Patent Application
20230338420
This application contains a Sequence Listing submitted as an electronic text file named “21-1677-US_sequence_listing.xml” having a size in bytes of 7.62 kb, and created on Feb. 6, 2023. The information contained in this electronic file is hereby incorporated by reference in its entirety.
The disclosure generally relates to methods for producing macrophages and neutrophils in serum-free and feeder-free conditions from SIRPα inhibited pluripotent stem cells. The disclosure further relates to SIRPα inhibited macrophages and neutrophils and uses thereof.
Current cancer immunotherapies concentrate on targeting cancer-specific antigens by the use of chimeric antigen receptors (CAR) T cells or monoclonal antibodies (mAb). There is an urgent need to develop novel immunotherapies that can treat patients with solid tumor cancers. Indiscriminately, solid cancers contain extremely complex tumor microenvironments (TME) that circumvent the innate and adaptive immune systems' anti-tumoral mechanisms. The heterogeneous nature of the tumor and the ability to shield from the immune system are the main reasons why current immunotherapies have not had much success targeting solid cancers. CAR-T cells and mAbs rely on the specificity of the cancer antigen which limits the targeting abilities to mainly circulatory cancers. Other mechanisms such as T cell exclusion, hypoxic milieu, and immunosuppressive myeloid cells create a hostile environment for the adaptive immune system to have any robust anti-tumorigenic effect (Joyce & Fearon (2015) Science (New York, N.Y), 348(6230), 74-80).
Macrophages are a group of diverse and active immune cells that are found across the body as either tissue-resident macrophages (TR-Macs) or circulating monocyte-derived macrophages (MD-Macs) (Davies, et al., (2013) Nature Immunology, 14(10), 986-995). Developing from the common myeloid progenitor lineage, macrophages are innate antigen presenting immune cells with an incredible appetite for phagocytosis. Upon activation, macrophages polarize into pro-inflammatory M1 subtype, or anti-inflammatory M2 subtype in which there are many other subtypes on a polarization spectrum (Kielbassa, et al., (2019) Frontiers in Immunology, 10:2215). Within the TME, tumor cells recruit macrophages via chemokine signaling, such as the CCL2/CCR2 pathway, and polarize the macrophages into a pathological, pro-tumorigenic state called tumor associated macrophages (TAMs) (Chen, et al., (2019) Journal of Biomedical Science, 26(1), 78). Through analyzing the role of macrophages in the TME, it has been found that TAMs mainly resemble M2 macrophages with increased anti-inflammatory and wound-healing signatures (Chanmee, et al., (2014) Cancers, 6(3), 1670-1690). TAMs produce many inhibitory factors including TGF-beta, IL-10, Arg1, IDO, and HIF-1alpha that inhibit and starve the existing T cell population within the TME (Zhu, et al., (2021) Journal of Cancer, 12(1), 54-64). The tumor cells within the TME circumvent the anti-tumorigenic properties of macrophages by the upregulation of immunosuppressive signals, including “don't eat me” cell receptors. One of the “don't eat me” receptors, CD47, was discovered by Weissman and colleagues as a mechanism for both hematological and solid tumor cancer cells to escape phagocytosis by TAMs (Chao, et al., (2010) Cell, 142(5), 699-713; Majeti, et al., (2009) Cell, 138(2), 286-299; Willingham, et al., (2012) Proceedings of the National Academy of Sciences, 109(17), 6662-6667). This cell surface receptor on tumor cells is recognized by the myeloid-specific receptor: signal regulatory protein alpha (SIRPα). SIRPα is abundantly expressed in macrophages, dendritic cells, and neutrophils. SIRPα is a ligand for the ubiquitously expressed “don't-eat-me” signal molecule CD47. SIRPα also promotes M2 polarization of tumor-associated macrophages. In physiological state, CD47 is expressed ubiquitously on normal, healthy cells as a marker of self; notably red blood cells (RBC) express CD47 to prevent macrophages from phagocytosing them as they mature (Oldenborg, et al., (2000) Science (New York, NY), 288(5473), 2051-2054; Oldenborg, et al., (2001) The Journal of Experimental Medicine, 193(7), 855-862). When CD47 and SIRPα interaction occurs, a signal is transduced to the immunoreceptor tyrosine-based inhibitory motifs (ITIMs) on the cytosolic tail of SIRPα. The ITIMs recruit SHP-1 and SHP-2 domain-containing phosphatases which block Myosin IIa and subsequent cytoskeletal rearrangement (Murata, et al., (2018) Cancer Science, 109(8), 2349-2357). Therefore, CD47/SIRPα activation specifically blocks phagocytosis from occurring when activating phagocytic stimuli is present.
Due to the vast upregulation of CD47 across many solid tumor cancers, targeting this signaling pathway by knocking out SIRPα in macrophages to generate cellular immunotherapy has the potential for widespread cancer treatment. In addition, macrophages have unique advantages for use cellular immunotherapy due to their access to the TME, phagocytic capabilities, and direct communication to the adaptive immune system via antigen presentation. Deriving macrophages from human donor peripheral blood monocytic cells (PBMCs) would be tedious and inefficient for genetic alteration and clinical use. Accordingly, there is a need in the art for efficient and cost-effective protocols.
Provided herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising:
In particular embodiments the inhibitor of TGFβ-mediated signaling is SB431542. In other particular embodiments the inhibitor of GSK3 is lithium chloride (LiCl). In certain embodiments the ROCK inhibitor used in the practice of the methods disclosed herein is Y-27632.
In certain embodiments the pluripotent stem cells are induced pluripotent stem cells (iPSCs).
Advantageously expression of SIRPα is inhibited in the human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing or base editing. Particular gene editing methods useful in the practice of these methods use a nuclease that includes but are not limited to a meganuclease, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas enzyme, particularly embodiments using Cas9. Advantageously gene editing results in knocking out SIRPα expression.
Also provided herein are modified macrophages produced according to the disclosed methods
Further provided herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising:
In particular embodiments, step (a) of the method comprises culturing the ETV2-induced pluripotent stem cells for about 1-2 days; step (b) of the method comprises culturing the ETV2-induced HEPs for about 6-7 days; and step (c) and step (d) comprises culturing myeloid progenitor cells for about 9 to 10 days.
In particular embodiments the serum-free and xeno-free culture medium in step (b) further comprises UM171.
In certain embodiments the pluripotent stem cells are induced pluripotent stem cells (iPSCs).
Advantageously expression of SIRPα is inhibited in the human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing or base editing. Particular gene editing methods useful in the practice of these methods use a nuclease that includes but are not limited to a meganuclease, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas enzyme, particularly embodiments using Cas9. Advantageously gene editing results in knocking out SIRPα expression.
Also provided herein are modified macrophages produced according to these disclosed methods.
Further provided herein is a method of producing modified neutrophils from pluripotent stem cells, the method comprising:
In particular embodiments the serum-free and xeno-free culture medium in step (b) further comprises UM171. In particular embodiments the retinoic acid receptor agonist is AM580.
In particular embodiments, step (a) of the method comprises culturing the ETV2-induced pluripotent stem cells for about 1-2 days; step (b) of the method comprises culturing the ETV2-induced HEPs for about 6-7 days; and step (c) and step (d) comprises culturing myeloid progenitor cells for about 8 to 9 days.
Advantageously expression of SIRPα is inhibited in the human pluripotent stem cells by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing or base editing. Particular gene editing methods useful in the practice of these methods use a nuclease that includes but are not limited to a meganuclease, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas enzyme, particularly embodiments using Cas9. Advantageously gene editing results in knocking out SIRPα expression.
Also provided herein are modified neutrophils produced according to these disclosed methods.
Also provided herein are methods for treating cancer by administering a therapeutically effective amount of the modified macrophages produced by the methods disclosed herein. In certain embodiments these methods also include administering a tumor-specific antibody. Also provided are methods for treating cancer by administering a therapeutically effective amount of the modified neutrophils produced by the methods disclosed herein.
In certain embodiments the neutrophils produced by these methods are useful for treating an infection, in particular a bacterial infection and particularly advantageously wherein the bacterial infection is a systematic infection.
These and other features, objects, and advantages of the present invention will become better understood from the description that follows. In the description, reference is made to the accompanying drawings, which form a part hereof and in which there is shown by way of illustration, not limitation, embodiments of the invention. The description of preferred embodiments is not intended to limit the invention to cover all modifications, equivalents, and alternatives. Reference should therefore be made to the claims recited herein for interpreting the scope of the invention.
The disclosure generally relates to methods for producing macrophages and neutrophils in serum-free and feeder-free conditions from SIRPα inhibited pluripotent stem cells. The disclosure further relates to SIRPα inhibited macrophages and neutrophils and uses thereof.
All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as though set forth in their entirety in the present application.
As utilized in accordance with the present disclosure, unless otherwise indicated, all technical and scientific terms shall be understood to have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
“Pluripotent stem cells” refer to cells having the capacity to differentiate into cells of all three germ layers. “Embryonic stem cells” or “ESCs” mean a pluripotent cell or population of pluripotent cells derived from an inner cell mass of a blastocyst. See Thomson et al., (1998) Science 282:1145-1147.
“Induced pluripotent stem cells” or “iPS cells” refer to a pluripotent cell or population of pluripotent cells that may vary with respect to their differentiated somatic cell of origin, that may vary with respect to a specific set of potency-determining factors and that may vary with respect to culture conditions used to isolate them, but nonetheless are substantially genetically identical to their respective differentiated somatic cell of origin and display characteristics similar to higher potency cells, such as ESCs. See, e.g., Yu et al., (2007) Science 318:1917-1920.
“Hematopoietic precursor cells (HPCs)” and “hematopoietic progenitors (HPs)” refer to immature multipotent progenitor cells of the hematopoietic lineage. HPCs are characterized by surface expression of CD45 and, in some cases, CD34, and a capacity to differentiate into myeloid and lymphoid progenitors and terminally differentiated lymphoid and myeloid cells.
“Myeloid progenitors” are cells capable of differentiating into cell types of the myeloid lineages.
“Chemically-defined culture” “fully defined, growth factor free culture conditions,” and “fully-defined conditions” indicate that the identity and quantity of each medium ingredient is known and the identity and quantity of supportive surface is known.
“Xeno-free culture medium” refers to medium that does not contain any components derived from animal sources, such as, for example, serum.
As used herein, an “SIRPα knockout” or “SIRPα-KO” is intended to encompass any disruption or deletion of SIRPA gene that results in the dysfunction or nonfunction of the SIRPα protein as it pertains to binding to CD47 or other SIRPα binding partners and/or as it pertains to the signaling within the SIRPα-expressing cell. This definition includes the insertion of an external plasmid/gene within the SIRPA gene locus or deleting a portion or the entire region of the SIRPA gene.
The methods provided herein comprise differentiating human pluripotent stem cells under conditions that promote differentiation of the pluripotent stem cells into hematopoietic progenitor cells and macrophages.
In some embodiments provided herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising:
Suitable pluripotent cells for use herein include human embryonic stem cells (hESCs) and human induced pluripotent stem (iPS) cells. ESCs are commercially available from sources such as WiCell Research Institute (Madison, Wis.). In particular embodiments, the pluripotent stem cells are induced pluripotent stem cells.
The pluripotent stem cells used in the methods disclosed herein have inhibited expression of SIRPα. SIRPα is abundantly expressed in macrophages, dendritic cells, and neutrophils. SIRPα is a ligand for the ubiquitously expressed “don't-eat-me” signal molecule CD47. SIRPα also promotes M2 polarization of tumor-associated macrophages.
“Having inhibited expression of SIRPα,” indicates the gene is repressed or not expressed in a functional protein form. In particular embodiments, the expression of SIRPα is knocked out such that there is no expression of SIRPα. This inhibition or knockout can be obtained by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing or base editing.
In particular embodiments, the gene editing method comprises the use of a nuclease selected from a meganuclease, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas enzyme. In particular embodiments, the nuclease is a Cas9 enzyme.
In some embodiments, normoxic conditions refer to conditions where oxygen is provided at or about standard atmospheric levels. In some embodiments, normoxic conditions refer to oxygen conditions of about 15% to about 20% oxygen (e.g., about 15%, 16%, 17%, 18%, 19%, 20% O2).
In some embodiments, hypoxic conditions refer to a level of environmental oxygen (e.g., a cell culture incubator gas mixture) of about 3% Otto about 10% O2. In some embodiments, hypoxic conditions are about 5% O2.
In some embodiments, the culture is “serum-free” which refers to cell culture materials that are free of serum obtained from animal or human (e.g., fetal bovine) blood.
In some embodiments, the culture conditions are feeder-free, meaning that the culture does not use feeder cells. In particular embodiments, the culture conditions are serum-free and feeder-free.
In particular embodiments, the method disclosed herein comprises an attachment step comprising culturing human pluripotent stem cells in a culture medium in normoxic conditions (i.e., where oxygen is provided at or about standard atmospheric levels) for about 24 hours. In particular embodiments, the culture medium is E8-TeSR. “E8 culture medium” and “E8” are used interchangeably and refer to the chemically defined culture medium having the following defined components: DMEM/F12, L-ascorbic acid-2-phosphate magnesium, sodium selenium, and NaHCO3, transferrin, insulin, FGF2 and TGFβ1.
In some embodiments, the culture medium used for culturing hPSCs to HPCs and/or myeloid progenitors to macrophages is “IF9S” media, which comprises IMDM/F12, L-ascorbic acid 2-phosphate Mg2+ salt, monothioglycerol, sodium selenite, polyvinyl alcohol, Glutamax™, non-essential amino acids (NEAA), chemically defined lipid concentrate (Life Technologies; Cat. No. 1905031), Holo-Transferrin, and insulin.
In particular embodiments, the culture medium comprises a Rho kinase (ROCK) inhibitor. Rock inhibitors, which are known in the art and include, but are not limited to, for example, Y27632 (commercially available from Stem Cell Technologies), and those found in Liao J K, Seto M, Noma K. Rho kinase (ROCK) inhibitors. J Cardiovasc Pharmacol. 2007; 50(1):17-24, the contents of which are incorporated by reference in its entirety.
In some embodiments, the inhibitor of TGFβ-mediated signaling is SB431542. In some embodiments, the inhibitor of GSK3 is lithium chloride (LiCl).
Also provided herein is a population of modified macrophages produced by the methods disclosed herein. The modified macrophages have inhibited expression of SIRPα as well as superior anti-tumor activity for therapeutic purposes.
The present disclosure also provides methods for efficient macrophage and neutrophil production from pluripotent stem cells using direct programming with transient expression of ETV2, e.g., by addition of modified mRNA (mmRNA) of ETV2 into the hiPSCs. Initially, hiPSCs are directly programmed into hematoendothelial progenitors using ETV2 mmRNA which transiently produced ETV2 within the cells. Next, the hematoendothelial progenitors are then differentiated into myeloid progenitors in the presence of GM-CSF, FGF2 and optionally UM171 (the presence of UM171 in combination with GM-CSF and FGF2 increases the number of macrophages neutrophils produced by the methods). Myeloid progenitors which are non-adherent could be continuously collected from cultures every 8-10 days for up to 30 days of post ETV2 transfection. Finally, these myeloid progenitors are subsequently differentiated into macrophages or neutrophils. The methods for macrophage and neutrophil production from pluripotent stem cells using direct programming with transient expression of ETV 2 are described in U.S. Publication No. 20200385676, the contents of which are incorporated by reference in its entirety.
In particular embodiments disclosed herein is a method of producing modified macrophages from pluripotent stem cells, the method comprising:
In particular embodiments provided herein is a method of producing modified neutrophils from pluripotent stem cells, the method comprising:
Suitable pluripotent cells for use herein include human embryonic stem cells (hESCs) and human induced pluripotent stem (iPS) cells. ESCs are commercially available from sources such as WiCell Research Institute (Madison, Wis.). In particular embodiments, the pluripotent stem cells are induced pluripotent stem cells.
The pluripotent stem cells used in the methods disclosed herein have inhibited expression of SIRPα.
“Having inhibited expression of SIRPα,” indicates the gene is repressed or not expressed in a functional protein form. In particular embodiments, the expression of SIRPα is knocked out such that there is no expression of SIRPα. This inhibition or knockout can be obtained by gene mutation, RNA-mediated inhibition, RNA editing, DNA gene editing or base editing.
In particular embodiments, the gene editing method comprises the use of a nuclease selected from a meganuclease, zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas enzyme. In particular embodiments, the nuclease is a Cas9 enzyme.
ETV2 can be transiently introduced into the PSCs by methods known in the art. Methods of transiently expressing ETV2 in PSCs are known in the art, and include, but are not limited to, for example, introducing transiently exogenous nucleic acids encoding the protein of interest (e.g., by plasmid expression vector transfection, or modified mRNA transfection); protein transduction, among others. In one embodiment, mmRNA of ETV-2 (e.g., Accession No: NM_014209.2; SEQ ID NO:4) is introduced into the PSCs by suitable methods. Methods of transiently expressing ETV2 in PSCs are described in U.S. Pat. No. 9,382,531, the contents of which are incorporated by reference in its entirety. Methods of introducing mmRNA into PSCs are known in the art, and include, but are not limited to, the method described in the Examples, for example, by transfection or electroporation. The methods of introducing mmRNA or DNA to transiently express ETV-2 protein is within the skill of one in the art and are not limited to what is demonstrated in the examples
After initiating transient expression of ETV2 in the hPSCs, these cells are cultured for a sufficient time to produce a population of ETV2-induced hematoendothelial progenitor cells (ETV2-induced HEPs). In particular embodiments, a sufficient time is a period of about 24 hours to about 4 days. In some embodiments, a sufficient amount of time to produce a population of ETV2-induced hematoendothelial progenitor cells comprises culturing the ETV2-induced cells for about 1-2 days. In some embodiments, a sufficient amount of time to produce a population of ETV2-induced hematoendothelial progenitor cells comprises culturing the ETV2-induced cells for about 3-8 days, for example, for about 4 days. For example, in some embodiments, the step to produce a population of ETV2-induced hematoendothelial progenitor cells comprises culturing for 3 days, alternatively 4 days, alternatively 5 days, alternatively 6 days, alternatively 7 days, alternatively 8 days to produce ETV2-induced hematoendothelial progenitor cells.
In some embodiments, the culture medium is “serum-free” which refers to cell culture materials that are free of serum obtained from animal or human (e.g., fetal bovine) blood.
In some embodiments, the culture conditions are feeder-free, meaning that the conditions do not use feeder cells. In particular embodiments, the culture conditions are serum-free and feeder-free.
In particular embodiments, the methods disclosed herein use a maintenance culture medium for culturing the hPSCs after transfection with ETV2 mmRNA. In particular embodiments the culture medium is E8-TeSR. E8 culture medium” and “E8” are used interchangeably and refer to the chemically defined culture medium having the following defined components: DMEM/F12, L-ascorbic acid-2-phosphate magnesium, sodium selenium, and NaHCO3 in a final volume of 200, transferrin, insulin, FGF2 and TGFβ1.
In some embodiments, the culture medium is a xeno-free cell culture medium. In some embodiments, the culture condition is xeno-free, serum free and feeder-free.
Serum-free and xeno-free medium suitable for culturing the ETV2-induced hematoendothelial progenitor cells to produce non-adherent myeloid progenitors are known in the art and include, but are not limited to, for example, StemLine II (commercially available from Sigma Aldrich).
In some embodiments, a sufficient amount of time for culturing the ETV2-induced HEPs to produce non-adherent myeloid progenitors is at least 4 days, for example, at least 4-23 days. In some embodiments, a sufficient amount of time for culturing the ETV2-induced HEPs to produce non-adherent myeloid progenitors is about 6 to 7 days.
In some embodiments, the methods disclosed herein comprise isolating the non-adherent myeloid cells from the culture. Suitable methods of isolating the cells are known in the art. In one example, non-adherent cells can be collected from the culture leaving the adherent cells behind. In some embodiments, the adherent cells isolated from the non-adherent myeloid cells, may be used in methods of producing macrophages.
For production of macrophages, the methods comprise the step of culturing the myeloid progenitors in a culture medium comprising M-CSF, IL-6, and IL-3 and further culturing the cultured cells comprising M-CSF for a sufficient time to differentiate the myeloid progenitors into modified macrophages. A suitable time to differentiate the myeloid progenitors into modified macrophages includes for at least 9 days, for example at least 9-21 days. In some embodiments, a suitable time for culturing the myeloid progenitors to differentiate into modified macrophages is about 9 to 10 days.
Serum-free and xeno-free medium suitable for culturing the myeloid progenitors to differentiate into modified macrophages are known in the art and include, but are not limited to, for example, StemLine II (commercially available from Sigma Aldrich).
For production of neutrophils, the methods comprise the step of culturing the myeloid progenitors in a culture medium comprising granulocyte-colony stimulating factor (G-CSF) and retinoic acid receptor agonist for a sufficient time to differentiate the myeloid progenitors into modified neutrophils. In some embodiments the retinoic acid receptor agonist is AM580.
A suitable time to differentiate the myeloid progenitors into modified neutrophils includes for at least 9 days, for example at least 9-21 days. In some embodiments, a suitable time for culturing the myeloid progenitors to differentiate into modified macrophages is about 9 to 10 days.
Serum-free and xeno-free medium suitable for culturing the myeloid progenitors to differentiate into modified neutrophils are known in the art and include, but are not limited to, for example, StemSpan™ H3000 (StemCell Technologies).
Also provided herein is a population of modified macrophages produced by the methods disclosed herein. The modified macrophages have inhibited expression of SIRPα as well as superior anti-tumor activity for therapeutic purposes.
Also provided herein is a population of modified neutrophils produced by the methods disclosed herein. The modified neutrophils have inhibited expression of SIRPα as well as superior anti-bacterial and anti-tumor activity for therapeutic purposes. While the methods disclosed herein include ordered, sequential events, the timing of the events may be varied by at least 20%. For example, while a particular step may be disclosed in one embodiment as lasting one day, the event may last for more or less than one day. For example, “one day” may include a period of about 18 to about 30 hours. Periods of time indicated that are multiple day periods may be multiples of “one day,” such as, for example, two days may span a period of about 36 to about 60 hours, and the like. In another embodiment, time variation may be lessened, for example, where day 2 is 48+/−3 hours from d0; day 4 is 96+/−3 hours from d0, and day 5 is 120 hours+/−3 hours from d0.
In particular embodiments, SIRPα knockout macrophages and neutrophils disclosed herein are useful for treating or preventing various disorders such as a cancer or an infection. In particular embodiments provided herein is a method of treating cancer comprising administering the SIRPα knockout macrophages disclosed herein. In particular embodiments provided herein is a method of treating cancer comprising administering the SIRPα knockout neutrophils disclosed herein. In some embodiments, the method comprises administering the SIRPα knockout macrophages disclosed herein together with a tumor-specific antibody.
In particular embodiments provided herein is a method of treating an infection comprising administering the SIRPα knockout neutrophils disclosed herein. In some embodiments, the infection is a systematic infection.
The terms “treatment” or “treat,” as used herein, refer to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include subjects having cancer as well as those prone to having cancer or those in cancer is to be prevented. In some embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of cancer. In other embodiments, those in need of treatment include subjects having an infection as well as those prone to have an infection or those in which an infection is to be prevented. In certain embodiments, the methods, compositions, and combinations disclosed herein can be used for the treatment of infections.
In some cases, macrophages and neutrophils obtained according to a method provided herein can be administered as a pharmaceutical composition comprising a therapeutically effective amount of macrophages and neutrophils as a therapeutic agent (i.e., for therapeutic applications).
The terms “pharmaceutical composition” or “therapeutic composition,” as used herein, refer to a compound or composition capable of inducing a desired therapeutic effect when properly administered to a subject. In some embodiments, the disclosure provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of the macrophages or neutrophils of the disclosure.
The terms “pharmaceutically acceptable carrier” or “physiologically acceptable carrier,” as used herein, refer to one or more formulation materials suitable for accomplishing or enhancing the delivery of the macrophages or neutrophils of the disclosure.
The term “subject” is intended to include human and non-human animals, particularly mammals. In certain embodiments, the subject is a human patient.
The terms “administration” or “administering,” as used herein, refer to providing, contacting, and/or delivering a compound or compounds by any appropriate route to achieve the desired effect. Administration may include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional, or intracranial injection), transdermal, topical, buccal, rectal, vaginal, nasal, ophthalmic, via inhalation, and implants.
Without limiting the disclosure, a number of embodiments of the disclosure are described below for purpose of illustration.
The Examples that follow are illustrative of specific embodiments of the disclosure, and various uses thereof. They are set forth for explanatory purposes only and should not be construed as limiting the scope of the disclosure in any way.
hiPSCs were cultured on Matrigel-treated 6-well plates with mTeSR media in normoxic conditions. Media was changed every day until cells grew to 60-70% confluency. Cells were dissociated into small clumps by treatment with EDTA and passaged 1:6 into a new Matrigel-treated 6-well plate.
hiPSCs were grown to 60-70% confluency on Matrigel-coated plates in mTeSR1 media and isolated in a single cell suspension by treatment with TrypLE. Cas9 protein and sgRNAs (gRNA1: GUGCUCCUUUCCAGGAGUGG (SEQ ID NO: 1) and gRNA2: ACUUAAACUCCACGUCAUCG (SEQ ID NO: 2)) were diluted in Stem cell Nucleofector Solution 2 and incubated on ice for 20 mins. 105 cells were diluted into the Cas9/sgRNA solution and immediately placed in a cuvette for electroporation using Lonza Nucleofector 2b device on setting A-23. The cells were serially diluted into 6-well Matrigel-coated plate with mTeSR media supplemented with 1× CloneR (STEMCELL Technologies). After 10-14 days, colonies formed from single cells were isolated and expanded in separate wells of a 24-well plate. After the clones were 60-70% confluent, cells were collected by EDTA-PBS dissociation for cryopreservation and isolating DNA extracts for genomic PCR. Each clone was genotyped by using SIRPA primers: αAATCTTAACACCTTGTACAGCCCCA (SEQ ID NO: 5) and AGTGCCTGCTCCAGACTTAAA (SEQ ID NO: 6).
The day prior to differentiation, single cell suspension of hiPSCs were acquired by TrypLE treatment of 60-80% confluent iPSCs. Washed single cells were plated on Collagen IV-treated 6-well plates at a density of 3000 cells/cm2 in TeSR-E8 media with 10 uM Rho kinase inhibitor (Y-27632 Tocris) and placed in the normoxic incubator. On day 0 and thereafter, component-defined IF9S media was used. To initiate differentiation into early mesoderm, hiPSCs were treated with BMP4 (50 ng/ml), FGF2 (50 ng/ml), Activin A (15 ng/ml), LiCl (2 mM), and 10 uM Rho kinase inhibitor (Y-27632 Tocris) on Day 0 and placed in hypoxic conditions (5% oxygen) for 48 hours. To continue differentiation into the hematovascular mesoderm, a full media change was performed on Day 2 and cells were treated with FGF2 (50 ng/ml), VEGF (50 ng/ml), and SB431542 (5 uM) and placed in hypoxic conditions for an additional 48 hours. On days 4 and 6, cells were treated with FGF2 (50 ng/ml), VEGF (50 ng/ml), SCF (50 ng/ml), TPO (50 ng/ml), IL3 (long/ml), and IL6 (50 ng/ml) to continue differentiation into hemogenic endothelial and hematopoietic progenitors (HPs) until day 9 in normoxic conditions. On day 9, floating hematopoietic progenitors (HPs)/hematopoietic precursor cells (HPCs) were collected for flow cytometry analysis or further differentiation.
For macrophage generation, IF9S media and normoxic conditions were used throughout. To initiate myelopoiesis, day 9 floating hematopoietic progenitors were plated on ultra-low attachment (ULA) 6-well plates (Corning Costar) at a density of 1×105 live HPs/well and treated with M-CSF (80 ng/ml), IL-3 (long/ml) and IL-6 (50 ng/ml) for 72 hours. On day 12, cells were treated with additional media containing M-CSF, IL-3 and IL-6 for another 72 hours to generate monocytic cell clumps. On day 15, terminal macrophage differentiation was performed by collecting all cells from the ULA 6-well plates and resuspending in fresh media treated with 80 ng/ml M-CSF and plated at a density of 2×105 cells/well on uncoated tissue culture 6-well plates for 96 hours. On day 19, macrophages were collected by vigorous pipetting to dissociate any adhered cells to be used for analysis and experiments.
Human ETV2 transcript variant 1 (NM_014209.3) was cloned into a 5′-MCS-1β construct as described previously (Suknuntha et al., 2018, Stem Cell Rev. 14, 525-534). To generate IVT templates with a 180-A tract, a reverse primer containing 180 T base pairs and an ATCGGTGCGGGCCTCTTCGCTA (SEQ ID NO: 3) forward primer including T7 promoter were used in a PCR reaction. All PCR reactions were carried out using Phusion (Thermo Fisher Scientific). The mmRNA was synthesized using the MEGAscript T7 Kit (Ambion, Austin, TX), using a custom ribonucleoside cocktail comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate (TriLink BioTechnologies, San Diego, CA), ATP, guanosine triphosphate, and cytidine triphosphate. The synthesis reactions were set up according to the manufacturer's instructions. Reactions were incubated for 2 h at 37° C. and treated with DNAse. RNA was purified using a PureLink RNA Mini Kit (Thermo Fisher Scientific) and adjusted with RNase-free water to 100 ng/μL working concentration before being stored at −80° C. Undifferentiated hiPSCs were transfected with using TransIT-mRNA reagent in E8 medium containing ROCK inhibitor (Suknuntha et al., 2018, Stem Cell Rev. 14, 525-534). In brief, for transfection, single-cell suspension was prepared using HyQtase (Thermo Fisher Scientific). Per one well of transfection, a total of 2×105 cells in 1 mL complete E8 medium with 10 μM ROCK inhibitor (STEMCELL Technologies) were plated into a collagen IV-coated 6-well plate; 30-60 min later, a mixture of 200 ng ETV2: TranslT-mRNA (Minis Bio, Madison, WI) was added to each well according to the manufacturer's instructions.
The day after transfection (day 1), the medium was changed with 1 mL of Stemline II (Sigma) supplemented with 20 ng/mL of human FGF2 (PeproTech). On day 2, 1 mL of the same medium was added. On day 3, the medium was changed and 1 mL of Stemline II supplemented with FGF2 (20 ng/mL), GM-CSF (25 ng/mL) (PeproTech), and UM171 (50 nM; Xcess Biosciences) were added. This medium was added daily up to days 8. On day 9, floating cells were gently harvested and used for macrophage differentiation. To induce specification to monocyte/macrophage lineages, floating cells were cultured in Stemline II, supplemented with M-CSF (80 ng/mL; Amgen), IL6 (50 ng/mL; Amgen), IL3 (10 ng/mL; Amgen) at 1×105 cells/well density in ultra-low attachment 6 well plate. After 3 days, 2 mL of the same medium with all components and cytokines was added on the top of existing culture. At day 15, to induce macrophage differentiation, cells were transferred to a 6 well plate containing Stemline II, supplemented with M-CSF (80 ng/mL; Amgen) for 4 days. At day 19, macrophages were gently harvested and filtered through a 70-μM mesh (Falcon, Life Sciences) before analysis.
To develop the SIRPα-Knockout iPS cell line, exon 3 of the SIRPA gene was targeted with two flanking sgRNAs. The CD47 binding region of SIRPα lies on exon 3, making it an ideal target for a functional SIRPα protein knockout (
Previously, a serum-free, xeno-free, component-defined method was developed for in vitro hematopoietic differentiation that utilizes morphogen-driven formation of the hemogenic endothelium (Uenishi et al., 2014, Stem Cell Reports, 3: 1073-1084). These methods allow for the generation of multipotent hematopoietic progenitors (HPs) with lymphoid and myeloid potential by day 9. With adaptations to the protocol using similar myelopoiesis-driving cytokines disclosed in Cao et al., 2019, Stem Cell Reports, 12: 1282-1297, SIRPα-KO iPSC-macrophages (i-Macs) were generated in 19 days in serum-free conditions (
The generation of the hemogenic endothelium (HE) was observed in SIRPα-KO iPSC-HE with morphology resembling WT iPSC-HE (
To generate macrophages from SIRPα-KO iPSC-HPs, the day 9 floating progenitor cells were collected and resuspended in IF9S media with M-CSF, IL-3, and IL-6. They were then plated on ultra-low attachment 6-well plates at a density of 1×105 cells/well and placed in the normoxic incubator for 72 hours. On day 12, the media was replenished, and myeloid cells formed in clumps until day 15. Myelopoiesis is essential for the generation of macrophages, so analysis of the heterozygous SIRPα-KO iPSC-myeloid cells on day 15 is critical for understanding the myeloid potential of said cells. The morphology of the SIRPα-KO iPSC-myeloid cells showed the population is not purely iPSC-monocytes, but rather a mix of myeloid progenitors, granulocytes, and macrophages (
The day 15 SIRPα-KO iPSC-myeloid cells were investigated further through flow cytometry analysis. The CD45+ population of SIRPα-KO iPSC-myeloid cells was around 90%, indicating at this time-point, the cells were committed to the blood lineage (
Macrophages have impressive diversity and plasticity, depending on the environment they reside. Based on cues that macrophages receive from their environment, they possess the ability to polarize into an array of phenotypes which differ in function and morphology. Classically activated macrophages, or M1 macrophages (M1-Macs), are stimulated by pathogens during infection and pro-inflammatory cytokines secreted from other immune cells. They possess pro-inflammatory and anti-tumorigenic capabilities, and highly express markers CD80, CD86 and antigen-presenting machinery HLA-DR. Alternatively activated macrophages, or M2 macrophages (M2-Macs), are stimulated by an immunosuppressive milieu and cytokines IL-4, IL-10 and TGF-beta. M2-Macs highly express markers CD163 and CD206 and are responsible for wound healing and regeneration of tissues, and therefore are anti-inflammatory. In the context of the TME, immunosuppressive signaling alters the TAM phenotype towards an M2, pro-tumorigenic state.
To test the plasticity and response to stimuli, day 19 SIRPα-KO i-Macs 19 cells were polarized into M1 and M2 phenotypes by the addition of IFN-γ+LPS and IL-4, respectively, for 48 hours (
The most crucial qualities of SIRPα-KO i-Macs to assess is their ability to phagocytose cancer and overall anti-tumorigenic properties. CD47 is overexpressed by many solid tumor cancers including ovarian, pancreatic, breast, lung, and melanoma cancers, and subsequently blocks macrophage phagocytosis. It would be expected to see an increase of phagocytosis by SIRPα-KO i-Macs against CD47-expressing cancer cells. However, because CD47/SIRPα signaling only blocks an activating signal, simply knocking out SIRPα should not initiate non-specific phagocytosis. Thus, to direct the SIRPα-KO i-Macs to phagocytose cancer cells, therapeutic monoclonal antibodies (mAb) were used. The Fc-receptors on macrophages bind to mAbs that target specific cancer-antigens and stimulate antibody-dependent cellular phagocytosis (ADCP), consequently killing the tumor cells.
CD47 overexpression has previously been shown to predict poor prognosis in patients and promote cancer cell invasion in high-grade serous ovarian carcinoma and is expressed on ovarian cancer cell line SKOV-3 (Li, et al., American Journal of Translational Research, 9(6), 2901-2910). In an in vitro cancer challenge, SKOV-3 GFP+ ovarian cancer cells were cultured with WT or SIRPα-KO i-Macs in varying effector to target (E:T) ratios with or without anti-HER2 for 24 hours. Without the addition of anti-HER2, both the WT and SIRPα-KO i-Macs only phagocytosed a maximum of 3-4% of the cancer cells at 8:1 effector to target ratio (
To test the phagocytic capability across multiple cancers, GD2-expressing WM266-4 melanoma cancer cells stained with CellTrace Violet were co-cultured with i-Macs with or without anti-GD2 Ch14.18 mAb. Since WM266-4 highly express CD47, similar results of enhanced phagocytosis by the SIRPα-KO i-Macs (
To capture a smaller time frame for antibody-dependent phagocytosis (ADCP), HER2-expressing SKOV-3 GFP+ovarian cancer cells were cultured with wildtype (WT) or SIRPα-KO iMacs with or without anti-HER2 monoclonal antibody for a total of 6 hours. As seen in the 24-hour assay, without the addition of anti-HER2, both WT and SIRPα-KO iMacs phagocytosed little to none of the cancer cells at all effector-to-target (E:T) ratios, suggesting the safety of SIRPα-KO iMacs against healthy CD47+ cells (
Macrophages also have the capability for cytotoxicity through antibody-dependent cellular cytotoxicity (ADCC), an appealing quality for cancer immunotherapy. When SIRPα-KO i-Macs+anti-HER2 mAb were co-cultured with HER2+CD47+MCF7 breast cancer spheroids for 4 days, there were significantly more dead cells, as shown by the white arrows, within the MCF7 cancer spheroid than wildtype (WT) counterparts (
Current in vitro antibody-dependent phagocytosis assays only consider the GFP+ cells within CD45+ iMacs during flow cytometric analysis and disregard any cancer cells that were killed or destroyed by mechanisms other than phagocytosis. To assess in vitro ADCC, iMacs were co-cultured with a fixed number of luciferase-expressing SKOV-3 cells over varying E:T ratios and time points, bioluminescence using SpectraMax plate reader serving to quantify the viability of SKOV-3 cells. Percent (%) cytotoxicity was calculated by the following formula:
100×(baseline tumor growth−experimental value)/(baseline−maximum lysis control).
In these experiments, SIRPα-KO iMacs were significantly better at killing SKOV-3 cells under any condition with addition of anti-HER2 as compared to wildtype (WT) iMacs+anti-HER2 (
To test SIRPα KO iMacs' cytotoxic capacity across multiple cancer types, GD2+GD3+WM266-4 melanoma cancer cells were co-cultured with iMacs with or without anti-GD3 mAb for 48 hours. With the addition of anti-GD3, SIRPα-KO iMacs displayed significantly higher cytotoxicity than WT iMacs at the 10:1 ratio, and showed steady increase of cytotoxicity across all ratios, unlike any other iMac group (
Macrophages within the tumor microenvironment have been implicated in promoting growth, metastases, and survival of solid tumors through a multitude of mechanisms including direct cell-to-cell signaling, and cytokine signaling (Chen et al., 2019, Journal of Biomedical Science 26: 78; Chanmee et al., 2014, Cancers 6: 1670-1690; and Zhu et al., 2021, Journal of Cancer 12: 54-64). Many anti-inflammatory cytokines and factors expressed by macrophages such as TGF-beta, IL-10, Arg1, IDO, and HIF-1alpha have been associated with solid tumor progression. Due to the myriad of anti-inflammatory cytokine expression, pro-inflammatory cytokines that promote activation of immune cells to an anti-tumorigenic state are suppressed or over-powered. SIRPα- and CD47-signaling between tumor associated macrophages within the tumor microenvironment has not been thoroughly assessed in the context of cytokine signaling pathways. To evaluate if the SIRPα-KO iMacs possessed the same cytokine signaling in response to tumor as WT iMacs, iMacs and SKOV-3 ovarian cancer cells were co-cultured together for 48 hours and 20 different cytokines were evaluated through a multiplex assay (
Wild type bone marrow-derived IISH2i-BM9 hiPSCs (Hu et al., 2011, eBlood 117: e109-e119) was obtained from WiCell (Madison, WI). Human induced pluripotent stem cells (hiPSCs) with knockout SIRPA gene were generated using CRISPR/Cas9 technology. Wild type and SIRPA−/− hiPSCs were cultured on Matrigel-coated tissue culture plates in E8 medium (STEMCELL Technologies).
Human ETV2 transcript variant 1 (NM_014209.3) was cloned into a 5′-MCS-1β construct as described previously (Suknuntha et al., 2018, Stem Cell Rev. 14: 525-534). To generate IVT templates with a 180-A tract, a reverse primer containing 180 T base pairs and an ATCGGTGCGGGCCTCTTCGCTA (SEQ ID NO: 3) forward primer including T7 promoter were used in a PCR reaction. All PCR reactions were carried out using Phusion (Thermo Fisher Scientific). The mmRNA was synthesized using the MEGAscript T7 Kit (Ambion, Austin, TX), using a custom ribonucleoside cocktail comprised of 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog, pseudouridine triphosphate (TriLink BioTechnologies, San Diego, CA), ATP, guanosine triphosphate, and cytidine triphosphate. The synthesis reactions were set up according to the manufacturer's instructions. Reactions were incubated for 2 h at 37° C. and treated with DNAse. RNA was purified using a PureLink RNA Mini Kit (Thermo Fisher Scientific) and adjusted with RNase-free water to 100 ng/μL working concentration before being stored at −80° C. Undifferentiated hiPSCs were transfected with using TransIT-mRNA reagent in E8 medium containing ROCK inhibitor (Suknuntha et al., 2018, Stem Cell Rev. 14: 525-534). In brief, for transfection, single-cell suspension was prepared using HyQtase (Thermo Fisher Scientific). Per one well of transfection, a total of 2×105 cells in 1 mL complete E8 medium with 10 μM ROCK inhibitor (STEMCELL Technologies) were plated into a collagen IV-coated 6-well plate; 30-60 min later, a mixture of 200 ng ETV2: TranslT-mRNA (Minis Bio, Madison, WI) was added to each well according to the manufacturer's instructions.
The day after transfection (day 1), the medium was changed with 1 mL of Stemline II (Sigma) supplemented with 20 ng/mL of human FGF2 (PeproTech). On day 2, 1 mL of the same medium was added. On day 3, the medium was changed and 1 mL of Stemline II supplemented with FGF2 (20 ng/mL), GM-CSF (25 ng/mL) (PeproTech), and UM171 (50 nM; Xcess Biosciences) were added. This medium was added daily up to days 8. On day 9, floating cells were gently harvested and used for terminal neutrophil differentiation. Following the first collection of floating cells, 2 mL of Stemline II supplemented with FGF2, GM-CSF, and UM171 was added to the remaining adherent cells. To induce neutrophil terminal differentiation, floating cells were cultured in StemSpanH300 medium (STEMCELL Technologies), supplemented with GlutaMAX 100X (Thermo Fisher Scientific), ExCyte 0.2% (Merck Millipore), human G-CSF (150 ng/mL; Amgen), Am580 retinoic acid agonist 2.5 μM (Sigma-Aldrich), and gentamycin (1,000×) (Life Technologies) at 5×105 cells/mL density. After 4 days, 2 mL of the same medium with all components and cytokines was added on the top of existing culture. Mature neutrophils were gently harvested from the supernatant after 8 days of culture, leaving the adherent macrophages, and filtered through a 70-μM mesh (Falcon, Life Sciences) before analysis.
To analyze cell surface markers, 5×105 cells were stained in fluorescence-activated cell sorting buffer with the appropriate antibodies (Table 1). Ghost Dye (Tonbo Biosciences, San Diego, CA) was used to analyze the live cell population. Cells were analyzed using a MACS Quant Analyzer 10 (Miltenyi Biotec, San Diego, CA) or Thermo Fisher Scientific FlowJo software (Tree Star, Ashland, OR).
To assess the morphology of cells within colonies, cells were fixed on glass slides using a Cytospin centrifuge (Cytospin 2; Thermo Shandon), stained with Wright-Giemsa solution (Sigma-Aldrich), and then observed under a light microscope (Olympus, Tokyo).
WM266-4 LUC2 GFP, CHLA-20_AAVS1-AkaLuc-EGFP, SK-BR3 LUC2 GFP and SKOV3 LUC2 GFP cells were maintained in tumor specialized media (Sigma-Aldrich) containing 80% MCDB-153, 20% Leibovitz's L-15, 1.68mM CaCl2 and 2% FBS. To access the cytotoxicity, hiPSC derived wild type and SIRPA−/− neutrophils or SIRPα-KO neutrophils or macrophages were incubated with target tumor cells (2,000 cells/well) for 4 hours at 37° C., at effector: target (E:T) ratios of 1:1, 2:1, 5:1, and 10:1, in a final volume of 200 μL, in a 96 well plate. Target cells were used for the maximal lysis with Pierce™ IP Lysis Buffer (ThermoFisher). VivoGlo™ Luciferin substrate (100 ug/well, Promega) was added, and luminescence was measured immediately after 5 mins incubation. Specific cell lysis was measured by % of cell lysis=100×{(Spontaneous death relative luminescence unit (RLU)−Test RLU)/(Spontaneous death RLU−Maximal killing RLU)}.
Wild type and SIRPA−/− neutrophils were plated at a 1:1 MOI for six hours. hiPSC neutrophils were then lysed with ddH2O plus 100 ug/ml DNase 1 solution for 1 hour. PrestoBlue (metabolic assay) reagent was then added and incubated for 2 hours at 37c/5% CO2 before reading fluorescence at 560/590 nm. The percentage of viable yeast was quantified relative to yeast with no neutrophils. Neutrophil-only controls were subtracted from that value. Bar graph show±SEM from 3 independent experiments showing percent yeast survival. Differences compared to wild type were not significant (p=0.1755) as determined by unpaired t test.
Phagocytosis was assessed using pHrodo Green E. coli BioParticles Conjugate (Invitrogen) according to a modified manufacturer's protocol. pHrodo Green E. coli beads were resuspended in 2 mL of PBS and sonicated with an ultrasonicator 3 times (20% amplitude, 20 s on/10 s off). Beads per assay (100 μL) were opsonized by mixing with opsonizing reagent at a 1:1 ratio and incubated at 37° C. for 1 h. Beads were washed 3 times mHBSS buffer by centrifugation at 4° C., 1,500 RCF for 15 min then final resuspension in mHBSS buffer. Beads were used immediately or stored at 4° C. for several days. Wild type and SIRPA−/− neutrophils (5×105) were resuspended in 100 μL of opsonized bead solution and incubated at 37° C. or on ice for 1 h. Phagocytosis was stopped by placing all samples on ice. Analysis was carried out with Thermo Fisher Scientific Attune cytometer for fluorescent particles (509/533). Cells were gated based on granulocyte population, single cells, and live cells using propidium iodine.
Floating wild type and SIRPA−/− neutrophils (105) were plated in each well of a black 96-well plate on 10 μg/mL fibrinogen with 100 μL of mHBSS buffer in the presence of 10 ng/mL dihydrorhodamine 123. Cells were incubated for 30 min at 37° C./5% CO2. PMA was added to a final concentration of 50 ng/mL or vehicle control DMSO was added to samples. Optimal reactive oxygen species production was determined by time course. Fluorescent measurements were taken of samples in triplicate or replicates of four on the Victor3 V plate reader (Ex/Em 500/536).
Chemotaxis was assessed using a microfluidic device. In brief, polydimethylsiloxane devices were plasma treated and adhered to glass coverslips. Devices were coated with 10 μg/mL fibrinogen (Sigma) in PBS for 30 min at 37° C., 5% CO2. The devices were blocked with 2% BSA-PBS for 30 min at 37° C., 5% CO2, to block non-specific binding, and then washed twice with mHBSS. Wild type and SIRPA−/− neutrophils were stained with calcein AM (Molecular Probes) in PBS for 10 min at room temperature followed by resuspension in modified Hank's balanced salt solution (mHBSS). Wild type and SIRPA−/− neutrophils were seeded at 5×106/mL to allow adherence for 30 min before addition of chemoattractant. Either 1 μM fMLP (Sigma) or 11.25 μM IL-8 (R&D Systems) was loaded onto the devices. Cells were imaged for 45-90 min every 30 s on a Nikon Eclipse TE300 inverted fluorescent microscope with a 10×μ objective and an automated stage using MetaMorph software (Molecular Devices). Automated cell tracking analysis was done using JEX software to calculate chemotactic index and velocity.
SIRPα-KO and wildtype (WT) iMacs were either cultured alone or co-cultured with SKOV-3 ovarian cancer and anti-HER2 monoclonal antibody for 48 hrs. The supernatants were collected for Human Inflammation 20-Plex ProcartaPlex Panel (ThermoFisher). Supernatants were tested in technical duplicates and raw values were produced on MAGPIX xMAP instrument plotted against a standardized curve.
Transfection of ETV2 mmRNA into the single cell of wild type and SIRPA−/− hiPSCs formed a typical endothelial morphology within 24 hours (
The myeloid progenitors expressed CD45 surface markers on day 9 (
Functional Evaluations
Functional characterization of neutrophils was performed using cytotoxicity assay (
ETV2 mmRNA induction produced 1.7×107 neutrophils from 106 wild type hiPSCs and 3×107 neutrophils from 106 SIRPA−/− hiPSCs within 3 weeks.
Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein. The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description can be made without departing from the spirit or scope of the present invention, as defined in the following claims.
This application claims priority to U.S. provisional application No. 63/306,830, filed Feb. 4, 2022, the disclosure of which is expressly incorporated by reference herein.
This invention was made with government support under HL142665 and OD011106 awarded by the National Institute of Health. The government has certain rights in the invention.
| Number | Date | Country | |
|---|---|---|---|
| 63306830 | Feb 2022 | US |
