Patent Grant
11530245
The instant application contains a Sequence Listing which has been submitted electronically in ASCII form and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Feb. 11, 2022, is named Sequence-Listing-V2_15060-1130_018745USNP.TXT and is 8,448 bytes in size.
Nature has evolved a wide array of protein-based materials and composites (e.g., silk, elastin, collagen) with mechanical properties and functions exceeding the performance of many synthetic polymers and even metal alloys. These remarkable properties arise from the multi-scale assembly of a narrow set of basic, repetitive peptide sequences. Engineering microbial cell factories for heterologous production of such proteins offers the opportunity to provide unlimited supplies of natural materials from cheap and renewable feedstocks (e.g., cellulosic biomass and simple sugars), presenting a sustainable and cost-effective approach to advanced material manufacturing. Further, editing protein sequences and engineering material assembly processes allow for tunable material properties and enable novel applications. Disclosed herein is a microbially-engineered process to produce strong adhesive mussel foot proteins (Mfps), and characterization properties of the synthesized Mfps.
Mfps secreted in the byssal threads of mussels have an extraordinary ability to adhere to various surfaces underwater, a feat which is unachievable by most chemical or synthetic adhesives. To date, seven main types of Mfps have been identified, and different Mfp types spatially organized at specific locations of the mussel byssal plaque have been found to serve different functions. While Mfp2 and Mfp4, which are localized at the core of the mussel byssal thread plaque, are mostly responsible for cohesive protein-protein interactions, the intrinsically disordered Mfp3 and Mfp5 are localized at the distal end of the plaque and play major roles in surface adhesion.
Among the different types of Mfps, Mfp5 has the highest known level of DOPA (˜26 mol %) and displays the highest adhesion strength (2.3-7 mJ m−2), resulting in the design of various DOPA-based synthetic biomimetic materials. Moreover, other residues and sequence features may also play important roles in surface adhesion. For example, over half of the tyrosine residues in Mfp5 have neighboring lysine residues, which are believed to assist in priming surfaces for facile interaction with DOPA, indicating that Mfps employ a more complex mechanism than just using DOPA-based interactions. Fully understanding the sequence-structure-function relationship is ultimately key to designing better biomimetics, and recombinant Mfp5 is an attractive adhesive material for various applications, such as in surgical and medical glues and for underwater repair.
Recombinant Mfp5 has been previously expressed in E. coli. After enzymatic conversion of tyrosine residues to DOPA, the resulting protein displayed a surface adhesion force of 49 nN μm−1 (force normalized to the radius of a contacting probe). Recently, Mfp5 was fused to the major subunit of curli protein CsgA, which exposed the Mfp5 domain on the exterior of self-assembled curli fibers. The β-sheet structure of the curli fiber contains intermolecular hydrogen bonds, enabling interactions between multiple fused Mfp5 domains. The resulting material displayed underwater surface adhesion forces up to 120 nN μm−1. Covalent linking of multiple Mfp5 proteins at the proteins' termini also leads to strong underwater adhesives due to the increased probability of protein-surface interactions and the enhanced density of inter-protein interactions and entanglements, effectively reducing adhesion failure. As disclosed herein, a microbial-based approach has been developed to produce covalently linked Mfp5 oligomers to evaluate their underwater adhesion properties. Based on measurement, the high molecular weight Mfp oligomers (e.g., Mfp53) disclosed herein displayed higher underwater adhesivity than previous reports, and thus is more attractive as an adhesive and a coating material and has broader applications as described herein.
In one aspect, the present disclosure is directed a mussel foot protein (Mfp) comprising a full length polypeptide sequence from a mussel species, a partial polypeptide sequence from a mussel species, and combinations thereof.
In another aspect, the present disclosure is directed to a method for synthesizing a mussel foot protein (Mfp) oligomer protein, the method comprising: fusing an N-terminal split intein (IntN) to a first Mfp repeat to produce a Mfp-IntN fusion protein; fusing a C-terminal split intein (IntC) to a second Mfp repeat to produce an IntC-Mfp fusion protein; and mixing the Mfp-IntN fusion protein and the IntC-Mfp fusion protein to produce a Mfp oligomer protein.
In yet another aspect, the present disclosure is directed to a system for producing a mussel foot protein (Mfp) adhesive, the system comprising: a Mfp-IntN fusion protein; and an IntC-Mfp fusion protein.
The embodiments described herein may be better understood by referring to the following description in conjunction with the accompanying drawings.
Using synthetic DNA with codons optimized for E. coli expression, Mytilus galloprovincialis Mfp5 were designed together with Mfp5 oligomers containing two or three consecutive Mfp5 sequences (named Mfp52 and Mfp53) and cloned them into standardized expression vectors (
Multiple Mfps from different mussel species exist, each having a slightly different amino acid sequence. In some embodiments, different Mfps (e.g., Mfp1, Mfp2, Mfp3, Mfp4, Mfp5, etc.) are utilized in the methods disclosed herein to produce Mfp oligomers with any number of repeats. Further, as described herein, a Mfp oligomer can be made from several different combinations via split intein reactions. For example, in some embodiments Mfp53 is made from Mfp52-IntN and IntC-Mfp51. In other embodiments, Mfp53 is made from Mfp51-IntN and IntC-Mfp52.
In some embodiments, both Mfp51 and Mfp52 are produced in E. coli and purified using affinity chromatography to purities of 99.9% and 92.2%, respectively (
SIs are auto-catalytic peptides that catalyze the spontaneous splicing-ligation reactions between two SI-fused target proteins, assembling the two target proteins covalently in trans (
MALDI-TOF spectra of unmodified Mfp51 and Mfp51DOPA are shown in
MALDI-TOF spectra of unmodified Mfp52 and Mfp52DOPA are shown in
Peak force tapping atomic force microscopy (PFT-AFM) was used to examine asymmetric adhesive and cohesive characteristics of the Mfp5 proteins between a colloidal probe and a protein-adsorbed mica surface under aqueous conditions (see
A similar positive correlation was also observed using synthetic poly-dihydroxystyrene-co-styrene polymers. From the retract curves, the recovery distance was also measured, which is defined as the length between the point where maximum adhesion force is achieved and the point where the probe is re-established to the initial zero adhesion baseline.
Related to recovery distance, another critical material property for adhesives is adhesion work, also known as peel force or work of separation. In
The longest curing time that allowed a reliable approach-retract curve measurement for Mfp53DOPA was 200 s, because longer cure times produced adhesion strengths that were too high and prevented recovery of retract curves, even at the maximum AFM probe separation of our equipment (1 μm). At a cure time of 200 s, Mfp53DOPA exhibited an adhesion force of ˜201 nN μm−1 and an adhesion work of ˜68 fJ μm−1, values which are higher than previously reported for Mfp-mimetic adhesives (
Protein-protein interactions confer high cohesion, and thus overall adhesion between two surfaces. To analyze protein absorption to one surface, the Mfps disclosed herein were subjected to steady shear-flows in phosphate-buffered saline (PBS) buffer and quantified adsorbed protein amounts using a quartz crystal microbalance with dissipation monitoring (QCM-D). According to polymer physics, these conditions should lead to physical chain disentanglement, resulting in a thin and disperse protein layer from a soluble protein solution.
In accordance with the present disclosure, E. coli was successfully engineered to produce Mfp5-based adhesive proteins with strong underwater adhesion capabilities. Under the experimental conditions, Mfp53DOPA displayed high adhesion forces and adhesion works that were comparable to or higher than previously reported Mfp-mimetic adhesives. With a longer curing time, the adhesion force of Mfp53 could be even higher than what was measured, but was beyond the detection limit of the method disclosed herein. Such adhesive proteins can potentially be used to replace natural Mfps in a variety of applications, with even better performance due to their stronger underwater adhesion. The results demonstrated that protein-protein cohesive interactions play an important role in determining both adhesion force and adhesion work. Positive correlations were observed between Mfp5's molecular weight and its measured adhesion force and adhesion work. These correlations indicate that producing high molecular weight proteins might be a natural strategy to obtain extensive cohesive interactions, as evidenced in Mfp2 and Mfp4, which have the highest molecular weights within the byssal plaque core (45 kDa and 90 kDa, respectively) among all Mfps and play cohesive roles in mussel plaques. The observed molecular weight dependent adhesion can be used in design rules to guide future engineering efforts, creating even stronger underwater adhesives.
In some embodiments, a Mfp is disclosed comprising a full length polypeptide sequence from a mussel species, a partial polypeptide sequence from a mussel species, or combinations thereof. In some embodiments, the Mfp is selected from the group consisting of Mfp1, Mfp2, Mfp3, Mfp4, and Mfp5.
In some embodiments, the Mfp is an oligomer protein comprising a plurality of repeats of the Mfp within one protein molecule. In some embodiments, the oligomer protein is synthesized from a mixture of a Mfp-IntN fusion protein and an IntC-Mfp fusion protein. In some embodiments, the Mfp-IntN fusion protein is produced by fusing an N-terminal split intein (IntN) to a first Mfp repeat, and the IntC-Mfp fusion protein is produced by fusing a C-terminal split intein (IntC) to a second Mfp repeat.
In some embodiments, the first Mfp repeat is Mfp52, and the second repeat is Mfp51. In some embodiments, the oligomer protein is Mfp53, the Mfp-IntN fusion protein is Mfp52-IntN, and the IntC-Mfp fusion protein is IntC-Mfp51.
In some embodiments, the first Mfp repeat is Mfp51, and the second repeat is Mfp52. In some embodiments, the oligomer protein is Mfp53, the Mfp-IntN fusion protein is Mfp51-IntN, and the IntC-Mfp fusion protein is IntC-Mfp52. In some embodiments, the IntN and IntC are from a Cfa split intein (SI). In some embodiments, the Mfp-IntN fusion protein and the IntC-Mfp fusion protein are separately expressed from E. coli.
Chemicals and Reagents. Unless otherwise noted, all chemicals and reagents were obtained from Millipore Sigma (Saint Louis, Mo., USA). Plasmid purification and gel extraction kits were purchased from iNtRON Biotechnology (Seoul, South Korea). FastDigest restriction enzymes and T4 DNA ligase were purchased from Thermo Fisher Scientific (Austin, Tex., USA) and were used according to the suggested protocols from the manufacturer.
Plasmid Construction. A BioBrick system was used to facilitate cloning of two-part split intein-fused material protein domains. This system takes the following conditions into account: (a) split intein genes, ribosome binding sites (RBS), 5′-untranslated regions (5′-UTR), antibiotic resistance markers, promoters, and origins of replication are flanked with appropriate restriction sites that allow them to be easily swapped with other corresponding genes of interest, (b) restriction sites that exist within open reading frames introduce amino acids that are small, flexible, and are not expected to change the protein behavior and dynamics, (c) restriction sites are all distinct with respect to one another to facilitate the assembly of complete plasmids in one pot and in one step. All restriction sites used are schematically mapped out in
E. coli strain MDS42pdu was used as a host strain for cloning of all genes and plasmids in this study. The amino acid sequences of Mytilus galloprovincialis Mfp51, Mfp52, and Mfp53 were codon-optimized for E. coli expression using the Gene Designer 2.0 software package (DNA 2.0 Inc.). All designed DNA sequences were chemically synthesized by Integrated DNA Technologies Inc. (San Jose, Calif., USA) (Table 1). These synthetic genes were then amplified using polymerase chain reaction (PCR) with corresponding forward and reverse primers as listed in Table 2. All mfp5 genes were amplified with BglII and BamHI sites on the 5′ and 3′ ends, respectively, for insertion into the pE7a-AKTK-H6 backbone (AKTK is SEQ ID NO: 19) containing the same sites, which was previously PCR amplified from plasmid pE7a-GFP1, with the addition of short coding sequences, 5′-ATGGCTAAGACTAAACATCATCACCATCATCAC-3′(SEQ ID NO: 1), translating to N′-MAKTK-H6-C′ (SEQ ID NO: 2) (
To construct plasmids containing split intein-fused Mfp5 proteins, the amino acid sequences of Cfa N- and C-inteins (CfaN and CfaC, respectively) were first codon-optimized and chemically synthesized using the same method as described above. The synthesized gene containing the CfaN domain, which is flanked by NdeI and KpnI sites, and the CfaC domain, which is flanked by Kpn2I and XhoI sites, were digested directly from the synthesized DNA. The mfp52 and mfp51 genes were amplified with corresponding primers (Table 2) containing KpnI and Kpn2I restriction sites. Amplified mfp52 and mfp51 fragments were digested (
Expression of Recombinant Proteins. E. coli strain BL21(DE3) (Thermo Fisher Scientific, Waltham, Mass.) was used as a host strain for expression of Mfps. E. coli strains containing the plasmids listed in Table 3 were cultured in shake flasks with Luria-Bertani (LB) broth containing 10 g/L tryptone, g/L sodium chloride, and 5 g/L yeast extract with the appropriate antibiotic (100 μg/mL ampicillin). Fresh transformants were cultivated overnight in 50 mL LB medium at 37° C. Overnight cultures were then used to inoculate 1 L fresh LB medium in Erlenmeyer flasks at an initial OD600=0.08. Cultures were grown at 37° C. with shaking to OD600=0.6, then induced by addition of 500 μM (for Mfp51 and CfaC-Mfp51) or 50 μM (Mfp52 and Mfp52-CfaN) IPTG. The culture was further cultivated at 37° C. at 250 rpm for another 5-7 hours. Cells were harvested by centrifugation at 4,500×g for 20 min at 4° C. Centrifuged cell pellets were either directly extracted or stored at −80° C. until needed.
Protein Purification. For Mfp51 and Mfp52, cell pellets were resuspended in 10 mL of guanidine lysis buffer (6 M guanidine hydrochloride (BioBasic Inc., Amherst, N.Y., USA), 50 mM potassium phosphates, and 300 mM sodium chloride at pH 7.4) per gram of wet cells and lysed by agitation at 250 rpm. The lysates were centrifuged at 20,000×g for 20 min at 18° C. To reduce the viscosity, collected lysates were further sonicated on ice (to maintain a roughly ambient temperature) for 30 minutes with a QSonica probe sonicator using 5 seconds on/5 seconds off cycles. The lysates were filtered through 0.2 μm filter membranes. Both proteins were purified using an AktaPure Fast Protein Liquid Chromatograph (FPLC, GE Healthcare Inc., Chicago, Ill., USA) equipped with a 5 mL nickel affinity chromatography column (GE Healthcare). The column was pre-equilibrated with guanidine lysis buffer followed by sample loading. After washing with 5-10 column volumes (CVs) of guanidine wash buffer (6 M guanidine hydrochloride, 50 mM potassium phosphates, 300 mM sodium chloride, and 50 mM imidazole at pH 7.4), proteins were eluted and fractionated with 5-10 CVs of guanidine elution buffer (6 M guanidine hydrochloride, 50 mM potassium phosphates, 300 mM sodium chloride, and 250 mM imidazole at pH 7.4). Purified Mfp51 and Mfp52 proteins were examined by SDS-PAGE as shown in
Split-Intein Mediated Ligation and Purification of Mfp53. Cell pellets containing CfaC-Mfp51 and Mfp52-CfaN-His10 fusion proteins were separately resuspended in 10 mL of urea lysis buffer (8 M urea, 100 mM sodium phosphates, and 300 mM sodium chloride at pH 7.4) per gram of wet cells and lysed by agitation at 250 rpm overnight. The lysates were centrifuged at 20,000×g for 20 min at 18° C. Clear cell lysate was then mixed at a final reactant ratio of 4:1 (CfaC-Mfp51: Mfp52-CfaN-His10) based on densitometric analysis of Coomassie Blue-stained SDS-PAGE gels. The excess IntC-Mfp51 does not contain His-tag, thus can be easily separated from the ligated product. The lysate mixture was stirred at 30° C. for 8 hours. The mixed lysate was then filtered through a 0.2 μm filter membrane and purified by nickel affinity chromatography as described above.
Post-Translational Modification with Tyrosinase. Purified protein solutions were first dialyzed against 100 mM sodium acetates buffer at pH 5.5 using a 10 kDa molecular weight cut off (MWCO) dialysis membrane (Thermo Fisher Scientific). Dialyzed proteins were then diluted to a concentration of 4 mg/mL in 100 mM sodium acetates buffer at pH 5.5 with 100 mM ascorbic acid and filtered. Tyrosinase was added to a final concentration of 250 U mL−1, and the mixture was incubated at 37° C. with agitation at 250 rpm for 30 minutes. After the reaction, the solution was filtered, and the enzyme activity in the flow-through was quenched by adding 0.2 mL of 6 N HCl per mL of reaction. The solution was filtered a final time and then was dialyzed extensively in 5% acetic acid at 4° C. and lyophilized.
Matrix-Assisted Laser Desorption/Ionization-Time of Flight (MALDI-TOF) Mass Spectrometry (MS) Analysis. Purified proteins at a final concentration of ˜10 μM in 0.1 v/v %. trifluoroacetic acid (TFA) solution were mixed with dihydroxyacetophenone (DHAP) and spotted on a stainless steel MALDI target plate. Samples were analyzed using a Shimadzu AXIMA Resonance MALDI-TOF Mass Spectrometer (Shimadzu, Columbia, Md., USA) at the Saint Louis University Protein Core Facility. Positive-ion mass spectra analysis was conducted in standard linear mode with a laser power/acceleration voltage of 60-100 volts. The quadruple ion trap available for MS analysis was limited by a maximum m/z ratio of 15 kDa. For Mfp51DOPA with an expected molecular weight of 10978.02 Da, the single- and double-charged state peaks could be assigned at m/z values of 5489.01 and 3659.34, respectively (
AFM Colloidal Probe Analysis. Peak Force Tapping-Atomic Force Microscopy (PFT-AFM) was used to characterize the protein samples by measuring adhesion force and adhesion works using a colloidal probe AFM cantilever (
For sample preparation, 10 μL of protein solution in PBS buffer was pipetted on a mica surface and set quiescently for 30 minutes. After extensive washing, the mica surface was mounted on the AFM stage and the adsorbed protein was probed under a buffered condition (100 mM sodium phosphates pH 7.4). Bovine serum albumin (BSA) and unmodified Mfp51 were used as controls and measured under the same condition.
Approach curves were fitted to the Alexander-de Gennes (AdG) model:
where F is the measured adhesion force, Z is the measured separation distance, kB is the Boltzmann constant, T is the absolute ambient temperature (˜298 K), R is the contact probe radius (5 μm). L, h, and s are fitted parameters that represent equilibrium film thickness, the offset distance that considers material compressibility upon maximum probe contact, and the average distance between occupied sorption sites, respectively. This model has been used to describe the interaction of random-coil polymers and proteins on surfaces. The data was fit using MATLAB. Data far beyond the fitted equilibrium thicknesses were not included in order to prevent misfitting at larger separation distances. All fitted data had correlation coefficients (r2) of at least 99%.
The fitted equilibrium thickness (L) parameters were further compared with both the radii of gyration assuming random-coil configurations, <R>, and the end-to-end distances when the proteins are fully stretched out as rigid rods, Lr. These distances were calculated using the formulas:
<R>=√{square root over (N<l>2)} (2)
and
Lr=Nl (3)
where N is the number of amino acids in the protein and 1 is the length of one amino acid (3.5 angstroms).
Following probe approaching, the probe was cured on the protein sample for a delay time varying from 0 to 50 seconds for most measurements. The adhesion force was taken at the point of maximum force (most negative force). The adhesion work was calculated as the area “under” the retraction curve, relative to the zero nN baseline (
For the strongest oligomer tested, Mfp53DOPA, adhesion forces with each respective cure time tested were averaged and fit to a logistic model of the form:
where F is the measured adhesion force, t is the cure time, and A, B, and Q are fitted constants. This model was appropriate given the assumption that an infinitesimally small cure time would result in zero adhesion force, while an infinite cure time would result in a theoretical maximum adhesion force (represented by the fit constant ‘A’) upon complete underwater curing of the material. The log-log scaling of the adhesion force and cure time axes allowed for the fitted model to give rise to an unpatterned residual, which indicates a high quality of fitting (
Quartz Crystal Microbalance with Dissipation Monitoring (QCM-D) Analysis. Gold-coated quartz crystal sensors (QSX 301, Biolin Scientific, Gothenburg, Sweden) were used for QCM analysis. The sensors were cleaned by UV irradiation for 15 minutes, heated in a mixture of ammonia (25%) and hydrogen peroxide (30%) at 75° C. for 5 minutes, then thoroughly rinsed with distilled water, dried with N2, and subjected to 10 minutes of UV irradiation before being mounted in the QCM flow modules (Biolin Scientific). PBS buffer carrier solution was flowed through an injector valve into the flow cell modules containing the quartz sensors at a flow rate of 0.1 mL min−1 until stable baselines were achieved. Protein solutions were prepared to final concentrations of 10 μM (or 2 mg mL−1 in the case of BSA) in PBS buffer (100 mM sodium phosphates pH 7.4) and flowed through the flow cell at a flow rate of 10 μL min−1 for 60 minutes. PBS buffer carrier solution was flowed through to wash unbound protein off the quartz sensors until the frequency shift was stable (
where Δm is change in mass, Δf is change in crystal resonance frequency, A is the active area of the crystal between electrodes, μquartz is the shear modulus of the quartz crystal, ρquartz is the density of the quartz crystal, and Fquartz is the reference frequency. This equation can be simplified to:
Δm=−C·Δf (6)
where C (=17.7 ng cm2 Hz−1) is a constant that combines all constants relating to using gold-coated quartz sensors for deposition with the QCM instrument utilized herein.
When introducing elements of the present invention or the preferred embodiment(s) thereof, the articles “a”, “an”, “the”, and “said” are intended to mean that there are one or more of the elements. The terms “comprising,” “including”, and “having” are intended to be inclusive and mean that there may be additional elements other than the listed elements.
As various changes could be made in the above constructions without departing from the scope of the invention, it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
GCTAAGACTAAA
CATCATCACCATCACCAC
GGT
GGCGGTGGCAGCAGATCTGGATCTAGCAGCGAAG
expression tag,
His
6 affinity tag, and linker
& BioBrick cut sites
GCTAAGACTAAA
CATCATCACCATCACCAC
GGT
GGCGGTGGCAGCAGATCTTCAAGTGAAGAATATA
expression tag,
His
6 affinity tag, and linker
& BioBrick cut sites
native extein amino acids &
KpnI restriction site
TCCGGA
GCAGAATATTGCCTGTCTTACGACACA
native extein amino acids &
Kpn2I restriction site
AKTK
HHHHHH
GGGGSRSGSSSEEYKG
expression tag, His6
affinity tag, and linker
& BioBrick cut sites
AKTK
HHHHHH
GGGGSRSSSEEYKGGY
expression tag, His6
affinity tag, and linker
& BioBrick cut sites
AEYCLSYDTEILTVEYGFLPIGKIVEERI
amino acids
amino acids
This application claims priority to U.S. Provisional Patent Application No. 62/725,636, filed on Aug. 31, 2018, which is hereby incorporated by reference in its entirety.
This invention was made with government support under N00014-15-1-2515 awarded by the US Navy, Office of Naval Research. The government has certain rights in the invention.
| Number | Name | Date | Kind |
|---|---|---|---|
| 10870783 | Lee | Dec 2020 | B2 |
| 20030013148 | Evans et al. | Jan 2003 | A1 |
| 20110033891 | Cha et al. | Feb 2011 | A1 |
| 20120202748 | Cha et al. | Aug 2012 | A1 |
| 20140315276 | Albayrak et al. | Oct 2014 | A1 |
| 20160220727 | Lu | Aug 2016 | A1 |
| Number | Date | Country |
|---|---|---|
| 2518081 | Oct 2012 | EP |
| 2013045632 | Apr 2013 | WO |
| WO-2017132580 | Aug 2017 | WO |
| Entry |
|---|
| Cha, H.J., et al. 2008 Biotechnol J 3: 631-638. (Year: 2008). |
| Wang, J., et al. 2018 Biotechnol J 13:1800146 (12 pages). (Year: 2018). |
| Collier, J.H., et al. 2011 Biomaterials 32: 4198-4204. (Year: 2011). |
| Bowen, C.H., et al. 2018 Biomacromolecules 19: 3853-3860. (Year: 2018). |
| Stevens, A.J., et al. 2016 J Am Chem Soc 138: 2162-2165. (Year: 2016). |
| Albayrak et al., “Direct polymerization of proteins”, ACS Synth. Biol., 2014, vol. 3, pp. 353-362. |
| Evans et al., “The cyclization and polymerization of bacterially expressed proteins using modified self-splicing inteins”, J. Biol. Chem. 1999, vol. 274, pp. 18359-18363. |
| Hwang et al., “Practical recombinant hybrid mussel bioadhesive fp-151”, Biomaterials., 2007, vol. 28, pp. 3560-3568. |
| Choi et al., “Recombinant mussel adhesive protein fp-5 (MAP fp-5) as a bulk bioadhesive and surface coating material”, Biofouling., 2011, vol. 27, No. 7, pp. 729-737. |
| Number | Date | Country | |
|---|---|---|---|
| 20200071368 A1 | Mar 2020 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62725636 | Aug 2018 | US |
