Patent Application
20180161356
The content of the electronically submitted sequence listing (Name: 3338_019PC07_SL.txt, Size: 377,094 bytes; and Date of Creation: Feb. 4, 2016) submitted in this application is incorporated herein by reference in its entirety.
The present invention relates to oligomeric compounds (oligomers) that target microtubule-associated protein tau (MAPT) transcript in a cell, leading to reduced expression of MAPT mRNA and/or Tau protein. Reduction of MAPT mRNA and/or Tau protein expression is beneficial for a range of medical disorders, such as tauopathies, Down syndrome, depression, seizure disorders, and movement disorders.
Tau protein is a microtubule-associated protein (MAP) that interacts with tubulin to stabilize, and promote assembly into, microtubules. Microtubules are critical structural components of the cellular cytoskeleton and are involved in various cellular processes, including mitosis, cytokinesis, and vesicular transport. Tau protein is present in multiple cell and tissue types, but is particularly abundant in neurons compared to non-neuronal cells.
Due to Tau's role in stabilizing microtubules, alteration of Tau expression levels and/or function can disrupt critical cellular processes, which is thought to contribute to various neurodegenerative disorders such as tauopathies. For example, it has been found that neurofibrillary inclusions in Alzheimer's disease (AD) contain aggregates of hyperphosphorylated Tau protein.
In addition, abnormal Tau expression and/or function has been associated with other diseases of the brain (also included in the family of pathologically and genetically defined tauopathies), including Frontotemporal dementia (FTD), progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), corticobasal ganglionic degeneration, dementia pugilistica, Frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Lytico-Bodig disease, tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, argyrophilic grain disease, corticobasal degeneration or frontotemporal lobar degeneration, and others. Abnormal Tau expression and/or function can also play a role in additional diseases such as Down Syndrome, seizure disorders (e.g., epilepsy), network dysfunction (e.g., depression), and movement disorders (e.g., Parkinson's disease).
Tau-associated disorders such as AD are the most common cause of dementia in the elderly, and robust and effective agents for the treatment of neurodegenerative diseases, including tauopathies, seizure disorders, and movement disorders, are greatly needed.
Antisense molecules that can decrease protein expression have been studied in the development of human therapeutics. Antisense molecules that target pre-mRNA or mRNA can reduce the RNA level thereby reducing the protein level. Antisense molecules can act on a target sequence through various mechanisms of action: degradation of mRNA through RNaseH, steric hindrance of ribosomal subunit binding, altering maturation of mRNA, splicing activation, 5′-cap formation inhibition, arrest of translation and/or double strand RNase activation. In some cases, however, antisense molecules targeting regions nearby polyadenylation sites are known to increase mRNA stability. See Vickers et al., NAR (2001) 29(6) 1293-1299.
The present invention provides an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the nucleic acid sequence corresponds to nucleotides 134,947-138,940 of SEQ ID NO: 1.
The present invention also provides an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the nucleic acid sequence corresponds to nucleotides 135,050-138,940 of SEQ ID NO: 1.
The present invention further provides an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the nucleic acid sequence corresponds to nucleotides 72,802-73,072 of SEQ ID NO: 1.
The present invention also provides an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the oligomer has at least one property selected from: (1) reduces expression of Tau mRNA in a cell, compared to a control cell that has not been exposed to the oligomer; and (2) reduces expression of Tau protein in a cell, compared to a control cell that has not been exposed to the oligomer.
The present invention also provides an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the oligomer has an in vivo tolerability less than or equal to a total score of 4, wherein the total score is the sum of a unit score of five categories, which are 1) hyperactivity; 2) decreased activity and arousal; 3) motor dysfunction and/or ataxia; 4) abnormal posture and breathing; and 5) tremor and/or convulsions, and wherein the unit score for each category is measured on a scale of 0-4.
The present invention also provides a conjugate comprising an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript, wherein the oligomer is covalently attached to at least one non-nucleotide or non-polynucleotide moiety.
The present invention also provides a pharmaceutical composition comprising an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript and a pharmaceutically acceptable carrier.
The present invention also provides a kit comprising an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript and instructions for use.
The present invention further provides a method of inhibiting or reducing Tau protein expression in a cell, the method comprising administering an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript to a cell expressing Tau protein, wherein the Tau protein expression in the cell is inhibited or reduced after the administration.
The present invention further provides a method for treating a seizure disorder in a subject in need thereof, the method comprising administering an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript to a cell expressing Tau protein to the subject.
The present invention further provides a method for treating a seizure disorder in a subject in need thereof, the method comprising administering an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript to a cell expressing Tau protein to the subject.
The present invention further provides the use of an oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAPT) transcript for the manufacture of a medicament for the treatment of a neurological disorder, e.g., a tauopathy, a neurodegenerative disease with tauopathy (a neurodegenerative disease which involves accumulation of tau protein in the brain), an epileptic disorder with tauopathy (an epileptic disorder which involves accumulation of tau protein in the brain), an epileptic disorder without tauopathy (an epileptic disorder which does not involve accumulation of tau protein in the brain), an idiopathic adult epileptic disorder without tauopathy (an idiopathic adult epileptic disorder which does not involve accumulation of tau protein in the brain), a seizure disorder, or any combination thereof.
E1. An oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAP]) transcript, wherein the nucleic acid sequence corresponds to nucleotides 134,947-138,940 of SEQ ID NO: 1.
E2. An oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAP]) transcript, wherein the nucleic acid sequence corresponds to nucleotides 135,050-138,940 of SEQ ID NO: 1.
E3. An oligomer of from 10 to 50 nucleotides in length comprising a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence within a microtubule-associated protein tau (MAP]) transcript, wherein the nucleic acid sequence corresponds to nucleotides 72,802-73,072 of SEQ ID NO: 1.
E4. The oligomer of any one of embodiments 1 or 3, wherein the nucleotide sequence comprises at least one nucleotide analog.
E5. The oligomer of any one of embodiments 1 to 4, which is a gapmer, a blockmer, a mixmer, a headmer, a tailmer, or a totalmer.
E6. The oligomer of any one of embodiments 1 to 5, which is a gapmer.
E7. The oligomer of embodiment 6, which has the formula of 5′-A-B-C-3′ (II), wherein
E8. The oligomer of embodiment 7, wherein A has the fomula of LmDnLoDpLq (III) and C has the fomula of Lm′Dn′Lo′Dp′Lq′ (IV) and wherein
E9. The oligomer of embodiment 7 or 8, wherein the first wing sequence comprises a combination of nucleotide analogs and DNA unit selected from (i) 1-9 nucleotide analogs and 1 DNA unit; (ii) 1-8 nucleotide analogs and 1-2 DNA units; (iii) 1-7 nucleotide analogs and 1-3 DNA units; (iv) 1-6 nucleotide analogs and 1-4 DNA units; (v) 1-5 nucleotide analogs and 1-5 DNA units; (vi) 1-4 nucleotide analogs and 1-6 DNA units; (vii) 1-3 nucleotide analogs and 1-7 DNA units; (viii) 1-2 nucleotide analogs and 1-8 DNA units; and (ix) 1 nucleotide analog and 1-9 DNA units.
E10. The oligomer of any one of embodiments 7 to 9, wherein the second wing sequence comprises a combination of nucleotide analogs and DNA unit selected from (i) 1-9 nucleotide analogs and 1 DNA unit; (ii) 1-8 nucleotide analogs and 1-2 DNA units; (iii) 1-7 nucleotide analogs and 1-3 DNA units; (iv) 1-6 nucleotide analogs and 1-4 DNA units; (v) 1-5 nucleotide analogs and 1-5 DNA units; (vi) 1-4 nucleotide analogs and 1-6 DNA units; (vii) 1-3 nucleotide analogs and 1-7 DNA units; (viii) 1-2 nucleotide analogs and 1-8 DNA units; and (ix) 1 nucleotide analog and 1-9 DNA units.
E11. The oligomer of any one of embodiments 8 to 10, wherein A is selected from L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLLL, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDLDL, LDDDL, LLLLLL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD, and C is selected from L, LL, LDL, LLL, LLLL, LLDL, LDLL, LDDL, LLDD, LLLLL, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDLDL, LDDDL, LLLLLL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD.
E12. The oligomer of any one of embodiments 1 to 11, which comprises at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten nucleotide analogs.
E13. The oligomer of any one of embodiments 1 to 12, wherein the nucleotide analog or analogs are selected from Locked Nucleic Acid (LNA); 2′-O-alkyl-RNA; 2′-amino-DNA; 2′-fluoro-DNA; arabino nucleic acid (ANA); 2′-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2′-O-methyl nucleic acid (2′-OMe), 2′-O-methoxyethyl nucleic acid (2′-MOE), and any combination thereof.
E14. The oligomer of any one of embodiments 1 to 13, wherein the nucleotide analog or analogs comprise a bicyclic sugar.
E15. The oligomer of embodiment 14, wherein the bicyclic sugar comprises cEt, 2′,4′-constrained 2′-O-methoxyethyl (cMOE), LNA, α-LNA, β-LNA, 2′-O,4′-C-ethylene-bridged nucleic acids (ENA), amino-LNA, oxy-LNA, or thio-LNA.
E16. The oligomer of any one of embodiments 1 to 15, wherein the nucleotide analog or analogs comprise an LNA.
E17. The oligomer of embodiment 16, which comprises three to five LNAs on the 5′ portion of the oligomer and three to five LNAs on the 3′ portion of the oligomer.
E18, The oligomer of any one of embodiments 1 and 4-17, wherein the nucleic acid sequence corresponds to nucleotides 134,947-138,924 of SEQ ID NO: 1.
E19. The oligomer of any one of embodiments 1 to 18, wherein the MAPT transcript comprises SEQ ID NO: 1.
E20. The oligomer of embodiment 19, wherein the nucleotide sequence hybridizes to a nucleic acid sequence within nucleotides 135,700-138,940; 136,000-138,940; 136,620-138,940; 136,860-138,940; 137,060-138,940; 137,300-138,940; 137,830-138,940; 138,030-138,940; 138,350-138,940; 134,821-135,020; 135,700-135,820; 136,000-136,110; 136,620-136,760; 136,860-136,960; 137,060-137,110; 137,300-137,400; 137,830-137,900; 138,030-138,140; 138,350-138,450; or 138,860-138,940 of SEQ ID NO: 1.
E21. The oligomer of embodiment 19, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of a nucleic acid sequence selected from nucleotides 134,947-138,940 of SEQ ID NO: 1.
E22. The oligomer of embodiment 21, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 135,700-138,940; 136,000-138,940; 136,620-138,940; 136,860-138,940; 137,060-138,940; 137,300-138,940; 137,830-138,940; 138,030-138,940; 138,350-138,940; 134,821-135,020; 135,700-135,820; 136,000-136,110; 136,620-136,760; 136,860-136,960; 137,060-137,110; 137,300-137,400; 137,830-137,900; 138,030-138,140; 138,350-138,450; or 138,860-138,940 of SEQ ID NO: 1.
E23. The oligomer of any one of embodiments 3 to 17, wherein the nucleic acid sequence corresponds to nucleotides 72,802-73,072; 72,812-73,062; 72,822-73,052; 72,832-73,042; 72,842-73,032; 72,852-73,022; 72,862-73,012; 72,872-73,002; 72,882-72,992; 72,892-72,982; or 72,902-72,972 of SEQ ID NO: 1.
E24. The oligomer of embodiment 22, wherein the nucleotide sequence hybridizes to a nucleic acid sequence within nucleotides 72,802-73,072; 72,812-73,062; 72,822-73,052; 72,832-73,042; 72,842-73,032; 72,852-73,022; 72,862-73,012; 72,872-73,002; 72,882-72,992; 72,892-72,982; or 72,902-72,972 of SEQ ID NO: 1.
E25. The oligomer of embodiment 23, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; or 72,902-72,972 of SEQ ID NO: 1.
E26. The oligomer of embodiment 24, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; or 72,902-72,972 of SEQ ID NO: 1.
E27. The oligomer of embodiment 24, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,947-72,960; 72,946-72,961; 72,907-72,922; 72,948-72,963; 72,950-72,963; 72,945-72,960; 72,950-72,965; 72,944-72,959; 72,947-72,962; 72,952-72,965; 72,946-72,959; 72,949-72,964; 72,951-72,964; 72,933-72,948; 72,934-72,949; 72,935-72,950; 72,932-72,951; 72,933-72,952; 72,934-72,953; 72,945-72,964; 72,944-72,963; 72,948-72,967; 72,946-72,965; 72,935-72,951; 72,936-72,953; 72,933-72,934; 72,933-72,954; 72,933-72,950; 72,935-72,954; 72,934-72,951; 72,934-72,950; 72,933-72,949; or 72,935-72,952 of SEQ ID NO: 1.
E28. The oligomer of any one of embodiments 1 to 27, wherein the nucleotide sequence comprises no mismatches or no more than one or two mismatches with the region.
E29. The oligomer of any one of embodiments 1, 2, 4-22, and 28, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 136,000-136,110 or 138,860-138,940 of SEQ ID NO: 1.
E30. The oligomer of embodiment 29, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 136,053-136,068 or 138,884-138,908 of SEQ ID NO: 1.
E31. The oligomer of any one of embodiments 1, 2, 4-22, and 28, wherein the nucleotide sequence comprises a nucleotide sequence at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from: SEQ ID NO: 4 to SEQ ID NO: 803.
E32. The oligomer of any one of embodiments 1, 2, 4-22, and 28, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from the sequences in
E33. The oligomer of any one of embodiments 1 to 17, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from: ctttatttccaaattcactt (SEQ ID NO: 676); actttatttccaaattcact (SEQ ID NO: 715); tttatttccaaattcacttt (SEQ ID NO: 644); ttatttccaaattcactttt (SEQ ID NO: 799); atttccaaattcacttttac (SEQ ID NO: 466); atttccaaattcactttta (SEQ ID NO: 559); actttatttccaaattcactt (SEQ ID NO: 680); or atttccaaattcactt (SEQ ID NO: 686).
E34. The oligomer of embodiment 32, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from: tatttccaaattcactttta (SEQ ID NO: 526); aataactttatttcca (SEQ ID NO: 773); agtaataactttatt (SEQ ID NO: 782); tttccaaattcactt (SEQ ID NO: 684); agagtaataactttat (SEQ ID NO: 784); agtaataactttattt (SEQ ID NO: 780); agagtaataacttta (SEQ ID NO: 786); ttaatcagagtaataa (SEQ ID NO: 795); tttaatcagagtaat (SEQ ID NO: 798); aatcagagtaataac (SEQ ID NO: 794); tttaatcagagtaata (SEQ ID NO: 797); taatcagagtaataa (SEQ ID NO: 796); ctttatttccaaattcact (SEQ ID NO: 713); and ctttatttccaaattcac (SEQ ID NO: 739).
E35. The oligomer of embodiment 32, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from: atttccaaattcacttttac (SEQ ID NOs: 466 to 490, 513 to 525, 910 to 918, 928, 929, or 932 to 935); tatttccaaattcactttta (SEQ ID NOs: 526 to 550, or 573 to 585); ttatttccaaattcactttt (SEQ ID NOs: 586-606, 629 to 642,799 to 801); tttatttccaaattcacttt (SEQ ID NOs: 644 to 647, 657 to 658, 919 to 921, or 930); ctttatttccaaattcactt (SEQ ID NOs: , 676 to 679, 681 to 683, 685, or 687 to 697); actttatttccaaattcactt (SEQ ID NO: 680); tttccaaattcactt (SEQ ID NO: 684); atttccaaattcactt (SEQ ID NOs: 686, 705, 712, 936, or 937, 922, 924, or 931); actttatttccaaattcact (SEQ ID NOs: 715 to 717); ctttatttccaaattcact (SEQ ID NOs: 713, 714 or 718 to 731,); ctttatttccaaattcac (SEQ ID NOs: 739 to 748); aataactttatttcca (SEQ ID NO: 773 or 774); agtaataactttattt (SEQ ID NO: 780); agtaataactttatt (SEQ ID NO: 782); agagtaataactttat (SEQ ID NO: 784); agagtaataacttta (SEQ ID NO: 786); aatcagagtaataac (SEQ ID NO: 794); ttaatcagagtaataa (SEQ ID NO: 795);taatcagagtaataa (SEQ ID NO: 796); tttaatcagagtaata (SEQ ID NO: 797); and tttaatcagagtaat (SEQ ID NO: 798)
E36. The oligomer of any one of embodiments 3 to 17, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from the sequences in
E37. The oligomer of any one of embodiments 3 to 17, wherein the nucleotide sequence has at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a nucleic acid sequence selected from: SEQ ID NO: 804 to SEQ ID NO: 892.
E38. The oligomer of any one of embodiments 1 to 37, which is single-stranded.
E39 . The oligomer of any one of embodiments 1 to 38, which has at least one property selected from: (1) reduces expression of Tau mRNA in a cell, compared to a control cell that has not been exposed to the oligomer; and (2) reduces expression of Tau protein in a cell, compared to a control cell that has not been exposed to the oligomer.
E40. The oligomer of any one of embodiments 1 to 39, wherein the oligomer has an in vivo tolerability less than or equal to a total score of 4, wherein the total score is the sum of a unit score of five categories, which are 1) hyperactivity; 2) decreased activity and arousal; 3) motor dysfunction and/or ataxia; 4) abnormal posture and breathing; and 5) tremor and/or convulsions, and wherein the unit score for each category is measured on a scale of 0-4.
E41. The oligomer of embodiment 40, wherein the in vivo tolerability is less than or equal to the total score of 3, the total score of 2, the total score of 1, or the total score of 0.
E42. The oligomer of any one of embodiments 1 to 41, wherein calcium oscillations of neuronal cells which are in contact with the oligomer are greater than or equal to 95%, greater than or equal to 90%, greater than or equal to 85%, greater than or equal to 80%, greater than or equal to 75%, or greater than or equal to 70% of oscillations in neuronal cells that are not in contact with the oligomer.
E43. The oligomer of any one of embodiments 1 to 42, which reduces expression of Tau mRNA in a cell by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to a cell not exposed to the oligomer.
E44. The oligomer of any one of embodiments 1 to 43, which reduces expression of Tau protein in a cell by at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% compared to a cell not exposed to the oligomer.
E45. The oligomer of any one embodiments 1 to 44, which comprises the nucleotides A, T, C, and G and at least one analog of the nucleotides A, T, C, and G, and has a sequence score greater than or equal to 0.2, wherein the sequence score is calculated by formula I:
E46. The oligomer of any one of embodiments 1 to 45, which has from 10 to 24 nucleotides in length or from 14 to 21 nucleotides in length.
E47. The oligomer of any one of embodiments 1 to 46, which has 14, 15, 16, 17, 20, or 21 nucleotides in length.
E48. The oligomer of embodiment 1, 2, 4-22, and 28, which comprises, consists essentially of, or consists of a nucleotide sequence selected from
E49. The oligomer of embodiment 48, which comprises, consists essentially of, or consists of: ATTtCcaaattcacTtTtAC (SEQ ID NO: 487); CTTTAtttccaaattCACTT (SEQ ID NO: 677); ACTTTatttccaaattCACT (SEQ ID NO: 715); TTTATttccaaattcACTTT (SEQ ID NO: 644); TTtATttccaaattcACtTT (SEQ ID NO: 645); TTaTTtccaaattcaCTtTT (SEQ ID NO: 593); ATTTccaaattcactTTTAC (SEQ ID NO: 474); ACTTTatttccaaattCACTT (SEQ ID NO: 680); ATTtccaaattcaCTT (SEQ ID NO: 686); TATTTccaaattcactTTTA (SEQ ID NO: 532); AATaactttatttCCA (SEQ ID NO: 773); AGTaataactttATT (SEQ ID NO: 782); TTTccaaattcaCTT (SEQ ID NO: 684); AGAgtaataacttTAT (SEQ ID NO: 784); AGTaataactttaTTT(SEQ ID NO: 780); AGAgtaataactTTA (SEQ ID NO: 786); TTAatcagagtaaTAA (SEQ ID NO: 795); TTTaatcagagtAAT (SEQ ID NO: 798); AATcagagtaatAAC (SEQ ID NO: 794); TTTaatcagagtaATA (SEQ ID NO: 797); TAAtcagagtaaTAA (SEQ ID NO: 796); CTTtatttccaaatTCACT (SEQ ID NO: 720); ATtTCcaaattcactTTtAC (SEQ ID NO: 472); AtTTCcaaattcactTTtAC (SEQ ID NO: 473); ATTtCcaaattcacTtTtAC (SEQ ID NO: 487); or CTTtatttccaaatTcAC (SEQ ID NO: 745), wherein the upper case letter is LNA and the lower case letter is DNA.
E50. The oligomer of embodiment 48, which comprises, consists essentially of, or consists of: ATtTCcaaattcactTTtAC (SEQ ID NO: 472); AtTTCcaaattcactTTtAC (SEQ ID NO: 473); ATTTccaaattcactTTTAC (SEQ ID NO: 474); ATTTCcaaattcacttTTAC (SEQ ID NO: 482); ATTtCcaaattcacTtTtAC (SEQ ID NO: 487); ATtTCcaaattcactTTtAC (SEQ ID NO: 524), AtTTCcaaattcactTTtAC (SEQ ID NO: 493), TATTTccaaattcactTTTA (SEQ ID NO: 532); TTaTTtccaaattcaCTtTT (SEQ ID NO: 593); TTTATttccaaattcACTTT (SEQ ID NO: 644); TTtATttccaaattcACtTT (SEQ ID NO: 645); TTTATttccaaattcaCTTT (SEQ ID NO: 646), TTTAtttccaaattcACTTT (SEQ ID NO: 647); CTTTAtttccaaattCACTT (SEQ ID NO: 677); CTTTAtttccaaattcACTT (SEQ ID NO: 679); ACTTTatttccaaattCACTT (SEQ ID NO: 680); CTTTatttccaaattCACTT (SEQ ID NO: 681); CTtTAtttccaaattCAcTT (SEQ ID NO: 683); TTTccaaattcaCTT (SEQ ID NO: 684); CtTTAtttccaaattCAcTT (SEQ ID NO: 685); ATTtccaaattcaCTT (SEQ ID NO: 686); CTTtatttccaaatTcACT (SEQ ID NO: 714); ACTTTatttccaaattCACT (SEQ ID NO: 715); ACTTtatttccaaatTCACT (SEQ ID NO: 716); CTTtatttccaaatTCACT (SEQ ID NO: 720); CTTtatttccaaatTCAC (SEQ ID NO: 740); CTTtatttccaaatTcAC (SEQ ID NO: 745); AATaactttatttCCA (SEQ ID NO: 773); AGTaataactttaTTT(SEQ ID NO: 780); AGTaataactttATT (SEQ ID NO: 782); AGAgtaataacttTAT (SEQ ID NO: 784); AGAgtaataactTTA (SEQ ID NO: 786); AATcagagtaatAAC (SEQ ID NO: 794); TTAatcagagtaaTAA (SEQ ID NO: 795); TAAtcagagtaaTAA (SEQ ID NO: 796); TTTaatcagagtaATA (SEQ ID NO: 797); or TTTaatcagagtAAT (SEQ ID NO: 798), wherein the upper case letter is LNA and the lower case letter is DNA.
E51. The oligomer of embodiment 48, which comprises, consists essentially of, or consists of CTTTAtttccaaattcACTT (SEQ ID NO: 679, ASO-001928), ATTTCcaaattcacttTTAC (SEQ ID NO: 482, ASO-001962); CTTTatttccaaattCACTT (SEQ ID NO: 681, ASO-001921), TTtATttccaaattcACtTT (SEQ ID NO: 645, ASO-001967); TTTAtttccaaattcACTTT (SEQ ID NO: 647, ASO-001948), TTaTTtccaaattcaCTtTT (SEQ ID NO: 593, ASO-001941), ACTTtatttccaaatTCACT (SEQ ID NO: 716, ASO-001956), CTtTAtttccaaattCAcTT (SEQ ID NO: 683, ASO-001942), TTTATttccaaattcaCTTT (SEQ ID NO: 646, ASO-001955), ACTTTatttccaaattCACTT (SEQ ID NO: 680, ASO-001968); CtTTAtttccaaattCAcTT (SEQ ID NO: 685, ASO -001935), AtTTCcaaattcactTTtAC (SEQ ID NO: 473, ASO-001933), TTtATttccaaattcACtTT (SEQ ID NO: 645, ASO-001967), ATtTCcaaattcactTTtAC (SEQ ID NO: 492), ATTtCcaaattcacTtTtAC (SEQ ID NO: 487, ASO-002038), or AtTTCcaaattcactTTtAC (SEQ ID NO: 493), wherein the upper case letter is LNA and the lower case letter is DNA.
E52. The oligomer of embodiment 50, which comprises, consists essentially of, or consists of ATtTCcaaattcactTTtAC (SEQ ID NO: 472, ASO-001940); AtTTCcaaattcactTTtAC (SEQ ID NO: 473, ASO-001933), ATTTccaaattcactTTTAC (SEQ ID NO: 474; ASO-001919);ATTTCcaaattcacttTTAC (SEQ ID NO: 482, ASO-001962); ATTtCcaaattcacTtTtAC (SEQ ID NO: 487, ASO-002038), ATtTCcaaattcactTTtAC (SEQ ID NO: 524, ASO-002263), AtTTCcaaattcactTTtAC (SEQ ID NO: 493, ASO-002439), TATTTccaaattcactTTTA (SEQ ID NO: 532, ASO-001954); TTaTTtccaaattcaCTtTT (SEQ ID NO: 593, ASO-001941), TTTATttccaaattcACTTT (SEQ ID NO: 644, ASO-000756); TTtATttccaaattcACtTT (SEQ ID NO: 645, ASO-001967); TTTATttccaaattcaCTTT (SEQ ID NO: 646, ASO-001955), TTTAtttccaaattcACTTT (SEQ ID NO: 647, ASO-001948), CTTTAtttccaaattCACTT (SEQ ID NO: 677, ASO-000757); CTTTAtttccaaattcACTT (SEQ ID NO: 679, ASO-001928), ACTTTatttccaaattCACTT (SEQ ID NO: 680, ASO-001968); CTTTatttccaaattCACTT (SEQ ID NO: 681, ASO-001921), CTtTAtttccaaattCAcTT (SEQ ID NO: 683, ASO-001942), TTTccaaattcaCTT (SEQ ID NO: 684, ASO-000128); CtTTAtttccaaattCAcTT (SEQ ID NO: 685, ASO -001935), ATTtccaaattcaCTT (SEQ ID NO: 686, ASO-000013); CTTtatttccaaatTcACT (SEQ ID NO: 714, ASO-002012); ACTTTatttccaaattCACT (SEQ ID NO: 715, ASO-001962); ACTTtatttccaaatTCACT (SEQ ID NO: 716, ASO-001956), CTTtatttccaaatTCACT (SEQ ID NO: 720, ASO-001995); CTTtatttccaaatTCAC (SEQ ID NO: 740, ASO-002007); CTTtatttccaaatTcAC (SEQ ID NO: 745, ASO-001997); AATaactttatttCCA (SEQ ID NO: 773, ASO-000118); AGTaataactttaTTT(SEQ ID NO: 780, ASO-000170); AGTaataactttATT (SEQ ID NO: 782, ASO-000125); AGAgtaataacttTAT (SEQ ID NO: 784, ASO-000134); AGAgtaataactTTA (SEQ ID NO: 786, ASO-000178); AATcagagtaatAAC (SEQ ID NO: 794, ASO-000307); TTAatcagagtaaTAA (SEQ ID NO: 795, ASO-000204); TAAtcagagtaaTAA (SEQ ID NO: 796, ASO-000330); TTTaatcagagtaATA (SEQ ID NO: 797, ASO-000326); and TTTaatcagagtAAT (SEQ ID NO: 798, ASO-000249).
E53. The oligomer of embodiment 1 to 48, which comprises, consists essentially of, or consists of a nucleotide sequence selected from
E54. The oligomer of embodiment 53, which comprises, consists essentially of, or consists of a nucleotide sequence selected from
E55. The oligomer of any one of embodiments 1 to 54, which comprises an internucleoside linkage selected from: a phosphodiester linkage, a phosphotriester linkage, a methylphosphonate linkage, a phosphoramidate linkage, a phosphorothioate linkage, and combinations thereof.
E56. The oligomer of any one of embodiments 1 to 55, wherein the oligomer comprises a nucleotide analog.
E57. The oligomer of embodiment 56, wherein the nucleotide analog comprises 5′methyl cytosine.
E58. A conjugate comprising the oligomer of any one of embodiments 1 to 57, wherein the oligomer is covalently attached to at least one non-nucleotide or non-polynucleotide moiety.
E59. The conjugate of embodiment 58, wherein the non-nucleotide or non-polynucleotide moiety comprises a protein, a fatty acid chain, a sugar residue, a glycoprotein, a polymer, or any combinations thereof.
E60. A pharmaceutical composition comprising the oligomer of any one embodiments 1 to 57 or the conjugate of embodiment 58 or 59 and a pharmaceutically acceptable carrier.
E61 The composition of embodiment 60, which further comprises a therapeutic agent.
E62. The composition of embodiment 61, wherein the therapeutic agent is a Tau antagonist.
E63. The composition of embodiment 62, wherein the Tau antagonist is an anti-Tau antibody or fragment thereof.
E64. A kit comprising the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63 and instructions for use.
E65. A diagnostic kit comprising the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63 and instructions for use.
E66. A method of inhibiting or reducing Tau protein expression in a cell, the method comprising administering the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63 to the cell expressing Tau protein, wherein the Tau protein expression in the cell is inhibited or reduced after the administration.
E67. The method of embodiment 66 wherein the oligomer inhibits or reduces expression of Tau mRNA in the cell after the administration.
E68. The method of embodiment 66 or 67, wherein the expression of Tau mRNA is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% after the administration compared to a cell not exposed to the oligomer.
E69. The method of any one of embodiments 66 to 68, wherein the oligomer reduces expression of Tau protein in the cell after the administration by at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to a cell not exposed to the oligomer.
E70. The method of any one of embodiments 66 to 69, wherein the cell is a neuron.
E71. A method for treating a tauopathy in a subject in need thereof, comprising administering an effective amount of the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63 to the subject.
E72. The method of embodiment 71, wherein the tauopathy is a disease selected from Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica (chronic traumatic encephalopathy), frontal temporal dementia, parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), Tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, corticobasal degeneration, lipofuscinosis, frontotemporal dementia, supranuclear palsy, frontotemporal lobar degeneration, and any combination thereof.
E73. The method of embodiment 71, wherein the tauopathy is progressive supranuclear palsy.
E74. The method of embodiment 71, wherein the tauopathy is Alzheimer's disease.
E75. The method of embodiment 71, wherein the tauopathy is frontal temporal dementia.
E76. A method of regulating neuronal hyperexcitability in a subject in need thereof comprising administering an effective amount of the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63 to the subject.
E77. A method for treating a seizure disorder in a subject in need thereof, comprising administering an effective amount of the oligomer of any one embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 61 to the subject.
E78. The method of embodiment 77, wherein the seizure disorder is a disease selected from epilepsy, juvenile myoclonic epilepsy, reflex epilepsy, benign familial infantile epilepsy (BFIE), infantile convulsions, infantile spasms, choreoathetosis (ICCA) syndrome, injury-associated seizures, brain injury, brain strokes, meningitis, and febrile seizures.
E79. A method for treating or preventing a neurological disorder comprising administering an effective amount of the oligomer of any one of embodiments 1 to 57, the conjugate of embodiment 58 or 59, or the composition of any one of embodiments 60 to 63.
E80. The method of embodiment 79, wherein the neurological disorder is selected from progressive supranuclear palsy, frontotemporal dementia-tau (FTD-tau), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), corticobasal degeneration (CBD), traumatic brain injury, chronic traumatic encephalopathy, HIV associated neurocognitive disorders, Argyrophilic grain disease, Down syndrome-Alzheimer's disease, Amnestic mild cognitive impairment-Alzheimer's disease, Parkinson's disease dementia, Hallervorden-Spatz disease (Pantothenate kinase-associated neurodegeneration), Niemann Pick disease type C, Myotonic dystrophy, Amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, Hemimegalencephaly, Tuberous sclerosis complex, Focal cortical dysplasia type 2b, or Ganglion cell tumors. In certain embodiments, the disease or condition is an epileptic disorder without tauopathy, e.g., Dravet Syndrome (severe myoclonic epilepsy of infancy), Temporal lobe epilepsy, Ohtahara syndrome (early infantile epileptic encephalopathy with suppression bursts), Lafora body disease, Generalized epilepsy with febrile seizures, Infantile spasms (West syndrome), Lennox Gastaut syndrome, Angelman Syndrome, Rett Syndrome, Landau Kleffner syndrome, focal seizures, simple focal seizures (no loss of consciousness), focal dyscognitive seizures (impairment of consciousness), focal seizure evolving to generalized tonic-clonic (GTC) convulsions, generalized seizures (convulsive or non-convulsive with bilateral discharges involving subcortical structures), absence seizures, myoclonic seizures, clonic seizures, tonic seizures, tonic-clonic seizures, atonic seizures, an autistic disorder, an autism spectrum disorder (e.g., as defined in the Diagnostic and Statistical Manual of Mental Disorders V (DSM-V)), an Asperger's disorder, a pervasive developmental disorder, and any combination thereof.
E81. The method of any one of embodiments 71 to 80, wherein the subject is a human.
E82. Use of the oligomer according to any one of the embodiments 1 to 57 for the manufacture of a medicament for the treatment of a neurological disorder.
E83. The oligomer of any one of embodiments 1 to 57 for use in therapy of a disease or condition.
E84. The oligomer for use of embodiment 83, wherein the disease or condition is a neurological disorder.
E85. The oligomer of embodiment 50, wherein the oligomer is ATtTCcaaattcactTTtAC (SEQ ID NO: 472) with the chemical structure of OxyAs OxyTs DNAts OxyTs OxyMCs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs DNAts OxyAs OxyMC (ASO-001940); AtTTCcaaattcactTTtAC (SEQ ID NO: 473) with the chemical structure of OxyAs DNAts OxyTs OxyTs OxyMCs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs DNAts OxyAs OxyMC (ASO-001933); ATTTccaaattcactTTTAC (SEQ ID NO: 474) with the chemical structure of OxyAs OxyTs OxyTs OxyTs DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs OxyTs OxyAs OxyMC (ASO-001919); ATTTCcaaattcacttTTAC (SEQ ID NO: 482) with the chemical structure of OxyAs OxyTs DNAts OxyTs DNAcs OxyMCs DNAas OxyAs DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs DNAts OxyTs OxyAs OxyMC (ASO-001962); ATTtCcaaattcacTtTtAC (SEQ ID NO: 487) with the chemical structure of OxyAs OxyTs OxyTs DNAts OxyMCs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs OxyTs DNAts OxyTs DNAts OxyAs OxyMC (ASO-002038); AtTTCcaaattcactTTtAC (SEQ ID NO: 493) with the chemical structure of OxyTs OxyMCs OxyMCs OxyAs OxyAs DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts DNAts DNAts OxyTs OxyAs OxyMCs (ASO-002439); ATtTCcaaattcactTTtAC (SEQ ID NO: 524) with the chemical structure of OxyAs OxyTs DNAts OxyTs DNAcs OxyMCs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs DNAts OxyAs OxyMCs (ASO-002263); TATTTccaaattcactTTTA (SEQ ID NO: 532) with the chemical structure of OxyTs OxyAs OxyTs OxyTs OxyTs DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs OxyTs OxyA (ASO-001954); TTaTTtccaaattcaCTtTT (SEQ ID NO: 593) with the chemical structure of OxyTs OxyTs DNAas OxyTs OxyTs DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas OxyMCs OxyTs DNAts OxyTs OxyT (ASO-001941); TTTATttccaaattcACTTT (SEQ ID NO: 644) with the chemical structure of OxyTs OxyTs OxyTs OxyAs OxyTs DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs OxyAs OxyMCs OxyTs OxyTs OxyT (ASO-000756); TTtATttccaaattcACtTT (SEQ ID NO: 645) with the chemical structure of OxyTs OxyTs DNAts OxyAs OxyTs DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs OxyAs OxyMCs DNAts OxyTs OxyT (ASO-001967); TTTATttccaaattcaCTTT (SEQ ID NO: 646) with the chemical structure of OxyTs OxyTs OxyTs OxyAs OxyTs DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas OxyMCs OxyTs OxyTs OxyT (ASO-001955); TTTAtttccaaattcACTTT (SEQ ID NO: 647) with the chemical structure of OxyTs OxyTs OxyTs OxyAs DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs OxyAs OxyMCs OxyTs OxyTs OxyT (ASO-001948); CTTTAtttccaaattCACTT (SEQ ID NO: 677) with the chemical structure of OxyMCs OxyTs OxyTs OxyTs OxyAs DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs OxyMCs OxyTs OxyT (ASO-000757); CTTTAtttccaaattcACTT (SEQ ID NO: 679) with the chemical structure of OxyMCs OxyTs OxyTs OxyTs OxyAs DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs OxyAs OxyMCs OxyTs OxyT (ASO-001928); ACTTTatttccaaattCACTT (SEQ ID NO: 680) with the chemical structure of OxyAs OxyMCs OxyTs OxyTs OxyTs DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs OxyMCs OxyTs OxyT (ASO-001968); CTTTatttccaaattCACTT (SEQ ID NO: 681) with the chemical structure of OxyMCs OxyTs OxyTs OxyTs DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs OxyMCs OxyTs OxyT (ASO-001921); CTtTAtttccaaattCAcTT (SEQ ID NO: 683) with the chemical structure of OxyMCs OxyTs DNAts OxyTs OxyAs DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs DNAcs OxyTs OxyT (ASO-001942); TTTccaaattcaCTT (SEQ ID NO: 684) with the chemical structure of OxyTs OxyTs OxyTs DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas OxyMCs OxyTs OxyT (ASO-000128); CtTTAtttccaaattCAcTT (SEQ ID NO: 685) with the chemical structure of OxyMCs DNAts OxyTs OxyTs OxyAs DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs DNAcs OxyTs OxyT (ASO -001935);ATTtccaaattcaCTT (SEQ ID NO: 686) with the chemical structure of OxyAs OxyTs OxyTs DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas OxyMCs OxyTs OxyT (ASO-000013); CTTtatttccaaatTcACT (SEQ ID NO: 714) with the chemical structure of OxyMCs OxyTs OxyTs DNAts DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts OxyTs DNAcs OxyAs OxyMCs OxyT (ASO-002012); ACTTTatttccaaattCACT (SEQ ID NO: 715) with the chemical structure of OxyAs OxyMCs OxyTs OxyTs OxyTs DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts OxyMCs OxyAs OxyMCs OxyT (ASO-001962); ACTTtatttccaaatTCACT (SEQ ID NO: 716) with the chemical structure of OxyAs OxyMCs OxyTs OxyTs DNAts DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts OxyTs OxyMCs OxyAs OxyMCs OxyT (ASO-001956), CTTtatttccaaatTCACT (SEQ ID NO: 720) with the chemical structure of OxyMCs OxyTs OxyTs DNAts DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts OxyTs OxyMCs OxyAs OxyMCs OxyT (ASO-1995); CTTtatttccaaatTCAC (SEQ ID NO: 740) with the chemical structure of OxyMCs OxyTs OxyTs DNAts DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts OxyTs OxyMCs OxyAs OxyMC (ASO-002007); CTTtatttccaaatTcAC (SEQ ID NO: 745) with the chemical structure of OxyMCs OxyTs OxyTs DNAts DNAas DNAts DNAts DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts OxyTs DNAcs OxyAs OxyMC (ASO-001997); AATaactttatttCCA (SEQ ID NO: 773) with the chemical structure of OxyAs OxyAs OxyTs DNAas DNAas DNAcs DNAts DNAts DNAts DNAas DNAts DNAts DNAts OxyMCs OxyMCs OxyA (ASO-000118); AGTaataactttaTTT(SEQ ID NO: 780) with the chemical structure of OxyAs OxyGs OxyTs DNAas DNAas DNAts DNAas DNAas DNAcs DNAts DNAts DNAts DNAas OxyTs OxyTs OxyT (ASO-000170); AGTaataactttATT (SEQ ID NO: 782) with the chemical structure of OxyAs OxyGs OxyTs DNAas DNAas DNAts DNAas DNAas DNAcs DNAts DNAts DNAts OxyAs OxyTs OxyT (ASO-000125); AGAgtaataacttTAT (SEQ ID NO: 784) with the chemical structure of OxyAs OxyGs OxyAs DNAgs DNAts DNAas DNAas DNAts DNAas DNAas DNAcs DNAts DNAts OxyTs OxyAs OxyT (ASO-000134); AGAgtaataactTTA (SEQ ID NO: 786) with the chemical structure of OxyAs OxyGs OxyAs DNAgs DNAts DNAas DNAas DNAts DNAas DNAas DNAcs DNAts OxyTs OxyTs OxyA (ASO-000178); AATcagagtaatAAC (SEQ ID NO: 794) with the chemical structure of OxyAs OxyAs OxyTs DNAcs DNAas DNAgs DNAas DNAgs DNAts DNAas DNAas DNAts OxyAs OxyAs OxyMC (ASO-000307); TTAatcagagtaaTAA (SEQ ID NO: 795) with the chemical structure of OxyTs OxyTs OxyAs DNAas DNAts DNAcs DNAas DNAgs DNAas DNAgs DNAts DNAas DNAas OxyTs OxyAs OxyA (ASO-000204); TAAtcagagtaaTAA (SEQ ID NO: 796) with the chemical structure of OxyTs OxyAs OxyAs DNAts DNAcs DNAas DNAgs DNAas DNAgs DNAts DNAas DNAas OxyTs OxyAs OxyA (ASO-000330); TTTaatcagagtaATA (SEQ ID NO: 797) with the chemical structure of OxyTs OxyTs OxyTs DNAas DNAas DNAts DNAcs DNAas DNAgs DNAas DNAgs DNAts DNAas OxyAs OxyTs OxyA (ASO-000326); or TTTaatcagagtAAT (SEQ ID NO: 798) with the chemical structure of OxyTs OxyTs OxyTs DNAas DNAas DNAts DNAcs DNAas DNAgs DNAas DNAgs DNAts OxyAs OxyAs OxyT (ASO-000249).
The sequence of ASO-000757 has one mismatch compared to the corresponding RhoA sequence; the sequences of ASO-0001967, ASO-000755, and ASO-001941 have two mismatches compared to the corresponding RhoA sequence; and the sequences of ASO-000753, ASO-002038, ASO-001933, and ASO-001940 have four mismatches compared to the corresponding RhoA sequence.
It is to be noted that the term “a” or “an” entity refers to one or more of that entity;
for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences. As such, the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
Furthermore, “and/or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and/or” as used in a phrase such as “A and/or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of” and/or “consisting essentially of” are also provided.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5′ to 3′ orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.
The term “about” is used herein to mean approximately, roughly, around, or in the regions of When the term “about” is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term “about” can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower). For example, if it is stated that “the oligomer reduces expression of Tau protein in a cell following administration of the oligomer by at least about 60%,” it is implied that the Tau levels are reduced by a range of 50% to 70%.
The term “nucleic acids” or “nucleotides” is intended to encompass plural nucleic acids. In some embodiments, the term “nucleic acids” or “nucleotides” refers to a target sequence, e.g., pre-mRNAs, mRNAs, or DNAs in vivo or in vitro. When the term refers to the nucleic acids or nucleotides in a target sequence, the nucleic acids or nucleotides can be naturally occurring sequences within a cell. In other embodiments, “nucleic acids” or “nucleotides” refers to a sequence in the oligomers of the invention. When the term refers to a sequence in the oligomers, the nucleic acids or nucleotides are not naturally occurring. In one embodiment, the nucleic acids or nucleotides in the oligomers are produced synthetically or recombinantly, but are not a naturally occurring sequence or a fragment thereof. In another embodiment, the nucleic acids or nucleotides in the oligomers contain at least one nucleotide analog that is not naturally occurring in nature. The term “nucleic acid” or “nucleoside” refers to a single nucleic acid segment, e.g., a DNA, an RNA, or an analog thereof, present in a polynucleotide. “Nucleic acid” or “nucleoside” includes naturally occurring nucleic acids or non-naturally occurring nucleic acids. In some embodiments, the terms “nucleotide”, “unit” and “monomer” are used interchangeably. It will be recognized that when referring to a sequence of nucleotides or monomers, what is referred to is the sequence of bases, such as A, T, G, C or U, and analogs thereof.
The term “nucleotide” as used herein, refers to a glycoside comprising a sugar moiety, a base moiety and a covalently linked group (linkage group), such as a phosphate or phosphorothioate internucleotide linkage group, and covers both naturally occurring nucleotides, such as DNA or RNA, and non-naturally occurring nucleotides comprising modified sugar and/or base moieties, which are also referred to as “nucleotide analogs” herein. Herein, a single nucleotide (unit) can also be referred to as a monomer or nucleic acid unit. In certain embodiments, the term “nucleotide analogs” refers to nucleotides having modified sugar moieties. Non-limiting examples of the nucleotides having modified sugar moieties (e.g., LNA) are disclosed elsewhere herein. In other embodiments, the term “nucleotide analogs” refers to nucleotides having modified base moieties. The nucleotides having modified base moieties include, but are not limited to, 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine.
The term “nucleoside” as used herein is used to refer to a glycoside comprising a sugar moiety and a base moiety, and can therefore be used when referring to the nucleotide units, which are covalently linked by the internucleotide linkages between the nucleotides of the oligomer. In the field of biotechnology, the term “nucleotide” is often used to refer to a nucleic acid monomer or unit, and as such in the context of an oligonucleotide can refer to the base—such as the “nucleotide sequence”, typically refer to the nucleobase sequence (i.e. the presence of the sugar backbone and internucleoside linkages are implicit). Likewise, particularly in the case of oligonucleotides where one or more of the internucleoside linkage groups are modified, the term “nucleotide” can refer to a “nucleoside” for example the term “nucleotide” can be used, even when specifying the presence or nature of the linkages between the nucleosides.
The term “nucleotide length” as used herein means the total number of the nucleotides (monomers) in a given sequence. For example, the sequence of AAAgatgaaatttgctcTTA (SEQ ID NO: 4) has 20 nucleotides; thus the nucleotide length of the sequence is 20. The term “nucleotide length” is therefore used herein interchangeably with “nucleotide number.”
As one of ordinary skill in the art would recognize, the 5′ terminal nucleotide of an oligonucleotide does not comprise a 5′ internucleotide linkage group, although it can comprise a 5′ terminal group.
As used herein, a “coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids. Although a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, untranslated regions (“UTRs”), and the like, are not part of a coding region. The boundaries of a coding region are typically determined by a start codon at the 5′ terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3′ terminus, encoding the carboxyl terminus of the resulting polypeptide.
The term “non-coding region” as used herein means a nucleotide sequence that is not a coding region. Examples of non-coding regions include, but are not limited to, promoters, ribosome binding sites, transcriptional terminators, introns, untranslated regions (“UTRs”), non-coding exons and the like. Some of the exons can be wholly or part of the 5′ untranslated region (5′ UTR) or the 3′ untranslated region (3′ UTR) of each transcript. The untranslated regions are important for efficient translation of the transcript and for controlling the rate of translation and half-life of the transcript.
The term “region” when used in the context of a nucleotide sequence refers to a section of that sequence. For example, the phrase “region within a nucleotide sequence” or “region within the complement of a nucleotide sequence” refers to a sequence shorter than the nucleotide sequence, but longer than at least 10 nucleotides located within the particular nucleotide sequence or the complement of the nucleotides sequence, respectively. The term “sub-sequence” or “subsequence” can also refer to a region of a nucleotide sequence.
The term “downstream,” when referring to a nucleotide sequence, means that a nucleic acid or a nucleotide sequence is located 3′ to a reference nucleotide sequence. In certain embodiments, downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.
The term “upstream” refers to a nucleotide sequence that is located 5′ to a reference nucleotide sequence.
As used herein, the term “regulatory region” refers to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, UTRs, and stem-loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3′ to the coding sequence.
The term “transcript” as used herein can refer to a primary transcript that is synthesized by transcription of DNA and becomes a messenger RNA (mRNA) after processing, i.e., a precursor messenger RNA (pre-mRNA), and the processed mRNA itself. The term “transcript” can be interchangeably used with “pre-mRNA” and “mRNA.” After DNA strands are transcribed to primary transcripts, the newly synthesized primary transcripts are modified in several ways to be converted to their mature, functional forms to produce different proteins and RNAs such as mRNA, tRNA, rRNA, lncRNA, miRNA and others. Thus, the term “transcript” can include exons, introns, 5′ UTRs, and 3′ UTRs.
The term “expression” as used herein refers to a process by which a polynucleotide produces a gene product, for example, a RNA or a polypeptide. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA) and the translation of an mRNA into a polypeptide. Expression produces a “gene product.” As used herein, a gene product can be either a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
The terms “identical” or percent “identity” in the context of two or more nucleic acids refer to two or more sequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence, not considering any conservative amino acid substitutions as part of the sequence identity. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software are known in the art that can be used to obtain alignments of amino acid or nucleotide sequences.
One such non-limiting example of a sequence alignment algorithm is the algorithm described in Karlin et al., 1990, Proc. Natl. Acad. Sci., 87:2264-2268, as modified in Karlin et al., 1993, Proc. Natl. Acad. Sci., 90:5873-5877, and incorporated into the NBLAST and XBLAST programs (Altschul et al., 1991, Nucleic Acids Res., 25:3389-3402). In certain embodiments, Gapped BLAST can be used as described in Altschul et al., 1997, Nucleic Acids Res. 25:3389-3402. BLAST-2, WU-BLAST-2 (Altschul et al., 1996, Methods in Enzymology, 266:460-480), ALIGN, ALIGN-2 (Genentech, South San Francisco, Calif.) or Megalign (DNASTAR) are additional publicly available software programs that can be used to align sequences. In certain embodiments, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (e.g., using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 90 and a length weight of 1, 2, 3, 4, 5, or 6). In certain alternative embodiments, the GAP program in the GCG software package, which incorporates the algorithm of Needleman and Wunsch (J. Mol. Biol. (48): 444-453 (1970)) can be used to determine the percent identity between two amino acid sequences (e.g., using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5). Alternatively, in certain embodiments, the percent identity between nucleotide or amino acid sequences is determined using the algorithm of Myers and Miller (CABIOS, 4:11-17 (1989)). For example, the percent identity can be determined using the ALIGN program (version 2.0) and using a PAM120 with residue table, a gap length penalty of 12 and a gap penalty of 4. One skilled in the art can determine appropriate parameters for maximal alignment by particular alignment software. In certain embodiments, the default parameters of the alignment software are used.
In certain embodiments, the percentage identity “X” of a first nucleotide sequence to a second nucleotide sequence is calculated as 100×(Y/Z), where Y is the number of amino acid residues scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.
Different regions within a single polynucleotide target sequence that align with a polynucleotide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
As used herein, the terms “homologous” and “homology” are interchangeable with the terms “identity” and “identical.”
The term “naturally occurring variant thereof” refers to variants of the Tau polypeptide sequence or MAPT nucleic acid sequence (e.g., transcript) which exist naturally within the defined taxonomic group, such as mammalian, such as mouse, monkey, and human. Typically, when referring to “naturally occurring variants” of a polynucleotide the term also can encompass any allelic variant of the MAPT-encoding genomic DNA which is found at Chromosomal position 17q21 by chromosomal translocation or duplication, and the RNA, such as mRNA derived therefrom. “Naturally occurring variants” can also include variants derived from alternative splicing of the MAPT mRNA. When referenced to a specific polypeptide sequence, e.g., the term also includes naturally occurring forms of the protein, which can therefore be processed, e.g., by co- or post-translational modifications, such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc.
In determining the degree of “complementarity” between oligomers of the invention (or regions thereof) and the target region of the nucleic acid which encodes mammalian Tau (e.g., the MAPT gene), such as those disclosed herein, the degree of “complementarity” (also, “homology” or “identity”) is expressed as the percentage identity (or percentage homology) between the sequence of the oligomer (or region thereof) and the sequence of the target region (or the reverse complement of the target region) that best aligns therewith. The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, dividing by the total number of contiguous monomers in the oligomer, and multiplying by 100. In such a comparison, if gaps exist, it is preferable that such gaps are merely mismatches rather than areas where the number of monomers within the gap differs between the oligomer of the invention and the target region.
The term “complement” as used herein indicates a sequence that is complementary to a reference sequence. It is well known that complementarity is the base principle of DNA replication and transcription as it is a property shared between two DNA or RNA sequences, such that when they are aligned antiparallel to each other, the nucleotide bases at each position in the sequences will be complementary, much like looking in the mirror and seeing the reverse of things. Therefore, for example, the complement of a sequence of 5′ “ATGC”3′ can be written as 3′ “TACG”5′ or 5′ “GCAT”3′. The terms “reverse complement”, “reverse complementary” and “reverse complementarity” as used herein are interchangeable with the terms “complement”, “complementary” and “complementarity.”
The terms “corresponding to” and “corresponds to,” when referencing two separate nucleic acid or nucleotide sequences can be used to clarify regions of the sequences that correspond or are similar to each other based on homology and/or functionality, although the nucleotides of the specific sequences can be numbered differently. For example, different isoforms of a gene transcript can have similar or conserved portions of nucleotide sequences whose numbering can differ in the respective isoforms based on alternative splicing and/or other modifications. In addition, it is recognized that different numbering systems can be employed when characterizing a nucleic acid or nucleotide sequence (e.g., a gene transcript and whether to begin numbering the sequence from the translation start codon or to include the 5′UTR). Further, it is recognized that the nucleic acid or nucleotide sequence of different variants of a gene or gene transcript can vary. As used herein, however, the regions of the variants that share nucleic acid or nucleotide sequence homology and/or functionality are deemed to “correspond” to one another. For example, a nucleotide sequence of a MAPT transcript corresponding to nucleotides X to Y of SEQ ID NO: 1 (“reference sequence”) refers to an MAPT transcript sequence (e.g., MAPT pre-mRNA or mRNA) that has an identical sequence or a similar sequence to nucleotides X to Y of SEQ ID NO: 1. A person of ordinary skill in the art can identify the corresponding X and Y residues in the MAPT transcript sequence by aligning the MAPT transcript sequence with SEQ ID NO: 1.
The terms “corresponding nucleotide analog” and “corresponding nucleotide” are intended to indicate that the nucleobase in the nucleotide analog and the naturally occurring nucleotide have the same pairing, or hybridizing, ability. For example, when the 2-deoxyribose unit of the nucleotide is linked to an adenine, the “corresponding nucleotide analog” contains a pentose unit (different from 2-deoxyribose) linked to an adenine.
The term “design” or “oligomer design” or “ASO Sequence” as used herein refers to a pattern of nucleotides (e.g., DNA) and nucleotide analogs (e.g., LNA) in a given sequence. As used herein, the design of an oligomer is shown by a combination of upper case letters and lower case letters. For example, an oligomer sequence of tatttccaaattcactttta (SEQ ID NO: 573) can have oligomer designs of ASO-002350 (TAtTTccaaattcactTTTA), ASO-002374 (TAtTTccaaattcacTtTTA), ASO-002386 (TATTtccaaattcaCTttTA), ASO-002227 (TATtTccaaattcactTTTA), ASO-002245 (TAttTCcaaattcactTTTA), ASO-002261 (TATtTccaaattcacTTtTA), ASO-002276 (ATttCcaaattcactTTTA), ASO-002228 (TATTtccaaattcaCtTtTA), ASO-002255 (TATTtccaaattcactTTTA), ASO-002285 (TATTtccaaattcacTTtTA), ASO-002230 (TATTtccaaattcacTtTTA), ASO-002256 (TATTtccaaattcAcTttTA), or ASO-002279 (TATTtccaaattcActTtTA), wherein the upper case letter indicates a nucleotide analog (e.g., LNA) and the lower case letter indicates a nucleotide (e.g., DNA)
The term “chemical structure” of an oligomer as used herein refers to a detailed description of the components of the oligomers, e.g., nucleotides (e.g., DNA), nucleotide analogs (e.g., beta-D-oxy-LNA), nucleotide base (e.g., A, T, G, C, U, or MC), and backbone structure (e.g., phosphorothioate or phosphorodiester). For example, a chemical structure of ASO-002350 can be OxyTs OxyAs DNAts OxyTs OxyTs DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas DNAcs DNAts OxyTs OxyTs OxyTs OxyAs.
“Potency” is normally expressed as an IC50 or EC50 value, in μM, nM or pM unless otherwise stated. Potency can also be expressed in terms of percent inhibition. IC50 is the median inhibitory concentration of a therapeutic molecule. EC50 is the median effective concentration of a therapeutic molecule relative to a vehicle or saline control. In functional assays, IC50 is the concentration that reduces a biological response, e.g., transcription of mRNA or protein expression, by 50% of the biological response that is achieved by the therapeutic molecule. In functional assays, EC50 is the concentration of a therapeutic molecule that produces 50% of the biological response, eg., transcription of mRNA or protein expression. IC50 or EC50 can be calculated by any number of means known in the art.
By “subject” or “individual” or “animal” or “patient” or “mammal,” is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, sports animals, and zoo animals including, e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, bears, and so on.
The term “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of the active ingredient to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the composition would be administered. Such composition can be sterile.
An “effective amount” of an oligomer as disclosed herein is an amount sufficient to carry out a specifically stated purpose. An “effective amount” can be determined empirically and in a routine manner, in relation to the stated purpose.
Terms such as “treating” or “treatment” or “to treat” or “alleviating” or “to alleviate” refer to both (1) therapeutic measures that cure, slow down, lessen symptoms of, and/or halt progression of a diagnosed pathologic condition or disorder and (2) prophylactic or preventative measures that prevent and/or slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented. In certain embodiments, a subject is successfully “treated” for a disease or condition disclosed elsewhere herein according to the methods provided herein if the patient shows, e.g., total, partial, or transient alleviation or elimination of symptoms associated with the disease or disorder.
II. The Oligomer
The present invention employs oligomeric compounds (referred herein as oligomers), for use in modulating the function of nucleic acid molecules encoding mammalian Tau, such as the MAPT nucleic acid, e.g., MAPT transcript, including MAPT pre-mRNA, and MAPT mRNA, or naturally occurring variants of such nucleic acid molecules encoding mammalian Tau. The term “oligomer” in the context of the present invention, refers to a molecule formed by covalent linkage of two or more nucleotides (i.e., an oligonucleotide).
The oligomer comprises a contiguous nucleotide sequence of from about 10 to about 50, such as 10-20, 16-20, 15-25, 10-30, 10-35, 10-40, or 10-45 nucleotides in length. The terms “antisense oligomer,” “antisense oligonucleotide,” and “ASO” as used herein are interchangeable with the term “oligomer.”
A reference to a SEQ ID number includes a particular nucleobase sequence, but does not include an oligomer design as shown in
In various embodiments, the oligomer of the invention does not comprise RNA (units). In some embodiments, the oligomer comprises one or more DNA units. In one embodiment, the oligomer according to the invention is a linear molecule or is synthesized as a linear molecule. In some embodiments, the oligomer is a single stranded molecule, and does not comprise short regions of, for example, at least 3, 4 or 5 contiguous nucleotides, which are complementary to equivalent regions within the same oligomer (i.e. duplexes)—in this regard, the oligomer is not (essentially) double stranded. In some embodiments, the oligomer is essentially not double stranded. In some embodiments, the oligomer is not a siRNA. In various embodiments, the oligomer of the invention can consist entirely of the contiguous nucleotide region. Thus, in some embodiments the oligomer is not substantially self-complementary.
In other embodiments, the present invention includes fragments of oligomers. For example, the invention includes at least one nucleotide, at least two contiguous nucleotides, at least three contiguous nucleotides, at least four contiguous nucleotides, at least five contiguous nucleotides, at least six contiguous nucleotides, at least seven contiguous nucleotides, at least eight contiguous nucleotides, or at least nine contiguous nucleotides of the oligomers disclosed herein. Fragments of any of the sequences disclosed herein are contemplated as part of the invention.
Suitably the oligomer of the invention is capable of down-regulating (e.g., reducing or removing) expression of the MAPT mRNA or protein. In this regard, the oligomer of the invention can affect indirect inhibition of Tau protein through the reduction in Tau mRNA levels, typically in a mammalian cell, such as a human cell, such as a neuronal cell.
Microtubule-associated protein tau (MAPT), in a pathologic state associated with disease, is also known as neurofibrillary tangle protein or paired helical filament-tau (PHF-tau). Synonyms of MAPT are known and include DDPAC, FTDP-17L, MSTD, MTBT1, MTBT2, PPND, PPP1R103, MAPTL, and TAU. The sequence for the MAPT gene can be found under publicly available Accession Number NC_000017.11 and the sequence for the MAPT pre-mRNA transcript can be found under publicly available Accession Number NG 007398 (SEQ ID NO: 1). The sequence for Tau protein can be found under publicly available Accession Numbers: P10636, P18518, Q14799, Q15549, Q15550, Q15551, Q1RMF6, Q53YB1, Q5CZI7, Q5XWFO, Q6QT54, Q9UDJ3, Q9UMHO, Q9UQ96, each of which is incorporated by reference herein in its entirety. Natural variants of the MAPT gene product are known. For example, natural variants of Tau protein can contain one or more amino acid substitutions selected from: R5H, R5L, D285N, V289A, K574T, L583V, G589V, N596K, N613H, P618L, P618S, G620V, S622N, K634M, S637F, V654M, E659V, K6861, G706R, R723W, and any combinations thereof. Therefore, the oligomers of the present invention can be designed to reduce or inhibit expression of the natural variants of the Tau protein.
Mutations in Tau are known to cause one or more pathological conditions. The oligomers of the invention can be used to reduce or inhibit the expression of a SNP or alternatively spliced MAPT transcript containing one or more mutations and consequently reduce the formation of a mutated Tau protein. Examples of Tau protein mutants include, but are not limited to a Tau protein comprising one or more mutations selected from: S515E, S516E, S519E, S531A, T548A, T548E, S552A, S552E, S579A, S713E, S721E, S726E, S730E, S739E, and any combination thereof. The oligomer of the invention can be designed to reduce or inhibit expression of any mutants of Tau proteins.
An example of a target nucleic acid sequence of the oligomers is MAPT pre-mRNA or MAPT mRNA. SEQ ID NO: 1 in
In some embodiments, an oligomer of the invention hybridizes to a region within the 3′ UTR of a MAPT transcript, e.g., SEQ ID NO: 1. In some embodiments, an oligomer of the invention hybridizes to a region within the 3′ UTR of a MAPT transcript, e.g., SEQ ID NO: 1, wherein the oligomer has a design according to formula: 5′ A-B-C 3′ as described elsewhere herein (e.g., Section II.G, e.g., Section II.G.I) or a chemical structure shown elsewhere herein (e.g.,
In one embodiment, the oligomer according to the invention comprises a contiguous nucleotide sequence that hybridizes to a region within 3′ UTR in a microtubule-associated protein MAPT transcript, e.g., a region corresponding to the 3′ UTR of SEQ ID NO: 1. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript (“target region”), wherein the nucleic acid sequence corresponds to nucleotides 134,947-138,940 of SEQ ID NO: 1. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript, wherein the nucleic acid sequence corresponds to nucleotides 134,947-138,940 of SEQ ID NO: 1, and wherein the oligomer has one of the designs described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In some embodiments, the target region corresponds to nucleotides 134,947-134,989, 135,533-135,550, 135,585-135,605, 135,690-135,710, 135,739-135,769, 135,775-135,792, 136,049-136,070, 136,053-136,068; 136,650-136,667, 136,693-136,723, 136,896-136,926, 137,067-137,089, 137,326-137,373, 137,851-137,883, 138,058-138,119, 138,377-138,394, 138,401-138,420, 138,884-138,908; 138,401-138,908; 138,377-138,908; 138,058-138,908; 137,851-138,908; 137,326-138,908; 137,067-138,908; 136,896-138,908; 136,693-138,908; 136,650-138,908; 136,049-138,908; 135,775-138,908; 135,739-138,908; or 134,947-138,908 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described elsewhere herein (e.g., Section II.G, e.g., a gapmer design, e.g., an alternating flank gapmer design). In another embodiment, the target region corresponds to nucleotides 134,947-134,989 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 135,533-135,550 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 135,585-135,605 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 135,690-135,710 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 135,739-135,769 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 135,775-135,792 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 136,049-136,070 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 136,053-136,068 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 136,650-136,667 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 136,693-136,723 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 136,896-136,926 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 137,067-137,089 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 137,326-137,373 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 137,851-137,883 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 138,058-138,119 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 138,377-138,394 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 138,401-138,420 of SEQ ID NO: 1. In another embodiment, the target region corresponds to nucleotides 138,884-138,908 of SEQ ID NO: 1.
In other embodiments, the target region corresponds to nucleotides 138,401-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 138,377-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 138,058-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 137,851-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 137,326-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 137,067-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 136,896-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 136,693-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 136,650-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 136,049-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 135,775-138,908 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 135,739-138,908 of SEQ ID NO: 1.
In other embodiments, the target region corresponds to nucleotides 136,053-136,068 of SEQ ID NO: 1+1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +20, +25, +30, +35, +40, +45, or +50 nucleotides at the 3′ end, the 5′ end, or both. In certain embodiments, the target region corresponds to nucleotides 138,884-138,908 of SEQ ID NO: 1+1, +2, +3, +4, +5, +6, +7, +8, +9, +10, +11, +12, +13, +14, +15, +20, +25, +30, +35, +40, +45, or +50 nucleotides of SEQ ID NO: 1 at the 3′ end, the 5′ end, or both.
In some embodiments, an oligomer of the invention hybridizes to a region within the 5′ UTR of a MAPT transcript, e.g., SEQ ID NO: 1. In some embodiments, an oligomer of the invention hybridizes to a region within the 5′ UTR of a MAPT transcript, e.g., SEQ ID NO: 1, wherein the oligomer has a design according to formula: 5′ A-B-C 3′ as described elsewhere herein (e.g., Section II.G, e.g., Section II.G.I) or a chemical structure shown elsewhere herein (e.g.,
In some embodiments, an oligomer of the invention hybridizes to a region within exon 2 of a MAPT transcript, e.g., SEQ ID NO: 1. In some embodiments, an oligomer of the invention hybridizes to a region within exon 2 of a MAPT transcript, e.g., SEQ ID NO: 1, wherein the oligomer has a design according to formula: 5′ A-B-C 3′ as described elsewhere herein (e.g., Section II.G, e.g., Section II.G.I) or a chemical structure shown elsewhere herein (e.g.,
In one embodiment, the oligomer according to the invention comprises a contiguous nucleotide sequence that hybridizes to a region within 5′ UTR and/or exon 2 in a microtubule-associated protein MAPT transcript, e.g., a region corresponding to the 5′ UTR and/or exon 2 of SEQ ID NO: 1. In the MAPT transcript, the 5′ UTR and exon 2 overlap but are not contiguous. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript (“target region”), wherein the nucleic acid sequence corresponds to nucleotides 72,802-73,072 of SEQ ID NO: 1. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript (“target region”), wherein the nucleic acid sequence corresponds to nucleotides 72,802-73,072 of SEQ ID NO: 1, and wherein the oligomer has one of the designs described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In some embodiments, the target region corresponds to nucleotides 72,802-73,072; 72,812-73,072; 72,822-73,072; 72,832-73,072; 72,842-73,072; 72,852-73,072; 72,862-73,072; 72,872-73,072; 72,882-73,072; 72,892-73,072; 72,902-73,072; 72,802-73,062; 72,802-73,052; 72,802-73,042; 72,802-73,032; 72,802-73,022; 72,802-73,012; 72,802-73,002; 72,802-72,992; 72,802-73,982; or 72,802-73,972 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described elsewhere herein (e.g., Section II.G, e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In some embodiments, the target region corresponds to nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; or 72,902-72,972 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described elsewhere herein (e.g., Section II.G, e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In other embodiments, the target region corresponds to nucleotides 72,947-72,960 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,946-72,961 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,907-72,922 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,948-72,963 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,950-72,963 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,945-72,960 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,950-72,965 of SEQ ID NO: 1.
In other embodiments, the target region corresponds to nucleotides 72,944-72,959 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,947-72,962 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,952-72,965 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,946-72,959 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,949-72,964 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,951-72,964 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,948 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,934-72,949 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,935-72,950 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,932-72,951 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,952 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,934-72,953 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,935-72,954 of SEQ ID NO: 1.
In other embodiments, the target region corresponds to nucleotides 72,944-72,963 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,945-72,964 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,946-72,965 of SEQ ID NO: 1.
In other embodiments, the target region corresponds to nucleotides 72,948-72,967 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,949 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,935-72,951 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,936-72,953 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,934 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,934-72,950 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,934-72,951 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,954 of SEQ ID NO: 1. In other embodiments, the target region corresponds to nucleotides 72,933-72,950 of SEQ ID NO: 1.
In other embodiments, an oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript (“target region”), wherein the nucleic acid sequence corresponds to nucleotides 97,648-97,661 of SEQ ID NO: 1, and wherein the oligomer optionally has one of the designs described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In yet other embodiments, an oligomer of the invention comprises a contiguous nucleotide sequence that hybridizes to a nucleic acid sequence, or a region within the sequence, of a MAPT transcript (“target region”), wherein the nucleic acid sequence corresponds to nucleotides 134,749-134,764 of SEQ ID NO: 1, and wherein the oligomer optionally has one of the designs described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, the oligomer of the invention is capable of hybridizing to the target nucleic acid (e.g., MAPT transcript) under physiological condition, i.e., in vivo condition. In some embodiments, the oligomer of the invention is capable of hybridizing to the target nucleic acid (e.g., MAPT transcript) in vitro. In some embodiments, the oligomer of the invention is capable of hybridizing to the target nucleic acid (e.g., MAPT transcript) in vitro under stringent conditions. Stringency conditions for hybridization in vitro are dependent on, inter alia, productive cell uptake, RNA accessibility, temperature, free energy of association, salt concentration, and time (see, e.g., Stanley T Crooks, Antisense Drug Technology: Principles, Strategies and Applications, 2nd Edition, CRC Press (2007))). Generally, conditions of high to moderate stringency are used for in vitro hybridization to enable hybridization between substantially similar nucleic acids, but not between dissimilar nucleic acids. An example of stringent hybridization conditions include hybridization in 5× saline-sodium citrate (SSC) buffer (0.75 M sodium chloride/0.075 M sodium citrate) for 1 hour at 40° C., followed by washing the sample 10 times in 1×SSC at 40° C. and 5 times in 1×SSC buffer at room temperature. In vivo hybridization conditions consist of intracellular conditions (e.g., physiological pH and intracellular ionic conditions) that govern the hybridization of antisense oligonucleotides with target sequences. In vivo conditions can be mimicked in vitro by relatively low stringency conditions. For example, hybridization can be carried out in vitro in 2×SSC (0.3 M sodium chloride/0.03 M sodium citrate), 0.1% SDS at 37° C. A wash solution containing 4×SSC, 0.1% SDS can be used at 37° C., with a final wash in 1×SSC at 45° C.
The oligomers of the invention comprise a contiguous nucleotide sequence which corresponds to the complement of a region of MAPT transcript, e.g., a nucleotide sequence corresponding to SEQ ID NO: 1.
In certain embodiments, the invention provides an oligomer from 10-50, such as 10-30 nucleotides in length which comprises a contiguous nucleotide sequence of a total of from 10-30 nucleotides, wherein the contiguous nucleotide sequence has at least 85%, 90%, 95%, 98%, or 99%) sequence identity to a region within the complement of a mammalian microtubule-associated protein tau (MAPT) transcript, such as SEQ ID NO: 1 or naturally occurring variant thereof. Thus, for example, the oligomer hybridizes to a single stranded nucleic acid molecule having the sequence of a portion of SEQ ID NO: 1.
The oligomer can comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to the equivalent region of a nucleic acid which encodes a mammalian Tau protein (e.g., SEQ ID NO: 1). The oligomer can comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to a nucleic acid sequence, or a region within the sequence, corresponding to nucleotides 134,947-138,940, 135,050-138,940; 135,700-138,940; 136,000-138,940; 136,620-138,940; 136,860-138,940; 137,060-138,940; 137,300-138,940; 137,830-138,940; 138,030-138,940; 138,350-138,940; 134,821-135,020; 135,050-135,820; 135,700-135,820; 136,000-136,110; 136,620-136,760; 136,860-136,960; 137,060-137,110; 137,300-137,400; 137,830-137,900; 138,030-138,140; 138,350-138,450; or 138,860-138,940 of SEQ ID NO: 1. Furthermore, the oligomer can have a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
The oligomer can also comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to the equivalent region of a nucleic acid which encodes a mammalian Tau protein (e.g., SEQ ID NO: 1). The oligomer can comprise a contiguous nucleotide sequence which is fully complementary (perfectly complementary) to a nucleic acid sequence, or a region within the sequence, corresponding to nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; or 72,902-72,972 of SEQ ID NO: 1. Furthermore, the oligomer can have a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, the nucleotide sequence of the oligomers of the invention or the contiguous nucleotide sequence has at least about 80% sequence identity to a sequence selected from SEQ ID NOs: 4 to 803, and 901 to 935 (i.e., the sequences in
In other embodiments, the oligomer of the invention comprises at least one oligomer sequence (e.g., ASO number) disclosed in
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of a nucleic acid sequence selected from nucleotides 134,947-134,989, 135,739-135,769, 135,775-135,792, 136,049-136,070, 136,053-136,068; 136,650-136,667, 136,693-136,723, 136,896-136,926, 137,067-137,089, 137,326-137,373, 137,851-137,883, 138,058-138,119, 138,377-138,394, 138,401-138,420, 138,884-138,924; 138,401-138,924; 138,377-138,924; 138,058-138,924; 137,851-138,924; 137,326-138,924; 137,067-138,924; 136,896-138,924; 136,693-138,924; 136,650-138,924; 136,049-138,924; 135,775-138,924; 135,739-138,924; 134,947-138,924; 134,947-138,940; 134,909-138,924; 134,871-138,924; and 134,854-138,924 of SEQ ID NO: 1. In some embodiments, the oligomer has a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, the nucleotide sequence of the oligomers of the invention or the contiguous nucleotide sequence has at least about 80% sequence identity to a sequence selected from SEQ ID NOs: 804 to 900 (i.e., the sequences in
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of a nucleic acid sequence selected from nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; and 72,902-72,972 of SEQ ID NO: 1. In some embodiments, the oligomer has a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 134,947-138,940 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 136,000-138,940 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 136,860-138,940 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In other embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 138,860-138,940 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In other embodiments, the region is within the complement of nucleotides 137,326-137,373 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 137,851-137,883 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,058-138,119 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,377-138,394 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,401-138,420 of SEQ ID NO: 1.
In some embodiments, the region is within the complement of nucleotides 138,884-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,401-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,377-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 138,058-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 137,851-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 137,326-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 137,067-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 136,896-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 136,693-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 136,650-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 136,049-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 135,775-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 135,739-138,924 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 134,947-138,924 of SEQ ID NO: 1.
In some embodiments the oligomer (or contiguous nucleotide portion thereof) is selected from, or comprises, one of the sequences selected from the group consisting of SEQ ID NOs: 4 to 803, 901 to 953, 956 to 958, and 960 or a region of at least 10 contiguous nucleotides thereof, wherein the oligomer (or contiguous nucleotide portion thereof) can optionally comprise one, two, three, or four mismatches when compared to the corresponding MAPT transcript.
In one embodiment, the oligomer can comprise a sequence selected from the group consisting of ctttatttccaaattcactt [138888-138907] (SEQ ID NO: 676); actttatttccaaattcact [138889-138908] (SEQ ID NO: 715); tttatttccaaattcacttt [138887-138906] (SEQ ID NO: 644); ttatttccaaattcactttt [138886-138905] (SEQ ID NO: 799); atttccaaattcacttttac [138884-138903](SEQ ID NO: 466); atttccaaattcactttta [138885-138903] (SEQ ID NO: 559); actttatttccaaattcactt [138888-138908] (SEQ ID NO: 680); atttccaaattcactt [138888-138903] (SEQ ID NO: 686); tatttccaaattcactttta [13885-138904] (SEQ ID NO: 526); aataactttatttcca [138897-138912] (SEQ ID NO: 773); agtaataactttatt [138901-138915] (SEQ ID NO: 782); tttccaaattcactt [138888-138902] (SEQ ID NO: 684); agagtaataactttat [138902-138917] (SEQ ID NO: 784); agtaataactttattt [138900-138915] (SEQ ID NO: 780); agagtaataacttta [138903-138917] (SEQ ID NO: 786); ttaatcagagtaataa [138908-138923] (SEQ ID NO: 795); tttaatcagagtaat [138910-138924] (SEQ ID NO: 798); aatcagagtaataac [138907-138921] (SEQ ID NO: 794); tttaatcagagtaata [138909-139924] (SEQ ID NO: 797); taatcagagtaataa[138908-138922] (SEQ ID NO: 796); ctttatttccaaattcact [138889-138907] (SEQ ID NO: 713); or ctttatttccaaattcac [138890-138907] (SEQ ID NO: 739). In a particular embodiment, the oligomer comprises atttccaaattcacttttac [138884-138903] (SEQ ID NO: 466). In one embodiment, the oligomer (or contiguous nucleotide portion thereof) optionally has one, two, three, or four mismatches against the selected sequence. In another embodiment, the oligomer optionally comprises one or more nucleotide analogs. In other embodiments, the oligomer has a design described elsewhere herein (e.g., Section II.G.I, e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In other embodiments, an oligomer of the invention comprises, consists essentially of, or consists of a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NOs: 939, 940, 524, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 956, 957, 958, 951, 952, or 953. In some embodiments, the oligomer having a sequence identity to SEQ ID NOs: 939, 940, 524, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 956, 957, 958, 951, 952, or 953 has the design of ASO-257283, ASO-257284, ASO-002263, ASO-002627, ASO-002677, ASO-002670, ASO-002663, ASO-002635, ASO-002643, ASO-002671, ASO-002664, ASO-002626, ASO-002634, ASO-002678, ASO-002650, ASO-002657, ASO-002642, ASO-002649, or ASO-002656, respectively.
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,802-73,072 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,872-73,002 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In certain embodiments, an oligomer of the invention comprises a nucleotide sequence having at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of nucleotides 72,852-73,072 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In some embodiments, an oligomer of the invention has at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a region within the complement of a nucleic acid sequence selected from nucleotides 72,862-73,012; 72,872-73,012; 72,882-73,012; 72,892-73,012; 72,902-73,012; 72,862-73,002; 72,872-73,002; 72,882-73,002; 72,892-73,002; 72,902-73,002; 72,862-72,992; 72,872-72,992; 72,882-72,992; 72,892-72,992; 72,902-72,992; 72,862-72,982; 72,872-72,982; 72,882-72,982; 72,892-72,982; 72,902-72,982; 72,862-72,972; 72,872-72,972; 72,882-72,972; 72,892-72,972; and 72,902-72,972 of SEQ ID NO: 1, wherein optionally, the oligomer has a design described elsewhere herein (e.g., Section II.G. e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure shown elsewhere herein (e.g.,
In other embodiments, the region is within the complement of nucleotides 72,902-73,002 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,862-72,992 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,872-72,992 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,882-72,992 of SEQ ID NO: 1.
In some embodiments, the region is within the complement of nucleotides 72,892-72,992 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,902-72,992 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,862-72,982 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,872-72,982 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,882-72,982 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,892-72,982 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,902-72,982 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,862-72,972 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,872-72,972 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,882-72,972 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,892-72,972 of SEQ ID NO: 1. In some embodiments, the region is within the complement of nucleotides 72,902-72,972 of SEQ ID NO: 1.
In one embodiment, the oligomer can comprise a sequence selected from the group consisting of SEQ ID NOs: 804 to 900. In one embodiment, the oligomer (or contiguous nucleotide portion thereof) optionally has one, two, or three mismatches against the selected sequence. In another embodiment, the oligomer optionally comprises one or more nucleotide analogs. In other embodiments, the oligomer has a design described elsewhere herein (e.g., Section II.G.I, e.g., a gapmer design, e.g., an alternating flank gapmer design) or a chemical structure described elasewhere herein. Non-limiting examples of the nucleotide analogs useful for the invention are disclosed elsewhere herein.
When the oligomer sequences are listed only with lower case letters (e.g., ctttatttccaaattcactt (SEQ ID NO: 676), the nucleic acids included in the oligomer can be either naturally occurring nucleic acids or nucleotide analogs. If an oligomer sequence is described as a combination of lower case letters and upper case letters (e.g., CTTtatttccaaattcaCTT), the upper case letters in the sequence are nucleotide analogs (e.g, LNA) while the lower case letters are naturally occurring nucleic acids (e.g., DNA). Therefore, for example, when a sequence “CTTtatttccaaattcaCTT” is provided herein, also provided is “ctttatttccaaattcactt (or SEQ ID NO: 676), wherein the three nucleic acids at the 3′ end are nucleotide analogs (e.g., LNA) and the three nucleic acids at the 5′ end are naturally occurring nucleic acids (e.g., DNA)” or “ctttatttccaaattcactt (or SEQ ID NO: 676) with a design of LLLDDDDDDDDDDDDDDLLL, wherein L is a nucleotide analog and D is a DNA unit.”
In certain embodiments, the oligomer of the invention comprises a nucleotide sequence selected from SEQ ID NO: 4 to 953, 956 to 958, and 960. See
In certain embodiments, the oligomers of the invention bind to the MAPT transcript and inhibit or reduce expression of the MAPT mRNA by at least about 10% or about 20% compared to the normal (i.e. control) expression level in the cell, e.g., at least about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 95% compared to the normal expression level (such as the expression level in the absence of the oligomer(s) or conjugate(s)) in the cell. In certain embodiments, the oligomer reduces expression of Tau protein in a cell following administration of the oligomer by at least 60%, at least 70%, at least 80%, or at least 90% compared to a cell not exposed to the oligomer (i.e., control). In some embodiments, the oligomer reduces expression of Tau protein in a cell following administration of the oligomer by at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to a cell not exposed to the oligomer (i.e., control).
In certain embodiments, the oligomer of the invention has at least one property selected from: (1) reduces expression of Tau mRNA in a cell, compared to a control cell that has not been exposed to the oligomer; (2) does not significantly reduce calcium oscillations in a cell; (3) does not significantly reduce tubulin intensity in a cell; (4) reduces expression of Tau protein in a cell; and (5) any combinations thereof compared to a control cell that has not been exposed to the oligomer.
In some embodiments, the oligomer of the invention does not significantly reduce calcium oscillations in a cell, e.g., neuronal cells. If the oligomer does not significantly reduce calcium oscillations in a cell, this property of the oligomer corresponds with a reduced neurotoxicity of the oligomer. In some embodiments, calcium oscillations are greater than or equal to 95%, greater than or equal to 90%, greater than or equal to 85%, greater than or equal to 80%, greater than or equal to 75%, or greater than or equal to 70% of oscillations in a cell not exposed to the oligomer.
Calcium oscillations are important for the proper functions of neuronal cells. Networks of cortical neurons have been shown to undergo spontaneous calcium oscillations resulting in the release of the neurotransmitter glutamate. Calcium oscillations can also regulate interactions of neurons with associated glia, in addition to other associated neurons in the network, to release other neurotransmitters in addition to glutamate. Regulated calcium oscillations are required for homeostasis of neuronal networks for normal brain function. (See, Shashank et al., Brain Research, 1006(1): 8-17 (2004); Rose et al., Nature Neurosci., 4:773-774 (2001); Zonta et al., J Physiol Paris., 96(3-4):193-8 (2002); Pasti et al., J. Neurosci., 21(2): 477-484 (2001).) Glutamate also activates two distinct ion channels, α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors and N-methyl-D-aspartate (NMDA) receptors.
In some embodiments, the calcium oscillations measured in the present methods are AMPA-dependent calcium oscillations. In some embodiments, the calcium oscillations are NMDA-dependent calcium oscillations. In some embodiments, the calcium oscillations are gamma-aminobutyric acid (GABA)-dependent calcium oscillations. In some embodiments, the calcium oscillations can be a combination of two or more of AMPA-dependent, NMDA-dependent or GABA-dependent calcium oscillations.
In certain embodiments, the calcium oscillations measured in the present methods are AMPA-dependent calcium oscillations. In order to measure AMPA-dependent calcium oscillations, the calcium oscillations can be measured in the presence of Mg2+ ions (e.g., MgCl2). In certain embodiments, the method further comprises adding Mg2+ ions (e.g., MgCl2) at an amount that allows for detection of AMPA-dependent calcium oscillations. In some embodiments, the effective ion concentration allowing for detection of AMPA-dependent calcium oscillations is at least about 0.5 mM. In other embodiments, the effective ion concentration to induce AMPA-dependent calcium oscillations is at least about 0.6 mM, at least about 0.7 mM, at least about 0.8 mM, at least about 0.9 mM, at least about 1 mM, at least about 1.5 mM, at least about 2.0 mM, at least about 2.5 mM, at least about 3.0 mM, at least about 4 mM, at least about 5 mM, at least about 6 mM, at least about 7 mM, at least about 8 mM, at least about 9 mM, or at least about 10mM. In a particular embodiment, the concentration of Mg2+ ions (e.g., MgCl2) useful for the methods is 1 mM. In certain embodiments, the concentration of Mg2+ ions (e.g., MgCl2) useful for the present methods is about 1 mM to about 10 mM, about 1 mM to about 15 mM, about 1 mM to about 20 mM, or about 1 mM to about 25 mM. Mg2+ ions can be added by the addition of magnesium salts, such as magnesium carbonate, magnesium chloride, magnesium citrate, magnesium hydroxide, magnesium oxide, magnesium sulfate, and magnesium sulfate heptahydrate.
In some embodiments, calcium oscillations are measured in the present method through the use of fluorescent probes which detect the fluctuations of intracellular calcium levels. For example, detection of intracellular calcium flux can be achieved by staining the cells with fluorescent dyes which bind to calcium ions (known as fluorescent calcium indicators) with a resultant, detectable change in fluorescence (e.g., Fluo-4 AM and Fura Red AM dyes available from Molecular Probes. Eugene, Oreg., United States of America).
In other embodiments, the oligomers of the invention do not significantly reduce the tubulin intensity in a cell. In some embodiments, tubulin intensity is greater than or equal to 95%, greater than or equal to 90%, greater than or equal to 85%, greater than or equal to 80%, greater than or equal to 75%, or greater than or equal to 70% of tubulin intensity in a cell not exposed to the oligomer (or exposed to saline).
In some embodiments, such property is observed when using from 0.04 nM to 400 μM concentration of the oligomer of the invention. In the same or a different embodiment, the inhibition or reduction of expression of MAPT mRNA and/or Tau protein in the cell results in less than 100%, such as less than 98%, less than 95%, less than 90%, less than 80%, such as less than 70%, mRNA or protein levels compared to cells not exposed to the oligomer. Modulation of expression level can be determined by measuring Tau protein levels, e.g., by methods such as SDS-PAGE followed by western blotting using suitable antibodies raised against the target protein. Alternatively, modulation of expression levels can be determined by measuring levels of MAPT mRNA, e.g., by northern blot or quantitative RT-PCR. When measuring inhibition via mRNA levels, the level of down-regulation when using an appropriate dosage, such as from about 0.04 nM to about 400 μM concentration, is, in some embodiments typically to a level of from about 10-20% the normal levels in the cell in the absence of the oligomer.
In certain embodiments, the oligomer of the invention has an in vivo tolerability less than or equal to a total score of 4, wherein the total score is the sum of a unit score of five categories, which are 1) hyperactivity; 2) decreased activity and arousal; 3) motor dysfunction and/or ataxia; 4) abnormal posture and breathing; and 5) tremor and/or convulsions, and wherein the unit score for each category is measured on a scale of 0-4. In certain embodiments, the in vivo tolerability is less than or equal to the total score of 3, the total score of 2, the total score of 1, or the total score of 0. In some embodiment, the assessment for in vivo tolerability is determined as described in Example 5 below.
In some embodiments, the oligomer can tolerate 1, 2, 3, or 4 (or more) mismatches, when hybridizing to the target sequence and still sufficiently bind to the target to show the desired effect, i.e., down-regulation of the target mRNA and/or protein. Mismatches can, for example, be compensated by increased length of the oligomer nucleotide sequence and/or an increased number of nucleotide analogs, which are disclosed elsewhere herein.
In some embodiments, the oligomer of the invention comprises no more than 3 mismatches when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 2 mismatches when hybridizing to the target sequence. In other embodiments, the contiguous nucleotide sequence comprises no more than 1 mismatch when hybridizing to the target sequence. In some embodiments, the target sequence is a region within nucleotides 134,947-138,940 of SEQ ID NO: 1. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, a region within nucleotides 134,947-138,940 of SEQ ID NO: 1. In some embodiments, the target sequence is a region within nucleotides 135,050-138,940 of SEQ ID NO: 1. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, a region within nucleotides 135,050-138,940 of SEQ ID NO: 1. In some embodiments, the target sequence is a region within nucleotides 72,802-73,072 of SEQ ID NO: 1. In some embodiments, the contiguous nucleotide sequence comprises no more than a single mismatch when hybridizing to the target sequence, a region within nucleotides 72,802-73,072 of SEQ ID NO: 1.
In some embodiments the region within the complement or the region can consist of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 contiguous nucleotides, such as from 12-22, such as from 14-21 nucleotides. Suitably, in some embodiments, the region is of the same length as the contiguous nucleotide sequence of the oligomer of the invention.
In some embodiments the oligomer according to the invention comprises a nucleotide sequence, or a region within the sequence, according to any one of SEQ ID NOs: 4 to 953, 956 to 958, and 960.
In other embodiments the oligomer according to the invention comprises a nucleotide sequence, or a region within the sequence, according to any one of SEQ ID NOs: 804 to 900. In other embodiments the oligomer according to the invention comprises a nucleotide sequence, or a region within the sequence, according to any one of SEQ ID NOs: 936 to 953,956 to 958, and 960.
However, it is recognized that, in some embodiments, the nucleotide sequence of the oligomer can comprise additional 5′ or 3′ nucleotides, such as, independently, 1, 2, 3, 4 or 5 additional nucleotides 5′ and/or 3′, which are non-complementary to the target sequence. In this respect the oligomer of the invention, can, in some embodiments, comprise a contiguous nucleotide sequence which is flanked 5′ and/or 3′ by additional nucleotides. In some embodiments the additional 5′ and/or 3′ nucleotides are naturally occurring nucleotides, such as DNA or RNA.
In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 677 (e.g., ASO-000757), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 679 (e.g., ASO-001928), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 715 (e.g., ASO-001962), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 681 (e.g., ASO-001921), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 644 (e.g., ASO-000756), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 647 (e.g., ASO-001948), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 593 (e.g., ASO-001941), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 716 (e.g., ASO-001956), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 474 (e.g., ASO-001919), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 683 (e.g., ASO-001942), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 587 (e.g., ASO-000755), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 685 (e.g., ASO-001935), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 472 (e.g., ASO-001940), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 646 (e.g., ASO-001955), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 680 (e.g., ASO-001968) or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 201 (e.g., ASO-000662), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 473 (e.g., ASO-001933), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 645 (e.g., ASO-001967), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 532 (e.g., ASO-001954), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 538 (e.g., ASO-001960), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 535 (e.g., ASO-001966), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 650 (e.g., ASO-001961), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 533 (e.g., ASO-001947), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 590 (e.g., ASO-001920), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 7 (e.g., ASO-000829), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 740 (e.g., ASO-002007), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 714 (e.g., ASO-002012), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 487 (e.g., ASO-002038), or a region thereof.
In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 153 (e.g., ASO-000540), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 686 (e.g., ASO-000013), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 471 (e.g., ASO-000753), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 223 (e.g., ASO-000642), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 688 (e.g., ASO-000762), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 53 (e.g., ASO-000389), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 154 (e.g., ASO-000555), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 202 (e.g., ASO-000566), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 595 (e.g., ASO-001934), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 655 (e.g., ASO-000761), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 482 (e.g., ASO-001926), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 485 (e.g., ASO-000758), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 589 (e.g., ASO-000760), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 370 (e.g., ASO-000635), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 548 (e.g., ASO-000759), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 250 (e.g., ASO-000388), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 251 (e.g., ASO-000390), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 258 (e.g., ASO-000394), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 256 (e.g., ASO-000396), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 51 (e.g., ASO-000411), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 69 (e.g., ASO-000435), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 71 (e.g., ASO-000442), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 255 (e.g., ASO-000447), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 84 (e.g., ASO-000449), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 262 (e.g., ASO-000451), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 365 (e.g., ASO-000468), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 285 (e.g., ASO-000478), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 392 (e.g., ASO-000527), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 417 (e.g., ASO-000543), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 76 (e.g., ASO-000558), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 74 (e.g., ASO-000581), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 390 (e.g., ASO-000614), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 28 (e.g., ASO-000830), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 46 (e.g., ASO-001778), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 43 (e.g., ASO-001779), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 49 (e.g., ASO-001780), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 52 (e.g., ASO-001781), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 67 (e.g., ASO-001782), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 56 (e.g., ASO-001925, or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 60 (e.g., ASO-001953), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 698 (e.g., ASO-214296), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 773 (e.g., ASO-000118), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 782 (e.g., ASO-000125), or a region thereof.
In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 807 (e.g., ASO-000461), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 824 (e.g., ASO-001783), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 825 (e.g., ASO-001784), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 811 (e.g., ASO-000520), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 818 (e.g., ASO-000774), or a region thereof. In some embodiments the oligomer according to the invention comprises a nucleotide sequence according to SEQ ID NO: 817 (e.g., ASO-000773), or a region thereof.
In some embodiments, the oligomer of the invention has a sequence score greater than or equal to 0.2, wherein the sequence score is calculated by formula I:
In other embodiments, the oligomer of the invention has a sequence score greater than or equal to 0.2, wherein the sequence score is calculated by formula IA:
In these embodiments, a sequence score of greater than or equal to a cut off value corresponds to a reduced neurotoxicity of the oligomer.
In certain embodiments, the oligomer of the invention has a sequence score greater than or equal to about 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1.0. In one embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence hybridizing to a non-coding region of a MAPT transcript, wherein the sequence score of the oligomer is greater than or equal to about 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1.0. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence hybridizing to a 3′ UTR of a MAPT transcript, wherein the sequence score of the oligomer is greater than or equal to about 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1.0. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence hybridizing to a 5′ UTR of a MAPT transcript, wherein the sequence score of the oligomer is greater than or equal to about 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1.0. In another embodiment, the oligomer of the invention comprises a contiguous nucleotide sequence hybridizing to exon 2 of a MAPT transcript, wherein the sequence score of the oligomer is greater than or equal to about 0.1, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95, or 1.0. In all of these embodiments, when the sequence score is greater than or equal to the cut off value, the oligomer is considered to have reduced neurotoxicity.
The oligomers can comprise a contiguous nucleotide sequence of a total of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides in length.
In some embodiments, the oligomers comprise a contiguous nucleotide sequence of a total of about 10-22, such as 10-21 or 12-18, such as 13-17 or 12-16, such as 13, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides in length.
In some embodiments, the oligomers comprise a contiguous nucleotide sequence of a total of 10, 11, 12, 13, or 14 contiguous nucleotides in length.
In some embodiments, the oligomer according to the invention consists of no more than 22 nucleotides, such as no more than 21 or 20 nucleotides, such as no more than 18 nucleotides, such as 15, 16 or 17 nucleotides. In some embodiments the oligomer of the invention comprises less than 22 nucleotides. It should be understood that when a range is given for an oligomer, or contiguous nucleotide sequence length, the range includes the lower and upper lengths provided in the range, for example from (or between) 10-50, includes both 10 and 50.
II.D. Nucleosides and Nucleoside Analogs
In one aspect of the invention, the oligomers comprise one or more non-naturally occurring nucleotide analogs. “Nucleotide analogs” as used herein are variants of natural nucleotides, such as DNA or RNA nucleotides, by virtue of modifications in the sugar and/or base moieties. Analogs could in principle be merely “silent” or “equivalent” to the natural nucleotides in the context of the oligonucleotide, i.e. have no functional effect on the way the oligonucleotide works to inhibit target gene expression. Such “equivalent” analogs can nevertheless be useful if, for example, they are easier or cheaper to manufacture, or are more stable to storage or manufacturing conditions, or represent a tag or label. In some embodiments, however, the analogs will have a functional effect on the way in which the oligomer works to inhibit expression; for example by producing increased binding affinity to the target and/or increased resistance to intracellular nucleases and/or increased ease of transport into the cell. Specific examples of nucleoside analogs are described by e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and in Scheme 1:
In one embodiment, the oligomer includes at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten nucleotide analogs. In another embodiment, the oligomer includes four, six, eight, or ten nucleotide analogs.
Examples of the nucleotide analogs include, but are not limited to, Locked Nucleic Acid (LNA); 2′-O-alkyl-RNA; 2′-amino-DNA; 2′-fluoro-DNA; arabino nucleic acid (ANA); 2′-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2′-O-methyl nucleic acid (2′-OMe), 2′-O-methoxyethyl nucleic acid (2′-MOE), or any combination thereof.
“Hexitol nucleic acids” or “HNA” are composed of phosphorylated 2,3-dideoxy-D-arabino-hexitol units with a nucleobase situated in the 2-[S]-position.
“cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4′-carbon and the 2′-carbon, wherein the bridge has the formula: 4′—CH(CH3)-0-2′.
“2′-O-methoxyethyl” (also 2′-MOE and 2′-O(CH2)2-OCH3 and MOE) refers to an O-methoxy-ethyl modification at the 2′ position of a furanosyl ring. A 2′-O-methoxyethyl modified sugar is a modified sugar.
As used herein, “2′-F” refers to modification of the 2′ position of the furanosyl sugar ring to comprise a fluoro group.
As used herein, “2′-OMe” or “2′-OCH3” or “2′-O-methyl” each refers to modification at the 2′ position of the furanosyl sugar ring to comprise a —OCH3 group.
The oligomer can thus comprise a simple sequence of natural occurring nucleotides—for example, 2′-deoxynucleotides (referred to herein generally as “DNA”), but also possibly ribonucleotides (referred to herein generally as “RNA”), or a combination of such naturally occurring nucleotides and one or more non-naturally occurring nucleotides, i.e. nucleotide analogs. Such nucleotide analogs can suitably enhance the affinity of the oligomer for the target sequence.
Examples of suitable nucleotide analogs are provided by WO2007/031091, which is incorporated by reference in its entirety, or are referenced therein.
Incorporation of affinity-enhancing nucleotide analogs in the oligomer, such as LNA or 2′-substituted sugars, can allow the size of the specifically binding oligomer to be reduced, and can also reduce the upper limit to the size of the oligomer before non-specific or aberrant binding takes place.
In some embodiments, the oligomer comprises at least one LNA. Additional details of the LNA compound are disclosed elsewhere herein. In some embodiments the oligomer comprises at least 2 LNAs. In some embodiments, the oligomer comprises from 3-10 LNAs, e.g., 6 or 7 LNAs, e.g., at least 3 or at least 4, or at least 5, or at least 6, or at least 7, or 8 LNAs. In some embodiments all the nucleotides analogs can be LNA.
In a specific embodiment, the oligomer of the invention includes a bicyclic sugar. Non-limiting examples of the bicyclic sugar includes cEt, 2′,4′-constrained 2′-O-methoxyethyl (cMOE), LNA, α-LNA, β-LNA, 2′-O,4′-C-ethylene-bridged nucleic acids (ENA), amino-LNA, oxy-LNA, or thio-LNA.
The term “thio-LNA” comprises a locked nucleotide in which Y in general Formula III below is selected from S or —CH2—S—. Thio-LNA can be in both beta-D and alpha-L-configuration.
The term “amino-LNA” comprises a locked nucleotide in which Y in general Formula III below is selected from —N(H)—, N(R)—, CH2—N(H)—, and —CH2—N(R)— where R is selected from hydrogen and C1-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.
The term “oxy-LNA” comprises a locked nucleotide in which Y in general Formula III below represents —O—. Oxy-LNA can be in both beta-D and alpha-L-configuration.
The term “ENA” comprises a locked nucleotide in which Y in general Formula III below is —CH2—O— (where the oxygen atom of —CH2—O— is attached to the 2′-position relative to the base B). Re is hydrogen or methyl.
In some exemplary embodiments LNA is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA and beta-D-thio-LNA, in particular beta-D-oxy-LNA.
It will be recognized that when referring to a nucleotide sequence motif or nucleotide sequence, which consists of only nucleotides, the oligomers of the invention which are defined by that sequence, can comprise a corresponding nucleotide analog in place of one or more of the nucleotides present in the sequence, such as LNA units or other nucleotide analogs, including cEt, cMOE, α-LNA, β-LNA, ENA, amino-LNA, oxy-LNA, thio-LNA, which raise the duplex stability/Tm of the oligomer/target duplex (i.e. affinity enhancing nucleotide analogs).
In some embodiments, any mismatches between the nucleotide sequence of the oligomer and the target sequence are found in regions outside the affinity enhancing nucleotide analogs, such as region B as referred to herein, and/or region D as referred to herein, and/or at the site of non-modified such as DNA nucleotides in the oligonucleotide, and/or in regions which are 5′ or 3′ to the contiguous nucleotide sequence.
Examples of such modification of the nucleotide include modifying the sugar moiety to provide a 2′-substituent group or to produce a bridged (locked nucleic acid) structure which enhances binding affinity and can also provide increased nuclease resistance.
In one embodiment, a nucleotide analog is oxy-LNA (such as beta-D-oxy-LNA, and alpha-L-oxy-LNA), and/or amino-LNA (such as beta-D-amino-LNA and alpha-L-amino-LNA) and/or thio-LNA (such as beta-D-thio-LNA and alpha-L-thio-LNA) and/or ENA (such as beta-D-ENA and alpha-L-ENA). In a particular embodiment, a nucleotide analog is beta-D-oxy-LNA.
In some embodiments the nucleotide analogs present within the oligomer of the invention (such as in regions A and C mentioned herein) are independently selected from, for example: 2′-O-alkyl-RNA units, 2′-amino-DNA units, 2′-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2′-fluoro-ANA units, HNA units, INA (intercalating nucleic acid—Christensen, 2002. Nucl. Acids. Res. 2002 30: 4918-4925, hereby incorporated by reference) units and 2′-MOE units. In some embodiments there is only one of the above types of nucleotide analogs present in the oligomer of the invention, or contiguous nucleotide sequence thereof.
In some embodiments the nucleotide analogs are 2′-O-methoxyethyl-RNA (2′-MOE), 2′-fluoro-DNA monomers, LNA nucleotide analogs, cEt, cMOE, α-LNA, β-LNA, ENA, amino-LNA, oxy-LNA, or thio-LNA units, and as such the oligonucleotide of the invention can comprise nucleotide analogs which are independently selected from these types of analog, or can comprise only one type of analog selected from those above. In some embodiments at least one of the nucleotide analogs is 2′-MOE-RNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2′-MOE-RNA nucleotide units. In some embodiments at least one of the nucleotide analogs is 2′-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2′-fluoro-DNA nucleotide units.
In some embodiments, the oligomer according to the invention comprises at least one Locked Nucleic Acid (LNA) unit, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 LNA units, such as from 3-7 or 4-8 LNA units, or 3, 4, 5, 6, 7, or 8 LNA units. In some embodiments, all the nucleotide analogs are LNA. In some embodiments, the oligomer can comprise both beta-D-oxy-LNA, and one or more of the following LNA units: thio-LNA, amino-LNA, oxy-LNA, and/or ENA in either the beta-D or alpha-L configurations or combinations thereof. In some embodiments all LNA cytosine units are 5′-methylcytosine. In some embodiments of the invention, the oligomer can comprise both LNA and DNA units. In certain embodiments, the combined total of LNA and DNA units is 10-50,10-30, such as 10-25, e.g., 10-22, such as 10-21. In some embodiments of the invention, the nucleotide sequence of the oligomer, such as the contiguous nucleotide sequence consists of at least one LNA and the remaining nucleotide units are DNA units. In some embodiments the oligomer comprises only LNA nucleotide analogs and naturally occurring nucleotides (such as RNA or DNA, e.g., DNA nucleotides), optionally with modified internucleotide linkages such as phosphorothioate.
The term “nucleobase” refers to the base moiety of a nucleotide and covers both naturally occurring as well as non-naturally occurring variants. Thus, “nucleobase” covers not only the known purine and pyrimidine heterocycles but also heterocyclic analogs and tautomeres thereof.
Examples of nucleobases include, but are not limited to adenine, guanine, cytosine, thymidine, uracil, xanthine, hypoxanthine, 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine.
In some embodiments, at least one of the nucleobases present in the oligomer is a modified nucleobase selected from the group consisting of 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine.
In certain embodiments, the present invention includes oligomers comprising nucleotide analogs. In some embodiments, the nucleotide analog comprises a modified nucleobase such as 5-methylcytosine. In other embodiments, the nucleotide analog comprise a modified nucleobases such as 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine. In certain embodiments, the oligomers have a chemical structure as disclosed in
The term “LNA” refers to a bicyclic nucleoside analog, known as “Locked Nucleic Acid”. It can refer to an LNA monomer, or, when used in the context of an “LNA oligonucleotide,” LNA refers to an oligonucleotide containing one or more such bicyclic nucleotide analogs. LNA nucleotides are characterized by the presence of a linker group (such as a bridge) between C2′ and C4′ of the ribose sugar ring—for example as shown as the biradical R4*-R2* as described below.
In certain embodiments, the LNA used in the oligonucleotide compounds of the invention has the structure of the general formula V:
wherein for all chiral centers, asymmetric groups can be found in either R or S orientation;
wherein X is selected from —O—, —S—, —N(RN*)—, —C(R6R6*)-, such as, in some embodiments —O—;
B is selected from hydrogen, optionally substituted C1-4-alkoxy, optionally substituted C1-4-alkyl, optionally substituted C1-4-acyloxy, nucleobases including naturally occurring and nucleobase analogs, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands; in some embodiments, B is a nucleobase or nucleobase analog;
P designates an internucleotide linkage to an adjacent monomer, or a 5′-terminal group, such internucleotide linkage or 5′-terminal group optionally including the sub stituent R5 or equally applicable the substituent R5*;
P* designates an internucleotide linkage to an adjacent monomer, or a 3′-terminal group;
R4* and R2* together designate a bivalent linker group consisting of 1-4 groups/atoms selected from —C(RaRb)—, —C(Ra)═C(Rb)—, —C(Ra)═N—, —O—, —Si(Ra)2-, —S—, —SO2-, —N(Ra)—, and >C═Z, wherein Z is selected from —O—, —S—, and —N(Ra)—, and Ra and Rb each is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, optionally substituted C1-12-alkoxy, C2-12-alkoxyalkyl, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C 1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-al kylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl can be optionally substituted and where two geminal substituents Ra and Rb together can designate optionally substituted methylene (═CH2), wherein for all chiral centers, asymmetric groups can be found in either R or S orientation, and;
each of the substituents R1*, R2, R3, R5, R5*, R6 and R6*, which are present is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C1-12-alkoxy, C2-12-alkoxyalkyl, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, hetero-aryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl can be optionally substituted, and where two geminal substituents together can designate oxo, thioxo, imino, or optionally substituted methylene; wherein RN is selected from hydrogen and C1-4-alkyl, and where two adjacent (non-geminal) substituents can designate an additional bond resulting in a double bond; and RN*, when present and not involved in a biradical, is selected from hydrogen and C1-4-alkyl; and basic salts and acid addition salts thereof. For all chiral centers, asymmetric groups can be found in either R or S orientation.
In some embodiments, R4* and R2* together designate a biradical consisting of a groups selected from the group consisting of C(RaRb)—C(RaRb)—, C(RaRb)—O—, C(RaRb)—NRa—, C(RaRb)—S—, and C(RaRb)—C(RaRb)—O—, wherein each Ra and Rb can optionally be independently selected. In some embodiments, Ra and Rb can be, optionally independently selected from the group consisting of hydrogen and C1-6alkyl, such as methyl, such as hydrogen.
In some embodiments, R4* and R2* together designate the biradical —O—CH(CH2OCH3)— (2′O-methoxyethyl bicyclic nucleic acid—Seth at al., 2010, J. Org. Chem)—in either the R— or S— configuration. In some embodiments, R4* and R2* together designate the biradical —O—CH(CH2CH3)— (2′-ethyl bicyclic nucleic acid—Seth at al., 2010, J. Org. Chem).—in either the R— or S— configuration.
In some embodiments, R4* and R2* together designate the biradical —O—CH(CH3)—.—in either the R— or S— configuration. In some embodiments, R4* and R2* together designate the biradical —O—CH2—O—O—CH2—(Seth at al., 2010, J. Org. Chem).
In some embodiments, R4* and R2* together designate the biradical —O—NR—CH3—(Seth at al., 2010, J. Org. Chem).
In some embodiments, the LNA units have a structure selected from the following group:
in which the orientation of the CH3— substituent in the cEt LNA units can independently be R or S, and in which the orientation of the MeOCH2— substituent in the cMOE LNA units can independently be R or S, and in which the orientation of the CH3— substituent in the 5′-Me-LNA units can independently be R or S.
In some embodiments, R1*, R2, R3, R5, R5* are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6aminoalkyl. For all chiral centers, asymmetric groups can be found in either R or S orientation.
In some embodiments, R1*, R2, R3, R5, R5* are hydrogen.
In some embodiments, R1*, R2, R3 are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl. For all chiral centers, asymmetric groups can be found in either R or S orientation.
In some embodiments, R1*, R2, R3 are hydrogen.
In some embodiments, R5 and R5* are each independently selected from the group consisting of H, —CH3, —CH2—CH3, —CH2—O—CH3, and —CH=CH2. Suitably in some embodiments, either R5 or R5* are hydrogen, whereas the other group (R5 or R5* respectively) is selected from the group consisting of C1-5 alkyl, C2-6 alkenyl, C2-6 alkynyl, substituted C1-6 alkyl, substituted C2-6 alkenyl, substituted C2-6 alkynyl or substituted acyl (—C(═O)—); wherein each substituted group is mono or poly substituted with substituent groups independently selected from halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl, substituted C2-6 alkynyl, OJ1, SJ1, NJ1J2, N3, COOJ1, CN, O—C(═O)NJ1J2, N(H)C(═NH)NJ, J2 or N(H)C(═X)N(H)J2 wherein X is O or S; and each J1 and J2 is, independently, H, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl, substituted C2-6 alkynyl, C1-6 aminoalkyl, substituted C1-6 aminoalkyl or a protecting group. In some embodiments either R5 or R5* is substituted C1-6 alkyl. In some embodiments either R5 or R5* is substituted methylene wherein preferred substituent groups include one or more groups independently selected from F, NJ1J2, N3, CN, OJ1, SJ1, O—C(═O)NJ1J2, N(H)C(═NH)NJ, J2 or N(H)C(O)N(H)J2. In some embodiments each J1 and J2 is, independently H or C1-6 alkyl. In some embodiments either R5 or R5* is methyl, ethyl or methoxymethyl. In some embodiments either R5 or R5* is methyl. In a further embodiment either R5 or R5* is ethylenyl. In some embodiments either R5 or R5* is substituted acyl. In some embodiments either R5 or R5* is C(═O)NJ1J2. For all chiral centers, asymmetric groups can be found in either R or S orientation. Such 5′ modified bicyclic nucleotides are disclosed in WO 2007/134181, which is hereby incorporated by reference in its entirety.
In some embodiments B is a nucleobase, including nucleobase analogs and naturally occurring nucleobases, such as a purine or pyrimidine, or a substituted purine or substituted pyrimidine, such as a nucleobase referred to herein, such as a nucleobase selected from the group consisting of adenine, cytosine, thymine, adenine, uracil, and/or a modified or substituted nucleobase, such as 5-thiazolo-uracil, 2-thio-uracil, 5-propynyl-uracil, 2′thio-thymine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, and 2,6-diaminopurine.
In some embodiments, R4* and R2* together designate a biradical selected from —C(RaRb)—O—, —C(RaRb)—C(RcRd)—O—, —C(RaRb)—C(RcRd)—C(ReRf)—O—, —C(RaRb)—O—C(RcRd)—, —C(RaRb)—O—C(RcRd)—O—, —C(RaRb)—C(RcRd)—, —C(RaRb)—C(RcRd)—C(ReRf)—, —C(Ra)═C(Rb)—C(RcRd)—, —C(RaRb)—N(Rc)—, —C(RaRb)—C(RcRd)—N(Rc)—, —C(RaRb)—N(Rc)—O—, and —C(RaRb)—S—, —C(RaRb)—C(RcRd)—S—, wherein Ra, Rb, Rc, Rd, Re, and Rf each is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C1-12-alkoxy, C2-12-alkoxyalkyl, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl can be optionally substituted and where two geminal substituents Ra and Rb together can designate optionally substituted methylene (═CH2). For all chiral centers, asymmetric groups can be found in either R or S orientation.
In a further embodiment R4* and R2* together designate a biradical (bivalent group) selected from —CH2—O—, —CH2—S—, —CH2—NH—, —CH2-N(CH3)—, —CH2—CH2—O—, —CH2—CH(CH3)—, —CH2—CH2—S—, —CH2—CH2—NH—, —CH2—CH2—CH2—, —CH2—CH2—CH2—O—, —CH2—CH2—CH(CH3)—, —CH═CH—CH2—, —CH2—O—CH2—O—, —CH2—NH—O—, —CH2—N(CH3)—O—, —CH2—O—CH2—, —CH(CH3)—O—, and —CH(CH2—O—CH3)—O—, and/or, —CH2—CH2—, and —CH═CH— For all chiral centers, asymmetric groups can be found in either R or S orientation.
In some embodiments, R4* and R2* together designate the biradical C(RaRb)—N(Rc)—O—, wherein Ra and Rb are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl, such as hydrogen, and; wherein le is selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl, such as hydrogen.
In some embodiments, R4* and R2* together designate the biradical C(RaRb)—O—C(RcRd)—O—, wherein Ra, Rb, Rc, and Rd are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl, such as hydrogen.
In some embodiments, R4* and R2* form the biradical —CH(Z)—O—, wherein Z is selected from the group consisting of C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, substituted C1-6 alkyl, substituted C2-6 alkenyl, substituted C2-6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio; and wherein each of the substituted groups, is, independently, mono or poly substituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(═X)NJ1J2, NJ3C(═X)NJ1J2 and CN, wherein each J1, J2 and J3 is, independently, H or C1-6 alkyl, and X is O, S or NJ1. In some embodiments Z is C1-6 alkyl or substituted C1-6 alkyl. In some embodiments Z is methyl. In some embodiments Z is substituted C1-6 alkyl. In some embodiments the substituent group is C1-6 alkoxy. In some embodiments Z is CH3OCH2—. For all chiral centers, asymmetric groups can be found in either R or S orientation. Such bicyclic nucleotides are disclosed in U.S. Pat. No. 7,399,845 which is hereby incorporated by reference in its entirety. In some embodiments, R1*, R2, R3, R5, R5* are hydrogen. In some embodiments, R1*, R2, R3 * are hydrogen, and one or both of R5, R5* can be other than hydrogen as referred to above and in WO 2007/134181, which is incorporated by reference herein in its entirety.
In some embodiments, R4* and R2* together designate a biradical which comprise a substituted amino group in the bridge such as consist of or comprise the biradical —CH2—N(Rc)—, wherein Rc is C1-12 alkyloxy. In some embodiments R4* and R2* together designate a biradical —Cq3q4-NOR—, wherein q3 and q4 are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl; wherein each substituted group is, independently, mono or poly substituted with substituent groups independently selected from halogen, OJ1, SJ1, NJ1J2, COOJ1, CN, O—C(═O)NJ1J2, N(H)C(═NH)N J1J2 or N(H)C(═X═N(H)J2 wherein X is O or S; and each of J1 and J2 is, independently, H, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6 aminoalkyl or a protecting group. For all chiral centers, asymmetric groups can be found in either R or S orientation. Such bicyclic nucleotides are disclosed in WO2008/150729 which is hereby incorporated by reference in its entirety. In some embodiments, R1*, R2, R3, R5, R5* are independently selected from the group consisting of hydrogen, halogen, C1.6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl. In some embodiments, R1*, R2, R3, R5, R5* are hydrogen. In some embodiments, R1*, R2, R3 are hydrogen and one or both of R5, R5* can be other than hydrogen as referred to above and in WO 2007/134181. In some embodiments R4* and R2* together designate a biradical (bivalent group) C(RaRb)—O—, wherein Ra and Rb are each independently halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJ1 SJ1, SOJ1, SO2J1, NJ1J2, N3, CN, C(═O)OJ1, C(═O)NJ1J2, C(═O)J1, O—C(═O)NJ1J2, N(H)C(═NH)NJ1J2, N(H)C(═O)NJ1J2 or N(H)C(═S)NJ1J2; or Ra and Rb together are ═C(q3)(q4); q3 and q4 are each, independently, H, halogen, C1-C12alkyl or substituted C1-C12 alkyl; each substituted group is, independently, mono or poly substituted with substituent groups independently selected from halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, OJ1, SJ1, NJ1J2, N3, CN, C(═O)OJ1, C(═O)NJ1J2, C(═O)J1, O—C(═O)NJ1J2, N(H)C(═O)NJ1J2 or N(H)C(═S)NJ1J2 and; each J1 and J2 is, independently, H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, C1-C6 aminoalkyl, substituted C1-C6 aminoalkyl or a protecting group. Such compounds are disclosed in WO2009006478A, hereby incorporated in its entirety by reference.
In some embodiments, R4* and R2* form the biradical -Q-, wherein Q is C(q1)(q2)C(q3)(q4), C(q1)=C(q3), C[═C(q1)(q2)]-C(q3)(q4) or C(q1)(q2)-C[═C(q3)(q4)], q1, q2, q3, q4 are each independently. H, halogen, C1-12 alkyl, substituted C1-12 alkyl, C2-12 alkenyl, substituted C1-12 alkoxy, OJ1, SJ1, SO2J1, SO2J1, NJ1J2, N3, CN, C(═O)OJ1, C(═O)—NJ1J2, C(⊚O) J1, —C(═O)NJ1J2, N(H)C(═NH)NJ1J2, N(H)C(═O)NJ1J2 or N(H)C(═S)NJ1J2; each J1 and J2 is, independently, H, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6 aminoalkyl or a protecting group; and, optionally wherein when Q is C(q1)(q2)(q3)(q4) and one of q3 or q4 is CH3 then at least one of the other of q3 or q4 or one of q1 and q2 is other than H. In some embodiments, R1*, R2, R3, R5, R5* are hydrogen. For all chiral centers, asymmetric groups can be found in either R or S orientation. Such bicyclic nucleotides are disclosed in WO2008/154401 which is hereby incorporated by reference in its entirety. In some embodiments, R1*, R2, R3, R5, R5* are independently selected from the group consisting of hydrogen, halogen, C1-6 alkyl, substituted C1-6 alkyl, C2-6 alkenyl, substituted C2-6 alkenyl, C2-6 alkynyl or substituted C2-6 alkynyl, C1-6 alkoxyl, substituted C1-6 alkoxyl, acyl, substituted acyl, C1-6 aminoalkyl or substituted C1-6 aminoalkyl. In some embodiments, R1*, R2, R3, R5, R5* are hydrogen. In some embodiments, R1*, R2, R3 are hydrogen and one or both of R5, R5* can be other than hydrogen as referred to above and in WO 2007/134181 or WO2009/067647 (alpha-L-bicyclic nucleic acids analogs).
Further bicyclic nucleoside analogs and their use in antisense oligonucleotides are disclosed in WO2011/115818, WO2011/085102, WO2011/017521, WO09/100320, WO10/036698, WO09/124295 & WO09/006478, each of which are incorporated by reference herein in their entireties. Such nucleoside analogs can in some aspects be useful in the compounds of present invention.
In some embodiments the LNA used in the oligonucleotide compounds of the invention has the structure of the general formula VI:
wherein Y is selected from the group consisting of —O—, —CH2O—, —S—, —NH—, N(Re) and/or —CH2—; Z and Z* are independently selected among an internucleotide linkage, RH, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety (nucleobase), and RH is selected from hydrogen and C1-4-alkyl; Ra, Rb Rc, Rd and Re are, optionally independently, selected from the group consisting of hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C1-12-alkoxy, C2-12-alkoxyalkyl, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl can be optionally substituted and where two geminal substituents Ra and Rb together can designate optionally substituted methylene (═CH2); and RH is selected from hydrogen and C1-4-alkyl. In some embodiments Ra, Rb Re, Rd and Re are, optionally independently, selected from the group consisting of hydrogen and C1-6 alkyl, such as methyl. For all chiral centers, asymmetric groups can be found in either R or S orientation, for example, two exemplary stereochemical isomers include the beta-D and alpha-L isoforms, which can be illustrated as follows:
Specific exemplary LNA units are shown below:
In other embodiments, the oligomers of the invention comprise nucleotides with modified sugar moieties as described in
It is recognized that an oligomeric compound can function via non RNase mediated degradation of target mRNA, such as by steric hindrance of translation, or other methods, however, in one aspect, the oligomers of the invention are capable of recruiting an endoribonuclease (RNase), such as RNaseH.
In one aspect, the oligomer, or contiguous nucleotide sequence, comprises a region of at least 7 consecutive nucleotide units, such as at least 8 or at least 9 consecutive nucleotide units (residues), in certain embodiments including 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides, which, when formed in a duplex with the complementary target RNA is capable of recruiting RNase. The contiguous sequence which is capable of recruiting RNase can be region B as referred to in the context of a gapmer as described herein. In some embodiments the size of the contiguous sequence which is capable of recruiting RNase, such as region B, can be higher, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide units.
U.S. Pat. No. 6,617,442, which is incorporated by reference herein in its entirety, provides in vitro methods for determining RNaseH activity, which can be used to determine the ability to recruit RNaseH. Therefore, in one embodiment, an oligomer of the invention is capable of recruiting RNaseH. In another embodiment, the invention includes a method of identifying an oligomer which is capable of utilizing RNaseH mechanism, e.g., recruiting RNaseH.
Oligomers can be screened to identify those which are effective in recruiting RNaseH. The ability of oligomers to recruit RNaseH can be determined by measuring the binding of the oligomers to RNaseH. The methods of determining binding of the oligomers to RNaseH are well known in the art. For example, the oligomers can be radiolabeled and binding of the oligomers to RNaseH can be detected by autoradiography. In some embodiments, fusion proteins of RNaseH with glutathione-S-transferase or small peptide tags can be prepared and immobilized to a solid phase such as beads. Labeled or unlabeled oligomers to be screened for binding to this enzyme can then be incubated with the solid phase. Oligomers which bind to the enzyme immobilized to the solid phase can then be identified either by detection of bound label or by eluting specifically the bound oligomers from the solid phase. Another method involves screening of oligomer libraries for binding partners. Recombinant tagged or labeled RNaseH is used to select oligomers from the library which interact with the enzyme. Sequencing of the oligomers leads to identification of those oligomers which will be more effective as antisense molecules.
An oligomer is deemed capable of recruiting RNaseH if, when provided with the complementary RNA target, it has an initial rate, as measured in pmol/l/min, of at least 1% , such as at least 5%, such as at least 10% or ,more than 20% of the of the initial rate determined using DNA only oligonucleotide, having the same base sequence but containing only DNA monomers, with no 2′ substitutions, with phosphorothioate linkage groups between all monomers in the oligonucleotide—using the methodology provided by Example 91-95 of U.S. Pat. No. 6,617,442.
In some embodiments, an oligomer is deemed essentially incapable of recruiting
RNaseH if, when provided with the complementary RNA target, and RNaseH, the RNaseH initial rate, as measured in pmol/l/min, is less than 1%, such as less than 5%,such as less than 10% or less than 20% of the initial rate determined using the equivalent DNA only oligonucleotide, with no 2′ substitutions, with phosphorothioate linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of U.S. Pat. No. 6,617,442.
In other embodiments, an oligomer is deemed capable of recruiting RNaseH if, when provided with the complementary RNA target, and RNaseH, the RNaseH initial rate, as measured in pmol/l/min, is at least 20%, such as at least 40%, such as at least 60%, such as at least 80% of the initial rate determined using the equivalent DNA only oligonucleotide, with no 2′ substitutions, with phosphorothioate linkage groups between all nucleotides in the oligonucleotide, using the methodology provided by Example 91-95 of U.S. Pat. No. 6,617,442.
Typically the region of the oligomer which forms the consecutive nucleotide units which, when formed in a duplex with the complementary target RNA is capable of recruiting RNase consists of nucleotide units which form a DNA/RNA like duplex with the RNA target—and include both DNA units and LNA units which are in the alpha-L configuration, particularly preferred being alpha-L-oxy LNA.
In some embodiments, the monomers which are capable of recruiting RNase are selected from the group consisting of DNA monomers, alpha-L-LNA monomers, C4′ alkylayted DNA monomers (see PCT/EP2009/050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300, hereby incorporated by reference in its entirety), and UNA (unlinked nucleic acid) nucleotides (see Fluiter et al., Mol. Biosyst., 2009, 10, 1039, hereby incorporated by reference). UNA is unlocked nucleic acid, typically where the C2-C3 C—C bond of the ribose has been removed, forming an unlocked “sugar” residue.
The oligomer of the invention can comprise a nucleotide sequence which comprises both nucleotides and nucleotide analogs, and can be in the form of a gapmer, blockmer, mixmer, headmer, tailmer, or totalmer. Examples of configurations of a gapmer, blockmer, mixmer, headmer, tailmer, or totalmer that can be used with the oligomer of the invention are described in U.S. Patent Appl. Publ. No. 2012/0322851, which is incorporated by reference herein in its entirety.
A gapmer oligomer is an oligomer which comprises a contiguous stretch of nucleotides which is capable of recruiting an RNase, such as RNaseH, such as a region of at least 7 DNA nucleotides, which is flanked both 5′ and 3′ by regions of affinity enhancing 1-6 nucleotide analogs 5′ and 3′ to the contiguous stretch of nucleotides which is capable of recruiting RNase.
A “headmer” is defined as an oligomer that comprises a region X and a region Y that is contiguous thereto, with the 5′-most monomer of region Y linked to the 3′-most monomer of region X. Region X comprises a contiguous stretch of non-RNase recruiting nucleoside analogs and region Y comprises a contiguous stretch (such as at least 7 contiguous monomers) of DNA monomers or nucleoside analog monomers recognizable and cleavable by the RNase.
A “tailmer” is defined as an oligomer that comprises a region X and a region Y that is contiguous thereto, with the 5′-most monomer of region Y linked to the 3′-most monomer of the region X. Region X comprises a contiguous stretch (such as at least 7 contiguous monomers) of DNA monomers or nucleoside analog monomers recognizable and cleavable by the RNase, and region X comprises a contiguous stretch of non-RNase recruiting nucleoside analogs.
Other “chimeric” oligomers, called “mixmers”, consist of an alternating composition of (i) DNA monomers or nucleoside analog monomers recognizable and cleavable by RNase, and (ii) non-RNase recruiting nucleoside analog monomers.
A “totalmer” is a single stranded oligomer which only comprises non-naturally occurring nucleotides or nucleotide analogs.
In some embodiments, in addition to enhancing affinity of the oligomer for the target region, some nucleoside analogs also mediate RNase (e.g., RNaseH) binding and cleavage. Since a-L-LNA monomers recruit RNaseH activity to a certain extent, in some embodiments, gap regions (e.g., region B as referred to herein) of oligomers containing α-L-LNA monomers consist of fewer monomers recognizable and cleavable by the RNaseH, and more flexibility in the mixmer construction is introduced.
In one embodiment, the oligomer of the invention is a gapmer. A gapmer oligomer is an oligomer which comprises a contiguous stretch of nucleotides which is capable of recruiting an RNase, such as RNaseH, such as a region of at least 7 DNA nucleotides, referred to herein in as region B (B), wherein region B is flanked both 5′ and 3′ by regions of affinity enhancing nucleotide analogs, such as from 1-10 nucleotide analogs 5′ and 3′ to the contiguous stretch of nucleotides which is capable of recruiting RNase—these regions are referred to as regions A (A) and C (C) respectively.
In certain embodiments, the gapmer is an alternating flank gapmer, examples of which are discussed below. In certain embodiments, the alternating flank gapmer exhibits less off target binding than a traditional gapmer. In certain embodiments, the alternating flank gapmer has better long term tolerability than a traditional gapmer.
An alternating flank gapmer can comprises a (poly)nucleotide sequence of formula (5′ to 3′), A-B-C, wherein: region A (A) (5′ region or a first wing sequence) comprises at least one nucleotide analog, such as at least one LNA unit, such as from 1-10 nucleotide analogs, such as LNA units, and; region B (B) comprises at least seven consecutive nucleotides which are capable of recruiting RNase (when formed in a duplex with a complementary RNA molecule, such as the pre-mRNA or mRNA target), such as DNA nucleotides, and; region C (C) (3′region or a second wing sequence) comprises at least one nucleotide analog, such as at least one LNA unit, such as from 1-10 nucleotide analogs, such as LNA units; wherein regions A and C can include at any position in A and C 1-2 insertions of DNA nucleotide regions (e.g., DNA gapmers), in which these DNA insertions can each be 1-3 DNA units long.
In certain other embodiments, the gapmer, e.g., an alternating flank gapmer, comprises a (poly)nucleotide sequence of formula (5′ to 3′), A-B-C, or optionally A-B-C-D or D-A-B-C, wherein: region A (A) (5′ region) comprises at least one nucleotide analog, such as at least one LNA unit, such as from 1-10 nucleotide analogs, such as LNA units, and; region B (B) comprises at least seven consecutive nucleotides which are capable of recruiting RNase (when formed in a duplex with a complementary RNA molecule, such as the mRNA target), such as DNA nucleotides, and; region C (C) (3′region) comprises at least one nucleotide analog, such as at least one LNA unit, such as from 1-10 nucleotide analogs, such as LNA units, and; region D (D), when present comprises 1, 2 or 3 nucleotide units, such as DNA nucleotides.
In some embodiments, region A comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide analogs, such as LNA units, such as from 2-5 nucleotide analogs, such as 2-5 LNA units, such as 2-5 nucleotide analogs, such as 3-5 LNA units; and/or region C consists of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide analogs, such as LNA units, such as from 2-5 nucleotide analogs, such as 2-5 LNA units, such as 2-5 nucleotide analogs, such as 3-5 LNA units.
In some embodiments B comprises 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 consecutive nucleotides which are capable of recruiting RNase, or from 8-14, or from 7-10, or from 7-9, such as 8, such as 9, such as 10, or such as 14 consecutive nucleotides which are capable of recruiting RNase. In some embodiments region B comprises at least seven DNA nucleotide unit, such as 7-23 DNA units, such as from 7-20 DNA units, such as from 7-14 DNA units, such as from 8-14 DNA units, such as 7, 8, 9, 10, 11, 12, 13, or 14 DNA units.
In some embodiments region A comprises 3, 4, or 5 nucleotide analogs, such as
LNA, region B consists of 7, 8, 9, 10, 11, 12, 13, or 14 DNA units, and region C consists of 3, 4, or 5 nucleotide analogs, such as LNA. Such designs include (A-B-C) 5-10-5, 3-14-3, 3-10-3, 3-10-4, 4-10-3, 3-9-3, 3-9-4, 4-9-3, 3-8-3, 3-8-4, 4-8-3, 3-7-3, 3-7-4, and 4-7-3, and can further include region D, which can have one to 3 nucleotide units, such as DNA units.
In some embodiments, the oligomer of the invention, e.g., an alternating flank gapmer, has the formula of 5′-A-B-C-3′, wherein
In other embodiments, the oligomer, e.g., an alternating flank gapmer, has the formula of 5′-A-B-C-3′, wherein B is a contiguous sequence of 7 to 23 DNA units, A is LmDnLoDpLq and C is Lm′Dn′Lo′Dp′Lq′ and wherein L is a nucleotide analog; D is a DNA unit; m and q′ are 1 to 6 units; n, p, n′, and p′ are 0 to 2 units; and o, q, m′, and o′ are 0 to 5.
In some embodiments, the first wing sequence (A in the formula) comprises a combination of nucleotide analogs and DNA units selected from (i) 1-9 nucleotide analogs and 1 DNA unit; (ii) 1-8 nucleotide analogs and 1-2 DNA units; (iii) 1-7 nucleotide analogs and 1-3 DNA units; (iv) 1-6 nucleotide analogs and 1-4 DNA units; (v) 1-5 nucleotide analogs and 1-5 DNA units; (vi) 1-4 nucleotide analogs and 1-6 DNA units; (vii) 1-3 nucleotide analogs and 1-7 DNA units; (viii) 1-2 nucleotide analogs and 1-8 DNA units; and (ix) 1 nucleotide analog and 1-9 DNA units.
In certain embodiments, the second wing sequence (C in the formula) comprises a combination of nucleotide analogs and DNA unit selected from (i) 1-9 nucleotide analogs and 1 DNA unit; (ii) 1-8 nucleotide analogs and 1-2 DNA units; (iii) 1-7 nucleotide analogs and 1-3 DNA units; (iv) 1-6 nucleotide analogs and 1-4 DNA units; (v) 1-5 nucleotide analogs and 1-5 DNA units; (vi) 1-4 nucleotide analogs and 1-6 DNA units; (vii) 1-3 nucleotide analogs and 1-7 DNA units; (viii) 1-2 nucleotide analogs and 1-8 DNA units; and (ix) 1 nucleotide analog and 1-9 DNA units.
In some embodiments, A in the oligomer formula has a sub-formula selected from L, LL, LDL, LLL, LLDL, LDLL, LDDL, LLLL, LLLLL, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDDDL, LLLLLL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD, and C in the oligomer formula has a sub-formula selected from L, LL, LDL, LLL, LLDL, LLLL, LDLL, LDDL, LLDD, LLLLL, LLLLD, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDDDL, LLLLLL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD.
In certain embodiments, the oligomer, e.g., an alternating flank gapmer, has the formula of 5′ A-B-C 3′, wherein B is a contiguous sequence of 7 to 23 DNA units, A has a formula of LLDLL, LDLLL, or LLLDL and C has the formula of LLDLL or LDLDLL, and wherein L is an LNA unit and D is a DNA unit.
In other embodiments, the oligomers of the invention are alternating flank gapmers having the formula of 5′ A-B-C 3′, wherein the oligomer has 12 to 25 nucleotides in length, A is a first wing sequence having the formula of LmdnLodpLq, C is a second wing sequence having the formula of Lq'dp'Lo'dn'Lm, wherein each wing independently has 1-17 nucleotides in length and is optionally interrupted by DNA spacers dn, dp, dn′and dp, each of which independently has 0 to 3 DNA units, with each wing flanking an all DNA gap of 7 to 23 nucleotides;
wherein m and m′ are at least 1;
and n, n′, p and p′ are independently 0-3 units;
such that m+n+o+p +q=1-17; and independently m′+n′+o′+p′+q′=1-17;
or (m+n+o+p+q) and (m′+n′+o′+p′+q′) are independently 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17;
or B comprises a DNA gap of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23.
Further gapmer designs are disclosed in WO2004/046160, which is hereby incorporated by reference in its entirety. WO2008/113832 hereby incorporated by reference in its entirety, refers to ‘shortmer’ gapmer oligomers. In some embodiments, oligomers presented herein can be such shortmer gapmers.
In some embodiments the oligomer, e.g., an alternating flank gapmer, comprises a contiguous nucleotide sequence of a total of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide units, wherein the contiguous nucleotide sequence is of formula (5′-3′), A-B-C, or optionally A-B-C-D or D-A-B-C, wherein; A consists of 1, 2, 3, 4, or 5 nucleotide analog units, such as LNA units; B consists of 7, 8, 9, 10, 11, 12, 13, or 14 contiguous nucleotide units which are capable of recruiting RNase when formed in a duplex with a complementary RNA molecule (such as a mRNA target); and C consists of 1, 2,3, 4, or 5 nucleotide analog units, such as LNA units. When present, D consists of a single DNA unit.
In some embodiments A comprises 1 LNA unit. In some embodiments A comprises 2 LNA units. In some embodiments A comprises 3 LNA units. In some embodiments A comprises 4 LNA units. In some embodiments A comprises 5 LNA units. In some embodiments C comprises 1 LNA unit. In some embodiments C comprises 2 LNA units. In some embodiments C comprises 3 LNA units. In some embodiments C comprises 4 LNA units. In some embodiments C comprises 5 LNA units. In some embodiments B comprises 7 nucleotide units. In some embodiments B comprises 8 nucleotide units. In some embodiments B comprises 9 nucleotide units. In certain embodiments, B comprises 10 nucleoside units. In certain embodiments, B comprises 11 nucleoside units. In certain embodiments, B comprises 12 nucleoside units. In certain embodiments, B comprises 13 nucleoside units. In certain embodiments, B comprises 14 nucleoside units. In certain embodiments, B comprises 7-23 DNA monomers. In some embodiments B comprises from 7-23 DNA units, such as 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 DNA units. In some embodiments B consists of DNA units. In some embodiments B comprises at least one LNA unit which is in the alpha-L configuration, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 LNA units in the alpha-L-configuration. In some embodiments B comprises at least one alpha-L-oxy LNA unit or wherein all the LNA units in the alpha-L-configuration are alpha-L-oxy LNA units. In some embodiments the number of nucleotides present in A-B-C are selected from (nucleotide analog units—region B-nucleotide analog units): 1-8-1, 1-8-2, 2-8-1, 2-8-2, 3-8-3, 2-8-3, 3-8-2, 4-8-1, 4-8-2, 1-8-4, 2-8-4, or;1-9-1, 1-9-2, 2-9-1, 2-9-2, 2-9-3, 3-9-2, 1-9-3, 3-9-1, 4-9-1, 1-9-4, or; 1-10-1, 1-10-2, 2-10-1, 2-10-2, 1-10-3, and 3-10-1. In some embodiments the number of nucleotides in A-B-C is selected from: 2-7-1, 1-7-2, 2-7-2, 3-7-3, 2-7-3, 3-7-2, 3-7-4, and 4-7-3. In other embodiments, the oligomer contains 10 DNA units in B, LDLLL in A (first wing) and LLDLL in C (second wing). In yet other embodiments, the oligomer contains 9 DNA units in B, LDDLL in A, and LDLDLL in C. In still other embodiments, the oligomer contains 10 DNA units in B, LLDLL in A, and LLDLL in C. In further embodiments, the oligomer contains 9 DNA units in B, LLLLL in A, and LDDLL in C. In certain embodiments, each of regions A and C comprises three LNA monomers, and region B consists of 7, 8, 9, 10, 11, 12, 13, or 14 nucleoside monomers, for example, DNA monomers. In some embodiments both A and C consist of two LNA units each, and B consists of 7, 8, or 9 nucleotide units, for example DNA units. In various embodiments, other gapmer designs include those where regions A and/or C consists of 3, 4, 5 or 6 nucleoside analogs, such as monomers containing a 2′-O-methoxyethyl-ribose sugar (2′-MOE) or monomers containing a 2′-fluoro-deoxyribose sugar, and region B consists of 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleosides, such as DNA monomers, where regions A-B-C have 3-8-3, 3-9-3, 3-10-3, 5-10-5 or 4-12-4 monomers. Further gapmer designs are disclosed in WO 2007/146511A2, hereby incorporated by reference in its entirety.
In some embodiments, the alternating flank oligomer has at least 10 contiguous nucleotides, comprising region A, region B, and region C (A-B-C), wherein region B comprises at least 5 consecutive nucleoside units and is flanked at 5′ by region A of 1-8 contiguous nucleoside units and at 3′ by region C of 1-8 contiguous nucleoside units, wherein region B, when formed in a duplex with a complementary RNA, is capable of recruiting RNaseH, and wherein region A and region C are selected from the group consisting of: (i) region A comprises a 5′ LNA nucleoside unit and a 3′ LNA nucleoside unit, and at least one DNA nucleoside unit between the 5′ LNA nucleoside unit and the 3′ LNA nucleoside unit, and, region C comprises at least two 3′ LNA nucleosides; or (ii) region A comprises at least one 5′ LNA nucleoside and region C comprises a 5′ LNA nucleoside unit, at least two terminal 3′ LNA nucleoside units, and at least one DNA nucleoside unit between the 5′ LNA nucleoside unit and the 3′ LNA nucleoside units, and (iii) region A comprises a 5′ LNA nucleoside unit and a 3′ LNA nucleoside unit, and at least one DNA nucleoside unit between the 5′ LNA nucleoside unit and the 3′ LNA nucleoside unit; and region C comprises a 5′ LNA nucleoside unit, at least two terminal 3′ LNA nucleoside units, and at least one DNA nucleoside unit between the 5′ LNA nucleoside unit and the 3′ LNA nucleoside units.
In some embodiments, region A or region C comprises 1, 2, or 3 DNA nucleoside units. In other embodiments, region A and region C comprise 1, 2, or 3 DNA nucleoside units. In yet other embodiments, region B comprises at least five consecutive DNA nucleoside units. In certain embodiments, region B comprises 6, 7, 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleoside units. In some embodiments, region B is 8, 9 10, 11, or 12 nucleotides in length. In other embodiments, region A comprises two 5′ terminal LNA nucleoside units. In some embodiments, region A has formula 5′[LNA]1-3[DNA]1-3[LNA]1-3, or 5′[LNA]1-2[DNA]1-2[LNA]1-2[DNA]1-2[LNA]1-2. In other embodiments, region C has formula [LNA]1-3[DNA]1-3[LNA]2-33′, or [LNA]1-2[DNA]1-2[LNA]1-2[DNA]1-2[LNA]2-33′ In yet other embodiments, region A has formula 5′[LNA]1-3[DNA]1-3[LNA]1-3, or 5′[LNA]1-2[DNA]2[LNA]1-2[DNA]1-2[LNA]1-2, and region C comprises 2, 3, 4 or 5 consecutive LNA nucleoside units. In some embodiments, region C has formula [LNA]1-3[DNA]1-3[LNA]2-33′ or [LNA]1-2[DNA]1-2[LNA]1-2[DNA]1-2[LNA]2-33′, and region A comprises 1, 2, 3, 4 or 5 consecutive LNA nucleoside units. In still other embodiments, region A has a sequence of LNA and DNA nucleosides, 5′-3′ selected from the group consisting of L, LL, LDL, LLL, LLDL, LDLL, LDDL, LLLL, LLLLL, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDDDL, LLLLLL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD, wherein L represents a LNA nucleoside, and D represents a DNA nucleoside. In yet other embodiments, region C has a sequence of LNA and DNA nucleosides, 5′-3′ selected from the group consisting of LL, LLL, LLLL, LDLL, LLLLL, LLDLL, LDLLL, LDDLL, LDDLLL, LLDDLL, LDLDLL, LDDDLL, LDLDDLL, LDDLDLL, LDDDLLL, and LLDLDLL. In a further embodiment, region A has a sequence of LNA and DNA nucleosides, 5′-3′ selected from the group consisting of LDL, LLDL, LDLL, LDDL, LLLDL, LLDLL, LDLLL, LLDDL, LDDLL, LLDLD, LDLLD, LDDDL, LLLLDL, LLLDLL, LLDLLL, LDLLLL, LLLDDL, LLDLDL, LLDDLL, LDDLLL, LDLLDL, LDLDLL, LDDDLL, LLDDDL, and LDLDLD, and region C has a sequence of LNA and DNA nucleosides, 5′-3′ selected from the group consisting of LDLL, LLLLL, LLDLL, LDLLL, LDDLL, LDDLLL, LLDDLL, LDLDLL, LDDDLL, LDLDDLL, LDDLDLL, LDDDLLL, and LLDLDLL.
In certain embodiments, the alternating flank oligomer has contiguous nucleotides comprising a sequence of nucleosides, 5′-3′, selected from the group consisting of LLDDDLLDDDDDDDDLL, LDLLDLDDDDDDDDDLL, LLLDDDDDDDDDDLDLL, LLLDDDDDDDDDLDDLL, LLLDDDDDDDDLDDDLL, LLLDDDDDDDDLDLDLL, LLLDLDDDDDDDDDLLL, LLLDLDDDDDDDDLDLL, LLLLDDDDDDDDDLDLL, LLLLDDDDDDDDLDDLL, LLLDDDLDDDDDDDDLL, LLLDDLDDDDDDDDDLL, LLLDDLLDDDDDDDDLL, LLLDDLLDDDDDDDLLL, LLLLLDDDDDDDLDDLL, LDLLLDDDDDDDDDDLL, LDLLLDDDDDDDLDDLL, LDLLLLDDDDDDDDDLL, LLDLLLDDDDDDDDDLL, LLLDLDDDDDDDDDDLL, LLLDLDDDDDDDLDDLL, LLLDLLDDDDDDDDDLL, LLLLDDDDDDDLDDDLL, LLLLLDDDDDDDDDLDLL, LLLLDDDDDDDDDDLDLL, LLLDDDDDDDDDDDLDLL, LLDLDDDDDDDDDDLDLL, LDLLLDDDDDDDDDLDLL, LLLDDDDDDDDDDLDDLL, LLLDDDDDDDDDLDDDLL, LLLDDDDDDDDLDLDDLL, LLLLDDDDDDDDDLDDLL, LLLLDDDDDDDDDLDLLL, LLLLDDDDDDDDLDDDLL, LLLLDDDDDDDDLDDLLL, LLLLDDDDDDDDLDLDLL, LLLLDDDDDDDLDDLDLL, LLLLDDDDDDDLDLDDLL, LLDLLDDDDDDDDDDDLL, LLDLLLDDDDDDDDLDLL, LLLDLDDDDDDDDDDDLL, LLLDLDDDDDDDDDLDLL, LLLDLDDDDDDDDLDDLL, LLLDLDDDDDDDLDLDLL, LLLLDDDDDDDDDLLDLL, LLLLLDDDDDDDDDLDLLL, LLLLLDDDDDDDDDLDDLL,
LLLLDDDDDDDDDDLLDLL, LLLLDDDDDDDDDDLDLLL, LLLLDDDDDDDDDDLDDLL, LLLDDDDDDDDDDDLLDLL, LLLDDDDDDDDDDDLDLLL, LLLLLDDDDDDDDDLLDLL, LLLDDDDDDDDDDDLDDLL, LLDLLDDDDDDDDDLDDLL, LLLDLDDDDDDDDDDLDLL, LLLDLDDDDDDDDDLDDLL, LLLLDDDDDDDDDLDLDLL, LLLLDDDDDDDDLLDLDLL, LDLLLDDDDDDDDDDLLDLL, LLDLLDDDDDDDDDDLLDLL, LLDLDDDDDDDDDDDDLLLL, LLDDLDDDDDDDDDDDLLLL, LLLDLDDDDDDDDDDDLLLL, LLDLDDDDDDDDDDDDDLLL, LLDLLDDDDDDDDDDDLLLL, LLDDLDDDDDDDDDDDDLLL, LLLDDDDDDDDDDDLDDLLL, LLLDLDDDDDDDDDDDDLLL, LLDLLDDDDDDDDDDDDLLL, LLLLDDDDDDDDDDDLLDLL, LLLLDDDDDDDDDDLLDDLL, LLLDDLDDDDDDDDDLDLLL, LLDDLDLDDDDDDDDDLLLL, LLDDLLDDDDDDDDDLDLLL, LLLDLDDDDDDDDDLDLDLL, LLDLLDDDDDDDDDLDDLLL, LLLDLDDDDDDDDDDLDLLL, LLDLDDLDDDDDDDDDLLLL, LLLLDDDDDDDDDLDLDDLL, LLLDLDDDDDDDDDLDDLLL, LLDLDLDDDDDDDDDDLLLL, LLDLLDDDDDDDDDDLDLLL, LLDLDLDDDDDDDDDLLDLL, LLDDLLDDDDDDDDDLLDLL, LLLLDDDDDDDDDLDDLDLL, LLLDDLDDDDDDDDDLLDLL, LLDLLDDDDDDDDDLLDDLL, LLDLDLDDDDDDDDDLDLLL, LLLDLDDDDDDDDDLLDDLL, LLDDLLDDDDDDDDDDLLLL, LLDLLDDDDDDDDDLDLDLL, LLLLDDDDDDDDDDLDDLLL, LLLDDLDDDDDDDDDDLLLL, LLLDLDDDDDDDDDDLLDLL, LLLLDDDDDDDDDDLDLDLL, LLLLDDDDDDDDDDDLDLLL, and LLDDLLDDDDDDDDDDLDLL; wherein L represents a LNA nucleoside, and D represents a DNA nucleoside. In other embodiments, the LNA nucleoside is beta-D-oxy LNA.
In yet other embodiments, an alternating flank oligomer has contiguous nucleotides comprising an alternating sequence of LNA and DNA nucleoside units, 5′-3′, selected from the group consisting of: 2-3-2-8-2, 1-1-2-1-1-9-2, 3-10-1-1-2, 3-9-1-2-2, 3-8-1-3-2, 3-8-1-1-1-1-2, 3-1-1-9-3, 3-1-1-8-1-1-2, 4-9-1-1-2, 4-8-1-2- 2, 3-3-1-8-2, 3-2-1-9-2, 3-2-2-8-2, 3-2-2-7-3, 5-7-1-2-2, 1-1-3-10-2, 1-1-3-7-1-2-2, 1-1-4-9-2, 2-1-3-9-2, 3-1-1-10-2, 3-1-1-7-1-2-2, 3-1-2-9-2, 4-7-1-3-2, 5-9-1-1-2, 4-10-1-1-2, 3-11-1-1-2, 2-1-1-10-1-1-2, 1-1-3-9-1-1-2, 3-10-1-2-2, 3-9-1-3-2, 3-8-1-1-1-2-2, 4-9-1-2-2, 4-9-1-1-3, 4-8-1-3-2, 4-8-1-2-3, 4-8-1-1-1-1-2, 4-7-1-2-1-1-2, 4-7-1-1-1-2-2, 2-1-2-11-2, 2-1-3-8-1-1-2, 3-1-1-11-2, 3-1-1-9-1-1-2, 3-1-1-8-1-2-2, 3-1-1-7-1-1-1-1-2, 4-9-2-1-2, 4- 7-1-3-3, 5-9-1-1-3, 5-9-1-2-2, 4-10-2-1-2, 4-10-1-1-3, 4-10-1-2-2, 3-11-2-1-2, 3-11-1-1-3, 5-9- 2-1-2, 3-11-1-2-2, 2-1-2-9-1-2-2, 3-1-1-10-1-1-2, 3-1-1-9-1-2-2, 4-9-1-1-1-1-2, 4-8- 2-1-1-1-2, 1-1-3-10-2-1-2, 2-1-2-10-2-1-2, 2-1-1-12-4, 2-2-1-11-4, 3-1-1-11-4, 2-1-1-13-3, 2- 1-2-11-4, 2-2-1-12-3, 3-11-1-2-3, 3-1-1-12-3, 2-1-2-12-3, 4-11-2-1-2, 4-10-2-2-2, 3-2-1- 9-1-1-3, 2-2-1-1-1-9-4, 2-2-2-9-1-1-3, 3-1-1-9-1-1-1-1-2, 2-1-2-9-1-2-3, 3-1-1-10-1-1-3, 2-1-1-2-1-9-4, 4-9-1-1-1-2-2, 3-1-1-9-1-2-3, 2-1-1-1-1-10-4, 2-1-2-10-1-1-3, 2-1-1-1-1-9-2-1-2, 2-2-2-9-2-1-2, 4-9-1-2-1-1-2, 3-2-1-9-2-1-2, 2-1-2-9-2-2-2, 2-1-1-1-1-9-1-1-3, 3-1-1-9-2-2-2, 2-2-2-10-4, 2-1-2-9-1-1-1-1-2, 4-10-1-2-3, 3-2-1-10-4, 3-1-1-10-2-1-2, 4-10-1-1-1-1-2, 4-11-1-1-3, and 2-2-2-10-1-1-2; wherein the first numeral represents an number of LNA units, the next a number of DNA units, and alternating LNA and DNA regions thereafter.
In other embodiments, the oligomers of the invention has the design described in
The monomers of the oligomers described herein are coupled together via linkage groups.
Suitably, each monomer is linked to the 3′ adjacent monomer via a linkage group.
The person having ordinary skill in the art would understand that, in the context of the present invention, the 5′ monomer at the end of an oligomer does not comprise a 5′ linkage group, although it may or may not comprise a 5′ terminal group.
The terms “linkage group” or “internucleotide linkage” are intended to mean a group capable of covalently coupling together two nucleotides. Specific and preferred examples include phosphate groups and phosphorothioate groups.
The nucleotides of the oligomer of the invention or contiguous nucleotides sequence thereof are coupled together via linkage groups. Suitably each nucleotide is linked to the 3′ adjacent nucleotide via a linkage group.
Suitable internucleotide linkages include those listed within WO2007/031091, for example the internucleotide linkages listed on the first paragraph of page 34 of WO2007/031091 (hereby incorporated by reference in its entirety).
Examples of suitable internucleotide linkages that can be used with the invention include phosphodiester linkage, a phosphotriester linkage, a methylphosphonate linkage, a phosphoramidate linkage, a phosphorothioate linkage, and combinations thereof.
It is, in some embodiments, preferred to modify the internucleotide linkage from its normal phosphodiester to one that is more resistant to nuclease attack, such as phosphorothioate or boranophosphate—these two, being cleavable by RNaseH, also allow that route of antisense inhibition in reducing the expression of the target gene.
Suitable sulphur (S) containing internucleotide linkages as provided herein may be preferred. Phosphorothioate internucleotide linkages are also preferred, particularly for the gap region (B) of gapmers. Phosphorothioate linkages can also be used for the flanking regions (A and C, and for linking A or C to D, and within region D, as appropriate).
Regions A, B and C, can, however, comprise internucleotide linkages other than phosphorothioate, such as phosphodiester linkages, particularly, for instance when the use of nucleotide analogs protects the internucleotide linkages within regions A and C from endo-nuclease degradation—such as when regions A and C comprise LNA nucleotides.
The internucleotide linkages in the oligomer can be phosphodiester, phosphorothioate or boranophosphate so as to allow RNaseH cleavage of targeted RNA. Phosphorothioate is preferred, for improved nuclease resistance and other reasons, such as ease of manufacture.
In one aspect of the oligomer of the invention, the nucleotides and/or nucleotide analogs are linked to each other by means of phosphorothioate groups.
It is recognized that the inclusion of phosphodiester linkages, such as one or two linkages, into an otherwise phosphorothioate oligomer, particularly between or adjacent to nucleotide analog units (typically in region A and or C) can modify the bioavailability and/or bio-distribution of an oligomer—see WO2008/113832, hereby incorporated by reference.
In some embodiments, such as the embodiments referred to above, where suitable and not specifically indicated, all remaining linkage groups are either phosphodiester or phosphorothioate, or a mixture thereof.
In some embodiments all the internucleotide linkage groups are phosphorothioate.
When referring to specific gapmer oligonucleotide sequences, such as those provided herein it will be understood that, in various embodiments, when the linkages are phosphorothioate linkages, alternative linkages, such as those disclosed herein can be used, for example phosphate (phosphodiester) linkages can be used, particularly for linkages between nucleotide analogs, such as LNA, units. Likewise, when referring to specific gapmer oligonucleotide sequences, such as those provided herein, when the C residues are annotated as 5′methyl modified cytosine, in various embodiments, one or more of the Cs present in the oligomer can be unmodified C residues.
US Publication No. 2011/0130441, which was published Jun. 2, 2011 and is incorporated by reference herein in its entirety, refers to oligomeric compounds having at least one bicyclic nucleoside attached to the 3′ or 5′ termini by a neutral internucleoside linkage. The oligomers of the invention can therefore have at least one bicyclic nucleoside attached to the 3′ or 5′ termini by a neutral internucleoside linkage, such as one or more phosphotriester, methylphosphonate, MMI, amide-3, formacetal or thioformacetal. The remaining linkages can be phosphorothioate.
In some embodiments, the oligomers of the invention have internucleotide linkages described in
In some embodiments, the internucleotide linkages are combinations of phosphorothioate linkages and phosphodiester linkages. Non-limiting examples of combination linkages are shown in ASO-002623, ASO-002667, ASO-002674, ASO-002631, ASO-002639, and ASO-002624.
In the context the term “conjugate” is intended to indicate a heterogeneous molecule formed by the covalent or non-covalent attachment (“conjugation”) of the oligomer as described herein to one or more non-nucleotide, or non-polynucleotide moieties. Examples of non-nucleotide or non-polynucleotide moieties include macromolecular agents such as proteins, fatty acid chains, sugar residues, glycoproteins, polymers, or combinations thereof. Typically proteins can be antibodies for a target protein. In some embodiments, typical polymers are polyethylene glycol.
Therefore, in various embodiments, the oligomer of the invention comprises both a polynucleotide region which typically consists of a contiguous sequence of nucleotides, and a further non-nucleotide region. When referring to the oligomer of the invention comprising a contiguous nucleotide sequence, the compound can comprise non-nucleotide components, such as a conjugate component.
The invention also provides for a conjugate comprising the oligomer according to the invention as herein described, and at least one non-nucleotide or non-polynucleotide moiety covalently attached to the oligomer. Therefore, in various embodiments where the oligomer of the invention comprises a specified nucleic acid or nucleotide sequence, as herein disclosed, the compound can also comprise at least one non-nucleotide or non-polynucleotide moiety (e.g., not comprising one or more nucleotides or nucleotide analogs) covalently attached to the oligomer.
Conjugation (to a conjugate moiety) can enhance the activity, cellular distribution or cellular uptake of the oligomer of the invention. Such moieties include, but are not limited to, antibodies, polypeptides, lipid moieties such as a cholesterol moiety, cholic acid, a thioether.
The oligomers of the invention can also be conjugated to active drug substances, for example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
In certain embodiments the conjugated moiety is a sterol, such as cholesterol.
III.A. Activated Oligomers
The term “activated oligomer,” as used herein, refers to an oligomer of the invention that is covalently linked (i.e., functionalized) to at least one functional moiety that permits covalent linkage of the oligomer to one or more conjugated moieties, i.e., moieties that are not themselves nucleic acids or monomers, to form the conjugates herein described. Typically, a functional moiety will comprise a chemical group that is capable of covalently bonding to the oligomer via, e.g., a 3′-hydroxyl group or the exocyclic NH2 group of the adenine base, a spacer that can be hydrophilic and a terminal group that is capable of binding to a conjugated moiety (e.g., an amino, sulfhydryl or hydroxyl group).
In some embodiments, this terminal group is not protected, e.g., is an NH2 group. In other embodiments, the terminal group is protected, for example, by any suitable protecting group such as those described in “Protective Groups in Organic Synthesis” by Theodora W Greene and Peter G M Wuts, 3rd edition (John Wiley & Sons, 1999).
In some embodiments, oligomers of the invention are functionalized at the 5′ end in order to allow covalent attachment of the conjugated moiety to the 5′ end of the oligomer. In other embodiments, oligomers of the invention can be functionalized at the 3′ end. In still other embodiments, oligomers of the invention can be functionalized along the backbone or on the heterocyclic base moiety. In yet other embodiments, oligomers of the invention can be functionalized at more than one position independently selected from the 5′ end, the 3′ end, the backbone and the base.
In some embodiments, activated oligomers of the invention are synthesized by incorporating during the synthesis one or more monomers that is covalently attached to a functional moiety. In other embodiments, activated oligomers of the invention are synthesized with monomers that have not been functionalized, and the oligomer is functionalized upon completion of synthesis.
The oligomer of the invention can be used in pharmaceutical formulations and compositions. Suitably, such compositions comprise a pharmaceutically acceptable diluent, carrier, salt or adjuvant.
The oligomer of the invention can be included in a unit formulation such as in a pharmaceutically acceptable carrier or diluent in an amount sufficient to deliver to a patient a therapeutically effective amount without causing serious side effects in the treated patient. However, in some forms of therapy, serious side effects may be acceptable in terms of ensuring a positive outcome to the therapeutic treatment.
The formulated drug may comprise pharmaceutically acceptable binding agents and adjuvants. Capsules, tablets, or pills can contain for example the following compounds: microcrystalline cellulose, gum or gelatin as binders; starch or lactose as excipients; stearates as lubricants; various sweetening or flavoring agents. For capsules the dosage unit may contain a liquid carrier like fatty oils. Likewise coatings of sugar or enteric agents may be part of the dosage unit. The oligonucleotide formulations can also be emulsions of the active pharmaceutical ingredients and a lipid forming a micellular emulsion.
The pharmaceutical compositions of the present invention can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be (a) oral (b) pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, (c) topical including epidermal, transdermal, ophthalmic and to mucous membranes including vaginal and rectal delivery; or (d) parenteral including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal, intra-cerebroventricular, or intraventricular, administration. In one embodiment the oligomer is administered IV, IP, orally, topically or as a bolus injection or administered directly in to the target organ. In another embodiment, the oligomer is administered intrathecal or intra-cerebroventricular as a bolus injection.
Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, sprays, suppositories, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Examples of topical formulations include those in which the oligomer of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Compositions and formulations for oral administration include but are not limited to powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Compositions and formulations for parenteral, intrathecal, intra-cerebroventricular, or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Delivery of drug to the target tissue can be enhanced by carrier-mediated delivery including, but not limited to, cationic liposomes, cyclodextrins, porphyrin derivatives, branched chain dendrimers, polyethylenimine polymers, nanoparticles and microspheres (Dass C R. J Pharm Pharmacol 2002; 54(0:3-27).
The pharmaceutical formulations of the present invention, which can conveniently be presented in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
For parenteral, subcutaneous, intradermal or topical administration the formulation can include a sterile diluent, buffers, regulators of tonicity and antibacterials. The active oligomers can be prepared with carriers that protect against degradation or immediate elimination from the body, including implants or microcapsules with controlled release properties. For intravenous administration the carriers can be physiological saline or phosphate buffered saline. International Publication No. WO2007/031091 (A2), published Mar. 22, 2007, further provides suitable pharmaceutically acceptable diluent, carrier and adjuvants—which are hereby incorporated by reference.
This disclosure further provides a diagnostic method useful during diagnosis of Tau related diseases, e.g., a tauopathy. Non-limiting examples of tauopathy include, but are not limited to, Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica (chronic traumatic encephalopathy), frontal temporal dementia, parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), Tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, corticobasal degeneration, lipofuscinosis, frontotemporal dementia, supranuclear palsy, or frontotemporal lobar degeneration.
The oligomers of the invention can be used to measure expression of Tau transcript in a tissue or body fluid from an individual and comparing the measured expression level with a standard Tau transcript expression level in normal tissue or body fluid, whereby an increase in the expression level compared to the standard is indicative of a disorder treatable by an oligomer of the invention.
The oligomer of the invention can be used to assay Tau transcript levels in a biological sample using any methods known to those of skill in the art. (Touboul et. al., Anticancer Res. (2002) 22 (6A): 3349-56; Verjout et. al., Mutat. Res. (2000) 640: 127-38); Stowe et. al., J. Virol. Methods (1998) 75 (1): 93-91).
By “biological sample” is intended any biological sample obtained from an individual, cell line, tissue culture, or other source of cells potentially expressing Tau transcript. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art.
This disclosure further provides kits that comprise an oligomer of the invention described herein and that can be used to perform the methods described herein. In certain embodiments, a kit comprises at least one oligomer in one or more containers. In some embodiments, the kits contain all of the components necessary and/or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results. One skilled in the art will readily recognize that the disclosed oligomer can be readily incorporated into one of the established kit formats which are well known in the art.
The oligomers of the invention can be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
In research, such oligomers can be used to specifically inhibit the synthesis of Tau protein (typically by degrading or inhibiting the mRNA and thereby prevent protein formation) in cells and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Further provided are methods of down-regulating the expression of MAPT mRNA and/or Tau protein in cells or tissues comprising contacting the cells or tissues, in vitro or in vivo, with an effective amount of one or more of the oligomers, conjugates or compositions of the invention.
In diagnostics the oligomers can be used to detect and quantitate MAPT transcript expression in cell and tissues by northern blotting, in-situ hybridization or similar techniques.
For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of MAPT transcript and/or Tau protein is treated by administering oligomeric compounds in accordance with this invention. Further provided are methods of treating a mammal, such as treating a human, suspected of having or being prone to a disease or condition, associated with expression ofMAPT transcript and/or Tau protein by administering a therapeutically or prophylactically effective amount of one or more of the oligomers or compositions of the invention. The oligomer, a conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount. In some embodiments, the oligomer or conjugate of the invention is used in therapy.
The invention further provides for an oligomer according to the invention, for use for the treatment of one or more of the diseases referred to herein, such as a disease selected from Alzheimer's disease, progressive supranuclear palsy, Down syndrome, dementia pugilistica (chronic traumatic encephalopathy and other traumatic brain injury), frontal temportal dementia, frontal temporal dementia with parkinsonism linked to chromosome 17 (FTDP-17), Lytico-Bodig disease (Parkinson-dementia complex of Guam), Tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, Hemimegalencephaly, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, corticobasal degeneration, lipofuscinosis, frontotemporal dementia, supranuclear palsy, and frontotemporal lobar degeneration (reviewed in Frost et.al., Trends Cell Biol (2015) 25: 216-53; Dyment et. al., Neurobiol. Aging (2014) September 6: S0197-4580; Moussaud et. al., Mol. Neurodeg (2014) 29:43 Ross et. al., South Med. J. (2014) 107: 715-21). In addition, the invention provides for oligomer use for the treatment diseases of brain network dysfunction including all forms of epilepsy and depression (Inoue et. al., Epilepsy (2012) 102: 8-12; Xi et. al., Med Hypotheses (2011) 76: 897-900; Hou et. al., Can. J. Psychiatry (2004) 3: 164-71). The invention further provides for a method for treating tauopathies, the method comprising administering an effective amount of one or more oligomers, conjugates, or pharmaceutical compositions thereof to an animal in need thereof (such as a patient in need thereof).
In certain embodiments, the disease, disorder, or condition is associated with overexpression of MAPT gene transcript and/or Tau protein.
The invention also provides for methods of inhibiting (e.g., by reducing) the expression of MAPT gene transcript and/or Tau protein in a cell or a tissue, the method comprising contacting the cell or tissue, in vitro or in vivo, with an effective amount of one or more oligomers, conjugates, or pharmaceutical compositions thereof, of the invention to affect degradation of expression of MAPT gene transcript thereby reducing Tau protein.
The invention also provides for the use of the oligomer or conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.
The invention further provides for a method for inhibiting Tau protein in a cell which is expressing Tau comprising administering an oligomer or a conjugate according to the invention to the cell so as to affect the inhibition of Tau protein in the cell.
The invention includes a method of reducing, ameliorating, preventing, or treating neuronal hyperexcitability in a subject in need thereof comprising administering an oligomer or a conjugate according to the invention.
The invention also provides for a method for treating a disorder as referred to herein the method comprising administering an oligomer or a conjugate according to the invention as herein described and/or a pharmaceutical composition according to the invention to a patient in need thereof.
The oligomers and other compositions according to the invention can be used for the treatment of conditions associated with over expression or expression of mutated version of Tau protein.
The invention provides for the oligomer or the conjugate according to invention, for use as a medicament, such as for the treatment of tauopathies. In some embodiments the tauopathy is a disease selected from Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica (chronic traumatic encephalopathy), frontal temporal dementia, frontal temporal dementia with parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), Down syndrome, Hemimegalencephaly, Tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, corticobasal degeneration, lipofuscinosis, frontotemporal dementia, supranuclear palsy, and frontotemporal lobar degeneration (reviewed in Frost et al, Trends Cell Biol (2015) 25: 216-53; Thom et al., Brain (2011) 134:2969-81; Zheng et al., Mol. Neurobiol. (2014) 49: 1532-9).
The invention provides for the oligomer or the conjugate according to invention, for use as a medicament, such as for the treatment of seizure disorders (Dyment et. al., Neurobiol. Aging (2014) September 6 S0197-4580; Inoue et. al., Epilepsy (2012) 102:8-12; Gheyera et. al., Ann Neurol (2014-76: 443-56). In some embodiments, the seizure disorder is selected from epilepsy, juvenile myoclonic epilepsy, reflex epilepsy, benign focal epilepsy of childhood (BFEC), generalized epilepsy with febrile seizures plus (GEFS+), migrating partial seizures in infancy (MPSI), Mendelian epilepsy syndromes, infantile convulsions, infantile spasms, severe myoclonic epilepsy of infancy (SMEI or Dravet syndrome), Juvenile myoclonic epilepsy (JME or Janz syndrome), Angelman syndrome, Rett syndrome, epilepsy in fragile X syndrome, choreoathetosis (ICCA) syndrome, injury-associated seizures, brain injury, brain strokes, meningitis, and febrile seizures. In certain embodiments, the epilepsy is benign familial infantile epilepsy (BFIE).
In other embodiments, the seizure disorder is selected from idiopathic generalized epilepsy, idiopathic partial epilepsy, symptomatic generalized epilepsy, or symptomatic partial epilepsy. In some embodiments, the seizure disorder is idiopathic epilepsy selected from childhood absence epilepsy, juvenile myoclonic epilepsy, epilepsy with grand mal seizures on awakening others, benign focal epilepsy of childhood. In certain embodiments, the seizure disorder is symptomatic epilepsy selected from West syndrome, Lennox-Gastaut syndrome, temporal lobe epilepsy, or frontal lobe epilepsy. In other embodiments, the seizure disorder is idiopathic generalized epilepsy selected from myoclonic seizures (sudden and very short duration jerking of the extremities), absence seizures (staring spells), or generalized tonic-clonic seizures (grand mal seizures). In still other embodiments, the seizure disorder is idiopathic partial epilepsy including benign focal epilepsy of childhood (BFEC).
The invention also provides for the oligomer or the conjugate according to the invention, for use as a medicament, such as for the treatment of movement disorders. In some embodiments, the movement disorder is selected from Akathisia (inability to sit still), Akinesia (lack of movement), Associated Movements (Mirror Movements or Homolateral Synkinesis), Athetosis (contorted torsion or twisting), Ataxia (gross lack of coordination of muscle movements), Ballismus (violent involuntary rapid and irregular movements), Hemiballismus (affecting only one side of the body), Bradykinesia (slow movement), Cerebral palsy, Chorea (rapid, involuntary movement), Sydenham's chorea, Rheumatic chorea, Huntington's disease, Dyskinesia (abnormal, involuntary movement), Tardive dyskinesia, Dystonia (sustained torsion), Dystonia muscularum, Blepharospasm, Writer's cramp, Spasmodic torticollis (twisting of head and neck), Dopamine-responsive dystonia (hereditary progressive dystonia with diurnal fluctuation or Segawa's disease), Essential tremor, Geniospasm (episodic involuntary up and down movements of the chin and lower lip), Myoclonus (brief, involuntary twitching of a muscle or a group of muscles), Metabolic General Unwellness Movement Syndrome (MGUMS), Mirror movement disorder (involuntary movements on one side of the body mirroring voluntary movements of the other side), Parkinson's disease, Paroxysmal kinesigenic dyskinesia, Restless Legs Syndrome RLS (WittMaack-Ekboms disease), Spasms (contractions), Stereotypic movement disorder, Stereotypy (repetition), Tic disorders (involuntary, compulsive, repetitive, stereotyped), Tourette's syndrome, Tremor (oscillations), Rest tremor (4-8 Hz), Postural tremor, Kinetic tremor, Essential tremor (6-8 Hz variable amplitude), Cerebellar tremor (6-8 Hz variable amplitude), Parkinsonian tremors (4-8 Hz variable amplitude), Physiological tremor (10-12 Hz low amplitude), Wilson's disease, and tics.
The invention further provides use of an oligomer of the invention in the manufacture of a medicament for the treatment of a disease, disorder or condition as referred to herein. In some embodiments, the oligomer or conjugate of the invention is used for the manufacture of a medicament for the treatment of a tauopathy, a seizure disorder, or a combination thereof.
Generally stated, one aspect of the invention is directed to a method of treating a mammal suffering from or susceptible to conditions associated with abnormal levels of Tau i.e., a tauopathy), comprising administering to the mammal and therapeutically effective amount of an oligomer targeted to MAPT transcript that comprises one or more LNA units. The oligomer, a conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.
The disease or disorder, as referred to herein, can, in some embodiments be associated with a mutation in the MAPT gene or a gene whose protein product is associated with or interacts with Tau protein. Therefore, in some embodiments, the target mRNA is a mutated form of the MAPT sequence.
An interesting aspect of the invention is directed to the use of an oligomer (compound) as defined herein or a conjugate as defined herein for the preparation of a medicament for the treatment of a disease, disorder or condition as referred to herein.
The methods of the invention can be employed for treatment or prophylaxis against diseases caused by abnormal levels of Tau protein. In some embodiments, diseases caused by abnormal levels of Tau protein are tauopathies. In certain embodiments, tauopathies include Alzheimer's disease, progressive supranuclear palsy, dementia pugilistica (chronic traumatic encephalopathy), frontal temporal dementia, parkinsonism linked to chromosome 17, Lytico-Bodig disease (Parkinson-dementia complex of Guam), Tangle-predominant dementia, ganglioglioma, gangliocytoma, meningioangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallervorden-Spatz disease, Pick's disease, corticobasal ganglionic degeneration, argyrophilic grain disease, corticobasal degeneration, lipofuscinosis, frontotemporal dementia, supranuclear palsy, down syndrome, and frontotemporal lobar degeneration.
In certain embodiments, the disease or condition for treatment or prophylaxis is a neurological disorder. In other embodiments, the neurological disorder is selected from progressive supranuclear palsy, frontotemporal dementia-tau (FTD-tau), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), corticobasal degeneration (CBD), traumatic brain injury, chronic traumatic encephalopathy, HIV associated neurocognitive disorders, Argyrophilic grain disease, Down syndrome-Alzheimer's disease, Amnestic mild cognitive impairment-Alzheimer's disease, Parkinson's disease dementia, Hallervorden-Spatz disease (Pantothenate kinase-associated neurodegeneration), Niemann Pick disease type C, Myotonic dystrophy, Amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, Hemimegalencephaly, Tuberous sclerosis complex, Focal cortical dysplasia type 2b, or Ganglion cell tumors. In certain embodiments, the disease or condition is an epileptic disorder without tauopathy, e.g., Dravet Syndrome (severe myoclonic epilepsy of infancy), Temporal lobe epilepsy, Ohtahara syndrome (early infantile epileptic encephalopathy with suppression bursts), Lafora body disease, Generalized epilepsy with febrile seizures, Infantile spasms (West syndrome), Lennox Gastaut syndrome, Angelman Syndrome, Rett Syndrome, Landau Kleffner syndrome, focal seizures, simple focal seizures (no loss of consciousness), focal dyscognitive seizures (impairment of consciousness), focal seizure evolving to generalized tonic-clonic (GTC) convulsions, generalized seizures (convulsive or non-convulsive with bilateral discharges involving subcortical structures), absence seizures, myoclonic seizures, clonic seizures, tonic seizures, tonic-clonic seizures, atonic seizures, an autistic disorder, an autism spectrum disorder (e.g., as defined in the Diagnostic and Statistical Manual of Mental Disorders V (DSM-V)), an Asperger's disorder, a pervasive developmental disorder, or any combination thereof.
In certain embodiments, the neurological disorder is a neurodegenerative disorder, an epileptic disorder, an idiopathic adult epileptic disorder, or any combination thereof. In other embodiments, the disease or condition is a neurodegenerative disorder with tauopathy (i.e., a neurodegenerative disease which involves accumulation of tau protein in the brain), an epileptic disorder with tauopathy (an epileptic disorder which involves accumulation of tau protein in the brain), an epileptic disorder without tauopathy (an epileptic disorder which does not involve accumulation of tau protein in the brain), an idiopathic adult epileptic disorder without tauopathy (an idiopathic adult epileptic disorder which does not involve accumulation of tau protein in the brain), or any combination thereof. In certain other embodiments, the disease or condition for treatment or prophylaxis is a neurodegenerative disease with tauopathy, e.g., progressive supranuclear palsy, frontotemporal dementia-tau (FTD-tau), frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17), corticobasal degeneration (CBD), traumatic brain injury, chronic traumatic encephalopathy, HIV associated neurocognitive disorders, Argyrophilic grain disease, Down syndrome-Alzheimer's disease, Amnestic mild cognitive impairment-Alzheimer's disease, Parkinson's disease dementia, Hallervorden-Spatz disease (Pantothenate kinase-associated neurodegeneration), Niemann Pick disease type C, Myotonic dystrophy, Amyotrophic lateral sclerosis, Parkinson's disease or Huntington's disease. In certain embodiments, the disease or condition for treatment or prophylaxis is an epileptic disorder with tauopathy, e.g., Hemimegalencephaly, Tuberous sclerosis complex, Focal cortical dysplasia type 2b, or Ganglion cell tumors. In certain embodiments, the disease or condition is an epileptic disorder without tauopathy, e.g., Dravet Syndrome (severe myoclonic epilepsy of infancy), Temporal lobe epilepsy, Ohtahara syndrome (early infantile epileptic encephalopathy with suppression bursts), Lafora body disease, Generalized epilepsy with febrile seizures, Infantile spasms (West syndrome), Lennox Gastaut syndrome, Angelman Syndrome, Rett Syndrome, or Landau Kleffner syndrome. In certain embodiments, the disease or condition for treatment or prophylaxis is an idiopathic adult epileptic disorder without tauopathy, e.g., focal seizures, simple focal seizures (no loss of consciousness), focal dyscognitive seizures (impairment of consciousness), focal seizure evolving to generalized tonic-clonic (GTC) convulsions, generalized seizures (convulsive or non-convulsive with bilateral discharges involving subcortical structures), absence seizures, myoclonic seizures, clonic seizures, tonic seizures, tonic-clonic seizures or atonic seizures. In certain embodiments, the neurological disorder for treatment or prophylaxis is an autistic disorder, an autism spectrum disorder (e.g., as defined in the Diagnostic and Statistical Manual of Mental Disorders V (DSM-V)), an Asperger's disorder or a pervasive developmental disorder.
Alternatively stated, in some embodiments, the invention is furthermore directed to a method for treating abnormal levels of Tau protein, the method comprising administering a oligomer of the invention, or a conjugate of the invention or a pharmaceutical composition of the invention to a patient in need thereof.
The invention also relates to an oligomer, a composition or a conjugate as defined herein for use as a medicament.
The invention further relates to use of a compound, composition, or a conjugate as defined herein for the manufacture of a medicament for the treatment of abnormal levels of Tau protein or expression of mutant forms of Tau protein (such as allelic variants, such as those associated with one of the diseases referred to herein).
A patient who is in need of treatment is a patient suffering from or likely to suffer from the disease or disorder.
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); D. N. Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press) (1986); Perbal (1984) A Practical Guide To Molecular Cloning; the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Miller and Calos eds. (1987) Gene Transfer Vectors For Mammalian Cells, (Cold Spring Harbor Laboratory); Wu et al., eds., Methods In Enzymology, Vols. 154 and 155; Mayer and Walker, eds. (1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986);); Crooks, Antisense drug Technology: Principles, strategies and applications, 2nd Ed. CRC Press (2007) and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.).
All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties. T
he following examples are offered by way of illustration and not by way of limitation.
A number of oligomers were designed to target the 3′ UTR of MAPT pre-mRNA. See
The oligomers were synthesized using methods well known in the art. Exemplary methods of preparing such oligomers are described in Barciszewski et al., Chapter 10—“Locked Nucleic Acid Aptamers” in Nucleic Acid and Peptide Aptamers: Methods and Protocols, vol. 535, Gunter Mayer (ed.) (2009), the entire contents of which is hereby expressly incorporated by reference herein.
In
In
Beta-D-oxy LNA nucleotides are designated by OxyB where B designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), methylcytosine (MC), adenine (A) or guanine (G), and thus include OxyA, OxyT, OxyMC, OxyC and OxyG.
Alpha-L-oxy LNA nucleotides are designated by AlfaOxyB where B designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), methylcytosine (MC), adenine (A) or guanine (G), and thus include AlfaOxyA, AlfaOxyT, AlfaOxyMC, AlfaOxyC and AlfaOxyG. The letter M or m before C or c indicates 5-methylcytosine.
Beta-D-Amino LNA nucleotides are designated by AminoB where B designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), methylcytosine (MC), adenine (A) or guanine (G), and thus include AminoA, AminoT, AminoMC, AminoC and AminoG. The letter M or m before C or c indicates 5-methylcytosine. Some examples of the oligomers including 5 methylcytosine include ASO-002672, ASO-002658, ASO-002622, ASO-002629, ASO-002621, ASO-002665, and ASO-002630. See
Beta-D-Thio-LNA nucleotides are designated by ThioB where B designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), methylcytosine (MC), adenine (A) or guanine (G), and thus include ThioA, ThioT, ThioMC, ThioC and ThioG. The letter M or m before C or c indicates 5-methylcytosine.
DNA nucleotides are designated by DNAb, where the lower case b designates a nucleotide base such as thymine (T), uridine (U), cytosine (C), 5-methylcytosine (MC), adenine (A) or guanine (G), and thus include DNAa, DNAt, DNAc, DNAmc and DNAg. The letter M or m before C or c indicates 5-methylcytosine.
The letter “s” after the nucleotide designation indicates phosphorothioate linkage whereas absence of “s” indicates phosphodiester linkage.
Thus a 3-10-3 beta-D-oxy LNA-DNA-beta-D-oxy LNA gapmer with sequence ATTtccaaattcaCTT, with full phosphorothioate internucleotide linkages would be designated OxyAs OxyTs OxyTs DNAts DNAcs DNAcs DNAas DNAas DNAas DNAts DNAts DNAcs DNAas OxyMCs OxyTs OxyT. In some embodiments, the oligomers have a mix of phosphorothioate and phosphodiester internucleotide linkages. Examples of the oligomers having a mix of phosphorothioate and phosphodiester internucleotide linkages include, but are not limited to, ASO-002625, ASO -002675, ASO -002633, ASO-002640, ASO-002632, ASO-002647, ASO-002655, ASO-002641, ASO-002648, ASO-002666, ASO-002659, ASO-002652, ASO-002645, ASO-002638, ASO-003270, ASO-003269, ASO-003268, ASO-002673, ASO-002661, ASO-002654, ASO-002668, ASO-002676, AS-002669 and ASO-002662. See
Preparation of Oligos with Mismatches
Oligos having mismatched bases at different locations were also prepared using standard methods well known in the art. Examples of oligomers with mismatched bases are provided in
Each of the oligomers targeting the 3′ UTR of an MAPT transcript was tested for its ability to decrease Tau protein in mouse primary neurons expressing the entire human MAPT gene as a bacmid containing transgene (C57-b16 BAC-Tg hTau; Polydoro et. al., J. Neurosci. (2009) 29 (34): 10747-9). Primary hTau mouse embryonic forebrain neuronal cultures do not express endogenous mouse tau as mouse tau was knocked out. Primary neurons were generated by papain digestion according to manufacturer's protocol (Worthington Biochemical Corporation, LK0031050). Briefly, forebrains were dissected from hTau mouse E18 BAC-Tg embryos expressing the entire human microtubule-associated protein Tau (MAP]) gene on a murine MAPT-null background and were incubated at 37° C. for 30-45 minutes in papain/DNase/Earle's balanced salt solution (EBSS) solution. After trituration and centrifugation of cell pellet, the reaction was stopped by incubation with EBSS containing protease inhibitors, bovine serum albumin (BSA) and DNase. The cells were triturated and washed with Neurobasal (NB, Invitrogen) supplemented with 2% B-27, 100 μg/ml penicillin, 85 μg/ml streptomycin, and 0.5 mM glutamine. The cells were plated in supplemented NB media onto poly-D-lysine-coated 96-well optical imaging plates (BD Biosciences) at 15,000 cells/well.
After obtaining the primary hTau mouse embryonic forebrain neuronal cultures expressing a human MAPT gene, the cultures were treated with oligomers to inhibit the Tau mRNA and protein expression. The cultures were then subject to immunocytochemistry and imaging to measure the inhibition. One day post plating (DIV 1), half of the supplemented neurobasal (NB) media on the primary hTau mouse embryonic forebrain neuronal cultures was removed and replaced with supplemented NB media containing various concentrations of LNA oligomers. Primary hTau neuronal cultures were cultured with LNA oligomers until 13 days post plating (DIV 13). On DIV 13, the cultures were rinsed with Dulbecco's phosphate-buffered saline lacking calcium and magnesium (DPBS, Invitrogen) and fixed in 4% paraformaldehyde/4% sucrose/DPBS for 15 min. Cultures were rinsed and then blocked and permeabilized in DPBS plus 0.1% Triton X-100 (TX-100) and 3% BSA for one hour at room temperature. Cultures were rinsed and then incubated for two hours at room temperature with primary antibody 1:500, Tau5 antibody to measure Tau protein, Invitrogen AHB0042; and 1:500, (3-III tubulin (TuJ-1) antibody to measure neurite area, Abcam ab41489) in DPBS plus 3% BSA and 0.1% TX-100. Cultures were rinsed and incubated with Hoeschst 33342 nuclear dye (1:800, Invitrogen) and AlexaFluor fluorescence-conjugated secondary antibodies (Invitrogen, 1:500) in DPBS plus 3% BSA and 0.1% TX-100 for one hour at room temperature. Cultures were rinsed abundantly and stored in DPBS until imaging. Imaging was conducted using the Cellomics VTi automated immunofluorescence imaging system. In brief, using untreated wells, saturation levels for each fluorophore channel were set to 70%. Then 12 sequential images were acquired from each well, and total fluorescence intensity and total fluorescence area were calculated for both Tau and TuJ-1 proteins using the Cellomics VTi SpotDetector (version 4) image analysis software. To evaluate Tau protein reduction resulting from oligomer treatment, a Tau5 total fluorescence intensity-to-Tuj-1 total fluorescence area ratio (Tau/TuJ-1) was created for each well and then all data were normalized to the average Tau/Tuj-1 ratio of the untreated wells. TuJ-1 intensity acts as an internal standard for each sample. To evaluate neurite/neuronal toxicity from oligomer treatment, the Tuj-1 total fluorescence area from each well was normalized to the average Tuj-1 total fluorescence area of the untreated wells. Nuclei counts from each well were also acquired as an alternative measure of toxicity associated with LNA oligomer treatment. Data are expressed as mean±S.D. For immunocytochemistry, data points represent the mean ±S.D. from wells treated in triplicate. Potency values were generated using wells treated with a broad concentration range of LNA oligomer, from which the resulting normalized Tau/Tuj-1 and Tuj-1 values were analyzed compared to normalized values from saline control samples. Analysis was done using non-linear regression with top and bottom values set at fixed values of 100% and 0%, respectively, where 100% inhibition represents a complete reduction of signal compared to the control sample (
The reduction of Tau protein by each oligomer was compared with saline. The results of the Tau protein reduction compared to Saline are shown in
Oligomers were diluted in water and added to cells at 1 day post plating (DIV01) to a final concentration of 5 μM. For IC50 determinations, neurons were treated with a top concentration of 5μM and a concentration response dilution of 1:3 was used to define the IC50 value. The calculated IC50 value for certain oligomers is shown in
The present application shows that a reduction of oscillations in intracellular free calcium concentration (calcium oscillation) corresponds to increased neurotoxicity of an oligomer to a cell. The amount of reduction and how it corresponds to an increase in neurotoxicity can be determined as described herein. To measure primary cortical neuron spontaneous calcium oscillation, rat primary cortical neurons were prepared from Sprague-Dawley rat embryos (E19). Cells were plated 25,000 cells/well onto 384 well poly-D-lysine coated fluorescent imaging plate reader (FLIPR plates) (Greiner Bio-One) in 25 μl/well Neurobasal media containing B27 supplement and 2 mM glutamine. Cells were grown for 11 days at 37° C. in 5% CO2 and fed with 25 μl of additional media on DIV04 and DIV08 for use on DIV11. On the day of the experiment, media was removed from the plate and the cells were washed once with 50 μl/well of 37° C. assay buffer (Hank's Balanced Salt Solution with 2 mM CaCl2 and 10 mM Hopes pH 7.4). Oscillations were tested in the presence and absence of 1 mM MgCl2 (
Effect of oligomers on primary neuronal spontaneous calcium oscillations was measured under two conditions, in the presence and absence of 1 mM MgCl2 as a source of Mg2+ ions, as described previously (Murphy et.al., J. Neurosci. 12, 4834-4845 (1992)). This was done to isolated N-methyl-D-aspartate (NMDA)- and α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-receptor mediated calcium oscillations. Data presented in
Antisense oligomer inhibition of spontaneous calcium oscillations mediated by either NMDA or AMPA was assessed in the presence or absence of 1 mM MgCl2 (representing 100% control in each case;
Calcium oscillation reduction was measured for the oligomers of the invention and summarized in
The present application also shows that the sequence score of an oligomer, as calculated herein, corresponds to the neurotoxicity of the oligomer. In certain aspects of the invention, the higher the sequence score the less neurotoxic the oligomer. Different cut off values, over which the sequence score indicates that the oligomer has reduced neurotoxicity, can be determined as described herein.
The sequence score of each oligomer was calculated to predict the suitability and neurotoxicity of the oligomers. Sequence score is a mathematical calculation determined for all oligomers and is based on the percent of G and C nucleotides, or analogs thereof, within a given oligomer sequence. The following formula was applied to all oligomers in order to calculate sequence score:
An example calculation is given for oligomer ASO-000013 (SEQ ID NO: 686; sequence score 0.25): ATTtccaaattcaCTT: 4-0/16=sequence score of 0.25.
The sequence score of the selected oligomers were calculated for further studies.
To determine the cut off value for the sequence score, an in vivo tolerability study was performed as shown in Example 5.
The in vivo tolerability of the oligomers was tested to see how the oligomer was tolerated when injected into an animal.
In vivo tolerability of the oligomers were tested in mice and rats. Animals for Tau qPCR and behavioral studies were adult, C57B1/6J female mice (20-30 g; Jackson Laboratories, Bar Harbor, Me.) housed 3-4 per cage. Animals were held in colony rooms maintained at constant temperature (21±2° C.) and humidity (50±10%) and illuminated for 12 hours per day (lights on at 0600 hours). In some cases, male and female transgenic mice (30-40g) expressing a tau transgene derived from a human PAC, H1 haplotype driven by the tau promoter (Polydoro et. al., J. Neurosci. (2009) 29(34): 10741-9), and in which the native mouse Tau gene was deleted, were used to assess pharmacodynamic endpoints and tissue drug concentrations. For intrathecal infusion studies, female Sprague-Dawley rats (180-225 g at testing; Harlan) were singly housed in colony rooms maintained at a constant temperature (21±2° C.) and humidity (50±10%) and illuminated for 12 hours per day (lights on at 0600 h). All animals had ad libitum access to food and water throughout the studies. Behavioral studies were conducted between 0700 and 1500 hours. Animals were maintained in accordance with the guidelines of the Animal Care and Use Committee of the Bristol-Myers Squibb Company, and the “Guide for Care and Use of Laboratory Animals” published by the National Institutes of Health. Research protocols were approved by the Bristol-Myers Squibb Company Animal Care and Use Committee.
The oligomers were administered to mice by either intracerebroventricular (ICV) injection or intrathecal injection. Intracerebroventricular injections were performed using a Hamilton micro syringe fitted with a 27 or 30-gauge needle, according to the method of Haley and McCormick. The needle was equipped with a polyethylene guard at 2.5 mm from the tip in order to limit its penetration into the brain. Mice were anesthetized using isoflurane anesthetic (1.5-4%). The mouse to be injected, weighing 20-30 g, was held by the loose skin at the back of the neck with the thumb and first fingers of one hand. Applying gentle but firm pressure, the head of the animal was then immobilized by pressing against a firm flat level surface. The needle tip was then inserted through the scalp and the skull, about 1 mm lateral and 1 mm caudal to bregma. Once the needle was positioned, antisense oligonucleotide was given in a volume of 5 microliters in saline vehicle and injected into the right (or left) lateral ventricle over 20-30 seconds. The needle was left in place for 10 seconds before removal. This procedure required no surgery or incision. Animals were warmed on heating pads until they recovered from the procedure. Brain tissue (right, frontal cortical region) was collected on dry ice or RNAlater for drug concentration analysis and Tau qPCR respectively at multiple time points following dosing, e.g., 1 week through 16 weeks post-dosing.
For intrathecal (IT) injections of mice, animals were maintained under light isoflurane anesthesia (1.5-5%). The mouse was held securely in one hand by the pelvic girdle and inserting a 30G ½ inch needle connected to a Hamilton syringe into the tissue between the dorsal aspects of L5 and L6, perpendicular to the vertebral column. When the needle enters the subarachnoid space, a sudden lateral movement of the tail was observed. This reflex was used as an indicator of successful placement of the needle for IT administration. A 5-10 μL volume of antisense oligonucleotide was injected slowly (over approximately 60 seconds) into the subarachnoid space.
For intrathecal injections in rat, intrathecal catheters were surgically implanted using methods described by Yaksh and Rudy, Physiol. Behay. (1976) 17(6): 1031-6. The rat was mounted to a stereotaxic frame with isoflurane anesthesia maintained through a nose cone. A skin incision was made beginning approximately at the line joining the ears and extending caudally about 3 cm along the midline. The muscle where it attached to the occipital crest of the skull was cut about 3 mm lateral on both sides of the muscle midline. Using retractors or forceps, the muscle was peeled caudally to expose the cisternal membrane at the base of the skull. The fascia and tissue were carefully removed from the membrane. The bent beveled end of a 16-22 gauge needle was used to make a 1-2 mm lateral incision in the cisternal membrane. A sterilized IT catheter, made of polyethylene tubing (PE10 tubing stretched to approximately 1.3 mm outer diameter), was inserted through the incision and carefully advanced caudally through the subarachnoid space while it was rotated between thumb and forefinger and while the base of the tail was gently pulled to align the spinal cord using the other hand. If any resistance was encountered, the catheter was retracted slightly, and slowly advanced again. Once the catheter had been advanced to the desired area, it was flushed with 20 μL sterile saline and the cranial end was passed through the skin using a 19 gauge needle about 1 cm from the incision. The catheter was plugged with a pin. Rats were given oral antibiotics for 5 days following the surgery. At least five days after surgery, a single antisense oligonucleotide injection was diluted in water and delivered via a programmable infusion pump (Knopf) at a rate of 10 μl/minute in a volume of 10 to 50 μl. A brief saline flush of 5 ul was given just prior to the antisense oligonucleotide delivery and a 10 μl saline flush was given just following the oligonucleotide delivery at a rate of 10 μl minute to cover the dead volume of the catheter (6-7 μl). A saline flush of 20 ul was also given to animals 1-2×/week until used for an experiment.
For one hour following the single injection of antisense oligonucleotide ICV (intra-cerebroventricular) or IT (intrathecal), animals were observed for behavioral side effects and scored for the severity of side effects on a scale of zero (no side effects) to 20 (convulsions resulting in euthanasia). The tolerability scale was divided into 5 neurobehavioral categories: 1) hyperactivity 2) decreased activity and arousal 3) motor dysfunction /ataxia 4) abnormal posture and breathing and 5) tremor/convulsions. Each category was scored on a scale of 0-4, with the worst possible total score of 20. Animals were observed for changes in behavior in the home cage, and then they were removed from the home cage for more detailed observations which included measurement of grip strength and righting reflex.
Short term recognition memory was measured using the novel object recognition (NOR) task. NOR testing was based on the spontaneous behavior of rodents to explore a novel object more than a familiar one (Dodart et. al., Neuroreport (1997) 8(5): 1173-8; Ennaceur and Delacour, Behav. Brain Res. (1988) 31 (1):47-59). After a one hour retention interval between training (T1) and testing (T2) sessions, mice remembering the objects from the training session will show a preference for the novel object on the test session. For these experiments, animals were handled for 3 days and habituated to the chamber (48 cm×38 cm×20 cm) on the day prior to the test session. The chamber was made of polyethylene and lined with vinyl flooring. On the test day, animals were placed in the rectangular test chamber and allowed to explore two identical objects (7.6 cm high×5.1 cm wide) for a 15 minute training period. One hour later, mice were placed back into the test chamber for a 10 minute test session, this time with one object they had observed during training and one novel object. Objects were cleaned thoroughly with 25% ethanol between training and testing sessions and between subjects, and were cleaned again at the end of the day with mild detergent. Object exploration was only considered when the animal's nose was pointed at the object. Exploration was recorded using ObjectScan tracking software (Cleversys, Reston, Va.). Data are reported as percent of time spent exploring objects (i.e., novel time/novel+familiar time *100).
Spatial learning and memory was assessed based on Morris Water Maze assay (Morris J. Neurosci. (1984) 11(1):47-60). Water maze represents a pool with the diameter of 120 cm. Water was made opaque using white, non-toxic tempura paint (20° C.±1). The pool was surrounded with distinct extra-maze cues.
Prior to hidden platform training, all mice were exposed to the water maze pool by allowing them to swim down the rectangular channel during 2 pre-training trials. The escape platform was placed in the middle of the channel. If a mouse was not able to find and mount the platform during 60 sec trial, it was guided to it and allowed to sit for up to 10 sec. After pre-training, mice underwent hidden platform training, during which a 10×10 cm platform was submerged 1.5 cm below the surface. The platform location remained the same throughout training whereas the drop location varied randomly between the four daily trials as well as across the 4 days of training. Mice received 2 sessions per day for 4 consecutive days. Each session consisted of 2 trials with a 10-min inter-trial interval. The maximum time allowed per trial was 60 sec. If a mouse did not find or mount the platform, it was guided to the platform by the experimenter. All mice were allowed to sit on the platform for 10 sec after each training trial.
For probe trials, the platform was removed and each mouse was allowed to swim for 60 sec. The drop location for the probe trials was 180° from the platform location used during hidden platform training. After 60 sec, mice were guided to the platform location before retrieval from the pool. For early memory retrieval mice were probed 2 h after the last hidden platform training; long term memory recall was assessed 16 h following the last hidden platform training. 2 h following the 16 h probe trial, all mice underwent the visible platform training, where a local cue (pole built using legos) was placed above the hidden platform. Mice were given 2 training trials. All behavior was recorded with a video tracking system (Cleversys, Inc). Escape latencies, distance traveled, swim paths, swim speeds, and platform crossings were recorded automatically for subsequent analysis.
The Catwalk (Noldus, The Netherlands) is an automated and computerized gait-analysis technique that allows objective quantification of multiple static and dynamic gait parameters. Mice were placed on one end of the catwalk and allowed free exploration for 3 min or until they have 5 compliant trials, whichever comes first. Data were exported and classified using the Catwalk software. An average of classified trials was used for data analysis. Measures of interest include but are not limited to: print position or the distance between the position of the hind paw and previous placement of the ipsilateral front paw, initial and terminal dual stances, paw swing speed, and paw stand or the duration of paw contact with the glass plate in a step cycle.
Statistical analyses for all behavioral tests were conducted using GraphPad Prism (GraphPad Software, Inc., La Jolla, Calif.). For NOR, data were analyzed using either a paired t-test for within-group analyses or by an ANOVA followed by a Dunnett's post-hoc test for between group analyses. For MWM, a repeated MWM ANOVA was used to analyze the acquisition phase and a one-way ANOVA followed by Dunnett's post-hoc for probe trial analyses.
Brain Tau mRNA Analysis
Mouse brain tissue was homogenized in a 10× volume of a high salt/sucrose buffer (10 mM Tris-HCl, pH 7.4, 800 mM NaCl, 10% sucrose (w/v), 1 mM EGTA) supplemented with phosphatase inhibitor cocktail sets 2 and 3, 1 mM PMSF (Sigma, Saint Louis, Mo.), and complete protease inhibitor cocktail EDTA-free (Roche, Indianapolis, Ind.) using a Quiagen TissueLyzer II. The homogenate was centrifuged at 20,000×g for 20 minutes at 4° C. The supernatant was centrifuged at 100,000×g for 1 hour at 4° C. and the supernatant was analyzed.
For cDNA synthesis and subsequent PCR, 300 ng of RNA from brain tissue was added to 1 well of a 96 well plate (Axygen, PCR-96-C-S). To each well 7.5 μl of master mix (54, of 2.5mM NTP mix and 2.54, random primers per reaction) was added and the plate was centrifuged at 1000 rpm and placed in thermocycler for 3 min at 70° C. Plates were immediately cooled on ice and 4μ1 of reaction master mix was added. Prior to PCR, plates were briefly centrifuged to collect sample in bottom of well. cDNA synthesis was carried out at 42° C. for 60 min, 95° C. for 10 min followed by a hold at 4° C. cDNA Samples were diluted 1:3 with molecular biology grade water and stored at −20° C. until further use.
For PCR, each sample was run in triplicate with two probe sets (MAPT: Taqman Expression assays Hs00902193_ml; RhoA: Taqman Expression assays; GAPDH Taqman Expression assays Hs01922876_ul). To each reaction 4 μl of previously diluted cDNA and 6μL of master mix was added and plates were centrifuged. Samples were incubated at 95° C. for 20 sec follow by 40 cycles at 95° C. for 1 sec and 60° C. for 20 sec.
Data was analyzed using the delta delta Ct method where each sample is first normalized to GAPDH and then expressed as percent of untreated control animals (see
In vivo cumulative tolerability threshold following an ICV injection of 100 m of an antisense oligonucleotide was set at 4. The correlation analysis in
The in vivo acute tolerability score and brain tau mRNA % control data shown in
The assays described herein can be used in combination to selected oligomers for further testing. Properties of selected oligomers can be described as shown in Table 1. Based on these criteria, certain oligomers were selected for additional dose-response testing in vitro and in vivo.
In another embodiment, oligomers can be selected based on the following characteristics: (1) Tau protein reduction >30% reduction in Tau protein (5 μM oligomer); (2) calcium oscillations <25% reduction in calcium oscillations; and (3) sequence score equal to or higher than 0.2.
Oligomers were injected into animals to determine their effect on Tau expression and on the behavioral properties of the animal.
The animals used in this Example are the same mice and rats described in
Example 5 and were handled in the same manner as described in Example 5. Animals were injected as described in Example 5.
RT-PCR assays were performed as described in Example 5.
The Home Cage Running Wheel assay measures spontaneous activity in a voluntary free-spinning running wheel (Columbus Instruments). Each wheel has a magnetic sensor that connects to a computer interface and records wheel revolutions at user-specified intervals. In this study, mice were placed individually into cages with a running wheel and wheel rotations were monitored continuously in 15 min increments. To allow for habituation and establish baseline activity levels, control and test mice were tested over 7 days, after which they were transferred into clean cages and dosed with either saline or 100ug ASO-000774 by ICV injection. Two weeks post treatment mice were returned to the running wheel cages to evaluate treatment effects over 7 days.
Brain Tau mRNA Analysis
Mouse brain tissue was homogenized as described in Example 5. Survival and Febrile Seizure Data (Gheyara et. al., Ann Neurol. 2014; 76(3): 443-456.)
Heat-Induced Seizures: Seizures were induced in P30-45 mice using a heat lamp as described (Oakley et al., Proc Natl Acad Sci USA 2009;106:3994-3999) except that a 2-minute acclimation period was used. Survival and febrile seizure data were analyzed by Cox proportional hazards regression using the R survival package (Therneau T M. Survival analysis. R package version 2.37-4 ed2013) and corrected for multiple comparisons with the method of Holm (Holm S. Scand J Stat 1979;6:65-70) For analysis of drug-induced epileptic activity in brain slices, a linear mixed effects model (Laird et al., Biometrics 1982;38:963-974.) was fitted using the R package. Random intercepts were included for each mouse and each genotype such that multiple comparison corrections were not needed due to “partial pooling.” Five thousand draws were obtained of parameter estimates, and 95% confidence intervals (CIs) were estimated as the 2.5th and 97.5th quantiles of these draws. Probability values were calculated by inverting the simulated CIs around the differences. Analyses of log(spike frequencyl0.1) and log(burst frequency 10.1) were conducted separately.
All animal protocols were approved by the Wallingford BMS Animal Care and Use Committee. CSF was collected from the cisterna magna of mice following exsanguination as described by Barten, et al., J Alz. Res. 24: 127-141 (2011). In brief, CSF was collected with a P20 pipettor after puncturing the dura with a 30 gauge needle under a dissecting microscope. Body temperature was monitored and maintained at normal levels using heating pads and lamps. CSF was collected from rats after exposure of the cisterna magna and withdrawal using a 1 ml insulin syringe. CSF was placed on ice, centrifuged briefly to remove any red blood cells, transferred to another tube while measuring the volume, and frozen on dry ice. CSF Tau protein reduction measured by Tau Protein Enzyme-Linked ImmunoSorbant Assay (ELISA described below) was observed after 4 weeks following a single bolus ICV injection of ASO-000013 (data not shown).
For brain tissue, BT2 (antibody to Tau amino acid 194-198, Thermo Scientific) was used to coat 96 well black ELISA plates (Costar) at a concentration of 2.5 μg/ml for 1 hour at 37° C. After washing in TBST, the plates were blocked with 3% bovine serum albumin in TBS. Recombinant human Tau441 (rPeptide; Bogart, Ga.) or a 1:5000 dilution of the brain homogenates were diluted in 1% BSA +0.05% Tween-20 in TBS. Alkaline phosphatase conjugated Tau-5 (antibody to Tau amino acid 210-230, Covance, Emeryville, Calif.) was added to the samples at a 1:2000 dilution for co-incubation overnight at 4° C. with shaking. After washing in TBST, the signal was amplified with the Tropix CDP Star detection reagent from Applied Biosystems. The chemiluminescent signal was read on an Envision (Perkin Elmer). For CSF samples, this ELISA was done in a 384 well format to minimize the volume of CSF needed. 10 μl of a 1:2 dilution of CSF was added to each well.
In-situ hybridization (ISH) detection of Tau mRNA or ASO-000013 was performed on 20 μm fresh frozen brain sections mounted. Slides were thawed, fixed in 4% paraformaldehyde for 10 minutes at room temperature, washed in phosphate buffered saline (PBS) and acetylated with 0.25% acetic anhydride/0.1M triethanolamine for 10 minutes at room temperature (RT). Following PBS washes, each slide was pre-hybridized in 0.7 ml pre-warmed hybridization buffer (HB), 50% formamide/5× saline sodium citrate (SSC), 100 μg/ml yeast tRNA, 1X Denhardt's, for 30 minutes at 67° C. 5′ FAM-labeled ASO-000013 sense probe (complementary all LNA probe, ASO-000067=SPC-11404) was heated to 90° C. for 4 minutes, cooled on ice then diluted in HB. Slides were hybridized in 0.45 ml for 30 minutes at 67° C. with a hybrislip (Electron Microscopy Sciences, Hatfield, Pa.). They were subsequently dipped in 0.1×SSC then washed three times in 0.1×SSC at 67° C. Slides were then treated in 3% hydrogen peroxide for 10 minutes, washed in PBS, and blocked for 15 minutes at RT in 0.1M Tris-HCl, pH 7.5, 0.15M NaCl, 0.5% blocking agent (FP1020, Perkin Elmer Waltham, Mass.). This was followed by incubation in rabbit anti-fluorescein-horse radish peroxidase for 30 minutes at RT. Following TBST washes (Tris buffered saline with 0.05% Tween 20), tyramide signal amplification was performed (TSA Plus, Perkin Elmer). Slides were washed in TBST, nuclei stained using DAPI, and coverslip mounted using Prolong Gold (Invitrogen, Carlsbad, Calif.). For chromogenic detection, slides (post-TSA washes) were incubated for a second time with anti-fluorescein-HRP for 30 minutes at RT, washed in TBST and developed using DAB substrate (Quanto, Thermo Scientific, Freemont, Calif.). Tau mRNA and ASO-00013 oligomer ISH indicate uniform distribution of tau mRNA reduction and oligomer across the mouse brain following a single ICV bolus injection of 100 μg ASO-000013 (data not shown).
In vivo reduction of human tau mRNA level was measured in mice after the administration of various oligomers (
Tau mRNA Reduction
Oligonucleotides, or oligomers similar to ASO-000013, ASO-000757, ASO-000762, ASO-000761, ASO-000758, ASO-000760, and ASO-000759 show potent knockdown of Tau protein in primary hTau neurons with good tolerability in vitro and in vivo when administered directly into the cerebral spinal fluid (CSF) via intra-cerebroventricular or intrathecal dosing (see, e.g.,
Oligomers like ASO-000013 produced sustained Tau reduction following a 100 μg intra-cerebroventricular (ICV) bolus injection (see
Dose dependent Tau RNA reduction was also observed following intrathecal (IT) injection of oligomers similar to ASO-000013 and ASO-000757 into lumbar ported rats (data not shown). A single bolus IT injection of 300 μg of ASO-000013 or ASO-000757 was injected into lumbar catheterized rats (as described above). Robust and sustained reduction of brain Tau mRNA was observed at both 3 days and 4 weeks following the single bolus administration using the proposed clinical route of administration of these representative oligomers (
Tau ASOs in the 3′UTR were administered at 100 μg intra-cerebroventricular (ICV) to hTau or wild type B16 mice in order to understand the hysteresis of Tau protein reduction with respect to mRNA reduction. During these studies, many of the Tau ASOs were not tolerated beyond 4 weeks following a single 100 μg ICV bolus dose. Some of the most potent Tau ASOs in this region also reduced expression of an unintended target Ras homolog gene family, member A (“RhoA”). RhoA is a small GTPase protein of Rho family. While the effects of RhoA activity are not all well known, it is primarily associated with cytoskeleton regulation, mostly actin stress fibers formation and actomyosin contractility. In humans, it is encoded by the gene RHOA. The RHOA gene contains the sequence of actttatttccaaatacacttcttt (SEQ ID NO: 959).
Certain traditional gapmer sequences were further modified in the gap design and the wing design. In particular, the traditional gapmer design was converted to an alternating flank gapmer design (e.g., ASO-001967, ASO-001941, ASO-001933, and ASO-1940).
ASO-001933 (100 μg-200 μg) was administered as a single bolus intra-cerebroventricularly (ICV) in mice, as described above, and produced greater than 50% reduction of brain Tau protein that was sustained for 4-12 weeks in hTau mice. At these dose levels, there were no clinical signs of toxicity and no gross or histologic findings observed over the 20-week period following a single ICV dose in mouse. ASO-000013 was also administered and gave results similar to ASO-001933. A single ICV bolus injection of 100 μg produced no adverse changes in cognition as assessed by novel object recognition or contextual fear conditioning, motor function as assessed by catwalk, rotorod and running wheel (data not shown). In a Tau knock out mouse carrying the entire human tau gene (hTau), the EC50 for reduction of human Tau brain mRNA and protein was ˜2.72 μg/g (414 nM). As
The relationship between the level of brain Tau protein suppression and functional outcome measures was studied in both tauopathy (Tg4510) and Dravet Syndrome mouse models. Initial data generated in these genetic mouse models (
In addition, about 25-50% reduction of brain soluble and insoluble Tau protein compared to a control is sufficient to improve survival and heat induced seizure in Dravet mice, which possess a mutation in the SCNA1 gene (
A number of oligomers were designed to target the 5′ UTR and/or exon 2 of MAPT pre-mRNA. See
The oligomers were synthesized using methods well known in the art. Exemplary methods of preparing such oligomers are described in Barciszewski et al., Chapter 10—Locked Nucleic Acid Aptamers” in Nucleic Acid and Peptide Aptamers: Methods and Protocols, vol. 535, Gunter Mayer (ed.) (2009), the entire contents of which is hereby expressly incorporated by reference herein.
Progressive supranuclear palsy (PSP) is a neurodegenerative syndrome that is clinically characterized by progressive postural instability, supranuclear gaze palsy, parkinsonism and cognitive impairment. PSP is defined neuropathologically by the accumulation of tau-positive neurofibrillary tangles in brain regions extending from the cerebral cortex, basal ganglia to the cerebellum and brainstem. The most severely affected brain regions include the brainstem substantia nigra, pontine nuclei and the cerebellar dentate nucleus. Tauopathy in these regions is believed to underpin several clinical features of PSP such as postural instability, dysarthria and gaze palsy. Suppression of Tau mRNA transcripts and, consequently, protein in the brain regions, can have therapeutic significance for treatment of PSP patients.
Subjects were male cynomolgus monkeys weighing 3.5-10.0 kg at the start of the study. Each was implanted with an intrathecal CSF catheter entering at the L3 or L4 vertebrae extending to approximately the L1 vertebra. The proximal end of the catheter was connected to a subcutaneous access port. CSF was collected through the port by gravity flow to a maximum of 0.5 ml CSF per sample. The CSF was centrifuged and the supernatent was kept at −90° C. until analyzed. Blood plasma obtained from an available vein was kept at −90° C. until analyzed.
Cynomolgus monkeys were administered with ASO-1933, which was dissolved in saline, at 0.33 ml/min in a 1.0 ml volume followed by a 0.5 ml sterile water flush. Total infusion time was 4.5 min.
Cynomolgus monkeys were administered the appropriate volume of a commercially available euthanasia solution while anesthetized with ketamine and isoflurane. Necropsy tissues were obtained immediately thereafter and the brain was transferred to wet ice for dissection. Areas of interest were dissected using 6 mm slices in an ASI Cyno Brain Matrix as well as free handed techniques. Samples were placed fresh in RNAlater, or frozen on dry ice for later analysis. Some slices were frozen intact for immunohistochemical analysis. Slices were placed in a weigh boat and floated on isopentane cooled with dry ice. Once frozen, slices were stored at −90° C. until analysis.
For brain block sectioning, the frozen brain blocks were cut on a cryostat coronal sections, and sections were thaw-mounted onto super frost slides, dried, re-frozen on dry ice, and stored at −80° C. until use. Brain sections collected from the cynomolgus monkey dosed with vehicle, ASO-1933 at 16 mg (1×16) or ASO-1933 at 16 mg twice (2×16, with 2 weeks apart) were used for the in situ hybridization (ISH) study.
In order to measure Tau mRNA expression using [35S]labeled antisense ISH, a Tau DNA template and [35S]labeled antisense probes were synthesized. A Tau DNA template (425 bp, 687-1111, accession number: XM_005584540.1) was amplified from a cynomolgus monkey cDNA library (Zyagen KD-201) by PCR using forward primer 5′-CAA GCT CGC ATG GTC AGT AA-3′ (SEQ ID NO: 954) and reverse primer 5′-AAT TAA CCC TCA CTA AAG GGA GA TTC TCA GTG GAG CCG ATC TT-3′ (SEQ ID NO: 955). Products of desired size were observed by gel electrophoresis. The Tau DNA template was transcripted with T3 RNA polymerase (Invitrogen AM1316) using [35S]UTP (Perkin Elmer NEG-739) to produce a [35S]labeled antisense ISH probe.
To measure Tau mRNA ISH using [35S]labeled antisense probe, slides were thawed, fixed in 4% paraformaldehyde for 15 min at 4° C. followed by rinsing. Slides were then treated in acetic anhydride/triethanolamine followed by rinsing. Slides were pre-hybridized in pre-hybridization solution at 50° C. for 3 hours and hybridized with 1.5×104 cpm/ul [35S]riboprobe (0.75 ml/slide) in hybridization solution. After hybridization, slides were washed at room temperature. Slides were then treated with Rnase A at 37° C., washed twice, followed by a high stringency wash. The sections were dehydrated in 90% alcohol containing 0.3 M NH4Ac, dried, and exposed against phosphor screen (Perkin Elmer PPN 7001487). After exposure, autoradiographic images on the screen were captured and analyzed using Cyclone storage phosphor system and OptiQuant Acquisition and Analysis software (PerkinElmer, Waltham, Mass.).
QuantiGene® ViewRNA tissue ISH was used to detect Tau mRNA expression at the subnucleus and cellular levels. An antisense probe (type-1) targeting Tau mRNA (2344-3300, accession number: XM_005584529) was synthesized by Affymetrix. Slides were fixed in 4% formaldehyde in phosphate buffered saline (PBS). After passing through alcohol gradients for 10 minutes each, slides were dried, followed by protease QF digestion. Subsequently, sections were washed and hybridized with the target probe. Slides were then washed in wash buffer and stored in storage buffer overnight. Slides were then processed through a series of sequential PreAmp and Amp hybridization steps. The sections were incubated with Label Probe AP followed by incubation with Fast Red Substrate, rinsed in PBS, and counterstained using either Gill's Hematoxylin or DAPI. Slides were coverslipped using DAKO ultramount mounting medium and stored. Labeled Tau mRNA was visualized using either a Leica brightfield microscope or a Leica confocal fluorescence microscope (excitation: 630 nm; emission: 760).
To measure Tau protein expression, Tau12 (BioLegend, San Diego, Calif., epitope to amino acids 6-18 on tau 441 sequence) and BT2 (Thermo Scientific, Rockville, Ill., epitope to amino acids 194-198) were used to coat Costar 3925 ELISA plates at 2.5 and 1 μg/ml, respectively. Plates were incubated for 1 h at 37° C. before washing with TBS with 0.05% Tween-20 (TBST). Non-specific binding was blocked by the addition of 3% bovine serum albumin (BSA) in TBS with 0.1% Tween-20 for 4 h at room temperature with shaking. Plates were washed with TBST before the addition of samples or standard curve generated with recombinant h-tau441 protein, both of which were prepared in TBST plus 1% BSA. Plates containing standard curve and samples were incubated overnight at 4° C. with shaking. The following detection antibodies were conjugated with alkaline phosphatase (AP) using the Lightning Link Conjugation Kit (Novus Biologicals, Littleton, CO): BT2 and HT7 (Thermo Scientific, epitope of 159-163). AP-conjugated detection antibodies were diluted in TBST plus 1% BSA and co-incubated with samples and standard curve for 1 h at room temperature with shaking. After washing with TBST, Tropix CDP-Star Ready-to-Use with Sapphire-II AP substrate (Applied Biosystems, Bedford, Mass.) was added for 30 min. Chemiluminescent signal was determined using a Perkin Elmer EnVision microplate reader (Waltham, Mass.).
The N-terminal tau sandwich ELISA (Tau12-BT2) consists of the anti-tau antibody Tau12 as capture and detection with an alkaline phosphatase (AP) conjugate of the anti-tau antibody BT2. The mid-domain tau sandwich ELISA (BT2-HT7) consists of the anti-tau antibody BT2 as the capture antibody and detection with an alkaline phosphatase (AP) conjugate of the anti-tau antibody HT7.High binding black well ELISA plates (Costar, Corning, Tewksbury, Mass.) were coated with anti-Tau BT2 monoclonal antibody (Thermo, Waltham, Mass.) at 2.5 μg/ml or Tau12 anti-tau monoclonal antibody (Covance) at 5 μg/ml in tris buffered saline (50 μL/well). The plates were washed with tris buffered saline containing 0.05% tween-20 (TBS-T) followed by blocking at room temperature with shaking in 3% BSA/TBS (BSA from Roche, Indianapolis, IN). The plates were rewashed as listed above followed by sample addition in triplicate (50 μL/well). Cynomolgus monkey CSF samples were diluted 1:30 (BT2/HT7) or 1:25 (Tau12/BT2) in 1% BSA/TBS-T. A Tau 441 (R-peptide, Bogart, Ga.) standard curve was made. The samples were incubated on the ELISA plate overnight at 4° C. with shaking. AP conjugated HT7 or BT2 was diluted to 0.25 μg/ml (HT7) or 0.1 μg/ml (BT2) in 1% BSA/TBS-T was added to the plates (50 μL/well) for co-incubation with standards and samples for 1 hour at room temperature with shaking. The plates were re washed followed by the addition of chemiluminescent substrate (Tropix CDP Star, Applied Biosystems, Grand Island, N.Y.) (100 μL/well) and incubation at room temperature with shaking for 30 minutes. The plates were read on a Perkin Elmer TopCount. Unknown sample values were read off the Tau-441 standard curve using GraphPad Prism software.
These studies demonstrate that intrathecally-applied Tau ASO distributes to the substantia nigra, pontine nuclei and dentate nucleus and suppresses Tau mRNA expression in these brain regions in Cynomolgus monkeys following intrathecal administration of ASO-001933 following two doses (2 week apart) of 16 mg (2×16).
In monkeys, a single intrathecal (IT) dose of 4mg of ASO-001933 produced Tau mRNA reductions between 58% to 80% in cortical brain regions and 63% in cerebellum within 2 weeks post dose (data not shown). These areas of the brain are believed to be important for treatment of Tau-dependent dysfunction in PSP (neurodegenerative tauopathies) and Dravet syndrome (epilepsy and autism spectrum disorders), leading indications for Tau antisense molecules like ASO-001933.
Consistent with Tau mRNA,
ASO-002038 was administered as a single bolus intracerebroventricularly (
To measure tau, rhoA and tubulin mRNA reduction, primary neuronal cultures were established from the forebrain of E18 transgenic mice expressing the human tau transgene on a mouse tau knockout background. (Andorfer et al. J Neurochem 86:582-590 (2003)). Cultures were prepared as described in Example 2. Alternatively, iNeurons from Cellular Dynamics Inc., were used per manufacturer specifications.
Lysis: Cells were plated on poly-D-lysine coated 96 well plates at 50,000 cells per well and maintained in Neurobasal media containing B27, glutamax and Penicillin-Streptomycin. ASOs were diluted in water and added to cells at DIV01 to a final concentration of 5 □M. For IC50 determinations, neurons were treated with a top concentration of 5 uM and a concentration response dilution of 1:3 was used to define the IC50. Following ASO treatment, neurons were incubated at 37° C. for 5 days to achieve steady state reduction of mRNA. Media was removed and cells were washed 1× in DPBS and lysed as follows. Measurement of lysate messenger RNA was performed using the Quantigene 2.0 Reagent System (Affymetrix), which quantitates RNA using a branched DNA-signal amplification method reliant on the specifically designed RNA capture probe set. The working cell lysis buffer solution was made by adding 50 μl proteinase K to 5 ml of pre-warmed Lysis mix and diluted to 1:4 final dilution with dH2O. The working lysis buffer was added to the plate (150 μl/well), triturated to mix, sealed and incubated. Following lysis the wells were titrated to mix and stored at −80° C. or assayed immediately.
Assay: Lysates were diluted in lysis mix dependent on the specific capture probe used (tau,RhoA or tubulin). 80 μl/well total were then added to the capture plate (96 well polystyrene plate coated with capture probes). Working probe sets reagents were generated by combining nuclease-free water 12.1 μl, lysis mixture 6.6 μl, blocking reagent 1 specific 2.0 probe set 0.3 μl (human MAPT catalogue #15486, human RHOA catalogue #SA-11696, or human beta 3 tubulin catalogue #SA-15628) per manufacturer instructions (QuantiGene 2.0 Affymetrix). Then 20 μl working probe set reagents were added to 80 μl lysate dilution (or 80 μl lysis mix for background samples) on the capture plate. Plates were centrifuged and then incubated for 16-20 hours at 55° C. to hybridize (target RNA capture). Signal amplification and detection of target RNA was begun by washing plates with buffer 3 times to remove unbound material. 2.0 Pre-Amplifier hybridization reagent (100 μl/well) was added, incubated at 55° C. for 1 hour then aspirated and wash buffer was added and aspirated 3 times. The 2.0 Amplifier hybridization reagent was then added as described (100 μl/well), incubated for 1 hour at 55° C. and the wash was repeated as described previously. The 2.0 Label Probe hybridization reagent was added next (100 μl/well), incubated for 1 hour at 50° C. and the wash was repeated as described previously. Lastly, the plates were centrifuged to remove any excess wash buffer and 2.0 Substrate was added (100 μ/well). Plates were incubated for 5 minutes at room temperature and plates were imaged on a PerkinElmer Envision multilabel reader in luminometer mode within 15 minutes.
Data determination: For the gene of interest, the average assay background signal was subtracted from the average signal of each technical replicate. The background-subtracted, average signals were divided by the background subtracted average signal for the housekeeping tubulin RNA. The percent inhibition for the treated sample was calculated relative to control treated sample lysate. Results of Quantigene assays for cells treated with the oligomers (ASOs) are shown in
This application is a non-provisional application claiming the benefit of U.S. Provisional Application No. 62/112,058, filed Feb. 4, 2015, U.S. Provisional Application No. 62/156,684, filed May 4, 2015, U.S. Provisional Application No. 62/237,922, filed Oct. 6, 2015, U.S. Provisional Application No. 62/238,941, filed Oct. 8, 2015, U.S. Provisional Application No. 62/279,612, filed Jan. 15, 2016, U.S. Provisional Application No. 62/279,614, filed Jan. 15, 2016, and U.S. Provisional Application No. 62/279,610, filed Jan. 15, 2016, all of which are incorporated herein by reference in their entireties.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2016/016646 | 2/4/2016 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62279610 | Jan 2016 | US | |
| 62279614 | Jan 2016 | US | |
| 62279612 | Jan 2016 | US | |
| 62238941 | Oct 2015 | US | |
| 62237922 | Oct 2015 | US | |
| 62156684 | May 2015 | US | |
| 62112058 | Feb 2015 | US |
