across the blood barrier or membrane of a particular organ (e.g., antibody to transferrin receptor; Friden et al., 1993, Science 259, 373-377). A gel complex of poly-lysine and lactose (Midoux et al., 1993, Nucleic Acid Res. 21, 871-878) or poloxamer 407 (Pastore, 1994, Circulation 90, 1-517) may be used to facilitate administration in arterial cells.
The viral particles and pharmaceutical compositions may be administered to patients in therapeutically effective amounts. As used herein, the term “therapeutically effective amount” refers to an amount sufficient to realize a desired biological effect. For example, a therapeutically effective amount for treating Angelman's syndrome is an amount sufficient to ameliorate one or more symptoms of Angelman's syndrome, as described herein (e.g., developmental delay, severe cognitive impairment, ataxic gait, frequent seizures, short attention span, absent speech, and characteristic happy demeanor). Further, AS iPSC-derived neurons or AS hESC derived neurons exhibit a depolarized resting membrane potential, delayed action potential development, and reduced spontaneous synaptic activity. Thus, a therapeutically effective amount for treating AS may return the neuronal resting membrane potential to about −70 mV, ameliorate the action potential development delay, increase spontaneous synaptic activity, or ameliorate additional alterations in the neuronal phenotype relating to rheobase, action potential characteristics (e.g., shape), membrane current, synaptic potentials, ion channel conductance, etc.
The appropriate dosage may vary depending upon known factors such as the pharmacodynamic characteristics of the particular active agent, age, health, and weight of the host organism; the condition(s) to be treated, nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, the need for prevention or therapy and/or the effect desired. The dosage will also be calculated dependent upon the particular route of administration selected. Further refinement of the calculations necessary to determine the appropriate dosage for treatment can be made by a practitioner, in the light of the relevant circumstances. For general guidance, a composition based on viral particles may be formulated in the form of doses of, e.g., at least 105 viral genomes per cell. The titer may be determined by conventional techniques. A composition based on vector plasmids may be formulated in the form of doses of between 1 μg to 100 mg, e.g., between 10 μg and 10 mg, e.g., between 100 μg and 1 mg. The administration may take place in a single dose or a dose repeated one or several times after a certain time interval.
Pharmaceutical compositions herein can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. In all cases, the composition should be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. Sterile injectable solutions can be prepared by incorporating the active agent (e.g., infectious particles) in the required amount with one or a combination of ingredients enumerated above, followed by filtered sterilization.
The viral particles and pharmaceutical compositions herein may be administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g., intracerebral or intraventricular, administration. In embodiments, viral particles or pharmaceutical compositions are administered intracerebrally or intracerebroventricularly. In embodiments, the viral particles or pharmaceutical compositions herein are administered intrathecally.
In embodiments, the viral particles and a pharmaceutical composition described above are administered to the subject by subcranial injection into the brain or into the spinal cord of the patient or human in need. In embodiments, the use of subcranial administration into the brain results in the administration of the encoding nucleotide sequences described herein directly to brain cells, including glia and neurons. As used herein, the term “neuron” refers to any cell in, or associated with, the function of the brain. The term may refer to any one the types of neurons, including unipolar, bipolar, multipolar and pseudo-unipolar.
shRNA Vector Generation and Lentiviral Preparation
Oligonucleotides encoding shRNAs were cloned into the pLKO.1-puro vector, which drives expression of the small RNA by the U6 promoter (Addgene plasmid #8453). Specifically, the polynucleotides to generate shRNAs encompassed the specific 21-nucleotide sequence to be targeted and its reverse complement, separated by a loop sequence of CTCGAG, and with a 5′ flank sequence of CCGG and a 3′ flank sequence of TTTTTG added for cloning into the plasmid vector. The following oligonucleotides encoding shRNAs as well as a scrambled shRNA control were utilized:
TTG-3′)
ACC-3′)
TCA-3′).
Cloning was verified by Sanger sequencing. Lentiviral particles were produced from cloned shRNAs in HEK293T cells using second generation lentiviral packaging plasmids (psPAX2, Addgene plasmid #12260; pMD2.G, Addgene plasmid #12259) and concentrated using the Lenti-X Concentrator Kit (Takara). Lentiviral titer was estimated using a qPCR kit detecting the 5′LTR (Applied Biological Materials).
Stem Cell Culture and Neuronal Differentiation
Angelman syndrome (AS) human embryonic stem cells (hESCs) were maintained under feeder-free conditions on Matrigel-coated substrates (Corning) in mTeSR-plus medium (Stem Cell Technologies). hESCs were cultured in at 37° C. in a humid incubator at 5% CO2. Cells were fed daily and passaged using 0.5 mM EDTA every four-five days. Glutamatergic neurons were generated from hESCs by doxycycline inducible expression of the human neurogenin2 (NGN2) transgene (Fernandopulle et al., 2018, Curr Protoc Cell Biol. 79(1): e51.). Briefly, the doxycycline-inducible NGN2 construct was stably integrated into the safe-harbor AAVS1 locus of AS hESCs using a pair of AAVS1 targeting TALENS and clonal cell lines were subsequently derived. Neuronal induction was then carried out by culturing these hESCs in Neural Induction Media consisting of DMEM/F12, N2 Supplement, Non-essential amino acids (NEAA), L-glutamine (all Gibco products), and 2 ug/mL doxycycline for three days. Neurons were then plated for terminal maturation in Cortical Neuron Medium consisting of DMEM/F12, Neurobasal Medium, B27 Supplement, Penicillin/Streptomycin (all Gibco products), BDNF (long/mL), GDNF (long/mL), NT-3 (long/mL), and Laminin (lug/mL). Human ESC-derived NGN2-induced neurons (7-10 days post-induction) were transduced with lentiviral particles at an MOI of 10.
Quantitative RT-PCR (qRT-PCR) Analysis
Neurons were collected for RNA isolation and qRT-PCR 7 days after viral transduction. Total RNA was isolated from hESC-derived neurons using RNA-STAT60 (AMS Biotechnology) according to the manufacturer's protocol. cDNA was produced using the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Gene expression analysis was performed at least in triplicate. All qPCR assays used were TaqMan Gene Expression Assays (Life Technologies). Ct values for each gene were normalized to the house keeping gene GAPDH. Relative expression was quantified as 2−ΔΔCt relative to the calibrator sample.
Data Summary and Results
AS hESC-derived neurons were transduced with lentiviral particles to express the selected shRNA sequences targeting the SNHG14 long non-coding RNA. qRT-PCR was used to determine the expression of UBE3A-ATS, the SNORD115 host gene, and UBE3A in SNHG14-shRNA-treated neurons relative to neurons treated with a non-targeting control shRNA (SCRAM).
It is understood that the foregoing detailed description and accompanying examples are merely illustrative and are not to be taken as limitations upon the scope of the subject matter described herein, which is defined solely by the appended claims and their equivalents. Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including without limitation those relating to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations, or methods of use, may be made without departing from the spirit and scope thereof.
nnnnnnnn can be CTCGAG (SEQ ID NO: 362), TCAAGAG (SEQ ID
GATGATGAGAACCTTATATT
CTCGAG
AATATAAGGTTCTCATCATC
ATGATGAGAACCTTATATT
CTCGAG
AATATAAGGTTCTCATCAT
TGATGAGAACCTTATATT
CTCGAG
AATATAAGGTTCTCATCA
GATGAGAACCTTATATT
CTCGAG
AATATAAGGTTCTCATC
TGATGATGAGAACCTTATAT
CTCGAG
ATATAAGGTTCTCATCATCA
TGATGATGAGAACCTTATA
CTCGAG
TATAAGGTTCTCATCATCA
TGATGATGAGAACCTTAT
CTCGAG
ATAAGGTTCTCATCATCA
TGATGATGAGAACCTTA
CTCGAG
TAAGGTTCTCATCATCA
GATGATGAGAACCTTATATT
nnnnnnnn
AATATAAGGTTCTCATCATC, wherein
nnnnnnnn can be CTCGAG (SEQ ID NO: 362), TCAAGAG (SEQ ID NO:
ATGATGAGAACCTTATATT
nnnnnnnn
AATATAAGGTTCTCATCAT, wherein
nnnnnnnn can be CTCGAG (SEQ ID NO: 362), TCAAGAG (SEQ ID NO:
TGATGAGAACCTTATATT
nnnnnnnn
AATATAAGGTTCTCATCA, wherein nnnnnnnn
GATGAGAACCTTATATT
nnnnnnnn
AATATAAGGTTCTCATC, wherein nnnnnnnn can
TGATGATGAGAACCTTATAT
nnnnnnnnATATAAGGTTCTCATCATCA, wherein
nnnnnnnn can be CTCGAG (SEQ ID NO: 362), TCAAGAG (SEQ ID NO:
TGATGATGAGAACCTTATA
nnnnnnnnTATAAGGTTCTCATCATCA, wherein nnnnnnnn
TGATGATGAGAACCTTAT
nnnnnnnnATAAGGTTCTCATCATCA, wherein nnnnnnnn
TGATGATGAGAACCTTA
nnnnnnnnTAAGGTTCTCATCATCA, wherein nnnnnnnn can
CAATGATGAGAACCGTATATT
CTCGAG
AATATACGGTTCTCATCATTG
GGTAACCTGTTCTCCAAATTT
CTCGAG
AAATTTGGAGAACAGGTTACC
This application claims benefit and priority to U.S. Provisional Application No. 63/317,155, filed Mar. 7, 2022, which is incorporated herein by reference in its entirety.
This invention was made with government support under Contract No. 1R01HD094953 awarded by the National Institutes of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63317155 | Mar 2022 | US |
