Patent Application
20080313747
The invention provides a method for targeted transgenesis of short hairpin RNA expression cassettes using recombinase mediated cassette exchange. Suitable nucleotide acid sequences and vectors for the targeted transgenesis and recombinase mediated transgenesis are provided.
The generation of transgenic mice by nuclear injection of purified DNA into fertilized eggs is a widely used approach for studying gene or promoter function in vivo. However, the level and pattern of expression often varies strongly depending on copy number, configuration, and integration site of the transgene. In addition, founder mice occasionally do not transmit the transgene. Thus, a number of different founders need to be generated and tested in order to identify a useful strain, which is a laborious and time-consuming undertaking (Bradley et. al., Nature Genet., 14:121-123 (1996); Jasin et al., Proc. Natl. Acad. Sci. USA, 93:8804-8808 (1996); Dobie et al., Trends Genet., 13:127-130 (1997); Garrick et al., Nature Genet., 18:56-59 (1998), Al-Shawl et al., Mol. Cell. Boil. 10:1192-1198 (1990)).
To overcome these limitations, homologous recombination in embryonic stem cells has been used to produce mice carrying a single copy of the transgene integrated into a predetermined site of the genome (Shaw-White et al., Transgenic Res.; (1):1-13 (1993); Bronson et al., Proc. Natl. Acad. Sci. USA, 93(17:9067-72 (1996); Hatada et al., J. Biol., Chem., 274(2):948-55 (1999); Vivian et al., Biotechniques, 27(1):154-62 (1999); Evans et al., Physiol. Genomics, Mar. 13, 2(2):67-75 (2000); Cvetkovic et al., J. boil. Chem., 275(2):1073-8 (2000); Guillot et al., Physiol. Genomics, Mar. 13, (2):77-83 (2000); Magness et al., Blood, 95(11):3568-77 (2000); Misra et al., BMC Biotechnol., 1(1):12 (2001); Minami et al., Blood, 100(12):4019-25 (2002); Tang et al., Genesis, 32(3):199-202 (2002)). In these studies, the ubiquitous Hprt locus was more or less successfully used for ‘targeted transgenesis’. Insertion of a lacZ gene under the control of the polyoma enhancer/HSV thymidine kinase promoter into the third exon of Hprt resulted in variable B-galactosidase expression that was both orientation and cell-type dependent (Shaw-White et al., Transgenic Res.; (1):1-13 (1993)). Although transgenes under the control of the human and the chicken β-actin gene promoter resulted in widespread expression when inserted into the Hprt locus, the level of transcripts varied strongly in different tissues (Bronson et al., Proc. Natl. Acad. Sci. USA, 93(17:9067-72 (1996)). Unexpectedly, expression of these transgenes, but not of the endogenous Hprt gene appeared to be low or undetectable in kidney and liver (Bronson et al., Proc. Natl. Acad. Sci. USA, 93(17:9067-72 (1996)). Hatada et al. demonstrated that the HPRT locus suppresses the activity of both, the haptoglobin gene promoter as well as the herpes simplex thymidine kinase promoter in several tissues of mice (Hatada et al., J. Biol., Chem., 274(2):948-55 (1999)). Likewise, a human eNOS promoter-LacZ reporter gene placed in the Hprt locus was found to be inactive in hepatic vessels that otherwise express the endogenous eNOS gene (Guillot et al., Physiol. Genomics, Mar. 13, (2):77-83 (2000). Finally, since the HPRT gene is on the X chromosome, transgene expression at this locus is subjected to random X-inactivation. The expression of the transgene in all cells of the female, therefore, requires the generation of homozygotes.
WO 04/63381 reports on a particular autosomal locus, namely Rosa 26 that allows strong and predictable expression of transgenes inserted through homologous recombination. This chromosomal locus was found useful in the context of the “targeted transgenesis” approach for the efficient generation of transgenic organisms (such as mice) with a predictable transgene expression pattern. The “targeted transgenesis” method provided in said application comprises consecutive experimental steps. A gene expression cassette comprising a suitable promoter (e.g. a ubiquitous or tissue specific promoter, either inducible or constitutive) functionally linked to a gene of interest is created; subsequently a vector for the targeted insertion of the above mentioned gene expression cassette into the Rosa26 locus is generated; the insertion of the above mentioned gene expression cassette into the Rosa26 locus through homologous recombination or site specific recombination in embryonic stem cells follows; finally transgenic mice are generated by the injection of such genetically modified ES cells into blastocysts.
Previously, he rosa26 locus had been identified by random insertion of retroviral sequences and a β-galactosidase-neomycin resistance fusion gene into the genome of mouse embryonic stem cells (Zambrowicz et al., Proc. Natl. Acad. Sci. USA, 94, 3789-94 (1997)). The rosa26 promoter appeared to mediate ubiquitous expression of promoter-less genes both in embryos and adult mice (Kisseberth et al., Dev. Biol., 214:128-138 (1999); Zambrowicz et al., Proc. Natl. Acad. Sci. USA, 94, 3789-94 (1997)), albeit at different levels in different organs (Vooijs et al., EMBO reports, 21:292-297 (2001)).
Moreover, WO 99/53017 describes a process for making transgenic animals which ubiquitously express a heterlogous gene, wherein the heterologous gene is under the control of a ubiquitously expressed endogenous promoter, e.g. that of the mouse Rosa26 locus. R. Dacquin et al., Dev. Dynamics 224:245-251 (2002) and K. A. Moses et al., Genesis 31:176-180 (2001) utilize the transgenic mouse strain R26R obtained according to WO 99/53017 for the expression of heterlogous genes. WO 02/098217 describes a method of targeting promoter-less selection cassettes into transcriptionally active loci, such as the Rosa26 locus.
Finally, WO 03/020743 describes the expression of transgenes in vivo by targeting protected transgene cassettes into predetermined loci (e.g. the Rosa26 locus), such that the introduced tissue specific exogenous promoter has at least some tissue specific activity. The protected transgene cassette contains (from 5′ to 3′ direction) a transcriptional stop signal, the exogenous tissue specific promoter and the gene of interest. The presence of a transcriptional stop signal is vital for the method of WO 03/020743 as therewith the expression pattern is determined primarily by the nature of the tissue specific exogenous promoter.
RNA interference (RNAi) has been discovered some years ago as a tool for inhibition of gene expression (Fire, A. et al., Nature 391, 806-811 (1998)). It based on the introduction of double stranded RNA (dsRNA) molecules into cells, whereby one strand is complementary to the coding region of a target gene. Through pairing of the specific mRNA with the introduced RNA molecule, the mRNA is degraded by a cellular mechanism. Since long dsRNA provokes an interferon response in mammalian cells, the technology was initially restricted to organisms or cells showing no interferon response (Bass, B. L., Nature 411, 428-429 (2001)). The finding that short (<30 bp) interfering RNAs (siRNA) circumvent the interferon response extended the application to mammalian cells (Elbashir, S. M. et al., Nature 411, 494-498 (2001)).
Although RNAi in mice has been in principle demonstrated, the current technology does not allow performing systematic gene function analysis in vivo. So far the inhibition of gene expression has been achieved by injection of purified siRNA into the tail vain of mice (McCaffrey, A. P. et al., Nature 418, 38-39 (2002); Lewis, D. H. et al., Nature Genet. 32, 107-108 (2002)). Using this approach, gene inhibition is restricted to specific organs and persists only a few days. A further improvement of the siRNA technology is based on the intracellular transcription of short hairpin RNA (shRNA) molecules using gene expression vectors (see
The in vivo validation of genes by RNAi mediated gene repression in a large scale setting requires the expression of siRNA at sufficiently high levels and with a predictable pattern in multiple organs. Targeted transgenesis provides the only approach to achieve reproducible expression of transgenes in the living organism (e.g. mammalians such as mice). WO 04/035782 discloses for the first time that a single copy of a siRNA expression vector integrated into a defined locus of the genome can provide sufficiently high levels of siRNA for efficient RNAi-mediated gene inhibition in multiple organs of the living organism.
Two types of procedures have been described for targeted integration of transgenes into defined loci of the embryonic stem (ES) cell genome. One is based on homologous recombination (HR) in embryonic stem cells, and the other on site-specific recombination. In the first case, the efficiency is limited by the low frequency of HR. In contrast, site-specific recombination has emerged as a powerful tool for the targeted insertion of transgenes into the eukaryotic genome.
Site-specific recombinases such as Flp and Cre mediate recombination between two copies of their target sequence termed FRT and loxP, respectively. The use of two incompatible target sequences, for example FRT in combination with F3 (Schlake & Bode, Biochemistry, 1994 Nov. 1, 33(43):12746-51) as well as inverted recognition target, sites (Feng et al., J. Mol. Biol. 292(4):779-85 (1999)) allows the insertion of DNA segments into a predefined chromosomal locus carrying target sequences in a similar configuration. This exchange system is called recombinase mediated cassette exchange (RMCE; Bode & Baer, Curr Opin Biotechnol. 2001 October; 12(5):473-80). In contrast to approaches using a single recombination site the targeting product is stable even under the permanent influence of the recombinase unless it is exposed to an exchange plasmid (Seibler & Bode (1997) Biochemistry 36, 1740-1747.).
So far, only few examples of successful RMCE in ES have been described (Feng et al., 3 Mol. Biol. 1999 Oct. 1; 292(4):779-85; Seibler et al., Biochemistry. 1998 May 5; 37(18):6229-34; Kolb, Anal Biochem. 2001 Mar. 15; 290(2):260-71; Belteki et al., Nat. Biotechnol. 2003 March; 21(3):321-4.; Cesari et al., 2004, Genesis, 38:87-92.). In these experiments, random integration of the exchange vector as well as incomplete recombination frequently produced unwanted transgene configurations. The efficiency of RMCE appeared to vary strongly depending on the choice of recombination sites, the selection strategy, and the chromosomal target. The criteria for efficient RMCE at a given locus are therefore not defined and unpredictable for a person skilled in the art.
The only example of efficient (>90%) RMCE at a defined locus used the tissue-specific β-casein gene as chromosomal target (Kolb, Anal Biochem. 2001 Mar. 15; 290(2):260-71). However, a HPRT gene was required to exclude random integration or incomplete recombination of the exchange vector. The application of this strategy is therefore limited to HPRT-negative ES cells. In addition, the cell type specific activity of the B-Casein locus may not be suitable for the expression of transgenes in multiple tissues. Taken together, a general strategy for efficient RMCE at a ubiquitously active locus has never been achieved.
It was surprisingly found that RMCE can be effectively be performed at ubiquitously active loci with high efficiency. The invention provides:
(1) a method for generating transgenic eukaryotic cells having an ubiquitous locus modified by an expression cassette comprising a short hairpin RNA construct operatively linked to a promoter or an inactive precursor thereof, which method comprises introducing the expression cassette into the ubiquitous locus of eukaryotic cells by recombinase mediated cassette exchange;
(2) the method of (1) above, which comprises
(a) introducing a functional DNA sequence into the Rosa26 locus of starting eukaryotic cells by homologous recombination with a targeting vector comprising flanking DNA sequences homologous to the ubiquitous locus and an acceptor DNA, which integrates into the genome of the starting cell, the acceptor DNA comprising two mutally incompatible first recombinase recognition sites (RRSs), and
(b) effecting recombinase mediated cassette exchange of the recombination product of step (a) having an RMCE target site with an exchange vector comprising a donor DNA, which comprises the expression cassette flanked by the same two mutually incompatible first RRSs contained in the acceptor DNA, by utilizing a recombinase which catalyzes recombination between the RRSs of the acceptor and donor DNA; (3) the method of (1) or (2) above, wherein the transgenic eukaryotic cells are derived from mouse and the ubiquitous locus is a Rosa26 locus, and
(i) the DNA sequences homologous to the Rosa26 locus are derived from the 5′ and 3′ flanking arm of the mouse Rosa26 locus, preferably said homologous DNA sequences having the sequences shown in SEQ ID NO:4 and 5, respectively, and/or
(ii) the RRSs of the targeting and exchange vectors are F3/Frt and the targeting vectors encodes the recombinase Flp or a mutant thereof, preferably Flpe; and/or
(iii) the targeting vector comprises a negative selection marker; and/or
(iv) the exchange vector comprises a promoter-less positive selection marker; and/or
(v) the promoter of the expression cassette is a H1 or H6; most preferably the targeting vector has the sequence shown in SEQ ID NO:11 and the exchange vector has the sequence shown in SEQ ID NO: 12 or a variant thereof with modification in the short hairpin RNA construct;
(4) an exchange vector as defined in (1) to (3) above;
(5) a eukaryotic cells having a modified ubiquitous locus obtainable by the method of (1), (2) and (3) above;
(6) a method for preparing a transgenenic multi-cell organism having a modified ubiquitous locus which comprises utilizing the method as defined in (1) and (3) above;
(7) the method of (6) above, wherein the transgenenic multi-cell organism is a non-human mammal and said method comprises modifying an ES cell as defined in (3) above;
(8) a transgenic multi-cell organism and non-human mammal obtainable by the above defined methods (6) and (7), respectively; and
(9) the use of the eukaryotic cell of (5) above, the transgenic multi-cell organism of (8) above, or the transgenic non-human mammal of (8) above for gene function studies, drug development, as disease model, etc.
The method of the invention offers several advantages over the current technology of pronuclear injection. In particular, the targeting vector allows insertion of a single copy of a gene expression cassette, thus avoiding modulation of transgene expression by the arrangement of multiple copies. By choosing the autosomal Rosa26 locus as insertion site, the expression pattern of the inserted transgene in the non-human animal is predictable; random X-inactivation and/or modulation by chromosomal position effects are avoided. This also eliminates the need to generate and analyse multiple transgenic strains for any given transgene. Finally, the Rosa26 targeting vector for the site-specific integration can be used for multiple gene expression cassettes. Moreover, the RMCE strategy provides for more flexibility for consitutive and inducible gene knock-down, RNA mediated gene silencing in transgene animals and living organs.
The term “living organisms” according to the present invention relates to multi-cell organisms which can be vertebrates such as mammals (e.g. non-human animals such as rodents including mice and rats; and humans) or non-mammals (e.g. fish) or can be invertebrates such as insects or worms, or can be plants (higher plants, algi or fungi). Most preferred living organisms are mice and fish.
“Eukaryotic cells” and “starting eukaryotic cells” according to the present invention include cells isolated (derived) from the above defined living organisms and cultured in vitro. These cells can be transformed (immortalized) or untransformed (directly derived from living organisms; primary cell culture). The term “eukaryotic cells” also includes mono-cellular eukaryqtic cells such as yeasts, etc.
It is preferred in the method (1) of the present invention that the eukaryotic cells are derived from a multi-cell organism including vertebrates, invertebrates and plants, preferably is a vertebrate cell, more preferably is derived from a mammal, including rodents such as mouse, rat, etc., or a fish such as zebrafish.
In the method (1) of the invention it is preferred that the functional DNA sequence comprises a gene encoding a protein/peptide of interest (i.e. is a expressible and translatable DNA sequence), more preferably said functional DNA sequence is a gene expression cassette (a) comprising a gene of interest operatively linked to a promoter, or (b) is a DNA sequence which can be converted into such gene expression cassette (i.e. into an operatively linked “promoter-gene of interest” construct, e.g. by subsequent modification reactions after its integration). The gene of interest within the gene expression cassette can be any gene coding for a certain protein/peptide of interest, including, but not limited to, recombinases, reporter genes, receptors, signaling molecules, transcription factors, pharmaceutically active proteins and peptides, drug target candidates, disease causing gene products, toxins, etc.
The promoter of the gene expression cassette (which is a heterologous promoter relative to the Rosa26 locus) preferably is a ubiquitous or tissue specific promoter, either constitutive or inducible. The ubiquitous promoter in the vector according to the invention is preferably selected from polymerases I, II and III dependent promoters, preferably is a polymerase II or III dependent promoter including, but not limited to, a CMV promoter, a CAGGS promoter, a snRNA promoter such as U6, a RNAse P RNA promoter such as H1, a tRNA promoter, a 7SL RNA promoter, a 5 S rRNA promoter, etc. Particularly preferred ubiquitous promoters are CAGGS, hCMV, PGK. Preferred tissue specific promoters are FABP (Saam & Gordon, J. Biol. Chem., 274:38071-38082 (1999)), Lck (Orban et al., Proc. Natl. Acad. Sci. USA, 89:6861-5 (1992)), CamKII (Tsien et al., Cell 87: 1317-1326 (1996)), CD19 (Rickert et al., Nucleic Acids Res. 25:1317-1318 (1997)), Keratin (Li et al., Development, 128:675-88 (201)), Albumin (Postic & Magnuson, Genesis, 26:149-150 (2000)), aP2 (Barlow et al., Nucleic Acids Res., 25 (1997)), Insulin (Ray et al., Int. J. Pancreatol. 25:157-63 (1999)), MCK (Bruning et al., Molecular Cell 2:559-569 (1998)), MYHC (Agak et al., J. Clin. Invest., 100:169-179 (1997), WAP (Utomo et al., Nat. Biotechnol. 17:1091-1096 (1999)), Col2A (Ovchinnikov et al., Genesis, 26:145-146 (2000)); preferred inducible promoter systes are Mx (Kuhn et al. Scinence, 269:1427-1429 (1995)), tet (Urlinger et al., Proc. Natl. Acad. Sci. USA, 97:7963-8 (2000)), Trex (Feng and Erikson, Human Gene Therapy, 10:419-27). Suitable inducible promoters are the above-mentioned promoters containing an operator sequence including, but not limited to, tet, Gal4, lac, etc.
The targeting vector, recombination vector, functional DNA sequence or gene expression cassette may further comprises one or more additional functional sequences including but not limited to (selectable) marker genes (such as the neomycin phosphotransferase gene of E. coli transposon, etc.), recombinase recognition sites (which in case of the recombination vector differ from the first recombinase recognition sites and which include loxP, FRT, variants thereof, etc.), poly A signals (such as synthetic polyadenylation sites, or the polyadenylation site of human growth hormones, etc.), splice acceptor sequences (such as a splice acceptor of adenovirus, etc.), introns, tags for protein detection, enhancers, selection markers, etc.
In a preferred embodiment methods (1) to (3) of the invention comprise homologous recombination. It is then preferred that the DNA sequences homologous to the Rosa26 locus are 0.2 to 20 kB, preferably 1 to 10 kB long. In a particularly preferred embodiment of the method (2) the eukaryotic cells are derived from mouse, the DNA sequences homologous to the Rosa26 locus are derived from the 5′ and 3′ flanking arm of the mouse Rosa26 locus, preferably said homologous DNA sequences having the sequences shown in SEQ ID NO:4 and 5, respectively, and the promoter is a CAGGS-promoter, most preferably the targeting vector has the sequence shown in SEQ ID NO:7.
As set forth above, methods (1) to (3) of the invention comprise recombinase mediated cassette exchange (RMCE). The insertion of transgenes or DNA segments into the genome can be mediated by site specific recombination (Fukushige & Sauer, Proc. Natl. Acad. Sci. USA 89(17):7905-9 (1992)). A site specific recombinase like cre or FLP recombines two recognition target sites like loxP or FRT, respectively. The use of two incompatible recognition target sites (F3 or F5, Schlake & Bode, Biochemistry, 1994 Nov. 1, 33(43):12746-51) or inverted recognition target sites (Feng et al., J. Mol. Biol. 292(4):779-85 (1999)) allows the insertion of DNA segments flanked by two incompatible or inverted target sites. This exchange system has been called recombinase mediated cassette exchange (RMCE). In a preferred embodiment a FLP based RMCE system is inserted into the Rosa26 locus. Said recombinase mediated recombination preferably comprises the steps:
In said recombinase mediated recombination method it is preferred that
For further selectable markers it is referred to U.S. Pat. Nos. 5,487,932 and 5,464,763 which are hereby incorporated in their entirety.
The ubiquitous promoter in the vector according to the invention is preferably selected from polymerase I, II and III dependent promoters, preferably is a polymerase II or III dependent promoter including, but not limited to, a CMV promoter, a CAGGS promoter, a snRNA promoter such as U6, a RNAse P RNA promoter such as H1, a tRNA promoter, a 7SL RNA promoter, a 5 S rRNA promoter, etc.
The ubiquitous promoter can be a constitutive promoter, or can be an inducible promoter. Suitable inducible promoters are the above-mentioned polymerase I, II and III dependent promoters containing an operator sequence including, but not limited to, tet, Gal4, lac, etc.
The expression vector of the invention is suitable for the following particularly preferred approaches (for constitutive and inducible expression):
The short hairpin RNA construct or inactive precursor thereof of the expression cassette comprises at least one segment corresponding to a short hairpin RNA (shRNA) or to complementary short interfering RNA (siRNA) strands. In case shRNA segments are utilized within the expression cassette, said cassette preferably comprises at least one shRNA segment having a nucleotide (e.g. DNA) sequence of the structure A-B-C or C-B-A. In case siRNA segments are utilized within the expression cassette, said cassette preferably comprises at least least two DNA segments A and C or C and A, wherein each of said at least two segments is under the control of a separate promoter as defined above (such as the Pol III promoter including inducible U6, H1 or the like). In the above segments
The above shRNA and siRNA segments may further comprise stop and/or polyadenylation sequences.
Suitable shRNA sequences for the knock down of a given target gene are well known in the art (see e.g. the particular shRNA sequences mentioned in Tables 1 and 2 below) or can readily be determined by the skilled artesian.
HOMO SAPIENS
Suitable siRNA sequences for the knockdown of a given target gene are well known in the art (e.g. the particular siRNA sequences mentioned in Lee N. S. et al., J. Nat. Biotechnol. 20(5):500-5 (2002) gcctgtgcctcttcagctacc (SEQ ID NO:215) and gcggagacagcgacgaagagc (SEQ ID NO:216) and in Du, Q. et al., Nucl. Acids Res. 21; (2005) cttattggagagagcacga (SEQ ID NO:217)) or can readily be determined by the skilled artisan.
A preferred embodiment of the method (1) or (2) of the invention concerns the following steps:
The vector according to embodiment (4) of the invention is suitable for stable or transient integration. Said vector is suitable for gene transfer.
The technology of the present application provides for the following advantages:
(i) A stable and body wide inhibition of gene expression by generating transgenic animals (such as mice).
(ii) A reversible inhibition of gene expression using the inducible constructs.
We showed that high efficient (>90%) RMCE at the ubiquitously expressed Rosa26 locus. The following features where combined in the RMCE strategy of the invention:
The methods (1) to (3) may further (besides step (a) and (b) defined above) comprise one or more of the steps (c) isolating the eukaryotic cells, preferably the ES cells having the desired fuctional exchange cassette integrated into the Rosa26 locus; and/or (d) modifying the integrated precursor of the exchange cassette and isolating (ES) cells having the desired modified functional exchange cassette.
The steps (a) and (b) of the methods (1) to (3) are preferably performed in vitro. The step (c) may be performed in vitro and in vivo.
The invention also provides a method for preparing a transgenenic multi-cell organism having a modified Rosa26 locus which comprises utilizing the method as defined in (1) to (3) above. This includes a method for preparing a non-human mammal comprising modifying starting ES cells according to steps (a) to (c). The ES cells may subsequently processed according one or more of the following steps:
(d) the ES cells obtained in steps (b) or (c) are injected into blastocysts; and/or
(e) transgenic non-human animals carrying one or more functional genes of interest at the Rosa26 locus are generated (viz. by well known breeding procedures).
The transgenic multi-cell organisms and non-human mammals obtainable by the method (6) and (7), respectively; preferably have an operatively functional gene expression cassette (as defined above) integrated into its Rosa26 locus. Such transgenic multi-cell organisms and non-human mammals are suitable for gene function studies, drug development, as disease model animals, etc.
The invention is further explained by the following examples and the attached figures, which are, however not to be construed so as to limit the invention.
Cell culture: Culture and targeted mutagenesis of ES cells were carried out as described in Hogan et al., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.), pp. 253-289 with ES cell lines derived from both inbred and F1 embryos (Examples 1 and 2). In Example 3 Art4.12 ES cells (Seibler et al., Nucl. Acid Res., 31(4):e12 (2003) were used.
Mice: All mice were kept in the animal facility at Artemis Pharmaceuticals GmbH in microisolator cages (Tecniplast Sealsave). B6D2F1 Mice for the generation of tetraploid blastocysts were obtained from Janvier. The polbflox/rosa(CreERT2) and ect2flox/rosa(CreERT2) mice were generated by breeding of rosa(CreERT2) ES mice with βT14 (Gu et al., Science, 265, 103-106.), respectively.
Production of ES mice by tetraploid embryo complementation: The production of mice by tetraploid embryo complementation was essentially performed as described (Eggan et al., Proc Natl Acad Sci USA, 98, 6209-6214.).
Ligand administration: 100 mg Tamoxifen-free base (Sigma, T5648) was suspended in 100 μl Ethanol and solved in 1 ml sunflower oil (Sigma). This 10 mg/100 μl tamoxifen solution was sonicated for 1-2 minutes and then stored at −20° C. For p.o. administration the solution was thawed at 55° C. and administrated to 4-8 week old mice by a feeding needle (FST Fine Science Tools GmbH, 18061-20).
Western blot analysis: Western blot analysis was performed using SDS-PAGE (NuPAGE, Invitrogen) and the Breeze Immunodetection System (Invitrogen) according to the manufacturer protocols. Immunodetection was done using sc-543 (HC-20, Santa Cruz Biotechnology, Inc.) against ER, PRB-106C against cre, actin sc-1616 Actin (1-19) against actin and rabbit polyclonal IgG (Santa Cruz Biotechnology, Inc.) antibodies.
X-Gal staining on tissue sections: To detect beta-galactosidase activity, tissues were embedded in Tissue Tec OCT (Sakura Finetek Europe B.V., The Netherlands), frozen on dry ice and cut into microsections. The sections were mounted onto slides and dried for 1-4 hours at room temperature. Sections were fixed for 5 min at room temperature in fixing solution (0.2% glutaraldehyde, 5 mM EGTA, 2 mM MgCl2 in 0.1 M PB ((0.1 M K2HPO4, pH 7.3)) and washed three times for 15 min at room temperature in washing buffer (2 mM MgCl2, 0.02% Nonidet-40 in 0.1 M PB). Subsequently, tissues were stained for beta-galactosidase activity over night at 37° C. using X-Gal solution (0.6 mg/ml X-Gal (predissolved in DMSO), 5 mM potassium hexacyanoferrat III, 5 mM potassium hexacyanoferrat II, in washing buffer). Sections were washed twice for 5 min at room temperature in PBS, counterstained with Nuclear Fast Red Solution for 10 min, rinsed shortly in aqua dest., dehydrated through a graded ethanol series and mounted in Eukitt (Sigma, Germany).
CreER Rosa-targeting vector: A 129 SV/EV-BAC library (Incyte Genomics) was screened with a probe against exon2 of the Rosa26 locus (amplified from mouse genomic DNA using Rscreen1s (GACAGGACAGTGCTTGTTTAAGG) (SEQ ID NO:1) and Rscreen1as (TGACTACACAATATTGCTCGCAC) (SEQ ID NO:2)). Out of the identified BACclone a 11 kb EcoRV subfragment was inserted into the HindIII site of pBS. Two fragments (a 1 kb SacII/XbaI- and a 4 kb XbaI-fragment, SEQ ID Nos:4 and 5, respectively) were used as homology arms and inserted into a vector containing a FRT-flanked neomycin resistance gene (unpublished) to generate the basic Rosa26 targeting vector. The CAGGS-promoter (SEQ ID NO:6, nucleotides 1-1616) or a splice acceptor site (SA) from adenovirus (Friedrich G., Soriano P., Genes Dev., 5:1513-23 (1991)) were inserted between the 5′ arm and the FRT flanked neomycin resistance gene. The CreERT2 and a polyadenylation site (pA; SEQ ID NO:6, nucleotides 3921-4099) were cloned 3′ of the SA or the CAGGS-promoter. The vector is free of a transcriptional stop sequence 5′ to the CAGGS-promoter
A CreERT2 gene (Feil et al., (1997) Biochem Biophys Res Commun., 237, 752-757) under the control of the CAGGS-promoter (Okabe, Fabs Letters 407:313-19 (1997)) was inserted into the rosa26 locus by homologous recombination in ES cells by utilizing the CreER Rosa-targeting vector as described above (
To investigate the pattern and level of CreERT2 expression in rosa(SA-CreERT2) and rosa(CAGGS-CreERT2) mice, we performed Western analysis using antibodies specific for Cre. The 74 kDa band corresponding to the CreERT2 fusion protein was detectable in all organs of rosa(CAGGS-CreERT2) mice, including brain (
FABP-Cre Rosa-targeting vector (SEQ ID NO:8): The splice acceptor site from adenovirus (SEQ ID NO:8, nucleotides 18569-18689) was inserted into the basic Rosa26 targeting vector described in 1. above. Into the SwaI and AscI restriction sites of the resulting plasmid was inserted a 3195 bp Xbablunt/AscI DNA fragment comprising in 5′ to 3′ order the polyadenylation signal from the human growth hormone gene (SEQ ID NO:8, nucleotides 18760-688; Bond et al, Science 289:1942-1946 (2000)), a modified Fabpl promoter (SEQ ID NO:8, nucleotides 702-1481; Fabpl4x at −132; Simon et al., J. Biol. Chem. 272:10652-10663 (1997)), a synthetic intron (SEQ ID NO:8, nucleotides 1521-1758), the Cre coding sequence (SEQ ID NO:8, nucleotides 1778-2830) and a synthetic polyA signal (SEQ ID NO:8, nucleotides 2888-3066).
A Cre gene under the control of the Fabpl4x at −132-promoter (SEQ ID NO:8;
Rosa26 RMCE targeting vector (SEQ ID NO:11): A 129 SV/EV-BAC library (Incyte Genomics) was screened with a probe against exon2 of the Rosa26 locus (SEQ ID NO:3). The exon2 probe was amplified from mouse genomic DNA using primers Rscreen1s (GACAGGACAGTGCTTGTTTAAGG; SEQ ID NO:1) and Rscreen1as (TGACTACACAATATTGCTCGCAC; SEQ ID NO:2). A 11 kb EcoRV fragment isolated from the identified BAC clone a was inserted into the HindIII site of pBS. Two subfragments from the 11 kb EcoRV fragment, the 1 kb SacII/XbaI- (SEQ ID NO:4) and the 4 kb XbaI-fragment (SEQ ID NO:5), were used as homology arms and inserted into a vector containing a FRT-flanked neomycin resistance gene (unpublished) to generate the basic Rosa26 targeting vector (SEQ ID NO:10). A splice acceptor site (SA) from adenovirus (Friedrich G., Soriano P., Genes Dev., 5:1513-23 (1991)) was inserted between the 5′ arm and the FRT flanked neomycin resistance gene. The neomycin was deleted by Flp-mediated deletion in bacteria (Buchholz et al., Nucleic Acids Res. 1996, 24:3118-9). The final Rosa(RMCE) targeting vector (SEQ ID NO:11,
Exchange vector (SEQ ID NO:12): The vector contains the F3 site and the FRT site in the same configuration as in the Rosa26 targeting vector described above. The vector was generated using standard cloning procedures and has the following order in 5′ to 3′ direction: a synthetic polyA signal (SEQ ID NO:12, nucleotides 23-201), a F3-site (SEQ ID NO:12, nucleotides 216-263), a neomycin-resistance gene lacking the start ATG (SEQ ID NO:12, nucleotides 271-1559), a H1-promoter (SEQ ID NO:12, nucleotides 1763-1996), a hairpin sequence (SEQ ID NO:12, nucleotides 1997-2051), and a FRT site (SEQ ID NO: 12, nucleotides 2161-2208).
Cell culture: ES cell culture and homologous recombination were carried out as previously described (Hogan et al., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.), pp. 253-289.)
Transfection of cells with the exchange vector: 1 day before transfection, 2×105 ES cells were plated on a 3 cm dish in 2 ml medium. Before transfection 2 ml fresh medium was given to the cells. 3 μl Fugene6 Reagent (Roche; Cat No. 1 814 443) was mixed with 100 μl serum free medium (OptiMEM 1 with Glutamax-I Invitrogen; Cat. No. Cat. No. 51985-035) and incubated for 5 min. 100 μl of the Fugene/OptiMEM solution was added to 2 μg circular DNA (c=0.33 μg/μl) and incubated for 15 min. This transfection complex was added drop wise to the medium and mixed by a circuiting movement. Fresh medium was added to the transfected cells the following day. From day 2, the medium was changed daily replaced by medium containing 250 μg/ml G418 (Geneticin; Invitrogen; Cat. No. 10131-019). 7 days after transfection, single clones were isolated by standard procedures as described (Hogan et al., (Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y.), pp. 253-289.).
The targeting vector to prepare the Rosa26 locus for RMCE is depicted in
The hybrid ES cell line ART4.12 ([C57BL/6×129S6/SvEvTac] F1) was used for homologous recombination, since these lines are capable to derive completely ES cell derived mice (ES mice) through tetraploid blastocyst complementation with high efficiency (Seibler et al., Nucl. Acid Res., 31(4):e12 (2003). ART4.12 cells where transfected with the rosa26 targeting vector and incubated in cell culture medium containing hygromycin B. Independent recombinant Rosa(RMCE) ES cell clones were obtained at a frequency of 2% as verified by Southern blot analysis (
The exchange vector (
Rosa(RMCE) ES cells where transfected with the exchange vector and selected in medium containing G418. Southern blot analysis of G418 resistant colonies revealed that successful RMCE had occurred in >90% of clones (
ShRNA transgenic ES cells were injected into tetraploid blastocysts and ES cell derived mice were obtained three weeks later at a frequency of 3%. Real time PCR analysis of 15 week old mice indicated a >80% reduction of leptin receptor mRNA in most organs, indicating that the shRNA transgene is ubiquitously expressed (Seibler et al. 2005, Nucl Acids Res 33(7):e67).
lacZ specific shRNA (nucleotide 1998-2055, SEQ ID NO:218) under the control of the human U6 promoter through RMCE was introduced into ART4.12/rosa26(RMCE) ES cells (Seibler et al. 2005, Nucl Acids Res 33(7):e67). Southern blot analysis of G418 resistant clones revealed that successful RMCE had occurred in >90% of clones. Recombinant ES cells were injected into tetraploid blastocysts and ES cell derived mice were derived. A highly expressed β-galactosidase gene was provided through breeding using a mouse strain carrying lacZ (nucleotide 2161-5678, SEQ ID NO:219) under the control of the ubiquitous CAGGS promoter, that had been placed into the Rosa26 promoter. X-Gal staining on tissue sections revealed a strong, uniform expression of lacZ under the control of the CAGGS promoter in every single cell, whereas the presence of the shRNA construct resulted in marked reduction of β-galactosidase activity in the vast majority of cells (Seibler et al. 2005, Nucl Acids Res 33(7):e67). These results indicate that the lacZ specific shRNA is sufficiently expressed to mediate efficient RNAi in all organs.
A CAGGS-Fluc (nucleotide 2100-5983, SEQ ID NO:218) expression cassette was inserted into the ES cell genome using RMCE at the rosa26 locus (Seibler et al. 2005, Nucl Acids Res 33(7):e67). Again, successful RMCE had occurred in >90% of clones as confirmed by Southern blot analysis. Recombinant ES cells were injected into blastocysts and mice were obtained upon transfer of blastocysts into pseudopregnant females. The Fluc-specific shRNA gene under the control of the human U6 promoter and the CAGGS-Fluc transgene were combined through breeding of mice. Measurement of luciferase activity in protein extracts from various organs revealed a strong reduction of luciferase activity in the presence, but not in the absence of the shRNA, indicating that both transgenes are ubiquitously expressed (Seibler et al. 2005, Nucl Acids Res 33(7):e67).
| Number | Date | Country | Kind |
|---|---|---|---|
| 04103229.3 | Jul 2004 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2005/053245 | 7/7/2005 | WO | 00 | 2/20/2007 |
