Patent Grant
11578335
This application is a U.S. 371 National Phase of International Application No. PCT/US2017/018196, filed on Feb. 16, 2017, which claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 62/295,997, filed on Feb. 16, 2016, which are hereby incorporated herein by reference in their entireties.
A Sequence Listing is provided herewith as a text file, “UCSDP044US_corrected2.txt” created on Dec. 14, 2020 and having a size of 205,667 bytes. The contents of the text file are incorporated by reference herein in their entirety.
Algae are among the most ancient and diverse organisms on the planet. Microalgae have evolved to adapt to a wide range of environments and consequently have proven to be a rich source of genetic and chemical diversity (Blunt et al., 2012; Gimpel et al., 2013; Parker et al., 2008). This diversity has been exploited as a unique source of bioactive compounds, including antioxidants, omega 3 fatty acids, and potentially novel therapeutic drugs (Cardozo et al., 2007). In addition, microalgae have also proven to be cost-effective and safe hosts for expressing a wide array of recombinant proteins, including human and animal therapeutics, vaccines, and industrial enzymes (Georgianna et al., 2013; Griesbeck and Kirchmayr, 2012; Rosales-Mendoza et al., 2012; Specht et al., 2010).
Chlamydomonas reinhardtii is a long established model system for studying molecular and genetic systems of algae. The most successful advances in recombinant protein expression within C. reinhardtii have been within the chloroplast where exogenous protein levels have reached almost 10% of total soluble protein (Manuell et al., 2007). This progress has been aided by the fact that gene integration occurs exclusively by homologous recombination within the plastid (Fischer et al., 1996). The chloroplast also has strong, well-characterized promoters and regulatory untranslated regions (UTRs) to enable high levels of transgene expression (Rosales-Mendoza et al., 2012; Specht et al., 2010). The most successful regulatory elements are those from endogenous highly expressed photosynthetic proteins (Gimpel and Mayfield, 2013; Rosales-Mendoza et al., 2012; Specht et al., 2010). However, recent work in the Mayfield laboratory has shown that high-throughput analysis of synthetic 5′ UTRs can identify novel regulatory elements and lead to increased transgene expression within the plastid (Specht and Mayfield, 2012).
While advancements have been made in heterologous nuclear gene expression in C. reinhardtii over the last several years (Rasala et al., 2013; Rasala et al., 2012; Schroda et al., 2000), these tools still lags significantly behind both plastid gene expression in algae, as well heterologous gene expression in many other eukaryotic organisms. Controlled nuclear gene expression is an essential tool for synthetic biology in any industrial microorganisms. Recent advances also allow protein products to be targeted to any cellular location in C. reinhardtii (Rasala et al., 2013). Targeted expression is essential for metabolic engineering, since enzymes need to be localized to their functional site. Proper localization is also important for the production of high-value protein products. Specific organelles may be better suited for proper post-translational modification and folding of complex proteins. In particular, chloroplasts lack the enzymes involved in protein glycosylation, an essential modification for many therapeutic proteins (Lingg et al., 2012). Finally, nuclear expression allows for the secretion of recombinant proteins, which can lead to simpler and cheaper downstream processing (Corchero et al., 2013).
One of the main reasons for poor heterologous gene expression from the nuclear genome of algae is the lack of strong promoters (Rosales-Mendoza et al., 2012; Specht et al., 2010). Studies have identified several endogenous promoters that promote exogenous gene expression, including those from the well-characterized and highly expressed genes such as those for the Rubisco small subunit (RBCS2), heat shock protein 70A (HSP70A), and photosystem I protein psaD (Cerutti et al., 1997; Schroda et al., 2000; Fischer and Rochaix, 2001). In an attempt to increase expression above the modest levels achieved with these native promoters, chimeric promoters have been developed that contain the heat shock 70A promoter region fused upstream of the RBCS2 promoter (arl), which has led to increased transcription (Schroda et al., 2002; Schroda et al., 2000; Wu et al., 2008). However, protein accumulation from exogenous genes expressed using this best chimeric promoter is still poor, with recombinant protein levels peaking around 0.25% of total soluble protein, which is well below the level of economic viability for almost any recombinant protein product. Finally, viral promoters that are favored in higher plant expression systems have been shown to be minimally successful in algal systems (Diaz-Santos et al., 2013). Therefore, novel regulatory elements must be identified or generated and combined into robust promoters capable of driving high rates of transcription in order to achieve the robust exogenous protein expression required to make algae a true industrial organisms.
Several recent reviews have highlighted the generation of synthetic promoters and promoter libraries as important biobricks for protein expression and, in particular, systems engineering (Blazeck and Alper, 2013; Hammer et al., 2006; Mukherji and van Oudenaarden, 2009; Ruth and Glieder, 2010). Engineered promoters have demonstrated the ability to drive exogenous gene expression above levels achieved by the best native promoter systems. In addition, development of libraries of designer promoters is essential for systems engineering. The synthetic nature of these promoters reduces or eliminates the chance of homology dependent gene silencing and can potentially allow them to be utilized in multiple species or cell lines. In this study, publicly available mRNA expression data was utilized to identify cis-motifs found in promoters of highly expressed C. reinhardtii genes. These motifs were then used to generate a novel set of completely synthetic algal promoters (saps) that allowed for high constitutive gene expression within the C. reinhardtii nucleus. A combination of analyzes of these native promoters and novel saps revealed previously uncharacterized C. reinhardtii promoter structures including a newly identified core DNA motif important for promoter function in highly transcribed genes.
Provided are synthetic promoters useful for high level transcription or expression of polynucleotides in an algal cell. Accordingly, in one aspect, provided is a synthetic promoter capable of promoting and/or initiating transcription of a polynucleotide in an algal cell. In varying embodiments, the synthetic promoter comprising from 3 to 30, e.g., from 3 to 27, e.g., from 3 to 25, e.g., from 3 to 20, e.g., from 3 to 15, e.g., from 3 to 10, e.g., from 3 to 5, promoter (cis)-elements selected from the group consisting of the sequences in Tables 1 and 2, and
In another aspect, provided is an expression cassette comprising a synthetic promoter as described above and herein.
In another aspect, provided is a vector comprising the expression cassette comprising a synthetic promoter as described above and herein. In varying embodiments, the vector is a plasmid vector.
In another aspect, provided is a cell comprising a synthetic promoter, or an expression cassette or vector comprising the synthetic promoter, as described above and herein. In varying embodiments, the cell is a green algal cell. In varying embodiments, the cell is a Chlamydomonas cell. In varying embodiments, the cell is a Chlamydomonas reinhardtii cell. In varying embodiments, the cell overexpresses, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or more, greater than a control, one or more transcription factors encoded by a polynucleotide comprising at least about 60% sequence identity, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity, to SEQ ID NOs:87-178, e.g., SEQ ID NO:150 (TF64). In varying embodiments, the cell underexpresses, e.g., by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, or more, less than a control, one or more transcription factors encoded by a polynucleotide comprising at least about 60% sequence identity, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity, to SEQ ID NOs:87-178, e.g., SEQ ID NO: 150 (TF64).
In a further aspect, provided is a method of transcribing or expressing a polynucleotide, e.g., in vitro or in an algal cell. In varying embodiments, the methods comprise contacting a polymerase to a polynucleotide comprising the synthetic promoter operably linked to a coding polynucleotide under conditions that allow the polymerase to transcribe the coding polynucleotide under the control of the synthetic promoter. In varying embodiments, the methods comprise introducing into the algal cell the polynucleotide operably linked to, e.g., and under the promoter control of, a synthetic promoter as described and herein. In a further aspect, provided is a method of increasing the transcription of a polynucleotide in an algal cell. In varying embodiments, the methods comprise introducing into the algal cell the polynucleotide operably linked to, e.g., and under the promoter control of, a synthetic promoter as described and herein. In varying embodiments, transcription of the polynucleotide is increased in response to light exposure and the synthetic promoter comprises one or more promoter (cis)-elements selected from the group consisting of the sequences in
In a further aspect, provided is a method of designing, constructing and/or assembling a synthetic promoter, e.g., as described herein. In varying embodiments, the methods comprise assembling or arranging at least about 3 (cis)-elements, e.g., from 3 to 30, e.g., from 3 to 27, e.g., from 3 to 25, e.g., from 3 to 20, e.g., from 3 to 15, e.g., from 3 to 10, e.g., from 3 to 5, promoter (cis)-elements selected from the sequences in Tables 1 and 2, and
In a further aspect, provided is a synthetic nuclear transcription system, the system comprising a synthetic promoter as described above and herein, operably linked to a polynucleotide of interest, and one or more transcription factors encoded by a polynucleotide comprising at least about 60% sequence identity, e.g., 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity, to SEQ ID NOs:87-178, e.g., SEQ ID NO: 150 (TF64). The systems can be used for in vitro or in vivo transcription. In some embodiments of the system, transcription of the polynucleotide is increased in response to light exposure and the synthetic promoter comprises one or more promoter (cis)-elements selected from the group consisting of the sequences in
In another aspect, provided is a kit comprising a synthetic promoter, or an expression cassette or vector or cell comprising the synthetic promoter, as described above and herein. In another aspect, provided is a kit comprising the synthetic nuclear transcription system, including green algal cells comprising the synthetic promoters and optionally overexpressed or underexpressed transcription factors, as described herein.
Definitions
Unless otherwise provided, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art of genetics, bioinformatics, and gene design. General dictionaries containing many of the terms used in this disclosure are: Singleton et al. (1994) Dictionary of Microbiology and Molecular Biology, 2nd Ed., John Wiley and Sons, New York; and Hale and Marham (1991) The Harper Collins Dictionary of Biology, Harper Perennial, New York. Any methods and materials similar or equivalent to those described herein may be used in the practice or testing of embodiments of the invention, though certain methods and materials are exemplified by those disclosed herein.
Codon optimization: As used herein, the term “codon optimization” refers to processes employed to modify an existing coding sequence, or to design a coding sequence in the first instance, for example, to improve translation in an expression host cell or organism of a transcript RNA molecule transcribed from the coding sequence, or to improve transcription of a coding sequence. Codon optimization includes, but is not limited to, processes including selecting codons for the coding sequence to suit the codon preference of the expression host organism. Codon optimization also includes, for example, the process sometimes referred to as “codon harmonization,” wherein codons of a codon sequence that are recognized as low-usage codons in the source organism are altered to codons that are recognized as low-usage in the new expression host. This process may help expressed polypeptides to fold normally by introducing natural and appropriate pauses during translation/extension. Birkholtz et al. (2008) Malaria J. 7:197-217. Codon optimization can also include codon abundance in relation to tRNA availability under certain conditions.
It will be understood that, due to the redundancy of the genetic code, multiple DNA sequences may be designed to encode a single amino acid sequence. Thus, optimized DNA sequences may be designed, for example, to remove superfluous restriction sites and undesirable RNA secondary structures, while optimizing the nucleotide sequence of the coding region so that the codon composition resembles the overall codon composition of the host in which the DNA is to be expressed.
Modify: As used herein, the terms “modify” or “alter,” or any forms thereof, mean to modify, alter, replace, delete, substitute, remove, vary, or transform.
Nucleic acid molecule: As used herein, the term “nucleic acid molecule” may refer to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide. A “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” A nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single- and double-stranded forms of DNA. A nucleic acid molecule can include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications (e.g., uncharged linkages: for example, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.; charged linkages: for example, phosphorothioates, phosphorodithioates, etc.; pendent moieties: for example, peptides; intercalators: for example, acridine, psoralen, etc.; chelators; alkylators; and modified linkages: for example, alpha anomeric nucleic acids, etc.). The term “nucleic acid molecule” also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations.
Operably linked: A first nucleotide sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. When recombinantly produced, operably linked nucleic acid sequences are generally contiguous, and, where necessary to join two protein-coding regions, in the same reading frame (e.g., in a polycistronic ORF). However, nucleic acids need not be contiguous to be operably linked.
The term, “operably linked,” when used in reference to a regulatory sequence and a coding sequence, means that the regulatory sequence affects the expression of the linked coding sequence. “Regulatory sequences,” or “control elements,” refer to nucleotide sequences that influence the timing and level/amount of transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters; translation leader sequences; introns; enhancers; stem-loop structures; repressor binding sequences; termination sequences; and polyadenylation recognition sequences. Particular regulatory sequences may be located upstream and/or downstream of a coding sequence operably linked thereto. Also, particular regulatory sequences operably linked to a coding sequence may be located on the associated complementary strand of a double-stranded nucleic acid molecule.
Promoter: As used herein, the term “promoter” refers to a region of DNA that may be upstream from the start of transcription, and that may be involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A promoter may be operably linked to a coding sequence for expression in a cell, or a promoter may be operably linked to a nucleotide sequence encoding a signal sequence which may be operably linked to a coding sequence for expression in a cell.
Vector: A nucleic acid molecule as introduced into a cell, for example, to produce a transformed cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. Examples of vectors include, but are not limited to: a plasmid; cosmid; bacteriophage; or virus that carries exogenous DNA into a cell. A vector may also include one or more genes, antisense molecules, and/or selectable marker genes and other genetic elements known in the art. A vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and/or proteins encoded by the vector. A vector optionally includes materials to aid in achieving entry of the nucleic acid molecule into the cell (e.g., a liposome, and protein coating).
Expression: As used herein, the term “expression” may refer to the transcription and stable accumulation of mRNA encoded by a polynucleotide, or to the translation of such an mRNA into a polypeptide. The term “over-expression,” as used herein, refers to expression that is higher than endogenous expression of the same or a closely related gene. A heterologous gene is over-expressed if its expression is higher than that of a closely-related endogenous gene (e.g., a homolog).
The terms “identical” or percent “identity,” and variants thereof in the context of two or more polynucleotide sequences, refer to two or more sequences or subsequences that are the same. Sequences are “substantially identical” if they have a specified percentage of nucleic acid residues or nucleotides that are the same (i.e., at least 60% identity, optionally at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity over a specified region (or the whole reference sequence when not specified)), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms (e.g., as described below and herein) or by manual alignment and visual inspection. The present invention provides polynucleotides improved for expression in algal host cells that are substantially identical to the polynucleotides AAACCCAAC, AAACCCATC, AACAGCCAG, AACTGAGG, ACCCCATCGC (Seq ID NO: 24), ACGGCCAT, AGCAAGTC, AGCAAGTC, AGCAATTT, ATGCATTA, CAACACACC, CACGAACC, CACGCCCTG, CGCTCGGC, and/or CGGGCCCA. Optionally, the identity exists over a region that is at least about 50 amino acids in length, or more preferably over a region that is 100, 200, 300, 400, 500, 600, 800, 1000, or more, nucleic acids in length, or over the full-length of the sequence.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
The term “comparison window”, and variants thereof, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can also be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needle man and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis.), Karlin and Altschul Proc. Natl. Acad. Sci. USA, 87: 2264-2268(1990), or by manual alignment and visual inspection (see, e.g., Ausubel et al., Current Protocols in Molecular Biology (1995 supplement)). Examples of an algorithm that is suitable for determining percent sequence identity and sequence similarity include the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al. (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (on the internet at ncbi.nlm.nih.gov/).
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
1. Introduction
Algae have enormous potential as bio-factories for the efficient production of a wide array of high-value products, and eventually as a source of renewable biofuels. However, tools for engineering the nuclear genomes of algae remain scarce and limited in functionality. We generated synthetic algal promoters (saps) as a tool for increasing nuclear gene expression and as a model for understanding promoter elements and structure in green algae. Promoters were generated to mimic native cis-motif elements, structure, and overall nucleotide composition of top expressing genes from Chlamydomonas reinhardtii. Twenty five saps were used to drive expression of a fluorescent report in transgenic algae. A majority of the promoters were functional in vivo and seven were identified to drive expression of the fluorescent reporter better than the current best endogenous promoter in C. reinhardtii, the chimeric hsp70/rbs2 promoter. Further analysis of the best synthetic promoter, sap11, revealed a new DNA motif essential for promoter function that is widespread and highly conserved in C. reinhardtii. These data demonstrate the utility of synthetic promoters to drive gene expression in green algae, and lays the groundwork for the development of a suite of saps capable of driving the robust and complex gene expression that will be required for algae to reach their potential as an industrial platform for photosynthetic bio-manufacturing.
2. Synthetic Promoters
Provided are synthetic promoters useful for high level transcription or expression of polynucleotides in an algal cell. Accordingly, in one aspect, provided is a synthetic promoter capable of promoting and/or initiating transcription of a polynucleotide in an algal cell. In varying embodiments, the synthetic promoter comprising from 3 to 30, e.g., from 3 to 27, e.g., from 3 to 25, e.g., from 3 to 20, e.g., from 3 to 15, e.g., from 3 to 10, e.g., from 3 to 5, promoter (cis)-elements selected from the group consisting of promoter (cis)-elements shown in Table 1 and (
Various additional cis elements are shown in Table 2.
In certain embodiments, the synthetic promoter comprises one or more Myb family, SBP family, bHLH family, C2H2 family, bZIP family, C3H family, Dof family or G2 family transcriptional factor binding site motifs. In certain embodiments, the synthetic promoter comprises one or more transcriptional factor binding site motifs selected from the group consisting of the sequences in
The (cis)-elements are positioned or arranged within a promoter scaffold or backbone. In varying embodiments, the nucleic acid base of highest probability or second highest probability at a particular position of the promoter scaffold or backbone (e.g., based on known native promoter sequences) relative to the transcriptional start site (TSS) is assigned to that position, e.g., as indicated in Table 3.
In varying embodiments, the synthetic promoter scaffold or backbone is derived from a promoter capable of expression of a polynucleotide in an algal cell, e.g., in the nucleus or a plastid organelle (e.g., a chloroplast). In varying embodiments, the synthetic promoter scaffold or backbone is derived from a promoter capable of driving expression in an algal cell selected from the group consisting of psbA, atpA, psbD, TufA and atpB. See, e.g., U.S. Patent Publication No. 2012/0309939.
In varying embodiments, the promoter comprises a nucleic acid sequence of a synthetic promoter shown in Table 4 (e.g., any one of SEQ ID NOs:38-62).
GGCCCGCTCTTCCGCTGCGCGTTAGAAGCGAGGCAGCATC
TCGCGACCGAACCCAGCAAGGTGCGTCAAGATCGCTGTCG
GTGCCCACACCTTTCTAGTCGTTCTTCGCCACCACCAACAA
ATTTTGGTACGGCGTGCGTCACTTGCATGGGGCTGGCCCAT
TGCAATGAGATGGGCGCATGGGGCGCTCAATTGTCTGCGA
CCGACTCACTTCGTCGCAACCACCTTTCGTGAGTAGGTAGT
In varying embodiments, the promoter is at least about 200 bp in length and up to about 500 bp, 600 bp, 700 bp, 750 bp, 800 bp, 900 bp or 1000 bp in length. In varying embodiments, the synthetic promoter promotes transcription levels that are at least about 2-fold greater, e.g., 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, or more, greater than a control promoter (e.g., a random polynucleotide sequence or a native promoter). In varying embodiments, the control promoter is the arl promoter. In varying embodiments, the control promoter is selected from psbA, atpA, psbD, TufA and atpB.
The synthetic promoters find use, e.g., for the expression of a polynucleotide of interest in an algal cell, e.g., a green algal cell, including a Chlamydomonas, Dunaliella, Haematococcus, Chlorella, or Scenedesmaceae cell.
3. Expression Cassettes, Vectors, Algal Cells, Kits
a. Expression Cassettes
Further provided are expression cassettes comprising the synthetic promoters as described above and herein, operably linked to a polynucleotide of interest to be transcribed. In some embodiments, the polynucleotide encodes a protein of interest, e.g., for expression in an algal cell. In varying embodiments, coding polynucleotide sequences can be improved for expression in photosynthetic organisms (e.g., algae) by changing codons that are not common in the algae host cell (e.g., used less than ˜20% of the time). A codon usage database of use is found at kazusa.or.jp/codon/. For improved expression of coding polynucleotide sequences in C. reinhardtii host cells, codons rare or not common to the nucleus or chloroplast of C. reinhardtii in the native nucleic acid sequences are reduced or eliminated. A representative codon table summarizing codon usage in the C. reinhardtii chloroplast is found on the internet at kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=3055.chloroplast.
As appropriate, the expression cassettes can further comprise terminating sequences, enhancers and other regulatory and/or linking sequences. In varying embodiments, the expression cassette comprises a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. Certain control regions (including subsequences within the synthetic promoter) may be native to the gene, or may be derived from an exogenous source.
b. Vectors
Further provided are vectors comprising the synthetic promoters and/or expression cassettes as described above and herein. The vector can be any appropriate form known in the art for introduction of a recombinant expression cassette comprising the synthetic promoters in an algal cell. In varying embodiments, the vectors can integrate into the genome of an algal cell (nuclear or plastid, e.g., chloroplast), or can support episomal expression (e.g., in either the algal cell nucleus or plastid, e.g., chloroplast). In varying embodiments, the vector is a DNA plasmid. In varying embodiments, the vector is a virus. In varying embodiments, the vector is a polynucleotide suitable for homologous recombination, e.g., into the genome of an algal cell.
Numerous suitable expression vectors are known to those of skill in the art. The following vectors are provided by way of example; for bacterial host cells: pQE vectors (Qiagen), pBluescript plasmids, pNH vectors, lambda-ZAP vectors (Stratagene), pTrc99a, pKK223-3, pDR540, and pRIT2T (Pharmacia); for eukaryotic host cells: pXT1, pSG5 (Stratagene), pSVK3, pBPV, pMSG, pET21a-d(+) vectors (Novagen), and pSVLSV40 (Pharmacia). However, any other plasmid or other vector may be used so long as it is compatible with the host cell. For example, illustrative vectors including without limitation, psbA-kanamycin vector can be used for the expression of one or more proteins, e.g., in the plastids of a photosynthetic organism. The synthetic promotors described herein can replace the promoters in the commercially available plasmid.
Knowledge of the chloroplast genome of the host organism, for example, C. reinhardtii, is useful in the construction of vectors for use in the disclosed embodiments. Chloroplast vectors and methods for selecting regions of a chloroplast genome for use as a vector are well known (see, for example, Bock, J. Mol. Biol. 312:425-438, 2001; Staub and Maliga, Plant Cell 4:39-45, 1992; and Kavanagh et al., Genetics 152:1111-1122, 1999, each of which is incorporated herein by reference). The entire chloroplast genome of C. reinhardtii is available to the public on the world wide web, at the URL “biology.duke.edu/chlamy_genome/-chloro.html” (see “view complete genome as text file” link and “maps of the chloroplast genome” link; J. Maul, J. W. Lilly, and D. B. Stern, unpublished results; revised Jan. 28, 2002; to be published as GenBank Ace. No. AF396929; and Maul, J. E., et al. (2002) The Plant Cell, Vol. 14 (2659-2679)). Generally, the nucleotide sequence of the chloroplast genomic DNA that is selected for use is not a portion of a gene, including a regulatory sequence or coding sequence. For example, the selected sequence is not a gene that if disrupted, due to the homologous recombination event, would produce a deleterious effect with respect to the chloroplast. For example, a deleterious effect on the replication of the chloroplast genome or to a plant cell containing the chloroplast. In this respect, the website containing the C. reinhardtii chloroplast genome sequence also provides maps showing coding and non-coding regions of the chloroplast genome, thus facilitating selection of a sequence useful for constructing a vector (also described in Maul, I. E., et al. (2002) The Plant Cell, Vol. 14 (2659-2679)). For example, the chloroplast vector, p322, is a clone extending from the Eco (Eco RI) site at about position 143.1 kb to the Xho (Xho I) site at about position 148.5 kb (see, world wide web, at the URL “biology.duke.edu/chlamy_genome/chloro.html”, and clicking on “maps of the chloroplast genome” link, and “140-150 kb” link; also accessible directly on world wide web at URL “biology.duke.edu/chlam-y/chloro/chloro140.html”).
Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding exogenous proteins. A selectable marker operative in the expression host may be present in the vector.
The expression cassettes comprising the synthetic promoters disclosed herein may be inserted into a vector by a variety of methods. In the most common method the sequences are inserted into an appropriate restriction endonuclease site(s) using procedures commonly known to those skilled in the art and detailed in, for example, Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012) and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons (through 2016). Polymerase and recombinase methods such as restriction free cloning (Bond, et al., Nucleic Acids Res. (2012) July; 40(Web Server issue):W209-13; PMID: 22570410) and Seamless Ligation Cloning Extract (SLiCE) (Zhang, et al, Nucleic Acids Res. (2012) April; 40(8):e55; PMID: 22241772) may also be employed.
c. Algal Cells
Further provided is a cell or population of cells comprising the synthetic promoters and/or expression cassettes and/or vectors as described above and herein. The algal cells may comprise the synthetic promoter integrated into their genome (plastid or nuclear), or within an episomal vector. In varying embodiments, the cell or population of cells are algal cells. In some embodiments, the cell or population of cells are green algal cells. In varying embodiments, the green algae is selected from the group consisting of Chlamydomonas, Dunaliella, Haematococcus, Chlorella, and Scenedesmaceae. In some embodiments, the Chlamydomonas is a Chlamydomonas reinhardtii. In varying embodiments, the green algae can be a Chlorophycean, a Chlamydomonas, C. reinhardtii, C. reinhardtii 137c, or a psbA deficient C. reinhardtii strain.
Transformation of host cells to contain the synthetic promoters and/or expression cassettes and/or vectors as described above and herein includes transformation with circular vectors, linearized vectors, linearized portions of a vector, or any combination of the above. Thus, a host cell comprising a vector may contain the entire vector in the cell (in either circular or linear form), or may contain a linearized portion of a vector of the present disclosure.
d. Kits
Further provided is a kit comprising the synthetic promoters and/or expression cassettes and/or vectors and/or cells or population of cells and/or synthetic nuclear transcription systems as described above and herein. In varying embodiments, the expression cassettes and/or vectors can comprise multiple cloning sites to allow for the convenient insertion of a coding polynucleotide that is operably linked to the synthetic promoter. In varying embodiments, the kits comprising a synthetic nuclear transcription system additionally comprise one or more transcription factors, or cell comprising one or more transcription factors, e.g., as encoded by one or more of SEQ ID NOs:87-178, e.g., SEQ ID NO:150 (TF64). In varying embodiments, the kits can comprise an algal cell or population of algal cells as described herein. As appropriate, the algal cells can be fresh or frozen. The algal cells may comprise the synthetic promoter integrated into their genome (nuclear or plastid, e.g., chloroplast), or within an episomal vector.
4. Methods of Designing Synthetic Promoters
Further provided is a method of designing, constructing and/or assembling a synthetic promoter, e.g., as described herein. In varying embodiments, the methods comprise assembling or arranging at least about 3 (cis)-elements, e.g., from 3 to 30, e.g., from 3 to 27, e.g., from 3 to 25, e.g., from 3 to 20, e.g., from 3 to 15, e.g., from 3 to 10, e.g., from 3 to 5, promoter (cis)-elements selected from the group consisting of the sequences in Tables 1 and 2 within a promoter scaffold or backbone. As appropriate, the placement of the (cis)-elements or the constructing of the promoter scaffold or backbone can be designed, constructed or assembled first. In varying embodiments, the promoter (cis)-elements are positioned or located within the promoter relative to the transcriptional start site (TSS) as indicated in Table 1. In varying embodiments, the promoter is at least about 200 bp in length and up to about 500 bp, 600 bp, 700 bp, 750 bp, 800 bp, 900 bp or 1000 bp in length. In varying embodiments, the synthetic promoter promotes transcription levels that are at least 2-fold greater, e.g., 3-fold, 4-fold, 5 fold, 6-fold, 7-fold, 8-fold, 9-fold, 10 fold, or more, greater than a control promoter (e.g., a random polynucleotide sequence or a native promoter). In varying embodiments, the nucleic acid base of highest probability or second highest probability at a particular position of the promoter scaffold or backbone relative to the transcriptional start site (TSS) is assigned to that position, e.g., as indicated in Table 3. In varying embodiments, the method is computer implemented.
5. Methods of Making Synthetic Promoters
The synthetic promoters can be made using any method known in the art, including recombinant and chemically synthesized techniques. Chemically synthesized promoters can by comprised entirely of native or naturally occurring DNA bases, or can contain one or more modified bases or derivatives. Modified bases are well known in the art, and include, e.g., 2-Aminopurine, 2,6-Diaminopurine (2-Amino-dA), 5-Bromo-deoxyuridine, deoxyUridine, inverted dT, Inverted Dideoxy-T, Dideoxycytidine (ddC), 5-Methyl deoxycytidine, 2′-deoxyInosine (dI), DeoxyInosine, 5-hydroxybutynl-2′-deoxyuridine, 8-aza-7-deazaguanosine, locked nucleic acids (LNAs), 5-Nitroindole, 2′-O-Methyl RNA, Hydroxmethyl dC, Unlocked Nucleic Acids (UNAs) (UNA-A, UNA-U, UNA-C, UNA-G), Iso-dG, Iso-dC, and 2′ Fluoro bases (Fluro A, Fluro C, Fluoro G, Fluoro U).
6. Methods of Promoting Transcription
Further provided is a method of transcribing or expressing a polynucleotide, e.g., in vitro or in an algal cell. In varying embodiments, the methods comprise contacting a polymerase to a polynucleotide comprising the synthetic promoter operably linked to a coding polynucleotide under conditions that allow the polymerase to transcribe the coding polynucleotide under the control of the synthetic promoter. In varying embodiments, the methods comprise introducing into the algal cell the polynucleotide operably linked to, e.g., and under the promoter control of, a synthetic promoter as described and herein. In a further aspect, provided is a method of increasing the transcription of a polynucleotide in an algal cell. In varying embodiments, the methods comprise introducing into the algal cell the polynucleotide operably linked to, e.g., and under the promoter control of, a synthetic promoter as described and herein. In some embodiments, the transcription levels of the polynucleotide are increased at least about 2-fold greater, e.g., 3-fold, 4-fold, 5 fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, or more, greater than a control promoter (e.g., a random polynucleotide sequence or a native promoter). In varying embodiments, the (coding) polynucleotide operably linked to the synthetic promoter is codon-biased or codon-optimized for expression in an algal cell. A representative codon table summarizing codon usage in the C. reinhardtii chloroplast is found on the internet at “kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=3055.chloroplast.” In various embodiments, preferred or more common codons for amino acid residues in C. reinhardtii are shown in Table 5.
In varying embodiments, the algal cell is a green algal cell, as described herein. In varying embodiments, the algal cell is a Chlamydomonas cell. In varying embodiments, the algal cell is a Chlamydomonas reinhardtii cell.
To generate a genetically modified host cell, a polynucleotide, or a polynucleotide cloned into a vector, is introduced stably or transiently into a host cell, using established techniques, including, but not limited to, electroporation, biolistic, calcium phosphate precipitation, DEAE-dextran mediated transfection, and liposome-mediated transfection. For transformation, a polynucleotide of the present disclosure will generally further include a selectable marker, e.g., any of several well-known selectable markers such as restoration of photosynthesis, or kanamycin resistance or spectinomycin resistance.
A polynucleotide or recombinant nucleic acid molecule described herein, can be introduced into a cell (e.g., alga cell) using any method known in the art. A polynucleotide can be introduced into a cell by a variety of methods, which are well known in the art and selected, in part, based on the particular host cell. For example, the polynucleotide can be introduced into a cell using a direct gene transfer method such as electroporation or microprojectile mediated (biolistic) transformation using a particle gun, or the “glass bead method,” or by pollen-mediated transformation, liposome-mediated transformation, transformation using wounded or enzyme-degraded immature embryos, or wounded or enzyme-degraded embryogenic callus (for example, as described in Potrykus, Ann. Rev. Plant. Physiol. Plant Mol. Biol. 42:205-225, 1991).
As discussed above, microprojectile mediated transformation can be used to introduce a polynucleotide into a cell (for example, as described in Klein et al., Nature 327:70-73, 1987). This method utilizes microprojectiles such as gold or tungsten, which are coated with the desired polynucleotide by precipitation with calcium chloride, spermidine or polyethylene glycol. The microprojectile particles are accelerated at high speed, into a cell using a device such as the BIOLISTIC PD-1000 particle gun (BioRad; Hercules Calif). Methods for the transformation using biolistic methods are well known in the art (for example, as described in Christou, Trends in Plant Science 1:423-431, 1996). Microprojectile mediated transformation has been used, for example, to generate a variety of transgenic plant species, including cotton, tobacco, corn, hybrid poplar and papaya. Important cereal crops such as wheat, oat, barley, sorghum and rice also have been transformed using microprojectile mediated delivery (for example, as described in Duan et al., Nature Biotech. 14:494-498, 1996; and Shimamoto, Curr. Opin. Biotech. 5:158-162, 1994). The transformation of most dicotyledonous plants is possible with the methods described above. Transformation of monocotyledonous plants also can be transformed using, for example, biolistic methods as described above, protoplast transformation, electroporation of partially permeabilized cells, introduction of DNA using glass fibers, and the glass bead agitation method.
The basic techniques used for transformation and expression in photosynthetic microorganisms are similar to those commonly used for E. coli, Saccharomyces cerevisiae and other species. Transformation methods customized for photosynthetic microorganisms, e.g., the chloroplast of a strain of algae, are known in the art. These methods have been described in a number of texts for standard molecular biological manipulation (see Packer & Glaser, 1988, “Cyanobacteria”, Meth. Enzymol., Vol. 167; Weissbach & Weissbach, 1988, “Methods for plant molecular biology,” Academic Press, New York, Green and Sambrook, Molecular Cloning, A Laboratory Manual, 4th Ed., Cold Spring Harbor Press, (2012); and Clark M S, 1997, Plant Molecular Biology, Springer, N.Y.). These methods include, for example, biolistic devices (See, for example, Sanford, Trends In Biotech. (1988).delta.: 299-302, U.S. Pat. No. 4,945,050; electroporation (Fromm et al., Proc. Nat'l. Acad. Sci. (USA) (1985) 82: 5824-5828); use of a laser beam, electroporation, microinjection or any other method capable of introducing DNA into a host cell.
Plastid transformation is a routine and well known method for introducing a polynucleotide into a plant cell chloroplast (see U.S. Pat. Nos. 5,451,513, 5,545,817, and 5,545,818; WO 95/16783; McBride et al., Proc. Natl. Acad. Sci., USA 91:7301-7305, 1994). In some embodiments, chloroplast transformation involves introducing regions of chloroplast DNA flanking a desired nucleotide sequence, allowing for homologous recombination of the exogenous DNA into the target chloroplast genome. In some instances one to 1.5 kb flanking nucleotide sequences of chloroplast genomic DNA may be used. Using this method, point mutations in the chloroplast 16S rRNA and rps12 genes, which confer resistance to spectinomycin and streptomycin, can be utilized as selectable markers for transformation (Svab et al., Proc. Natl. Acad. Sci. USA, 87:8526-8530, 1990), and can result in stable homoplasmic transformants, at a frequency of approximately one per 100 bombardments of target leaves.
In some embodiments, an alga is transformed with one or more polynucleotides which encode one or more polypeptides, as described herein. In one embodiment, a transformation may introduce a nucleic acid into a plastid of the host alga (e.g., chloroplast). In another embodiment, a transformation may introduce a second nucleic acid into the chloroplast genome of the host alga. In still another embodiment, a transformation may introduce two protein coding regions into the plastid genome on a single gene, or may introduced two genes on a single transformation vector.
Transformed cells can be plated on selective media following introduction of exogenous nucleic acids. This method may also comprise several steps for screening. A screen of primary transformants can be conducted to determine which clones have proper insertion of the exogenous nucleic acids. Clones which show the proper integration may be propagated and re-screened to ensure genetic stability. Such methodology ensures that the transformants contain the genes of interest. In many instances, such screening is performed by polymerase chain reaction (PCR); however, any other appropriate technique known in the art may be utilized. Many different methods of PCR are known in the art (e.g., nested PCR, real time PCR). For any given screen, one of skill in the art will recognize that PCR components may be varied to achieve optimal screening results. For example, magnesium concentration may need to be adjusted upwards when PCR is performed on disrupted alga cells to which (which chelates magnesium) is added to chelate toxic metals. Following the screening for clones with the proper integration of exogenous nucleic acids, clones can be screened for the presence of the encoded protein(s) and/or products. Protein expression screening can be performed by Western blot analysis and/or enzyme activity assays. Product screening may be performed by any method known in the art, for example mass spectrometry, SDS PAGE protein gels, or HPLC or FPLC chromatography.
The expression of the protein can be accomplished by inserting a polynucleotide sequence (gene) encoding the protein or enzyme into the chloroplast genome of a microalgae. The modified strain of microalgae can be made homoplasmic to ensure that the polynucleotide will be stably maintained in the chloroplast genome of all descendants. A microalga is homoplasmic for a gene when the inserted gene is present in all copies of the chloroplast genome, for example. It is apparent to one of skill in the art that a chloroplast may contain multiple copies of its genome, and therefore, the term “homoplasmic” or “homoplasmy” refers to the state where all copies of a particular locus of interest are substantially identical. Plastid expression, in which genes are inserted by homologous recombination into all of the several thousand copies of the circular plastid genome present in each plant cell, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readily exceed 10% or more of the total soluble plant protein. The process of determining the plasmic state of an organism of the present disclosure involves screening transformants for the presence of exogenous nucleic acids and the absence of wild-type nucleic acids at a given locus of interest.
The following examples are offered to illustrate, but not to limit the claimed invention.
Materials and Methods.
POWRS Motif Identification. The top 50 highest-expressed endogenous genes were identified based on their RNA accumulation under ambient conditions according to previously published RNA-seq data (Fang et al., 2012). Since promoter structure is not strictly defined in Chlamydomonas reinhardtii the sequence between −1000 and +50 for the top 50 genes were analyzed using the POWRS motif identification program (Davis et al., 2012) (Phytozome 10.2, Chlamydomonas reinhardtii v4.3 and/or v5.5). All default settings on POWRS were used, except that the minimum number of sequences that a valid motif must match was lowered to ten.
Generation of synthetic promoters. Promoters were generated using random insertion of POWRs motifs, constraining positions relative to the positions of the motif clusters in the native sequences. Promoter backbones were generated to ensure similar GC content as the native promoters, including a periodic AT-rich regions (
Plasmid construction. The synthetic algal promoters were synthesized as gBlocks (IDT, Coralville, Iowa) integrating in DNA ends that allowed cloning via SLiCE technology (Zhang et al., 2012) (Table 7). All restriction enzymes were purchased from New England Biolabs (Ipswich, Mass.). The pBR4 expression vector with the hygromycin B resistance gene under the control of the B-tubulin promoter and a separate cassette with the mCherry gene driven by the arl promoter was used as the backbone (Berthold et al., 2002; Rasala et al., 2012). pBR4 was digested with NdeI and XbaI to remove the arl promoter up to end of the RBCS2 5′UTR and generate ends for SLiCE cloning. Synthetic promoters were cloned with the RBCS2 5′UTR, which was amplified with appropriate primers to allow 15 bp overhangs with the synthetic promoters as well the digested backbone (Table 7), resulting in the constructs in
C. reinhardtii growth and transformation. Wild-type (cc1690) C. reinhardtii were grown and transformed using the methods described previously using 1 μg of plasmid DNA (Rasala et al., 2012). Plasmid constructs were digested with KpnI to linearize them prior to electroporation. Transformants were first screened on TAP (Tris-acetate-phosphate)/agar plates containing 15 μg/ml hygromycin, resulting in approximately 5,000 to 12,000 transformants per selection. The entire transformant pool was then collected and transferred to liquid TAP medium for two days, followed by screening on the flow cytometer.
Flow cytometry measurement of mCherry fluorescence. mCherry fluorescence was visualized by a BD LSRII flow cytometer and analyzed using FlowJo v10.0.8. The population was gated using the following strategy: the FSC and SSC parameters were obtained using a 488 nm blue laser and were used to eliminate smaller non-algal samples and clumps of algae that can be misread as a single cell. Next, the 488 nm laser using a 685LP and a 710/50 filter set was used in combination with a 405 nm violet laser and 450/50 filter to remove dead cells and remaining debris from the population. The mCherry fluorescence was then measured with a 561 nm yellow/green laser with a 600LP and 610/20 filter set. To better visualize the population, the mCherry fluorescence channel was plotted against the window created by the 405 nm laser with a 505LP and 535/30 filter set. Using the untransformed parent strain as a reference, the events containing only background fluorescence were removed from the analysis. What remained was considered single-cell, living, C. reinhardii that is expressing mCherry. A representative window was selected from the remaining population and the mCherry fluorescence channel was broken down into individual events, resulting in 80 to 10,000 data points.
Genomic promoter motif analysis. For whole genome promoter analysis, genome sequence and annotation for Creinhardtii_281_v5.5 was obtained from phytozome.jgi.doe.gov (Merchant et al., 2007). Annotated 5′ UTR start sites were compared to PASA assembled EST start sites. Only 4,412 of the 22,892 total annotated 5′ UTR start sites were within 10 bp of a PASA EST start site and considered EST validated sites. Sequence from −1000 bp upstream to +500 bp downstream of the validated 5′ UTR start sites were analyzed for new motifs using DREME (Bailey, 2011). Then the promoter sequences were analyzed by CentriMo to identify POWRS or DREME motifs that are enriched in specific regions relative to the TSS (Bailey and Machanick, 2012).
96-well vs flow cytometry mCherry fluorescence measurement. Two independent pools of C. reinhardtii were grown and transformed as described in experimental procedures. Differences in transformation efficiencies resulted in twice as many transformants in pool 2 as in pool 1. Each pool was transformed twice each with arl or sap11 resulting in four independent pools of transformants. After selection on solid media, 24 transformants were picked from each plate and transferred to a 96-well plate with 200 μl TAP, grown to saturation, then diluted 1:20 in TAP. Transformed cells were grown until late log phase in TAP media without antibiotics. Cells (100 μl) were transferred to a black 96-well plate (Corning Costar, Tewksbury, Mass.). mCherry fluorescence (575 nm/608 nm) was read using a Tecan plate reader (Tecan Infinite M200 PRO, Männedorf, Switzerland). Fluorescence signals were normalized to chlorophyll fluorescence (440 nm/680 nm). After first 24 transformants were selected, the remaining transformants were collected from each plate and transferred to 50 ml TAP. mCherry fluorescence was measured as in experimental procedures. While, measurement of 24 transformants per construct resulted in variable results between experiments, measurement of 6000+ transformants resulted in consistent, reproducible results. This result was also independent of transformation efficiency.
Results
Native motif identification and saps generation. In order to generate saps capable of driving high heterologous gene expression, native C. reinhardtii genes were analyzed that showed the highest RNA accumulation in wild type (wt) cells grown under ambient conditions. The top 50 genes were identified based on previously published RNA-seq data (Fang et al., 2012). This data set was chosen because the growth conditions best match typical ambient small scale laboratory growth conditions for green algae. Promoter regions (−1000 to +50 nt from the transcription start site) from these genes were analyzed using the POWRs software (Davis et al., 2012). POWRs identifies motifs based not only on enriched sequences but also on the position of these elements within the promoter region. POWRs clusters sequences together based on similarity to create motif clusters that can be characterized by position weight matrixes. POWRs identified 127 motif clusters containing 979 unique motifs within the top 50 native gene promoters (
Analysis of the top 50 native promoters also revealed that there is a decrease in the GC content within 500 bp around the transcription start site (
Synthetic promoters were generated to include nucleotide backbones that had a similar GC profile as the native promoters, including the aforementioned AT-bias towards the TSS and AT rich regions at −280 and −140 bp (
Synthetic promoters drive transcription in vivo. Twenty five saps were studied for their ability to drive the expression of the mCherry fluorescent reporter protein. The saps were synthesized and cloned in front of an mCherry reporter gene, which also contained the 5′ and 3′ RBCS2 UTRs as well as the first RBCS2 intron (
Transformation of the C. reinhardtii nucleus occurs almost exclusively through non-homologous end-joining (Gumpel et al., 1994; Sodeinde and Kindle, 1993). This results in random insertion, multiple insertions, and highly variable exogenous gene expression. Typical promoter analysis involves measuring the expression of 10-50 individual transformants. However, measuring individual transformants is time and resource consuming, and the variability in expression is still high unless many individual are measured. Alternatively, if many transformants are pooled and protein or RNA levels are measured of the total population, noise from positional insertion effects can be reduced, but this does not allow measurement of the range of expression over the population pool. Therefore, for this study flow cytometry was used to measure promoter strength. Flow cytometry allows measurement of both a large number of transformants while also recording the data for individual transgenic cells. This provides a highly confident average as well as the range of expression for our reporter gene for each promoter tested.
To determine if our synthetic promoters were functional based on our design principles, and not just coincidental, random promoters were also generated whose sequence had a similar GC content to both native and our synthetic promoters, but with no periodical AT rich regions upstream or placement of motifs (
Analysis of mCherry expression driven by the 25 saps revealed a wide range of functionality compared to arl. As expected, there was low level of mCherry fluorescence above the WT background in our random promoter transformants (
sap11 contains a positive cis-effector motif. In order to determine which motifs contribute to the promoter strength of the high-expressing saps, we chose sap11 for further analysis, as it consistently produced the greatest amount of mCherry. First, a deletion series was performed in which nucleotides were deleted from the 5′ end so that −250, −150, or −50 bp upstream of the TSS remained (
To further narrow down specific motifs essential for sap11 function, motif deletion analysis was performed. Four regions contained POWRs identified motifs between −150 and −50 bp from the TSS (
Because the CCCAT motifs had such a significant impact on sap11 function, we set out to determine if it may be a core motif within C. reinhardtii. One method to identify core motifs is to identify motifs that are relatively enriched at specific locations relative to the TSS in a large number of promoters. Therefore, we analyzed the promoter regions of 4,412 genes in C. reinhardtii. Promoters were chosen if their 5′ UTR start sites (Chlamydomonas reinhardtii v5.5) were within 10 bp of the start site of PASA(Program to Assemble Spliced Alignments; Phytozome 10.2) assembled EST. Promoter sequences from −1000 to +500 of the 5′ UTR site were analyzed to identify motifs that are enriched in similar regions (Bailey and Machanick, 2012). Surprisingly, the top eight motifs identified were all CCCAT-like motifs that were highly enriched only at −100 to −40 bp upstream of the TSS with a peak at −65 bp (
Motif sequence similarity search using TOMTOM analysis of this motif sequence revealed some homology to the cis-motif recognized by the Arabidopsis phytochrome interacting factor (PIFs;
C. reinhardtii promoters contain AT and TC rich motifs near TSS. CentriMo analysis of the C. reinhardtii promoters revealed other motifs that were enriched at specific regions relative to the TSS. Of note, AT-rich motifs appeared to peak at the TSS and then at periodic but decreasing intervals both upstream and downstream of the TSS (
Discussion
In this study, synthetic promoters were successfully generated that were capable of driving exogenous gene expression within the C. reinhardtii nucleus. The saps generated in this study were based on native DNA motifs identified using the POWRs algorithm. Using a stochastic method of motif placement that was based on motif location relative to the TSS in native promoters, we were able to generate saps that were as successful as, or better than, the best native promoters in C. reinhardtii (Schroda et al., 2002; Schroda et al., 2000). The current best promoter for C. reinhardtii is a non-native promoter arl that is a hybrid between two endogenous promoter regions. Our novel saps rely on a completely synthetic promoter backbone with a cis-regulatory motif structure informed from annotation based and experimentally derived genomic information. It should be noted that the HSP70A promoter acts as a transcriptional state enhancer, which increases the probability of transcription of the neighboring promoter (Schroda et al., 2008). It would be interesting to see if fusing the HSP70A promoter upstream our synthetic promoter further improves their function similarly to HSP70A's effect on RBCS2. Alternatively, our promoters could also be fused with other native 5′ and 3′ UTRs, such as psaD, which in one study showed similar improvements over arl for luciferase expression (Kumar et al., 2013).
Bioinformatic analysis used to identify motifs within native promoters led to the identification of novel elements as well as information about promoter structure within the nuclear genome of C. reinhardtii. First, C. reinhardtii promoters have an AT-bias near the TSS, which is unique from other plant species studied thus far (
In addition to AT-rich regions, TC-rich regions were also enriched in C. reinhardtii promoters. This enrichment was more significant in the top 50 expressed genes compared to the genome-in whole (
Promoter motif deletion analysis did reveal the presence of an essential motif within the sap11 promoter. Motif regions 3 and 4 contained nearly identical CCCAT motifs. Knock out of these motifs led to severe reduction of sap11 function. Bioinformatic analysis further revealed that this motif is highly enriched at −65 bp upstream of the TSS of 1564 genes with 446 having the exact CCCATGCA sequence (
The combination of bioinformatic analysis of gene structure and expression and in vivo testing of synthetic primers based on these analyses has proven a fruitful area of research for discovery of unknown cis elements and for use in designing strong synthetic promoters (Blazeck and Alper, 2013; Koschmann et al., 2012; Venter, 2007). The knowledge gained in this study gives us a synthetic template to generate large promoter libraries. These libraries will be used to generate more significant data about the importance of individual motifs and overall promoter structure in C. reinhardtii, which will ideally enable us to generate successive rounds of engineered promoters to achieve exogenous gene expression above currently achieved levels. Large promoter libraries will also allow for the integration of multiple genes into the same host by allowing separate transgenes to be driven by unique promoters to reduce genomic rearrangements brought about by sequence specific targeting that may arise from a genome laced with identical sequences. This latter feature is particularly important in metabolic engineering, which often requires the introduction of multiple enzymes into the host organism. Finally, as we have demonstrated in this study, synthetic promoters provide a platform on which to identify motifs in vivo involved in transcriptional regulation in C. reinhardtii. In the future, this can be expanded to motifs predicted to be involved in inducible regulation such as heat shock, nickel or nitrate addition or iron-deficiency. Together these tools will represent a large step forward in the synthetic engineering of algae for the production of biofuels and bio-products.
This example is published as Anderson, et al, Algal Research (2017) 22:47-55. which is hereby incorporated herein by reference in its entirety for all purposes.
Methods
Algal Strains, Culture Conditions, and Genetic Transformation. Chlamydomonas reinhardtii cc1010 (Chlamydomonas Resource Center, St. Paul, N. Mex.) was used as the wild type strain for this study. Algal strains were cultured in TAP (Tris-Acetate-Phosphate) medium [25] at 23° C. under constant illumination (5,000 lux) and with constant shaking (100 rmp). C. reinhardtii was transformed by electroporation as previously described [19] with the exception of the 40 mM sucrose supplement. Transformants were selected on TAP medium agar plates supplemented with 10 μg/ml zeocin. Gene-positive colonies were screened by PCR.
Generation of Transcription Factor Library. Initial gene models for 346 identified C. reinhardtii TFs were obtained from the PlnTFDB (http://pintfdb.bio.uni-potsdam.de/v3.0/) [24,26]. These were then cross-referenced by BLAST against the Phytozome database (http://phytozome.jgi.doe.gov) to obtain the most up-to-date and accurate gene models. Primers were designed to anneal to the 5′ and 3′ ends of each gene (Integrated DNA Technologies). RNA was isolated from cc1010 cultures grown to 6×108 cells per ml using PureLink Plant RNA Reagent (Ambion by Life Technologies) and cDNA libraries generated with Verso cDNA Synthesis Kit (Thermo Fisher Scientific). Gene coding sequences were amplified with Phusion Polymerase using the GC buffer (Thermo Fisher Scientific) supplemented with 0.5 to 1M Betaine (Sigma) with a touchdown PCR protocol [27]. Successfully amplified CDSs were then cloned into the pENTR/D-TOPO vector in E. coli via TOPO cloning (Life Technologies). Resulting clones were sequence verified by Sanger sequencing. Silent mutations were deemed acceptable. In the case of non-silent mutations, these were allowed only after multiple independent clones were confirmed with the same difference(s) from the published gene model. Clones were transferred to pDEST22 (S. cerevisiae Y1H vector) or pTM207 (ble2A-derived [19] C. reinhardtii nuclear expression vector) via Gateway LR-Clonase (Life Technologies).
Yeast Culture Conditions and Yeast One-Hybrid Assay. Culture conditions and mating of Saccharomyces cerevisiae YM4271 and Y1H assay were performed following the MATCHMAKER One-Hybrid System protocol (CLONTECH Laboratories, Inc.). Reporter plasmids were chromosomally integrated in the S. cerevisiae YM4271 genome. Briefly, Y1H library strains were inoculated into 96 well plates and cultured overnight (0/N). The OD600 was measured from 100 μl of 0/N culture. Using white 96 well plates (Greiner), 50 μl of 0/N culture was combined with 50 μl of Luciferase Assay Reagent (Promega) using an injector on a Tecan plate reader (Tecan Infinite M200 PRO). Luminescence was measured five seconds post-injection. Luminescence was first normalized to the OD600 and then for each TF normalized to the empty vector control. A one sided Grubbs' test for outliers (0.05 level) was used to determine fold increases in luminescence that were outside the distribution. Assays were repeated with replicates for outlier samples. Values were determined significant by Student's t-test and/or greater than two standard deviations from the mean of the empty vector luminescence control.
Immunoblotting. Cells were cultured until mid to late log phase, washed in PBS-T (Phosphate-Buffered Saline-Tween) buffer, and lysed by sonication. Total soluble protein pellets were resuspended in SDS-PAGE loading buffer. Boiled samples were separated on a 12% SDS-PAGE gel, transferred to nitrocellulose, and probed with anti-GAL4-AD antibody (Sigma) for S. cerevisiae or anti-FLAG monoclonal antibody conjugated to alkaline phosphatase (Sigma) for C. reinhardtii.
RNA Purification. RNA was extracted from C. reinhardtii strains of interest after 3-4 days of growth in TAP medium under constant light using PureLink Plant RNA Reagent (Ambion by Life Technologies) according to the manufacture's protocol. RNA was treated with 4 U of TURBO DNase (Thermo Fisher Scientific) for 30 min at 37° C.
RNA-Sequencing and Analysis. RNA from three biological replicates for each strain analyzed was sent to the Institute for Genomic Medicine at the University of California, San Diego for Next-Generation Sequencing on an Illumina HiSeq2500. Single-end 50 bp reads were generated. Reads were aligned to the latest reference index (Chlre4_Augustus5_transcripts.fasta) downloaded from the Joint Genome Institute (JGI) at www.phytozome.net using TopHat open software on Galaxy (usegalaxy.org) [28-30]. Differential expression analysis was performed using Cufflinks also on Galaxy. For gene identification, C. reinhardtii strain 503 was used as a reference strain due to the lack of a published sequence for strain cc1010. The average log 2 (fold change) of all FPKM (Fragments Per Kilobase of transcript per Million mapped reads) values ≥1.0 for the experimental strain (transcription factor constitutive-expression) compared to the control strain (GFP constitutive-expression strain) was plotted.
Reverse Transcriptase Quantitative Polymerase Chain Reaction. 1 μg of purified RNA was reverse transcribed using the Verso cDNA synthesis kit (Thermo Fisher Scientific). cDNA was diluted 1:2 for qPCR analysis using Power SYBR Green PCR Master Mix (Applied Biosystems). qPCR was performed on a My iQ thermocycler (Bio Rad). Two biological replicates were performed each with technical triplicates. The ΔΔCt method was used for relative quantification of gene expression [31]. RACK1 was used as an internal standard. The mean log 2 (fold change) and SEM from biological replicates was plotted.
Promoter Motif Identification. Promoter sequences were obtained from NCBI. DNA sequences were analyzed using the software programs MEME [32,33], AME [34], and Jalview [35].
Results.
Construction of a putative transcription factor library. One of our main goals with this project was to narrow down the list of potential cognate TF-promoter pairs, i.e., which TFs bind and regulate which nuclear promoters, in C. reinhardtii. An understanding of the global network of regulatory interactions within the nuclear genome is critical for the engineering of synthetic transcription systems, a long-range goal for our laboratory. Therefore, we set out to construct a library of recombinant C. reinhardtii nuclear transcription factors (TFs). Just after the C. reinhardtii genome sequence was completed [11], putative TFs, as well as transcription regulators (TRs), were identified by presence of homology to known TF/TR domains and available at the Plant Transcription Factor Database (PlnTFDB) [24,26]. In order to have the most up-to-date gene model for the TFs and TRs, we took fragments from the identified genes and used a BLAST search against the latest gene models from Phytozome. The TF/TR library (referred to simply as the TF library from here on) was generated using TOPO cloning such that the gene encoding each TF was PCR amplified from C. reinhardtii cc1010 cDNA and ligated into the pENTR/D-TOPO vector, followed by transformation into Escherichia coli (see Materials and Methods). We were able to successfully construct plasmid vectors encoding 92 different putative TFs predicted in the C. reinhardtii genome (Table 8) (from a total of over 300 TFs identified by bioinformatics). Our library contains TFs belonging to multiple TF families including but not limited to: High Mobility Group (HMG) box, basic Helix-Loop-Helix (bHLH), Cys2His2 zinc finger (C2H2), Cys3His zinc finger (C3H), Forkhead-associated (FHA), basic Leucine Zipper (bZIP), MYB (myeloblastosis), Gcn5-related N-acetyltransferase (GNAT), Tubby bipartite (TUB), Tumor necrosis factor receptor-associated (TRAF), SET (histone methyltransferases), and CCAAT-enhancer-binding proteins (CCAAT). A complete list of each TF and relevant information can be found in Table 8.
Putative transcription factors initiate transcription from C. reinhardtii promoters in yeast. As an initial screen for potential DNA-binding activity, we performed a high-throughput yeast one-hybrid (Y1H) assay to test our TFs' ability to activate transcription from known C. reinhardtii promoters [36,37]. We transferred our entire pENTR-TF library to the Y1H vector pDEST22 via Gateway LF-transferase which allowed the TFs to be fused to the yeast GAL4 transcription activation domain [38]. Separately, “bait” promoters of interest were cloned (in 300 base pair (bp) fragments, labeled A, B, and C (5′ to 3′), for a total of 900 bps per promoter (Table 9) 5′ to a yeast minimal promoter element followed by the reporter gene Gaussia luciferase [39]. Each TF-vector was transformed into separate haploid Saccharomyces cerevisiae YM4271 cells and crossed against the opposite mating type of strains harboring DNA bait promoters of interest. S. cerevisiae strains producing each TF were also cultured so whole cells could be processed for western blot analysis of TF protein production (
We assayed all 92 TFs against five C. reinhardtii nuclear promoters: LCIC, LCI5, SEBP1, Nar1.2, and LHCBM5 (
TFs 2, 3, 9, 28, 34, 45, 64, 69, and 81 each activated transcription from LCIC promoter fragment C (
To summarize these Y1H assays, our data provide information on 1,288 TF-promoter potential binding interactions, 26 of which were positive hits. TF64 was the most active in this assay, activating transcription with four of the five promoters tested. TFs 3, 30, and 34 each activated transcription from two promoters. Note that some TFs bound multiple fragments of the same promoter. Many TFs however did not show activity with any of the five C. reinhardtii promoters we assayed. These data are summarized in Table 10.
Chlamydomonas
reinhardtii
Chlamydomonas
reinhardtii
Chlamydomonas
reinhardtii
Chlamydomonas
reinhardtii
Chlamydomonas
reinhardtii
Volvox
carteri
Volvox
carteri
Volvox
carteri
Volvox
carteri
Volvox
carteri
Chlorella
vulgaris
Chlorella
vulgaris
Chlorella
vulgaris
Chlorella
vulgaris
Zea
mays
Zea
mays
Arabidopsis
thaliana
Arabidopsis
thaliana
Putative transcription factors initiate transcription from orthologous promoters from multiple species. We also assayed our TF library with bait promoters from the closely related algal species Volvox carteri and Chlorella vulgaris, as well as from the distantly related plant species Arabidopsis thaliana and Zea mays. Again, we tested promoters LCIC, LCI5, SEBP1, Nar1.2, and LHCBM5 (Table 10,
Analysis of potential TF64-binding promoters identified from the Y1H assay. Utilizing the collection of our Y1H data, we hypothesized we could identify commonalities among promoters which may function as specific motifs or binding sites important for gene regulation. We chose to analyze the promoter fragments that activated transcription in combination with TF64 because it provided us with the largest sample size, 13 promoter fragments in total. We used the software program MEME (Multiple Em (Expectation maximization) for Motif Elicitation) [32,33] to search for enriched DNA motifs. Unfortunately, no statistically significant motifs were identified. The top motif found was an 11 nucleotide sequence, TGNGCANNTNN (SEQ ID NO:228) (
Constitutive expression of the TF library in C. reinhardtii. We next attempted to study our TF library expressed in C. reinhardtii cc1010. The gene encoding each TF was cloned from the pENTR vector into a ble-2A expression vector [19], pTM207 (see
In deciding which TF to carry forward with our study, we considered our Y1H data concurrently with our limited ability to produce the recombinant TFs in C. reinhardtii. TFs 2 and 64 both showed potential DNA binding activity and were capable of being constitutively produced in C. reinhardtii. Ultimately, we chose TF64 to continue our study of TF-promoter binding partners in C. reinhardtii.
Production of TF64 in C. reinhardtii. Basic Helix-Loop-Helix (bHLH) transcription factor family members, like TF64, are highly conserved in their functional and DNA-binding domains, even across distantly related species and genera [46-49]. They recognize a canonical binding site, CANNTG (called the E-box), in promoters of genes they regulate [47,49]. A BLAST search of the PlnTFDB TF64 sequence showed conservation in DNA binding, E-box specificity site, and dimerization interface domains among top hits of TF-like proteins from other microalgae species (
We generated multiple strains of cc1010 that constitutively produced TF64 (cc1010::TF64-4, -7, -8, -9, and -11) shown by western blot (
As a control, we also used the pTM207 vector to generate a strain that constitutively produced GFP under control of PAR1 (
Growth curves were performed on strains cc1010::TF64-7, cc1010::GFP, and wild type cc1010 cultured in TAP medium under constant light for four days (
TF64 regulates many endogenous nuclear genes. To identify the genes/promoters TF64 regulates in C. reinhardtii, we performed an RNA-sequencing experiment on two independent strains, cc1010::TF64-7 (referred to as the low-constitutive strain) and cc1010::TF64-9 (referred to as the high-constitutive strain), along with our control strain cc1010::GFP (
The most highly regulated genes, both activated and inhibited, from the low-constitutive and high-constitutive TF64-producing strains were identified by bioinformatics using the BLASTx search function from NCBI (Table 11a, 11b, 11c). Inhibited genes were mostly uncharacterized and showed little similarity in function. Activated genes, particularly from the low-constitutive TF64-7 dataset, fell into relatively distinct functional categories including: photosynthesis, cell structure, cell cycle, and metabolism. Table 12 lists the top 20 activated genes (that have also been previously characterized) identified from the TF64-7 RNA-Seq data. These data suggest TF64, like many bHLH transcription factor family members [51,52], regulates many genes involved in a wide variety of developmental and cellular processes in C. reinhardtii.
reinhardtii)
reinhardtii)
reinhardtii)
reinhardtii)
reinhardtii)
reinhardtii)
reinhardtii)
Bioinformatic analysis of promoters of genes regulated by TF64. We chose three sets of promoters, TF64-activated, TF64-inhibited, and TF64-non-regulated, from the low-constitutive TF64-7 RNA-Seq dataset to analyze for common motifs. Promoters included 1,000 bps 5′ to the ATG translation start site of the 30 top activated, inhibited, and non-regulated (log 2=0) genes. Most genes did not have annotated 5′ UTRs. Promoters from each regulatory category were analyzed by MEME to identify any common motifs, however no statistically significant sequences were found for any group. Additionally, we used the program AME (Analysis of Motif Enrichment) [34] to determine if the bHLH canonical binding site, CANNTG, was present with statistical significance, and it was not for any of the three promoter categories.
We further analyzed the promoter groups using the alignment software Jalview [35]. Promoters were aligned without gaps and all CANNTG sequences were identified for each group. Analysis of CANNTG composition as well as relative location within the promoter did not reveal significant differences among the three promoter groups analyzed. These data suggest that the CANNTG sequence is ubiquitous throughout the C. reinhardtii genome. While this motif may play a role in TF64-DNA binding, it is not solely responsible for the gene regulation observed in the TF64-constitutive expression strains¬. It is likely that other co-factors and/or regulatory elements are important for transcription of the genes we identified to be regulated by TF64, further underscoring the complex nature of nuclear gene regulation in eukaryotic microalgae.
TF64 activates transcription of light harvesting complex II components. To validate our RNA-Seq analysis, we performed reverse transcriptase quantitative PCR (RT-qPCR) on selected genes. Strains cc1010::TF64-7 and cc1010::GFP were cultured in TAP medium under constant light for three days until mid-log phase growth was reached. RNA was isolated from cells and cDNA was synthesized for RT-qPCR analysis. Among the top activated genes from the TF64-7 RNA-Seq dataset were LHCBM7, LHCBM8, LHCBM4, and LHCBM1 (Table 10) of light harvesting complex II (PSII) [44]. We were able to confirm that transcripts from these genes were approximately 16 times (for LHCBM7), four times (for LHCBM8 and LHCBM4), and eight times (for LHCBM1) more abundant in the TF64-producing strain compared to the GFP-producing strain by RT-qPCR (
Transcription analysis of Y1H-assayed genes. We also investigated transcription of the genes whose promoters were found to activate transcription with TF64 by Y1H (i.e., LCI5, SEBP1, LCIC, and Nar1.2). RNA-Seq data indicated that each of these genes were down-regulated in C. reinhardtii cells constitutively expressing the gene encoding TF64 (
Collectively, these results highlight the nature of high-throughput screens, like the Y1H, and high-throughput sequencing data, as generated here by RNA-sequencing: they produce large amounts of data that can serve as an excellent starting point for narrowing down potential molecular interactions of interest. Here, we successfully used these two screens to identify potential TF-promoter binding partners in C. reinhardtii.
Conclusions.
In this study, we successfully constructed a recombinant transcription factor library that includes 92 (nearly one third of the putative) transcription factors (TFs) encoded by the nuclear genome of C. reinhardtii. To date, very few TFs have actually been characterized from this species of microalgae [20]. We analyzed the 92 TFs' ability to activate transcription via a yeast one-hybrid screen, studied the TFs' abilities to be constitutively expressed in their native organism C. reinhardtii, and finally assessed transcription profiles by RNA-Seq from two independent strains constitutively expressing one specific TF (TF64). These high-throughput studies were designed to narrow down the vast amount of hypothetical transcription factor-promoter binding pairs in C. reinhardtii (˜350 TFs×15,000 nuclear genes=5,250,000 potential interactions). Our results establish a clear direction for investigation of direct binding partners that could be used in an engineered synthetic nuclear transcription system in green algae.
Using a yeast one-hybrid assay [37], we were able to analyze 4,508 potential binding interactions between TFs and promoter fragments. Sixty-five of these were found to be positive hits correlating with 28 TFs with potential DNA binding activity. We assayed five promoters (LCIC, LCI5, SEBP1, Nar1.2, and LHCBM5) in different combinations from C. reinhardtii, V. carteri, C. vulgaris, A. thaliana, and Z. mays. The ability to activate transcription from unique DNA sequences by a number of the putative TFs analyzed support the bioinformatic data [24] suggesting these proteins are in fact functional transcription factors, capable of regulating transcription in C. reinhardtii.
Compiling the yeast one-hybrid data, we sought to identify common motifs among promoter fragments found to activate transcription in combination with an individual TF. The promoters, however, proved to be more cryptic than anticipated. We studied TF64-associated promoters, 13 sequences in total, and were unable to identify commonalities by bioinformatics. It may be that a larger number of promoters need to be analyzed before such a characterization is possible. In the future, it would be interesting to compare DNA sequences from a larger dataset of C. reinhardtii promoters and also determine if identified motifs were conserved in the promoters of other closely or distantly related species.
Our TF library was cloned into a C. reinhardtii constitutive expression vector for production in C. reinhardtii. To our knowledge, this was the first attempt to constitutively produce a recombinant library of native TFs in C. reinhardtii. Of the 92 TF-encoding vectors that were transformed, only eight resulted in successful production of protein under the conditions attempted. As almost all of the TFs produced protein in S. cerevisiae, the algae expression data suggest that the failure for most TFs to produce protein in C. reinhardtii is possibly due to adverse effects of constitutively expressing their genes. It is possible these TFs could be produced under more tightly controlled experimental conditions, or when placed under inducible or conditional expression systems.
TF64 was our most successful TF in that it was able to be produced in multiple strains of C. reinhardtii and it was the most active TF in the yeast one-hybrid assay. From RNA-sequencing data on strains constitutively producing TF64, compared to a GFP-constitutive strain, we were able to determine that TF64 likely plays a role in regulating transcription of genes involved in multiple cellular and developmental processes in wild type C. reinhardtii. Constitutive production of TF64 led to an increase in transcript levels of genes functioning in photosynthesis and the cell cycle, as well as many others. Follow-up studies on the biological role of TF64 should prove to be interesting from a basic science perspective, leading to greater insights into the C. reinhardtii lifecycle.
Our goal with this study was to identify potential cognate transcription factor-promoter pairs from C. reinhardtii that, once validated, could be used in a synthetic nuclear transcription system. From our yeast one-hybrid data, we identified 28 TFs with possible DNA binding activity. Further studies are required to confirm these interactions in vivo in C. reinhardtii. Specifically focusing on TF64, we were able to verify the activation of transcription of nine genes, LHCBM1-9, by both RNA-Seq and RT-qPCR. It is yet to be determined if this gene activation is in fact due to a direct TF-promoter binding interaction.
These data lay the groundwork for the construction of a synthetic transcription system. This line of work provides the scientific community the necessary tools for sophisticated and robust genetic engineering in microalgae.
For photosynthetic organisms, light and dark cycles act as major drivers of metabolism and gene expression pattern variation. During day time, green algae can utilize photosynthesis to drive the production of sugars that are then used for energy in a myriad of metabolic processes including the production of starches and sugars. During the night the cells must utilize stored energy in the form of sugars, starches, or lipids to continue metabolic activity. The switching from phototrophic to hetrotropic metabolism requires large sets of genes to be switched on or off. In Chlamydomonas ˜80% of the genome displays detectable periodic gene expression changes throughout a 24 hour day/night cycle (Zones et al., 2015). We therefore predicted that unique regulatory motifs may be used to regulate these light-induced or dark-induced genes in response to light intensity. If identified, these motifs can then be utilized to drive transgene expression specifically in response to light or dark conditions. Since light is one of the easiest variables to control in commercial scale cultivation of algae, design and production of light/dark-responsive synthetic promoters would be highly useful for inducing or silencing transgene expression.
Using high resolution RNA-seq data taken from Chlamydomonas reinhardtii on a 12 hour light-12 hour dark cycle (Zones et al., 2015, supra) we identified genes that were differentially expressed by at least two fold between the middle of the light-period (day) and the middle of the dark-period (night) while displaying moderate to high expression levels overall during their upregulated time period. Specifically, we averaged the Reads Per Kilobase of transcript per Million mapped reads (RPKM) for each transcript during the middle 4 hours of the 12-hour light period and the middle 4 hours of the 12-hour dark period. Genes with at least a 2-fold increase in averaged read count during the light phase compared to the dark phase and an average RPKM of more than 100 were determined to be light-upregulated strong expressers. Similarly genes with at least a 2-fold increase in average read count during the dark phase compared to the light and an average RPKM of more than 100 were determined to be dark-upregulated strong expressers. Collectively this represented 255 light-upregulated genes and 248 dark-upregulated genes. The 1000 bp region 5′ from the transcriptional start site of these genes was retrieved (Phytozome 12, Chlamydomonas reinhardtii genome v5.5) and analyzed using the POWRS motif identification program (Davis et al., 2012). All default settings on POWRS were used and −1000 bp regions from all 17737 annotated genes in the whole genome used as the background control data set. POWRS identified 31 and 32 enriched motif clusters in the light-upregulated and dark-upregulated promoter datasets, respectively compared to promoters in the rest of the genome. Motifs enriched in the light-upregulated or dark-upregulated data sets were compared each other using the Tomtom motif comparison tool (Gupta, et al., (2007) Genome Biol. 8(2):R24).
Statistical analyses as those presented above serve as an unbiased method for identifying conserved nucleotide motifs which correlate with increased transcription levels. This strategy alleviates the necessity for understanding the mechanism of action of the associated sequence. For an organism like Chlamydomonas reinhardtii, it is favorable to use this approach due to large gaps in the understanding of regulatory elements in the species. However, a wealth of knowledge is available across the kingdom Plantae which serve as a guide to understanding the complex transcriptional regulation found in C. reinhardtii. One of the best-understood aspects of the regulatory system is that by encouraging an activating transcription factor to bind in a regulatory region associated with a transgene, one can increase transcript abundance and subsequent protein accumulation. Systems have been derived in S. cerevisiae and E. coli which take advantage of known DNA-binding proteins to engineer complex circuits of protein expression for a wide variety of purposes (Wang et al. 2011, Ellis et al. 2009, Kotula et al. 2014).
Transcription factor families are easily identifiable in silico and homology analysis to better-understood systems can provide a groundwork for understanding in C. reinhardtii. The Plant Transcription Factor Database (PTFDB) (//planttfdb.cbi.pku.edu.cn/) has identified each family of transcription factor found in C. reinhardtii based on sequence homology to other plants. The PTFDB has also compiled data from across the literature to provide putative binding sites for those families of transcription factors. Transcription factor (TF) binding sites have been studied across plants through one of the following processes: ampDAP, ChIP/ChIP-seq, DAP, PBM, or SELEX. TF binding sites found in the literature that are associated with a given TF family are projected to other species to help characterize binding in a virgin system. The sequence motifs attributed to TF families found in C. reinhardtii are provided as position-weight matrices in
In an effort to better characterize the in vivo TF/sequence cognate pairs for C. reinhardtii, 90 predicted transcription factors were cloned from C. reinhardtii cDNA into a constitutive nuclear expression construct (Andersen et a 2017). Upon characterization of their binding in a Y1H assay, a bHLH-family transcription factor (Cre02.g109700.t1.2, will be referred to as TF64) was selected for further analysis. Three strains were designed to determine if constitutive expression of a transgenic transcription factor can increase recombinant protein abundance in C. reinhardtii. We generated a strain which expressed high levels of TF64, one which expressed low levels of TF64, and a control strain which used the same construct to express GFP, a non-DNA binding protein. These three strains in addition to an untransformed wild-type strain were transformed with an expression cassette which drives OFP expression, which is easily detected by a fluorescent plate reader. The promoter associated with the OFP gene must contain binding site(s) associated with the bHLH transcription factor family (CANNTG). Conveniently, the AR1 promoter that is well-established in the field has three putative bHLH binding sites, identified in
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
This invention was made with government support under DE-EE-0003373 from the United States Department of Energy. The government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2017/018196 | 2/16/2017 | WO |
| Publishing Document | Publishing Date | Country | Kind |
|---|---|---|---|
| WO2017/143080 | 8/24/2017 | WO | A |
| Entry |
|---|
| Schroda et al (The Plant Journal, 2001, 21(2): 121-131). |
| Jameel et al (Int. J. Mol. Sci., 2020, 21(4): 1357). |
| Lu et al (Critical Reviews in Biotechnology, 2021, 41(8): 1233-1256). |
| Jin et al (Microbial Biotechnology, 2019, 12(6): 1476-1486). |
| PCT Non-Establishment of International Search Report and Written Opinion dated May 30, 2017 issued in PCT/US2017/018196. |
| Bailey et al. (2012) “Inferring direct DNA binding from ChIP-seq.” Nucleic Acids Res 40(17): e128 [10 pages]. |
| Bernard et al. (2010) “TC-motifs at the TATA-box expected position in plant genes: a novel class of motifs involved in the transcription regulation.” BMC Genomics 11: 166 [15 pages]. |
| Blazeck et al. (2013) “Promoter engineering: recent advances in controlling transcription at the most fundamental level.” Biotechnology Journal 8: 46-58. |
| Calistri et al. (2011) “Evolutionary trends of GC/AT distribution patterns in promoters.” Molecular Phylogenetics and Evolution 60: 228-235. |
| Davis et al. (2012) “POWRS: position-sensitive motif discovery.” PLoS One. 7(7): e40373 [10 pages]. |
| Fang et al. (2012) “Transcriptome-wide changes in Chlamydomonas reinhardtii gene expression regulated by carbon dioxide and the CO2-concentrating mechanism regulator CIA5/CCM1.” Plant Cell 24: 1876-1893. |
| Fujimori et al. (2005) “GC-compositional strand bias around transcription start sites in plants and fungi.” BMC Genomics 6: 26 [11 pages]. doi:10.1186/1471-2164-6-26. |
| Gabrielian et al. (1999) “Curved DNA in promoter sequences.” In Silico Biol 1: 183-196 [MS # 8G/0672—26 pages]. |
| Gupta et al. (2007) “Quantifying similarity between motifs.” Genome Biol. 8(2): R24 [9 pages]. |
| Kanhere et al. (2005) “Structural properties of promoters: similarities and differences between prokaryotes and eukaryotes.” Nucleic Acids Res 33(10): 3165-3175. |
| Koschmann et al. (2012) “Integration of bioinformatics and synthetic promoters leads to the discovery of novel elicitor-responsive cis-regulatory sequences in Arabidopsis.” Plant Physiology 160: 178-191. |
| Kumar et al. (2013) “Evaluating nuclear transgene expression systems in Chlamydomonas reinhardtii.” Algal Res 2: 321-332. |
| Rasala et al. (2014) “Photosynthetic biomanufacturing in green algae; production of recombinant proteins for industrial, nutritional, and medical uses.” Photosynthesis Research 123(3): 227-23 9. |
| Riano-Pachon et al. (2008) “Green transcription factors: a chlamydomonas overview.” Genetics 179: 31-39. |
| Scaife et al. (2015) “Establishing Chlamydomonas reinhardtii as an industrial biotechnology host.” The Plant Journal 82: 532-546. |
| Schroda et al. (2000) “The HSP70A promoter as a tool for the improved expression of transgenes in Chlamydomonas.” The Plant Journal 21: 121-131. |
| Schroda et al. (2002) “Sequence elements within an HSP70 promoter counteract transcriptional transgene silencing in Chlamydomonas.” The Plant Journal 31(4): 445-455. |
| Venter, M. (2007) “Synthetic promoters: genetic control through cis engineering,” Trends Plant Sci 12(3): 118-124. |
| Zones et al. (2015) “High-Resolution Profiling of a Synchronized Diurnal Transcriptome from Chlamydomonas reinhardtii Reveals Continuous Cell and Metabolic Differentiation.” Plant Cell 27(10): 2743-69. |
| Number | Date | Country | |
|---|---|---|---|
| 20190382779 A1 | Dec 2019 | US |
| Number | Date | Country | |
|---|---|---|---|
| 62295997 | Feb 2016 | US |
