Patent Application
20210198676
The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jul. 1, 2019, is named 18-21019-WO_SL.txt. and is 134,472 bytes in size.
Priming specificity is a key factor when performing either single or multiplexed PCR. With the advent of targeted next generation sequencing (NGS), there is a significant need for highly multiplexed PCR to simultaneously amplify hundreds to thousands of genomic target regions in a single tube. Although advances in primer design and reaction chemistries have largely overcome the formation of PCR artifacts including primer dimer formation and off-target amplification, certain target loci present challenging sequence content for assay design and additional measures to improve specificity are needed. These include target regions of lower base composition complexity and target regions with related pseudogenes or gene homologues of similar sequence. Reduction of such artifacts is critical for targeted next generation sequencing panels as the presence of primer dimers and off-target amplification artifacts increase the cost of sequencing when present in the NGS library as both generate sequenceable products. The addition of the disclosed temperature controlled polymerase inhibitors demonstrate an improvement to both on-target amplification in a highly multiplexed PCR assay as well as a reduction in primer dimer formation.
Additionally, the disclosed polynucleotide-based inhibitors can be used to further simplify NGS library preparation and other workflows by eliminating the need for a purification step following the use of a polymerase when needed for compatibility with subsequent enzymatic steps. For example, inactivation of polymerases used for DNA end repair prior to NGS adapter ligation allows one to eliminate a bead-based purification step. Similarly, if adapter ligation is performed following multiplexed PCR, polymerase activity can be inhibited for the subsequent DNA ligase-mediated NGS adapter ligation step.
Although antibody hotstart polymerase inhibitors are widely used, the advantage of the disclosed temperature controlled polymerase inhibitors is that their activity is reversible, similar to aptamer-based hotstart polymerase inhibitors. An advantage of the present polymerase inhibitors over aptamer-based inhibitors is in the flexibility and ease of design. For polymerase specific inhibition, different replication blocking modifications are used, and by altering the Tm of the partially double-stranded duplex portion, inhibition of polymerase activity can simply be adjusted for reaction temperatures from 16° C. to >75° C. With the disclosed inhibitors, it is possible to inhibit one polymerase type while another polymerase type remains active. A second advantage over some aptamers that require a stem-loop structure for inhibition is that the disclosed inhibitors are comprised of two independent oligonucleotides where annealing and denaturation occurs more cooperatively in a narrower temperature range. This is due to the bimolecular vs. intramolecular sequence complementarity, thereby making them easier to fine-tune to specific reaction conditions.
The present disclosure provides compositions and methods for using polymerase inhibitors in PCR and subsequent enzymatic processing steps.
The polymerase inhibitors of the present disclosure include a partially double-stranded polynucleotide duplex with at least one 5′ overhang (also referred to herein as a “single-stranded region”) as shown in
In some embodiments, a polymerase inhibitor can include a synthetic nucleic acid molecule which includes a first oligonucleotide comprising a first complementary region and a second oligonucleotide comprising a second complementary region and a first single-stranded region positioned 5′ to the second complementary region, where the first complementary region is sufficiently complementary to the second complementary region to form a double-stranded region at a temperature below a melting temperature of the polymerase inhibitor and the first single-stranded region includes a first replication blocking sequence or the first oligonucleotide further comprises a first extension blocking group.
In some embodiments, a polymerase inhibitor of the present disclosure can include a synthetic nucleic acid molecule which can include a first oligonucleotide and a second oligonucleotide, where the first oligonucleotide can include a first complementary region and the second oligonucleotide can include a second complementary region and a first single-stranded region positioned 5′ to the second complementary region, where the first complementary region and the second complementary region are sufficiently complementary to form a double-stranded region at a temperature below a melting temperature of the polymerase inhibitor, where the first oligonucleotide also includes a second single-stranded region positioned 5′ to the first complementary region, where the first single-stranded region can include a first replication blocking sequence or the first oligonucleotide can include a first extension blocking group at a 3′ end of the first oligonucleotide, and where the second single-stranded region can include a second replication blocking sequence or the second oligonucleotide can include a second extension blocking group at a 3′ end of the second oligonucleotide.
In some embodiments, a kit of the present disclosure can include a polymerase inhibitor of the present disclosure and a polymerase.
In some embodiments, a method for performing PCR includes the steps of (i) combining a polymerase inhibitor of the present disclosure with a thermostable polymerase, deoxynucleotides, a substrate polynucleotide, and at least one primer pair comprising a forward primer and a reverse primer sufficient to amplify a target portion of the substrate polynucleotide to form a first reaction mixture under conditions sufficient for the first complementary region and secondary complementary region to form a double-stranded region, and (ii) incubating the first reaction mixture under conditions sufficient to (a) dissociate the first oligonucleotide and the second oligonucleotide of the polymerase inhibitor, (b) allow the forward and reverse primers to anneal to the substrate polynucleotide, and (c) allow the thermostable polymerase to extend the forward and reverse primers to yield PCR amplicons.
In some embodiments, a method for inhibiting polymerase in a PCR reaction product can include the steps of (i) adding a polymerase inhibitor of the present disclosure to a reaction product that includes a thermostable polymerase and PCR amplicons and (ii) enzymatically processing the PCR amplicons at an enzymatic processing temperature.
The summary above, as well as the following detailed description of illustrative embodiments, is better understood when read in conjunction with the appended drawings. For the purpose of illustrating the present disclosure, exemplary constructions of the disclosure are shown in the drawings. However, the disclosure is not limited to specific methods and instrumentalities disclosed herein.
While compositions and methods are described herein by way of examples and embodiments, those skilled in the art recognize the compositions and methods are not limited to the embodiments or drawings described. It should be understood that the drawings and description are not intended to be limited to the particular form disclosed. Rather, the intention is to cover all modifications, equivalents and alternatives falling within the spirit and scope of the appended claims and description. Any headings used herein are for organization purposes only and are not meant to limit the scope of the description of the claims. As used herein, the words “may” and “can” are used in the permissive sense (i.e., meaning having the potential to) rather than the mandatory sense (i.e. meaning must). Similarly, the words “include,” “including,” and “includes” mean including, but not limited to. The present disclosure describes particular embodiments and with reference to certain drawings, but the subject matter is not limited thereto.
The present disclosure will provide description to the accompanying drawings, in which some, but not all embodiments of the subject matter of the disclosure are shown. Indeed, the subject matter may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, rather, these embodiments are provided so that this disclosure satisfies all the legal requirements.
Definitions
Certain terminology is used in the following description for convenience only and is not limiting. Unless specifically set forth herein, the terms “a,” “an,” and “the” are not limited to one element, but instead should be read consistent with the meaning of “one or more,” “at least one,” and “one or more than one.” As used herein “another” means at least a second or more. The terminology includes the words noted above, derivatives thereof and words of similar import.
The use of the term “or” in the claims is used to mean “and/or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive.
Use of the term “about,” when used with a numerical value, is intended to include +/−10%. For example, if a number of nucleotides is identified as about 200, this would include 180 to 200 (plus or minus 10%).
As used herein, the term “synthetic,” with respect to a nucleic molecule refers to a nucleic acid molecule produced by in vitro chemical and/or enzymatic synthesis.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.
The present disclosure generally relates to compositions and methods for using polymerase inhibitors in PCR and subsequent enzymatic processing steps.
Polymerase Inhibitors
Generally, the polymerase inhibitors of the present disclosure include a partially double-stranded polynucleotide duplex with at least one 5′ overhang, where the 5′ overhang includes a replication blocking sequence or the recessed 3′ end includes an extension blocking group. The polymerase inhibitors of the present disclosure can include two 5′ overhangs. In such cases, the second 5′ overhang can include a replication blocking sequence or the second recessed 3′ end can include an extension blocking group.
In some embodiments, a polymerase inhibitor of the present disclosure can include a synthetic nucleic acid molecule which can include a first oligonucleotide and a second oligonucleotide, where the first oligonucleotide can include a first complementary region and the second oligonucleotide can include a second complementary region and a first single-stranded region positioned 5′ to the second complementary region, where the first complementary region and the second complementary region are sufficiently complementary to form a double-stranded region at a temperature below a melting temperature of the polymerase inhibitor, and where the first single-stranded region can include a first replication blocking sequence or the first oligonucleotide can include a first extension blocking group at a 3′ end of the first oligonucleotide.
In some embodiments, a polymerase inhibitor of the present disclosure, a polymerase inhibitor of the present disclosure can include a synthetic nucleic acid molecule which can include a first oligonucleotide and a second oligonucleotide, where the first oligonucleotide can include a first complementary region and the second oligonucleotide can include a second complementary region and a first single-stranded region positioned 5′ to the second complementary region, where the first complementary region and the second complementary region are sufficiently complementary to form a double-stranded region at a temperature below a melting temperature of the polymerase inhibitor, where the first oligonucleotide also includes a second single-stranded region positioned 5′ to the first complementary region, where the first single-stranded region can include a first replication blocking sequence or the first oligonucleotide can include a first extension blocking group at a 3′ end of the first oligonucleotide, and where the second single-stranded region can include a second replication blocking sequence or the second oligonucleotide can include a second extension blocking group at a 3′ end of the second oligonucleotide.
In some embodiments, the first oligonucleotide and the second oligonucleotide are separate oligonucleotides, i.e. they are not part of the same polynucleotide. In some embodiments, the first oligonucleotide and the second oligonucleotide can be part of the same polynucleotide. For example, the first oligonucleotide and second oligonucleotide can be connected and form a stem loop structure. In some embodiments, the synthetic nucleic acid molecule can further comprise a connecting region that is positioned between a 5′ end of the first oligonucleotide and the 3′ end of the second oligonucleotide. In some embodiments, the connecting region can include deoxynucleotides, ribonucleotides, inosine bases or carbon or other spacers.
In some embodiments, the synthetic nucleic acid molecule can further include an affinity label. By way of example, but not limitation, the affinity label can be biotin or digoxygenin. By way of example, but not limitation, biotin can be added during synthesis using a biotin-label deoxynucleotide.
Complementary Regions
In any of the foregoing embodiments, the complementary regions of the first oligonucleotide and second oligonucleotide of the polymerase inhibitors of the present disclosure—the first complementary region and second complementary region, respectively—can be sufficiently complementary for the first oligonucleotide and the second oligonucleotide to form a double-stranded region at a temperature below a melting temperature. The sequences should not be self-complementary to avoid the formation of secondary structure when the first and second oligonucleotide are dissociated which can inhibit the formation and effectiveness of the inhibitor. In some embodiments, the double-stranded portion of the polymerase inhibitors of the present disclosure can include a low complexity sequence to increase the rate of annealing for duplex formation at permissive temperatures, such as those shown in
In some embodiments, the complementary regions can include from about 6 to about 100 or more nucleotides. By way of example, but not limitation, the first complementary region and second complementary region can include 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 nucleotides and any range or value therebetween. The length of the complementary regions, in addition to other factors such as the sequence of the first and second oligonucleotides, can impact the melting temperature of the polymerase inhibitor.
Single-Stranded Regions
Polymerase inhibitors of the present disclosure can include one or more single-stranded regions. These single-stranded regions can form 5′ overhangs which can further include replication blocking sequences. These 5′ overhangs can generate a natural substrate for polymerase extension due to the 3′ recessed end that is formed by the double-stranded region.
The single-stranded regions—the first single-stranded region and the second single-stranded region—can be of any length that is suitable for use as a polymerase inhibitor and to achieve the desired melting temperature. In some embodiments, the first single-stranded region is from 1 to about 100 nucleotides or more in length. By way of example, but not limitation, the first single-stranded region can include about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 85, 90, 95 or 100 nucleotides and any range or value therebetween. Similarly, in some embodiments, the second single-stranded region is from about 1 to about 100 nucleotides or more in length. By way of example, but not limitation, the second single-stranded region can include about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 85, 90, 95 or 100 nucleotides and any range or value therebetween.
Replication Blocking Sequences
The 5′ overhang(s) of the polymerase inhibitors of the present disclosure can further include a replication blocking sequence. A replication blocking sequence can be any suitable sequence that prevents extension by a polymerase such as, by way of example but not limitation, a general polymerase replication blocking sequence such as a stable abasic site or a carbon spacer. In some embodiments, the replication blocking sequence can be selected from the group consisting of a stable abasic site, a carbon spacer, at least one 2′-O methyl nucleotide, a deoxyuridine base, a deoxyinosine base, and from about 2 to about 50 consecutive nucleotide bases, or any combination thereof. In some embodiments, the replication blocking sequence can include 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50 consecutive ribonucleotides and any range of value therebetween. Certain replication blocking sequences can be specific to particular polymerases. By way of example but not limitation, a consecutive stretch of least two ribo(U) bases or at least 2 ribo(A) bases or a combination thereof can be used to block extension by high fidelity polymerases. Exemplary high fidelity polymerases include Kapa HiFi HotStart ReadyMix (Roche), Q5 DNA Polymerase (NEB), PrimeStar GXL Polymerase (Clontech), and Herculase DNA Polymerase (Agilent). By way of further example but not limitation, a consecutive stretch of at least two ribo(G) bases can be used to block extension by Taq polymerase. By way of further example but not limitation, a deoxyuridine base or deoxyinosine base can be used to block extension by a high fidelity proofreading polymerase, i.e. a high fidelity polymerase having 3′-5′ exonuclease activity, such as, by way of example, but not limitation Kapa HiFi HotStart ReadyMix (Roche).
In some embodiments, the replication blocking sequence is positioned relative to the 3′ recessed end such that it can prevent a partial extension reaction from the 3′ recessed end and preserve the 5′ overhang. By way of example but not limitation, the replication blocking sequence can be within 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides of the double-stranded region, i.e. the corresponding complementary region on the same oligonucleotide, or any range therebetween.
In some embodiments, the single-stranded region can include 5′ terminal deoxynucleotides positioned 5′ of the replication blocking sequence. By way of example, but not limitation, the single-stranded region can include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or more deoxynucleotides and any range therebetween. Exemplary terminal deoxynucleotide sequences are shown in
Extension Blocking Groups and Nuclease Resistant Modifications
In some embodiments, the first oligonucleotide or second oligonucleotide can further include an extension blocking group at a 3′ end of the first oligonucleotide or second oligonucleotide, respectively. As an alternative to a replication blocking sequence or in addition to one, an extension blocking group on the 3′ recessed end can prevent polymerase extension of the polymerase inhibitor. An extension blocking group is any group that, when included, at the 3′ end of the polymerase inhibitor with a complementary 5′ overhang, can prevent extension by a polymerase, while allowing annealing of the polymerase to the polymerase inhibitor when it is partially double-stranded. By way of example, but not limitation, an extension blocking group can be selected from the group consisting of a 3′ phosphate, a 3′ carbon or other spacer, a 3′ inverted dT, a 3′ amino modification and a 3′ dideoxynucleotide or any combination thereof.
Where an extension blocking group is included in a polymerase inhibitor of the present disclosure, a further nuclease resistant modification of the 3′ terminal end can be required to maintain the extension blocking group such as, by way of example but not limitation, when the polymerase is a high fidelity polymerase or polymerase with 3′ to 5′ exonuclease activity. By way of example, but not limitation, the nuclease resistant modification can be a 3′ terminal phosphorothioate linkage. In some embodiments, the nuclease resistant modification can be two or more phosphorothioate linkages. By way of example, but not limitation, the nuclease resistant modification can include 2, 3, 4 or more phosphorothioate linkages. In any of the foregoing embodiments, a polymerase inhibitor of the present disclosure can include both one or more replication blocking sequences and one or more extension blocking groups as well as nuclease resistant modifications.
Polymerases
In some embodiments, a polymerase inhibitor of the present disclosure can be bound to a polymerase. In some embodiments, a polymerase inhibitor of the present disclosure can be bound to one or more polymerases. In some embodiments, the polymerase inhibitor of the present disclosure is bound to two polymerases.
As noted, the types of replication blocking sequence can, in some instances, be specific to certain polymerases. The polymerase inhibitors of the present disclosure can generally be used to inhibit any polymerase, however, certain embodiments may be useful to inhibit specific polymerases such as Taq polymerase or a high fidelity polymerase.
Melting Temperatures
The melting temperature of the polymerase inhibitor can be calculated by known methods known to one of ordinary skill in the art. By way of example, but not limitation, commercial software such as that found on the IDT (idtdna.com), NEB (neb.com) and ThermoFisher (thermofisher.com) websites can be used to calculate the Tm of the polymerase inhibitor based on the sequences of the first oligonucleotide and the second oligonucleotide and on other parameters such as buffer, salt concentration and the like. In addition, in some instances, polymerase binding can alter the melting temperature by stabilizing the polymerase inhibitor. The melting temperature of the double-stranded portion of the inhibitor is important for regulating the switch to reversible polymerase inactivation. Incubation at temperatures below the melting temperature of the inhibitor duplex results in polymerase binding and inhibition of polymerase activity as shown in
In some embodiments, the melting temperature of the polymerase inhibitor is below 90° C., 89° C., 88° C., 87° C., 86° C., 85° C., 84° C., 83° C., 82° C., 81° C., 80° C., 79° C., 78° C., 77° C., 76° C., 75° C., 74° C., 73° C., 72° C., 71° C., 70° C., 69° C., 68° C., 67° C., 66° C., 65° C., 64° C., 63° C., 62° C., 61° C., 60° C., 59° C., 58° C., 57° C., 56° C., 55° C., 54° C., 53° C., 52° C., 51° C., 50° C. or lower and any range or value therebetween. In some embodiments the melting temperature of the polymerase inhibitor is 90° C., 89° C., 88° C., 87° C., 86° C., 85° C., 84° C., 83° C., 82° C., 81° C., 80° C., 79° C., 78° C., 77° C., 76° C., 75° C., 74° C., 73° C., 72° C., 71° C., 70° C., 69° C., 68° C., 67° C., 66° C., 65° C., 64° C., 63° C., 62° C., 61° C., 60° C., 59° C., 58° C., 57° C., 56° C., 55° C., 54° C., 53° C., 52° C., 51° C., 50° C. or lower and any range or value therebetween. The desired melting temperature of the polymerase inhibitor can depend on the application. By way of example, but not limitation, if a polymerase chain reaction (PCR) is to be performed, the melting temperature of the polymerase inhibitor can be below an annealing temperature or an extension temperature of the PCR. By adjusting the length, base composition, or both of the polymerase inhibitor, a desired melting temperature can be achieved. By way of further example, but not limitation, if the polymerase inhibitor is to be used to inhibit polymerase in a reaction such as an enzymatic processing reaction, the melting temperature can be above the enzymatic processing temperature. In any of the foregoing embodiments, the melting temperature refers to the temperature of the partially double-stranded polymerase inhibitor at which 50% of the partially double-stranded structure is denatured.
Kits
In some embodiments, a kit can include a polymerase inhibitor of the present disclosure. In some embodiments, a kit of the present disclosure can include a polymerase inhibitor of the present disclosure and a polymerase. In some embodiments, the polymerase is a thermostable polymerase. In some embodiments, a kit of the present disclosure can include a polymerase inhibitor of the present disclosure, a polymerase and at least one primer pair. In some embodiments, a kit of the present disclosure can include a polymerase inhibitor of the present disclosure, a polymer, at least one primer pair and deoxynucleotides. In any of the foregoing embodiments, a kit of the present disclosure can further comprise a reaction buffer. In any of the foregoing embodiments, a kit of the present disclosure can include a universal primer. In some embodiments, where a kit of the present disclosure includes a universal primer, it can also include a plurality of different target-specific primer pairs for amplifying a plurality of different loci of a nucleic acid substrate, wherein each of the plurality of target-specific primer pairs comprise a forward primer and a reverse primer, wherein the forward primer and the reverse primer comprise a 3′ complementary sequence that is complementary to a first sequence of the nucleic acid substrate and a second sequence of the nucleic acid sequence, respectively, wherein the first sequence and second sequence is different for each of the plurality of different target-specific primer pairs, wherein the forward and reverse primer of each of the plurality of different target-specific primer pairs further comprise a 5′ terminal sequence that is not complementary to the nucleic acid substrate, wherein the 5′ terminal sequence and the universal primer are complementary to a common sequence.
In any of the foregoing embodiments, the polymerase inhibitor of a kit can include a replication blocking sequence specific to the polymerase that is included in the kit. By way of example, but not limitation, where the kit includes Taq polymerase, the polymerase inhibitor can include at least one replication blocking sequence such as the first replication blocking sequence which includes a consecutive stretch of two or more ribo(G) bases. By way of further example, but not limitation, where the kit includes a high fidelity polymerase, the polymerase inhibitor can include at least one replication blocking sequence such as the first replication blocking sequence which includes a consecutive stretch of at least two ribo(U) bases or two ribo(A) bases.
In accordance with the present disclosure, a kit can include any of the components necessary to perform a reaction, such as a PCR reaction of enzymatic processing step, in addition to a polymerase inhibitor of the present disclosure.
In some embodiments, a kit of the present disclosure includes a polymerase inhibitor of the present disclosure and a ligase. In some embodiments, a kit of the present disclosure can include a polymerase inhibitor of the present disclosure, a ligase, and an adaptor polynucleotide.
In any of the foregoing embodiments where the polymerase inhibitor is not a single polynucleotide, a kit of the present disclosure can include the first oligonucleotide and the second oligonucleotide in separate packaging, e.g. separate tubes.
Methods
Polymerase inhibitors of the present disclosure can be useful for reversible activation of thermostable polymerases for PCR. Exemplary polymerase inhibitors are shown in
Polymerase inhibitors of the present disclosure can also be used for temperature controlled inactivation of polymerase activity after PCR or other polymerase based enzymatic incubation and can eliminate a purification step when needed for compatibility with subsequent enzymatic incubations. In such methods, high melting temperature polymerase inhibitors can be used that are above the desired reaction conditions. Exemplary polymerase inhibitors are shown in
In some embodiments, a method for performing PCR includes the steps of (i) combining a polymerase inhibitor of the present disclosure with a thermostable polymerase, deoxynucleotides, a substrate polynucleotide, and at least one primer pair comprising a forward primer and a reverse primer sufficient to amplify a target portion of the substrate polynucleotide to form a first reaction mixture under conditions sufficient for the first complementary region and secondary complementary region to form a double-stranded region, and (ii) incubating the first reaction mixture under conditions sufficient to (a) dissociate the first oligonucleotide and the second oligonucleotide of the polymerase inhibitor, (b) allow the forward and reverse primers to anneal to the substrate polynucleotide, and (c) allow the thermostable polymerase to extend the forward and reverse primers to yield PCR amplicons. In some embodiments, the method for performing PCR further includes step (iii) enzymatically processing the PCR amplicons in the first reaction mixture at an enzymatic processing temperature. In some embodiments, the thermostable polymer and polymerase inhibitor are mixed before being combined with the substrate polynucleotide, at least one primer pair and deoxynucleotides. In some embodiments, the temperature for the conditions sufficient in step (ii) is a temperature above the melting temperature of the polymerase inhibitor. In some embodiments, the temperature for the conditions sufficient in step (ii) is at least 5° C. above the melting temperature of the polymerase inhibitor. By way of example but not limitation, the temperature can be about 5° C., 6° C., 7° C., 8° C., 9° C., 10° C., 11° C., 12° C., 13° C., 14° C., 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C. or 50° C. higher than the melting temperature of the polymerase inhibitor or any range or value therebetween. In some embodiments, the enzymatic processing temperature in step (iii) is below the melting temperature of the polymerase inhibitor. In some embodiments, the enzymatic processing temperature of step (iii) can be at least 5° C. below the melting temperature of the polymerase inhibitor. By way of example but not limitation, the enzymatic processing temperature can be about 5° C., 6° C., 7° C., 8° C., 9° C., 10° C., 11° C., 12° C., 13° C., 14° C., 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C. or 50° C. lower than the melting temperature of the polymerase inhibitor or any range or value therebetween. In some embodiments, the enzymatic processing step (iii) can include (a) adding a ligase and an adaptor polynucleotide to the first reaction mixture after step (ii) and (b) incubating the PCR amplicons, ligase and adaptor polynucleotide under conditions sufficient to ligate the adaptor polynucleotide to at least a portion of the PCR amplicons. In some embodiments, the method for performing PCR in step (i) can include (a) adding a universal primer to the first reaction mixture, where the forward and reverse primer of each of the at least one primer pair each comprise a 5′ terminal sequence that is not complementary to the substrate polynucleotide, where at least a portion of the universal primer and the 5′ terminal sequence are complementary to a common sequence. In embodiments with the universal primer, the conditions sufficient in step (ii) can be further sufficient to (d) allow the universal primer to anneal to the PCR amplicons; and (e) allow the thermostable polymerase to extend the universal primer to yield universal PCR amplicons. In some embodiments, where the PCR reaction yield universal PCR amplicons, the method can further comprise an enzymatic processing step at an enzymatic processing step as described in the present disclosure.
In some embodiments, a method for inhibiting polymerase in a PCR reaction product can include the steps of (i) adding a polymerase inhibitor of the present disclosure to a reaction product that includes a thermostable polymerase and PCR amplicons and (ii) enzymatically processing the PCR amplicons at an enzymatic processing temperature. In some embodiments, the enzymatic processing temperature of step (iii) can be at least 5° C. below the melting temperature of the polymerase inhibitor. By way of example but not limitation, the enzymatic processing temperature can be about 5° C., 6° C., 7° C., 8° C., 9° C., 10° C., 11° C., 12° C., 13° C., 14° C., 15° C., 20° C., 25° C., 30° C., 35° C., 40° C., 45° C. or 50° C. lower than the melting temperature of the polymerase inhibitor or any range or value therebetween. In some embodiments, the enzymatic processing step (iii) can include (a) adding a ligase and an adaptor polynucleotide to the first reaction mixture after step (ii) and (b) incubating the PCR amplicons, ligase and adaptor polynucleotide under conditions sufficient to ligate the adaptor polynucleotide to at least a portion of the PCR amplicons. I
Generally, the molarity of the polymerase inhibitor should be in excess of the polymerase molecules in order to drive complete polymerase binding and inhibition at temperatures below the melting temperature of the inhibitor duplex. In some embodiments, the polymerase inhibitor is added to a reaction at a molar amount between about 2 and about 1000 times the molar amount of the polymerase, i.e. a molar ratio of polymerase inhibitor to polymerase of between about 1:1 and about 1000:1. By way of example, but not limitation, the molar ratio between the polymerase inhibitor and polymerase can be about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 100:1, 200:1, 300:1, 400:1, 500:1, 600:1, 700:1, 800:1, 900:1, 1000:1 or more and any range or value therebetween. Generally, the molarity of the polymerase inhibitor should be in excess of the substrate polynucleotide when PCR is performed. In some embodiments, where PCR is performed, the molar ratio of polymerase inhibitor to the substrate polynucleotide can, by way of example, but not limitation, between about 2:1 to about 1000:1. By way of example, but not limitation, the molar ratio between the polymerase inhibitor and substrate polynucleotide can be about 1.1:1, 1.5:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 100:1, 200:1, 300:1, 400:1, 500:1, 600:1, 700:1, 800:1, 900:1, 1000:1 or more and any range or value therebetween.
The polymerase inhibitors of the present disclosure can be used in any method where polymerases are used or present. By way of example but not limitation, such methods include PCR and amplicon processing. Non-limiting, exemplary methods that could include a polymerase inhibitor of the present disclosure include the multiplex PCR methods used for the following commercial kits: Swift Biosciences Accel-Amplicon, Swift Biosciences Swift Amplicon HS, Pillar Biosciences ONCO/Reveal BRCA1 & BRCA2 panel, Ion AmpliSeq Cancer Hotspot Panel v2, Illumina TruSeq Amplicon—Cancer Panel, Illumina TruSight Panels, AmpliSeq for Illumina Comprehensive Cancer Panel, Qiagen QuantiFast Kits. Non-limiting, exemplary methods that could include a polymerase inhibitor of the present disclosure include the methods used for the following commercial kits: Swift Biosciences Swift 2S Turbo Library kit, Swift 2S library kit, Roche Kapa HiFi, Roche Kapa Hyper, New England Biolabs NEBNext® Multiplex Oligos.
The following examples, as described below, use materials with the sequences in Tables 1-3 as provided below.
Materials
Inhibitor oligonucleotide (Table 1, 18-57)
Inhibitor oligonucleotide (Table 1, 18-58)
Accel-Amplicon 56G Oncology Panel (Swift Biosciences, cat #AL-56248)
10 ng/μl Human genomic DNA (Coriell Institute, NA12878)
Low TE buffer (Teknova cat #TO227)
Methods
An Accel-Amplicon 56G library was made following the manufacturers protocol with the following changes. A partially double stranded polynucleotide duplex with a 5′ overhang and a 4 riboU stretch at each end was made by combining oligonucleotides 18-57 and 18-58 at equimolar concentrations in low TE buffer and is referred to as the polymerase inhibitor in this example. The multiplex PCR reaction was set up by first adding the amount of polymerase inhibitor to the polymerase enzyme that would make a final concentration of 0 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, or 10 μM in the 30 μl multiplex PCR reaction. Reactions were set-up on ice and at room temperature for each concentration. The additional reagents were then added to the reactions either on ice or at room temperature such that the 30 μl reaction volume consisted of 24 μl polymerase enzyme plus polymerase inhibitor, 2 μl target-specific primers, 3 μl universal primer, and 1 μl of human genomic DNA. For room temperature set-up, the reaction was incubated at room temperature for 30 minutes before cycling. For ice set-up, the reaction was immediately placed in the thermocycler for amplification. PCR amplification, adapter ligation, and library quantification were performed as described by the manufacturer. Libraries were sequenced on a MiniSeq (Illumina) with paired end reads of 151 bases.
Results
Prior to data analysis, sequence-specific primer trimming was performed from the 5′ end of both read 1 and read 2 to remove synthetic primer sequences. Reads were aligned to the human genome and to the target regions. Primer dimers were defined as reads with an insert size of less than 35 bases. No primer dimer formation was detected with an on-ice set-up and addition of the polymerase inhibitor eliminated detectable primer dimers with a room temperature set-up when added at 1 μM or greater (
Conclusions
Addition of a partially double-stranded polynucleotide duplex with a 5′ overhang containing a 4 riboU stretch decreased primer dimer amplification when added at greater than or equal to 1 μM in a multiplex PCR with a non-hotstart polymerase set up at room temperature. Addition of this molecule did not have a notable effect on other sequencing metrics used to evaluate multiplex PCR quality, on target and coverage uniformity, when used at less than 10 μM.
Materials
Inhibitor oligonucleotide (Table 1, 18-57)
Inhibitor oligonucleotide (Table 1, 18-58)
Accel-Amplicon Custom NGS Panel (Swift Biosciences)
10 ng/μl Human genomic DNA (Coriell Institute, NA12878)
Low TE buffer (Teknova cat #TO227)
544 target-specific primers (Table 2)
Methods
An Accel-Amplicon NGS library was made following the manufacturers protocol with the following changes. For the multiplex PCR reaction, a custom set of target-specific primer pairs was used consisting of a mix of 544 target-specific primers present at different concentrations as indicated in Table 2. Primers listed in Table 2 have a 5′ tail of the following sequence TCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 553). This panel was not fully optimized for amplicon performance and therefore made it possible to observe changes in nonspecific priming by the polymerase. A partially double stranded polynucleotide duplex with a 5′ overhang and a 4 riboU stretch at each end was made by combining oligonucleotides 18-57 and 18-58 at 30 μM each and is referred to as the polymerase inhibitor in this example. The multiplex PCR reaction was set up by first adding 5 μl of the polymerase inhibitor for a final concentration of 5 μM or 5 μl of low TE buffer to polymerase at room temperature or on ice. The additional reagents were then added to the reactions either at room temperature or on ice such that the 30 μl reaction volume consisted of 20 μl polymerase plus polymerase inhibitor or low TE buffer, 2 μl target-specific primer pairs, 3 μl universal primer, 1 μl of human genomic DNA, and 4 μl low TE buffer. For room temperature set-up, the reaction was incubated at room temperature for 30 minutes before cycling. For ice set-up, the reaction was immediately placed in the thermocycler for amplification. The following cycling program was run on all reaction mixes: 30 seconds at 98° C. followed by 4 cycles of 10 seconds at 98° C., 5 minutes at 63° C., and 1 minute at 65° C., then 22 cycles of 10 seconds at 98° C. and 1 minute at 64° C., and completed with 1 minute at 65° C. Reaction purification, adapter ligation, and library quantification was performed as described by the manufacturer. Libraries were sequenced on a MiniSeq (Illumina) with paired end reads of 151 bases.
Results
All libraries were prepared in duplicate and data shown are an average of the two libraries. Prior to data analysis, sequence-specific primer trimming was performed from the 5′ end of both read 1 and read 2 to remove synthetic primer sequences. Reads were aligned to the human genome and to the target regions. Primer dimers were defined as reads with an insert size of less than 35 bases. Primer dimer formation increased by greater than 5-fold with a room temperature set-up compared to ice (
Conclusions
Addition of a partially double-stranded polynucleotide duplex with a 5′ overhang containing a 4 riboU stretch decreased primer dimer amplification and increased polymerase specificity in a multiplex PCR used to create a targeted NGS library. These advantages were most evident with a room temperature set-up but were also observed when the reaction was set-up on ice.
Materials
Inhibitor oligonucleotide (Table 1, 18-57)
Inhibitor oligonucleotide (Table 1, 18-58)
Universal primer (Table 3, 16-365)
Q5® Hot Start High-Fidelity 2× Master Mix (NEB, cat #M0494)
10 ng/μl genomic DNA
Low TE buffer (Teknova cat #T0227)
1244 forward target-specific primers (Table 3)
1244 reverse target-specific primers (Table 3)
P5 primer consisting of full-length Illumina P5 adapter sequence and a 3′ tag (Table 3, 18-190)
P7 indexing primers consisting of full-length Illumina P7 adapter sequence (Table 3, 17-1195 and 17-1196)
SPRIselect reagent (Beckman Coulter, B23318)
20% PEG-8000/2.5M NaCl solution.
Methods
Genomic DNA was diluted in low TE buffer. 1244 target-specific forward primers and 1244 target-specific reverse primers, targeting hotspot SNPs found throughout the genome were designed with a melting temperature between 62.5° C. and 68.0° C. and with an amplicon size from 116 to 211 base pairs. These 2488 target-specific primers were combined at 60 nM each. For each amplicon both the forward and reverse target-specific primers contained the following 23 base pair universal sequence, TCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 554), at the 5′ end. The forward target-specific primer also contained the following 17 base pair sequence, AGCAGGATCGGTATGGC (SEQ ID NO: 555), between the 23 base pair universal sequence and the target-specific sequence. A partially double stranded polynucleotide duplex with a 5′ overhang and a 4 riboU stretch at each end was made by combining oligonucleotides 18-57 and 18-58 at 30 μM each and is referred to as the polymerase inhibitor in this example. A first multiplex PCR reaction for target selection and amplification was performed in 30 μl. The reaction was set up by first adding 5 μl of the polymerase inhibitor for a final concentration of 5 μM or 5 μl of low TE buffer to 15 μl of Q5 Hot Start High-Fidelity 2× Master Mix (2000 U/mL) on ice. The additional reagents were then added to the reactions on ice such that the 30 μl reaction volume consisted of 20 μl Q5 Hot Start High-Fidelity 2× Master Mix plus polymerase inhibitor or low TE buffer, 3 μl 100 μM universal primer 16-365, 2 μl target-specific primer mix, 1 μl of genomic DNA, and 4 μl low TE buffer. The following cycling program was run on all reaction mixes: 30 seconds at 98° C. followed by 4 cycles of 10 seconds at 98° C. and 6 minutes at 66° C., then 18 cycles of 10 seconds at 98° C., 15 seconds at 60° C., and 1 minute at 66° C., and completed with 1 minute at 65° C. A purification was performed with 30 μl SPRIselect beads (1.0× ratio) and the beads were resuspended in 30 μl of a second reaction mix containing 15 μl Q5 Hot Start High-Fidelity 2× Master Mix, 2.5 μl 6 uM P5 primer 18-190, and 2.5 ul 6 μM P7 indexing primer 17-1195 or 17-1196. The following cycling program was run on all reaction mixes: 45 seconds at 98° C. followed by 8 cycles of 10 seconds at 98° C., 15 seconds at 60° C., and 1 minute at 66° C. to index and add full-length adapters to the amplicons. The reaction was purified with 26 μl of 20% PEG-8000/2.5M NaCl solution (0.85× ratio) and the DNA was eluted in 20 μl low TE Buffer. Library was quantified by qPCR and sequenced on a Mini Seq (Illumina) with paired end reads of 151 bases.
Results
Adapter trimming was performed, and reads were aligned to the reference genome and to the target regions. Intended amplicons had a minimum insert length of 133 bp, a 116 bp minimal amplicon size plus a 17 bp tag from the forward primer. Therefore, any sequences shorter than 133 bp are unintended products from primer dimer formation and/or off-target priming. Read length was assessed in the presence or absence of the polymerase inhibitor and the presence of short reads, less than 55 bp, was reduced by 9.5% in the presence of the polymerase inhibitor (
Conclusions
Addition of a partially double-stranded polynucleotide duplex with a 5′ overhang containing a 4 riboU stretch decreased the presence of short, unwanted reads in a multiplex PCR with a hotstart DNA polymerase used to create a targeted NGS library.
It should be understood that the foregoing description provides embodiments of the present invention which can be varied and combined without departing from the spirit of this disclosure. To the extent that the different aspects disclosed can be combined, such combinations are disclosed herein.
The present application is a continuation of International Application No. PCT/US2019/040367, filed Jul. 2, 2019, published as WO 2020/010124, which claims priority to U.S. Provisional Application No. 62/693,265, filed Jul. 2, 2018, the entirety of each of which is incorporated herein by reference.
| Number | Date | Country | |
|---|---|---|---|
| 62693265 | Jul 2018 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | PCT/US2019/040367 | Jul 2019 | US |
| Child | 17138996 | US |
