The discovery of histone post-translational modifications (PTMs) and the peptides that specifically interact with these marks has enabled scientists and cell engineers to manipulate chromatin, the DNA-protein structure that regulates gene expression states in eukaryotic cells.
Embodiments disclosed herein relate to compositions and methods involving synthetic modification of histone-binding proteins.
In some embodiments, histone-binding fusion-protein compositions include a modified polycomb chromodomain (PCD) motif, for example two tandem copies of the H3K27me3-binding PCD at the N-terminus separated by a linker. Such linkers can range in size (number of amino acids) and composition, including flexible or rigid linkers.
In other embodiments, methods are disclosed that relate to multivalent engagement of one or more histone proteins by a transcription regulator protein, for example by contacting one or more histone proteins with a histone-binding fusion-protein composition having a modified PCD motif. In some embodiments, the modification comprises two tandem copies of the H3K27me3-binding PCD at the N-terminus.
In further embodiments, methods are disclosed that relate to tuning the activity of a synthetic histone-binding transcriptional regulator, for example, the transcription regulator protein may include a histone-binding fusion-protein with a modified polycomb chromodomain (PCD) motif.
Thus, embodiments herein relate to methods to engineer proteins that are designed to activate or repress the expression of genes in living cells, with an objective being to activate or repress target genes based on “epigenetic” states instead of their DNA sequences.
Advantages of embodiments of the present disclosure will be apparent from the following detailed description of the exemplary embodiments thereof, which description should be considered in conjunction with the accompanying drawings in which:
Aspects of this specification are disclosed in the following description and related drawings directed to specific embodiments. Alternate embodiments may be devised without departing from the spirit or the scope of the invention. Additionally, well-known elements of exemplary embodiments of the invention will not be described in detail or will be omitted so as not to obscure the relevant details. Further, to facilitate an understanding of the description, discussion of several terms used herein follows.
The word “exemplary” is used herein to mean “serving as an example, instance, or illustration.” Any embodiment described herein as “exemplary” is not necessarily to be construed as preferred or advantageous over other embodiments. Likewise, the terms “embodiments of the invention,” “embodiments” or “invention” do not require that all embodiments of the method, system or apparatus include the discussed feature, advantage or mode of operation.
The following abbreviations are used herein: ELISA, enzyme-linked immunosorbent assay; H3K27me3, histone H3 trimethylated at lysine 27; PCD, Polycomb chromodomain motif; PcTF, monovalent Polycomb-based transcription factor; Pc2TF, bivalent Polycomb-based transcription factor; PTM, post translational modification.
It should also be understood that substantially similar components are at times identified using a single reference number for clarity. Further, it should also be understood that the present application makes reference to examples to aid in understanding features and advantages of the invention, and not to limit the invention to the examples herein.
In multicellular organisms, information relevant to cell state, tissue identity, and oncogenesis is often encoded as biochemical modifications of histones, which are bound to DNA in eukaryotic nuclei and regulate gene expression states. For example, “Polycomb-based transcription factor” (PcTF), a fusion protein that recognizes histone modifications through a protein-protein interaction between its polycomb chromodomain (PCD) motif and trimethylated lysine 27 of histone H3 (H3K27me3) at genomic sites, has been developed and validated. In another example, PcTF has been found to activate genes at methyl-histone-enriched loci in cancer-derived cell lines. However, PcTF induces modest activation of a methyl-histone associated reporter compared to a DNA-binding activator.
Therefore, in some embodiments, PcTF is modified to enhance its binding avidity. For example, we demonstrate the activity of a modified regulator called Pc2TF, which has two tandem copies of the H3K27me3-binding PCD at the N-terminus. Pc2TF has a smaller apparent dissociation constant value in vitro and shows enhanced gene activation in HEK293 cells compared to PcTF. Thus, in further embodiments, the intrinsic histone-binding activity of the PCD motif can be used to tune the activity of synthetic histone-binding transcriptional regulators.
In a specific embodiment, the Polycomb-based Transcription factor (PcTF) was constructed using a histone PTM-binding motif from the natural protein CBX8. The CBX8 effector protein binds to histone H3 trimethylated at lysine 27 (H3K27me3) through its N-terminal Polycomb chromodomain (PCD) and establishes a silenced transcriptional state. Expression of PcTF, an artificial transcriptional activator with an N-terminal PCD, mCherry tag, and C-terminal VP64 activation domain, led to increased expression of H3K27me3-enriched genes in three different cancer-derived cell lines.
These results show promise for designing transcription factors that can read chromatin marks to rewire aberrant epigenetic programming. However, binding affinities observed in vitro for isolated PCD domains is poor, reported as 5 to >500 μM, compared to DNA-binding domains with target affinities in the pico- to nanomolar range such as TALEs (˜3-220 nM), Zinc Fingers (˜0.01-16 nM), and CRISPR/Cas (˜0.5 nM). Stronger gene upregulation when mCherry-VP64 was targeted to a promoter via a Gal4 DNA binding domain compared to the PCD histone-binding domain also has been observed. PcTF-mediated gene activation is dose dependent and high PcTF expression levels are required for optimal activity. This limits the usefulness of PcTF for therapeutic applications where barriers to delivery severely limit the number of proteins that ultimately reach the nuclei of target cells. Although pharmacokinetic barriers to DNA and protein delivery in vivo are not trivial, increasing the effective dose of PcTF could significantly advance this technology towards clinical use.
The appearance of tandem histone binding domains within natural proteins suggests that the performance of histone-binding regulators can be customized and tuned through multivalency, defined as contact with more than one histone PTM via multiple domains. Multivalent chromatin proteins can engage adjacent PTMs within a single histone tail, such as K4me3 and R8me2 on histone H3 bound by Spindlinl, or K5ac and K12ac on histone H4 bound by TAFII250. PTM targets can also reside on two distinct histone tails, such as H4K16ac and H3K4me3 bound by BPTF. Dual recognition of histone PTMs is accomplished by tandem protein motifs within the histone-binding protein. Comparisons of natural mono- and divalent proteins as well as histone peptide on- and off-target binding studies have produced compelling evidence that tandem motifs contribute to avidity and specificity.
The idea that combinatorial avidity allows proteins to read a “histone code” has been the topic of some controversy. Until recently, multivalency had not been demonstrated using a rationally designed composition of binding domains. Tandem histone binding domains have been used to design protein probes to fluorescently label regions that are enriched for specific histone modifications. To date, multivalency has not been used to design a transcriptional regulator and tandem PCDs have not been reported. In order to compensate for the modest affinity of the CBX8 PCD for its target, in some embodiments, we added a second copy of H3K27me3-binding PCD to the N-terminus of PcTF to build Pc2TF. Here, we demonstrate that Pc2TF shows stronger avidity for H3K27me3 in vitro. This activity corresponds with enhanced activation of a H3K27me3-repressed gene in cultured cells. These results have important implications for building and tuning fusion proteins that target sites of Polycomb-mediated silencing, which plays a central role in cancer and stem cell plasticity.
Design of a bivalent synthetic chromatin-based transcriptional regulator. We designed the Pc2TF protein to simultaneously recognize two copies of the histone posttranslational modification H3K27me3. The Polycomb chromodomain motif (PCD) comprises three β strands packed against α C-terminal a helix, and a hydrophobic pocket formed by three aromatic residues that interact with a methyl-lysine sidechain (
To quickly and efficiently identify a linker that would allow contact of each PCD with a H3K27me3 ligand, we used an in vitro expression and ELISA procedure to test four Pc2TF variants. Different lengths and physical characteristics were explored by using flexible glycine-serine linkers and rigid alpha-helical linkers. Glycine and serine, amino acids with small side chains, have been used in a wide range protein engineering applications to build linker peptides that have minimal interference with the function of tethered proteins. However, as was demonstrated by mutagenesis of a rigid linker in the bivalent protein BPTF, added flexibility can destabilize protein-histone interactions. Rigid linkers might perform better by stabilizing the distance between PCDs to support interactions with neighboring K27me3 moieties. The Pc2TF constructs included two tandem copies of the PCD separated by one of four linkers: flexible SEQ. ID. NO. 1: (GGGGS)4, long flexible SEQ. ID. NO. 2: (GGGGS)16, rigid SEQ. ID. NO. 3: (EAAAR)4, and long rigid SEQ. ID. NO. 4: (EAAAR)16. Based on a simplified layout of the interacting components (PCDs and a nucleosome carrying two H3K27me3 modifications) (
To expedite the prototyping stage, we used a cell-free expression system. Pc2TF variants and a control protein with no binding domain (PcATF) were expressed from a pET28 vector (
To compare known concentrations of Pc-fusion proteins in subsequent experiments, we over-expressed and purified recombinant proteins from E. coli. Denaturing polyacrylamide electrophoresis (PAGE) of lysates from IPTG-treated and untreated E. coli confirmed inducible production of the proteins at roughly the expected sizes: 37, 44, and 52 kilo Daltons for PCΔTF, PcTF, and Pc2TF respectively (
To determine impact of the additional PCD domain on PcTF avidity, we exposed tethered histone peptides to varying concentrations of soluble PcTF and Pc2TF. Liquid phase ligand (H3K27me3 peptide) binding assays (fluorescence polarization, FP) reported by other groups have determined affinities of N-terminal PCD motifs from the Drosophila Pc protein (residues 1-90, Kd=5.0±1 μM13) and mammalian CBX8 protein (mouse residues 1-62, Kd=165±20 μM12; human residues 8-61, K>500 μM). The amino acid sequence of the PCD in our fusion proteins (human CBX8 residues 1-62) is identical to the mouse ortholog. To acquire data that is relevant to the full-length fusion proteins (295 to 445 residues) that we had previously tested as gene regulators in cancer cell lines we used a histone peptide microspot array. We used a mathematical model to predict relative RFP signal levels after Pc-fusion binding and subsequent washing of the microarray. PcTF has a higher mCherry: PCD ratio than Pc2TF (1:1 vs. 1:2). Therefore, PcTF should show higher relative RFP signal when all targets (H3K27me3 peptides) within a microspot are saturated by PCD binding (
Overall, analysis of the microspot array data suggest that at 10 and 20 μM of H3K27me3 the Kdapp of Pc2TF is roughly 2-fold smaller than PcTF (
Next, we investigated the binding properties of the mono- and bivalent PCD proteins over a range of target ligand densities to approximate dynamic distributions of H3K27me3 that may occur in chromatin. We assumed that random distribution within each mixture would decrease the spacing between H3K27me3 targets as their concentration was increased. We applied dilutions of the target ligand (0-100% H3K27me3 mixed with unmodified H3K27, 1000 nM final concentration) to ELISA wells and exposed the immobilized ligands to the highest concentration of fusion proteins that produced minimal background signal in preliminary ELISA trials (0.1 μM). At 0-15% H3K27me3, HRP signal for PcTF or Pc2TF was not significantly greater than the negative control fusion protein (PcΔTF). In this range, the number of fixed H3K27me3 ligands may not have captured enough fusion proteins to yield detectable signal after washing. At 20% -30% and higher, the HRP signal from the PcTF and Pc2TF wells increased with H3K27me3 concentration.
A Hill slope of 2.75 from the nonlinear regression (R2=0.90) for Pc2TF (
To investigate ligand selectivity, 50 nM of purified PcTF, Pc2TF, or PcΔTF was tested for interaction with histone peptides that were trimethylated at different lysine residues. PcTF and Pc2TF showed significant binding with H3K27me3 peptides compared to the control protein PcΔTF (
The results from the assays with purified proteins led us to ask, what is the biological consequence of increased binding in living cells where the physical distribution of H3K27me3 is much different. In the cellular chromatin environment, H3K27me3 can occur in cis on the radial surface of a single nucleosome (
Previously, we demonstrated that PcTF activated a reporter gene near ectopic H3K27me3 in HEK293 cells. Here, we determined the biological significance of PCD bivalency by comparing the gene-regulation activities of Pc2TF and PcTF at the same reporter. Doxycycline (dox)-mediated induction Gal4-EED in HEK293 Gal4-EED/luc cells leads to accumulation of H3K27me3 at and silencing of a chromosomally integrated Tk-luciferase transgene (
We transfected dox-treated cells (96 hours) with the PcΔTF negative control, PcTF, or Pc2TF cloned into a mammalian expression vector (
Expression of fusion regulators in cells that were treated with dox for 0, 48, and 96 hours showed that Pc2TF had roughly twice the activity as PcTF (96 hours), and that Pc2TF activated Tk-luciferase without prior dox-induced silencing (
In the embodiments and examples disclosed herein, there are demonstrations of modular, synthetic multivalency of a chromatin-derived, histone-binding protein with gene-regulating activity. We have demonstrated for the first time the use of a monovalent synthetic effector to activate chromatin-silenced genes in live cells. Natural bivalent chromatin proteins that recognize two histone post translational modifications at once suggest a broader design space for synthetic chromatin effectors. Our application of bivalency to design a synthetic fusion protein produced two important advances for engineering synthetic chromatin effectors. First, we determined that synthetic linkers allow tethered histone PTM-binding peptides to function within the context of a fusion protein in vitro and in live cells. Second, we have established that doubling the valency with tandem PCDs strengthens avidity and increases gene regulation activity by at least 2-fold.
Here, we demonstrated that different synthetic linkers allow tethered histone PTM-binding peptides to bind in vitro to varying degrees. We observed weaker binding for the longer flexible linker (80 amino acids) compared to the shorter linker in our ELISA experiment. This result is likely due to lower production of the long flexible linker variant in TXTL. Given that both variants showed binding above background, SEQ. ID. NO. 5 (GGGGS)-repeat number may not significantly affect bivalent PCD engagement with H3K27me3 in vitro. For the rigid linker-tethered PCDs, only the longer length (80 amino acids) appeared to support binding. Assuming that this variant protein was properly folded, lack of binding over background for the shorter SEQ. ID. NO. 6 (EAAAR)-repeat variant could be caused by suboptimal rotation, i.e., in trans instead of in cis, of the second PCD away from the 2-D binding surface in the ELISA well. This mechanism was demonstrated with mutated alpha-helical linkers in bivalent BPTF and with tandem Zinc Finger DNA binding domains. In the context of cellular chromatin where looping and folding occurs, H3K27me3 would not necessarily be constrained to one face of the Pc2TF protein. Valuable insights and perhaps greater Pc2TF performance might be acquired by exploring additional linker variants in cells as well as in vitro.
We have established that tandem PCDs strengthen avidity for H3K27me3 in a cooperative manner in vitro and increase gene regulation activity in live cells by at least 2-fold compared to a monovalent PCD. The wide distribution of multivalency within bromodomain family and other effector proteins suggests that multivalent engagement has an important, evolutionarily-conserved biological role. Multivalency appears to largely be represented by cell-cycle and gene-activating effectors. Relatively few multivalent proteins that recognize silencing marks have been studied in biophysical detail. Examples include the chromodomains of the Arabidopsis protein CMT3 and the mammalian protein HP1β; as bivalent homodimers, these proteins show enhanced interaction with their respective ligands H3K9meK27me and H3K9me3. Pc2TF is novel in its composition of histone-binding motifs: adjacent, identical Polycomb chromodomains within a single peptide. Therefore, its activity in vitro and in cells provides new insights into the recognition of histone marks by effector proteins.
In the context of cellular chromatin, Pc2TF appears to be active at the target gene prior to full repression (
Further engineering efforts to achieve greater, nonlinear enhancement of PcTF/Pc2TF may require changes within the PCD binding motif. The hydrophobic interaction between the methylammonium cage and the methyl-lysine moiety (
Multivalent engagement of combinatorial histone marks has recently become a key line of evidence to support the controversial histone code hypothesis. Rationally-designed synthetic multivalency will advance this important area of research by exploring functions beyond the limits of pre-existing natural multivalent proteins. Furthermore, engineered chromatin effectors provide a practical tool to support artificial regulation of gene expression states through direct engagement with highly-conserved components of chromatin, i.e. histone tails and their modifications. Therapeutic, synthetic gene regulators that leverage this mechanism could help circumvent the shortcomings of epigenetic inhibitors, which target chromatin enzymes that can gain drug-resistant mutations. This demonstrates that synthetic biology is a powerful tool for fundamental investigations of chromatin biology and epigenetic engineering.
Plasmid Constructs for TXTL and Bacterial Expression. Constructs (
TXTL: Cell-free Expression. TXTL reactions were set up with the following conditions as previously described: 9 μL lysate, 10 nM final template vector, 0.5 nM σ70-T7 RNA pol vector to a total of 12 μL. A Roche Lightcycler 480 was used to detect mCherry fluorescence with the following: protocol: 30° C. for 10 minutes, bring to 29° C. for 1 second, scan 533-610 nm, repeat 96 times (total 16 hrs).
E. coli Expression and Purification of Proteins. All selection media contained 50 μg/mL kanamycin. PcΔTF, PcTF, and Pc2TF in pET28 were transformed into Rosetta 2pLys DE3 cells and plated on LB agar and grown at 37° C. overnight. The next day, a single colony from each was used to inoculate 50 mL LB and grown overnight at 37° C. at 300 RPM. The next day, 1 liter of LB in a baffled Erlenmeyer flask was inoculated to an OD600 of 0.1. The cultures were grown to an OD600=0.6, induced with IPTG (1 mM final concentration) and allowed to express Pc66 TF and PcTF at 37° C. for 5 hours with shaking (220 RPM). Pc2TF-expression was carried out overnight at room temperature with shaking (220 RPM) to aid solubility of the protein. Cell disruption and protein purification are described in detail below. Purification of recombinant protein from E. coli. also is described below.
Enzyme-linked immunosorbent assays (ELISAs). All steps were carried out at room temperature except specifically noted, and all incubations and washes were agitated at 800 RPM on an Eppendorf Thermomixer R. Clear bottom plates (Greiner bio-one #655101) were coated in 50 μL of 20 ng/μL neutravidin in PBS pH. 8.0 overnight at 4° C. The plates were washed the next day 3× with 200 μL 0.2% PBS-Tween (PBST) with 5 minutes of shaking at 800 RPM between washes. The plate was blocked for 30 min at 800 RPM at room temperature with 200 uL 5% BSA in 0.2% PBST followed by 3× washes of 200 μL 0.2% PBST for 5 minutes each at 800 RPM. 50 μL of 1μM biotinylated peptides (Anaspec: H3 (21-44), H3K4me3 (1-21), H3K9me3 (1-21), H3K27me3 (21-44), or H3K27Ac (21-43)) in 0.2% PBST) were incubated at room temperature for 1 hour at 800 RPM, followed by 3× washes of 200 μL 0.2% PBST for 5 minutes at 800 RPM. The plate was blocked with 200 μL 5% skim milk in 0.2% PBST (room temperature, 800 RPM, 30 min.). 1.5 μL TxTL (
to fit the Hill equation to the data by minimizing the sum of the squared errors between the equation and data (varying Kdapp and n). R2 was calculated as 1−(SSreg/SStot), where total sum of squares SStot=Σi(yi−
Peptide Microspot Arrays. APTES functionalized glass slides were coated with 200 μL of 1:1 (v/v) 40 mg/mL BS3 crosslinking solution and 1 mg/mL neutravidin with a cover slide (Thermo Scientific, #651-2-5251) and incubated overnight at 4° C. The next day, the cover slide was removed and the slide was rinsed 3× with 0.2% PBST for 5 minutes each. Slides were deactivated by incubation with Na2CO3/NaHCO3 buffer pH 9.4 for 30 minutes. The slides were quickly rinsed with ddH2O, and centrifuged to dry at 1200 RPM for 2 minutes. Slides were printed with biotinylated peptides (Anaspec) at concentrations of 10, 20, or 50 μM in 20% glycerol and PBS with a pin-printer (spot to spot distance=600 μm) and incubated at room temperature for 1 hr. The slide was rinsed with ddH2O as described above and blocked with superblock for 1 hr at room temperature. Proteins were diluted in superblock and incubated on the slide for 1 hr at room temperature. The slides were rinsed with 0.2% PBST for 3 minutes each followed by quick rinsing with ddH2O 3× and centrifuged dry (as described). Red fluorescent protein (mCherry) signal was detected at 50% gain and 50% intensity on a PowerScanner at 635 nm and 535 nm, 10 μm resolution. Slides were also scanned at 75%-75% and 100%-100% to obtain a suitable signal to noise ratio. Arraypro software was used to quantify the median intensity values for each spot and background levels. Graphpad Prism software was used to fit the binding saturation nonlinear regression equation y=(Bmax*X)/(Kdapp+X) to the data, where Bmax is the highest binding value, and X is the concentration of protein.
Plasmid Constructs for Mammalian Expression. MV10 was constructed from pcDNA3.1(+) (Invitrogen) with the following modifications. The CMV promoter was removed via SpeI digestion and T4 ligase recircularization. A dsDNA fragment that encodes Kozak (ribosome binding site), XbaI, a nuclear localization sequence, 6x histidine, and a stop codon SEQ. ID. NO. 17(5′-cccgccgccaccatggagtctagacccaagaaaaagcgcaaggtacaccatcaccaccatcacgcgtaaagctgag) with SpeI overhangs at both ends (ctag/t) was inserted at XbaI. CMV (SpeI/XbaI fragment) was reintroduced upstream of Kozak at SpeI. Proper orientation of inserts was confirmed by Sanger sequencing. Constructs PcTF and Pc2TF (
Cell Culture and Transfection. HEK293 Gal4-EED/luc cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% tetracycline-free fetal bovine serum and 1% penicillin and streptomycin at 37° C. in a humidified CO2 incubator. Silencing of the reporter gene (Tk-luciferase) was induced by supplementing the media with 1 μg/mL of dox for 48 or 96 hours. For wash-out of doxycycline (to allow depletion of Gal4-EED), growth medium was removed and replaced with dox-minus medium supplemented with 0.5 μg/mL puromycin to select for the transgenic anti-Gal4-EED shRNA, and grown for 5 days. Prior to transfection, dox treated or untreated cells were plated in 12-well culture dishes at 40% confluency (˜1.0E5 cells per well) in 2 mL pen/strep-free growth medium. Transient transfections were carried out by adding 100 μL of DNA/Lipofectamine complexes to each well: 1 μg pDNA or ddH2O for mock transfections (10 μL), 3μL Lipofectamine LTX (Invitrogen), 87 μL Opti-MEM. 48 hours after transfection, cellular mCherry (580/610 excitation/emission) was imaged in culture dishes on a Nikon Eclipse Ti wide field inverted fluorescent microscope (MEA53100) at 200× magnification (eyepiece=10×; objective=CFI S Plan Fluor ELWD 20×, numerical aperture=0.45), 25° C., without oil immersion, and with either phase contrast or an mCherry filter set (TE2000 cube, excitation FF01-562/40-25, emission FF01-641/75-25). Images from each channel were acquired with a digital monochrome camera (Coolsnap ES2 12 bit, 20 MHz) and overlaid using NIS-Elements software. For downstream assays (RT-qPCR, Western blots, and flow cytometry), the growth medium was removed, semi-adherent cells were gently collected with 1× PBS washes, pelleted (200 g, room temperature, 5 min) and resuspended in 1× PBS. Six replicate samples (wells) were pooled for assays in
RT-qPCR. Preparation of total RNA, cDNA synthesis, and qPCR were performed as previously described using ˜1.0E6 HEK293 Gal4-EED/luc cells that were pelleted (500 g, room temperature, 5 min) and lysed with 500 μL TRIzol (Thermo Fisher #15596026). DNA/LNA oligos for qPCR were: mCherry-forward SEQ. ID. NO. 18 (5′-cctgaagggcgagatcaag), reverse SEQ. ID. NO. 19 (5′-ttgacctcagcgtcgtagtg), LNA probe #41 (Millipore Sigma #04688007001); luciferase-forward SEQ. ID. NO. 20 (5′-caggtcttcccgacgatg), reverse SEQ. ID. NO. 21 (5′-gtattccgtgctccaaaac), LNA probe #70 (Millipore Sigma #04688937001); GAPDH (reference)-Roche human G6PD assay (Millipore Sigma #5046246001). Mean Crossing point (Cp), the first peak of d2y/dx2 (fluorescence over cycle number), was calculated by the Roche LightCycler 480 software for three replicate wells per unique reaction. For each biological replicate (one transfection per fusion protein) two replicate cDNA synthesis reactions (from one RNA prep) were completed. Expression level was calculated as delta Cp=2̂[Cpreference−Cp]. “mRNA level log2(FC)”=delta Cp transfected cells/delta Cp mock.
Western blots. Total protein was prepared from roughly 250,000 cells. Sample preparation, polyacrylamide gel electrophoresis (PAGE), and membrane blotting are described in detail in Supporting Information. Immunostaining was carried out with the following: blocking buffer-5% nonfat dry milk in 1× PBST (1x PBS, 0.1% Tween-20); primary 1-chicken polyclonal anti-mCherry, 1:2000 (Novus Biologicals #NBP2-25158); secondary 1-HRP-conjugated rabbit anti-chicken, 1:2000 (Millipore Sigma #AP162P); primary 2-anti-histone H3, 1:1000 (Abcam #ab1791); secondary 2- HRP-conjugated goat anti-rabbit, 1:2000 (Cell Signalling Technology #7074). Immunostaining was performed at 4° C. overnight (primary) or at room temperature for 1 hour (secondary) with nutation in a Parafilm pouch. Immunostained blots were washed 4×10 min in 1× PBST, with orbital shaking at room temperature. HRP signal was detected using the SuperSignal West Femto substrate kit (Thermo Fisher #34095) and a PXi4 imager (Syngene) with GeneSys software.
Imaging and flow cytometry. Cells were passed through a 35 μm nylon strainer (EMS #64750-25). Red fluorescent signal from mCherry was detected on a BD Accuri C6 flow cytometer (675 nm LP filter) using CFlow Plus software. Data were further analyzed using FlowJo 10.0. One run (˜10,000 live cells, gated by forward and side scatter) was completed per sample. “RFP median signal/noise (S/N)”=median RFP signal from live RFP-positive cells/median RFP noise from live untransfected cells.
Luciferase Assays. Cell counts (per 100 μL) were determined by flow cytometry (BD Accuri C6). 100 μL of cells or 1× PBS (blank) were incubated with 100 μL of complete luciferase assay reagent as described in the protocol for the Biotium Firefly Luciferase Assay Kit (89138-960) and in previous work in Corning and Costar 96-well Cell Culture Plates, opaque, white (Corning 3789A). Chemiluminescence was detected using a Synergy H1 Multi-Mode Reader (Biotek). Replicates included three samples (100 μL each) taken from a single population of transfected cells. “Luc ×cell−1(a.u.)” =[Sample Luciferase signal]—1×PBS blank signal/[cell count ×(100 μL/20 μL)]. For fusion protein-expressing cells, normalization was performed by dividing Luc ×cell−1 by the RFP median signal/noise value (from flow cytometry).
Purification of recombinant protein from E. coli. IPTG-induced cells were pelleted by centrifugation at 4,000 RCF for 10 min, resuspended in 30 mL of purification buffer (10% glycerol, 250 mM NaCl, 50 mM Na2PO4, pH 8.0), and frozen at −80° C. overnight. Disruption of thawed cells (on ice) was performed by sonication with a QSONICA instrument (model Q500) at 50% power: (1 second on, 2 seconds off)×6000 cycles. After addition of imidazole (10 mM final concentration), insoluble material was pelleted at 16,000 RPM for 30 min at 4° C. in a Beckman Coulter Avante J-E Rotor JA-17. Purification columns were prepared by washing 2.5 mL of Ni-NTA Agarose (Qiagen #30210) with 10 mL of ddH20 on a 50 mL polyprep column, then equilibrated with 15 mL purification buffer plus 10 mM imidazole. Soluble fractions of cell lysates were loaded onto a plugged column, vortexed briefly to homogenize resin and supernatant, and incubated with rotation at 4° C. for 2 h. The cap and bottom plug were removed to empty the unbound fraction, and flow-through was applied back to the column once. Protein-bound resin was washed with 10 mL binding buffer plus 10 mM imidazole, followed by 5 mL binding buffer plus 20 mM imidazole and 5 mL binding buffer plus 50 mM imidazole. Resin was incubated with 1 mL of binding buffer plus 250 mM imidazole for 10 min in a plugged column before elution. Elution was repeated with binding buffer plus 500 mM, and then binding buffer plus 1.0 M imidazole. Proteins were concentrated and buffer-exchanged into PBS using a 15 mL 30,000 kDa centrifugal filter and repeated washes of PBS followed by centrifugation at 4000 RCF for 10 min, and stored at 4° C. in a final volume of about 1 mL. Concentration of protein was determined using a denaturing polyacrylamide gel with bovine serum albumin (BSA) standards.
Western blot detailed protocol. Roughly 250,000 cells were pelleted at 300 g for 5 min, lysed by resuspension in 500 μL Mammalian Cell PE LB (G-Biosciences #786-180) plus 5 μL 100× ProteaseArrest (G-Biosciences #786-108), and vortexed for 2 min. Insoluble debris was pelleted at 16,000 xg, 4° C., 5 min and discarded. Samples for denaturing polyacrylamide gel electrophoresis (PAGE) were prepared by heating 15 μL lysate plus 4 μL NuPAGE® LDS Sample Buffer 4×(Thermo Fisher #NP0007) and 1 μL 1M DL-Dithiothreitol (DTT, Millipore Sigma #D0632-1G) at 100° C. for 5 min. Samples (cooled to room temperature) and a pre-stained protein standard (10 μL, Thermo Fisher #10748010) were electrophoresed at 120 V in a 4-12% Bis-Tris gel (Thermo Fisher #NP0322BOX) with MOPS-SDS buffer [50 mM MOPS, 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.7] diluted 1:20 in an XCell SureLock vertical chamber (Invitrogen #EI0001). Proteins were transferred onto a nitrocellulose membrane (Bio-Rad #1704158) via semi-dry transfer in a Transblot Turbo system (Bio-Rad #1704150). Complete transfer was verified by staining the membrane with 1×Ponceau-S (G-Biosciences #786-576).
The following claims are not to be limited to the embodiments and examples disclosed herein. All references herein are hereby incorporated by reference in their entirety.
This application claims priority to U.S. Provisional Patent Application Ser. No. 62/630,352, filed on Feb. 14, 2018.
This invention was made with government support under K01 CA188164 awarded by the National Institutes of Health. The government has certain rights in the invention.
Number | Date | Country | |
---|---|---|---|
62630352 | Feb 2018 | US |