Patent Grant
11555192
The Sequence Listing in ASCII text file format of 81,175 bytes in size, created on May 10, 2021, with the file name “2021-05-10SequenceListing_SHOSHAN11,” filed in the U.S. Patent and Trademark Office on even date herewith, is hereby incorporated herein by reference.
The present invention relates to compositions and methods for treating cancer, particularly to agents that inhibit the expression and/or activity of the protein second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI (SMAC/Diablo), including RNA interference molecules silencing the expression of SMAC/Diablo and peptides modulating its activity, useful for treating cancers associated with overexpression of SMAC/Diablo.
The canonical SMAC/Diablo (second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI) isoform, SMAC-α, is a mitochondrial intermembrane space (IMS) pro-apoptotic protein (Verhagen, A. M., et al. 2000. Cell 102, 43-53; Du, Cet al. 2000. Cell 102, 33-42). The N-terminus of SMAC/Diablo serves as a mitochondrial targeting signal (MTS), and is cleaved to form the mature 26 kDa protein. Following the induction of apoptosis, SMAC/Diablo is released into the cytosol (Du, Cet al. 2000, ibid; Deng, Y., et al. 2002. Genes Dev. 16, 33-45), where it interacts with members of the protein family designated “inhibitor of apoptosis proteins” (IAPs), including cIAP1, cIAP2, and XIAP to neutralize the inhibitory effects of IAPB on caspases and, thus, initiates apoptosis (Shiozaki, E. N., and Shi, Y. 200). Trends Biochem. Sci. 29, 486-494; Verhagen, A. M., and Vaux, D. L. 2002. Apoptosis 7, 163-166). This interaction neutralizes the inhibitory effects of IAPB on caspases, and thus initiates apoptosis. In interacting with IAPB, SMAC/Diablo acts as a homodimer, mediated via an N-terminal motif (Ala-Val-Pro-Ile). In addition, SMAC/Diablo was shown to be controlled by several other proteins including the Bcl-2 family of proteins, mitogen-activated protein kinase family members, (e.g. Erk1/2) and c-Jun N-terminal kinase.
Although there are number of SMAC/Diablo variants generated by alternative splicing, SMAC/Diablo-α is the main IAP inhibitor (Adrain, C., et al. 2001. EMBO J 20, 6627-6636). Another isoform, SMAC/Diablo-β (Also known as SMAC-S), which lacks both the IAP-binding motif (IBM) and the MTS, can sensitize cells to apoptosis when over-expressed, suggesting that SMAC/Diablo may also serve functions that are IBM- and mitochondria-independent. A cytosolic form, SMAC/Diablo-ε, which also lacks both IBM and MTS elements, is ubiquitously expressed in normal human tissues and cancer cell lines (Martinez-Ruiz, G. U., et al., 2014. Int J Clin Exp Pathol 7, 5515-5526), is not involved in apoptosis and has been shown to be associated with tumorigenicity (Grimshaw, M. J., et al., 2008 Breast Cancer Res 10, R52). Additional isoforms of SMAC/Diablo are SMAC/Diablo-δ (also known and SMAC/Diablo-3), SMAC/Diablo-4 and SMAC/Diablo-γ (also known as SMAC/Diablo-5).
Mice lacking SMAC/Diablo are viable, grow and mature normally, present embryonic fibroblasts, lymphocytes, and hepatocytes without any histological abnormalities, and exhibit wild-type responses to all types of apoptotic stimuli (Okada, H., et al., 2002 Mol Cell Biol 22, 3509-3517).
SMAC/Diablo was found to be down-regulated in certain types of cancers. For instance, the expression levels of both SMAC/Diablo mRNA and protein were reduced in hepatocellular carcinoma cells, as compared to normal hepatic tissue (Bao, S. T., et al., 2006. Hepatobiliary Pancreat Dis Int 5, 580-583). Over-expression of recombinant SMAC/Diablo was found to sensitize neoplastic cells to apoptotic death (Kashkar, H., et al., 2006. Blood 108, 3434-3440). SMAC/Diablo or mimetic molecules thereof have been proposed as anti-cancer agents capable of inhibiting IAPB and thus promoting cancer cell death (for example, U.S. Application Publication Nos. 2013/0196927; U.S. Pat. Nos. 7,816,538, 7,884,211, and 9,861,679).
U.S. Patent Application Publication No. 2008/0253966 discloses methods for diagnosing and providing prognosis of cancer diseases that underexpress SMAC/Diablo, and methods for treating or inhibiting such diseases.
Unexpectedly, despite its role in promoting cell death, SMAC/Diablo was found to be over-expressed in some cancers and higher levels of both SMAC/Diablo protein and its encoding mRNA were reported in cervical cancer (Arellano-Llamas, A., et al., 2006. BMC Cancer 6, 256), lung, ovarian and prostate carcinomas, different types of sarcoma (Yoo, N. J., et al., 2003. APMIS 111, 382-388), gastric carcinomas (Shintani, M., et al., 2014. Oncol Lett 8, 2581-2586), pancreatic cancer (Hu H. Y. et al., 2012. Hepatogastroenterology 59(120):2640-3), testis cancer (Yoo N. J. et al., 2003. APMIS 111(3):382-388) and renal cell carcinoma (Kempkensteffen, C., et al., 2008. J Cancer Res Clin Oncol 134, 543-550).
There is a growing awareness of the understanding that cancer is not a single disease. Thus, there is a need for and it would be highly advantageous to have compositions and methods for treating cancer diseases that share common characteristics.
The present invention provides compositions and methods for treating cancers that overexpress SMAC/Diablo. The present invention provides agents that inhibit the expression and/or activity of SMAC/Diablo. In particular embodiments the present invention provides RNA inhibitory agents that silence or otherwise down regulate the expression of SMAC/Diablo and peptides that interact with SMAC/Diablo protein within the mitochondria and/or nucleus.
The present invention is based in part on the unexpected discovery that silencing the expression of SMAC/Diablo encoding mRNA, using small interfering RNA (siRNA) molecules, in cancer cell lines overexpressing the mRNA and encoded protein, markedly reduced the cell proliferation. Silencing SMAC/Diablo in mice subcutaneous xenografts of lung cancer cells or of breast triple negative cancer cells significantly reduced tumor growth. Furthermore, following SMAC/Diablo silencing treatment, residual lung tumors demonstrated morphological changes, including the development of alveoli-like anatomical structures and elimination of intracellular organelles, such as lamellar bodies, which are typical to alveolar type 2 (AT2) cells in lung tissue and non-small cells lung carcinoma cells. Next-generation sequencing of mRNA material obtained from tumors treated with SMAC-silencing siRNA molecules revealed altered expression of genes associated with intercellular membranal and exosomal networks, cells differentiation, lipid metabolism and transport activities. SMAC/Diablo silencing in lung cancer tumors decreased the level of phospholipids, including phosphatidylcholine, and the expression of enzymes associated with their synthesis. The present invention further discloses peptides derived from proteins interacting with SMAC/Diablo and modulate its activity. The peptides specifically bind to SMAC/Diablo and, when targeted into the mitochondria and/or nucleus of cancerous cells overexpressing SMAC/Diablo, inhibit the cell proliferation.
According to one aspect, the present invention provides a method for treating cancer associated with over-expression of second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI (SMAC/Diablo) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one agent that inhibits the expression and/or activity of the SMAC/Diablo.
According to certain exemplary embodiments, inhibiting the expression and/or activity of SMAC/Diablo results in reduced proliferation of cancerous cells.
According to certain embodiments, the agent that inhibits the expression and/or activity of SMAC/Diablo is selected from the group consisting of an inhibitory nucleic acid, an inhibitory peptide, an inhibitory small molecule, an inhibitory aptamer, and combinations thereof.
According to certain embodiments, the agent is SMAC/Diablo silencing oligonucleotide or a recombinant construct encoding same, targeted to the gene or mRNA sequence encoding SMAC/Diablo protein.
According to certain embodiments, the SMAC/Diablo encoding gene comprises a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:1 (NG_029459.1).
According to certain embodiments, the SMAC/Diablo protein is selected from the group consisting of SMAC/Diablo-α, having an amino acids sequence at least 80%, at least 85%, at least 90% or more homologous to the amino acid sequence set forth in SEQ ID NO:2; SMAC/Diablo-δ, having an amino acids sequence at least 80%, at least 85%, at least 90% or more homologous to the amino acid sequence set forth in SEQ ID NO:4; SMAC/Diablo-β, having an amino acids sequence at least 80%, at least 85%, at least 90% or more homologous to the amino acid sequence set forth in SEQ ID NO:6; SMAC/Diablo-4, having an amino acids sequence at least 80%, at least 85%, at least 90% or more homologous to the amino acid sequence set forth in SEQ ID NO:8; and SMAC/Diablo-γ, having an amino acids sequence at least 80%, at least 85%, at least 90% or more homologous to the amino acid sequence set forth in SEQ ID NO:10. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the SMAC/Diablo-α is encoded by a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:3 (NM_019887.5); the SMAC/Diablo-δ is encoded by a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:5 (NM_001278342.1); the SMAC/Diablo-β is encoded by a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:7 (NM_001278304.1; NM_138930.3); the SMAC/Diablo-4 is encoded by a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:9 (NM_001278302.1); and the SMAC/Diablo-γ is encoded by a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:11 (NM_001278303.1). Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the SMAC/Diablo protein is human protein (hSMAC/Diablo)selected from the group consisting of hSMAC/Diablo-α, having the amino acid sequence set forth in SEQ ID NO:2; hSMAC/Diablo-δ, having the amino acid sequence set forth in SEQ ID NO:4; hSMAC/Diablo-δ, having the amino acid sequence set forth in SEQ ID NO:6; hSMAC/Diablo-4, having the amino acid sequence set forth in SEQ ID NO:8; and hSMAC/Diablo-γ, having the amino acid sequence set forth in SEQ ID NO:10. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the hSMAC/Diablo-α is encoded by the nucleic acid sequence having SEQ ID NO:3; hSMAC/Diablo-δ is encoded by the nucleic acid sequence having SEQ ID NO:5; hSMAC/Diablo-β is encoded by the nucleic acid sequence having SEQ ID NO:7; hSMAC/Diablo-4 is encoded by the nucleic acid sequence having SEQ ID NO:9; and hSMAC/Diablo-γ is encoded by the nucleic acid sequence having SEQ ID NO:11. Each possibility represents a separate embodiment of the present invention.
According to some embodiments, the SMAC/Diablo protein is selected from the group consisting of SMAC/Diablo-α and SMAC/Diablo-δ.
According to certain embodiments, the SMAC/Diablo silencing molecule comprises at least 15 consecutive nucleic acid bases targeted to (hybridizable with) a nucleic acid sequence encoding SMAC/Diablo protein or to a complementary polynucleotide thereof.
According to certain embodiments, the SMAC/Diablo silencing molecule comprises at least 15 consecutive nucleic acid bases substantially identical to a nucleic acid sequence at least 80%, at least 85%, at least 90% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:3 or to a nucleic acid sequence complementary to SEQ ID NO:3.
According to certain exemplary embodiments, the SMAC/Diablo protein is hSMAC/Diablo-α having the amino acid sequence set forth in SEQ ID NO:2, encoded by the nucleic acid sequence set forth in SEQ ID NO:3.
According to certain embodiments, the SMAC/Diablo silencing molecule comprises at least 15 consecutive nucleic acid bases substantially homologous to nucleic acid bases at positions 900-1,500 of SEQ ID NO:3 or to a complementary polynucleotide thereof.
According to certain embodiments, the inhibitory nucleic acid comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs:12-17, 20-25, and 28-43, a DNA or RNA sequence corresponding thereto, analogs, derivatives and combinations thereof. Each possibility represents separate embodiment of the present invention.
According to certain embodiments, the inhibitory nucleic acid is selected from the group consisting of an interfering RNA (RNAi), an antisense polynucleotide, a catalytic RNA, and an RNA-DNA chimera.
According to certain embodiments, the nucleic acid agent inhibiting the expression of SMAC/Diablo (SMAC/Diablo silencing oligonucleotide) is selected from the group consisting of RNA interference (RNAi) molecule and antisense molecule. According to some embodiments, the RNAi molecule is an unmodified and/or modified double stranded (ds) RNA molecules including, but not limited to, short-temporal RNA (stRNA), small interfering RNA (siRNA), short-hairpin RNA (shRNA), and microRNA (miRNA). In some embodiments, the SMAC/Diablo inhibitor is a biosynthetic precursor of a SMAC/Diablo-targeted dsRNA.
According to certain exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is siRNA. siRNAs are typically short double-stranded RNA species with phosphorylated 5′ ends and hydroxylated 3′ ends. The siRNA molecules of the invention comprise a first oligonucleotide and a second oligonucleotide essentially complementary thereto (sense and antisense RNA strands) that can form an RNA duplex. Typically, each strand of the siRNA molecule is no more than 30 nucleotides in length, and is preferably about 19-25 nucleotides in length.
The siRNA molecules may further comprise 3′ nucleotide overhangs on either or both strands, i.e. terminal portions of the nucleotide sequence that are not base paired between the two strands of the double stranded siRNA molecule. Preferably, the overhang is about 1-5 nucleotides in length, more preferably 2 nucleotides in length.
According to certain embodiments, the SMAC/Diablo silencing oligonucleotide is siRNA molecule comprising a first oligonucleotide comprising a nucleic acid sequence substantially homologous to at least 15 consecutive nucleic acid bases of SEQ ID NO:3 and a second polynucleotide sequence substantially complementary to the first oligonucleotide; wherein said first and second oligonucleotides are able to anneal to each other to form the siRNA molecule.
According to certain exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:12 (AAGCGGUGUUUCUCAGAAUUG) and a second oligonucleotide substantially complementary thereto. According to some embodiments, the second oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:13 (AACAAUUCUGAGAAACCCGC). According to certain further exemplary embodiments, the targeted SMAC/Diablo polynucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NO:3 and SEQ ID NO:5.
According to certain exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:14 (GCAGAUCAGGCCUCUAUAA) and a second oligonucleotide substantially complementary thereto. According to some embodiments, the second oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:15 (UUAUAGAGGCCUGAUCUGC). According to certain further exemplary embodiments, the targeted SMAC/Diablo polynucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, and SEQ ID NO:11.
According to certain exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:16 (CCCGGAAAGCAGAAACCAA) and a second oligonucleotide substantially complementary thereto. According to some embodiments, the second oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:17 (UUGGUUUCUGCUUUCCGGG). According to certain further exemplary embodiments, the targeted SMAC/Diablo polynucleotide comprises the nucleic acid sequence set forth in any one of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, and SEQ ID NO:11.
According to certain embodiments, the first and/or the second oligonucleotide of the siRNA molecules of the present invention further comprises 3′ overhang of two thymine nucleotides. According to these embodiments, the SMAC/Diablo siRNA molecule is selected from the group consisting of an siRNA molecule comprising a first nucleotide having the nucleic acid sequence set forth in SEQ ID NO:20 and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:21; an siRNA molecule comprising a first nucleotide having the nucleic acid sequence set forth in SEQ ID NO:22 and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:23; and an siRNA molecule comprising a first nucleotide having the nucleic acid sequence set forth in SEQ ID NO:24 and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:25. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the SMAC/Diablo silencing oligonucleotide is chemically modified. According to some embodiments, the SMAC/Diablo silencing oligonucleotide comprises at least one 2′-sugar modification. In a particular embodiment, the 2′-sugar modification is a 2′-O-methyl (2′-O-Me) modification.
According to certain embodiments, the SMAC/Diablo silencing oligonucleotide is modified (typically by a 2′-O-Me) at least at one position selected from the group consisting of position 3, 5, 6, 7, 9, 10, 11, 16 and 21 of SEQ ID NO:12 or SEQ ID NO:20.
According to certain embodiments, the hSMAC/Diablo silencing oligonucleotide is modified (typically by a 2′-O-Me) at least at one position selected from the group consisting of position 6, 7, 10, 12, and 19 of SEQ ID NO:13 or SEQ ID NO:21.
According to some exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:20 derivatized by 2-O′-Me at positions 5, 10, 16 and 21 (SEQ ID NO:28) and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:21 derivatized by 2-O′-Me at positions at positions 6, 12 and 19 (SEQ ID NO:29).
According to some exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:20 derivatized by 2-O′-Me at positions 3, 6, 11, and 21 (SEQ ID NO:34) and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:21 derivatized by 2-O′-Me at positions at positions 6, and 19 (SEQ ID NO:35).
According to certain embodiments, the SMAC/Diablo silencing oligonucleotide is modified (typically by a 2′-O-Me) at least at one position selected from the group consisting of position 4, 6, 9, 10, 13, 15 and 17 of SEQ ID NO:14 or SEQ ID NO:22.
According to certain embodiments, the hSMAC/Diablo silencing oligonucleotide is modified (typically by a 2′-O-Me) at least at one position selected from the group consisting of position 2, 4, 6, 8, 9, 12, 13, 15, 17 and 18 of SEQ ID NO:15 or SEQ ID NO:23.
According to some exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:22 derivatized by 2-O′-Me at positions 4, 9, 13, and 17 (SEQ ID NO:38) and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:7 derivatized by 2-O′-Me at positions at positions 6, 12, and 18 (SEQ ID NO:39).
According to some exemplary embodiments, the SMAC/Diablo silencing oligonucleotide is an siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:22 derivatized by 2-O′-Me at positions 6, 10, and 15 (SEQ ID NO:40) and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:23 derivatized by 2-O′-Me at positions at positions 2, 9, and 17 (SEQ ID NO:41).
According to some embodiments, the siRNA is a single-stranded short hairpin RNA (shRNA) wherein the first oligonucleotide sequence is separated from the second oligonucleotide sequence by a linker which forms a loop structure upon annealing of the first and second oligonucleotide sequences. In some embodiments the linker length is about 3 to about 60 nucleotides.
According to certain embodiments, the method of the present invention comprises administering to the subject a nucleic acid construct capable of expressing at least one inhibitory nucleic acid.
According to some embodiments, the expressed inhibitory nucleic acid comprises a sequence selected from the group consisting of SEQ ID NOs:12-17, 20-25, 28-29, 34-35 and 38-41. According to certain embodiments, the nucleic acid construct is capable of expressing at least one siRNA molecule. According to certain exemplary embodiments, the method comprises administrating to the subject a construct capable of expressing siRNA molecule comprising a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:20 and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:13 or SEQ ID NO:21.
The present invention discloses novel peptides derived from hSMAC/Diablo-associated proteins that can bind to hSMAC/Diablo. When the peptide derived from hSMAC/Diablo-interacting protein is targeted into the cell and further into the nucleus and/or the mitochondria, such that the interaction with hSMAC/Diablo occurs within the organelle(s), the interaction results in inhibition or intervention in phospholipid biosynthesis, cell growth and/or cell proliferation.
According to further embodiments of the invention, the agent that inhibits the activity of SMAC/Diablo is an inhibitory peptide targeted to the nucleus and/or to the mitochondria of a cell. According to certain embodiments, the cell is overexpressing SMAC/Diablo.
According to certain embodiments, the inhibiting peptide is a conjugate comprising a peptide derived from hSMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a mitochondria and/or nucleus targeting moiety. The mitochondria and/or nucleus targeting moiety can be peptidic or non-peptidic, and is covalently linked to the peptide derived from SMAC/Diablo-interacting protein directly or via linker. The targeting moiety may be linked to the peptide derived from hSMAC/Diablo-interacting protein at any position. According to some embodiments, the targeting moiety is linked to the N- or the C-terminus of the peptide derived from hSMAC/Diablo-interacting protein. When the conjugate comprises a combination of mitochondria and nucleus targeting moieties each moiety may be independently linked to the N- or C-terminus of the peptide or the mitochondria and nucleus targeting moieties can be linked in tandem to the N- or C-terminus of the peptide. According to some embodiments, the conjugate further comprises a cell penetration moiety enhancing the permeability of the conjugate through the cell plasma membrane. Any cell penetrating moiety as is known in the art can be used according to the teachings of the present invention.
According to some embodiments, the inhibiting peptide is a conjugate of a peptide derived from hSMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a nucleus targeting moiety. Any nucleus targeting (localization) moiety as is known in the art can be used according to the teachings of the present invention. According to certain exemplary embodiments, the nucleus targeting moiety is the tetrapeptide RrRK, wherein r is D-arginine (SEQ ID NO:68). The nucleus targeting tetrapeptide can be independently located at the C- or N-terminus of the peptide derived from hSMAC/Diablo-interacting protein.
According to some embodiments, the inhibiting peptide is a conjugate of a peptide derived from hSMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a mitochondria targeting moiety. Any mitochondria targeting (localization) moiety as is known in the art can be used according to the teachings of the present invention. According to certain exemplary embodiments, the mitochondria targeting moiety comprises the amino acid sequence set forth in SEQ ID NO:72. The mitochondria targeting peptide can be independently located at the C- or N-terminus of the peptide derived from hSMAC/Diablo-interacting protein. When the mitochondria targeting peptide having SEQ ID NO:72 is located at the C-terminus of the peptide derived from hSMAC/Diablo-interacting protein, its C-terminus may be amidated.
According to certain embodiments, the peptide derived from hSMAC/Diablo-interacting protein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67. According to some embodiments, the peptide derived from hSMAC/Diablo-interacting protein comprises an amino acid sequence selected from the group consisting of SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48 and SEQ ID NO:49. Each possibility represents a separate embodiment of the present invention.
According to certain exemplary embodiments, the inhibiting peptide conjugate targeted to the nucleus comprises an amino acid sequence selected from the group consisting of SEQ ID NO:69, SEQ ID NO: 70 and SEQ ID NO:71.
According to certain exemplary embodiments, the inhibiting peptide conjugate targeted to the mitochondria comprises an amino acid sequence selected from the group consisting of SEQ ID NO:73 and SEQ ID NO:74.
According to certain embodiments, the cancer is selected from the group consisting of lung cancer, breast cancer, colon cancer, lymphoma, sarcomas, stomach cancer, skin cancer, renal cancer, prostate cancer, testicular cancer, cervical cancer, leukemia and pancreatic cancer. Each possibility represents a separate embodiment of the present invention.
According to certain currently exemplary embodiments, the cancer is lung cancer.
According to certain additional currently exemplary embodiments, the cancer is breast cancer.
According to certain embodiments treating the cancer comprises re-programming the cancerous cells to at least one of attenuated lipid synthesis, decreased proliferation, and differentiation.
According to certain exemplary embodiments, the cancer is lung cancer and treating the lung cancer comprises at least one of inducing differentiation of AT2-like cells to differentiated non-proliferating AT1 cells; reducing proliferation of AT2-like undifferentiated cells and a combination thereof. These activities lead to the appearance of alveolar healthy-like morphology.
Any method as is known in the art for administering the agent that inhibits the expression and/or activity of the SMAC/Diablo can be used according to the teachings of the present invention. According to some embodiment, the inhibitory agent is administered within a pharmaceutical composition. According to certain exemplary embodiments, the pharmaceutical composition further comprises pharmaceutically acceptable excipients, diluents or carriers.
According to certain embodiments, the inhibitory agent is an RNA inhibitory molecule or a peptide. According to certain currently exemplary embodiments, the inhibitory agent is siRNA molecule. According to additional certain currently exemplary embodiments, the inhibitory agent is a peptide conjugate comprising a peptide derived from hSMAC/Diablo-interacting protein and a nucleus and/or mitochondria targeting moiety. According to these embodiments, the RNAi molecule, the construct comprising same or the peptide conjugate is administered within a pharmaceutical composition, said pharmaceutical composition optionally further comprises pharmaceutically acceptable excipients, diluents or carriers.
According to additional exemplary embodiments, the RNAi molecule is encapsulated within a nanoparticle or a liposome. According to some embodiments, the RNAi molecule is encapsulated within Polyethylenimine (PEI)-Poly(D,L-lactide-co-glycolide) (PLGA) nanoparticle or any other siRNA-delivery system as is known in the art.
The mode of administering the inhibitory agent according to the teachings of the present invention will depend upon the type of the agent, the type and severity of the cancer and parameters related to the subject (age, gender, weight etc.).
According to certain embodiments, the inhibitory agent or a pharmaceutical composition comprising same is administered via intravenous, intradermal, intramuscular, intra-arterial, intralesional, percutaneous, subcutaneous, intranasal or oral administration or by inhalation or by aerosol administration, or by combinations thereof. In some embodiments, administration is prophylactic administration, and in alternative embodiments, administration is therapeutic administration. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the method of the present invention further comprises administering to the subject at least one additional anti-cancer agent or anti-cancer therapy.
Any agent and/or therapy as is known in the art for treating the cancerous disease of the subject can be employed as long as its activity does not interfere with the inhibition of SMAC/Diablo expression and/or activity according to the teachings of the present invention.
According to another aspect, the present invention provides at least one agent that inhibits the expression and/or activity of SMAC/Diablo for use in treating cancer associated with over-expression of SMAC/Diablo.
According to additional aspect, the present invention provides the use of at least one agent that inhibits the expression and/or activity of SMAC/Diablo for the preparation of a medicament for treating cancer associated with over-expression of SMAC/Diablo.
The at least one agent and the cancer types are as described hereinabove.
According to further aspect, the present invention provides an isolated SMAC/Diablo silencing molecule comprising a first oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:12 and optionally a 3′ overhang of 1-5 nucleotides, derivatized by 2′-O-methyl (2′-O-Me) at positions 5, 10, 16, and 21 and a second oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:13 and optionally a 3′ overhang of 1-5 nucleotides, derivatized by 2′-O-Me at positions 6, 12 and 19.
According to certain embodiments, the SMAC/Diablo silencing oligonucleotide comprising a first oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:20 derivatized by 2′-O-Me at positions 5, 10, 16, and 21 and a second oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:21 derivatized by 2′-O-Me at positions 6, 12 and 19.
According to yet further aspect, the present invention provides an isolated SMAC/Diablo silencing molecule comprising a first oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:12 and optionally a 3′ overhang of 1-5 nucleotides, derivatized by 2′-O-methyl (2′-O-Me) at positions 3, 6, 11 and 21, and a second oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:13 and optionally a 3′ overhang of 1-5 nucleotides, derivatized by 2′-O-Me at positions 6 and 19.
According to certain embodiments, the SMAC/Diablo silencing molecule comprises a first oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:20 derivatized by 2′-O-Me at positions 3, 6, 11, and 21 and a second oligonucleotide comprising the nucleic acid sequence set forth in SEQ ID NO:21 derivatized by 2′-O-Me at positions 6 and 19.
According to additional aspect, the present invention provides an isolated SMAC/Diablo silencing molecule comprises a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:14 and optionally a 3′ overhang of 1-5 nucleotides and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:15 and optionally a 3′ overhang of 1-5 nucleotides. According to certain embodiments, the first oligonucleotide is derivatized by 2′-O-Me at positions 4, 9, 13 and 17 and the second oligonucleotide is derivatized by 2′-O-Me at positions 6, 12 and 18. According to other embodiments, the first oligonucleotide is derivatized by 2′-O-Me at positions 6, 10, and 15 and the second oligonucleotide is derivatized by 2′-O-Me at positions 2, 9 and 17.
According to some embodiments, the isolated SMAC/Diablo silencing molecule comprises a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:22 and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:23. According to certain embodiments, the first oligonucleotide is derivatized by 2′-O-Me at positions 4, 9, 13 and 17 and the second oligonucleotide is derivatized by 2′-O-Me at positions 6, 12 and 18. According to other embodiments, the first oligonucleotide is derivatized by 2′-O-Me at positions 6, 10, and 15 and the second oligonucleotide is derivatized by 2′-O-Me at positions 2, 9 and 17.
According to additional aspect, the present invention provides an isolated SMAC/Diablo silencing molecule comprises a first oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:16 and optionally a 3′ overhang of 1-5 nucleotides and a second oligonucleotide having the nucleic acid sequence set forth in SEQ ID NO:17 and optionally a 3′ overhang of 1-5 nucleotides. According to certain embodiments, the first oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:24 and the second oligonucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:25.
According to yet additional aspect, the present invention provides an isolated synthetic or recombinant peptide having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, wherein the peptide is capable of binding to human SMAC/Diablo. According to certain embodiments, the peptide comprises the amino acid sequence set forth in any one of SEQ ID NOs:46-67.
According to certain embodiments, the peptide further comprises a nucleus and/or mitochondria targeting moiety. The nucleus or mitochondria targeting moiety can be linked to the peptide at any position, typically at the N- or at the C-terminus, directly or via a linker. According to some embodiments, the conjugate further comprises a cell-penetrating moiety.
According to certain embodiments, the present invention provides a peptide conjugate comprising a peptide having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, and a nucleus targeting peptide having the amino acid sequence set forth in SEQ ID NO:68. According to some embodiments, the peptide conjugate comprises a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, and a nucleus targeting peptide having the amino acid sequence set forth IN SEQ ID NO:68. According to certain exemplary embodiments, the peptide conjugate comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 69, SEQ ID NO:70, and SEQ ID NO:71. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the present invention provides a peptide conjugate comprising a peptide having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, and a mitochondria targeting peptide having the amino acid sequence set forth IN SEQ ID NO:72. According to some embodiments, the peptide conjugate comprises a peptide having an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, and a nucleus targeting peptide having the amino acid sequence set forth IN SEQ ID NO:72. According to certain exemplary embodiments, the peptide conjugate comprises an amino acid sequence selected from the group consisting of SEQ ID NO:73, and SEQ ID NO:74. Each possibility represents a separate embodiment of the present invention.
It is to be understood explicitly that the scope of the present invention encompasses homologs, analogs, variants and derivatives, including shorter and longer peptides, polypeptides, proteins and polynucleotides, as well as peptides, polypeptides, proteins and polynucleotide analogs with one or more amino acid or nucleic acid substitution, as well as amino acid or nucleic acid derivatives, non-natural amino or nucleic acids and synthetic amino or nucleic acids as are known in the art, with the stipulation that these variants and modifications must preserve the capacity of inhibiting the expression and/or the activity of SMAC/Diablo according to the teachings of the present invention.
It is to be understood that any combination of each of the aspects and the embodiments disclosed herein is explicitly encompassed within the disclosure of the present invention.
Other objects, features and advantages of the present invention will become clear from the following description and drawings.
The present invention addresses the paradox of overexpression of SMAC/Diablo, a protein participating in promoting apoptosis by negatively regulating the inhibitor of apoptosis protein (IAP) family, in several types of cancer. The present invention shows for the first time that silencing SMAC/Diablo expression and/or modulating its activity within the nucleus and/or mitochondria in cancerous cells over-expressing this protein, reduced the proliferation of the cells and/or the growth of tumors comprising cells with the modulated expression and or activity of SMAC/Diablo. According to some embodiments, SMAC/Diablo expression is silenced by RNA inhibitory molecules and its activity within the nucleus and/or mitochondria is modulated using peptides derived with proteins interacting with SMAC/Diablo.
Using as example lung cancer xenografts treated with SMAC/Diablo silencing siRNA molecule, immunohistochemistry and electron-microscopy of residual lung tumor tissue demonstrated morphological changes, including the development of glandular, alveoli-like structures and elimination of lamellar bodies. Next-generation sequencing of lung tumors treated with SMAC/Diablo specific siRNA molecule revealed altered expression of genes associated with intercellular membranal and exosomal networks, cells differentiation, lipid metabolism and transporter expression and/or activity compared to lung tumors treated with non-targeted-siRNA molecule. Silencing of SMAC/Diablo expression decreased phospholipids and phosphatidylcholine levels, and the expression of enzymes associated with their synthesis. Without wishing to be bound by any specific theory or mechanism of action, the above-described phenomena suggest that SMAC/Diablo possesses an additional, non-apoptotic function associated with, inter alia, regulation of lipid synthesis essential for cancer cell growth. Agents inhibiting the expression and/or activity of SMAC/Diablo within the nucleus and/or the mitochondria in cancer types overexpressing this protein can thus be used as therapeutics.
Definitions
As used herein, the terms “SMAC/Diablo” and “SMAC” are used herein interchangeably and refer to the second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI protein. Several SMAC/Diablo variants, generated by alternative splicing, are known in the art, all encompassed within the teachings of the present invention. According to certain embodiments, the terms as used herein refer to a protein having an amino acid sequence at least 80% homologous to the human SMAC/Diablo (hSMAC/Diablo) protein having an amino acids sequence set forth in any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 6, SEQ ID NO:8 and SEQ ID NO:10. According to certain exemplary embodiments, the terms refers to hSMAC/Diablo protein having an amino acids sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO: 6, SEQ ID NO:8 and SEQ ID NO:10.
As used herein, the term “treatment” or “treating” refers to clinical intervention designed to alter the natural course of the individual or cell being treated during the course of clinical pathology, e.g., cancer. Desirable effects of treatment include decreasing the rate of disease progression (delaying progression of a disease), ameliorating or palliating the disease state, and remission or improved prognosis of the disease. For example, an individual is successfully “treated” if one or more symptoms associated with cancer are mitigated or eliminated, including, but are not limited to, reducing the proliferation of cancerous cells, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, delaying the progression of the disease, and/or prolonging survival of individuals.
As used herein, “delaying progression of a disease” means to defer, hinder, slow, retard, stabilize, and/or postpone development of the disease (such as cancer). This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. For example, a late stage cancer, such as development of metastasis, may be delayed.
The terms “cell growth” and “cell proliferation” are used herein interchangeably and refer to the number of viable cells of a particular type observed after a certain growth period.
The terms “inhibit” “decrease”, “reduce” and ‘silence” with regard to the expression or activity of SMAC/Diablo are used herein interchangeably and includes any decrease in expression or protein activity or level of the SMAC/Diablo gene or mRNA or protein encoded by the SMAC/Diablo. According to certain embodiments, inhibition of SMAC/Diablo activity refers to modulation or inhibition of SMAC/Diablo association with partner proteins within the nucleus and/or mitochondria, resulting in an inhibition/decrease/reduction of cell growth (proliferation). The decrease may be of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target gene/mRNA or level of the protein encoded by a gene which has not been targeted by an inhibiting agent and/or as compared to the proliferation rate of cells in which the target gene/mRNA was not silenced or of cells in which the activity of the protein was not modulated.
The terms “polynucleotide”, “nucleic acid sequence”, “polynucleotide sequence” and “oligonucleotide” are used interchangeably herein and refer to an oligomer or polymer of ribonucleic acid (ribo-oligonucleotide or ribo-oligonucleoside) or deoxyribonucleic acid comprising up to about 100-1,000 nucleic acid residues. These terms encompass nucleotide sequences strands composed of naturally-occurring nucleobases, sugars and covalent inter-sugar linkages as well as polynucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted polynucleotides may be preferred over native forms because of the valuable characteristics including, for example, increased stability in the presence of plasma nucleases and enhanced cellular uptake. A polynucleotide may be a polymer of RNA or DNA or hybrid thereof, that is single- or double-stranded, linear or branched, and that optionally contains synthetic, non-natural or altered nucleotide bases. The terms also encompass RNA/DNA hybrids. It is to be explicitly understood that the polynucleotide sequences provided herein can be of DNA or RNA molecules.
“RNA interference (RNAi)” is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target gene results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene, thereby inhibiting expression of the target gene. In some embodiments, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRNA-specific endonuclease Dicer, which promotes cleavage of long dsRNA into double-stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target genes. As used herein, inhibition by RNAi includes any decrease in expression or protein activity or level of the SMAC/Diablo gene or mRNA or protein encoded by the target gene, i.e., SMAC/Diablo. The decrease may be of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target gene or the activity or level of the protein encoded by a target gene which has not been targeted by an RNA interfering agent.
“Small interfering RNA” (siRNA), also referred to herein as “short interfering RNA” is defined as an agent which functions to inhibit expression of a target gene (silencing the gene) e.g., by RNAi. An siRNA may be chemically synthesized, may be produced by in vitro transcription, or may be produced within a host cell. In one embodiment, siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, or 22 nucleotides in length, and may contain a 3′ and/or 5′ overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand. Preferably the siRNA is capable of promoting RNA interference through degradation or specific post-transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA). According to other embodiment, an siRNA is a small hairpin (also called stem loop) RNA (shRNA). In some embodiments, these shRNAs are composed of a short (e.g., 19-25 nucleotides) antisense strand, followed by a 5-9 nucleotide loop, and the analogous sense strand. Alternatively, the sense strand may precede the nucleotide loop structure and the antisense strand may follow. RNA interfering agents, e.g., siRNA molecules, may be administered to a subject having or at risk for having cancer associated with over-expression of SMAC/Diablo, to inhibit expression of SMAC/Diablo, and thereby treat, ameliorate, or inhibit the cancer in the subject.
The terms “construct”, or “RNAi expression construct” are used herein interchangeably to describe an artificially assembled or isolated nucleic acid molecule which includes the polynucleotide of interest. In general, a construct may include the polynucleotide or polynucleotides of interest, a marker gene which in some cases can also be a gene of interest and appropriate regulatory sequences. According to certain embodiments of the invention, the polynucleotide of interest encode siRNA molecule. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The regulatory elements typically include a promoter sequence for directing transcription of the polynucleotide of interest in the cell in a constitutive or inducible manner. The term construct includes vectors but should not be seen as being limited thereto. According to certain embodiments, the term “vector,” is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Another type of vector is a phage vector. Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome (such as an adenoviral vector, a lentiviral vector, etc.). Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell and thereby are replicated along with, the host genome.
The terms “complementary” or “complement thereof” are used herein to refer to the sequence of polynucleotide which is capable of forming Watson & Crick base pairing with another specified polynucleotide throughout the entirety of the complementary region. This term is applied to pairs of polynucleotides based solely upon their sequences and not any particular set of conditions under which the two polynucleotides would actually bind. The terms “substantially complementary” and “sufficiently complementary” are used herein interchangeably. An oligomeric compound need not be 100% complementary to its target nucleic acid to be specifically hybridizable. Moreover, an oligomeric compound may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization (e.g., a bulge, a loop structure or a hairpin, structure). A “non-complementary nucleobase” means a nucleobase of an antisense oligonucleotide that is unable to undergo precise base pairing with a nucleobase at a corresponding position in a target nucleic acid. In some embodiments there are non-complementary positions, also known as “mismatches”, between the oligomeric compound and the target nucleic acid, and such non-complementary positions may be tolerated between an oligomeric compound and the target nucleic acid provided that the oligomeric compound remains substantially complementary to the target nucleic acid.
As used herein, the term “peptide” indicates a sequence of amino acids linked by peptide bonds. Peptides according to some embodiments of the present invention consist of 10-50 amino acids, for example 15-35 amino acids or 20-25 amino acids.
In some embodiments, a peptide according to the present invention is up to 30 amino acids, for example up to 29 amino acids, 28 amino acids, 27 amino acids, 26 amino acids, 25 amino acids, 24 amino acids, 23 amino acids, 22 amino acids, 21 amino acids, 20 amino acids, 19 amino acids, 18 amino acids, 17 amino acids, 16 amino acids, 15 amino acids, 14 amino acids, 13 amino acids, 12 amino acids, 11 amino acids, or up to 10 amino acids. Each possibility represents a separate embodiment of the invention.
The term “amino acid” refers to compounds, which have an amino group and a carboxylic acid group, preferably in a 1,2-1,3-, or 1,4-substitution pattern on a carbon backbone. α-Amino acids are most preferred, and include the 20 natural amino acids (which are L-amino acids except for glycine) which are found in proteins, the corresponding D-amino acids, the corresponding N-methyl amino acids, side chain modified amino acids, the biosynthetically available amino acids which are not found in proteins (e.g., 4-hydroxy-proline, 5-hydroxy-lysine, citrulline, ornithine (Orn), canavanine, djenkolic acid, β-cyanoalanine), and synthetically derived α-amino acids, such as aminoisobutyric acid, norleucine (Nle), norvaline (NorVal, Nva), homocysteine and homoserine. β-Alanine and γ-amino butyric acid are examples of 1,3 and 1,4-amino acids, respectively, and many others as well known to the art.
Some of the amino acids used in this invention are those which are available commercially or are available by routine synthetic methods. Certain residues may require special methods for incorporation into the peptide, and either sequential, divergent or convergent synthetic approaches to the peptide sequence are useful in this invention. Natural coded amino acids and their derivatives are represented by one-letter codes or three-letter codes according to IUPAC conventions. When there is no indication, the L isomer was used. The D isomers are indicated by “D” or “(D)” before the residue abbreviation.
As used herein, an “amino acid residue” means the moiety which remains after the amino acid has been conjugated to additional amino acid(s) to form a peptide, or to a moiety (such as a cell penetrating moiety (CPP) and/or mitochondria and/or nucleus targeting moiety), typically through the alpha-amino and carboxyl of the amino acid.
As used herein, the terms “targeting moiety” and “localization moiety” with reference to targeting of a peptide of the invention to the nucleus and/or mitochondria are used herein interchangeably and refer to a molecule which is able to target the peptide to the specific organelle and facilitate or enhance its penetration into the nucleus or mitochondria. The targeting moiety typically enhances the permeability of the peptide, i.e. its ability to penetrate, pervade, or diffuse through a barrier or membrane, typically a phospholipid membrane. The nucleus and/or mitochondria targeting moiety may also enhance the penetration of the peptide through the plasma membrane. Additionally or alternatively, a cell penetrating moiety (CPP) specifically designed to enhance the permeability of the peptide through the plasma membrane is added to the targeting moiety.
The term “expression”, as used herein, refers to the production of a functional end-product e.g., an mRNA or a protein.
According to one aspect, the present invention provides a method for treating or delaying progression of cancer associated with over-expression of second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI (SMAC/Diablo) in a subject in need thereof, comprising administering to the subject an effective amount of at least one agent that decreases or inhibits the expression of SMAC/Diablo gene and/or protein and/or modulate the protein activity, and/or its interaction with associated proteins (partners).
According to certain embodiments, the agent that decreases or inhibits the expression and/or activity of SMAC/Diablo is selected from the group consisting of an inhibitory nucleic acid, an inhibitory small molecule, an inhibitory polypeptide or peptide and an inhibitory aptamer.
According to certain aspects, the present invention provides a method for treating or delaying progression of cancer associated with over-expression of second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI (SMAC/Diablo) in a subject in need thereof, comprising administering to the subject an effective amount of at least one RNAi molecule, the RNAi molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:12-43.
According to certain embodiments, the method comprises administering an effective amount of an RNAi molecule comprises a nucleic acid sequence set forth in any one of SEQ ID NOs:12-17, 20-25, 28-29, 34-35, and 38-42. Each possibility represents a separate embodiment of the present invention.
Inhibitory Nucleic Acids
According to certain embodiments, the agent is an inhibitory nucleic acid Nucleic acid inhibitors can be used to decrease the expression of SMAC/Diablo gene. Nucleic acid inhibitors include a siRNA, a dsRNA, a ribozyme, a triple-helix former, an aptamer, or an antisense nucleic acid. siRNAs are small double stranded RNAs (dsRNAs) as described hereinabove. Antisense agents can include, for example, from about 8 to about 80 nucleobases (i.e. from about 8 to about 80 nucleotides), e.g., about 8 to about 50 nucleobases, or about 12 to about 30 nucleobases. Antisense compounds include ribozymes, external guide sequence (EGS) oligonucleotides, and other short catalytic RNAs or catalytic oligonucleotides which hybridize to the target nucleic acid and modulate its expression. Antisense compounds can include a stretch of at least eight consecutive nucleobases that are complementary to a sequence in the target gene.
According to certain embodiments, the inhibitory nucleic acid comprises at least 15 consecutive nucleic acids substantially identical to a gene or mRNA at least 80% homologous to the gene or mRNA encoding human SMAC/Diablo (hSMAC/Diablo) protein or to a complementary polynucleotide thereof.
According to certain embodiments, the inhibitory nucleic acid is targeted to a SMAC/Diablo encoding gene comprising a nucleic acid sequence at least 80%, at least 85%, at least 90%, at least 95% or more homologous to the nucleic acid sequence set forth in SEQ ID NO:1 (NG_029459.1).
According to certain embodiments, the hSMAC/Diablo protein is selected from the group consisting of SMAC/Diablo-α, having the amino acid sequence set forth in SEQ ID NO:2; SMAC/Diablo-δ, having the amino acid sequence set forth in SEQ ID NO:4; SMAC/Diablo-β, having the amino acid sequence set forth in SEQ ID NO:6; SMAC/Diablo-4, having the amino acid sequence set forth in SEQ ID NO:8; and SMAC/Diablo-γ, having the amino acid sequence set forth in SEQ ID NO:10. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the hSMAC/Diablo-α is encoded by the nucleic acid sequence having SEQ ID NO:3; hSMAC/Diablo-δ is encoded by the nucleic acid sequence having SEQ ID NO:5; hSMAC/Diablo-β is encoded by the nucleic acid sequence having SEQ ID NO:7; hSMAC/Diablo-4 is encoded by the nucleic acid sequence having SEQ ID NO:9; and hSMAC/Diablo-γ is encoded by the nucleic acid sequence having SEQ ID NO:11. Each possibility represents a separate embodiment of the present invention.
The nucleic acid agents of the present invention are of at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 at least 18, at least 19, at least 20, or at least 21 bases specifically hybridizable with SMAC/Diablo RNA, but excluding the full length SMAC/Diablo transcript or known variants thereof. The SMAC/Diablo-silencing oligonucleotides of the invention are preferably no more than about 1000 bases in length, more preferably no more than about 100 bases in length. In other preferable embodiments, the oligonucleotides are no more than 30 nucleotides (or base pairs) in length.
According to certain embodiments, the RNAi molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:12-43.
According to certain exemplary embodiments, the SMAC/Diablo inhibitory nucleic acid is siRNA molecule selected from the group consisting of:
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:12 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:13;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:14 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:15;
siRNA comprising a first sense strand having the nucleic acid sequence set forth in SEQ ID NO:16 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:17; and
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:18 and second polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:19.
According to certain embodiments, the hSMAC/Diablo protein is hSMAC/Diablo-β having the amino acid sequence set forth in SEQ ID NO:6, encoded by the nucleic acid sequence set forth in NO:7. According to these embodiments, wherein the inhibitory nucleic acid is siRNA molecule, the siRNA molecule is selected from the group consisting of siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and second polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:23; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25; and siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:26 and an anti sense strand having the nucleic acid sequence set forth in SEQ ID NO:27.
According to certain embodiments, the hSMAC/Diablo protein is hSMAC/Diablo-δ having the amino acid sequence set forth in SEQ ID NO:4, encoded by the nucleic acid sequence set forth in SEQ ID NO:5. According to these embodiments, wherein the inhibitory nucleic acid is siRNA molecule, the siRNA molecule is selected from the group consisting of siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:20 and an anti sense strand having the nucleic acid sequence set forth in SEQ ID NO:21; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:23; and siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25.
According to certain embodiments, the hSMAC/Diablo protein is hSMAC/Diablo-4 having the amino acid sequence set forth in SEQ ID NO:8, encoded by the nucleic acid sequence set forth in SEQ ID NO:9. According to these embodiments, wherein the inhibitory nucleic acid is siRNA molecule, the siRNA molecule is selected from the group consisting of siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:23; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25; and siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:26 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:27.
According to certain embodiments, the hSMAC/Diablo protein is hSMAC/Diablo-γ having the amino acid sequence set forth in SEQ ID NO:10, encoded by the nucleic acid sequence set forth in SEQ ID NO:11. According to these embodiments, wherein the inhibitory nucleic acid is siRNA molecule, the siRNA molecule is selected from the group consisting of siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:23; and siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25.
In some embodiments, the sense and antisense strands of the present siRNA can comprise two complementary, single-stranded RNA molecules or can comprise a single molecule in which two complementary portions are base-paired and are covalently linked by a single-stranded “hairpin” area. Without wishing to be bound by any theory, it is believed that the hairpin area of the latter type of siRNA molecule is cleaved intracellularly by the “Dicer” protein (or its equivalent) to form a siRNA of two individual base-paired RNA molecules.
Preferably, one or both strands of the siRNA of the invention can also comprise a 3′ overhang. As used herein, a “3′ overhang” refers to at least one unpaired nucleotide extending from the 3′-end of an RNA strand. Thus in one embodiment, the siRNA of the invention comprises at least one 3′ overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length. In the embodiment in which both strands of the siRNA molecule comprise a 3′ overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3′ overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the siRNA of the invention can comprise 3′ overhangs of dithymidylic acid (“TT”) or diuridylic acid (“UU”).
As illustrated in the Example section hereinbelow, exemplary siRNA oligonucleotides of the present invention are 19 to 21 base pairs in length with two 3′ overhang on each strand, selected from the group consisting of:
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:20 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:21;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:23;
siRNA comprising a first sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25; and
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:26 and second polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:27.
While a preferable embodiment of the invention is directed to double-stranded siRNA molecules wherein the two 3′ nucleotides are deoxythymidine residues (SEQ ID Nos. 20-27), it is to be understood that other modifications are within the scope of the present invention. Thus, the use of analogs, variants and derivatives of the sequences set forth in any one of SEQ ID NOS: 12-27 is contemplated, as long as the inhibitory activity of the SMAC/Diablo expression is retained. For example, in a particular embodiment, the siRNA may contain 2′-O-methyl and/or phosphorothioate substituent nucleotides. According to certain exemplary embodiments, the siRNA may contain 2′-O-methyl (2′-O-ME) modification. According to these embodiments, the siRNA is selected from the group consisting of siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:28 and an antisense strand having the nucleic acid sequence set forth in SEQ ID N0:29; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:30 and an antisense strand having the nucleic acid sequence set forth in SEQ ID N0:31; siRNA comprising a first sense strand having the nucleic acid sequence set forth in SEQ ID NO:32 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:33; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:34 and second polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:35; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:36 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:37; siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:38 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:39; siRNA comprising a first sense strand having the nucleic acid sequence set forth in SEQ ID NO:40 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:41; and siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:42 and second polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:43.
In other particular embodiments, the siRNA is a variant, homolog or derivative of any one of SEQ ID NOs:12-27.
As used herein, the term “variant” refers to substantially similar sequences possessing common qualitative biological activities. An oligonucleotide variant includes a pharmaceutically acceptable salt, homolog, analog, extension or fragment of a nucleotide sequence useful for the invention. Encompassed within the term “variant” are chemically modified natural and synthetic nucleotide molecules (derivatives). Also encompassed within the term “variant” are substitutions, additions or deletions within the nucleotide sequence of the molecule, as long as the required function is sufficiently maintained. Oligonucleotide variants may share at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity (homology). In different embodiments, “homolog” may refer e.g. to any degree of homology disclosed herein.
Another agent capable of silencing the expression of a SMAC/Diablo RNA is a DNAzyme molecule capable of specifically cleaving its encoding polynucleotides. DNAzymes are single-stranded nucleic acid agents which are capable of cleaving both single and double stranded target sequences. A general model (the “10-23” model) for the DNAzyme has been proposed. “10-23” DNAzymes have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate-recognition domains of seven to nine deoxyribonucleotides each. This type of DNAzyme can effectively cleave its substrate RNA at purine:pyrimidine junctions (for a review of DNAzymes see Khachigian, L. M. 2002. Curr Opin Mol Ther 4, 119-21). Examples of construction and amplification of synthetic, engineered DNAzymes recognizing single and double-stranded target cleavage sites have been disclosed in U.S. Pat. No. 6,326,174.
Another agent capable of silencing SMAC/Diablo is a ribozyme molecule capable of specifically cleaving its encoding polynucleotides. Ribozymes are being increasingly used for the sequence-specific inhibition of gene expression by the cleavage of mRNAs encoding proteins of interest (Welch et al., 1998. Curr Opin Biotechnol. 9:486-96). The possibility of designing ribozymes to cleave any specific target RNA has rendered them valuable tools in both basic research and therapeutic applications. In the therapeutics area, ribozymes have been exploited to target viral RNAs in infectious diseases, dominant oncogenes in cancers and specific somatic mutations in genetic disorders. Most notably, several ribozyme gene therapy protocols for HIV patients are already in Phase 1 trials. More recently, ribozymes have been used for transgenic animal research, gene target validation and pathway elucidation. Several ribozymes are in various stages of clinical trials. ANGIOZYME was the first chemically synthesized ribozyme to be studied in human clinical trials. ANGIOZYME specifically inhibits formation of the VEGF-r (Vascular Endothelial Growth Factor receptor), a key component in the angiogenesis pathway. Ribozyme Pharmaceuticals, Inc., as well as other firms has demonstrated the importance of anti-angiogenesis therapeutics in animal models. HEPTAZYME, a ribozyme designed to selectively destroy Hepatitis C Virus (HCV) RNA, was found effective in decreasing Hepatitis C viral RNA in cell culture assays (Ribozyme Pharmaceuticals, Incorporated—http://www.rpi.com/index.html).
An additional method of silencing SMAC/Diablo is via triplex forming oligonucleotides (TFOs). In the last decade, studies have shown that TFOs can be designed which can recognize and bind to polypurine/polypirimidine regions in double-stranded helical DNA in a sequence-specific manner. Thus the DNA sequence encoding the SMAC/Diablo RNA of the present invention can be targeted thereby down-regulating the RNA molecule.
The recognition rules governing TFOs are outlined e.g. by EP Publication 375408. Modification of the oligonucleotides, such as the introduction of intercalators and backbone substitutions, and optimization of binding conditions (pH and cation concentration) have aided in overcoming inherent obstacles to TFO activity such as charge repulsion and instability, and it was recently shown that synthetic oligonucleotides can be targeted to specific sequences (for a recent review see Seidman and Glazer, 2003. J Clin Invest; 112:487-94).
In general, the triplex-forming oligonucleotide has the sequence correspondence:
However, it has been shown that the A-AT and G-GC triplets have the greatest triple helical stability. The same authors have demonstrated that TFOs designed according to the A-AT and G-GC rule do not form non-specific triplexes, indicating that the triplex formation is indeed sequence specific.
Thus for any given sequence in the regulatory region a triplex forming sequence may be devised. Triplex-forming oligonucleotides preferably are at least 15, more preferably 25, still more preferably 30 or more nucleotides in length, up to 50 or 100 bp.
Transfection of cells (for example, via cationic liposomes) with TFOs, and subsequent formation of the triple helical structure with the target DNA, induces steric and functional changes, blocking transcription initiation and elongation, allowing the introduction of desired sequence changes in the endogenous DNA and results in the specific downregulation of gene expression. In addition, Vuyisich and Beal have recently shown that sequence specific TFOs can bind to dsRNA, inhibiting activity of dsRNA-dependent enzymes such as RNA-dependent kinases (Vuyisich and Beal, 2000. Nuc. Acids Res 28:2369-74). Additionally, TFOs designed according to the abovementioned principles can induce directed mutagenesis capable of effecting DNA repair, thus providing both downregulation and upregulation of expression of endogenous genes (Seidman and Glazer, 2003, ibid). Detailed description of the design, synthesis and administration of effective TFOs can be found in U.S. Patent Application Nos. 2003/017068; 2003/0096980; 2002/0128218 and 2002/0123476 and U.S. Pat. No. 5,721,138.
It will be appreciated that nucleic acid agents capable of hybridizing SMAC/Diablo RNA may down-regulate an activity thereof by preventing SMAC/Diablo RNA binding to another downstream agent.
The inhibitory acid agents of the present invention (e.g., an siRNA molecule such as those set forth by any one of SEQ ID NOs:12-27) can be directly administered to the subject or can be expressed within the subject cell. To express such an agent (i.e., to produce an RNA molecule) in mammalian cells, a nucleic acid sequence encoding the agents of the present invention is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence and additional regulatory elements for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner. The nucleic acid construct may preferably include additional sequences to form an expression vector suitable for replication and/or integration in eukaryotes, and preferably also in prokaryotes.
The type of vector may be selected e.g. for producing single-stranded or double-stranded RNA or DNA. Suitable vectors for producing various silencing oligonucleic acids are known in the art. For example, RNAi expression vectors (also referred to as a dsRNA-encoding plasmid) are replicable nucleic acid constructs used to express (transcribe) RNA which produces siRNA moieties in the cell in which the construct is expressed. Such vectors include a transcriptional unit comprising an assembly of (1) genetic element(s) having a regulatory role in gene expression, for example, promoters, operators, or enhancers, operatively linked to (2) a “coding” sequence which is transcribed to produce a double-stranded RNA (two RNA moieties that anneal in the cell to form an siRNA, or a single hairpin RNA which can be processed to an siRNA), and (3) appropriate transcription initiation and termination sequences.
Some of these vectors have been engineered to express small hairpin RNAs (shRNAs), which get processed in vivo into siRNA-like molecules capable of carrying out gene-specific silencing. Another type of siRNA expression vector encodes the sense and antisense siRNA strands under control of separate pol III promoters. The siRNA strands from this vector, like the shRNAs of the other vectors, have 3′ thymidine termination signals. Silencing efficacy by both types of expression vectors was comparable to that induced by transiently transfecting siRNA.
Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used.
Various vectors for delivering and expressing silencing RNA molecules such as siRNAs are known in the art, and include for example plasmid vectors, inducible vectors, adenoviral vectors, retroviral vectors and lentiviral vectors and CMV-based vectors. Exemplary vectors include pSilencer™ vectors (Ambion), Genescript siRNA vectors, Imagenex vectors (e.g. IMG-1000, IMG-700 and IMG-1200), among others.
Various methods can be used to introduce the expression vector of the present invention into cells. Such methods are generally described in Sambrook et al, (1989, 1992), in Ausubel et al., (1989), Chang et al., (1995), Vega et al., (1995), and Gilboa et at. (1986), and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
Useful lipids for lipid-mediated transfer of the RNA inhibitory molecule of the invention or construct comprising same are, for example, DOTMA, DOPE, and DC-Chol (Tonkinson et al., 1996. Cancer Investigation, 14(1): 54-65). Other vectors can be used, such as cationic lipids, polylysine, and dendrimers.
Other than containing the necessary elements for the transcription of the inserted coding sequence, the expression construct of the present invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed RNA.
According to another aspect, the present invention provides an isolated SMAC/Diablo silencing molecule selected from the group consisting of:
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:14 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:15;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:16 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:17;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:18 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:19;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:22 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:23;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:24 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:25;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:26 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:27;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:28 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:29;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:30 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:31;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:32 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:33;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:34 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:35;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:36 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:37;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:38 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:39;
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:40 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:41; and
siRNA comprising a sense strand having the nucleic acid sequence set forth in SEQ ID NO:42 and an antisense strand having the nucleic acid sequence set forth in SEQ ID NO:43. Each possibility represents a separate embodiment of the present invention.
According to certain aspects, the present invention provides a method for treating or delaying progression of cancer associated with over-expression of second mitochondria-derived activator of caspase/direct inhibitor of apoptosis-binding protein with low pI (SMAC/Diablo) in a subject in need thereof, comprising administering to the subject an effective amount of at least one peptide conjugate comprising a peptide derived from SMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a mitochondria and/or nucleus targeting moiety.
According to certain embodiments, the method comprises administering an effective amount of a peptide conjugate comprising the amino acid sequence set forth in any one of SEQ ID NOs:69-71 and 73-74. Each possibility represents a separate embodiment of the present invention.
Inhibitory Peptides
The present invention discloses novel peptides derived from proteins that interact with SMAC/Diablo. When the peptide derived from SMAC/Diablo-interacting protein is targeted into the cell and further into the nucleus and/or the mitochondria, such that the interaction with hSMAC/Diablo occurs within the organelle(s), the interaction results in inhibition or intervention with at least one of phospholipid biosynthesis, cell growth, cell proliferation and any combination thereof.
According to further embodiments of the invention, the agent that inhibits the activity of SMAC/Diablo is an inhibitory peptide targeted to the nucleus and/or to the mitochondria of a cell overexpressing SMAC/Diablo.
According to certain embodiments, the inhibiting molecule is a peptide conjugate comprising a peptide derived from SMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a mitochondria and/or nucleus targeting moiety. The mitochondria and/or nucleus targeting moiety can be peptidic or non-peptidic, and is covalently linked to the peptide derived from SMAC/Diablo-interacting protein directly or via linker. The targeting moiety may be linked to the peptide derived from SMAC/Diablo-interacting protein at any position. According to some embodiments, the targeting moiety is linked to the N- or the C-terminus of the peptide derived from SMAC/Diablo-interacting protein. When the conjugate comprises a combination of mitochondria and nucleus targeting moieties each moiety may be independently linked to the N- or C-terminus of the peptide or the mitochondria and nucleus targeting moieties can be linked in tandem to the N- or C-terminus of the peptide. According to certain exemplary embodiments, each of the nucleus and mitochondria targeting moiety also enhances the permeability of the peptide conjugate through the cell membrane.
The peptides derived from SMAC/Diablo-interacting proteins and/or the peptide conjugate can be synthetic or recombinant.
According to certain embodiments, the nucleus and/or mitochondria targeting moiety enhances the permeability of the peptide derived from SMAC/Diablo-interacting protein through the nuclear or mitochondrial membrane, respectively, and typically also through the cell membrane.
According to certain embodiments, the C-terminus of the peptide conjugate is a modified carboxy terminal group selected from the group consisting of an amide, ester and alcohol group. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the peptide conjugate comprises a peptide derived from hSMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a nucleus targeting moiety.
According to certain embodiments, the peptide conjugate comprises a peptide derived from hSMAC/Diablo-interacting protein having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, analogs, derivatives and/or fragments thereof, and a mitochondria targeting moiety.
According to some embodiments, the peptide conjugate comprises an amino acid sequence selected from the group consisting of SEQ ID NO:69; SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:73; and SEQ ID NO:74. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the peptide conjugate further comprises at least one additional moiety selected from the group consisting of cell penetration moiety, a detectable label and a carrier. Each possibility represents a separate embodiment of the present invention. In some embodiments, the cell penetration moiety is a fatty acid residue. The additional moiety can be linked to the peptide conjugate directly or via a linker. Each possibility represents a separate embodiment of the present invention.
According to some embodiments, the conjugated peptides of the present invention comprise a cell penetrating moiety.
In some embodiments, the amino terminus of the peptides disclosed herein is modified. In some embodiments, the amino terminal modification is addition of a cell penetration moiety.
In some embodiments, the carboxy terminus of the conjugated peptides disclosed herein is modified. In some embodiments, the carboxy terminal modification is addition of a permeability-enhancing moiety.
Non-limitative examples of cell permeability moieties include hydrophobic moieties such as lipids, fatty acids, steroids and bulky aromatic or aliphatic compounds. According to certain embodiments, the cell penetrating moiety is a peptide (CPP).
In some embodiments, the cell permeability moiety is covalently linked to the N- or C-terminus of the peptide conjugate via a direct bond. In other embodiments, the cell permeability moiety is covalently linked to the N- or C-terminus of the peptide via a linker. In some embodiments, the cell permeability moiety is a fatty acid residue. In some embodiments, the fatty acid residue is selected from C12-C20 fatty acids. In some particular embodiments, the fatty acid residue is a myristoyl group (Myr). In additional particular embodiments, the fatty acid residue is a stearoyl group (Stear). In yet additional embodiments, the fatty acid residue is a palmitoyl group (Palm).
In some embodiments, the peptide-conjugate amino terminus is modified with an amino terminal blocking group. In some embodiments, the amino terminal blocking group is selected from the group consisting of an acetyl and alkyl. Each possibility represents a separate embodiment of the present invention.
In some embodiments, the carboxy terminus of the peptide conjugates disclosed herein is modified. In some embodiments, the carboxy terminus is modified with a carboxy terminal group. In some embodiments, the carboxy terminal group is selected from the group consisting of amide, ester and alcohol group. Each possibility represents a separate embodiment of the present invention. In some particular embodiments, the carboxy terminal group is an amide group.
The procedures utilized to construct peptide compounds of the present invention generally rely on the known principles and methods of peptide synthesis, such as solid phase peptide synthesis, partial solid phase synthesis, fragment condensation and classical solution synthesis.
Some of the peptides of the present invention, that do not comprise non-coded amino acids, can be synthesized using recombinant methods know in the art. Peptide conjugates may be synthesized chemically or alternatively may be produced recombinantly and coupled synthetically with the conjugating moiety.
The peptides of the invention can be used in the form of pharmaceutically acceptable salts. As used herein the term “salts” refers to both salts of carboxyl groups and to acid addition salts of amino or guanido groups of the peptide molecule. The term “pharmaceutically acceptable” means suitable for administration to a subject, e.g., a human. For example, the term “pharmaceutically acceptable” can mean approved by a regulatory agency of the Federal or a state government or listed in the U. S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. Pharmaceutically acceptable salts include those salts formed with free amino groups such as salts derived from non-toxic inorganic or organic acids such as acetic acid, citric acid or oxalic acid and the like, and those salts formed with free carboxyl groups such as salts derived from non-toxic inorganic or organic bases such as sodium, calcium, potassium, ammonium, calcium, ferric or zinc, isopropylamine, triethylamine, procaine, and the like.
Analogs and derivatives of the peptides are also within the scope of the present application.
“Derivatives” of the peptides of the invention as used herein cover derivatives which may be prepared from the functional groups which occur as side chains on the residues or the N- or C-terminal groups, by means known in the art, and are included in the invention as long as they remain pharmaceutically acceptable, i.e., they do not destroy the activity of the peptide, do not confer toxic properties on compositions containing it, and do not adversely affect the immunogenic properties thereof.
These derivatives may include, for example, aliphatic esters of the carboxyl groups, amides of the carboxyl groups produced by reaction with ammonia or with primary or secondary amines, N-acyl derivatives of free amino groups of the amino acid residues, e.g., N-acetyl, formed by reaction with acyl moieties (e.g., alkanoyl or carbocyclic aroyl groups), or 0-acyl derivatives of free hydroxyl group (e.g., that of seryl or threonyl residues) formed by reaction with acyl moieties.
“Analogs” of the peptides of the invention as used herein cover compounds which have the amino acid sequence according to the invention except for one or more amino acid changes, typically, conservative amino acid substitutions.
In some embodiments, an analog has at least about 75% identity to the sequence of the peptide of the invention, for example at least about 80%, at least about 85%, at least about 90%, at least about 99% identity to the sequence of the peptide of the invention.
Conservative substitutions of amino acids as known to those skilled in the art are within the scope of the present invention. Conservative amino acid substitutions include replacement of one amino acid with another having the same type of functional group or side chain e.g. aliphatic, aromatic, positively charged, negatively charged.
Conservative substitution tables providing functionally similar amino acids are well known in the art.
The following six groups each contain amino acids that are conservative substitutions for one another:
1) Alanine (A), Serine (S), Threonine (T);
2) Aspartic acid (D), Glutamic acid (E);
3) Asparagine (N), Glutamine (Q);
4) Arginine (R), Lysine (K), Histidine (H);
5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and
6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W).
Analogs according to the present invention may comprise also peptidomimetics. “Peptidomimetic” means that a peptide according to the invention is modified in such a way that it includes at least one non-coded residue or non-peptidic bond. Such modifications include, e.g., alkylation and more specific methylation of one or more residues, insertion of or replacement of natural amino acid by non-natural amino acids, replacement of an amide bond with another covalent bond. A peptidomimetic according to the present invention may optionally comprise at least one bond which is an amide replacement bond such as urea bond, carbamate bond, sulfonamide bond, hydrazine bond, or any other covalent bond. The design of appropriate analogs may be computer assisted. Analogs are included in the invention as long as they remain pharmaceutically acceptable and their activity is not damaged.
The inhibitory agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.
According to yet additional aspect, the present invention provides an isolated synthetic or recombinant peptide having an amino acid sequence at least 80% homologous to an amino acid sequence selected from the group consisting of SEQ ID NOs:46-67, an analog, derivative or a fragment thereof, wherein the peptide is capable of binding to human SMAC/Diablo. According to certain embodiments, the peptide comprises the amino acid sequence set forth in any one of SEQ ID NOs:46-67. Each possibility represents a separate embodiment of the present invention.
According to certain embodiments, the peptide further comprises a nucleus and/or mitochondria targeting moiety. The nucleus or mitochondria targeting moiety can be linked to the peptide at any position, typically at the N- or at the C-terminus, directly or via a linker. According to some embodiments, the conjugate further comprises a cell-penetrating moiety.
According to certain embodiments, the present invention provides a synthetic or recombinant peptide having the amino acid sequence set forth in SEQ ID NO:69.
According to certain embodiments, the present invention provides a synthetic or recombinant peptide having the amino acid sequence set forth in SEQ ID NO:70.
According to certain embodiments, the present invention provides a synthetic or recombinant peptide having the amino acid sequence set forth in SEQ ID NO:71.
According to certain embodiments, the present invention provides a synthetic or recombinant peptide having the amino acid sequence set forth in SEQ ID NO:73.
According to certain embodiments, the present invention provides a synthetic or recombinant peptide having the amino acid sequence set forth in SEQ ID NO:74.
Pharmaceutical Compositions
The agents of the present invention can be administered to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients.
As used herein a “pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
Herein the term “active ingredient” refers to the agent accounting for silencing the expression of SMAC/Diablo and/or modulating its activity within a nucleus or mitochondria of a cancerous cell overexpressing SMAC/Diablo. According to certain exemplary embodiments, the active ingredient of the invention inhibits the proliferation of cancerous cell and/or reduces the growth of a tumor in cancers wherein SMAC/Diablo is overexpressed.
Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
Herein the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.
Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal or parenteral delivery, including intramuscular, subcutaneous and intramedullary injections as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, or intranasal injections.
Alternately, one may administer the pharmaceutical composition in a local rather than systemic manner, for example, by intra-articular injections or by microinjections, under arthroscopy, into the inflammatory synovial tissue (i.e. in situ).
Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
For oral administration, the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient. Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
Pharmaceutical compositions which can be used orally include push-fit capsules made of gelatin as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain the active ingredients in admixture with filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
For administration by nasal inhalation, the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane or carbon dioxide. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, e.g., gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.
Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water based solution, before use.
The pharmaceutical composition of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, e.g., conventional suppository bases such as cocoa butter or other glycerides.
Preferably the pharmaceutical composition can also include DOTMA, DOPE, and DC-Chol (Tonkinson et al., 1996, ibid) as transfection agents or as additives to transfection agents neutralizing the negative charge of the nucleotides in the RNA inhibiting molecules. A preferred example of a transfection agent is poly(ethylamine) (PEI).
Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (nucleic acid agent) effective to prevent, alleviate or ameliorate symptoms of a disorder or prolong the survival of the subject being treated.
Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. The data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975. In: “The Pharmacological Basis of Therapeutics”, Ch. 1 p. 1).
Dosage amount and interval may be adjusted individually to provide plasma levels of the active ingredient are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
Depending on the severity and responsiveness of the condition to be treated, dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as the U.S. Food and Drug Administration (FDA) approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.
The present invention demonstrates over-expression of SMAC/Diablo in many types of cancer, additional to those reported in other studies (Bao, S. T., et al., 2006, ibid; Arellano-Llamas, A., et al., 2006, ibid; Yoo, N. J., et al., 2003, ibid; Shintani, M., et al., 2014 ibid; Kempkensteffen, C., et al., 2008, ibid; and Shibata, T., et al., 2007. Diagn Mol Pathol 16, 1-8). This is unexpected in view of the pro-apoptotic activity of the protein, which promotes caspase activation by binding IAPB. The present invention demonstrates that silencing SMAC/Diablo expression in various cancer cell lines over-expressing SMAC/Diablo inhibited their growth, and, furthermore, in lung cancer xenografts inhibited tumor growth and resulted in the formation of glandular alveoli-like structures, and morphological changes indicative of cell differentiation. Cell growth inhibition was not observed in non-cancerous cell lines, although SMAC/Diablo expression was inhibited. Inhibition of the cancer-cell growth as a result of SMAC/Diablo silencing, but not in non-cancerous cells, implies for an important functional role of the protein in cancer. The results presented herein implies for SMAC/Diablo as an important regulator of phospholipids transport and synthesis,
The present study has taken several approaches to elucidate the molecular mechanism underlying the effects of reducing hSMAC levels in lung A549-derived tumors, including immunoblotting, immunohistochemistry, electron microscopy, q-PCR, NGS and functional analysis of the data. SMAC/Diablo-silencing resulted in reduction of Ki-67, a cellular marker of proliferation, both in culture (
Ki-67 protein is detected during all cell cycle phases, other than resting G0 phase. During S phase, Ki-67 protein levels markedly increased, with these levels being maintained in interphase and M-phase (Brunu S. et al., 1992. Cell Prolif 25, 31-40). In addition, cells treated with si-hSMAC were arrested in S phase, reflected by inhibition of BrdU incorporation and decreased DNA content in the si-hSMAC-TTs (
SMAC/Diablo silencing in tumors resulted in a widely altered expression of genes associated with the extracellular matrix, the cell-secreted collagen and proteoglycan matrix overlying endothelial and epithelial cells, extracellular exosomes, and proteins in the ER and Golgi lumen associated with vesicle formation (
As described hereinbelow, SMAC/Diablo silencing is also associated with a modified expression of transporters of metabolites, ions, and enzymes involved in metabolism (
Morphological analysis of A549-derived tumor sections demonstrated structural reorganization of section derived from si-hSMAC-A-treated tumors (si-hSMAC-A-TTs) into glandular, alveolar-like clusters. These structures resembled normal lung alveoli with respect to the arrangement of endothelial cells and macrophages, as visualized by anti-CD-31 (
A549 cells are non-small cells lung carcinoma cell line, derived from primary tumor. A549 is characterized, as the pre-Alveolar Type II pneumocytes (AT2) of the human lung by expression of high numbers of multilamellar bodies (Foster K. A. et al., 1998. Exp Cell Res, 243, 359-366). While AT1 cells are flattened squamous cells accounting for ˜95% of the alveolar surface and lie adjacent to capillary endothelial cells to form the pulmonary gas exchange region (
Further support for the differentiation of cells in the residual “tumor” in si-hSMAC-A-TTs is provided by the NGS data analysis showing up-regulation of genes associated with ion transport (
Without wishing to be bound by any theory or mechanism of action, these changes in si-hSMAC-TTs may reflect functional changes with respect to airway surface liquid hydration and the clearance associated with the maturation or/and differentiation of A549 to normal-like lung cells.
Cancer progression is associated with stromal activity, characterized by increased deposition of collagen isoforms, laminin and fibronectin, and by heparan sulphate production, as well as of extracellular matrix (ECM) degradative enzymes and metalloproteinases (MMPs). Reduction of SMAC/Diablo levels in tumors also altered stromal formation (
Immunofluorescent of staining si-NT-TTs showed the presence of SMAC in the nucleus (
Ultrastructure analysis of si-NT-TTs and si-hSMAC-A-TTs using EM clearly demonstrated marked changes in intracellular organelles, including the nucleus (
As demonstrated herein, the expression levels of many genes associated with the formation of vesicle mediating intra- and extra-cellular transport and related to organelles, such as the ER and Golgi and to exosomes, were modified (
The presence of phospholipids in chromatin and the nuclear matrix and the roles of nuclear phospholipids in the structural organization of chromatin and nucleic acid synthesis have been demonstrated (Alessenko, A. V., and Burlakova, E. B. 2002. Bioelectrochemi 58, 13-21). As intra-nuclear phospholipids regulate DNA replication (Maraldi et al. 1993, ibid) changes seen in the expression of many genes upon silencing SMAC/Diablo expression (Tables 3-5) may result from the decrease in phospholipids levels in the cell (
Interestingly, SMAC/Diablo has been shown to interact with two nuclear proteins, the aryl hydrocarbon receptor nuclear translocator (ARNT), also known as the oxygen-independent β subunit of hypoxia-inducible factors (HIF-1β) and the Mastermind-like transcriptional co-activator MAML (Wang J et al. 2011. Mol Syst Biol 7, 536). To execute their transcriptional function, HIF factors must form a heterodimer between an oxygen-dependent α subunit (HIF-1α or HIF-2α) and an oxygen-independent subunit (HIF-1β). The HIF-2α-ARNT dimer is involved in cellular adaptation to the oxygen stress related to tumor growth and progression. ARNT is also required for nuclear localization of the transcriptional repressors NPAS1 and NPAS3 (The C H et al., 2006. J Biol Chem 281, 34617-34629). MAML2, as a transcriptional co-activator, plays an important role in Notch signaling, regulating multiple developmental pathways (McElhinny A S et al., 2008. Oncogene 27, 5138-5147). MAML2 binds to proteins such as a cyclic AMP response element-binding protein (CREB or CBP).
Thus, as nuclear SMAC/Diablo binds HIF-1β (ARNT) and MAML2, it may compete with HIF-1α, HIF-2α, NPAS1, or NPAS3 binding to ARNT. Similarly, by binding MAML2, SMAC/Diablo may interfere with interactions of MAML2 with CBP.
Without wishing to be bound by any specific theory or mechanism of action, silencing the expression of SMAC/Diablo by the RNAi molecules of the invention, or interfering with its binding capacity to HIF-1β (ARNT) and/or MAML2 within the nucleus by the peptides of the invention, together with SMAC/Diablo-mediated regulation of phospholipid synthesis and given how nuclear phospholipids control nuclear structure and function, explains the effect of SMAC/Diablo on multiple signaling pathways and on proliferation of cancerous cells.
The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
Materials and Methods
Materials
The cell transfection agents JetPRIME and JetPEI were from PolyPlus transfection (Illkirch, France), SMAC/Diablo-siRNA were obtained from Genepharma (Suzhou, China). Propidium iodide (PI), sulforhodamine B (SRB), Triton X-100, Tween-20 were obtained from Sigma (St. Louis, Mo.). Paraformaldehyde was purchased from Emsdiasum (Hatfield, Pa.). Dulbecco's modified Eagle's medium (DMEM) was obtained from Gibco (Grand Island, N.Y.). Normal goat serum (NGS) and the supplements fetal calf serum (FCS), L-glutamine and penicillin-streptomycin were obtained from Biological Industries (Beit Haemek, Israel). Horseradish peroxidase (HRP)-conjugated anti-mouse, anti-rabbit and anti-goat antibodies were from KPL (Gaithersburg, Md.). Primary antibodies, their source, and the dilutions used are detailed in Table 1 herein below. A CellTiter-Glo luciferase-based assay and TUNEL stain was obtained from Promega (Madison, Wis.). 3,3-diaminobenzidine (DAB) was obtained from (ImmPact-DAB, Burlingame, Calif.).
Cell Culture and Transfection
HeLa (human cervical carcinoma) cells, A549 (non-small lung carcinoma) cells, MCF-7 (human breast carcinoma) cells, PC3 (prostate cancer) cells, HepG2 (human hepatocellular carcinoma), MDA-MB-231 (human breast carcinoma), PANC-1 (human pancreatic carcinoma), HTB-72 (SK-MEL-28) (human melanoma), U-87MG (human glioblastoma), U-118MG (human glioblastoma) cells and non-cancerous HaCaT (spontaneously transformed aneuploid immortal keratinocyte cell line from adult human skin), HEK-293 (human embryonic kidney), TREx-293 (human Embryonic kidney), PGA (mouse primary glia and astrocyte) cells were grown in DMEM culture medium and H358 (non-small cell lung cancer), THP1 (human Leukemic monocyte), KG-1α (acute myeloid leukemia) and WI38 (fibroblast derived human lung) cells were grown in RPMI-1640 and EMEM culture medium supplemented with 10% FCS, 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, 1 mM sodium pyruvate and non-essential amino acids, and maintained in a humidified atmosphere at 37° C. with 5% CO2.
RNA Sequences
SMAC/Diablo Human Specific siRNA used include:
si-hSMAC-A1: Sense 5′AAGCGGUGUUUCUCAGAAUUGtt3′, wherein the nucleotides at positions 5, 10, 16 and 21 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:28) and antisense 5′AACAAUUCUGAGAAACCCGCtt3′ wherein the nucleotides at positions 6, 12, and 19 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:29);
si-hSMAC-A2: Sense 5′AAGCGGUGUUUCUCAGAAUUGtt3′, wherein the nucleotides at positions 6, 9, and 21 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:30) and antisense 5′AACAAUUCUGAGAAACCCGCtt3′ wherein the nucleotides at positions 7 and 12 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:31);
si-hSMAC-A3: Sense 5′AAGCGGUGUUUCUCAGAAUUGtt3′, wherein the nucleotides at positions 3, 7, 11, and 16 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:32) and antisense 5′AACAAUUCUGAGAAACCCGCtt3′ wherein the nucleotides at positions 6, 10 and 19 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:33);
si-hSMAC-A4: Sense 5′AAGCGGUGUUUCUCAGAAUUGtt3′, wherein the nucleotides at positions 3, 6, 11, and 21 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:34) and antisense 5′AACAAUUCUGAGAAACCCGCtt3′ wherein the nucleotides at positions 6, and 19 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:35);
hSMAC-B1: Sense, 5′GCAGAUCAGGCCUCUAUAAtt3′, wherein the nucleotides at positions 4, 9, and 15 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:36); antisense, 5′UUAUAGAGGCCUGAUCUGCtt3′, wherein the nucleotides at positions 4, 9, 15, and 18 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:37);
hSMAC-B2: Sense, 5′GCAGAUCAGGCCUCUAUAAtt3′, wherein the nucleotides at positions 4, 9, 13, and 17 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:38); antisense, 5′UUAUAGAGGCCUGAUCUGCtt3′, wherein the nucleotides at positions 6, 12, and 18 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:39);
hSMAC-B3: Sense, 5′GCAGAUCAGGCCUCUAUAAtt3′, wherein the nucleotides at positions 6, 10, and 15 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:40); antisense, 5′UUAUAGAGGCCUGAUCUGCtt3′, wherein the nucleotides at positions 2, 9, and 17 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:41);
hSMAC-B4: Sense, 5′GCAGAUCAGGCCUCUAUAAtt3′, wherein the nucleotides at positions 4, 13, and 17 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:42); antisense, 5′UUAUAGAGGCCUGAUCUGCtt3′, wherein the nucleotides at positions 8, 13, and 18 (marked in bold and underline) are derivatized by 2′-O-Me (SEQ ID NO:43);
non-targeting siRNA (si-NT): sense: 5′ GCAAACAUCCCAGAGGUAU3′ (SEQ ID NO:44) antisense: 5′ AUACCUCUGGGAUGUUUGC3′ (SEQ ID NO:45).
The siRNAs were synthesized by Genepharma (Suzhou, China). Cells were seeded (150,000 cells/well) on 6-well culture dishes to 40-60% confluence and transfected with 10-100 nM si-NT or si-hSMAC/Diablo using the JetPRIME transfection reagent (Illkirch, France), according to the manufacturers' instructions.
Cells were transiently transfected with pcDNA3.1 plasmid (0.5-2 μg DNA) encoding SMAC/Diablo-GFP or pEGFP encoding for GFP using the JetPRIIVIE reagent according to the manufacturer's instructions.
Cell Death Analysis
Cells death was analyzed by propidium iodide (PI) staining and flow cytometer (Beckton-Dickinson, San Jose, Calif.) and BD CellQuest Pro software, or using acridine orange ethidium bromide staining (Abu-Hamad, S., et al., 2009. J Cell Sci, 122(Pt 11): p. 1906-1916).
Determination of Cellular ATP Levels
Cellular ATP levels were estimated using the luciferase-based assay (CellTiter-Glo, Promega). Cells were transfected with si-hSMAC and 48 h and 72 h post-transfection, were washed twice with PBS and seeded in 96-well plates at densities of 5×104 cells/ml (A549, HeLa cells and H358, non-small cell lung cancer cells). ATP levels were assayed according to the manufacturer's protocol and luminescence was recorded using an Infinite M1000 plate reader.
Cell Cycle Analysis
For cell cycle analysis, cells were harvested, washed with PBS and fixed with ice-cold 70% ethanol overnight at −20° C. The cells were then washed with PBS, incubated with RNase A (100 μg/ml) in PBS for 30 min at 37° C. Then the cells were incubated with PI (1 μg/ml) before analysis on a flow cytometer (iCyt Eclipse EC800, UK). Single cells were gated and a minimum of 10,000 cells acquired and analyzed by FACS Eclipse analyzer.
Sulforhodamine B (SRB) Cell Proliferation Assay
Twenty-four hours post-transfection with si-NT or si-hSMAC, cells (10,000/well) were counted and seeded in 96-well plates. After additional 48, 72 or 96 hours, the cells were washed with PBS, fixed with 10% trichloroacetic acid, and stained with SRB. SRB was extracted from the cells using 100 mM Tris base and absorbance at 510 nm was determined using an Infinite M1000 plate reader (Tecan, Mannedorf, Switzerland).
Xenograft Experiments
Five-week-old male athymic Swiss nude mice (weight ˜19-22 g) were obtained from Envigo and allowed a week of acclimatization to their new surroundings. Lung cancer cells A549 (3×106), or breast cancer cells MDA-MB231 (3×106) were injected subcutaneous (s.c.) into the hind leg flanks of the mice. Approval for the experimental protocol was obtained from the Institutional Animal Care and Use Committee of the Soroka University Medical Center. Eleven days after inoculation, the developing tumors were measured in two dimensions with a digital caliper and tumor volume was calculated as follows: volume=X2×Y/2, where X and Y are the short and long tumor dimensions, respectively. Mice with xenografts reaching a volume of 65-100 mm3 were randomized to receive either non-targeting (NT) siRNA or siRNA targeted to human hSMAC (si-hSMAC); 5 animals in each group. Tumors and section thereof that received NT siRNA are designated si-NT-TTs (siRNA non-targeting treated tumors) and tumors and section thereof that received hSMAC siRNA are designated si-hSMAC-TTs (siRNA hSMAC treated tumors). Treatment substances were injected into the established s.c. tumors using the jetPEI delivery reagent (10 μg siRNA/20 μl jetPEI). The tumors were injected (at a volume equal to 10 to 20% of the tumor volume) with si-NT or the appropriate si-hSMAC every three days. Beginning on the day of inoculation, mouse weight and tumor volume were monitored twice a week using a digital caliper. At the end of the experiment, i.e. when tumor volume reached approximately 1300 mm3, the mice were sacrificed using CO2 gas, the tumors were excised and ex vivo weight was determined. Half of each tumor was fixed in 4% buffered formaldehyde, paraffin-embedded and processed for histological examination, while the second half was frozen in liquid nitrogen and stored in −80° C. for immunoblot analysis.
Quantitative Real-Time PCR (q-PCR)
Total RNA was isolated from cells using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Complementary DNA was synthesized from 1 μg total RNA using a Verso cDNA synthesis kit (Thermo Scientific). q-PCR was performed using specific primers (KiCqStart Primers; Sigma Aldrich) in triplicates, using Power SYBER green master mix (Applied Biosystems, Foster City, Calif.). The levels of the target genes were normalized relative to β-actin mRNA levels. Samples were amplified by a 7300 Real Time PCR System (Applied Biosystems) 95° C. for 2 minutes and for 40 cycles using the following PCR parameters: 95° C. for 15 seconds, 60° C. for 1 minute, and 72° C. for 1 minute. The copy numbers for each sample were calculated by the CT-based calibrated standard curve method. The mean fold changes (±SEM) of the three replicates were calculated. The target genes examined and the forward and reverse sequences of the primers used are listed in Table 2 hereinbelow.
Next-Generation Sequencing (NGS) and Functional Analysis
Libraries were prepared by the INCPM-RNA-seq unit (Weizmann Institute, Israel). Briefly, polyA fraction (mRNA) was purified from 500 ng of total RNA, isolated as above, followed by fragmentation and generation of double stranded cDNA. End repair, a base addition, adapter ligation and PCR amplification steps were performed according to established methods. Libraries were evaluated by Qubit and TapeStation. Sequencing libraries were constructed with barcodes to allow multiplexing of 20 samples in one lane. Between 22 and 26 million reads single-end 60-bp reads were sequenced per sample on Illumina HiSeq 2500 V4 instrument.
Bioinformatics analyses were carried out at the Bioinformatics Core Facility at the National Institute for Biotechnology in the Negev, Ben-Gurion University. Raw sequence reads were assessed for quality using FASTQC and further trimmed for removal of remaining adaptors and low quality bases using Trimmomatic. The trimmed reads from each sample were separately aligned to the human and mouse genomes (GRCh38 and GRCm38.75, respectively) using STAR v2.3.0 with default settings. An average of 23.7±0.8 million reads per sample was obtained. Of these, an average of 13, 2.6, 7.8 and 0.3 million reads were mapped to human only, mouse only, both human and mouse, and none of them, respectively. After rejection of multi-mapped reads, a total of 11.5±2.5 human-specific, uniquely mapped reads, and 2.3±1.7 mouse-specific, uniquely mapped reads were subjected for further analysis. The number of aligned reads per gene per sample were counted using HTSeq count with “intersection-nonempty” (to handle reads that overlap with more than one gene) and “no stranded” as parameters. The other parameters were set to their default. Normalization and statistical analysis for differential expression were carried out using DESeq2 v1.6.3. Fold change values were converted to linear scale, with a minus sign indicating down-regulation.
Differentially expressed genes were defined as those having a p-value <0.05, and linear fold change >1.5 and <−1.5. Functional analysis was performed using the Gene Ontology system, DAVID and Expander software tools.
Patient-Derived Samples
Chronic lymphocytic leukemia (CLL) blood samples were obtained from Soroka University Medical Center from patients not receiving any disease treatment. Blood samples were also obtained from healthy volunteers. Peripheral blood mononuclear cells (PBMCs) were isolated from venous blood of CLL patients by Ficoll-Paque PLUS (GE Healthcare) density gradient centrifugation as described previously (Admoni-Elisha, L., et al., 2016. PLoS One, 2016. 11(4): p. e0148500).
Fresh lung cancerous and non-cancerous tissue specimens were obtained from the same lung cancer patients undergoing either pneumonectomy or pulmonary lobectomy to remove tumor tissue and were immediately frozen in liquid nitrogen and maintained at −80° C. until use. Cancer and normal lung tissue surrounding the tumor were validated by hospital pathologists. Proteins were extracted from the tissue sample using a lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1.5 mM MgCl2, 10% glycerol, 1% Triton X-100, a protease inhibitor cocktail (Calbiochem), followed by sonication and centrifugation (10 min, 600 g). Protein concentration was determined and samples were stored in −80° C. until use.
The research was approved by the Soroka University Medical Center Advisory Committee on Ethics in Human Experimentation and conducted in accordance with national laws and regulations, the ethical principles set forth in the Declaration of Helsinki and with good clinical practice as described in the ICH guidelines. Written informed consent was obtained from all participants prior to entry into the study. All subjects received a copy of their signed and dated informed consent form.
Immunohistochemistry
Tissue microarrays (MC5003, LC807) containing cancer and normal tissues purchased from US Biomax (US Biomax, Inc. USA) and formalin-fixed and paraffin-embedded tumor sections were immunohistochemistry (IHC) stained. Sections were deparaffinized using xylene and a graded ethanol series. Endogenous peroxidase activity was blocked by incubating the sections in 3% H2O2 for 10 minutes. Antigen retrieval was performed in 0.01M citrate buffer (pH 6.0) in 95° C.-98° C. for 20 minutes. After washing sections with PBS containing 0.1% Triton-X100 (pH 7.4), non-specific antibody binding was reduced by incubating the sections in 10% normal goat serum for 2 hr. After decanting excess serum, sections were incubated overnight at 4° C. with primary antibodies (sources and dilutions are detailed in Supplementary Table 1). Sections were washed with PBST. For IHC, endogenous peroxidase activity was blocked by incubating the sections in 3% H2O2 for 15 min. After washing thoroughly with PBST, the sections were incubated for 2 h with anti-mouse or anti rabbit (1:250) secondary antibodies conjugated to HRP, as appropriate. Sections were washed five times in PBST and the peroxidase reaction was subsequently visualized by incubating with 3,3-diaminobenzidine (DAB) (ImmPact-DAB, Burlingame, Calif.). After rinsing in water, the sections were counterstained with hematoxylin, and mounted with Vectashield mounting medium (Vector Laboratories, Burigame, Calif.). Finally, the sections were observed under a microscope (Leica DM2500) and images were collected at 20× magnification with the same light intensity and exposure time.
Immunoblot Staining
For immunostaining, membranes containing electro-transferred proteins following SDS-PAGE were blocked with 5% non-fat dry milk in TBS (10 mM Tris 150 mM NaCl, pH 7.8) containing 0.1% Tween-20, incubated with the primary antibodies (sources and dilutions as detailed in Table 1 or in the corresponding example). Following washing 3 times with TBST (10 mM Tris 150 mM NaCl, pH 7.8 containing 0.05% Tween-20) the membranes were incubated with HRP-conjugated anti-mouse or anti-rabbit (1:10,000) or anti-goat (1:20,000) IgG. Enhanced EZ-ECL chemiluminescence detection kit (Cat: 20-500-120), Biological Industries, Beit—Haemek, Ill.) was used for detection of HRP activity. Band intensity was quantified using FUSION-FX (Vilber Lourmat, France).
TUNEL Assay
Tumor sections were processed for the TUNEL assay using the DeadEnd Fluorometric TUNEL system (Promega, Madison, Wis.) according to the manufacturer's instructions. Sections were deparaffinized, equilibrated in PBS, permeabilized with proteinase K (20 μg/ml in PBS), post-fixed in 4% paraformaldehyde, and incubated in TdT reaction mix (Promega) for 1 h at 37° C. in the dark. Slides were then washed in 2× saline-sodium citrate (SSC) buffer and counter-stained with PI (1 μg/ml), and cover slipped with Vectashield mounting medium (Vector Laboratories, Burigame, Calif.). Fluorescent images of apoptotic cells (green) and cell nuclei (red) were captured using a confocal microscope (Olympus 1X81).
Lipid Extraction
Lipids were extracted from si-NT-TTs and si-hSMAC-A-TTs as described previously (Folch, J., M. et al., 1957. J Biol Chem, 226(1): p. 497-509.). Briefly, 10-20 mg of tissue were added to CHCl3/MeOH (2:1, v/v) (7.5 mg/ml) and homogenized twice using ultrasound sonication. Water (12 μl/mg) was added to the suspension; the tube was closed with a glass cap and shaken at room temperature for 2 h at 400 rpm. The suspension was heated to 60° C. for 10 min and subsequently stored at 8° C. for more than 1 h in order to denature proteolipids. Undissolved material was separated by filtration through a Syringe Filter (0.4 μm pore). After evaporation of solvent, the residue was re-dissolved in CHCl3/MeOH. The suspension was filtered and the solvent was evaporated again. The weight of the extracted lipids was determined.
Estimation of Phospholipids, Phosphatidylcholine and Phosphatidylethanolamine
Phospholipids content of the lipids extracted from si-NT-TTs and si-hSMAC-A-TTs as described above was determined based on the formation of a complex of the phospholipids with ammonium ferrothiocyanate as described previously (Stewart, J. C., 1980. Anal Biochem, 104(1): p. 10-14). The absorbance at 488 nm was determined and the amounts of phospholipids were calculated using phosphatidylcholine (PC) a standard (10-100 μg). For phosphatidylcholine (PC) determination, samples of the extracted lipids were analyzed using ammonium thiocyanatocobaltate reagent as described previously (Yoshida, Y., E. et al., 1979. J Biochem, 86(3): p. 825-828). The absorbance at 316 nm was measured and PC amount was calculated using a phosphatidylcholine standard (10-100 μg).
Phosphatidylethanolamine (PE) content of the lipids extracted from si-NT-TTs and si-hSMAC-A-TTs was measured using a fluorescence-based assay as described previously (Jae-Yeon Choi et al. 2018. J. Biol. Chem 293, 1493-1503). Briefly, samples of lipid extracted from tumors as described above were dissolved in chloroform and after then chloroform was evaporated under gas nitrogen. The dried extract was then re-suspended in 0.8 mM Triton X-100. To 20 μl of lipid samples, reaction mixture including 50 μl reaction buffer (80 mM NaCl, 2 mM KPO4, pH 7.4), 30 μL H2O and 12.5 μl borate buffer (100 mM boric acid, NaCl 75 mM, sodium tetraborate 25 mM, pH, 9) were added and placed in 96 well plate and mixed well. 12.5 μl of 100 μM distyrylbenzene-bis-aldehyde (DSB-3), kindly provided by Prof. Uwe Bunz, (Organisch-Chemisches Institute, Heidelberg, Germany) prepared in 10 mM KH2PO4, pH 7.4 were then added. After 2 h of incubation in dark with shaking at 100 rpm, fluorometric detection of PE was carried out at λex=403 nm, λem=508 nm, using a plate reader. A standard curve using purified PE was carried out in parallel.
Expression levels of SMAC/Diablo in tissue microarray slides containing samples of randomly selected normal (10-20 healthy) controls and different types of malignant cancer (40 to 80) were assessed by immunohistochemistry (IHC) using SMAC/Diablo-specific antibodies (
Levels of SMAC/Diablo expression were higher in samples of lung cancer (non-small cell lung cancer; NSCLC), relative to samples of adjacent healthy tissue from the same lung (
The expression level of SMAC/Diablo in cancerous cell lines, including HeLa, A549, H358, HepG2, MCF7, MDA-MB-231, U-87MG, U-118MG, THP1, and KG-1α cells, were about 2-4 fold higher compared to the non-cancerous TREx-293, HEK-293, HaCaT and WI-38 cell lines (
The function of SMAC/Diablo in cancer was explored by silencing its expression in a number of human-derived cancer cell lines of various origins (i.e., HeLa, A549, H358, MCF-7, PC3, HepG2, MDA-MB-231, PANC-1, and HTB-72) using siRNA specific to human SMAC/Diablo (designated si-hSMAC-A, comprising a sense stand having the nucleic acid sequence set forth in SEQ ID NO: SEQ ID NO:20 and an antisense strand having the nuclkeic acid sequence set forth in SEQ ID NO:21). SMAC/Diablo protein expression levels were markedly decreased (80-90%) in all tested cell lines (
The effect of the SMAC/Diablo silencing on cell growth was examined using the sulforhodamine B (SRB) assay. In the three cell lines tested (HeLa, A549, and H358), a marked 70-80% decrease in cell proliferation was observed 120 h post-transfection with si-hSMAC-A, whereas the control transfected with non-targeting siRNA (si-NT) showed no significant effect on cell growth (
si-hSMAC-A and si-hSMAC-B were modified by 2′-O methylation (2′-O Me) to form si-hSMAC-A1, si-hSMAC-A2 si-hSMAC-A3 si-hSMAC-A4 si-hSMAC-B1 si-hSMAC-B2 si-hSMAC-B3 and si-hSMAC-B4 described hereinabove. The effect of these modified forms on SMAC/Diablo expression and on cell proliferation was examined using 30 and 50 nM of each inhibitory RNA molecule in the lung cancer line A549. Of the examined si-hSMAC-A modified molecules, si-hSMAC-A1 and si-hSMAC-A4 were found to be most active in reducing cell proliferation (
Lung cancer cells (A549) treated with si-hSMAC-A, the most active siRNA, showed a significant decrease in the number of cells expressing the cell proliferation factor/marker Ki-67 as reflected by a decrease of about 85% in Ki-67 positive cells (
As Ki-67 levels are increased with cell cycle progression, this decrease in expression suggests that cells treated with si-hSMAC-A do not advance in the cell cycle. Cell cycle analysis revealed an about 3-fold increase in the number of cells in S-phase in si-hSMAC-treated A549 cells relative to etoposide-treated cells (a chemotherapy medication used for the treatments of a number of types of cancer, including lung cancer) (
Silencing SMAC/Diablo in HeLa, A549, and H358 cells reduced cellular ATP levels by 20-35% (
There was no significant cell death (5-10%) of HeLa, A549 or H358 cells silenced for SMAC/Diablo (
The effect of si-hSMAC-A was tested on a sub-cutaneous (s.c) tumor xenograft of A549 cells established in nude mice (
All mice were sacrificed 39 days post-cell inoculation, and the tumors were excised (
The expression levels of the cell proliferation factor Ki-67, as analyzed by IHC staining or q-PCR, were markedly decreased (˜80%) in the si-hSMAC-A-TTs (
TUNEL staining revealed a lack of significant apoptosis in either si-NT-TTs or si-hSMAC-A-TTs from A549-derived xenograft tumors (data not shown). As SMAC/Diablo released from mitochondria during apoptosis binds to and counters the activities of IAPB leading to the release of bound caspases (Verhagen, A. M., et al. 2000. Cell 102, 43-53), the expression levels of XIAP1, cIAP1, and cIAP2, as well as of pro-apoptotic proteins including caspases 3, 8, and 9, Cyto c, and AIF were analyzed. The expression levels of these genes (mRNA) were noticeably decreased, as revealed by q-PCR (
In cell culture, immunoblotting (
These results suggest cross-talk between the levels of expression of SMAC/Diablo and those of a variety of apoptosis-related proteins.
Hematoxylin and eosin (H&E) staining of sections from si-NT-TTs and si-hSMAC-A-TTs lung cancer xenografts demonstrated a mostly similar morphology of lung cancer tissue with cyst-like structures (
Further structural analysis revealed that the cells organized in a chain around the glandular-like structures were positively stained for the endothelial cell marker CD31 (
Further support for this view comes from analysis of the formation of stroma in H&E-stained si-NT-TTs and si-hSMAC-A-TTs (
Staining with Sirius red and of vimentin, staining collagen and intermediate filaments, respectively, appeared to be similar in si-NT-TTs and si-hSMAC-A-TTs (data not shown). In contrast, staining for α-SMA, a myofibroblast marker, was observed mainly in si-NT-TTs, and was significantly reduced in si-hSMAC-A-TTs (
Interestingly, it was noticed that although SMAC/Diablo is known as a mitochondrial protein, high levels were also detected in the nucleus and cytosol of NSCLC tissue microarray samples (
Nuclear localization of SMAC/Diablo was also detected in lung cancer tissue by IHC analysis (
NGS was used to investigate changes in patterns of gene expression in si-NT-TTs and si-hSMAC-A-TTs (
Of the human genes the expression of which was modified following SMAC/Diablo silencing, about 186 were up-regulated and 242 were down-regulated. Functional analysis (Gene Ontology system, DAVID) of gene expression in si-NT-TTs and si-hSMAC-A-TTs revealed differential expression of genes associated with key functions and pathways related to tumorigenicity (
Genes associated with membranes, organelles and extracellular matrix—The expression of about 200 genes associated with cell membrane, exosomes, and extracellular matrix and proteins found in the lumen of the ER and Golgi were altered. While genes associated with cell membrane, extracellular exosomes and extracellular matrix were found to be both up- and down-regulated, genes associated with ER lumen and Golgi were only down-regulated (
Genes associated with lipid transport, synthesis and regulation—Alterations in the membranal system could reflect that membrane components, such those involved in phospholipid synthesis, were impaired upon SMAC reduction. Indeed, si-SMAC-TTs showed alterations in the expression levels of genes associated with the transport, synthesis and regulation of lipids (
Transporters of metabolites and ions and cell metabolism—Another interesting group of differentially expressed genes includes those related to the transport of metabolites and ions (
Up-regulated genes included the Ft/sucrose symporter, genes involved in the regulation of lipid metabolism, the thiamine pyrophosphate (TPP) transporter, a cation/proton antiporter, and those encoding several channels for K+, Na+, Cl− (
Metabolism-related genes whose expression was altered in si-hSMAC-A-TTs included dehydrogenases and deaminases responsible for mediating the conversion of oxaloacetate to phosphoenolpyruvate, alcohol dehydrogenase, hexose-6-phosphate dehydrogenase, and adenosine deaminase, all of which were down-regulated (
Inflammation and the tumor microenvironment—The si-hSMAC-A-TTs also showed a reduction in the expression of genes associated with inflammation and the tumor microenvironment, including cytokines, chemokines, their related receptors, and intracellular proteins associated with inflammatory and immune responses (Table 5). Selected results were confirmed by q-PCR (
A conclusion following from these results is that up-regulation of the expression of SMAC/Diablo in tumor cells may be associated with an increase in the inflammatory activity that is essential for tumorigenicity, invasiveness, metastasis, and angiogenesis.
(3.1 × 10−11)
(7.9 × 10−18)
(1 × 10−3)
(1 × 10−4)
(6.2 × 10−12)
(2.3 × 10−11)
(1.8 × 10−4)
(3 × 10−4)
(1.1 × 10−13)
(6.2 × 10−17)
As SMAC silencing resulted in morphological changes (
In addition, in si-NT-TTs, the major DNA form in the nucleus is darkly staining heterochromatin, while in si-SMAC-TTs, the DNA is mainly found as euchromatin and not readily stained (
The amounts of total phospholipids and PC in si-NC-TTs and si-SMAC-A-TTs lipid extracts were analyzed (
These results are in agreement with the findings that SMAC/Diablo silencing resulted in alterations in the expression levels of genes associated with the transport, synthesis and regulation of lipids (
A network of proteins interacting with SMAC/Diablo (
Fourteen (14) proteins were selected as being associated with SMAC/Diablo, all of human (Homo sapiens) origin:
A custom glass-bound peptide array consisting of 768 overlapping peptides (of 20-25 amino acid length) derived from the above-selected proteins was prepared by Intavis, Bioanalytical instruments, Kolen, Germany.
The peptide array was incubated overnight at 4° C. with purified SMAC (0.8 μM) and then blotted with anti-SMAC antibodies (1:2000) and incubated for additional 4 h at 4° C. followed by 2 h incubation with HRP-conjugated anti-mouse IgG and detection using the EZ-ECL chemiluminescence detection kit as described hereinabove.
Dark spots, marked with their location on the peptide array, represent binding of SMAC to peptides derived from the SMAC-interacting proteins (
SSQPAQSLPSQPLLRSPLPLQQKLLL
The effect of peptide 2C18 (SEQ ID NO:47) derived from the SMAC/Diablo interacting proteins, Ubiquitin conjugating enzyme E2 K Protein (UBEK2); and of peptide 1G12 (SEQ ID NO:48) derived from Baculoviral IAP repeat containing 2 Protein (BIRC2) on SMAC/Diablo capability to interact with these and other peptides was examined.
The glass-bound peptide array described hereinabove was used. SMAC/Diablo (0.8 μM) was incubated with each of the peptides—2C18 (2.4 μM) and 1G12 (2.4 μM) for 2 hr at 24° C. and then incubated with the peptide array for 4 h at 4° C. Then the slides were washed and SMAC/Diablo antibodies (1:2000) were added, followed by incubation with HRP-conjugated anti-mouse IgG after which chemiluminescent spots were detected. Corresponding glass-bound peptide array incubated overnight with 0.8 μM free SMAC/Diablo, blotted with the same concentration of SMAC/Diablo antibodies followed by incubation with HRP-conjugated anti-mouse IgG served as a control. As expected, pre-incubation of SMAC/Diablo with peptide 2C18 or peptide 1G12 significantly decreased or even prevented the interaction of SMAC/Diablo with the corresponding peptides, as the binding site is already occupied by the free peptide pre-incubated with SMAC/Diablo. This is indicated by the decreased intensity or disappearance of chemiluminescence in the peptide spot position compared to the control (
Considering the presence of the overexpressed SMAC/Diablo in the mitochondria intermembrane space and in the nucleus it is important to target SMAC/Diablo interacting peptide to these compartments, facilitating the cellular uptake and nucleus and/or mitochondria localization of the peptides of the present invention is of significant importance for the therapeutic use of the peptides of the invention. Several conjugates of peptides of the invention fused to cell- and nucleus or mitochondria penetrating peptide were designed (Table 7 below).
The tetrapeptide Arg-D-Arg-Arg-Lys (Cindy A P et al. 2010. Bioorganic & Medicinal Chemistry 18:3564-3569) was used to facilitate cellular uptake and nuclear localization. The peptide is designated herein cell/nucleus penetrating peptide (nuCPP, SEQ ID NO:71).
The tetrapeptide D-Arg-Dmt-Orn-Phe, wherein Dmt=2,6-dimethyl-L-tyrosine, (Carmine Pasquale Cerrato, et al. 2015. The FASEB Journal, 29(11): 4589-4599), was used to facilitate cellular uptake and mitochondria localization. The peptide is designated herein cell/mitochondria penetrating peptide (mtCPP, SEQ ID NO:72)
A peptide comprising transferrin-receptor binding domain (Tf) having the sequence His-Ala-Ile-Tyr-Pro-Arg (SEQ ID NO:80 and a peptide comprising the Drosophila antennapedia (ANTP) domain having the sequence Met-Arg-Gln-Ile-Lys Ile-Trp-Phe-Gln-Asn-Arg-Arg-Met-Lys-Trp-Lys (SEQ ID NO:81) each was used to facilitate uptake of the peptide through the cell plasma membrane and into the cytosol.
A549 cells were seeded in 96-well plate (5000 cells/well). After 24 h cells were incubated with each of the examined peptides at a concentration of 5, 10, or 30 μM for 48 h in a serum (10%) containing medium or for 24 h in a serum-free medium. Then, cells were washed with PBS, fixed with 10% trichloroacetic acid, and analyzed for cell growth using the SRB method described herein above. Cell growth with no addition of a peptide was taken as a control (100% cell growth). Table 8 presents the cell growth in the presence of the peptide as % of control. Results are the mean±SD (n=3).
Table 8 clearly demonstrates that peptides derived from proteins interacting with SAMC/Diablo, shown herein to bind SMAC/Diablo, when targeted to the nucleus or the mitochondria significantly inhibit cell proliferation. These results indicate that the interaction of selected peptides with SMAC/Diablo under non-apoptotic conditions resulted in inhibition of the non-apoptotic function of SMAC/Diablo, leading to inhibited cell growth.
Phosphatidylserine decarboxylase or SMAC/Diablo expressing vector was expressed in Escherichia coli BL21 cells. Bacteria were grown at 37° C. to reach absorbance at 600 nm of 0.4, after which expression was induced with isopropyl β-D-1 thiogalactopyranoside. PSD was purified by chromatography using DEAE-cellulose column and eluted with NaCl. SMAC/Diablo was purified using nickel-nitrilotriacetic acid resin and eluted using imadazol. Representing results of the purified SMAC/Diablo and PSD are shown in
PSD activity was analyzed by following the formation of phosphatidylethanolamine (PE) analyzed as described hereinabove for lipids extracted from xenograft tumors. As is demonstrated in
The effect of selected peptides, particularly the peptide conjugates of SEQ ID NOs” 69-71 and 72-74 on sub-cutaneous (s.c) tumors is examined.
A549 (5×106) or diffuse large B-cell lymphoma (DLBCL) HT (ACC-567) cells (3×106) are injected sub-cutaneously into the hind leg flanks of eight week-old athymic male nude mice (Envigo). When tumor size reaches 50-100 mm3, the mice are grouped and treated by intra-tumoral injection of a buffer (HBSS) or with the selected peptide/peptide conjugate to a final concentration of 30 to 60 μM. Mice are sacrificed when tumors volumes reach 10-15% of the mouse weight. Tumors are then excised; half of each tumor is fixed in 4% buffered formaldehyde, paraffin-embedded and processed for IHC, and the second half is frozen in liquid nitrogen for immunoblotting and qPCR analyses. Tumor sections are analyzed for: (a) proteins related to lipid metabolism; (b) cancer cell proliferation by staining for the proliferation factor Ki-67 using specific antibodies; (c) tissue morphology using H&E and Sirius Red staining to monitor stromal activity and anti-CD31 antibody staining for evaluating angiogenesis; and (d) apoptosis using the TUNEL assay.
The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IL2018/050835 | 7/26/2018 | WO |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2019/021289 | 1/31/2019 | WO | A |
| Number | Name | Date | Kind |
|---|---|---|---|
| 5464764 | Capecchi | Nov 1995 | A |
| 5487992 | Capecchi | Jan 1996 | A |
| 5721138 | Lawn | Feb 1998 | A |
| 6326174 | Joyce | Dec 2001 | B1 |
| 7816538 | Harran | Oct 2010 | B2 |
| 7884211 | Harran | Feb 2011 | B2 |
| 9861679 | Lalaoui | Jan 2018 | B2 |
| 20020123476 | Emanuele | Sep 2002 | A1 |
| 20020128218 | Emanuele | Sep 2002 | A1 |
| 20030096980 | Froehler | May 2003 | A1 |
| 20030170680 | Froehler | Sep 2003 | A1 |
| 20080253966 | Bonavida | Oct 2008 | A1 |
| 20130196927 | Benetatos | Aug 2013 | A1 |
| 20160161495 | Begley | Jun 2016 | A1 |
| 20160184383 | Lalaoui | Jun 2016 | A1 |
| Number | Date | Country |
|---|---|---|
| 0375408 | Jun 1990 | EP |
| 2004005248 | Jan 2004 | WO |
| 2013016675 | Jan 2013 | WO |
| 2017109774 | Jun 2017 | WO |
| Entry |
|---|
| Puckett and Barton. Bioorg Med Chem. May 15, 2010; 18(10): 3564-3569. doi:10.1016/j.bmc.2010.03.081. |
| Wilkinson et al. Journal of Biological Chemistry, vol. 279, No. 49, Dec. 3, pp. 51082-51090, 2004. |
| Shintani et al., (2014) Smac/DIABLO expression in human gastrointestinal carcinoma: Association with clinicopathological parameters and survivin expression. Oncol Lett 8(6): 2581-2586. |
| Shiozaki and Shi (2004) Caspases, IAPs and Smac/DIABLO: mechanisms from structural biology. Trends Biochem Sci 29(9): 486-494. |
| Shoshan-Barmatz et al., (2017) A molecular signature of lung cancer: potential biomarkers for adenocarcinoma and squamous cell carcinoma. Oncotarget 8(62): 105492-105509. |
| Shteinfer-Kuzmine et al., (2017) Mitochondrial VDAC1-based peptides: Attacking oncogenic properties in glioblastoma. Oncotarget 8(19): 31329-31346. |
| Stewart (1980) Colorimetric determination of phospholipids with ammonium ferrothiocyanate. Anal Biochem 104(1): 10-14. |
| Teh et al., (2006) Neuronal PAS domain protein 1 is a transcriptional repressor and requires arylhydrocarbon nuclear translocator for its nuclear localization. J Biol Chem 281(45): 34617-34629. |
| Tonkinson and Stein (1996) Antisense oligodeoxynucleotides as clinical therapeutic agents. Cancer Invest 14(1): 54-65. |
| Verhagen and Vaux (2002) Cell death regulation by the mammalian IAP antagonist Diablo/Smac. Apoptosis 7(2): 163-166. |
| Verhagen et al., (2000) Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell 102(1): 43-53. |
| Vuyisich and Beal (2000) Regulation of the RNA-dependent protein kinase by triple helix formation. Nucleic Acids Res 28(12): 2369-2374. |
| Wang et al., (2011) Toward an understanding of the protein interaction network of the human liver. Mol Syst Biol 7: 536; 11 pages with Corrigendum. |
| Welch et al., (1998) Expression of ribozymes in gene transfer systems to modulate target RNA levels. Curr Opin Biotechnol 9(5): 486-496. |
| Yamaguchi et al., (2003) Bax plays a pivotal role in thapsigargin-induced apoptosis of human colon cancer HCT116 cells by controlling Smac/Diablo and Omi/HtrA2 release from mitochondria. Cancer Res 63(7): 1483-1489. |
| Yoo et al., (2003) Immunohistochemical analysis of Smac/DIABLO expression in human carcinomas and sarcomas. APMIS 111(3): 382-388. |
| Yoshida et al., (1979) A simple method for measuring phosphatidylcholine as its hydrophobic complex with tetrathiocyanatocobaltate. J Biochem 86(3): 825-828. |
| Zhang et al., (2003) Activation of ERK1/2 protects melanoma cells from TRAIL-induced apoptosis by inhibiting Smac/DIABLO release from mitochondria. Oncogene 22(19): 2869-2881. |
| Zhao et al., (2012) A role for two-pore K+channels in modulating Na+absorption and Cl-secretion in normal humar bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol 302(1): L4-L12. |
| Kohli et al., SMAC/Diablo-dependent apoptosis induced by nonsteroidal antiinflammatory drugs (NSAIDs) in colon cancer cells. Proc Natl Acad Sci USA, Nov. 30, 2004, 101(48): 16897-16902. |
| Liu et al., Smac/DIABLO regulates the apoptosis of hypertrophic scar fibroblasts. International Journal of Molecular Medicine, 2013, 32(3): 615-622. |
| Abu-Hamad et al., (2009) The VDAC1 N-terminus is essential both for apoptosis and the protective effect of anti-apoptotic proteins. J Cell Sci 122(Pt 11): 1906-1916. |
| Admoni-Elisha et al., (2016) Novel Biomarker Proteins in Chronic Lymphocytic Leukemia: Impact on Diagnosis, Prognosis and Treatment. PLoS One 11(4): e0148500; 28 pages. |
| Adrain et al., (2001) Apoptosis-associated release of Smac/DIABLO from mitochondria requires active caspases and is blocked by Bcl-2. EMBO J 20(23): 6627-6636. |
| Alessenko and Burlakova (2002) Functional role of phospholipids in the nuclear events. Bioelectrochemistry 58(1): 13-21. |
| Anversa et al., (2011) Tissue-specific adult stem cells in the human lung. Nat Med 17(9): 1038-1039. |
| Arellano-Llamas et al., (2006) High Smac/DIABLO expression is associated with early local recurrence of cervical cancer. BMC Cancer 6: 256; 10 pages. |
| Bao et al., (2006) Relationship between expression of Smac and Survivin and apoptosis of primary hepatocellular carcinoma. Hepatobiliary Pancreat Dis Int 5(4): 580-583. |
| Barkauskas et al., (2013) Type 2 alveolar cells are stem cells in adult lung. J Clin Invest 123(7): 3025-3036. |
| Bruno and Darzynkiewicz (1992) Cell cycle dependent expression and stability of the nuclear protein detected by Ki-67 antibody in HL-60 cells. Cell Prolif 25(1): 31-40. |
| Cerrato et al., (2015) Novel cell-penetrating peptide targeting mitochondria. FASEB J 29(11): 4589-4599. |
| Chauhan et al., (2003) JNK-dependent release of mitochondrial protein, Smac, during apoptosis in multiple myeloma (MM) cells. J Biol Chem 278(20): 17593-17596. |
| Cheng et al., (2016) Targeting Phospholipid Metabolism in Cancer. Front Oncol 6: 266; 17 pages. |
| Choi et al., (2018) A novel fluorescence assay for measuring phosphatidylserine decarboxylase catalysis. J Biol Chem 293(5): 1493-1503. |
| Cooper et al., (2016) Long Term Culture of the A549 Cancer Cell Line Promotes Multilamellar Body Formation and Differentiation towards an Alveolar Type II Pneumocyte Phenotype. PLoS One 11(10): e0164438; 20 pages. |
| Deng et al., (2002) TRAIL-induced apoptosis requires Bax-dependent mitochondrial release of Smac/DIABLO. Genes Dev 16(1): 33-45. |
| Du et al., (2000) Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell 102(1): 33-42. |
| El-Galaly et al., (2017) The number of extranodal sites assessed by PET/CT scan is a powerful predictor of CNS relapse for patients with diffuse large B-cell lymphoma: An international multicenter study of 1532 patients treated with chemoimmunotherapy. Eur J Cancer 75: 195-203. |
| Folch et al., (1957) A simple method for the isolation and purification of total lipides from animal tissues. J Biol Chem 226(1): 497-509. |
| Foster et al., (1998) Characterization of the A549 cell line as a type II pulmonary epithelial cell model for drug metabolism. Exp Cell Res 243(2): 359-366. |
| Fujita et al., (2016) Extracellular vesicle transfer of cancer pathogenic components. Cancer Sci 107(4): 385-390. |
| Gilboa et al., (1986) Transfer and expression of cloned genes using retroviral vectors. BioTechniques 4(6): 504-512. |
| Glunde and Serkova (2006) Therapeutic targets and biomarkers identified in cancer choline phospholipid metabolism. Pharmacogenomics 7(7): 1109-1123. |
| Glunde et al., (2006) Choline metabolism in cancer: implications for diagnosis and therapy. Expert Rev Mol Diagn 6(6): 821-829. |
| Glunde et al., (2011) Choline metabolism in malignant transformation. Nat Rev Cancer. Author manuscript; available in PMC Feb. 23, 2015. 33 pages. |
| Grimshaw et al., (2008) Mammosphere culture of metastatic breast cancer cells enriches for tumorigenic breast cancer cells. Breast Cancer Res 10(3): R52; 10 pages. |
| Hietanen et al., (1986) Fatty acid composition of phospholipids and neutral lipids and lipid peroxidation in human breast cancer and lipoma tissue. Carcinogenesis 7(12): 1965-1969. |
| Hu et al., (2012) Clinical significance of Smac and Ki-67 expression in pancreatic cancer. Hepatogastroenterology 59(120): 2640-2643. Abstract. |
| Inazu (2014) Choline transporter-like proteins CTLs/SLC44 family as a novel molecular target for cancer therapy. Biopharm Drug Dispos 35(8): 431-449. |
| Jacobs et al., (2010) Impaired de novo choline synthesis explains why phosphatidylethanolamine N-methyltransferase-deficient mice are protected from diet-induced obesity. J Biol Chem 285(29): 22403-22413 with supplementary information. |
| Kashkar et al., (2006) XIAP targeting sensitizes Hodgkin lymphoma cells for cytolytic T-cell attack. Blood 108(10): 3434-3440. |
| Keckesova et al., (2017) LACTB is a tumour suppressor that modulates lipid metabolism and cell state. Nature. Author manuscript; available in PMC Nov. 21, 2018. 43 pages. |
| Kempkensteffen et al., (2008) Expression levels of the mitochondrial IAP antagonists Smac/DIABLO and Omi/HtrA2 in clear-cell renal cell carcinomas and their prognostic value. J Cancer Res Clin Oncol 134(5): 543-550. |
| Khachigian (2002) DNAzymes: cutting a path to a new class of therapeutics. Curr Opin Mol Ther 4(2): 119-121. |
| Kotton and Fine (2008) Lung stem cells. Cell Tissue Res 331(1): 145-156. |
| Maraldi et al., (1993) Decrease in nuclear phospholipids associated with DNA replication. J Cell Sci 104 (Pt 3): 853-859. |
| Martinez-Ruiz et al., (2008) Role of Smac/DIABLO in cancer progression. J Exp Clin Cancer Res 27: 48; 7 pages. |
| Martinez-Ruiz et al., (2014) Ectopic expression of new alternative splice variant of Smac/DIABLO increases mammospheres formation. Int J Clin Exp Pathol 7(9): 5515-5526. |
| McElhinny et al., (2008) Mastermind-like transcriptional co-activators: emerging roles in regulating cross talk among multiple signaling pathways. Oncogene 27(38): 5138-5147. |
| Medes et al., (1953) Metabolism of neoplastic tissue. IV. A study of lipid synthesis in neoplastic tissue slices in vitro. Cancer Res 13(1): 27-29. |
| Minciacchi et al., (2015) Extracellular vesicles in cancer: exosomes, microvesicles and the emerging role of large oncosomes. Semin Cell Dev Biol. Author manuscript; available in PMC Apr. 1, 2016. 25 pages. |
| Mustafa et al., (2014) Mechanical stretch induces lung α-epithelial Na(+) channel expression. Exp Lung Res 40(8): 380-391. |
| Okada et al., (2002) Generation and characterization of Smac/DIABLO-deficient mice. Mol Cell Biol 22(10): 3509-3517. |
| Parra and Pérez-Gil (2015) Composition, structure and mechanical properties define performance of pulmonary surfactant membranes and films. Chem Phys Lipids 185: 153-175. |
| Paul et al., (2018) A New Role for the Mitochondrial Pro-apoptotic Protein SMAC/Diablo in Phospholipid Synthesis Associated with Tumorigenesis. Mol Ther 26(3): 680-694 with supplementary data. |
| Puckett and Barton (2010) Targeting a ruthenium complex to the nucleus with short peptides. Bioorg Med Chem. Author manuscript; available in PMC May 15, 2011. 16 pages. |
| Rock and Hogan (2011) Epithelial progenitor cells in lung development, maintenance, repair, and disease. Annu Rev Cell Dev Biol 27: 493-512. |
| Rock et al., (2009) Transmembrane protein 16A (TMEM16A) is a Ca2+-regulated Cl- secretory channel in mouse airways. J Biol Chem 284(22): 14875-14880. |
| Seidman and Glazer (2003) The potential for gene repair via triple helix formation. J Clin Invest 112(4): 487-494. |
| Shabtay-Orbach et al., (2015) Paracrine regulation of glioma cells invasion by astrocytes is mediated by glial-derived neurotrophic factor. Int J Cancer 137(5): 1012-1020. |
| Shibata et al., (2007) Disturbed expression of the apoptosis regulators XIAP, XAF1, and Smac/DIABLO in gastric adenocarcinomas. Diagn Mol Pathol 16(1): 1-8. |
| Number | Date | Country | |
|---|---|---|---|
| 20210261965 A1 | Aug 2021 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62537475 | Jul 2017 | US | |
| 62618646 | Jan 2018 | US |
