Patent Application
20240240178
The invention is generally directed to siRNA compositions for inhibiting gene expression in targeted cancer cells.
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 26, 2022, is named 10911_011098-WO0_SL.txt and is 248,895 bytes in size.
RNA interference (RNAi), also known as RNA silencing, has been extensively explored for therapeutic use in reducing gene expression but in the decades since its discovery few therapeutics have been approved. The traditional design pattern for RNA inhibition is that one piece of siRNA aims at one specific sequence (Reynolds et al., Nat Biotechnol, 22:326-330 (2004)). There remains a need in the art for compositions and methods of delivering siRNA to cells (e.g., malignant cells, tumor-associated T cells, effector T cells) to inhibit diseases such as cancer, metastasis or metabolic diseases. The nucleic acid compounds and methods of using the same as provided herein solve these and other problems in the art.
Recent work has expanded the RNA constructs to include joining two siRNAs to inhibit two different targets (Liu et al., Sci Reports, 6: (2016)). SiRNA's processed by cellular RNAi machinery to produce two siRNAs as opposed to dual administration offers a number of benefits including increased circulating half-life and reduced renal excretion (Liu et al., Sci Reports, 6: (2016)).
Dual targeting of genes by a single siRNA through targeting conserved homologous regions has been shown to be effective to inhibit the expression of gene families by diminishing the function of escape pathways. In vitro, a multi-target siRNA targeting the conserved homology region of DNMT3 family members effectively inhibited expression (Du et al., Gen and Mol Bio, 35:164-171(2012)).
Delivery to tissues other than the liver has remained a complication and hinderance for RNAi therapies. Aptamer-siRNA chimeras have been used to effectively deliver siRNA's to downregulate expression of oncological genes targets (Liu et al., Sci Reports, 6: (2016)).
U.S. Pat. No. 6,506,559 discloses a method to inhibit expression of a target gene in a cell, the method comprising the introduction of a double-stranded RNA into the cell in an amount sufficient to inhibit expression of the target gene, wherein the RNA is a double-stranded molecule with a first ribonucleic acid strand consisting essentially of a ribonucleotide sequence which corresponds to a nucleotide sequence of the target gene and a second ribonucleic acid strand consisting essentially of a ribonucleotide sequence which is complementary to the nucleotide sequence of the target gene. Furthermore, the first and the second ribonucleotide strands are separately complementary strands that hybridize to each other to form the said double-stranded construct, and the double-stranded construct inhibits expression of the target gene.
U.S. Pat. No. 5,475,096 discloses nucleic acid molecules each having a unique sequence, each of which has the property of binding specifically to a desired target compound or molecule. Each nucleic acid molecule is a specific ligand of a given target compound or molecule. The process, known as SELEX, is based on the idea that nucleic acids have sufficient capacity to form a variety of two- and three-dimensional structures with sufficient chemical versatility available within their monomers to act as ligands (form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of potentially any size can serve as targets.
The SELEX method involves selection from a mixture of candidates and step-wise iterations of structural improvement, using the same general selection theme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound to target molecules, dissociating the nucleic acid-target pairs, amplifying the nucleic acids dissociated from the nucleic acid-target pairs to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired.
U.S. Pat. No. 9,953,131 discloses a method for designing a dual-targeting short interfering RNAs (siRNAs) in which both strands are deliberately designed to separately target different mRNA transcripts with complete complementarity.
U.S. Pat. No. 9,777,278 discloses an interfering nucleic acid (iNA) duplex comprised of a sense strand of nucleotides having a 5′ end and a 3′ end annealed onto an antisense strand of nucleotides having a 5′ end and a 3′ end wherein the antisense strand has at least two segments, wherein one segment of the antisense strand can target a first RNA and another segment of the antisense strand can target a second RNA, or one segment of the antisense strand can target a first portion of an RNA and another segment of the antisense strand can target a second non-contiguous portion of said RNA.
U.S. Pat. No. 9,695,425 discloses an siRNA molecule that, when internalized by a B cell, suppresses expression of BAFF-R and one other target oncogene selected from: Bcl6, Bcl2, STAT3, Cyclin D1, Cyclin E2 and c-myc.
U.S. Pat. No. 10,689,654 discloses a bivalent siRNA chimera capable of silencing two or more genes. Methods of using the bivalent siRNA chimeras for selectively targeting cells to down-regulate the expression of multiple genes is also disclosed
Du et al., Gen and Mol Bio, 35:164-171(2012) discloses a siRNA targeting the conserved homologous region of DNMT3 family members.
U.S. Pat. No. 10,689,654 discloses a bivalent siRNA chimera platform that incorporates two aptamers for increase efficiency of delivering siRNAs to the targeted cell. Furthermore, those aptamers are conjugated to an siRNA construct that is processed by cellular RNAi machinery to produce at least two different siRNAs to inhibit expression of two or more different genes.
U.S. patent application Ser. No. 15/899,473 discloses bispecific aptamers.
U.S. Pat. No. 9,567,586 discloses an EPCAM aptamer coupled to an siRNA.
U.S. Pat. No. 10,385,343 discloses a method of treating cancer by administering a chimeric molecule comprising an EPCAM binding aptamer domain and an inhibitory nucleic acid domain that targets Plk1.
Patent Application PCT/US2020/038355 discloses an EpCAM-binding aptamer domain conjugated to an siRNA that inhibits the expression of a gene selected from the group consisting of: UPF2; PARP1; APE1; PD-L1; MCL1; PTPN2; SMG1; TREX1; CMAS; and CD47 for the purpose of treating cancer.
U.S. Pat. No. 10,960,086 discloses an siRNA-aptamer chimera that utilizes two aptamers targeting HER2 and HER3 and an siRNA targeting EGFR.
U.S. Pat. No. 8,828,956 N-acetylgalactosamine (GalNAc)-siRNA conjugates that enables subcutaneous dosing of RNAi therapeutics with potent and durable effects and a wide therapeutic index. This delivery systems is only effective for delivering to the liver as GalNAc binds to the Asialoglycoprotein receptor (ASGPR) that is predominantly expressed on liver hepatocytes.
U.S. Pat. No. 8,058,069 discloses lipid nanoparticle (LNP) delivery technology. LNP technology (formerly referred to as stable nucleic acid-lipid particles or SNALP) encapsulates siRNAs with high efficiency in uniform lipid nanoparticles that are claimed to be effective in delivering RNAi therapeutics to disease sites in various preclinical models.
U.S. Pat. No. 10,278,986 discloses an antibody conjugated to an siRNA as a delivery mechanism. The antibody targets C5aR and the siRNA targets C5 expression for the treatment of rheumatoid arthritis. Patent Application PCT/US2020/036307 discloses a method of preparing an antibody covalently linked to one or more oligonucleotides.
Aptamers are single-stranded RNA or DNA oligonucleotides that are capable of binding with high affinity and specificity and are cost effective to produce. Aptamers are of great interest as an antibody-like replacement and are being investigate for their ability to selectively bind to a specific target, including proteins, peptides, carbohydrates, etc., as well as function as a ligand for directed drug delivery. However, there are two primary hurdles for aptamers reaching clinical significance, their need to be stabilized for in vivo use against nuclease degradation which results in a short half life, and their rapid renal clearance due to their small size.
Native DNA aptamers are more stable than RNA aptamers as RNA is a transient messenger. The in vitro half-life of an RNA aptamer in plasma is a few seconds, while a DNA aptamer has a half-life of up to hour (2000 White et al, 2002 Takei et al, 1991 Shaw et al). The 2′ hydroxyl group of RNA makes it chemically unstable, susceptible to hydrolysis, and allows for the catalysis of RNA strand scission by endoribonucleases (2009 Houseley et al). For these reasons, RNA aptamers are commonly chemically modified primarily at the 2′-position of pyrimidines to enhance stability.
U.S. Pat. No. 5,660,985 describes oligonucleotides containing nucleotide derivatives chemically modified at the 5- and 2′-positions of pyrimidines and purines including 2′-fluoro and 2′-amino modifications.
U.S. Pat. No. 5,580,737, describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2′-amino (2′-NH#), 2′-fluoro (2′-F), and/or 2′-O-methyl (2′-OMe).
U.S. patent application Ser. No. 08/264,029 describes oligonucleotides containing various 2′-modified pyrimidines.
U.S. patent application Ser. No. 10/524,817 describes a 4′-thioribonucleotide modified aptamer which was later developed in Kato, Y. et al. (2005) into an aptamer against human α-thrombin.
U.S. Pat. No. 9,914,914 describes six different modifications where the canonical ribofuranose ring of DNA and RNA is replaced by five- or six-membered congeners comprising HNA (1,5 anhydrohexitol nucleic acids), CeNA (cyclohexenyl nucleic acids), LNA (2′-O,4′-C-methylene-β-D-ribonucleic acids; locked nucleic acids), ANA (arabinonucleic acids), FANA (2′-fluoro-arabinonucleic acid) and TNA (a-L-threofuranosyl nucleic acids).
U.S. patent application Ser. No. 61/748,834 describes Threose nucleic acid (TNA) modified aptamers.
U.S. patent application Ser. No. 60/905,461 describes double-stranded locked nucleic acid modifications (2′-O,4′-C-methylene-β-D-ribonucleic acids).
Lato, S. M. (2002) Nucleic Acids Res., describes Ribonucleoside 5′-(alpha-P-borano)-triphosphates (BH3-RNA) modified aptamers.
PCT Publication No. 1997/004726 describes spiegelmers which are mirror images of the natural aptamers in which the D-ribose (the natural ribose) are replaced with the unnatural L-ribose. PCT Publication NO. 2001/006014 describes one of the first SELEX generated spiegelmers developed against D-adenosine.
Jhaveri, S. et al. (1998) Bioorg. Med. Chem. Lett., describes Ribonucleoside 5′-(alpha-thio) triphosphates (S-RNA) modified aptamers.
PCT Publication No. 1994/010562 describes RNA aptamers containing photoreactive chromophore 5-iodouridine using crosslinking SELEX.
In spite of recent advances, there is a need in the art for compositions and methods of delivering modulators of cell activity (e.g., anti-tumor agents, anti-obesity agents) to cells (e.g., malignant cells, tumor-associated T cells, effector T cells) to inhibit diseases such as cancer, metastasis or metabolic diseases. The nucleic acid compounds and methods of using the same as provided herein solve these and other problems in the art.
A multi-targeting siRNA-aptamer platform is provided that is efficiently delivered and is processed by cellular RNAi machinery to produce one, two or more siRNAs. Methods of using the multi-targeting siRNA-aptamer for selectively targeting cancer cells to down-regulate the expression of multiple genes are also provided.
Cancer drugs are most effective when given in combination. One rationale for combination therapy is to use drugs that work by different mechanisms, thereby decreasing the likelihood that resistant cancer cells will develop. When drugs with different effects are combined, each drug can be used at its optimal dose, without intolerable side effects. See for example, https://www.merckmanuals.com/en-ca/home/cancer/prevention-and-treatment-of-cancer/combination-cancer-therapy, accessed May 3, 2021.
Combination therapy may also operate by simultaneously blocking two or more signaling pathways, Wu et al., Nat Biotechnol, 25:1290-1297 (2007). In addition, tumor progression and metastasis may be suppressed by overcoming the functional redundancy or synergistic action of targeted molecules (van der Veeken, et al., Current Cancer Drug Targets, 9:748-760 (2009)).
Zhao, et al. (Cancer discovery. 4. 10.1158/2159-8290.CD-13-0465, 2013) discuss the problem of intra-tumor heterogeneity and the approach of using computationally predictive combination therapy to address this problem.
NSCLC is any type of epithelial lung cancer other than small cell lung cancer (SCLC). NSCLC includes squamous cell carcinoma, large cell carcinoma, and adenocarcinoma, but there are other types also. NSCLCs are associated with cigarette smoke, however, adenocarcinomas are also found in patients who have never smoked.
NSCLC is generally less sensitive to chemotherapy and radiation therapy compared with SCLC. There are approximately 240,000 new cases and 130,000 deaths from lung cancer (NSCLC and SCLC combined) in the United States per year and lung cancer is the leading cause of cancer-related mortality in the United States.
Patients with advanced non-small cell lung cancer (NSCLC) have a very poor prognosis. TROP2 expression is associated with a poor prognosis, particularly in patients with adenocarcinoma histology, and offers a promising target for treatments. See https://www.onclive.com/view/novel-adc-appears-to-leverage-trop2-expression-in-nsclc accessed Apr. 27, 2022.
In certain embodiments of the instant invention NSCLC is treated with a chimeric aptamer siRNA construct comprising aptamers against Trop2 and Her3 plus siRNAs that inhibit a synthetic lethal pair of genes. In one preferred embodiment of a NSCLC treatment the synthetic lethal gene pair include UBB and UBC.
Colorectal cancer (CRC), including bowel cancer, colon cancer, or rectal cancer, colorectal cancer is the third most common cancer diagnosed in the United States. The American Cancer Society's estimates that in the United States there are 106,180 new cases of colon cancer.
In certain embodiments of the instant invention colon cancer is treated with a chimeric aptamer siRNA construct comprising aptamers against Epcam and Her3 plus siRNAs that inhibit a synthetic lethal pair of genes. In one preferred embodiment of a colon cancer treatment the synthetic lethal gene pair include UBB and UBC.
Prostate cancer is the second most common cancer globally. In 2018 there an estimated 1.2 million new cases with 359,000 deaths. Bray F, Ferlay J, Soerjomataram I, Siegel R L, Torre L A, Jemal A (November 2018). “Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries”. CA: A Cancer Journal for Clinicians. 68 (6): 394-424. doi:10.3322/caac.21492. PMID 30207593. S2CID 52188256.
In certain embodiments of the instant invention prostate cancer is treated with a chimeric aptamer siRNA construct comprising aptamers against Trop2 and PSMA plus siRNAs that inhibit a synthetic lethal pair of genes. In one preferred embodiment of a NSCLC treatment the synthetic lethal gene pair include UBB and UBC.
As used herein, the term “oncogene” refers to a gene that can in some circumstances transform a cell into a cancerous cell or a gene that promotes the survival of a cancer cell.
As used herein, the term “effective amount” in the context of the administration of a therapy to a subject refers to the amount of a therapy that achieves a desired prophylactic or therapeutic effect.
A “siRNA,” “small interfering RNA,” “small RNA,” or “RNAi” as provided herein refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene (e.g., when expressed in the same cell as the gene or target gene). The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In certain embodiments, a siRNA or RNAi is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA.
In certain embodiments, the instant invention comprises a chimeric molecule including a cancer marker-binding domain and an inhibitory nucleic acid domain. As used herein, “cancer marker-binding domain” refers to a domain and/or molecule that can bind specifically to a molecule more highly expressed on the surface of a cancer cell as compared to a healthy cell of the same type (a “cancer marker”). As used herein, “inhibitory nucleic acid domain” refers to a domain comprising an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid can be a siRNA.
Certain embodiments of the instant invention comprise multi- and multi-multi-targeting siRNA and siRNA-aptamer chimeric molecules in treating cancer and other diseases which can be treated by genetic inhibition. The compounds and methods in certain embodiments of the instant invention may utilize one or more aptamers that target the therapeutic constructs specifically to cancer cells, providing effective and on-target suppression of the gene or genes targeted by the siRNA.
As used herein “multi-targeting siRNA or construct” refers to a set of unique and novel synthetic molecules for efficacious anti-tumor activity. These constructs each include siRNA molecules that each engage a cell's RNA inhibition system to inhibit more than one different gene (for example UBB and UBC).
As used herein “multi-multi-targeting siRNA or construct” refers to a set of unique and novel synthetic molecules for efficacious anti-tumor activity. These constructs each include siRNA molecules that each engage cell's RNA inhibition system to inhibit more than one different gene and that also include sequences found multiple times within each gene. Such multi-multi-targeting siRNA can be utilized alone or in constructs comprising multiple such siRNAs as well as one or more aptamers. Simple examples of such constructs can be targeted to one or more cancer cells and can inhibit or silence three or four genes although more exotic constructs can readily be envisioned by one skilled in the art once the instant invention is understood.
Ubiquitin B (UBB) is one of the two genes that encode for Ubiquitin. Silencing of UBB results in dependence on the second gene, Ubiquitin C (UBC) (Tsherniak et al., Cell, 170: 564-576(2017)). In certain embodiments described herein UBB and UBC can be effectively targeted with a single siRNA.
UBB and UBC also contain multiple conserved regions that could be exploited as a means to target both genes in multiple locations with one siRNA. Targeting multiple genes in multiple locations will be defined as multi-multi-targeting. Thus, a UBB/UBC siRNA can be designed as a multi-multi-targeting siRNA construct. When included in an siRNA/aptamer chimera including more than one aptamer, the construct actually can be thought of as a multi-multi-multi-targeting molecule.
A preferred aptamer for conjugation to a multi-targeting siRNA is an epithelial cell adhesion molecule (EpCAM) aptamer, EpCAM is a glycosylated membrane protein that is expressed in most organs and glands, with the highest expression in colon. (Schnell et al., BBA—Biomembranes, 1828: 1989-2001(2013)). Sequences for EpCAM are known for a variety of species, e.g., human EpCAM (see, e.g., NCBI Gene ID:4072; protein sequence: NCBI Ref Seq: NP_002345.2). A single EpCAM aptamer consisting of 19-nt RNA possesses similar binding affinity as antibodies and is efficiently internalized through receptor-mediated endocytosis (Shigdar, et al., Cancer Sci, 102:991-998 (2011); Wang, et al., Theranostics, 5:1456-1472 (2015)). Additionally, EpCAM is highly expressed in colon cancers and associated with colon cancer cell migration, proliferation, metastasis, and poor prognosis (Liang et al., Cancer Letters, 433: 165-175(2018)). For these reasons EpCAM has been used in certain embodiments of the instant invention as an aptamer target for targeted delivery of therapeutic siRNAs for colon cancer.
In certain embodiments, the aptamers described herein, for example those targeting EpCAM, permit the therapy to target tumor-initiating cells (also referred to as cancer stem cells). These cells are responsible not only for tumor initiation, relapse, and metastasis, but are also relatively resistant to conventional cytotoxic therapy. Thus, the compositions and methods described herein permit effective treatment of the underlying pathology in a novel way that existing therapies fail to do.
Moreover, the compounds according to certain embodiments of the instant invention are expected to be surprisingly efficacious in the treatment of colon cancers.
The compounds according to the instant invention are effective to inhibit gene expression in tumor cells.
The instant invention is also designed for targeted delivery of the therapeutic constructs and thus rapid tumor regression.
In certain embodiments, the cancer marker can be a protein and/or polypeptide. In certain embodiments, one cancer marker can be EpCAM. In certain preferred embodiments, the cancer marker-binding domain can be an aptamer.
In certain embodiments each siRNA inhibits two or more different genes.
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of UBB and UBC.
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of MAP2K1 and MAP2K2.
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of ERK1 (MAPK3) and ERK2 (MAPK1).
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of MAPK11 and MAPK14.
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of MDM2 and MDM4.
One embodiment provides a bivalent siRNA chimera that contains two siRNAs where one siRNA inhibits the expression of PFKFB3 and PFKFB4.
In certain embodiments siRNAs have been experimentally verified by real-time RT-PCR analysis and shown to provide at least 70% target knockdown at the mRNA level when used under optimal delivery conditions (confirmed using validated positive control and measured at the mRNA level 24 to 48 hours after transfection using 100 nM siRNA).
In certain other embodiments, siRNAs have been demonstrated to silence target gene expression by at least 75% at the mRNA level when used under optimal delivery conditions as validated by positive controls and measured at the mRNA level 24 to 48 hours after transfection using 100 nM siRNA.
Another embodiment provides a siRNA-aptamer chimera with two aptamers.
In certain embodiments, an aptamer of the siRNA chimeras binds to a cell surface protein expressed on cancer cells.
In certain embodiments, an aptamer of the siRNA chimeras specifically bind to epithelial cell adhesion molecules (EpCAM), a glycosylated membrane protein.
In certain embodiments, an aptamer of the siRNA chimeras specifically bind to DExH-Box Helicase 9, DHXP ((NCBI Gene ID: 1660). DHX9 protein is involved in transcriptional and translational regulation, DNA replication/repair, and maintenance of genome stability. DHX9 has been shown to shuttle between the nucleus and the cytoplasm
In certain embodiments, a method is provided which includes administering to a subject in need thereof and effective amount of bivalent siRNA chimera having aptamers that specifically bind to EPCAM and siRNA constructs that are processed to produce siRNA that inhibits expression of UBB and UBC; NR4A1, NR4A2 and NR4A3; ADORA2A and ADORA2B; MAP2K1 and MAP2K2; ERK1 (MAPK3) and ERK2 (MAPK1); MAPK11 and MAPK14; MDM2 and MDM4; PFKFB3 and PFKFB4; TOX and TOX2.
Another embodiment provides a pharmaceutical composition containing one or more different bivalent siRNA chimeras in an amount effective to down down-regulate at least three different genes in a target cell.
The method includes administering a dual targeting siRNA agent to the subject to be treated. When the organism to be treated is a mammal such as a human, the composition can be administered by any means known in the art including, but not limited to oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, and airway (aerosol) administration. In some embodiments, the compositions are administered by intravenous infusion or injection.
Additional cancer markers that may be targeted by the aptamer portion of certain embodiments of the instant invention include, but are not limited to, ERBB2, ERBB3, PSMA, FOLH1, CD44, FOLH1, PSCA, PDCD1, TACSTD2, NT5E, PDCD1, CTLA4, LAG3, DHX9, or HAVCR2.
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting ERBB2 (HER2) (NCBI Gene ID: 2064). HER2, a membrane tyrosine kinase, is overexpressed in 20%-30% of breast cancer and correlates with poor prognosis, high aggressiveness, and extensive drug resistance. U.S. Pat. No. 10,960,086 discloses an aptamer targeting HER2 as part of an siRNA-aptamer chimera.
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting ERBB3 (HER3) (NCBI Gene ID: 2065). HER3, a membrane tyrosine kinase, is involved in the resistance against EGFR- and HER2-targeted therapies through activation of a compensatory survival pathway. U.S. Pat. No. 10,960,086 discloses an aptamer targeting HER3 as part of an siRNA-aptamer chimera.
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting PSMA (NCBI Gene ID: 2346). Prostate-specific membrane antigen is a transmembrane protein expressed in all types of prostatic tissue. PSMA expression correlates
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting CD44 (NCBI Gene ID: 960). CD44 is a transmembrane glycoprotein whose aberrant expression and dysregulation contributes to tumor initiation and progression. CD44 is involved in many processes including T cell differentiation, branching morphogenesis, proliferation, adhesion and migration. CD44 is a common biomarker of cancer stem cells.
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting EPCAM (NCBI Gene ID: 4072). EPCAM is a glycosylated membrane protein that is expressed in most organs and glands, with the highest expression in colon and is associated with colon cancer cell migration, proliferation, metastasis, and poor prognosis. A single EpCAM aptamer consisting of 19-nt RNA possesses similar binding affinity as antibodies and is efficiently internalized through receptor-mediated endocytosis (Shigdar, et al., Cancer Sci, 102:991-998 (2011).
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting PSCA, prostate stem cell antigen (NCBI Gene ID: 8000). PSCA is a membrane glycoprotein predominantly expressed in the prostate with a possible role in cell adhesion, proliferation control and cell survival. PSCA can have a tumor promoting or a tumor suppressive effect depending on the cell type.
In certain embodiments, the aptamer-siRNA chimera of the instant invention includes an aptamer targeting TROP2 (NCBI Gene ID: 4070). TROP2, a cell-surface glycoprotein, is a paralog of epithelial-specific cell adhesion molecule (EpCAM). It is overexpressed in adenocarcinomas, minimally expressed in normal tissues, and expression level is correlated with tumor invasiveness and poor prognosis.
The inhibitory nucleic acid domain of constructs according to the instant invention can inhibit the expression of a gene product that is upregulated in a cancer cell and/or the expression of a gene that is required for cell growth and/or survival. In some embodiments, the inhibitory nucleic acid domain can inhibit the expression of a gene selected from UBB (e.g. “Ubiquitin B”; NCBI Gene ID: 7314); UBC (e.g. “Ubiquitin C”; NCBI Gene ID: 7316), BCL2, STAT3, MYC, SYK, CCNE2, CCND1, CCND2, BIRC5, EGFR, UBB, UBC, NR4A1, NR4A2, NR4A1, NR4A3, ADORA2a, ADORA2b, ADORA1, MAP2K1, MAP2K2, MAPK3 (ERK1), MAPK1 (ERK2), HIF1, HIF2, PFKFB3, PFKFB4, PLK1, PLK4, CDK11A, CDK11B, CDK4, CDK6, PARP1, or PARP2. Sequences of these genes, e.g., the human mRNAs, may be obtained from the NCBI database and can be used according to the instant invention to inhibitory nucleic acids.
Furthermore, provided herein are exemplary inhibitory nucleic acid domains, e.g., a nucleic acid having the sequence of SEQ ID NO: 604.
Ubiquitin B (UBB) is one of the two genes that encode for Ubiquitin. Silencing of UBB results in dependence on the second gene, Ubiquitin C (UBC) (Tsherniak et al., Cell, 170: 564-576(2017)). Targeting of UBC in high-grade serous ovarian cancer (HGSOC), a cancer known for chronic UBB repression, demonstrated tumor regression and long term survival benefits. This suggests dual targeting UBB and UBC as a potential therapeutic strategy for cancer (Kedves, et al., Clin Invest, 127: 4554-4568 (2017)).
In certain embodiments, a siRNA according to the invention targets BCL2 (NCBI Gene ID:596) which is a regulator of apoptosis that is triggered in response to stress signals. BCL-2 was the first gene shown to promote prolonged cell survival rather than increased proliferation leading to the concept that inhibition of apoptosis is an important step in tumorigenesis.
In certain embodiments, a dual-targeting siRNA targets BCL2 and STAT3 (NCBI Gene ID: 6774) which is a cytoplasmic transcription factor that regulates cell proliferation, differentiation, survival, angiogenesis, and immune response.
In certain embodiments, a dual-targeting siRNA targets BCL2 and MYC (NCBI Gene ID: 4609) which is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. Reregulated expression of MYC causally contributes to tumorigenesis and tumor growth maintenance.
In certain embodiments, a dual-targeting siRNA targets BCL2 and SYK (NCBI Gene ID: 6850), Spleen Associated Tyrosine Kinase, which has a cancer dependent therapeutic function. In many hematopoietic malignancies, SYK provides a survival function and inhibition or silencing of SYK can promote apoptosis. In cancers of non-immune cells, SYK can suppress tumorigenesis by enhancing cell-cell interactions and inhibiting migration.
In certain embodiments, a dual-targeting siRNA targets BCL2 and Cyclin E2 (NCBI Gene ID: 9134), a member of the cyclin family that assists in regulating the cell cycle and whose expression has been associated with chemotherapy resistance of tumor cells and poor prognosis.
In certain embodiments, a dual-targeting siRNA targets Cyclin E2 and Cyclin D1 (NCBI Gene ID: 595). Cyclin D1 overexpression is predominantly correlated with early cancer onset, tumor progression, shorter cancer patient survival and increased metastases.
In certain embodiments, a dual-targeting siRNA targets Cyclin D1 and EGFR (NCBI Gene ID: 1956), epidermal growth factor receptor, a cell surface protein whose expression modulates growth, signaling, differentiation, adhesion, migration and survival of cancer cells.
In certain embodiments, a dual-targeting siRNA targets Survivin (BIRC5) (NCBI Gene ID: 332) and Cyclin D2 (NCBI Gene ID: 895). Expression of Survivin in tumors correlates with inhibition of apoptosis, resistance to chemotherapy, and tumor progression. Cyclin D2 overexpression has a critical role in cell cycle progression and the tumorigenicity and suppression of cyclin D2 expression has been linked to G1 arrest in vitro.
CD45.1+CD45.2+(B6SJL×C57BL6) congenic mice were subcutaneously injected with OVA-expressing EL4 cells (E.G7 lymphoma) cells (5×105 cells per mouse) in one flank. Six days later, PBS, wild-type or Nr4a1−/− OT-I cells (3×106 cells per mouse) were adoptively transferred into mice intravenously. Tumor sizes were monitored after adoptive transfer. To assess tumor-infiltrating donor T cells, mice were euthanized 6 days after T cell transfer. Donor-derived T cells were collected from tumor, draining lymph nodes and spleens, and subjected to flow cytometry analysis. Adoptive transfer of Nr4a1−/− transgenic CD8+ T recognizing OVA257-264 peptide (OT-I) cells into E.G7 tumor cell-bearing mice nearly eliminated tumors, in contrast with wild-type OT-I cells and a PBS control group. This data demonstrates that NR4A1 is linked to CD8+ T cell dysfunction (Liu, X., et al. Nature 2019).
Dysfunctional, or exhausted CD8+ T cells arise in the settings of chronic viral infection or cancer when persistent exposure to antigen leads to prolonged T cell receptor (TCR) signaling. In the exhausted state, T cell effector functions are impaired and manifest as decreased proliferative capacity, reduced cytolytic function and effector cytokine production, and altered in gene expression and metabolism. Notably, exhausted T cells upregulate multiple inhibitory receptors that include but are not limited to these immune checkpoint proteins: PD-1, CTLA-4, TIM-3, LAG-3, TIGIT, 2B4/CD244 and others. While activated effector T cells also transiently express immune checkpoint proteins, expression level increase and are sustained on exhausted T cell subsets. Transcription factors such as TOX and NR4A1 have been described as master regulators of exhaust.
In certain embodiments, these first-in-class, bivalent aptamer-dual siRNA chimeras harnesses the immune stimulatory potential of CTLA-4 and PD-1 within one RNA molecule. The results of the Phase III Checkmate 227 clinical trial in advanced non-small cell lung cancer recently demonstrated the longer duration of overall survival compared with chemotherapy in patients with NSCLC (Hellmann et al., N Engl J Med, 2019). In addition to delivering CTLA-4 and PD-1 antagonists selectively to T cells, this bivalent aptamer carries siRNA silencers that knock down expression of NR4A1, which reinvigorates exhausted T cells and VHL, which enables cells to adapt to hypoxic conditions in the TME.
In certain embodiments, a dual-targeting siRNA targets NR4A1 (NCBI Gene ID: 3164) and NR4A2 (NCBI Gene ID: 4929). When T cells encounter sustained T cell stimulation through exposure to self-antigens, to chronic infections or to the tumor microenvironment, then effector T cells may become dysfunctional to avoid excessive immune responses, which is known as T-cell exhaustion. NR4A1, a driver of cancer cell survival, has been identified as a key mediator of T cell dysfunction and contributor of regulatory T-cell-mediated suppression of anti-tumor immunity in the tumor microenvironment. Nr4a2 is highly expressed in tumor-infiltrating cells than in bystander cells. Furthermore, mice lacking Nr4a1 and Nr4a2 genes specifically in Tregs showed resistance to tumor growth in transplantation models.
In certain embodiments, a dual-targeting siRNA targets NR4A1 and NR4A3 (NCBI Gene ID: 8013), which is expressed similarly to NR4A1.
In certain embodiments, a multi-targeting siRNA targets NR4A1, NR4A2, and NR4A3.
In certain embodiments, a dual-targeting siRNA targets ADORA2a (NCBI Gene ID: 135) and ADORA2b (NCBI Gene ID: 136). ADORA2a signaling during T cell activation strongly inhibited development of cytotoxicity and cytokine-producing activity in T cells, whereas the inhibition of T cell proliferation was only marginal. While an adenosine-rich environment may allow for the expansion of T cell, it impairs the functional activation of T cells. Targeting the ADORA2a immunosuppressive pathway restores both effector function and metabolic fitness of peripheral and tumor-derived CD8+ T cells. ADORA2b promotes the expansion of myeloid-deriver suppressor cells which are immunosuppressive cells that promote tumor progression by impairing antitumor T-cell responses and/or modulating angiogenesis. Inhibition may be effective in delaying the growth of melanoma and perhaps other cancer as they improve local immunosurveillance. Experiments targeting both ADORA2a and aADORA2b have shown greater infiltration by CD8+ T cells as well as NK cells, and they encompass fewer Tregs.
In certain embodiments, a dual-targeting siRNA targets ADORA2a and ADORA1 (NCBI Gene ID: 134). ADORA1 and ADORA2A are paralogues and high-affinity receptors responding to low concentrations of extracellular adenosine.
In certain embodiments, a dual-targeting siRNA targets MAP2K1 (NCBI Gene ID: 5604), MEK1, and MAP2K2 (NCBI Gene ID: 5605), MEK2. MEK1 and MEK2 are closely related and participate in the Ras/Raf/MEK/ERK signal transduction cascade. MEK1 and MEK2 are the exclusively specific activators of ERK1/2, and their inhibition could result in the clinical benefits for treatment of cancers with RAS/RAF dysfunction.
In certain embodiments, a dual-targeting siRNA targets MAPK3 (NCBI Gene ID: 5595), ERK1, and MAPK1 (NCBI Gene ID: 5594) ERK2. ERK1 and ERK2, which are homologous by 85%, are part of the MAPK pathway, and the only substrate or MEK. The Ras-dependent extracellular signal-regulated kinase (ERK)1/2 mitogen-activated protein (MAP) kinase pathway plays a central role in cell proliferation control. ERK1/2 inhibitors can reverse the abnormal activation of MAPK pathway induced by upstream mutations including RAS mutation (Liu et al).
In certain embodiments, a dual-targeting siRNA target HIF1 (NCBI Gene ID: 3091) and HIF-2 (NCBI Gene ID: 2034). Hypoxia inducible factor (HIF)-1 and HIF-2 are heterodimeric transcription factors mediating the cellular response to hypoxia.
In certain embodiments, a dual-targeting siRNA target TOX(NCBI Gene ID: 9760) and TOX2 (NCBI Gene ID: 84968). High mobility group (HMG)-box transcription factors, TOX and TOX2, are critical for the transcriptional program of CD8; T cell exhaustion downstream of NFAT.
In certain embodiments, a dual-targeting siRNA targets PFKFB2 (NCBI Gene ID: 5208) and PFKFB3 (NCBI Gene ID: 5209). PFKFB2 is overexpressed in pancreatic adenocarcinomas and functions to regulate glycolysis and proliferation in pancreatic cancer cells. PFKFB3 is important for maintaining metabolic functions in pancreatic cancers and may be involved in providing a localized ATP supply at the plasma membrane.
In certain embodiments, a dual-targeting siRNA targets PFKFB3 and PFKFB4 (NCBI Gene ID: 5210). PFKFB4 is regulatory enzyme synthesizes a potent stimulator of glycolysis and is over expressed in many types of cancer such as in glioma, lung, and prostate cancers.
In certain embodiments, a dual-targeting siRNA targets PLK1 (NCBI Gene ID: 5347) and PLK4 (NCBI Gene ID: 10733). Polo-like kinase 1 and 4 play an important role in the initiation, maintenance, and completion of mitosis. Dysfunction of PLK1/4 promotes tumorigenesis. PLK1/4's role in cellular growth and proliferation and overexpression in multiple types of human cancer and has made them an attractive dual target.
In certain embodiments, a dual-targeting siRNA targets CDK11A (NCBI Gene ID: 728642) and CDK11B (NCBI Gene ID: 984). Recent studies have found that the overexpression and activation of CDK11 is crucial in the growth and proliferation of cancer cells, including breast cancer, multiple myeloma, osteosarcoma, and other types of cancer. Both of genes contain 20 exons and 19 introns that encode almost identical protein kinases, CDK11A and CDK11B.
In certain embodiments, a dual-targeting siRNA targets CDK6 (NCBI Gene ID: 1021) and CDK4 (NCBI Gene ID: 1432). CDK4/6 is highly expressed in the majority of human cancers through a multitude of genomic alterations. Sustained activation of CDK4/6 encourages cancer cells to enter the cell cycle continuously by shortening the duration of the G1 phase. CDK4/6 is highly expressed in the majority of human cancers through a multitude of genomic alterations. Sustained activation of CDK4/6 encourages cancer cells to enter the cell cycle continuously by shortening the duration of the G1 phase.
In certain embodiments, a dual-targeting siRNA targets MAPK11 (NCBI Gene ID: 5600) and MAPK14 (NCBI Gene ID: 1019). Mitogen activated protein kinases are involved in signaling transduction pathways, cell survival, differentiation, proliferation and apoptosis. MAPK11 has been found to be hypermethylated with a slight increase of expression in Breast, Uterine Endometrial, Cervical, Ovarian and Uterine Carcinosarcoma cell samples. MAPK11'S functions are mostly redundant to MAPK14 making these genes a strong dual target.
In certain embodiments, a dual-targeting siRNA targets MDM2 (NCBI Gene ID: 4193) and MDM4 (NCBI Gene ID: 4194). MDM2 and MDM4 are inhibitors of p53 expression. Dual inhibition of these genes has been shown to inhibit cellular proliferation by inducing cell cycle arrest and apoptosis in certain cancers.
In certain embodiments, a dual-targeting siRNA targets PARP1 (NCBI Gene ID: 142) and PARP2 (NCBI Gene ID: 10038). PARP is an important player in the DNA repair pathway which decreases cytotoxicity of chemotherapies and other. Targeted inhibition of PARP in cancerous cells assists in promoting cytotoxicity especially in combination with another therapy.
In certain embodiments, a dual-targeting construct targets PIKFYVE (NCBI Gene ID: 200576) as one of the targets. PIKFYVE is a lipid kinase and is involved in oncogenesis and cancer cell migration. Inhibition of this target has demonstrated slowed growth in prostate tumor cells.
In certain embodiments, a dual-targeting construct targets MTOR (NCBI Gene ID: 2475) as one of the targets. mTOR is a phosphatidylinositol kinase-related kinase and plays a key role in tumorigenesis. The AKT/mTOR signaling pathway is often upregulated in tumors.
In certain embodiments, a dual-targeting construct targets GRB7 (NCBI Gene ID: 2886) as one of the targets. GRB7, growth factor receptor bound protein-7, is a critical mediator of EGFR/ErbB signaling and the cancers associated.
In certain embodiments, a dual-targeting construct targets IDO1 (NCBI Gene ID: 3620) as one of the targets. Indoleamine 2, 3-dioxygenase, IDO1, is a tryptophan catabolic enzymes that catalyze the conversion of tryptophan into kynurenine which has the effect of suppressing the functions of effector T and natural killer cells, and promotes neovascularization of solid tumors.
In certain embodiments, a dual-targeting construct targets c-MYC (NCBI Gene ID: 4609) as one of the targets. C-MYC is a proto-oncogene and overexpression of the c-Myc gene is responsible for many of the changes that induce malignant changes.
In certain embodiments, a dual-targeting construct targets YY1 (NCBI Gene ID: 7528) as one of the targets. Yin Yang 1, YY1 is a transcription factor that regulates transcriptional activation and repression of many genes associated malignant transformation. YY1 is known to be pro-tumorigenic in colon cancer.
In certain embodiments, a dual-targeting construct targets CBLB (NCBI Gene ID: 868) as one of the targets. Cbl-b is expressed in all leukocyte subsets and regulates several signaling pathways in T cells, NK cells, B cells, and different types of myeloid cells
In certain embodiments, a dual-targeting construct targets RICTOR (NCBI Gene ID: 253260) as one of the targets. RICTOR is a member of the protein complex mTORC2 that functions in the regulation of actin organization, cell proliferation and survival.
In certain embodiments, a dual-targeting construct targets MSI1 (NCBI Gene ID: 4440) as one of the targets. Musashi RNA binding protein is a member of the protein complex mTORC2 that functions in the regulation of actin organization, cell proliferation and survival.
In certain embodiments, a dual-targeting construct targets AKT1 (NCBI Gene ID: 207) as one of the targets. AKT is a key element of the PI3K/AKT signaling pathway and regulates tumor growth, survival and invasiveness of tumor cells.
In certain embodiments, a dual-targeting construct targets BATF (NCBI Gene ID: 10538) as one of the targets. BATF, Basic Leucine Zipper ATF-Like Transcription Factor, may play an important role in the development of different types of cancer, including colon cancer, lymphoma and multiple myeloma
In certain embodiments, a dual-targeting construct targets ME2 (NCBI Gene ID: 4200) as one of the targets. Malic Enzyme 2 expression increases as tumor progression, cell migration, and invasion capabilities of cells are increased.
In certain embodiments, a dual-targeting construct targets ME3 (NCBI Gene ID: 10873) as one of the targets. Malic Enzyme 3 can promote proliferation, migration and invasion in pancreatic cancer cells.
Certain embodiment this invention include dual-targeting siRNA targeting two genes selected from a list consisting of: AKT1, ASCL1, BRAF, CD155, CDCP1, CTLA4, CTNNB1, CUX1, DHODH, EHMT1, ELK1, ERBB2, EZH2, FLT3, GLI1, GRB2, TOP1, GRB7, IDO1, KRAS, FGFR1, FGFR2, FKBP52, UBB, UBC, NUAK1, ONECUT2, PSMA, PDL1, PDL2, SON, NR4A1, NR4A, NR4A2, NR4A3, ADORA2a, ADORA2B, ADORA1, MAP2K1, MAP2K2, MAPK3 (ERK1), MAPK1 (ERK2), MAPK14, MDM2, MDM4, ME2, ME3, MSI1, MSI2, MTOR, RICTOR, RPTOR, MYCN, HIF1, HIF2, PFKFB3, PFKFB4, PFKFB2, PIK3CA, PIKFYVE, PTPN11, SKP2, SOAT1, SREBP2, SULT2B1, YAP, YY1, TEAD2, TERTM TMPRSS2, TSPAN3, ULK1, PLK1, PLK4, CDK11A, CDK11B, CDK4, CDK6, PARP1, PARP2, SYK, STAT3, MYC, BCL2, BCLXL, BMI1, FGFR3, FGFR4, PDGFRA, PDGFRB, IGF1R, IGF2R, ABCC3, IKBKB, IKBKA, FOXM1, RORC, PAK1, CXCR4, CCNE2, CCND2, BIRC5, CCND1, EGFR, EPCAM, HER2, HER3, GSK3B, RAB11, RAB1, Mir652, TAGN2, DUSP1, RPL10, FPRL1, miR29B, MUC12, miR200a, HSF1, TSPX, TRAF6, GATA2, ABDH2, AR, CCL5, PIKFYVE, MTOR, GRB7, IDO1, c-MYC, YY1, RICTOR, CBLB, MSI1, MSI2, and TPX2.
In some embodiments, the methods described herein relate to treating a subject having or diagnosed as having cancer with a composition as described herein. Subjects having cancer can be identified by a physician using current methods of diagnosing cancer.
In some embodiments, the pharmaceutical composition as described herein can be a parenteral dose form. Since administration of parenteral dosage forms typically bypasses the patient's natural defenses against contaminants, parenteral dosage forms are preferably sterile or capable of being sterilized prior to administration to a patient. Examples of parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions. In addition, controlled-release parenteral dosage forms can be prepared for administration of a patient, including, but not limited to, DUROS®-type dosage forms and dose-dumping.
Suitable vehicles that can be used to provide parenteral dosage forms as disclosed within are well known to those skilled in the art. Examples include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate. Compounds that alter or modify the solubility of a pharmaceutically acceptable salt can also be incorporated into the parenteral dosage forms of the disclosure, including conventional and controlled-release parenteral dosage forms.
Pharmaceutical compositions can also be formulated to be suitable for oral administration, for example as discrete dosage forms, such as, but not limited to, tablets (including without limitation scored or coated tablets), pills, caplets, capsules, chewable tablets, powder packets, cachets, troches, wafers, aerosol sprays, or liquids, such as but not limited to, syrups, elixirs, solutions or suspensions in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion, or a water-in-oil emulsion. Such compositions contain a predetermined amount of the pharmaceutically acceptable salt of the disclosed compounds, and may be prepared by methods of pharmacy well known to those skilled in the art. See generally, Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams, and Wilkins, Philadelphia Pa. (2005).
Conventional dosage forms generally provide rapid or immediate drug release from the formulation. Depending on the pharmacology and pharmacokinetics of the drug, use of conventional dosage forms can lead to wide fluctuations in the concentrations of the drug in a patient's blood and other tissues. These fluctuations can impact a number of parameters, such as dose frequency, onset of action, duration of efficacy, maintenance of therapeutic blood levels, toxicity, side effects, and the like. Advantageously, controlled-release formulations can be used to control a drug's onset of action, duration of action, plasma levels within the therapeutic window, and peak blood levels. In particular, controlled- or extended-release dosage forms or formulations can be used to ensure that the maximum effectiveness of a drug is achieved while minimizing potential adverse effects and safety concerns, which can occur both from under-dosing a drug (i.e., going below the minimum therapeutic levels) as well as exceeding the toxicity level for the drug. In some embodiments, the composition can be administered in a sustained release formulation.
In further embodiments, administration of a dual targeting siRNA agent is administered in combination an additional therapeutic agent. The dual targeting siRNA agent and an additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.
The following non-limiting examples illustrate embodiments of the invention in operation. Having read the specification claims and Figures in their entirety, one skilled in the art will reasonably appreciate that numerous modifications and substitutions of the embodiments are possible and can be carried out without requiring undue experimentation. Such modifications and substitutions constitute part of the present invention.
siRNA targeting sequences UBBs1- (SEQ ID NO: 896): AAGGCCAAGATCCAAGATAAA (U.S. Pat. No. 8,470,998) and UBBs2- (SEQ ID NO: 897): AAGAGGTGGTATGCAGATCTT. Analysis of UBB revealed three potential targeting regions for UBBs1 with 19/19, 18/19, and 17/19 conserved identities (
After identifying a siRNA that bound to the UBB gene in three regions, 6 genes were identified to have conserved homology with UBB and to be potential dual target partners to the siRNA inhibition. These targets (DCP2, FAM83F, LOC646588, RNF17, NACA2, and UBC,
BLAST results of UBC (
A lead siRNA or aptamer compound could be substituted in this template (
A siRNA library was developed containing 19 compounds of 19mer siRNA's targeting UBB Sequences:
6 scrambled UBBs1 targeting sequences were developed as controls:
Three UBBs1-like targeting compounds were developed including one that is designed to target UBC in a conserved location to target both UBB and UBC.
HCT-116, SW480, RKO, and HT-29 colon cancer cells were treated under standard siRNA transfection conditions with various siRNA compounds including those previously listed as well as ASN (negative control) and ASP (positive control) (16.7 nM; 96 hr) (
The siRNA targeting UBBs1 (SEQ ID NO: 604) is cytotoxic to SW480 and HCT-116. The siRNA targeting sequence (SEQ ID NO: 624) and (SEQ ID NO: 625) also inhibit UBB. The siRNA developed to target UBC (SEQ ID NO: 626) is as potent as the siRNA targeting UBBs1 (SEQ ID NO: 604). A UBBs1 scrambled siRNA targeting sequence (SEQ ID NO: 621) does not have a cytotoxic effect and could be used as a negative control. A novel siRNA targeting sequence (SEQ ID NO: 603) is surprisingly more potent than UBBs1 (SEQ ID NO: 604).
MCF-7 and SK-BR-3 breast cancer cells were treated under standard siRNA transfection conditions with various siRNA compounds including those previously listed as well as controls: ASN siRNA (negative), ASP siRNA (positive) (16.7 nM; 96 hr) (
The siRNA targeting UBBs1 (SEQ ID NO: 604) is cytotoxic to MCF-7 and SK-BR-3. The siRNA targeting (SEQ ID NO: 626) is as potent as the siRNA to UBBs1 (SEQ ID NO: 604) and the siRNA targeting (SEQ ID NO: 603) appears to be more potent than UBBs1 (SEQ ID NO: 604). This experiment demonstrated surprising efficacy of dual UBB and UBC siRNA inhibition on breast cancer cells.
Dose response curve of HCT-116 and various siRNA sequences. Cells were grown to 2,000 cells/well in a 384-well plate, and treated with 62 pM-15 nM of compounds for 96 hours (
These results demonstrate that high concentrations of siRNA-aptamer dual targeting chimeras is not necessary to see efficacy in cancer cells.
In order to demonstrate that active siRNA targeting (SEQ ID NO: 626), (SEQ ID NO: 6-03), and (SEQ ID NO: 604) silence both UBB and UBC and other UBB targeting siRNA's do not, a cell assay was performed using HT29, RKO, SW480, and HCT116 cells. Cells were treated with siRNA or control (15 nM siRNA; 20 hr). UBB (
Results indicate the dual targeting capability of siRNA's to (SEQ ID NO: 604) across multiple cell types.
HCT116 cells were treated with the specified siRNA including U01, a Luciferase GL3 siRNA (15 nM siRNA; 20 hr). qPCR results were normalized to GAPDH. Results demonstrate the ability of siRNA's targeting (SEQ ID NO: 626), (SEQ ID NO: 603) and (SEQ ID NO: 604) to dual inhibit UBB and UBC. Control UBB inhibitors are not able to inhibit UBC (
Additionally, HCT116 cells were treated with another set of UBB/UBC targeted siRNAs.
siRNA targeting (SEQ ID NO: 302) and (SEQ ID NO: 304) and (SEQ ID NO: 305) and (SEQ ID NO: 308) demonstrated significantly diminished UBB and UBC expression levels. (
Depicts BLAST results of homologous regions between UBB and UBC mRNA at regions with 19/19, 18/19 and 17/19 identity over the 19 nt stretch (
Dual UBB and UBC siRNA Targeting Sequences:
UBB Similar to UBC siRNA Targeting Sequences:
(SEQ ID NO: 627) was identified 2× in UBC and 1× in UBB. (SEQ ID NO: 628) was identified 4× in UBC and 1× in UBB. (SEQ ID NO: 629) was identified 2× in UBC and 3× in UBB. (SEQ ID NO: 630) was identified 7× in UBC and 1× in UBB. (SEQ ID NO: 631) was identified 7× in UBC and 1× in UBB.
HCT-116 (
These results identify (SEQ ID NO: 628), (SEQ ID NO: 629), (SEQ ID NO: 630), (SEQ ID NO: 631), and (SEQ ID NO: 641) as siRNA targets with the ability to inhibit both UBB and UBC.
Human UBB and UBC sequences were compared to mouse in order to find potential homologous regions for in vivo drug development studies. (SEQ ID NO: 624) and (SEQ ID NO: 43) sequences were found to be effective siRNA targeting regions for human and contain high homology to mouse. (SEQ ID NO: 62) with minimal nucleotide differences was identified 4× in mouse UBB and (SEQ ID NO: 43) with minimal nucleotide differences was identified 9× in mouse UBC. These sequences will be effective for multi-species in vivo pre-clinical studies (
An additional mouse sequence (SEQ ID NO: 644: U52) was tested against UBB and UBC. Additionally, a dicer substrate siRNA (SEQ ID NO: 645: U22ds (
2′F pyrimidine modifications of the siRNA targeting SEQ ID NO: 895 are depicted in
HCT-116 cells were treated with UBB-UBC targeting siRNAs. Modified and unmodified versions of SEQ ID NO: 895 are able to silence UBB and UBC with similar activity to unmodified (
Cell viability was measured, and the silencing of these genes demonstrated >98% cytotoxicity at 96 hours (
Utilizing Basic Local Alignment Search Tool (Blast), new sequences were identified with highly conserved homology to dual or triple targets.
NR4A3 was found to have three potential targeting regions which have 18/19 conserved identities across all three sequences with NR4A1, and 18/19, 18/19, and 17/19 conserved identities with NR4A2 (
NR4A1, NR4A2, and NR4A3 siRNA Targeting Sequences:
ADORA2A was found to have three potential targeting regions which have 18/19 conserved identities across all three sequences with ADORA2B (
ADORA2A and ADORA2B siRNA Targeting Sequences:
MAP2K1 was found to have five potential targeting regions which have 19/19, 19/19, 17/19, 18/19, and 17/19 conserved identities with MAP2K2 (
MAP2K1 and MAP2K2 siRNA Targeting Sequences:
ERK1 (MAPK3) was found to have four potential targeting regions which have 18/19, 18/19, 16/19 conserved identities with ERK2 (MAPK1) (
MAPK3 and MAPK1 siRNA Targeting Sequences:
MAPK11 was found to have three potential targeting regions which have 19/19, 19/19, and 18/19 conserved identities with MAPK14 (
MAPK11 and MAPK14 siRNA Targeting Sequences:
MDM2 was found to have two potential targeting regions which have 16/19 and 16/19 conserved identities with MDM4 (
MDM2 and MDM4 siRNA Targeting Sequences:
PFKFB3 was found to have two potential targeting regions which both had 19/19 conserved identities with PFKFB4 (
PFKFB3 and PFKFB4 siRNA Targeting Sequences:
Based on this work these sequences are potential siRNA targets for dual or triple inhibition of gene expression.
HCT116 cells were treated with siRNA and the expression levels of MAP2K1 and MAP2K2 (
SiRNA targeting sequences (SEQ ID NOS: 652-654) reduced MAP2K1 and MAP2K2 expression. SiRNA targeting sequences (SEQ ID NOS: 657-659) effectively reduced expression of MAPK1 and MAPK3. The siRNA targeting sequence (SEQ ID NO: 657) knocked down expression of MAPK1, MAPK3, and MAP2K2.
SKBR3 cells were treated with siRNA and the expression levels of ADORA2A/ADORA2B (
HCT116 cells were treated with siRNA and the expression levels of MAPK11/MAPK14 (
HCT116 cells were treated with siRNA that targeted either the expression levels of MAP2K1 or of MAP2K2, the expression of both were measured after treatment (
All four siRNAs effectively and selectively inhibited expression of MAP2K1.
(SEQ ID NO: 672), (SEQ ID NO: 674), and (SEQ ID NO: 675) effectively and selectively inhibited expression of MAP2K2.
SK-BR3 cells were treated with siRNA and the expression of EGFR was measured after treatment (
Previously Disclosed in U.S. Pat. No. 10,689,654:
All of the siRNAs targeting the sequences above demonstrated significant decrease in target expression, with SEQ ID NO: 682 and SEQ ID NO: 684 showing the most promising inhibition.
SW-480 cells were treated with siRNA and the expression of BIRC5 was measured after treatment (
Previously Disclosed in U.S. Pat. No. 10,689,654:
(SEQ ID NO: 691) decreased BIRC5 expression 70% and (SEQ ID NO: 685) decreased expression 76%.
HCT116 cells were treated with siRNA and the expression of PIKFYVE was measured after treatment (
SEQ ID NO: 695 decreased PIKFYVE expression 69%.
SK-BR3 cells were treated with siRNA and the expression of NR4A1 (
siRNA targeting (SEQ ID NO: 701) induced NR4A1 expression while (SEQ ID NO: 700), (SEQ ID NO: 702) and (SEQ ID NO: 703) reduced it. All four siRNAs targeting NR4A2 sequences reduced NR4A2 expression with (SEQ ID NO: 704) decreasing expression 91%. Sequences were found to moderately reduce NR4A3 expression.
SK-BR3 cells were treated with siRNA and the expression of MTOR and GRB7 (
siRNA targeting (SEQ ID NO: 708) and (SEQ ID NO: 710) reduced GRB7 expression and all four siRNAs targeting MTOR greatly reduced MTOR expression.
BT549 cells were treated with siRNA and the expression of IDO1 and STAT3 (
All four siRNAs targeting IDO1 sequences above demonstrated significant decrease in expression, while (SEQ ID NO: 720), (SEQ ID NO: 721), and (SEQ ID NO: 722) demonstrated decrease in STAT3 expression.
HCT116 cells were treated with siRNA and the expression of c-MYC and YY1 (
Target Sequences of c-MYC:
All four siRNAs targeting c-MYC demonstrated decrease in expression levels, with SEQ ID NO: 725 and SEQ ID NO: 726 showing the largest reduction in expression. All four siRNAs targeting YY1 also demonstrated decrease in expression levels, with SEQ ID NO: 730 and SEQ ID NO: 731 showing the largest reduction in expression.
HCT116 cells were treated with siRNA and the expression of MDM2 and MDM4 (
siRNAs targeting (SEQ ID NO: 733) and (SEQ ID NO: 735) demonstrated significant reduction in MDM2 expression. And all four siRNAs targeting MDM4 demonstrated decreases in expression levels with (SEQ ID NO: 738) and (SEQ ID NO: 739) exhibiting the greatest expression decrease.
U2OS (
siRNAs targeting (SEQ ID NO: 740):) demonstrated significant reduction in CBLB expression, but all four siRNAs showed efficacy. All four siRNAs targeting TOX demonstrated decreases in expression levels with (SEQ ID NO: 745) exhibiting the greatest expression decrease.
HCT116 cells were treated with siRNA and the expression of RICTOR and TOX2 (
All four siRNAs targeting RICTOR demonstrated significant reduction in RICTOR expression. All four siRNAs targeting TOX2 also demonstrated decreases in expression levels of TOX2 with (SEQ ID NO: 753) exhibiting the greatest expression decrease.
HCT116 cells were treated with siRNA and the expression of MSI1 and MSI2 (
All four siRNAs targeting MSI1 targeting siRNAs demonstrated significant reduction in MSI1 expression but (SEQ ID NO: 759) showed the most significant decrease in target expression. All four siRNAs targeting MSI2 also demonstrated decreases in expression levels of MSI2 with (SEQ ID NO: 760) exhibiting the greatest expression decrease.
HCT116 cells were treated with siRNA and the expression of UBC and VHL (
All four siRNAs targeting UBC targeting siRNAs demonstrated significant reduction in UBC expression. All four siRNAs targeting VHL also demonstrated decreases in expression levels of VHL particularly (SEQ ID NO: 769) and (SEQ ID NO: 770).
SKBR3 cells were treated with siRNA and the expression of ADORA2A and ADORA2B (
All four siRNAs targeting ADORA2A demonstrated significant reduction in ADORA2A expression, with (SEQ ID NO: 396) and (SEQ ID NO: 398) demonstrating the most significant reduction in expression. All four siRNAs targeting ADORA2B also demonstrated decreases in expression levels of ADORA2B particularly (SEQ ID NO: 400).
HCT116 cells were treated with siRNA and the expression of PTPN2 and VHL (
All four siRNAs targeting VHL demonstrated significant reduction in VHL expression with (SEQ ID NO: 415) demonstrating the most significant reduction in expression. Two siRNAs targeting PTPN2 also demonstrated significant in expression levels of PTPN2 particularly (SEQ ID NO: 422).
HCT116 cells were treated with siRNA and the expression of UBB and UBC (
All four siRNAs targeting UBB alone demonstrated reduction in UBB expression, with (SEQ ID NO: 303) and (SEQ ID NO: 304) demonstrating significant reduction in expression. All four siRNAs targeting UBC demonstrated significant decreases in expression levels of UBC. (SEQ ID NO: 302), (SEQ ID NO: 304), and (SEQ ID NO: 305) demonstrated comparable dual action inhibition to U21.
SKBR3 cells were treated with siRNA and the expression of AKT1 and BATF (
All four siRNAs targeting AKT1 alone demonstrated reduction in AKT1 expression, with minimal off-target effects. All four BATF targeting siRNAs exhibited significant reduction in BATF expression with possible dual action inhibition to AKT1.
22Rv1 cells were treated with siRNA and the expression of ME2 and ME3 (
All four siRNAs targeting ME2 alone demonstrated significant reduction in ME2 expression, with (SEQ ID NO: 237) exhibiting the most significant reduction. All four ME3 targeting siRNAs also exhibited significant reduction in ME3.
EpCAM aptamers were individually synthesized by in vitro transcription with PCR products as templates. The ssDNA of EpCAM aptamer containing T7 RNA polymerase promoter site (underlined) and adaptor sequence (5′-TAATACGACTCACTATAGCGACTGGTTACCCGGTCGT-3′) (SEQ ID NO: 772) was synthesized from IDT as a PCR template. PCR was performed with forward primer (5′-TAATACGACTCACTATA GCGACTGGTTA-3) (SEQ ID NO: 773) and reverse primer (5′-ACGACCGGGTAACCAGTCGC-3′) (SEQ ID NO: 774). The PCR products were put into T-A cloning pCR 2.1 vector (Invitrogen) and sequenced. Transcription was performed with PCR product as templates using DuraScript transcription kits following manufacturer's instruction.
Bivalent aptamers support increased cargo internalization and specificity. Moreover, experiments for increasing ligand valency to augment cargo delivery has been demonstrated by the use of nanoparticle-based carriers (Pardella et al., Cancers 2020. 12(10), 2799) (
EpCAM-directed aptamers-siRNA chimeras were individually synthesized by in vitro transcription from an annealed DNA templates (
Utilizing the same synthesis method above, RNA1 and RNA2 is synthesized, purified, mixed, and annealed. The resulting products were run on a gel for confirmation (
Utilizing the same synthesis method above, two RNA's are synthesized, purified, mixed, and annealed.
Alternative EPCAM aptamer sequences to be used in this construct or in other constructs of this application include:
2′F Cytidine with 2-Pyridyl at the 5 Position Uridine:
Alternative HER2 aptamer sequences to be used in this construct or in other constructs of this application include:
2′F Cytidine with 2-Pyridyl at the 5 Position Uridine:
2′F Cytidine with Benzyl at the 5 Position Uridine:
Resulting products were run on a gel for confirmation (
(
The PCR products are sequenced or put into T-A cloning pCR2.1 vector (Invitrogen) and sequenced. Transcription is performed with TranscriptAid T7 High Yield Transcription Kit following manufacturer's instruction. 2′F-modified pyrimidines (TriLink, San Diego, CA) are incorporated into RNA to replace CTP and UTP. The transcribed RNAs are purified with phenol/chloroform/isoamyl alcohol (25:24:1) (Sigma-Aldrich), precipitated with isopropanol (Sigma-Aldrich) followed by cold 70% ethanol wash. The RNA pellets are dissolved in nuclease free water (IDT). The three RNAs are mixed at molar ratio 1:1:1 and annealed to form one entity by heated at 94° C. for 3 min followed by slowly cooling to room temperature within 1 h. Resulting products were run on a gel for confirmation (
Two RNAs are generated by in vitro transcription, with PCR products as templates
RNA2: DHX9 Aptamer-UBB Anti-Sense siRNA
The PCR products are sequenced or put into T-A cloning pCR2.1 vector (Invitrogen) and sequenced. Transcription is performed with TranscriptAid T7 High Yield Transcription Kit following manufacturer's instruction. 2′F-modified pyrimidines (TriLink, San Diego, CA) are incorporated into RNA to replace CTP and UTP. The transcribed RNAs are purified with phenol/chloroform/isoamyl alcohol (25:24:1) (Sigma-Aldrich), precipitated with isopropanol (Sigma-Aldrich) followed by cold 70% ethanol wash. The RNA pellets are dissolved in nuclease free water (IDT). The RNAs are mixed at molar ratio 1:1 and annealed to form one entity by heated at 94° C. for 3 min followed by slowly cooling to room temperature within 1 h. Resulting products were run on a gel for confirmation.
HCT-116 cells were transfected with various Aptamer-siRNA compositions with a transfection reagent ration of 6:1 for 48 hours and expression level of the target UBB was measured using qPCR. Compositions included previously disclosed controls as well as partial Aptamer-siRNA constructs shown in
HCT116 cells were treated with previously described compositions as well as DasP1/sPLK, a PSMA aptamer-PLK1 siRNA construct. The cells treated with PSUP, PSMA aptamer-BIRC5 siRNA-UBB siRNA-PSMA aptamer, demonstrated the most significant toxicity at the lowest concentrations to colon cancer cells. H2UH3 (HER3 aptamer-U21 siRNA-HER2 aptamer) also demonstrated significant toxicity to cancer cells at a lower concentration than control (
Additionally, HCT116 cells were transfected and treated for 72 hours with previously described variations of the multi-targeting UBB/UBC siRNA. Transfection reagent ratio was 6:1 and cells were treated with 20, 40, or 60 nM of RNA. Viability was measured using cell titer glow. The active siRNAs (U21, U22, U22ds, and U22ds (2′F) showed significant toxicity to the colon cancer cell compared to control (
Additionally, HCT116 cells were transfected and treated for 72 hours with various aptamer-siRNA constructs, some previously described. C32.1 is the construct disclosed in
2′F Cytidine with 2-Pyridyl the 5 Position Uridine:
Binding structures of select aptamers are shown in
2′F Cytidine with 2-Pyridyl the 5 Position Uridine:
2′F Cytidine with Benzyl at the 5 Position Uridine:
Binding structures of select aptamers are shown in
2′F Cytidine with Benzyl at the 5 Position Uridine:
2′F Cytidine with 4-Pyridyl the 5 Position Uridine:
See
The PCR products are processed according to the methods previously stated.
See
Two RNAs are generated by in vitro transcription, with PCR products as templates.
The PCR products are processed as previously described.
2′F Cytidine with Benzyl at the 5 Position Uridine:
2′F pyrimidine Modification:
See
2′F Cytidine with Benzyl at the 5 Position Uridine:
Two RNAs are generated by in vitro transcription, with PCR products as templates.
The PCR products are processed as previously described.
2′F Cytidine with Benzyl at the 5 Position Uridine:
2′F Cytidine with 4-Pyridyl at the 5 Position Uridine:
PCR products are processed as previously discussed using sequences presented in this application.
2′F Cytidine with 2-Pyridyl the 5 Position Uridine:
PCR products are processed as previously discussed using sequences presented in this application.
2′F Cytidine with 2-Pyridyl the 5 Position Uridine:
2′F Cytidine with Benzyl at the 5 Position Uridine:
Standard linkage is 3′ end of an aptamer linked to 5′ of an siRNA. Here we provide an example of the 3′end of the siRNA linked to the 5′end of the aptamer. Linked via poly-adenosine linkage. siRNA is the guide strand (
Male NSG mice are injected subcutaneously (HCT116) or intrasplenically (mHCT116) with human HCT116 CRC tumor cells to disseminate LM, whereas experimental controls receive saline. Huot et al. demonstrated elevated ubiquitin expression in this model (Huot et al., Dis Models & Mech, 13:1754-8403 (2020)).
Mice will be treated with the dual UBB-UBC targeting siRNAs conjugated to EPCAM aptamer, Epcam-scrambled siRNA, or vehicle by intraperitoneal injection of 0.1 ml of the indicated solution. Mice will be treated with a dose of dual targeting siRNA sufficient to inhibit expression of UBB and UBC by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% or more, for at least 5, more preferably 7, 10, 14, or 18 days. Alternatively, mice will be dosed multiple times in order to inhibit expression of UBB and UBC by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% or more, for at least 5, more preferably 7, 10, 14, or 18 days. All the mice are sacrificed on day 18, and tumors are collected for quantitation.
To assess the impact of a compound comprising dual targeting siRNA conjugated to EPCAM aptamer on tumor growth in vivo, subcutaneous HCT-116 xenografts will be established in athymic nu/nu male mice. The compound will be injected intraperitoneally to tumor-bearing mice every other day for 1 week and every day for the following two weeks. Control mice will be injected intraperitoneally with equivalent volume of PBS or Epcam-scrambled siRNA. All the mice are sacrificed on day 21, and tumors are collected for quantitation.
In certain embodiments, the invention provides pharmaceutical compositions containing a dual targeting siRNA agent, as described herein, and a pharmaceutically acceptable carrier.
The pharmaceutical compositions featured herein are administered in dosages sufficient to inhibit expression of the target genes. In general, a suitable dose of siRNA will be in the range of 0.01 to 200.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 to 50 mg per kilogram body weight per day.
The pharmaceutical composition may be administered once daily, or the siRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the siRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the siRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.
Many modifications and variations of this invention can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. The invention is defined by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. The specific embodiments described herein, including the following examples, are offered by way of example only, and do not by their details limit the scope of the invention.
All references cited herein are incorporated by reference to the same extent as if each individual publication, database entry (e.g., Genbank sequences or GeneID entries), patent application, or patent, was specifically and individually indicated to be incorporated by reference. This statement of incorporation by reference is intended by Applicants, pursuant to 37 C.F.R. § 1.57(b)(1), to relate to each and every individual publication, database entry (e.g. Genbank sequences or GeneID entries), patent application, or patent, each of which is clearly identified in compliance with 37 C.F.R. § 1.57(b)(2), even if such citation is not immediately adjacent to a dedicated statement of incorporation by reference. The inclusion of dedicated statements of incorporation by reference, if any, within the specification does not in any way weaken this general statement of incorporation by reference. Citation of the references herein is not intended as an admission that the reference is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents.
The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and the accompanying figures. Such modifications are intended to fall within the scope of the appended claims.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.
This application is a National Stage of International Application No. PCT/US2022/027930, filed May 5, 2022, which claims priority to U.S. Provisional Patent Application No. 63/185,359 filed May 6, 2021, U.S. Provisional Patent Application No. 63/231,234 filed Aug. 9, 2021, U.S. Provisional Patent Application No. 63/242,865 filed Sep. 10, 2021, U.S. Provisional Patent Application No. 63/250,548 filed Sep. 30, 2021, U.S. Provisional Patent Application No. 63/287,037 filed Dec. 7, 2021, U.S. Provisional Patent Application No. 63/287,040 filed Dec. 7, 2021 and U.S. Provisional Patent Application No. 63/323,997 filed Mar. 25, 2022. All of the above applications are incorporated herein by reference in their entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2022/027930 | 5/5/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63185359 | May 2021 | US | |
| 63231234 | Aug 2021 | US | |
| 63242865 | Sep 2021 | US | |
| 63250548 | Sep 2021 | US | |
| 63287037 | Dec 2021 | US | |
| 63287040 | Dec 2021 | US | |
| 63323997 | Mar 2022 | US |
