Toxins active against pests

Abstract

Disclosed and claimed are novel methods for controlling lepidopteran pests whereby said pests are contacted with a pesticidal amount of a toxin obtainable from Bacillus thuringiensis isolate PS31G1 (NRRL B-21560).

Description

BACKGROUND OF THE INVENTION

The soil microbe Bacillus thuringiensis (B.t.) is a Gram-positive, spore-forming bacterium characterized by parasporal crystalline protein inclusions. These inclusions often appear microscopically as distinctively shaped crystals. The proteins can be highly toxic to pests and specific in their toxic activity. Certain B.t. toxin genes have been isolated and sequenced, and recombinant DNA-based B.t. products have been produced and approved for use. In addition, with the use of genetic engineering techniques, new approaches for delivering these B.t. endotoxins to agricultural environments are under development, including the use of plants genetically engineered with endotoxin genes for insect resistance and the use of stabilized intact microbial cells as B.t. endotoxin delivery vehicles (Gaertner, F. H., L. Kim [1988]TIBECH 6:S4-S7). Thus, isolated B.t. endotoxin genes are becoming commercially valuable.

Until the last fifteen years, commercial use of B.i. pesticides has been largely restricted to a narrow range of lepidopteran (caterpillar) pests. Preparations of the spores and crystals of B. thuringiensis subsp. kurstaki have been used for many years as commercial insecticides for lepidopteran pests. For example, B. thuringiensis var. kurstai HD-1 produces a crystalline δ-endotoxin which is toxic to the larvae of a number of lepidopteran insects.

In recent years, however, investigators have discovered B.t. pesticides with specificities for a much broader range of pests. For example, other species of B.t., namely israelensis and morrisoni (a.k.a. tenebrionis , a.k.a. B.t. M-7, a.k.a. B.t. san diego ), have been used commercially to control insects of the orders Diptera and Coleoptera, respectively (Gaertner, F. H. [1989] “Cellular Delivery Systems for Insecticidal Proteins: Living and Non-Living Microorganisms,” in Controlled Delivery of Crop Protection Agents , R. M. Wilkins, ed., Taylor and Francis, New York and London, 1990, pp. 245-255.). See also Couch, T. L. (1980) “Mosquito Pathogenicity of Bacillus thuringiensis var. israelensis ,” Developments in Industrial Microbiology 22:61-76; and Beegle, C.C. (1978) “Use of Entomogenous Bacteria in Agroecosystems,” Developments in Industrial Microbiology 20:97-104. Krieg, A., A. M. Huger, G. A. Langenbruch, W. Schnetter (1983) Z. ang. Ent . 96:500-508 describe Bacillus thuringiensis var. tenebrionis , which is reportedly active against two beetles in the order Coleoptera. These are the Colorado potato beetle, Leptinotarsa decemlineata , and Agelastica alni.

Recently, new subspecies of B.t. have been identified, and genes responsible for active δ-endotoxin proteins have been isolated (Höfte, H., H. R. Whiteley [1989 ] Microbiological Reviews 52(2):242-255). Höfte and Whiteley classified B.t. crystal protein genes into four major classes. The classes were Cryl (Lepidoptera-specific), CryII (Lepidoptera- and Diptera-specific), CryIII (Coleoptera-specific), and CryIV (Diptera-specific). The discovery of strains specifically toxic to other pests has been reported (Feitelson, J. S., J. Payne, L. Kim [1992 ] Bio/Technology 10:271-275). CryV has been proposed to designate a class of toxin genes that are nematode-specific. Lambert et al. (Lambert, B., L. Buysse, C. Decock, S. Jansens, C. Piens, B. Saey, J. Seurinck, K. van Audenhove, J. Van Rie, A. Van Vliet, M. Peferoen [1996 ] Appl. Environ. Microbiol 62(1):80-86) describe the chracterization of a Cry9 toxin active against lepidopterans. Published PCT applications WO 94/05771 and WO 94/24264 also describe B.t. isolates active against lepidopteran pests. Gleave et al. ([1991] JGM 138:55-62), Shevelev et al. ([1993 ] FEBS Lett . 336:79-82; and Smulevitch et aL ([1991 ] FEBS Lett . 293:25-26) also describe B.t. toxins. Many other classes of B.t. genes have now been identified.

The cloning and expression of a B.t. crystal protein gene in Escherichia coli has been described in the published literature (Schnepf, H. E., H. R. Whiteley [1981 ] Proc. Natl. Acad. Sci. USA 78:2893-2897.). U.S. Pat. No. 4,448,885 and U.S. Pat. No. 4,467,036 both disclose the expression of B.t. crystal protein in E. coli . U.S. Pat. Nos. 4,990,332; 5,039,523; 5,126,133; 5,164,180; and 5,169,629 are among those which disclose B.t. toxins having activity against lepidopterans. PCT application WO96/05314 discloses PS86W1, PS86V1, and other B.t. isolates active against lepidopteran pests. The PCT patent applications published as WO94/24264 and WO94/05771 describe B.t. isolates and toxins active against lepidopteran pests. B.t. proteins with activity against members of the family Noctuidae are described by Lambert et al. supra. U.S. Pat. Nos. 4,797,276 and 4,853,331 disclose B. thufingiensis strain tenebnonis which can be used to control coleopteran pests in various environments. U.S. Pat. No. 4,918,006 discloses B.t. toxins having activity against dipterans. U.S. Pat. No. 5,151,363 and U.S. Pat. No. 4,948,734 disclose certain isolates of B.t. which have activity against nematodes. Other U.S. patents which disclose activity against nematodes include 5,093,120; 5,236,843; 5,262,399; 5,270,448; 5,281,530; 5,322,932; 5,350,577; 5,426,049; and 5,439,881. As a result of extensive research and investment of resources, other patents have issued for new B.t. isolates and new uses of B.t. isolates. See Feitelson et al., supra, for a review. However, the discovery of new B.t. isolates and new uses of known B.t. isolates remains an empirical, unpredictable art.

Isolating responsible toxin genes has been a slow empirical process. Carozzi et al. (Carozzi, N. B., V. C. Kramer, G. W. Warren, S. Evola, G. Koziel (1991) Appl. Env. Microbiol . 57(11):3057-3061) describe methods for identifying toxin genes. This report does not disclose or suggest the specific primers and probes of the subject invention for lepidopteran-active toxin genes. U.S. Pat. No. 5,204,237 describes specific and universal probes for the isolation of B.t. toxin genes. This patent, however, does not describe the probes and primers of the subject invention.

Black cutworm ( Agrofis ipsilon (Hufnagel); Lepidoptera: Noctuidae) is a serious pest of many crops including maize, cotton, cole crops (Brassica, broccoli, cabbages, Chinese cabbages), and turf. Secondary host plants include beetroots, Capsicum (peppers), chickpeas, faba beans, lettuces, lucerne, onions, potatoes, radishes, rape (canola), rice, soybeans, strawberries, sugarbeet, tobacco, tomatoes, and forest trees. In North America, pests of the genus Agrotis feed on clover, corn, tobacco, hemp, onion, strawberries, blackberries, raspberries, alfalfa, barley, beans, cabbage, oats, peas, potatoes, sweetpotatoes, tomato, garden flowers, grasses, lucerne, maize, asparagus, grapes, almost any kind of leaf, weeds, and many other crops and garden plants. Other cutworms in the Tribe Agrotini are pests, in particular those in the genus Feltia (e.g., F. jaculifera (Guenée); equivalent to ducens subgothica ) and Euxoa (e.g., E. messoria (Harris), E. scandens (Riley), E. auriliaris Smith, E. detersa (Walker), E. tessellate (Harris), E. ochrogaster (Guenée). Host plants include various crops, including rape.

Cutworms are also pests outside North America, and the more economically significant pests attack chickpeas, wheat, vegetables, sugarbeet, lucerne, maize, potatoes, turnips, rape, lettuces, strawberries, loganberries, flax, cotton, soybeans, tobacco, beetroots, Chinese cabbages, tomatoes, aubergines, sugarcane, pastures, cabbages, groundnuts, Cucurbita, turnips, sunflowers, Brassica, onions, leeks, celery, sesame, asparagus, rhubarb, chicory, greenhouse crops, and spinach. The black cutworm A. ipsilon occurs as a pest outside North America, including Central America, Europe, Asia, Australasia, Africa, India, Taiwan, Mexico, Egypt, and New Zealand.

Cutworms progress through several instars as larvae. Although seedling cutting by later instar larvae produces the most obvious damage and economic loss, leaf feeding commonly results in yield loss in crops such as maize. Upon reaching the fourth larval instar, larvae begin to cut plants and plant parts, especially seedlings. Because of the shift in feeding behavior, economically damaging populations may build up unexpectedly with few early warning signs. Their nocturnal habit and behavior of burrowing into the ground also makes detection problematic. Large cutworms can destroy several seedlings per day, and a heavy infestation can remove entire stands of crops.

Cultural controls for A. ipsilon such as peripheral weed control can help prevent heavy infestations; however, such methods are not always feasible or effective. Infestations are very sporadic, and applying an insecticide prior to planting or at planting has not been effective in the past. Some baits are available for control of cutworms in crops. To protect turfgrass such as creeping bentgrass, chemical insecticides have been employed. Use of chemical pesticides is a particular concern in turf because of the close contact the public has with treated areas (e.g., golf greens, athletic fields, parks and other recreational areas, professional landscaping, home lawns). Natural products (e.g., nematodes, azadirachtin) generally perform poorly. To date, Bacillus thuringiensis products have not been widely used to control black cutworm because highly effective δ-endotoxins have not been available.

BRIEF SUMMARY OF THE INVENTION

The subject invention concerns materials and methods useful in the control of non-mammalian pests and, particularly, plant pests. In a specific embodiment, the subject invention provides new toxins useful for the control of lepidopterans. In a particularly preferred embodiment, the toxins of the subject invention are used to control black cutworm. The subject invention further provides nucleotide sequences which encode the lepidopteran-active toxins of the subject invention. The subject invention further provides nucleotide sequences and methods useful in the identification and characterization of genes which encode pesticidal toxins. The subject invention further provides new Bacillus thunngiensis isolates having pesticidal activities.

In one embodiment, the subject invention concerns unique nucleotide sequences which are useful as primers in PCR techniques. The primers produce characteristic gene fragments which can be used in the identification and isolation of specific toxin genes.

In one embodiment of the subject invention, B.t. isolates can be cultivated under conditions resulting in high multiplication of the microbe. After treating the microbe to provide single-stranded genomic nucleic acid, the DNA can be contacted with the primers of the invention and subjected to PCR amplification. Characteristic fragments of toxin-encoding genes will be amplified by the procedure, thus identifing the presence of the toxin-encoding gene(s).

A further aspect of the subject invention is the use of the disclosed nucleotide sequences as probes to detect genes encoding B.t. toxins which are active against lepidopterans.

Further aspects of the subject invention include the genes and isolates identified using the methods and nucleotide sequences disclosed herein. The genes thus identified will encode toxins active against lepidopterans. Similarly, the isolates will have activity against these pests.

New pesticidal B.t. isolates of the subject invention include PS31G1, PS185U2, PS11B, PS218G2, PS213E5, PS28C, PS86BB1, PS89J3, PS94R1, and PS27J2.

In a preferred embodiment, the subject invention concerns plants cells transformed with at least one polynucleotide sequence of the subject invention such that the transformed plant cells express pesticidal toxins in tissues consumed by the target pests. As described herein, the toxins useful according to the subject invention may be chimeric toxins produced by combining portions of multiple toxins.

Such transformation of plants can be accomplished using techniques well known to those skilled in the art and would typically involve modification of the gene to optimize expression of the toxin in plants.

Alternatively, the B.t. isolates of the subject invention, or recombinant microbes expressing the toxins described herein, can be used to control pests. In this regard, the invention includes the treatment of substantially intact B.t. cells, and/or recombinant cells containing the expressed toxins of the invention, treated to prolong the pesticidal activity when the substantially-intact cells are applied to the environment of a target pest. The treated cell acts as a protective coating for the pesticidal toxin. The toxin becomes active upon ingestion by a target insect.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NO. 1 is a forward primer useful according to the subject invention.

SEQ ID NO. 2 is a reverse primer useful according to the subject invention.

SEQ ID NO. 3 is a forward primer useful according to the subject invention.

SEQ ID NO. 4 is a reverse primer useful according to the subject invention.

SEQ ID NO. 5 is a forward primer useful according to the subject invention.

SEQ ID NO. 6 is a reverse primer useful according to the subject invention.

SEQ ID NO. 7 is an amino acid sequence of the toxin designated 11B1AR.

SEQ ID NO. 8 is a nucleotide sequence encoding an amino acid sequence of toxin 11B1AR (SEQ ID NO. 7).

SEQ ID NO. 9 is an amino acid sequence of the toxin designated 11B1BR.

SEQ ID NO. 10 is a nucleotide sequence encoding an amino acid sequence of toxin 11B1BR (SEQ ID NO. 9).

SEQ ID NO. 11 is an amino acid sequence of the toxin designated 1291A.

SEQ ID NO. 12 is a nucleotide sequence encoding an amino acid sequence of toxin A1291A (SEQ ID NO. 11).

SEQ ID NO. 13 is an amino acid sequence of the toxin designated 1292A.

SEQ ID NO. 14 is a nucleotide sequence encoding an amino acid sequence of toxin 1292A (SEQ ID NO. 13).

SEQ ID NO. 15 is an amino acid sequence of the toxin designated 1292B.

SEQ ID NO. 16 is a nucleotide sequence encoding an amino acid sequence of toxin 1292B (SEQ ID NO. 15).

SEQ ID NO. 17 is an amino acid sequence of the toxin designated 31GA.

SEQ ID NO. 18 is a nucleotide sequence encoding an amino acid sequence of toxin 31GA (SEQ ID NO. 17).

SEQ ID NO. 19 is an amino acid sequence of the toxin designated 31 GBR.

SEQ ID NO. 20 is a nucleotide sequence encoding an amino acid sequence of toxin 31GBR (SEQ ID NO. 19).

SEQ ID NO. 21 is an amino acid sequence of the toxin designated 85N1R identified by the method of the subject invention.

SEQ ID NO. 22 is a nucleotide sequence encoding an amino acid sequence of toxin 85N1R (SEQ ID NO. 21).

SEQ ID NO. 23 is an amino acid sequence of the toxin designated 85N2.

SEQ ID NO. 24 is a nucleotide sequence encoding an amino acid sequence of toxin 85N2 (SEQ ID NO. 23).

SEQ ID NO. 25 is an amino acid sequence of the toxin designated 85N3.

SEQ ID NO. 26 is a nucleotide sequence encoding an amino acid sequence of toxin 85N3 (SEQ ID NO. 25).

SEQ ID NO. 27 is an amino acid sequence of the toxin designated 86VIC1.

SEQ E NO. 28 is a nucleotide sequence encoding an amino acid sequence of toxin 86V1C1 (SEQ ID NO. 27).

SEQ ID NO. 29 is an amino acid sequence of the toxin designated 86V1C2.

SEQ ID NO. 30 is a nucleotide sequence encoding an amino acid sequence of toxin 86V1C2 (SEQ ID NO. 29).

SEQ ID NO. 31 is an amino acid sequence of the toxin designated 86V1C3R.

SEQ ID NO. 32 is a nucleotide sequence encoding an amino acid sequence of toxin 86V1C3R (SEQ ID NO. 31).

SEQ ID NO. 33 is an amino acid sequence of the toxin designated F525A.

SEQ ID NO. 34 is a nucleotide sequence encoding an amino acid sequence of toxin F252A (SEQ ID NO. 33).

SEQ ID NO. 35 is an amino acid sequence of the toxin designated F525B.

SEQ ID NO. 36 is a nucleotide sequence encoding an amino acid sequence of toxin F525B (SEQ ID NO. 35).

SEQ ID NO. 37 is an amino acid sequence of the toxin designated F525C.

SEQ ID NO. 38 is a nucleotide sequence encoding an amino acid sequence of toxin F525C (SEQ ID NO. 37).

SEQ ID NO. 39 is an amino acid sequence of the toxin designated F573A.

SEQ ID NO. 40 is a nucleotide sequence encoding an amino acid sequence of toxin F573A (SEQ ID NO. 39).

SEQ ID NO. 41 is an amino acid sequence of the toxin designated F573B.

SEQ ID NO. 42 is a nucleotide sequence encoding an amino acid sequence of toxin F573B (SEQ ID NO. 41).

SEQ ID NO. 43 is an amino acid sequence of the toxin designated F573C.

SEQ ID NO. 44 is a nucleotide sequence encoding an amino acid sequence of toxin F573C (SEQ ID NO. 43).

SEQ ID NO. 45 is an amino acid sequence of the toxin designated FBB1A.

SEQ ID NO. 46 is a nucleotide sequence encoding an amino acid sequence of toxin FBB1A (SEQ ID NO. 45).

SEQ ID NO. 47 is an amino acid sequence of the toxin designated FBB1BR.

SEQ ID NO. 48 is a nucleotide sequence encoding an amino acid sequence of toxin FBB1BR (SEQ ID NO. 47).

SEQ ID NO. 49 is an amino acid sequence of the toxin designated FBB1C.

SEQ ID NO. 50 is a nucleotide sequence encoding an amino acid sequence of toxin FBB1C (SEQ ID NO. 7).

SEQ ID NO. 51 is an amino acid sequence of the toxin designated FBB1D.

SEQ ID NO. 52 is a nucleotide sequence encoding an amino acid sequence of toxin FBB1D (SEQ ID NO. 51).

SEQ ID NO. 53 is an amino acid sequence of the toxin designated J31AR.

SEQ ID NO. 54 is a nucleotide sequence encoding an amino acid sequence of toxin J31AR (SEQ ID NO. 53).

SEQ ID NO. 55 is an amino acid sequence of the toxin designated J32AR.

SEQ ID NO. 56 is a nucleotide sequence encoding an amino acid sequence of toxin J32AR (SEQ ID NO. 55).

SEQ ID NO. 57 is an amino acid sequence of the toxin designated W1FAR.

SEQ ID NO. 58 is a nucleotide sequence encoding an amino acid sequence of toxin W1FAR (SEQ ID NO. 57).

SEQ ID NO. 59 is an amino acid sequence of the toxin designated W1FBR.

SEQ ED NO. 60 is a nucleotide sequence encoding an amino acid sequence of toxin W1FBR (SEQ ID NO. 59).

SEQ ID NO. 61 is an amino acid sequence of the toxin designated W1FC.

SEQ ID NO. 62 is a nucleotide sequence encoding an amino acid sequence of toxin W1FC (SEQ ID NO. 61).

SEQ ID NO. 63 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 64 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 65 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 66 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 67 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 68 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

SEQ ID NO. 69 is an oligonucleotide useful as a PCR primer or hybridization probe according to the subject invention.

DETAILED DISCLOSURE OF THE INVENTION

The subject invention concerns materials and methods for the control of non-mammalian pests. In specific embodiments, the subject invention pertains to new Bacillus thunngiensis isolates and toxins which have activity against lepidopterans. In a particularly preferred embodiment, the toxins and methodologies described herein can be used to control black cutworm. The subject invention further concerns novel genes which encode pesticidal toxins and novel methods for identifying and characterizing B.t. genes which encode toxins with useful properties. The subject invention concerns not only the polynucleotide sequences which encode these toxins, but also the use of these polynucleotide sequences to produce recombinant hosts which express the toxins.

A further aspect of the subject invention concerns novel isolates and the toxins and genes obtainable from these isolates. The novel B.t. isolates of the subject invention have been designated PS31G1, PS185U2, PS11B, PS218G2, PS213E5, PS28C, PS86BB1, PS89J3, PS94R1, PS202S, PS101DD, and PS27J2.

The new toxins and polynucleotide sequences provided here are defined according to several parameters. One critical characteristic of the toxins described herein is pesticidal activity. In a specific embodiment, these toxins have activity against lepidopteran pests. The toxins and genes of the subject invention can be further defined by their amino acid and nucleotide sequences. The sequences of the molecules can be defined in terms of homology to certain exemplified sequences as well as in terms of the ability to hybridize with, or be amplified by, certain exemplified probes and primers. The toxins provided herein can also be identified based on their immunoreactivity with certain antibodies.

Methods have been developed for making useful chimeric toxins by combining portions of B.t. crystal proteins. The portions which are combined need not, themselves, be pesticidal so long as the combination of portions creates a chimeric protein which is pesticidal. This can be done using restriction enzymes, as described in, for example, European Patent 0 228 838; Ge, A. Z., N. L. Shivarova, D. H. Dean (1989) Proc. Natl. Acad. Sci. USA 86:40374041; Ge, A. Z., D. Rivers, R. Milne, D. H. Dean (1991) J. Biol. Chem . 266:17954-17958; Schnepf, H. E., K. Tomczak, J. P. Ortega, H. R. Whiteley (1990) J. Biol. Chem . 265:20923-20930; Honee, G., D. Convents, J. Van Rie, S. Jansens, M. Peferoen, B. Visser (1991) Mol. Microbiol . 5:2799-2806. Alternatively, recombination using cellular recombination mechanisms can be used to achieve similar results. See, for example, Caramori, T., A. M. Albertini, A. Galizzi (1991) Gene 98:37-44; Widner, W. R., H. R. Whiteley (1990) J. Bacteyiol . 172:2826-2832; Bosch, D., B. Schipper, H. van der Kliej, R.A. de Maagd, W.J. Stickema (1994) Biotechnology 12:915-918. A number of other methods are known in the art by which such chimeric DNAs can be made. The subject invention is meant to include chimeric proteins that utilize the novel sequences identified in the subject application.

With the teachings provided herein, one skilled in the art could readily produce and use the various toxins and polynucleotide sequences described herein.

B.t. isolates useful according to the subject invention have been deposited in the permanent collection of the Agricultural Research Service Patent Culture Collection (NRRL), Northern Regional Research Center, 1815 North University Street, Peoria, Ill. 61604, USA. The culture repository numbers of the B.t. strains are as follows:

	Culture	Repository No.	Deposit Date
	B.t. PS11B (MT274)	NRRL B-21556	April 18, 1996
	B.t. PS86BB1 (MT275)	NRRL B-21557	April 18, 1996
	B.t. PS86V1 (MT276)	NRRL B-21558	April 18, 1996
	B.t. P586W1 (MT277)	NRRL B-21559	April 18, 1996
	B.t. PS31G1 (MT278)	NRRL B-21560	April 18, 1996
	B.t. PS89J3 (MT279)	NRRL B-21561	April 18, 1996
	B.t. PS185U2 (MT280)	NRRL B-21562	April 18, 1996

Cultures which have been deposited for the purposes of this patent application were deposited under conditions that assure that access to the cultures is available during the pendency of this patent application to one deterniined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 CFR 1.14 and 35 U.S.C. 122. The deposits will be available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.

Further, the subject culture deposits will be stored and made available to the public in accord with the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they w ill be stored with all the c are necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposit, and in any case, for a period of at least thirty (30) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the culture(s). The depositor acknowledges the duty to replace the deposit(s) should the depository be unable to ftnnish a sample when requested, due to the condition of a deposit. All restrictions on the availability to the public of the subject culture deposit s will be irrevocably removed upon the granting of a patent disclosing them.

Following is a table which provides characteristics of certain isolates useful according to the subject invention.

TABLE 1
Description of B. t. strains toxic to lepidopterans
Culture	Crystal Description	Approx. MW (kDa)	Serotype
PS185U2	small bipyramid	130 kDa doublet, 70 kDa	ND
PS11B	bipyramid tort	130 kDa, 70 kDa	ND
P5218G2	amorpnic	135 kDa, 127 kDa	ND
PS213E5	amorpbic	130 kDa	ND
PS86W1	multiple amorphic	130 kDa doublet	5a5b gatteriae
PS28C	amorphic	130 kDa triplet	5a5b gatteriae
PS86BB1	BP without	130 kDa doublet	5a5b gatteriae
PS89J3	spherical/amorphic	130 kDa doublet	ND
PS86V1	BP	130 kDa doublet	ND
PS94R1	BP and amorphic	130 kDa doublet	ND
HD525	BP and amorpnic	130 kDa	not motile
HD573A	multiple amorphic	135 kDa, 79 kDa doublet, 72 kDa	not motile
P527J2	lemon-shaped	130 kDa 50 kDa	4 (sotto or kenyae)
ND = not determined

In one embodiment, the subject invention concerns materials and methods including nucleotide primers and probes for isolating and identifying Bacillus thuringiensis (B.t.) genes encoding protein toxins which are active against lepidopteran pests. The nucleotide sequences described herein can also be used to identify new pesticidal B.t. isolates. The invention finther concerns the genes, isolates, and toxins identified using the methods and materials disclosed herein.

Genes and toxins. The genes and toxins useful according to the subject invention include not only the full length sequences but also fragments of these sequences, variants, mutants, and fusion proteins which retain the characteristic pesticidal activity of the toxins specifically exemplified herein. Chimeric genes and toxins, produced by combining portions from more than one B.t. toxin or gene, may also be utilized according to the teachings of the subject invention. As used herein, the terms “variants” or “variations” of genes refer to nucleotide sequences which encode the same toxins or which encode equivalent toxins having pesticidal activity. As used herein, the term “equivalent toxins” refers to toxins having the same or essentially the same biological activity against the target pests as the exemplified toxins.

It should be apparent to a person skilled in this art that genes encoding active toxins can be identified and obtained through several means. The specific genes exemplified herein may be obtained from the isolates deposited at a culture depository as described above. These genes, or portions or variants thereof, may also be constructed synthetically, for example, by use of a gene synthesizer. Variations of genes may be readily constructed using standard techniques for making point mutations. Also, fragments of these genes can a be made using commercially available exonucleases or endonucleases according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically cut off nucleotides from the ends of these genes. Also, genes which encode active fragments may be obtained using a variety of restriction enzymes. Proteases may be used to directly obtain active fragments of these toxins.

Equivalent toxins and/or genes encoding these equivalent toxins can be derived from B.t. isolates and/or DNA libraries using the teachings provided herein. There are a number of methods for obtaining the pesticidal toxins of the instant invention. For example, antibodies to the pesticidal toxins disclosed and claimed herein can be used to identify and isolate other toxins from a mixture of proteins. Specifically, antibodies may be raised to the portions of the toxins which are most constant and most distinct from other B.t. toxins. These antibodies can then be used to specifically identify equivalent toxins with the characteristic activity by immunoprecipitation, enzyme linked immunosorbent assay (ELISA), or western blotting. Antibodies to the toxins disclosed herein, or to equivalent toxins, or fragments of these toxins, can readily be prepared using standard procedures in this art. The genes which encode these toxins can then be obtained from the microorganism.

Fragments and equivalents which retain the pesticidal activity of the exemplified toxins would be within the scope of the subject invention. Also, because of the redundancy of the genetic code, a variety of different DNA sequences can encode the amino acid sequences disclosed herein. It is well within the skill of a person trained in the art to create these alternative DNA sequences encoding the same, or essentially the same, toxins. These variant DNA sequences are within the scope of the subject invention. As used herein, reference to “essentially the same” sequence refers to sequences which have amino acid substitutions, deletions, additions, or insertions which do not materially affect pesticidal activity. Fragments retaining pesticidal activity are also included in this definition.

A further method for identifying the toxins and genes of the subject invention is through the use of oligonucleotide probes. These probes are detectable nucleotide sequences. Probes provide a rapid method for identifying toxin-encoding genes of the subject invention. The nucleotide segments which are used as probes according to the invention can be synthesized using a DNA synthesizer and standard procedures.

Certain toxins of the subject invention have been specifically exemplified herein. Since these toxins are merely exemplary of the toxins of the subject invention, it should be readily apparent that the subject invention comprises variant or equivalent toxins (and nucleotide sequences coding for equivalent toxins) having the same or similar pesticidal activity of the exemplified toxin. Equivalent toxins will have amino acid homology with an exemplified toxin. This amino acid homology will typically be greater than 60%, preferably be greater than 75%, more preferably greater than 80%, more preferably greater than 90%, and can be greater than 95%. The amino acid homology will be highest in critical regions of the toxin which account for biological activity or are involved in the determination of three-dimensional configuration which ultimately is responsible for the biological activity. In this regard, certain amino acid substitutions are acceptable and can be expected if these substitutions are in regions which are not critical to activity or are conservative amino acid substitutions which do not affect the three-dimensional configuration of the molecule. For example, amino acids may be placed in the following classes: non-polar, uncharged polar, basic, and acidic. Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the compound. Table 2 provides a listing of examples of amino acids belonging to each class.

TABLE 2
Class of Amino Acid Examples of Amino Acids
Nonpolar            Ala, Val, Leu, Ile, Pro, Met, Phe, Trp
Uncharged Polar     Gly, Ser, Thr, Cys, Tyr, Asn, Gln
Acidic              Asp, Olu
Basic               Lys, Arg, His

In some instances, non-conservative substitutions can also be made. The critical factor is that these substitutions must not significantly detract from the biological activity of the toxin.

The toxins of the subject invention can also be characterized in terms of the shape and location of toxin inclusions, which are described above.

As used herein, reference to “isolated” polynucleotides and/or “purified” toxins refers to these molecules when they are not associated with the other molecules with which they would be found in nature. Thus, reference to “isolated and purified” signifies the involvement of the “hand of man” as described herein. Chimeric toxins and genes also involve the “hand of man.”

Recombinant hosts. The toxin-encoding genes harbored by the isolates of the subject invention can be introduced into a wide variety of microbial or plant hosts. Expression of the toxin gene results, directly or indirectly, in the intracellular production and maintenance of the pesticide. With suitable microbial hosts, e.g., Pseudomonas, the microbes can be applied to the situs of the pest, where they will proliferate and be ingested. The result is a control of the pest. Alternatively, the microbe hosting the toxin gene can be treated under conditions that prolong the activity of the toxin and stabilize the cell. The treated cell, which retains the toxic activity, then can be applied to the environment of the target pest.

Where the B.t. toxin gene is introduced via a suitable vector into a microbial host, and said host is applied to the environment in a living state, it is essential that certain host microbes be used. Microorganism hosts are selected which are known to occupy the “phytosphere” (phylloplane, phyllosphere, rhizosphere, and/or rhizoplane) of one or more crops of interest. These microorganisms are selected so as to be capable of successfully competing in the particular environment (crop and other insect habitats) with the wild-type microorganisms, provide for stable maintenance and expression of the gene expressing the polypeptide pesticide, and, desirably, provide for improved protection of the pesticide from environmental degradation and inactivation.

A large number of microorganisms are known to inhabit the phylloplane (the surface of the plant leaves) and/or the rhizosphere (the soil surrounding plant roots) of a wide variety of important crops. These microorganisms include bacteria, algae, and fungi. Of particular interest are microorganisms, such as bacteria, e.g., genera Pseudomonas, Erwinia, Serratia, Klebsiella, Xanthomonas, Streptomyces, Rhizobium, Rhodopseudomonas, Methylophilius, Agrobacterium, Acetobacter, Lactobacillus, Arthrobacter, Azotobacter, Leuconostoc, and Alcaligenes; fungi, particularly yeast, e.g., genera Saccharonyces, Cryptococcus, Kluyveronyces, Sporobolomyces, Rhodotorula, and Aureobasidium. Of particular interest are such phytosphere bacterial species as Pseudomonas syringae, Pseudomonas fluorescens, Serratia marcescens, Acetobacter xylinum, Agrobacterium tumefaciens, Rhodopseudomonas spheroides, Xanthomonas campestris, Rhizobium melioti, Alcaligenes entrophus , and Azotobacter vinlandii ; and phytosphere yeast species such as Rhodotorula rubra, R. glutinis, R. maarina, R. aurantiaca, Cryptococcus albidus, C. diffluens, C. laurentii, Saccharomyces rosei, S. pretoriensis, S. cerevisiae, Sporobolomyces roseus, S. odorus, Kluyveromyces veronae , and Aureobasidium pollulans . Of particular interest are the pigmented microorganisms.

A wide variety of ways are available for introducing a B.t. gene encoding a toxin into a microorganism host under conditions which allow for stable maintenance and expression of the gene. These methods are well known to those skilled in the art and are described, for example, in U.S. Pat. No. 5,135,867, which is incorporated herein by reference.

Control of lepidopterans, including black cutworm, using the isolates, toxins, and genes of the subject invention can be accomplished by a variety of methods known to those skilled in the art. These methods include, for example, the application of B.t. isolates to the pests (or their location), the application of recombinant microbes to the pests (or their locations), and the transformation of plants with genes which encode the pesticidal toxins of the subject invention. Recombinant microbes may be, for example, a B.t., E. coli , or Pseudomonas. Transformations can be made by those skilled in the art using standard techniques. Materials necessary for these transformations are disclosed herein or are otherwise readily available to the skilled artisan.

Synthetic genes which are functionally equivalent to the toxins of the subject invention can also be used to transform hosts. Methods for the production of synthetic genes can be found in, for example, U.S. Pat. No. 5,380,831.

Treatment of cells. As mentioned above, B.t. or recombinant cells expressing a B.t. toxin can be treated to prolong the toxin activity and stabilize the cell. The pesticide microcapsule that is formed comprises the B.t. toxin within a cellular structure that has been stabilized and will protect the toxin when the mnicrocapsule is applied to the environment of the target pest. Suitable host cells may include either prokaryotes or eukaryotes, normally being limited to those cells which do not produce substances toxic to higher organisms, such as mammals. However, organisms which produce substances toxic to higher organisms could be used, where the toxic substances are unstable or the level of application sufficiently low as to avoid any possibility of toxicity to a mammalian host. As hosts, of particular interest will be the prokaryotes and the lower eukaryotes, such as fungi.

The cell will usually be intact and be substantially in the proliferative form when treated, rather than in a spore form, although in some instances spores may be employed.

Treatment of the microbial cell, e.g., a microbe containing the B.t. toxin gene, can be by chemical or physical means, or by a combination of chemical and/or physical means, so long as the technique does not deleteriously affect the properties of the toxin, nor diminish the cellular capability of protecting the toxin. Examples of chemical reagents are halogenating agents, particularly halogens of atomic no. 17-80. More particularly, iodine can be used under mild conditions and for sufficient time to achieve the desired results. Other suitable techniques include treatment with aldehydes, such as glutaraldehyde; anti-infectives, such as zephiran chloride and cetylpyridinium chloride; alcohols, such as isopropyl and ethanol; various histologic fixatives, such as Lugol iodine, Bouin's fixative, various acids and Helly's fixative (See: Humason, Gretchen L., Animal Tissue Techniques , W. H. Freeman and Company, 1967); or a combination of physical (heat) and chemical agents that preserve and prolong the activity of the toxin produced in the cell when the cell is administered to the host environment. Examples of physical means are short wavelength radiation such as gamma-radiation and X-radiation, freezing, UV irradiation, lyophilization, and the like. Methods for treatment of microbial cells are disclosed in U.S. Pat. Nos. 4,695,455 and 4,695,462, which are incorporated herein by reference.

The cells generally will have enhanced structural stability which will enhance resistance to environmental conditions. Where the pesticide is in a proform, the method of cell treatment should be selected so as not to inhibit processing of the proform to the mature form of the pesticide by the target pest pathogen. For example, formaldehyde will crosslink proteins and could inhibit processing of the proform of a polypeptide pesticide. The method of treatment should retain at least a substantial portion of the bio-availability or bioactivity of the toxin.

Characteristics of particular interest in selecting a host cell for purposes of production include ease of introducing the B.t. gene into the host, availability of expression systems, efficiency of expression, stability of the pesticide in the host, and the presence of auxiliary genetic capabilities. Characteristics of interest for use as a pesticide microcapsule include protective qualities for the pesticide, such as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; survival in aqueous environments; lack of manunalian toxicity; attractiveness to pests for ingestion; ease of killing and fixing without damage to the toxin; and the like. Other considerations include ease of formulation and handling, economnics, storage stability, and the like.

Growth of cells. The cellular host containing the B.t. insecticidal gene may be grown in any convenient nutrient medium, where the DNA construct provides a selective advantage, providing for a selective medium so that substantially all or all of the cells retain the B.t. gene. These cells may then be harvested in accordance with conventional ways. Alternatively, the cells can be treated prior to harvesting.

The B.t. cells of the invention can be cultured using standard art media and fermentation techniques. Upon completion of the fermentation cycle the bacteria can be harvested by first separating the B.t. spores and crystals from the fermentation broth by means well known in the art. The recovered B.t. spores and crystals can be formulated into a wettable powder, liquid concentrate, granules or other formulations by the addition of surfactants, dispersants, inert carriers, and other components to facilitate handling and application for particular target pests. These formulations and application procedures are all well known in the art.

Methods and formulations for control of pests. Control of lepidopterans using the isolates, toxins, and genes of the subject invention can be accomplished by a variety of methods known to those skilled in the art. These methods include, for example, the application of B.t. isolates to the pests (or their location), the application of recombinant microbes to the pests (or their locations), and the transformation of plants with genes which encode the pesticidal toxins of the subject invention. Recombinant microbes may be, for example, a B. t., E. coli , or Pseudomonas. Transformations can be made by those skilled in the art using standard techniques. Materials necessary for these transformations are disclosed herein or are otherwise readily available to the skilled artisan.

Formulated bait granules containing an attractant and spores and crystals of the B. t. isolates, or recombinant microbes comprising the genes obtainable from the B.t. isolates disclosed herein, can be applied to the soil. Formulated product can also be applied as a seed-coating or root treatment or total plant treatment at later stages of the crop cycle. Plant and soil treatments of B.t. cells may be employed as wettable powders, granules or dusts, by mixing with various inert materials, such as inorganic minerals (phyllosilicates, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvants, stabilizing agents, other pesticidal additives, or surfactants. Liquid formulations may be aqueous-based or non-aqueous and employed as foams, gels, suspensions, emulsifiable concentrates, or the like. The ingredients may include Theological agents, surfactants, emulsifiers, dispersants, or polymers.

As would be appreciated by a person skilled in the art, the pesticidal concentration will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or to be used directly. The pesticide will be present in at least 1% by weight and may be 100% by weight. The dry formulations will have from about 1-95% by weight of the pesticide while the liquid formulations will generally be from about 1-60% by weight of the solids in the liquid phase. The formulations will generally have from about 10 2 to about 10 4 cells/mg. These formulations will be administered at about 50 mg (liquid or dry) to 1 kg or more per hectare.

The formulations can be applied to the environment of the pest, e.g., soil and foliage, by spraying, dusting, sprinkling, or the like.

Mutants. Mutants of the isolates of the invention can be made by procedures well known in the art. For example, an asporogenous mutant can be obtained through ethylmethane sulfonate (EMS) mutagenesis of an isolate. The mutants can be made using ultraviolet light and nitrosoguanidine by procedures well known in the art.

A smaller percentage of the asporogenous mutants will remain intact and not lyse for extended fermentation periods; these strains are designated lysis minus (−). Lysis minus strains can be identified by screening asporogenous mutants in shake flask media and selecting those mutants that are still intact and contain toxin crystals at the end of the fermentation. Lysis minus strains are suitable for a cell treatment process that will yield a protected, encapsulated toxin protein.

To prepare a phage resistant variant of said asporogenous mutant, an aliquot of the phage lysate is spread onto nutrient agar and allowed to dry. An aliquot of the phage sensitive bacterial strain is then plated directly over the dried lysate and allowed to dry. The plates are incubated at 30° C. The plates are incubated for 2 days and, at that time, numerous colonies could be seen growing on the agar. Some of these colonies are picked and subcultured onto nutrient agar plates. These apparent resistant cultures are tested for resistance by cross streaking with the phage lysate. A line of the phage lysate is streaked on the plate and allowed to dry. The presumptive resistant cultures are then streaked across the phage line. Resistant bacterial cultures show no lysis anywhere in the streak across the phage line after overnight incubation at 30° C. The resistance to phage is then reconfirmed by plating a lawn of the resistant culture onto a nutrient agar plate. The sensitive strain is also plated in the same manner to serve as the positive control. After drying, a drop of the phage lysate is placed in the center of the plate and allowed to dry. Resistant cultures showed no lysis in the area where the phage lysate has been placed after incubation at 30° C. for 24 hours.

Polynucleotide probes. It is well known that DNA possesses a fundamental property called base complementarity. In nature, DNA ordinarily exists in the form of pairs of anti-parallel strands, the bases on each strand projecting from that strand toward the opposite strand. The base adenine (A) on one strand will always be opposed to the base thymine (T) on the other strand, and the base guanine (G) will be opposed to the base cytosine (C). The bases are held in apposition by their ability to hydrogen bond in this specific way. Though each individual bond is relatively weak, the net effect of many adjacent hydrogen bonded bases, together with base stacking effects, is a stable joining of the two complementary strands. These bonds can be broken by treatments such as high pH or high temperature, and these conditions result in the dissociation, or “denaturation,” of the two strands. If the DNA is then placed in conditions which make hydrogen bonding of the bases thermodynamically favorable, the DNA strands will anneal, or “hybridize,” and reform the original double stranded DNA. If carried out under appropriate conditions, this hybridization can be highly specific. That is, only strands with a high degree of base complementarity will be able to form stable double stranded structures. The relationship of the specificity of hybridization to reaction conditions is well known. Thus, hybridization may be used to test whether two pieces of DNA are complementary in their base sequences. It is this hybridization mechanism which facilitates the use of probes of the subject invention to readily detect and characterize DNA sequences of interest.

The probes may be RNA or DNA. The probe will normally have at least about 10 bases, more usually at least about 18 bases, and may have up to about 50 bases or more, usually not having more than about 200 bases if the probe is made synthetically. However, longer probes can readily be utilized, and such probes can be, for example, several kilobases in length. The probe sequence is designed to be at least substantially complementary to a gene encoding a toxin of interest. The probe need not have perfect complementarity to the sequence to which it hybridizes. The probes may be labelled utilizing techniques which are well known to those skilled in this art.

One approach for the use of the subject invention as probes entails first identifying by Southern blot analysis of a gene bank of the B.t. isolate all DNA segments homologous with the disclosed nucleotide sequences. Thus, it is possible, without the aid of biological analysis, to know in advance the probable activity of many new B.t. isolates, and of the individual endotoxin gene products expressed by a given B.t. isolate. Such a probe analysis provides a rapid method for identifying potentially commercially valuable insecticidal endotoxin genes within the multifarious subspecies of B.t.

One hybridization procedure useful according to the subject invention typically includes the initial steps of isolating the DNA sample of interest and purifying it chemically. Either lysed bacteria or total fractionated nucleic acid isolated from bacteria can be used. Cells can be treated using known techniques to liberate their DNA (and/or RNA). The DNA sample can be cut into pieces with an appropriate restriction enzyme. The pieces can be separated by size through electrophoresis in a gel, usually agarose or acrylamide. The pieces of interest can be transferred to an immobilizing membrane in a manner that retains the geometry of the pieces. The membrane can then be dried and prehybridized to equilibrate it for later immersion in a hybridization solution. The manner in which the nucleic acid is afflxeed to a solid support may Yary. This filing of the DNA for later processing has great value for the use of this technique in field studies, remote from laboratory facilities.

The particular hybridization technique is not essential to the subject invention. As improvements are made in hybridization techniques, they can be readily applied.

As is well known in the art, if the probe molecule and nucleic acid sample hybridize by forming a strong non-covalent bond between the two molecules, it can be reasonably assumed that the probe and sample are essentially identical. The probe's detectable label provides a means for determining in a known manner whether hybridization has occurred.

The nucleotide segments of the subject invention which are used as probes can be synthesized by use of DNA synthesizers using standard procedures. In the use of the nucleotide segments as probes, the particular probe is labeled with any suitable label known to those skilled in the art, including radioactive and non-radioactive labels. Typica l radioactive labels include 32 p, 35 S, or the like. A probe labeled with a radioactive isotope can be constructed from a nucleotide sequence complementary to the DNA sample by a conventional nick translation reaction, using a DNase and DNA polymerase. The probe and sample can then be combined in a hybridization buffer solution and held at an appropriate temperature until annealing occurs. Thereafter, the membrane is washed free of extraneous materials, leaving the sample and bound probe molecules typically detected and quantified by autoradiography and/or liquid scintillation counting. For synthetic probes, it may be most desirable to use enzymes such as polynucleotide kinase or terminal transferase to end-label the DNA for use as probes.

Non-radioactive labels include, for example, ligands such as biotin or thyroxine, as well as enzymes such as hydrolases or perixodases, or the various chemiluminescers such as luciferin, or fluorescent compounds like fluorescein and its derivatives. The probes may be made inherently fluorescent as described in International Application No. WO93/16094. The probe may also be labeled at both ends with different types of labels for ease of separation, as, for example, by using an isotopic label at the end mentioned above and a biotin label at the other end.

The amount of labeled probe which is present in the hybridization solution will vary widely, depending upon the nature of the label, the amount of the labeled probe which can reasonably bind to the filter, and the stringency of the hybridization. Generally, substantial excesses of the probe will be employed to enhance the rate of binding of the probe to the fixed DNA.

Various degrees of stringency of hybridization can be employed. The more severe the conditions, the greater the complementarity that is required for duplex formation. Severity can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under stringent conditions by techniques well known in the art, as described, for example, in Keller, G. H., M. M. Manak (1987) DNA Probes , Stockton Press, New York, N.Y., pp. 169-170.

As used herein “stringent” conditions for hybridization refers to conditions which achieve the same, or about the same, degree of specificity of hybridization as the conditions employed by the current applicants. Specifically, hybridization of immobilized DNA on Southern blots with 32P-labeled gene-specific probes was performed by standard methods (Maniatis et al.). In general, hybridization and subsequent washes were carried out under stringent conditions that allowed for detection of target sequences with homology to the exemplified toxin genes. For double-stranded DNA gene probes, hybridization was carried out overnight at 20-25° C. below the melting temperature (Tm) of the DNA hybrid in 6×SSPE, 5×Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G. A., K. A. Jacobs, T. H. Eickbush, P. T. Cherbas, and F. C. Kafatos [1983 ] Methods of Enzymology , R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285).

Tm=81.5° C.+16.6 Log[Na+]+0.41(% G+C)−0.61(% formamide)−600/length of duplex in base pairs.

Washes are typically carried out as follows:

(1) Twice at room temperature for 15 minutes in 1×SSPE, 0.1% SDS (low stringency wash).

(2) Once at Tm-20° C. for 15 minutes in 0.2×SSPE, 0.1% SDS (moderate stringency wash).

For oligonucleotide probes, hybridization was carried out overnight at 10-20° C. below the melting temperature (Tm) of the hybrid in 6X SSPE, 5×Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. Tm for oligonucleotide probes was determined by the following formula:

Tm (° C.)=2(number T/A base pairs)+4(number G/C base pairs)

(Suggs, S. V., T. Miyake, E. H. Kawashime, M. J. Johnson, K. Itakura, and R. B. Wallace [1981 ] ICN-UCLA Symp. Dev. Biol. Using Punfied Genes , D. D. Brown [ed.], Academic Press, New York, 23:683-693).

Washes were typically carried out as follows:

(1) Twice at room temperature for 15 minutes 1×SSPE, 0.1% SDS (low stringency wash).

(2) Once at the hybridization temperature for 15 minutes in 1×SSPE, 0.1% SDS (moderate stringency wash).

Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid, and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the nucleotide sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions, and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to an ordinarily skilled artisan. Other methods may become known in the future.

The known methods include, but are not limited to:

(1) synthesizing chemically or otherwise an artificial sequence which ig a mutation, insertion or deletion of the known sequence;

(2) using a nucleotide sequence of the present invention as a probe to obtain via hybridization a new sequence or a mutation, insertion or deletion of the probe sequence; and

(3) mutating, inserting or deleting a test sequence in vitro or in vivo.

It is important to note that the mutational, insertional, and deletional variants generated from a given probe may be more or less efficient than the original probe. Notwithstanding such differences in efficiency, these variants are within the scope of the present invention.

Thus, mutational, insertional, and deletional variants of the disclosed nucleotide sequences can be readily prepared by methods which are well known to those skilled in the art. These variants can be used in the same manner as the exemplified primer sequences so long as the variants have substantial sequence homology with the original sequence. As used herein, substantial sequence homology refers to homology which is sufficient to enable the variant to function in the same capacity as the original probe. Preferably, this homology is greater than 50%; more preferably, this homology is greater than 75%; and most preferably, this homology is greater than 90%. The degree of homology needed for the variant to function in its intended capacity will depend upon the intended use of the sequence. It is well within the skill of a person trained in this art to make mutational, insertional, and deletional mutations which are designed to improve the function of the sequence or otherwise provide a methodological advantage.

PCR technology. Polymerase Chain Reaction (PCR) is a repetitive, enzymatic, primed synthesis of a nucleic acid sequence. This procedure is well known and commonly used by those skilled in this art (see Mullis, U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159; Saiki, Randall K., Stephen Scharf, Fred Faloona, Kary B. Mullis, Glenn T. Horn, Henry A. Erlich, Norman Arnheim [1985] “Enzymatic Amplification of β-Globin Genomic Sequences and Restriction Site Analysis for Diagnosis of Sickle Cell Anemia,” Science 230:1350-1354.). PCR is based on the enzymatic amplification of a DNA fragment of interest that is flanked by two oligonucleotide primers that hybridize to opposite strands of the target sequence. The primers are oriented with the 3′ ends pointing towards each other. Repeated cycles of heat denaturation of the template, annealing of the primers to their complementary sequences, and extension of the annealed primers with a DNA polymerase result in the amplification of the segment defmed by the 5′ ends of the PCR primers. Since the extension product of each primer can serve as a template for the other primer, each cycle essentially doubles the amount of DNA fragment produced in the previous cycle. This results in the exponential accumulation of the specific target fragment, up to several million-fold in a few hours. By using a thermostable DNA polymerase such as Taq polymerase, which is isolated from the thermophilic bacterium Thernms aquaticus , the amplification process can be completely automated.

The DNA sequences of the subject invention can be used as primers for PCR amplification. In performing PCR amplification, a certain degree of mismatch can be tolerated between primer and template. Therefore, mutations, deletions, and insertions (especially additions of nucleotides to the 5′ end) of the exemplified primers fall within the scope of the subject invention. Mutations, insertions and deletions can be produced in a given primer by methods known to an ordinarily skilled artisan. It is important to note that the mutational, insertional, and deletional variants generated from a given primer sequence may be more or less efficient than the original sequences. Notwithstanding such differences in efficiency, these variants are within the scope of the present invention.

FOLLOWING ARE EXAMPLES WHICH ILLUSTRATE PROCEDURES FOR PRACTICING THE INVENTION.

These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

EXAMPLE 1

Culturing of B.t. Isolates Usefull According to the Invention

A subculture of B.t. isolates, or mutants thereof, can be used to inoculate the following peptone, glucose, salts medium:

	Bacto Peptone	7.5	g/l
	Glucose	1.0	g/l
	KH 2 PO 4	3.4	g/l
	K 2 HPO 4	4.35	g/l
	Salt Solution	5.0	ml/l
	CaCl 2 Solution	5.0	ml/l
	pH 7.2
	Salts Solution (100 ml)
	MgSO 4 .7H 2 O	2.46	g
	MnSO 4 .H 2 O	0.04	g
	ZnSO 4 .7H 2 O	0.28	g
	FeSO 4 .7H 2 O	0.40	g
	CaCl 2 Solution (100 ml)
	CaCl 2 .2H 2 O	3.66	g

The salts solution and CaCl 2 solution are filter-sterilized and added to the autoclaved and cooked broth at the time of inoculation. Flasks are incubated at 30° C. on a rotary shaker at 200 rpm for 64 hr.

The above procedure can be readily scaled up to large fermentors by procedures well known in the art.

The B.t. spores and/or crystals, obtained in the above fermentation, can be isolated by procedures well known in the art. A frequently-used procedure is to subject the harvested fermentation broth to separation techniques, e.g., centrifugation. cl EXAMPLE 2

Black Cutworm Bioassay

Suspensions of powders containing B.t. isolates were prepared by mixing an appropriate amount of powder with distilled water and agitating vigorously. Suspensions were mixed with black cutworm artificial diet (BioServ, Frenchtown, N.J.) amended with 28 grams alfalfa powder (BioServ) and 1.2 ml formalin per liter of finished diet. Suspensions were mixed with finished artificial diet at a rate of 3 ml suspension plus 27 ml diet. After vortexing, this mixture was poured into plastic trays with compartmentalized 3 ml wells (Nutrend Container Corporation, Jacksonville, Fla.). A water blank containing no B.t. served as the control. Early first-instar Agrotis ipsilon larvae (French Agricultural Services, Lamberton, MN) were placed singly onto the diet mixture. Wells were then sealed with “MYLAR” sheeting (ClearLam Packaging, Ill.) using a tacking iron, and several pinholes were made in each well to provide gas exchange. Larvae were held at 29° C. for four days in a 14:10 (light:dark) holding room. Mortality was recorded after four days.

The following B.t. isolates were found to have activity against black cutworm: PS185U2, PS11B, PS218G2, PS213E5, PS86W1, PS28C, PS86BB1, PS89J3, PS86V1, PS94R1, HD525, HD573A, PS27J2, HD110, HD10, PS202S, HD29, PS101DD, HD129,

TABLE 3
Percentage black cutworm mortality associated with B.t. isolates
	Estimated toxin concentration
	(μg toxin/mL diet)
	Sample	200	100	50	25
	PS86BB1	51	25	9	1
	PS31G1	30	20	7	5
	PS11B	37	16	3	o
	HD573	11	13	3	o
	HD129	87	73	43	7
	PS86V1	73	29	19	3
	PS89J3	68	27	15	3
	PS86W1	61	23	12	15
	PS185U2	69	32	14	16
	HD525	67	20	11	4
	water control	1

EXAMPLE 3

Identification of Genes Encoding Novel Lepidopteran-Active Bacillus thuringiensis Toxins

Two primer pairs useful for the identification and classification of novel toxin genes by PCR amplification of polymorphic DNA fragments near the 3′ ends of B.t. toxin genes were designed. These oligonucleotide primers allow the discrimination of genes encoding toxins in the Cry7, Cry8, or Cry9 subfamilies from genes for the more common lepidopteran-active toxins in the Cryl subfamily based on size differences for the amplified DNA. The sequences of these primers are:

Forward 1 5° C.GTGGCTATATCCTTCGTGTYAC 3′ (SEQ ID NO. 1)

Reverse 1 5′ ACRATRAATGTTCCTTCYGTTTC 3′ (SEQ ID NO. 2)

Forward 2 5′ GGATATGTMTTACGTGTAACWGC 3′ (SEQ ID NO. 3)

Reverse 2 5° C.TACACTTTCTATRTTGAATRYACCTTC 3′ (SEQ ID NO. 4) Standard PCR amplification (Perkin Elmer, Foster City, Calif.) using primer pair 1 (SEQ ID NOS. 1 and 2) of the subject invention yields DNA fragments approximately 415-440 base pairs in length from B.t. toxin genes related to the cry1 subfamily.

PCR amplification using primer pair 2 (SEQ ID NOS. 3 and 4) according to the subject invention yields DNA fragments approximately 230-290 base pairs in length from cry7, cry8, or cry9 subfamily toxin genes.

These primers can be used according to the subject invention to identify genes encoding novel toxins. Crude DNA templates for PCR were prepared from B.t. strains. A loopful of cells was scraped from an overnight plate culture of Bacillus thuringiensis and resuspended in 300 ml TE buffer (10 mM Tris-Cl, 1 mM EDTA, pH 8.0). Proteinase K was added to 0.1 mg/ml and the cell suspension was heated to 55° C. for 15 minutes. The suspension was then boiled for 15 minutes. Cellular debris was pelleted in a microfage and the supernatant containing the DNA was transferred to a clean tube.

PCR was carried out using the primer pair consisting of the Forward 2 (SEQ ID NO. 3) and Reverse 2 (SEQ ID NO. 4) oligonucleotides described above. Strains were identified that contained genes characterized by amplification of DNA fragments approximately 230-290 bp in length. Spore-crystal preparations from these strains were subsequently tested for bioactivity against Agrotis epsilon and additional lepidopteran targets.

PS185U2 was examined using both primer pairs 1 and 2 (SEQ ID NOS. 1 and 2 and SEQ ID NOS. 3 and 4, respectively). In this strain, primer pair 1 (SEQ ID NOS. 1 and 2) yielded a DNA band of the size expected for toxin genes related to the cry1 subfamily.

EXAMPLE 4

Restriction Fragment Length Polymorphism (RFLP) Analysis of Bacillus thuringiensis Toxin Genes Present in Lepidopteran-Active Strains

Total cellular DNA was prepared from Bacillus thuringiensis (B.t.) strains grown to an optical density, at 600 nm, of 1.0. Cells were pelleted by centrifugation and resuspended in protoplast buffer (10 mgjml lysozyme in 0-3 M sucrose, 25 mM Tris-Cl [pH 8.0], 25 mM EDTA). After incubation at 37° C. for 1 hour, protoplasts were lysed by two cycles of freezing and thawing. Nine volumes of a solution of 0.1 M NaCl, 0.1% SDS, 0.1 M Tris-Cl were added to complete lysis. The cleared lysate was extracted twice with phenol:chloroform (1:1). Nucleic acids were precipitated with two volumes of ethanol and pelleted by centrifugation. The pellet was resuspended in TE buffer and RNase was added to a final concentration of 50 g/ml. After incubation at 37° C. for 1 hour, the solution was extracted once each with phenol:chloroform (1:1) and TE-saturated chloroform. DNA was precipitated from the aqueous phase by the addition of one-tenth volume of 3M NaOAc and two volumes of ethanol. DNA was pelleted by centrifugation, washed with 70% ethanol, dried, and resuspended in TE buffer.

Two types of PCR-amplified, 32 P-labeled DNA probes were used in standard Southern hybridizations of total cellular B.t. DNA to characterize toxin genes by RFLP. The first probe (A) was a DNA fragment amplified using the following primers:

Forward 3: 5′ CCAGWTTTAYAGGAGG 3′ (SEQ ID NO. 5)

Reverse 3: 5′ GTAAACAAGCTCGCCACCGC 3′ (SEQ ID NO. 6)

The second probe (B) was either the 230-290 bp or 415-440 bp DNA fragment amplified with the primers described in the previous example.

Hybridization of immobilized DNA on Southern blots with the aforementioned 32 P-labeled probes was performed by standard methods (Maniatis, T., E. F. Fritsch, J. Sambrook [1982 ] Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.). In general, hybridization and subsequent washes were carried out under moderate stringency. For double-stranded DNA gene probes, hybridization was carried out overnight at 20-25° C. below the melting temperature (Tm) of the DNA hybrid in 6×SSPE, 5×Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz, G. A., K. A. Jacobs, T. H. Eickbush, P. T. Cherbas, and F. C. Kafatos [1983] In Methods in Enzymology , R. Wu, L. Grossman and K. Moldave (eds.), Academic Press, New York. 100:266-285):

Tm=81.5° C.+16.6 Log[Na+]+0.41(% G+C)−0.61(% formamide)−600/length of duplex in base pairs.

Washes were typically carried out as follows:

(1) Twice at room temperature for 15 minutes in 1×SSPE, 0.1% SDS (low stringency wash).

(2) Once at Tm −20° C. for 15 minutes in 0.2×SSPE, 0.1% SDS (moderate stringency wash).

RFLP data was obtained for the ten strains most active on Agrotis ipsilon (Tables 4 and 5). The hybridizing DNA bands described here contain all or part of the novel toxin genes under investigation.

TABLE 4
RFLP data for Bacillus thuringiensis strains using probe A
Approximate size (base pairs)
Bacillus thuringiensis strain
Digest	PS185U2	PS89J3	PS11B	HD129	PS86BB1	PSS6W1	PS86V1	PS31G1	HD573	HD525
EcoRI	8410	11837	11168	11132	8267	8718	10356	11687	9816	9570
	3631	9769	7347	5876	5585	5159	7105	7419	5908	5760
	1900	7225		3684				3659	3838	3742
	925	4921		628				1716
	661							846
								498
SacI		8997		6326	10057	9165	12170	10564	6708	6216
		5645			5450	5993	6046	6063	5204	5074
		3741				4120		4710
		2548				3291
HinDIII	5331	11837	5603	11409	8682	10384	10356	5620
	3997	9505		5458	5724	5993	7105	2570
	1993	6129		1945	3868		3436	936
				1190	3027
KpnI		12852		4596		9878		4258
		5802				8938
						6300
XbaI	2658		1596	5876				9312
	763			3870				5911
	630			3258				2827
				2093				2636
				1521				1760
								1010
								625
								359

TABLE 5
RFLP data for Bacillus thuringiensis strains using probe B
Approxirnate size (base pairs)
Bacillus thuringiensis Strain
Digest	PS185U2	PS89J3	PS11B	HD129	PS86BB1	PS86W1	PS86V1	PS31G1	HD573	HD525
EcoRI	10493	10838	9874	4922	8286	7334	9791	8603	9741	9741
	4387	6217	7347	3048	5567	6638	6412	4228	6146	5840
			3686						3685	3878
SacI		10252		5177	9619	11487	11475	10646	5840	5840
		6217			5297	6638	6081	6789
								5486
HinDIII	7197	5880	7718	5177	5567	6316	6412	6475	5840	5840
	5553	3985	6033	4022	3740	4239	4199	3183	4522	4522
		2700	2882		2513	2845	3057
KpnI	3548	12113	1446	10491	10624	12074	12756	1528	10791	10791
		7345	1076		7884	8953	9286		4082	4296
									1994	2099
XbaI		5262		5048	4563	5716	4921	9684	5549	5840
		3985		3048	3386	4455	3583	6630	3501	3685

EXAMPLE 5

DNA Sequencing of Toxin Genes

PCR-amplified segments of toxin genes present in B.t. strains active on Agrotis ipsilon were sequenced. To accomplish this, amplified DNA fragments obtained using primers Forward 3 (SEQ ID NO. 5) and Reverse 3 (SEQ ID NO. 6) were first cloned into the PCR DNA TA-cloning plasmid vector, pCRII, as described by the supplier (Invitrogen, San Diego, Calif.). Several individual pCRII clones from the mixture of amplified DNA fragments from each B.t. strain were chosen for sequencing. Colonies were lysed by boiling to release crude plasmid DNA. DNA templates for automated sequencing were amplified by PCR using vector-specific primers flanking the plasmid multiple cloning sites. These DNA templates were sequenced using Applied Biosystems (Foster City, Calif.) automated sequencing methodologies. Toxin gene sequences and their corresponding nucleotide sequences, described below (SEQ ID NO. 7 through SEQ ID NO. 62), were identified by this method. These sequences are listed in Table 6. The polypeptide sequences deduced from these nucleotide sequences are also shown.

From these partial gene sequences, seven oligonucleotides useful as PCR primers or hybridization probes were designed. The sequences of these oligonucleotides are the following:

5′GTTCATTGGTATAAGAGTTGGTG 3′ (SEQ ID NO. 63)

5′CCACTGCAAGTCCGGACCAAATTCG 3′ (SEQ ID NO. 64)

5′GAATATATTCCCGTCYATCTCTGG 3′ (SEQ ID NO. 65)

5′GCACGAATTACTGTAGCGATAGG 3′ (SEQ ID NO. 66)

5′GCTGGTAACTTTGGAGATATGCGTG 3′ (SEQ ID NO. 67)

5′GATTTCTTTGTAACACGTGGAGG 3′ (SEQ ID NO. 68)

5′CACTACTAATCAGAGCGATCTG 3′ (SEQ ID NO. 69)

Specific gene toxin sequences and the oligonucleotide probes that enable identification of these genes by hybridization, or by PCR in combination with the Revers e 3 primer described above, are listed in Table 6.

TABLE 6
Sequence ID reference numbers
Strain	Toxin	Peptide	Nucleotide	Probe used
PS11B	11B1AR	SEQ ID NO. 7	SEQ ID NO. 8
	11B1BR	SEQ ID NO. 9	SEQ ID NO. 10	SEQ ID NO. 65
HD129	1291A	SEQ ID NO. 11	SEQ ID NO. 12	SEQ ID NO. 63
	1292A	SEQ ID NO. 13	SEQ ID NO. 14	SEQ ID NO. 64
	1292B	SEQ ID NO. 15	SEQ ID NO. 16
PS31G1	31GA	SEQ ID NO. 17	SEQ ID NO. 18	SEQ ID NO. 65
	31GBR	SEQ ID NO. 19	SEQ ID NO. 20
PS185U2	85N3	SEQ ID NO. 25	SEQ ID NO. 26	SEQ ID NO. 66
PS86V1	86V1C1	SEQ ID NO. 27	SEQ ID NO. 28	SEQ ID NO. 68
	86V1C2	SEQ ID NO. 29	SEQ ID NO. 30	SEQ ID NO. 64
	86V1C3R	SEQ ID NO. 31	SEQ ID NO. 32	SEQ ID NO. 69
HD525	F525A	SEQ ID NO. 33	SEQ ID NO. 34	SEQ ID NO. 64
	F525B	SEQ ID NO. 35	SEQ ID NO. 36	SEQ ID NO. 63
	F525C	SEQ ID NO. 37	SEQ ID NO. 38
HD573	F573A	SEQ ID NO. 39	SEQ ID NO. 40	SEQ ID NO. 63
	F573B	SEQ ID NO. 41	SEQ ID NO. 42	SEQ ID NO. 67
	F573C	SEQ ID NO. 43	SEQ ID NO. 44	SEQ ID NO. 64
PS86BB1	FBB1A	SEQ ID NO. 45	SEQ ID NO. 46	SEQ ID NO. 68
	FBB1BR	SEQ ID NO. 47	SEQ ID NO. 48	SEQ ID NO. 69
	FBB1C	SEQ ID NO. 49	SEQ ID NO. 50	SEQ ID NO. 64
	FBB1D	SEQ ID NO. 51	SEQ ID NO. 52	SEQ ID NO. 63
PS89J3	J31AR	SEQ ID NO. 53	SEQ ID NO. 54	SEQ ID NO. 68
	J32AR	SEQ ID NO. 55	SEQ ID NO. 56	SEQ ID NO. 64
PS86W1	W1FAR	SEQ ID NO. 57	SEQ ID NO. 58	SEQ ID NO. 68
	W1FBR	SEQ ID NO. 59	SEQ ID NO. 60	SEQ ID NO. 69
	W1FC	SEQ ID NO. 61	SEQ ID NO. 62	SEQ ID NO. 64

EXAMPLE 6

Insertion of Toxin Genes Into Plants

One aspect of the subject invention is the transformation of plants with genes encoding the insecticidal toxin. The transformed plants are resistant to attack by the target pest.

Genes encoding pesticidal toxins, as disclosed herein, can be inserted into plant cells using a variety of techniques which are well known in the art. For example, a large number of cloning vectors comprising a replication system in E. coli and a marker that permits selection of the transformed cells are available for preparation for the insertion of foreign genes into higher plants. The vectors comprise, for example, pBR322, pUC series, M13 mp series, pACYC184, etc. Accordingly, the sequence encoding the B.t. toxin can be inserted into the vector at a suitable restriction site. The resulting plasmid is used for transformation into E. coli . The E. coli cells are cultivated in a suitable nutrient medium, then harvested and lysed. The plasmid is recovered. Sequence analysis, restriction analysis, electrophoresis, and other biochemical-molecular biological methods are generally carried out as methods of analysis. After each manipulation, the DNA sequence used can be cleaved and joined to the next DNA sequence. Each plasmid sequence can be cloned in the same or other plasmids. Depending on the method of inserting desired genes into the plant, other DNA sequences may be necessary. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, then at least the right border, but often the right and the left border of the Ti or Ri plasmid T-DNA, has to be joined as the flanking region of the genes to be inserted.

The use of T-DNA for the transformation of plant cells has been intensively researched and sufficiently described in EP 120 516; Hoekema (1985) In: The Binary Plant Vector System , Offset-durlkerij Kanters B. V., Alblasserdam, Chapter 5; Fraley et al., Crit. Rev. Plant Sci . 4:1-46; and An et al. (1985) EMBO J . 4:277-287.

Once the inserted DNA has been integrated in the genome, it is relatively stable there and, as a rule, does not come out again. It normally contains a selection marker that confers on the transformed plant cells resistance to a biocide or an antibiotic, such as kanamycin, G 418, bleomycin, hygromycin, or chloramphenicol, inter alia. The individually employed marker should accordingly permit the selection of transformed cells rather than cells that do not contain the inserted DNA.

A large number of techniques are available for inserting DNA into a plant host cell. Those techniques include transformation with T-DNA using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation agent, fusion, injection, biolistics (microparticle bombardment), or electroporation as well as other possible methods. If Agrobacteria are used for the transformation, the DNA to be inserted has to be cloned into special plasmids, namely either into an intermediate vector or into a binary vector. The intermediate vectors can be integrated into the Ti or Ri plasmid by homologous recombination owing to sequences that are homologous to sequences in the T-DNA. The Ti or Ri plasmid also comprises the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate themselves in Agrobacteria. The intermediate vector can be transferred into Agrobacterium tumefaciens by means of a helper plasmid (conjugation). Binary vectors can replicate themselves both in E. coli and in Agrobacteria. They comprise a selection marker gene and a linker or polylinker which are framed by the right and left T-DNA border regions. They can be transformed directly into Agrobacteria (Holsters et al. [1978 ] Mol. Gen. Genet . 163:181-187). The Agrobacterium used as host cell is to comprise a plasmid carrying a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be contained. The bacterium so transformed is used for the transformation of plant cells. Plant explants can advantageously be cultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes for the transfer of the DNA into the plant cell. Whole plants can then be regenerated from the infected plant material (for example, pieces of leaf, segments of stalk, roots, but also protoplasts or suspension-cultivated cells) in a suitable medium, which may contain antibiotics or biocides for selection. The plants so obtained can then be tested for the presence of the inserted DNA. No special demands are made of the plasmids in the case of injection and electroporation. It is possible to use ordinary plasmids, such as, for example, pUC derivatives.

The transformed cells grow inside the plants in the usual manner. They can form germ cells and transmit the transformed trait(s) to progeny plants. Such plants can be grown in the normal manner and crossed with plants that have the same transformed hereditary factors or other hereditary factors. The resulting hybrid individuals have the corresponding phenotypic properties.

In a preferred embodiment of the subject invention, plants will be transformed with genes wherein the codon usage has been optimized for plants. See, for example, U.S. Pat. No. 5,380,831. Also, advantageously, plants encoding a truncated toxin will be used. The truncated toxin typically will encode about 55% to about 80% of the full length toxin. Methods for creating synthetic B.t. genes for use in plants are known in the art.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof wil I be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.

69 23 base pairs nucleic acid single linear DNA (genomic) not provided 1CGTGGCTATA TCCTTCGTGT YAC 23 23 base pairs nucleic acid single linear DNA (genomic) not provided 2ACRATRAATG TTCCTTCYGT TTC 23 23 base pairs nucleic acid single linear DNA (genomic) not provided 3GGATATGTMT TACGTGTAAC WGC 23 28 base pairs nucleic acid single linear DNA (genomic) not provided 4CTACACTTTC TATRTTGAAT RYACCTTC 28 16 base pairs nucleic acid single linear DNA (genomic) not provided 5CCAGWTTTAY AGGAGG 16 20 base pairs nucleic acid single linear DNA (genomic) not provided 6GTAAACAAGC TCGCCACCGC 20 137 amino acids amino acid single linear protein not provided 7Pro Gly Phe Xaa Gly Gly Asp Ile Leu Arg Arg Thr Ser Pro Xaa Gln1 5 10 15Ile Ser Xaa Leu Arg Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr 20 25 30Arg Val Arg Ile Xaa Xaa Ala Ser Thr Thr Xaa Xaa Gln Phe His Thr 35 40 45Ser Ile Xaa Gly Arg Pro Ile Asn Gln Gly Asn Phe Ser Xaa Thr Met 50 55 60Ser Ser Gly Ser Asn Leu Gln Ser Gly Xaa Phe Arg Thr Val Gly Phe65 70 75 80Thr Thr Pro Xaa Asn Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser 85 90 95Xaa His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu 100 105 110Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg 115 120 125Ala Xaa Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 8CCAGGATTTA YAGGAGGAGA TATTCTTCGA AGAACTTCAC CTGKSCAGAT TTCAWCCTTA 60AGAGTAAATA TTACTGCACC ATTATCACAA AGATATCGGG TAAGAATTCR CWACGCTTCT 120ACYACAWATT TWCAATTCCA TACATCAATT GRCGGAAGAC CTATTAATCA GGGKAATTTT 180TCASCAACTA TGAGTAGTGG GAGTAATTTA CAGTCCGGAA KCTTTAGGAC TGTAGGTTTT 240ACTACTCCGT KTAACTTTTC AAATGGATCA AGTGTATTTA CGTTAAGTKC TCATGTCTTC 300AATTCAGGCA ATGAAGTTTA TATAGATCGA ATTGAATTTG TTCCGGCAGA AGTAACCTTT 360GAGGCAGAAT ATGATTTAGA AAGAGCACMA AAGGCGGTGG CGAGCTTGTT TAC 413 136 amino acids amino acid single linear protein not provided 9Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Asp Gly Gly Xaa1 5 10 15Val Gly Thr Ile Arg Ala Asn Val Asn Ala Pro Leu Thr Gln Gln Tyr 20 25 30Arg Ile Arg Leu Arg Tyr Ala Ser Thr Thr Ser Phe Val Val Asn Leu 35 40 45Phe Val Asn Asn Ser Ala Ala Gly Phe Thr Leu Pro Ser Thr Met Ala 50 55 60Gln Asn Gly Ser Leu Thr Xaa Glu Ser Phe Asn Thr Leu Glu Val Thr65 70 75 80His Xaa Ile Arg Phe Ser Gln Ser Asp Thr Thr Leu Arg Leu Asn Ile 85 90 95Phe Pro Ser Ile Ser Gly Gln Xaa Val Tyr Val Asp Lys Xaa Glu Ile 100 105 110Val Pro Xaa Asn Pro Thr Arg Glu Ala Glu Glu Asp Leu Glu Asp Xaa 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 10CCAGGWTTTA CAGGAGGGGA TATACTTCGA AGAACGGaCG GTGGTRCAGT TGGAACGATT 60AGAGCTAATG TTAATGCCCC ATTAACACAA CAATATCGTA TAAGATTACG CTATGCTTCG 120ACAACAAGTT TTGTTGTTAA TTTATTTGTT AATAATAGTG CGGCTGGCTT TACTTTACCG 180AGTACAATGG CTCAAAATGG TTCTTTAACA YRCGAGTCGT TTAATACCTT AGAGGTAACT 240CATWCTATTA GATTTTCACA GTCAGATACT ACACTTAGGT TGAATATATT CCCGTCYATC 300TCTGGTCAAG RAGTGTATGT AGATAAACWT GAAATCGTTC CAWTTAACCC GACACGAGAA 360GCGGAAGAAG ATTTAGAAGA TSCAAAGAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 11Pro Gly Phe Xaa Gly Gly Asp Ile Leu Arg Arg Thr Gly Val Gly Thr1 5 10 15Phe Gly Thr Ile Arg Val Arg Xaa Thr Ala Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Phe Ala Xaa Thr Thr Asn Leu Phe Ile Gly Ile 35 40 45Arg Val Gly Asp Arg Gln Val Asn Tyr Phe Asp Phe Gly Arg Thr Met 50 55 60Asn Arg Gly Asp Glu Leu Arg Tyr Glu Ser Phe Ala Thr Arg Glu Phe65 70 75 80Thr Thr Asp Phe Asn Phe Arg Gln Pro Gln Glu Leu Ile Ser Val Phe 85 90 95Ala Asn Ala Phe Ser Ala Gly Gln Glu Val Tyr Phe Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Lys Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 12CCAGGTTTTA YAGGAGGGGA TATACTCCGA AGAACAGGGG TTGGTACATT TGGAACAATA 60AGGGTAAGGA YTACTGCCCC CTTAACACAA AGATATCGCA TAAGATTCCG TTTCGCTTYT 120ACCACAAATT TGTTCATTGG TATAAGAGTT GGTGATAGAC AAGTAAATTA TTTTGACTTC 180GGAAGAACAA TGAACAGAGG AGATGAATTA AGGTACGAAT CTTTTGCTAC AAGGGAGTTT 240ACTACTGATT TTAATTTTAG ACAACCTCAA GAATTAATCT CAGTGTTTGC AAATGCATTT 300AGCGCTGGTC AAGAAGTTTA TTTTGATAGA ATTGAGATTA TCCCCGTTAA TCCCGCACGA 360GAGGCGAAAG AGGATYTAGA AGCAGCAAAG AAAGCGGTGG CGAGCTTGTT TAC 413 135 amino acids amino acid single linear protein not provided 13Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser Leu1 5 10 15Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr Arg 20 25 30Ile Xaa Val Arg Tyr Ala Xaa Thr Thr Asn Ile Arg Leu Ser Val Asn 35 40 45Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg Leu 50 55 60Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn Thr65 70 75 80Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile Glu 85 90 95Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe Ile 100 105 110Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Glu Ala Ala Lys 115 120 125Lys Ala Val Ala Ser Leu Phe 130 135 407 base pairs nucleic acid single linear DNA (genomic) not provided 14GGMTTTATAG GAGGAGCTCT ACTTCAAAGG ACTGACCATG GTTCGCTTGG AGTATTGAGG 60GTCCAATTTC CACTTCACTT AAGACAACAA TATCGTATTA SAGTCCGTTA TGCTTYTACA 120ACAAATATTC GATTGAGTGT GAATGGCAGT TTCGGTACTA TTTCTCAAAA TCTCCCTAGT 180ACAATGAGAT TAGGAGAGGA TTTAAGATAC GGATCTTTTG CTATAAGAGA GTTTAATACT 240TCTATTAGAC CCACTGCAAG TCCGGACCAA ATTCGATTGA CAATAGAACC ATCTTTTATT 300AGACAAGAGG TCTATGTAGA TAGAATTGAG TTCATTCCAG TTAATCCGAC GCGAGAGGCG 360AAAGAGGATC TAGAAGCAGC AAAAAAAGCG GTGGCGAGCT TGTTTAC 407 137 amino acids amino acid single linear protein not provided 15Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln1 5 10 15Ile Ser Thr Leu Arg Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr 20 25 30Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr 35 40 45Ser Ile Asp Gly Arg Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met 50 55 60Ser Ser Gly Ser Asn Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe65 70 75 80Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser 85 90 95Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu 100 105 110Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg 115 120 125Ala Gln Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 16CCAGGATTTA CAGGAGGAGA TATTCTTCGA AGAACTTCAC CTGGCCAGAT TTCAACCTTA 60AGAGTAAATA TTACTGCACC ATTATCACAA AGATATCGGG TAAGAATTCG CTACGCTTCT 120ACCACAAATT TACAATTCCA TACATCAATT GACGGAAGAC CTATTAATCA GGGGAATTTT 180TCAGCAACTA TGAGTAGTGG GAGTAATTTA CAGTCCGGAA GCTTTAGGAC TGTAGGTTTT 240ACTACTCCGT TTAACTTTTC AAATGGATCA AGTGTATTTA CGTTAAGTGC TCATGTCTTC 300AATTCAGGCA ATGAAGTTTA TATAGATCGA ATTGAATTTG TTCCGGCAGA AGTAACCTTT 360GAGGCAGAAT ATGATTTAGA AAGAGCGCAA AAGGCGGTGG CGAGCTTGTT TAC 413 136 amino acids amino acid single linear protein not provided 17Pro Gly Phe Xaa Gly Gly Asp Ile Leu Arg Arg Thr Asp Gly Gly Ala1 5 10 15Val Gly Thr Ile Arg Ala Asn Val Asn Ala Pro Leu Thr Gln Gln Tyr 20 25 30Arg Ile Arg Leu Arg Tyr Ala Ser Thr Thr Ser Phe Val Val Asn Leu 35 40 45Phe Val Asn Asn Ser Ala Ala Gly Phe Thr Leu Pro Ser Thr Met Ala 50 55 60Gln Asn Gly Ser Leu Thr Tyr Glu Ser Phe Asn Thr Leu Glu Val Thr65 70 75 80His Thr Ile Arg Phe Ser Gln Ser Asp Thr Thr Leu Arg Leu Asn Ile 85 90 95Phe Pro Ser Ile Ser Gly Gln Glu Val Tyr Val Asp Lys Leu Glu Ile 100 105 110Val Pro Ile Asn Pro Thr Arg Glu Ala Glu Glu Asp Leu Glu Asp Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 18CCAGGWTTTA YAGGAGGGGA TATACTTCGA AGAACGGACG GTGGTGCAGT TGGAACGATT 60AGAGCTAATG TTAATGCCCC ATTAACACAA CAATATCGTA TAAGATTACG CTATGCTTCG 120ACAACAAGTT TTGTTGTTAA TTTATTTGTT AATAATAGTG CGGCTGGCTT TACTTTACCG 180AGTACAATGG CTCAAAATGG TTCTTTAACA TACGAGTCGT TTAATACCTT AGAGGTAACT 240CATACTATTA GATTTTCACA GTCAGATACT ACACTTAGGT TGAATATATT CCCGTCTATC 300TCTGGTCAAG AAGTGTATGT AGATAAACTT GAAATCGTTC CAATTAACCC GACACGAGAA 360GCGGAAGAAG ATTTAGAAGA TGCAAAGAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 19Pro Gly Phe Xaa Gly Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln1 5 10 15Ile Ser Thr Leu Arg Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr 20 25 30Arg Val Arg Ile Arg Tyr Ala Xaa Thr Thr Asn Leu Gln Phe His Thr 35 40 45Ser Ile Asp Gly Arg Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met 50 55 60Ser Ser Gly Ser Asn Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe65 70 75 80Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser 85 90 95Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu 100 105 110Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg 115 120 125Ala Gln Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 20CCAGGWTTTA YAGGAGGAGA TATTCTTCGA AGAACTTCAC CTGGCCAGAT TTCAACCTTA 60AGAGTAAATA TTACTGCACC ATTATCACAA AGATATCGGG TAAGAATTCG CTACGCTTYT 120ACYACAAATT TACAATTCCA TACATCAATT GACGGAAGAC CTATTAATCA GGGKAATTTT 180TCAGCAACTA TGAGTAGTGG GAGTAATTTA CAGTCCGGAA GCTTTAGGAC TGTAGGTTTT 240ACTACTCCGT TTAACTTTTC AAATGGATCA AGTGTATTTA CGTTAAGTGC TCATGTCTTC 300AATTCAGGCA ATGAAGTTTA TATAGATCGA ATTGAATTTG TTCCGGCAGA AGTAACCTTT 360GAGGCAGAAT ATGATTTAGA AAGAGCACAA AAGGCGGTGG CGAGCTTGTT TAC 413 106 amino acids amino acid single linear protein not provided 21Phe Thr Gly Gly Asp Ile Leu Arg Arg Asn Thr Ile Gly Glu Phe Val1 5 10 15Ser Leu Gln Val Asn Ile Asn Ser Pro Ile Thr Gln Arg Tyr Arg Leu 20 25 30Arg Phe Arg Tyr Ala Ser Ser Arg Asp Ala Arg Ile Thr Val Ala Ile 35 40 45Gly Gly Gln Ile Arg Val Asp Met Thr Leu Glu Lys Thr Met Glu Ile 50 55 60Gly Glu Ser Leu Thr Xaa Arg Thr Phe Ser Tyr Thr Asn Phe Ser Asn65 70 75 80Pro Phe Ser Phe Arg Ala Asn Pro Asp Ile Ile Arg Ile Ala Glu Glu 85 90 95Leu Pro Ile Arg Gly Gly Glu Leu Val Tyr 100 105 318 base pairs nucleic acid single linear DNA (genomic) not provided 22TTTACAGGAG GGGATATCCT TCGAAGAAAT ACCATTGGTG AGTTTGTGTC TTTACAAGTC 60AATATTAACT CACCAATTAC CCAAAGATAC CGTTTAAGAT TTCGTTATGC TTCCAGTAGG 120GATGCACGAA TTACTGTAGC GATAGGAGGA CAAATTAGAG TAGATATGAC CCTTGAAAAA 180ACCATGGAAA TTGGGGAGAG CTTAACATYT AGAACATTTA GCTATACCAA TTTTAGTAAT 240CCTTTTTCAT TTAGGGCTAA TCCAGATATA ATTAGAATAG CTGAAGAACT TCCTATTCGC 300GGTGGCGAGC TTGTTTAC 318 96 amino acids amino acid single linear protein not provided 23Ile Pro Leu Val Ser Leu Cys Leu Tyr Lys Ser Ile Leu Thr His Gln1 5 10 15Leu Pro Lys Asp Thr Val Xaa Xaa Phe Val Met Leu Pro Val Gly Met 20 25 30His Glu Leu Leu Xaa Arg Xaa Glu Asp Lys Leu Glu Xaa Ile Xaa Pro 35 40 45Leu Lys Lys Pro Trp Lys Leu Gly Arg Ala Xaa His Leu Glu His Leu 50 55 60Ala Ile Pro Ile Leu Val Ile Leu Phe His Leu Gly Leu Ile Gln Ile65 70 75 80Xaa Leu Glu Xaa Leu Lys Asn Phe Leu Phe Ala Val Ala Ser Leu Phe 85 90 95 292 base pairs nucleic acid single linear DNA (genomic) not provided 24AAATACCATT GGTGAGTTTG TGTCTTTACA AGTCAATATT AACTCACCAA TTACCCAAAG 60ATACCGTTTA ARATTTCGTT ATGCTTCCAG TAGGGATGCA CGAATTACTG TAGCGATAGG 120AGGACAAATT AGAGTAGATA TGACCCTTGA AAAAACCATG GAAATTGGGG AGAGCTTAAC 180ATCTAGAACA TTTAGCTATA CCAATTTTAG TAATCCTTTT TCATTTAGGG CTAATCCAGA 240TATAATTAGA ATAGCTGAAG AACTTCCTAT TCGCGGTGGC GAGCTTGTTT AC 292 108 amino acids amino acid single linear protein not provided 25Pro Gly Phe Xaa Gly Gly Asp Ile Leu Arg Arg Asn Thr Ile Gly Glu1 5 10 15Phe Val Ser Leu Gln Val Asn Ile Asn Ser Pro Ile Thr Gln Arg Tyr 20 25 30Arg Leu Arg Phe Arg Tyr Ala Ser Ser Arg Asp Ala Arg Ile Thr Val 35 40 45Ala Ile Gly Gly Gln Ile Arg Val Xaa Met Thr Leu Glu Lys Thr Met 50 55 60Glu Ile Gly Glu Ser Leu Thr Ser Arg Thr Phe Ser Tyr Thr Asn Phe65 70 75 80Ser Asn Pro Phe Ser Phe Arg Ala Asn Pro Asp Ile Ile Arg Ile Ala 85 90 95Glu Glu Leu Pro Ile Arg Gly Gly Glu Leu Val Tyr 100 105 324 base pairs nucleic acid single linear DNA (genomic) not provided 26CCAGGWTTTA YAGGAGGGGA TATCCTTCGA AGAAATACCA TTGGTGAGTT TGTGTCTTTA 60CAAGTCAATA TTAACTCACC AATTACCCAA AGATACCGTT TAAGATTTCG TTATGCTTCC 120AGTAGGGATG CACGAATTAC TGTAGCGATA GGAGGACAAA TTAGAGTAKA TATGACCCTT 180GAAAAAACCA TGGAAATTGG GGAGAGCTTA ACATCTAGAA CATTTAGCTA TACCAATTTT 240AGTAATCCTT TTTCATTTAG GGCTAATCCA GATATAATTA GAATAGCTGA AGAACTTCCT 300ATTCGCGGTG GCGAGCTTGT TTAC 324 136 amino acids amino acid single linear protein not provided 27Gly Phe Xaa Gly Gly Asp Val Ile Arg Arg Thr Asn Thr Gly Gly Phe1 5 10 15Gly Ala Ile Arg Val Ser Val Thr Gly Pro Leu Thr Gln Arg Tyr Arg 20 25 30Ile Arg Phe Arg Tyr Ala Ser Thr Ile Asp Phe Asp Phe Phe Val Thr 35 40 45Arg Gly Gly Thr Thr Ile Asn Asn Phe Arg Phe Thr Arg Thr Met Asn 50 55 60Arg Gly Gln Glu Ser Arg Tyr Glu Ser Tyr Arg Thr Val Glu Phe Thr65 70 75 80Thr Pro Phe Asn Phe Thr Gln Ser Gln Asp Ile Ile Arg Thr Xaa Ile 85 90 95Gln Gly Leu Ser Gly Asn Gly Glu Val Tyr Leu Asp Arg Ile Glu Ile 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Glu Glu Asp Leu Glu Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 411 base pairs nucleic acid single linear DNA (genomic) not provided 28AGGATTTAYA GGAGGAGATG TAATCCGAAG AACAAATACT GGTGGATTCG GAGCAATAAG 60GGTGTCGGTC ACTGGACCGC TAACACAACG ATATCGCATA AGGTTCCGTT ATGCTTCGAC 120AATAGATTTT GATTTCTTTG TAACACGTGG AGGAACTACT ATAAATAATT TTAGATTTAC 180ACGTACAATG AACAGGGGAC AGGAATCAAG ATATGAATCC TATCGTACTG TAGAGTTTAC 240AACTCCTTTT AACTTTACAC AAAGTCAAGA TATAATTCGA ACAYCTATCC AGGGACTTAG 300TGGAAATGGG GAAGTATACC TTGATAGAAT TGAAATCATC CCTGTAAATC CAACACGAGA 360AGCGGAAGAR GATTTAGAAG CGGCGAAGAA AGCGGTGGCG AGCTTGTTTA C 411 136 amino acids amino acid single linear protein not provided 29Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Glu Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 30CCAGGATTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAGG ATCTAGAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 142 amino acids amino acid single linear protein not provided 31Pro Gly Phe Xaa Gly Gly Gly Ile Leu Arg Arg Thr Thr Asn Gly Thr1 5 10 15Phe Gly Thr Leu Arg Val Thr Val Asn Ser Pro Leu Thr Gln Arg Tyr 20 25 30Arg Val Arg Val Arg Phe Ala Ser Ser Gly Asn Phe Ser Ile Arg Ile 35 40 45Leu Arg Gly Asn Thr Ser Ile Ala Tyr Gln Arg Phe Gly Ser Thr Met 50 55 60Asn Arg Gly Gln Glu Leu Thr Tyr Glu Ser Phe Val Thr Ser Glu Phe65 70 75 80Thr Thr Asn Gln Ser Asp Leu Pro Phe Thr Phe Thr Gln Ala Gln Glu 85 90 95Asn Leu Thr Ile Leu Ala Glu Gly Val Ser Thr Gly Ser Glu Tyr Phe 100 105 110Ile Asp Arg Ile Glu Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Glu 115 120 125Glu Asp Leu Glu Ala Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 140 428 base pairs nucleic acid single linear DNA (genomic) not provided 32CCAGGWTTTA YAGGAGGGGG TATACTCCGA AGAACAACTA ATGGCACATT TGGAACGTTA 60AGAGTAACAG TTAATTCACC ATTAACACAA AGATATCGCG TAAGAGTTCG TTTTGCTTCA 120TCAGGAAATT TCAGCATAAG GATACTGCGT GGAAATACCT CTATAGCTTA TCAAAGATTT 180GGGAGTACAA TGAACAGAGG ACAGGAACTA ACTTACGAAT CATTTGTCAC AAGTGAGTTC 240ACTACTAATC AGAGCGATCT GCCTTTTACA TTTACACAAG CTCAAGAAAA TTTAACAATC 300CTTGCAGAAG GTGTTAGCAC CGGTAGTGAA TATTTTATAG ATAGAATTGA AATCATCCCT 360GTGAACCCGG CACGAGAAGC AGAAGAGGAT TTAGAAGCRG CGAAGAAAGC GGTGGCGAGC 420TTGTTTAC 428 136 amino acids amino acid single linear protein not provided 33Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Glu Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 34CCAGGATTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAGG ATCTAGAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 35Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Gly Val Gly Thr1 5 10 15Phe Gly Thr Ile Arg Val Arg Thr Thr Ala Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Phe Ala Ser Thr Thr Asn Leu Phe Ile Gly Ile 35 40 45Arg Val Gly Asp Arg Gln Val Asn Tyr Phe Asp Phe Gly Arg Thr Met 50 55 60Asn Arg Gly Asp Glu Leu Arg Tyr Glu Ser Phe Ala Thr Arg Glu Phe65 70 75 80Thr Thr Asp Phe Asn Phe Arg Gln Pro Gln Glu Leu Ile Ser Val Phe 85 90 95Ala Asn Ala Phe Ser Ala Gly Gln Glu Val Tyr Phe Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Lys Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 36CCAGGTTTTA CAGGAGGGGA TATACTCCGA AGAACAGGGG TTGGTACATT TGGAACAATA 60AGGGTAAGGA CTACTGCCCC CTTAACACAA AGATATCGCA TAAGATTCCG TTTCGCTTCT 120ACCACAAATT TGTTCATTGG TATAAGAGTT GGTGATAGAC AAGTAAATTA TTTTGACTTC 180GGAAGAACAA TGAACAGAGG AGATGAATTA AGGTACGAAT CTTTTGCTAC AAGGGAGTTT 240ACTACTGATT TTAATTTTAG ACAACCTCAA GAATTAATCT CAGTGTTTGC AAATGCATTT 300AGCGCTGGTC AAGAAGTTTA TTTTGATAGA ATTGAGATTA TCCCCGTTAA TCCCGCACGA 360GAGGCGAAAG AGGATCTAGA AGCAGCAAAG AAAGCGGTGG CGAGCTTGTT TAC 413 137 amino acids amino acid single linear protein not provided 37Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Ser Pro Gly Gln1 5 10 15Ile Ser Thr Leu Arg Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr 20 25 30Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asn Leu Gln Phe His Thr 35 40 45Ser Ile Asp Gly Arg Pro Ile Asn Gln Gly Asn Phe Ser Ala Thr Met 50 55 60Ser Ser Gly Ser Asn Leu Gln Ser Gly Ser Phe Arg Thr Val Gly Phe65 70 75 80Thr Thr Pro Phe Asn Phe Ser Asn Gly Ser Ser Val Phe Thr Leu Ser 85 90 95Ala His Val Phe Asn Ser Gly Asn Glu Val Tyr Ile Asp Arg Ile Glu 100 105 110Phe Val Pro Ala Glu Val Thr Phe Glu Ala Glu Tyr Asp Leu Glu Arg 115 120 125Ala Gln Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 38CCAGGWTTTA CAGGAGGAGA TATTCTTCGA AGAACTTCAC CTGGCCAGAT TTCAACCTTA 60AGAGTAAATA TTACTGCACC ATTATCACAA AGATATCGGG TAAGAATTCG CTACGCTTCT 120ACCACAAATT TACAATTCCA TACATCAATT GACGGAAGAC CTATTAATCA GGGGAATTTT 180TCAGCAACTA TGAGTAGTGG GAGTAATTTA CAGTCCGGAA GCTTTAGGAC TGTAGGTTTT 240ACTACTCCGT TTAACTTTTC AAATGGATCA AGTGTATTTA CGTTAAGTGC TCATGTCTTC 300AATTCAGGCA ATGAAGTTTA TATAGATCGA ATTGAATTTG TTCCGGCAGA AGTAACCTTT 360GAGGCAGAAT ATGATTTAGA AAGAGCACAR AAGGCGGTGG CGAGCTTGTT TAC 413 137 amino acids amino acid single linear protein not provided 39Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Gly Val Gly Thr1 5 10 15Phe Gly Thr Ile Arg Val Arg Thr Thr Ala Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Phe Ala Ser Thr Thr Asn Leu Phe Ile Gly Ile 35 40 45Arg Val Gly Asp Arg Gln Val Asn Tyr Phe Asp Phe Gly Arg Thr Met 50 55 60Asn Arg Gly Asp Glu Leu Arg Tyr Glu Ser Phe Ala Thr Arg Glu Phe65 70 75 80Thr Thr Asp Phe Asn Phe Arg Gln Pro Gln Glu Leu Ile Ser Val Phe 85 90 95Ala Asn Ala Phe Ser Ala Gly Gln Glu Val Tyr Phe Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Lys Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 40CCAGGTTTTA CAGGAGGGGA TATACTCCGA AGAACAGGGG TTGGTACATT TGGAACAATA 60AGGGTAAGGA CTACTGCCCC CTTAACACAA AGATATCGCA TAAGATTCCG TTTCGCTTCT 120ACCACAAATT TGTTCATTGG TATAAGAGTT GGTGATAGAC AAGTAAATTA TTTTGACTTC 180GGAAGAACAA TGAACAGAGG AGATGAATTA AGGTACGAAT CTTTTGCTAC AAGGGAGTTT 240ACTACTGATT TTAATTTTAG ACAACCTCAA GAATTAATCT CAGTGTTTGC AAATGCATTT 300AGCGCTGGTC AAGAAGTTTA TTTTGATAGA ATTGAGATTA TCCCCGTTAA TCCCGCACGA 360GAGGCGAAAG AGGATCTAGA AGCAGCAAAG AAAGCGGTGG CGAGCTTGTT TAC 413 137 amino acids amino acid single linear protein not provided 41Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Asn Ala Gly Asn1 5 10 15Phe Gly Asp Met Arg Val Asn Ile Thr Ala Pro Leu Ser Gln Arg Tyr 20 25 30Arg Val Arg Ile Arg Tyr Ala Ser Thr Ala Asn Leu Gln Phe His Thr 35 40 45Ser Ile Asn Gly Arg Ala Ile Asn Gln Ala Asn Phe Pro Ala Thr Met 50 55 60Asn Ser Gly Glu Asn Leu Gln Ser Gly Ser Phe Arg Val Ala Gly Phe65 70 75 80Thr Thr Pro Phe Thr Phe Ser Asp Ala Leu Ser Thr Phe Thr Ile Gly 85 90 95Ala Phe Ser Phe Ser Ser Asn Asn Glu Val Tyr Ile Asp Arg Ile Glu 100 105 110Phe Val Pro Ala Glu Val Thr Phe Ala Thr Glu Ser Asp Gln Asp Arg 115 120 125Ala Gln Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 42CCAGGWTTTA CAGGAGGGGA TATCCTTCGA AGAACGAATG CTGGTAACTT TGGAGATATG 60CGTGTAAACA TTACTGCACC ACTATCACAA AGATATCGCG TAAGGATTCG TTATGCTTCT 120ACTGCAAATT TACAATTCCA TACATCAATT AACGGAAGAG CCATTAATCA GGCGAATTTC 180CCAGCAACTA TGAACAGTGG GGAGAATTTA CAGTCCGGAA GCTTCAGGGT TGCAGGTTTT 240ACTACTCCAT TTACCTTTTC AGATGCACTA AGCACATTCA CAATAGGTGC TTTTAGCTTC 300TCTTCAAACA ACGAAGTTTA TATAGATCGA ATTGAATTTG TTCCGGCAGA AGTAACATTT 360GCAACAGAAT CTGATCAGGA TAGAGCACAA AAGGCGGTGG CGAGCTTGTT TAC 413 136 amino acids amino acid single linear protein not provided 43Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Xaa Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 44CCAGGATTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAGG ATCTAKAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 45Gln Xaa Leu Ser Gly Gly Asp Val Ile Arg Arg Thr Asn Thr Gly Gly1 5 10 15Phe Gly Ala Ile Arg Val Ser Val Thr Gly Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Tyr Ala Ser Thr Ile Asp Phe Asp Phe Phe Val 35 40 45Thr Arg Gly Gly Thr Thr Ile Asn Asn Phe Arg Phe Thr Arg Thr Met 50 55 60Asn Arg Gly Gln Glu Ser Arg Tyr Glu Ser Tyr Arg Thr Val Glu Phe65 70 75 80Thr Thr Pro Phe Asn Phe Thr Gln Ser Gln Asp Ile Ile Arg Thr Ser 85 90 95Ile Gln Gly Leu Ser Gly Asn Gly Glu Val Tyr Leu Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Thr Arg Glu Ala Glu Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 414 base pairs nucleic acid single linear DNA (genomic) not provided 46CCAGGWTTTA tCAGGAGGAG ATGTAATCCG AAGAACAAAT ACTGGTGGAT TCGGAGCAAT 60AAGGGTGTCG GTCACTGGAC CGCTAACACA ACGATATCGC ATAAGGTTCC GTTATGCTTC 120GACAATAGAT TTTGATTTCT TTGTAACACG TGGAGGAACT ACTATAAATA ATTTTAGATT 180TACACGTACA ATGAACAGGG GACAGGAATC AAGATATGAA TCCTATCGTA CTGTAGAGTT 240TACAACTCCT TTTAACTTTA CACAAAGTCA AGATATAATT CGAACATCTA TCCAGGGACT 300TAGTGGAAAT GGGGAAGTAT ACCTTGATAG AATTGAAATC ATCCCTGTAA ATCCAACACG 360AGAAGCGGAA GARGATTTAG AAGCGGCGAA GAAAGCGGTG GCGAGCTTGT TTAC 414 142 amino acids amino acid single linear protein not provided 47Pro Gly Phe Thr Gly Gly Gly Ile Leu Arg Arg Thr Thr Asn Gly Thr1 5 10 15Phe Gly Thr Leu Arg Val Thr Val Asn Ser Pro Leu Thr Gln Arg Tyr 20 25 30Arg Val Arg Val Arg Phe Ala Ser Ser Gly Asn Phe Ser Ile Arg Ile 35 40 45Leu Arg Gly Asn Thr Ser Ile Ala Tyr Gln Arg Phe Gly Ser Thr Met 50 55 60Asn Arg Gly Gln Glu Leu Thr Tyr Glu Ser Phe Val Thr Ser Glu Phe65 70 75 80Thr Thr Asn Gln Ser Asp Leu Pro Phe Thr Phe Thr Gln Ala Gln Glu 85 90 95Asn Leu Thr Ile Leu Ala Glu Gly Val Ser Thr Gly Ser Glu Tyr Phe 100 105 110Ile Asp Arg Ile Glu Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Glu 115 120 125Glu Asp Leu Glu Ala Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 140 428 base pairs nucleic acid single linear DNA (genomic) not provided 48CCAGGWTTTA CAGGAGGGGG TATACTCCGA AGAACAACTA ATGGCACATT TGGAACGTTA 60AGAGTAACAG TTAATTCACC ATTAACACAA AGATATCGCG TAAGAGTTCG TTTTGCTTCA 120TCAGGAAATT TCAGCATAAG GATACTGCGT GGAAATACCT CTATAGCTTA TCAAAGATTT 180GGGAGTACAA TGAACAGAGG ACAGGAACTA ACTTACGAAT CATTTGTCAC AAGTGAGTTC 240ACTACTAATC AGAGCGATCT GCCTTTTACA TTTACACAAG CTCAAGAAAA TTTAACAATC 300CTTGCAGAAG GTGTTAGCAC CGGTAGTGAA TATTTTATAG ATAGAATTGA AATCATCCCT 360GTGAACCCGG CACGAGAAGC AGAAGAGGAT TTAGAAGCAG CGAAGAAAGC GGTGGCGAGC 420TTGTTTAC 428 136 amino acids amino acid single linear protein not provided 49Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Glu Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 50CCAGGWTTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAGG ATCTAGAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 51Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg Thr Gly Val Gly Thr1 5 10 15Phe Gly Thr Ile Arg Val Arg Thr Thr Ala Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Phe Ala Ser Thr Thr Asn Leu Phe Ile Gly Ile 35 40 45Arg Val Gly Asp Arg Gln Val Asn Tyr Phe Asp Phe Gly Arg Thr Met 50 55 60Asn Arg Gly Asp Glu Leu Arg Tyr Glu Ser Phe Ala Thr Arg Glu Phe65 70 75 80Thr Thr Asp Phe Asn Phe Arg Gln Pro Gln Glu Leu Ile Ser Val Phe 85 90 95Ala Asn Ala Phe Ser Ala Gly Gln Glu Val Tyr Phe Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Lys Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 412 base pairs nucleic acid single linear DNA (genomic) not provided 52CCAGGTTTTA CAGGAGGGGA TATACTCCGA AGAACAGGGG TTGGTACATT TGGAACAATA 60AGGGTAAGGA CTACTGCCCC CTTAACACAA AGATATCGCA TAAGATTCCG TTTCGCTTCT 120ACCACAAATT TGTTCATTGG TATAAGAGTT GGTGATAGAC AAGTAAATTA TTTTGACTTC 180GGAAGAACAA TGAACAGAGG AGATGAATTA AGGTACGAAT CTTTTGCTAC AAGGGAGTTT 240ACTACTGATT TTAATTTTAG ACAACCTCAA GAATTAATCT CAGTGTTTGC AAATGCATTT 300AGCGCTGGTC AAGAAGTTTA TTTTGATAGA ATTGAGATTA TCCCCGTTAA TCCCGCACGA 360GAGGCGAAAG AGGATCTAGA AGCAGCAAAG AAAGCGGTGG CGAGCTTGTT TA 412 137 amino acids amino acid single linear protein not provided 53Pro Gly Phe Thr Gly Gly Asp Val Ile Arg Arg Thr Asn Thr Gly Gly1 5 10 15Phe Gly Ala Ile Arg Val Ser Val Thr Gly Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Tyr Ala Ser Thr Ile Asp Phe Asp Phe Phe Val 35 40 45Thr Arg Gly Gly Thr Thr Ile Asn Asn Phe Arg Phe Thr Arg Thr Met 50 55 60Asn Arg Gly Gln Glu Ser Arg Tyr Glu Ser Tyr Arg Thr Val Glu Phe65 70 75 80Thr Thr Pro Phe Asn Phe Thr Gln Ser Gln Asp Ile Ile Arg Thr Ser 85 90 95Ile Gln Gly Leu Ser Gly Asn Gly Glu Val Tyr Leu Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Thr Arg Glu Ala Glu Glu Asp Xaa Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 54CCAGGATTTA CAGGAGGAGA TGTAATCCGA AGAACAAATA CTGGTGGATT CGGAGCAATA 60AGGGTGTCGG TCACTGGACC GCTAACACAA CGATATCGCA TAAGGTTCCG TTATGCTTCG 120ACAATAGATT TTGATTTCTT TGTAACACGT GGAGGAACTA CTATAAATAA TTTTAGATTT 180ACACGTACAA TGAACAGGGG ACAGGAATCA AGATATGAAT CCTATCGTAC TGTAGAGTTT 240ACAACTCCTT TTAACTTTAC ACAAAGTCAA GATATAATTC GAACATCTAT CCAGGGACTT 300AGTGGAAATG GGGAAGTATA CCTTGATAGA ATTGAAATCA TCCCTGTAAA TCCAACACGA 360GAAGCGGAAG AGGATTTWGA AGCGGCGAAG AAAGCGGTGG CGAGCTTGTT TAC 413 136 amino acids amino acid single linear protein not provided 55Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Xaa Asp Leu Xaa Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 56CCAGGATTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAKG ATCTABAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 137 amino acids amino acid single linear protein not provided 57Pro Gly Phe Thr Gly Gly Asp Val Ile Arg Arg Thr Asn Thr Gly Gly1 5 10 15Phe Gly Ala Ile Arg Val Ser Val Thr Gly Pro Leu Thr Gln Arg Tyr 20 25 30Arg Ile Arg Phe Arg Tyr Ala Ser Thr Ile Asp Phe Asp Phe Phe Val 35 40 45Thr Arg Gly Gly Thr Thr Ile Asn Asn Phe Arg Phe Thr Arg Thr Met 50 55 60Asn Arg Gly Gln Glu Ser Arg Tyr Glu Ser Tyr Arg Thr Val Glu Phe65 70 75 80Thr Thr Pro Phe Asn Phe Thr Gln Ser Gln Asp Ile Ile Arg Thr Ser 85 90 95Ile Gln Gly Leu Ser Gly Asn Gly Glu Val Tyr Leu Asp Arg Ile Glu 100 105 110Ile Ile Pro Val Asn Pro Thr Arg Glu Ala Glu Glu Asp Leu Glu Ala 115 120 125Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 413 base pairs nucleic acid single linear DNA (genomic) not provided 58CCAGGWTTTA CAGGAGGAGA TGTAATCCGA AGAACAAATA CTGGTGGATT CGGAGCAATA 60AGGGTGTCGG TCACTGGACC GCTAACACAA CGATATCGCA TAAGGTTCCG TTATGCTTCG 120ACAATAGATT TTGATTTCTT TGTAACACGT GGAGGAACTA CTATAAATAA TTTTAGATTT 180ACACGTACAA TGAACAGGGG ACAGGAATCA AGATATGAAT CCTATCGTAC TGTAGAGTTT 240ACAACTCCTT TTAACTTTAC ACAAAGTCAA GATATAATTC GAACATCTAT CCAGGGACTT 300AGTGGAAATG GGGAAGTATA CCTTGATAGA ATTGAAATCA TCCCTGTAAA TCCAACACGA 360GAAGCGGAAG AGGATTTAGA AGCGGCGAAG AAAGCGGTGG CGAGCTTGTT TAC 413 142 amino acids amino acid single linear protein not provided 59Pro Gly Phe Xaa Gly Gly Gly Ile Leu Arg Arg Thr Thr Asn Gly Thr1 5 10 15Phe Gly Thr Leu Arg Val Thr Val Asn Ser Pro Leu Thr Gln Arg Tyr 20 25 30Arg Val Arg Val Arg Phe Ala Ser Ser Gly Asn Phe Ser Ile Arg Ile 35 40 45Leu Arg Gly Asn Thr Ser Ile Ala Tyr Gln Arg Phe Gly Ser Thr Met 50 55 60Asn Arg Gly Gln Glu Leu Thr Tyr Glu Ser Phe Val Thr Ser Glu Phe65 70 75 80Thr Thr Asn Gln Ser Asp Leu Pro Phe Thr Phe Thr Gln Ala Gln Glu 85 90 95Asn Leu Thr Ile Leu Ala Glu Gly Val Ser Thr Gly Ser Glu Tyr Phe 100 105 110Ile Asp Arg Ile Glu Ile Ile Pro Val Asn Pro Ala Arg Glu Ala Glu 115 120 125Glu Asp Leu Glu Ala Ala Lys Lys Ala Val Ala Ser Leu Phe 130 135 140 428 base pairs nucleic acid single linear DNA (genomic) not provided 60CCAGGWTTTA YAGGAGGGGG TATACTCCGA AGAACAACTA ATGGCACATT TGGAACGTTA 60AGAGTAACAG TTAATTCACC ATTAACACAA AGATATCGCG TAAGAGTTCG TTTTGCTTCA 120TCAGGAAATT TCAGCATAAG GATACTGCGT GGAAATACCT CTATAGCTTA TCAAAGATTT 180GGGAGTACAA TGAACAGAGG ACAGGAACTA ACTTACGAAT CATTTGTCAC AAGTGAGTTC 240ACTACTAATC AGAGCGATCT GCCTTTTACA TTTACACAAG CTCAAGAAAA TTTAACAATC 300CTTGCAGAAG GTGTTAGCAC CGGTAGTGAA TATTTTATAG ATAGAATTGA AATCATCCCT 360GTGAACCCGG CACGAGAAGC AGAAGAGGAT TTAGAAGCAG CGAAGAAAGC GGTGGCGAGC 420TTGTTTAC 428 136 amino acids amino acid single linear protein not provided 61Pro Gly Phe Ile Gly Gly Ala Leu Leu Gln Arg Thr Asp His Gly Ser1 5 10 15Leu Gly Val Leu Arg Val Gln Phe Pro Leu His Leu Arg Gln Gln Tyr 20 25 30Arg Ile Arg Val Arg Tyr Ala Ser Thr Thr Asn Ile Arg Leu Ser Val 35 40 45Asn Gly Ser Phe Gly Thr Ile Ser Gln Asn Leu Pro Ser Thr Met Arg 50 55 60Leu Gly Glu Asp Leu Arg Tyr Gly Ser Phe Ala Ile Arg Glu Phe Asn65 70 75 80Thr Ser Ile Arg Pro Thr Ala Ser Pro Asp Gln Ile Arg Leu Thr Ile 85 90 95Glu Pro Ser Phe Ile Arg Gln Glu Val Tyr Val Asp Arg Ile Glu Phe 100 105 110Ile Pro Val Asn Pro Thr Arg Glu Ala Lys Glu Asp Leu Glu Ala Ala 115 120 125Lys Lys Ala Val Ala Ser Leu Phe 130 135 410 base pairs nucleic acid single linear DNA (genomic) not provided 62CCAGGTTTTA TAGGAGGAGC TCTACTTCAA AGGACTGACC ATGGTTCGCT TGGAGTATTG 60AGGGTCCAAT TTCCACTTCA CTTAAGACAA CAATATCGTA TTAGAGTCCG TTATGCTTCT 120ACAACAAATA TTCGATTGAG TGTGAATGGC AGTTTCGGTA CTATTTCTCA AAATCTCCCT 180AGTACAATGA GATTAGGAGA GGATTTAAGA TACGGATCTT TTGCTATAAG AGAGTTTAAT 240ACTTCTATTA GACCCACTGC AAGTCCGGAC CAAATTCGAT TGACAATAGA ACCATCTTTT 300ATTAGACAAG AGGTCTATGT AGATAGAATT GAGTTCATTC CAGTTAATCC GACGCGAGAG 360GCGAAAGAGG ATCTAGAAGC AGCAAAAAAA GCGGTGGCGA GCTTGTTTAC 410 23 base pairs nucleic acid single linear DNA (genomic) not provided 63GTTCATTGGT ATAAGAGTTG GTG 23 25 base pairs nucleic acid single linear DNA (genomic) not provided 64CCACTGCAAG TCCGGACCAA ATTCG 25 24 base pairs nucleic acid single linear DNA (genomic) not provided 65GAATATATTC CCGTCYATCT CTGG 24 23 base pairs nucleic acid single linear DNA (genomic) not provided 66GCACGAATTA CTGTAGCGAT AGG 23 25 base pairs nucleic acid single linear DNA (genomic) not provided 67GCTGGTAACT TTGGAGATAT GCGTG 25 23 base pairs nucleic acid single linear DNA (genomic) not provided 68GATTTCTTTG TAACACGTGG AGG 23 22 base pairs nucleic acid single linear DNA (genomic) not provided 69CACTACTAAT CAGAGCGATC TG 22

Claims

1. A method for the control of a lepidopteran pest wherein said method comprises contacting said pest with a pesticidal amount of a Bacillus thuringiensis toxin, or a pesticidal portion of said toxin, wherein said toxin is obtainable from Bacillus thuringiensis isolate PS31G1 NRRL B-21560, wherein said isolate comprises a polynucleotide that encodes said toxin, and wherein said polynucleotide comprises the nucleotide sequence shown in SEQ ID NO. 18.

2. The method of claim 1 wherein said pest is a cutworm.

3. The method of claim 2 wherein said pest is a black cutworm.

4. The method of claim 1 wherein said pest is Agrotis epsilon.