The invention concerns a trans-splicing RNA (tsRNA) molecule comprising one or multiple unstructured binding domains; a cell or vector comprising said tsRNA; and a method for killing cells or treating a disease using said tsRNA.
The sequence listing disclosed herein is included in a text file having the name “Sequence_Listing,” created on december 7, having a size of 33,009 bytes. The foregoing text file is incorporated herein by reference.
Spliceosome-meditated RNA trans-splicing (SMaRT) is the process by which two distinct precursor messenger RNAs (pre-mRNAs), or other spliceable RNAs, are joint in trans to generate a chimeric RNA molecule in the nucleus that, after nuclear export, triggers the formation of a chimeric protein in the cytoplasm. This technology can be used to repair defective RNA, e.g. by replacing a mutated with an intact exon, or to label an endogenous message with a functional sequence.
However, trans-splicing-based repair is difficult to achieve because durable repair requires the trans-splicing RNA to be delivered continuously or to be expressed endogenously after genomic integration, it also requires precise splicing towards the intended splice sites within the target, and it must be efficient enough to trigger the therapeutic phenotype despite strong competition with regular cis-splicing.
Trans-splicing-based labelling with a functional sequence concerns, for example, an RNA coding for a fluorescent protein to monitor the expression of genes in living cells or a death signal to selectively trigger death of cells expressing aberrant transcripts in a suicide gene therapy approach. An aberrant transcript can be a biomarker for diseased cells such as transcripts of oncogenes specific for cancer or viral transcripts. The death signal can be triggered by a) a direct signal such as a toxin e.g. diphtheria or the cholera toxin, b) an apoptotic gene such as a caspase, or c) an enzyme such as the herpes simplex virus thymidine kinase (HSVtk) that triggers a death signal upon co-delivery of a drug like ganciclovir (GCV). Direct toxins a) or apoptotic signals b) can immediately trigger cell death which, unfortunately, increases the risks involved with unspecific targeting or off-targeting. This makes the regulatory approval of such technologies problematical. In contrast, the use of a combination of two components c) which, by themselves, are not toxic to the cells represents a much safer approach.
As a therapy, trans-splicing-triggered cell death is easier to achieve than trans-splicing-based repair because the trans-splicing construct needs to be delivered only once into the target cells and so long-term expression is not necessary. Moreover, alternative on-target trans-splicing, i.e. trans-splicing towards the right target but involving any splice sites of that target, is not disadvantageous but instead contributes to a target-specific death signal and trans-splicing doesn't need to be highly efficient to trigger a signal that is strong enough to kill the targeted cells.
Based on the HSVtk/GCV-system we have developed an efficient trans-splicing-based suicide gene therapy approach. We have designed new trans-splicing RNAs both for 5′ and 3′ exon replacement (ER), i.e. for attaching a suicide gene or a component of a suicide gene system such, as the HSVtk, either to the 5′ or 3′ end of the target message. We have investigated RNA structure design to improve both on-target activity and specificity of trans-splicing RNA (tsRNA).
According to a first aspect, there is provided a trans-splicing RNA molecule comprising: at least one binding domain specific for at least a part of a gene that associates with or is a biomarker for a disease to be treated;
Reference herein to of a gene that associates with or is a biomarker for a disease to be treated is reference to a gene that is characteristic of said disease and so is exclusively or preferentially present or expressed when said disease occurs.
Reference herein to a protein that is a component of a suicide system is reference to a protein that interacts with at least one other molecule to trigger or result in death of a cell in which said protein is expressed.
Those skilled in the art will appreciate that the tsRNA has nucleotides complementary to a gene with which it is to bind and because it is RNA will include the nucleotides adenosine, guanosine, cytidine or uridine and the respective bases adenine, guanine, cytosine, and uracil or known chemical modifications of the same.
As those skilled in the art know, RNA is a chain of nucleotides, but unlike DNA, it is often found in nature as a single-strand folded onto itself due to the presence of self-complementary sequences that allow parts of the RNA to fold and pair with itself to form a highly structured molecule. Thus, reference herein to an unstructured state is reference to a state within said binding site where the sequence of RNA nucleotides exists in an unfolded chain. This chain may be curved or bent but it is not folded; thus there is no internal binding or self-complementary sequences.
As an alternative, a further way of describing an unstructured state is where said binding site comprises a sequence predicted not to fold into a stable minimum free energy secondary structure (Gibbs free energy of RNA secondary structure formation ΔG≥0 kcal/mol) or is at least less structured than the average of possible binding domains (ΔG>ΔGaverage). While RNAfold indicates such structures as open circle, mfold would not give any result for structures with ΔG≥0 kcal/mol.
In favoured embodiments said binding domain is not fully complementary to the target gene, or pre-mRNA, and so said binding domain does not form perfect duplexes with the target gene and, usually, is not longer than 200 bp, most usually not longer than 100 bp.
In certain embodiments of the invention said binding domain, including said binding site, comprises a sequence of nucleotides selected from the list comprising or consisting of: 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300 or more nucleotides.
In yet further certain embodiments of the invention said binding domain comprises a sequence of nucleotides that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to said part of said gene that associates with or is a biomarker for a disease to be treated. Ideally, the mismatches in said binding domain are positioned in way to avoid any stretches of 45 nt or longer that are perfectly complementary to the target, including or excluding said binding site, and ideally at least 5 nucleotides from the 5′ or 3′ end. We think these features most likely act by suppressing antisense effects including A-to-I editing that might result from the formation of long double-stranded RNA in the nucleus. These features appear to be particularly beneficial in 3′ER.
In certain embodiments the binding domain, particularly when it is short i.e. less than 100 nucleotides including the binding site, is located adjacent a spacer sequence that helps to maintain the unstructured nature of the binding domain and so the tsRNA also includes a spacer sequence, known to those skilled in the art, adjacent said binding domain.
Those skilled in the art will appreciate that said binding domain can be designed to bind to any biomarker of any disease and, providing it has the recited features, efficient trans-splicing will occur. Thus the suicide gene therapy constructs or sequences described herein can easily be reprogrammed to target alternative diseases or diseased tissue simply by exchanging the target binding domains.
In yet further certain embodiments of the invention said trans-splicing RNA molecule comprises a plurality of said binding domains which are complementary to the same or different parts of a gene that associates with or is a biomarker for a disease to be treated. Where the further binding domain is for the same part of the gene we have found it significantly improves specific on-target trans-splicing. Where the further binding domain is for a different part of the gene or even a different gene we have found it enhances trans-splicing activity and improves the trans-splicing phenotype.
Indeed, we have found that the specificity of trans-splicing with the intended target splice site was improved 6-fold by designing trans-splicing RNA (tsRNA) comprising multiple target binding domains. In addition, or as an alternative to the afore, we also found that the inclusion in the tsRNA, outside the binding domain, of at least one cis-binding or self-binding domain shielded the trans-splice site in the absence of the target DNA. The inclusion of both multiple target binding domains and at least one of said cis-binding domains improved the specificity of trans-splicing 10-fold and the trans-splicing activity more than 2-fold. Therefore in certain embodiments said tsRNA further comprises at least one cis-binding domain located outside said binding domain.
In certain further embodiments said tsRNA is either 5′ or 3′ tsRNA.
While unstructured, mismatched target binding domains significantly improved both 5′ or 3′ exon replacement, either 3′ER or 5′ER was improved by increasing the thermodynamic stability of the tsRNA 3′ end. This was undertaken by creating a highly structured 3′ end by inserting therein an RNA chain of nucleotides that is folded, or pairs with itself, due to the presence of self-complementary sequences, to form a highly structured molecule. An example of a highly structured RNA chain for insertion into the tsRNA is a hammerhead ribozyme sequence, a hairpin loop forming sequence, or a y-shaped structure forming sequence, however, other such structure are known by those skilled in the art and so can be used for this purpose. Accordingly, other certain embodiments comprise at least one 3′ highly structured RNA sequence. We think this feature most likely acts by stabilizing the trans-splicing RNA and protecting it from ribonucleolytic degradation. This feature appears to be particularly beneficial in 5′ER. Further formation of the active ribozyme, hairpin loop, or Y-shaped structure was supported by inserting a spacer between the ribozyme and the polyA site.
5′ER was improved by inserting a cis-cleaving tertiary structure stabilized (second generation) hammerhead ribozyme between the binding domains and the polyadenylation site, or when other highly stable RNA chains were used, then between theses stable RNA chains and the polyadenylation site. This feature removes the polyA tail of the trans-splicing RNA which then cannot be exported anymore into the cytoplasm increasing its nuclear concentration and trans-splicing activity. This feature also avoids that trans-splicing RNA for 5′ER can be exported, translated, and trigger a phenotype in the absence of trans-splicing.
Our work shows that these optimised tsRNAs efficiently triggered the death of HPV-16 or AFP-positive cells. Thus, spliceosome-mediated RNA trans-splicing represents a promising therapeutic strategy to trigger cell death in suicide gene therapy approaches.
In other embodiments said disease is cancer or a viral infection or a bacterial infection or an acquired genetic disease caused by mutations triggered by transposable elements, radiation, chemicals, or unknown triggers.
In the first instance said cancer is selected from the group comprising: hepatocellular carcinoma (HCC), cervical cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancers, melanoma including malignant melanoma, squamous-cell carcinoma, basal-cell carcinoma, Merkel cell carcinoma, lung cancer, cell bladder cancer, breast cancer, colon or rectal cancer, anal cancer, endometrial cancer, kidney cancer, leukemia, acute myelogenous or myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), chronic lymphotic leukemia (CML), chronic myelogenous or myeloid leukemia (CML), hairy cell leukemia (HCL), T-cell prolymphocytic leukemia (P-TLL), large granular lymphocytic leukemia, adult T-cell leukemia, lymphoma, myeloma, non-Hodgkin lymphoma, pancreatic cancer, prostate cancer, thyroid cancer, nasopharyngeal cancer, mouth or throat cancer, oropharyngeal cancers, stomach cancer, brain tumours, bone cancer, and stem cell cancers and, indeed pther cancers that would benefit from the treatment disclosed herein.
In the second instance said viral infection is selected from the group comprising: Papillomaviruses, human papillomavirus type 16, human papillomavirus type 18, retroviruses, lentiviruses, herpes viruses, adenovirus, adeno-associated virus, Flu virus, Hepatitis virus, Hepatitis B virus (HBV), Hepatitis C virus (HCV), Epstein-Barr virus (EBV), human T-cell lymphotropic virus (HTLV), human immunodeficiency virus (HIV), human immunodeficiency virus type 1 (HIV-1), and human immunodeficiency virus type 2 (HIV-2), and others.
In the third instance said bacterial infection is selected from the group comprising: Bartonella henselae, Francisella tularensis, Listeria monocytogenes, salmonella species, Salmonella typhi, Brucella species, Legionella species. Mycobacteria species, Mycobacterium tunberculosis, Nocardia species, Rhodococcus species, Yersinia species, Neisseria meningitides and others.
In the last instance said acquired genetic disease is selected from the group comprising: Neurofibromatosis 1 and 2, Mc Cune Albright, Duchenne muscular dystrophy (DMD), Epidermolysis bullosa, Fanconi A and C, Philadelphia chromosome, Hemophilia A and B, cystic fibrosis, Muckle Wells syndrome, lipoprotein lipase deficiency, B-thalassemia, pyruvate dehydrogenase complex deficiency, and others.
In an alternative aspect there is provided a medicament comprising said tsRNA according to the invention and, optionally, at least one further component of said suicide system effective to trigger death of a cell expressing said trans-spliced RNA.
In an alternative aspect there is provided a pharmaceutical composition comprising said tsRNA according to the invention; optionally, at least one further component of said suicide system effective to trigger death of a cell expressing said trans-spliced RNA; and a carrier suitable for human or veterinary use.
In the afore optional instance said further component may be, e.g., ganciclovir, although other known co-component suicide systems for cell death may be used. Examples are cytosine deaminase-5-fluorocytosine, cytochrome P450—ifosfamide, cytochrome P450-cyclophosphamide, and nitroreductase-5-[aziridin-1-yl]-2,4-dinitrobenzamide.
In an alternative aspect there is provided a cell containing said tsRNA or a vector containing said tsRNA.
In a further aspect there is provided method of killing a cell comprising transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming said cell with tsRNA or a vector containing the tsRNA according to the invention and, optionally, exposing said cell to at least one other component of said suicide system effective to trigger death of a cell expressing said trans-spliced RNA.
In this embodiment the invention is typically practiced in vitro.
In a further aspect there is provided a method of treating a disease comprising transfecting, lipofecting, transducing, electroporating, nucleofecting or transforming a diseased cell with tsRNA or a vector containing the tsRNA according to the invention ex vivo or in vivo and, optionally, exposing said cell to at least one other component of said suicide system effective to trigger death of a cell expressing said trans-spliced RNA.
In a further aspect there is provided a method of targeting a diseased cell comprising topical application (including a cream, a gel, a foam, a lotion, ointment or aerosol), intranasal application, alveolar application, systemic application, oral application, intravenous application, intramuscular application, subcutaneous application, cutaneous application, intraperitoneal application, or injection into a tumor with tsRNA or a vector containing the tsRNA according to the invention in vivo and, and, optionally, exposing said cell to other components of said suicide system effective to kill said cell.
In a certain methods of the invention said cell is a virally transformed cell. Typically the cell is transformed with a virus selected from the group comprising: Papillomaviruses, human papillomavirus type 16, human papillomavirus type 18, retroviruses, lentiviruses, herpes viruses, adenovirus, adeno-associated virus, Flu virus, Hepatitis virus, Hepatitis B virus (HBV), Hepatitis C virus (HCV), Epstein-Barr virus (EBV), human T-cell lymphotropic virus (HTLV), human immunodeficiency virus (HIV), human immunodeficiency virus type 1 (HIV-1), and human immunodeficiency virus type 2 (HIV-2).
In yet other methods of the invention said cell is a cancer cell such as a hepatocellular carcinoma (HCC) cell, cervical cancer cell, vaginal cancer cell, vulvar cancer cell, penile cancer cell, skin cancer cell, melanoma cell including malignant melanoma cell, squamous-cell carcinoma cell, basal-cell carcinoma cell, Merkel cell carcinoma cell, lung cancer cell, cell bladder cancer cell, breast cancer cell, colon or rectal cancer cell, anal cancer cell, endometrial cancer cell, kidney cancer cell, leukemia cell, acute myelogenous or myeloid leukemia (AML) cell, acute lymphoblastic leukemia (ALL) cell, chronic lymphotic leukemia (CML) cell, chronic myelogenous or myeloid leukemia (CML) cell, hairy cell leukemia (HCL) cell, T-cell prolymphocytic leukemia (P-TLL) cell, large granular lymphocytic leukemia cell, adult T-cell leukemia cell, lymphoma cell, myeloma cell, non-Hodgkin lymphoma cell, pancreatic cancer cell, prostate cancer cell, thyroid cancer cell, nasopharyngeal cancer cell, mouth or throat cancer cell, oropharyngeal cancer cell, stomach cancer cell, brain tumour cell, bone cancer cell, and stem cell cancer cell. Ideally said cell is mammalian and most typically human.
In the claims which follow and in the preceding description of the invention, except where the context requires otherwise due to express language or necessary implication, the word “comprise”, or variations such as “comprises” or “comprising” is used in an inclusive sense i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
All references, including any patent or patent application, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any of the prior art constitutes part of the common general knowledge in the art.
Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.
Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings).
Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.
Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
The patent or application file contains at least one drawings executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
An embodiment of the present invention will now be described by way of example only with reference to the following wherein:
RNA design: The trans-splicing constructs were designed combining various reported and novel molecular features to improve activity and target specificity. The 3′ER ts constructs consisted of a CMV promoter (pEGFP-N1, Clontech acc no. U55762) followed by a binding domain (BD) of 50 bases complementary to the target AFP intron 5. The BD included two mismatches at positions 18 and 19 to inhibit potential antisense (as) effects that can be triggered by longer dsRNA in the nucleus of the cell. Software ‘foldanalyze’ (HUSAR, DKFZ) was used to select short unstructured BDs within the complete antisense RNA structure space that can be directed against the AFP intron 5. Structures of the selected BDs were confirmed by RNA 2° structure (minimum free energy and centroid) predictions using software tools mfold and RNAfold. Such selected BDs were then fused with the rest of the trans-splicing RNA making sure that the BDs remained unstructured upon fusion and were not involved in base-pairing the trans-splicing or coding domains which was achieved by implementing suitable spacers. The selected 3′splice signal (3′ss) was designed to functionally compete with the cellular cis-splice site and was supported by an intronic splice enhancer (ISE) (McCarthy, et al., 1998; Konczak, et al., 2000; Yeo et al., 2004), a branchpoint (BP) (Eul, 2006) and polypyrimidine tract (Ppt) (Nobel, et al., 1998; Taggart, et al, 2012). The HSVtk cds was preceded with a sequence coding for a proteolytic cleavage site P2A (Kim, et al, 2011) to ensure endogenous release of the native HSV-tk from the AFP-HSVtk fusion protein that initially results from the trans-splicing process. The HSVtk gene is devoid of a start codon and can only be translated after trans-splicing using the translational start of the target message. The HSVtk gene was equipped with an A/G-rich exonic splice enhancer (ESE) generated by using degenerative alternative codons that do not alter the HSV-tk amino acid sequence (Fairbrother, et al, 2002; Jin et al., 2003) (supplementary
The 5′ER ts constructs were designed with the same molecular features as p3ER but with different orientation including a translational signal motif along with the CMV promoter. All the structural elements important for translation of eukaryotic mRNA were included: original cap site of AFP (Gibbs, et al. 1987) followed by the consensus Kozak sequence GCCRGCCAUGG (Kozak, 1995, 1999, 2005). Immediately after the translation start signal was the coding domain HSVtk inclusive of the ESE and mini intron followed by a 5′ss signal (Freund, et al. 2005). The 5′ BD was designed in a similar way with mismatches at positions 24 and 25 to avoid as-effects. Following the BD, a hammerhead ribozyme (HH Rz) (Saksmerprome, et al. 2004) was incorporated for enhanced cleaving of the BD after delivery into the nucleus. The HH RZ is followed by a long spacer to isolate the polyA from the ribozyme followed by the SV40 polyA.
Mutation designs: The 3′/5′ΔHSVtk were designed to produce a full-length inactive HSVtk protein with two point mutations: A to G at position 115 (glycine to glutamic acid), G to A mutation at position 649 (histidine to arginine) (Sasadeusz, et al. 1997). The 3/5′Δss were designed to check the importance of having an active splice signal, mutation in the ss should result in reduced ts. The 3′Δss1 had the conserved BP changed from A to C, 3′Δss2 had 6/8 nucleotides changed including the BP and both the ss has mutated AG to TC acceptor ss. The 5′Δss1 had 7/11 bases changed with consensus donor ss GT intact and 5′Δss2 had 10/11 bases changed including the mutation of donor ss from GT to AC. The 5′ΔHH Rz had the conserved cleavage motif GUC changed to ACA to eliminate or greatly reduce the cleaving efficiency of the ribozyme.
Plasmid construction: The 3′ and 5′ parental exon replacement (ER) constructs named p3ER_ΔBD-opt and p5ER_ΔBD-opt_HH respectively were gene synthesised (GeneArt, Regensburg) and cloned into pVAX1 (AddGene) using SpeI and BbsI to be used as master vectors to sub-clone the remaining of the trans-splicing constructs. The AFP mini-gene consisting of exons 3-6 and introns 3 and 5 (AFP_E3-E6) derived from NCBI (acc num M16110) was gene synthesised (GeneArt, Regensburg) and cloned into pVAX1 using NheI and KpnI. The HSVtk positive control was sub-cloned from the p3EL and p5EL expression plasmids using SacI and BamHI. The complete 1136 base cds of the HSVtk gene (NCBI acc num AF057310) was gene synthesized as part of trans-splicing construct.
A total of 80 constructs were designed and region of change was either gene synthesised or PCR amplified and were sub-cloned into the p3ER_ΔBD-opt and p5ER_ΔBD-opt_HH parental or master vectors. The p3ER_ΔBD-opt_Δss1 and p3ER_ΔBD-opt_Δss2 are 3′ splice site mutations sub-cloned inside p3ER_ΔBD-opt with BbvCI and SacI, NheI and PvuI respectively to replace the wild type ss. Similarly the p5ER_ΔBD-opt_HH_Δss1 was cloned inside p5ER_ΔBD-opt_HH with BssHII and BbsI. The p5ER_ΔBD-opt_HH_Δss2 was synthesised using nested PCR method to generate the desired 5′ss mutation and cloned into the master vector with BssHII and KpnI. The 3′ and 5′ substitution mutation to generate a weaker HSVtk protein namely p3ER_ΔBD-opt_ΔHSVtk and p5ER_ΔBD-opt_HH_ΔHSVtk was cloned into their parental vectors using PvuI and PstI, PstI and NheI respectively. The 5′HH Rz mutation namely p5ER_ΔBD-opt_ΔHH was generated using nested PCR method and cloned into the parental vector with KpnI and BbvCI. The p3ER_BD-opt with NheI and BbvCI and p5ER_BD-opt_HH with KpnI and BbvCI were sub-cloned to generate the BDs with no mismatch (state-of-the-art BDs) with the target. The p3ER_BD(−) was generated by removing the BD from the p3ER_ΔBD-opt with NheI and BbvCI and replacing a small oligo with same RE overhang. However the p5ER_BD(−)_HH and p5ER_BD(−)_ΔHH were generated by replacing the 5′BD with a random 8-mer to bind with the stem III of the HH Rz, sub-cloning into the parental vector with KpnI and BbvCI. The p5ER_ΔBD-opt_HH(−) with no HH was sub-cloned using KpnI and BbvCI. The 3′structured BDs namely p3ER_ΔBD-struc1, p3ER_ΔBD-struc2 and p3ER_BD-opt-inv were sub-cloned using NheI and BbvCI. The 5′structured BDs namely p5ER_ΔBD-struc1_HH and p5ER_ΔBD-opt-inv_HH were sub-cloned with KpnI and BbsI. More 5′ER constructs to look at the stability of the 3′end of the RNA like p5ER_ΔBD-opt_hp_HH and p5ER_ΔBD-opt_Y_HH were cloned inside the parental using KpnI and BbsI. Additional BDs to study the specificity of on-target and alternative trans-splicing in the 3′ER namely p3ER_ΔBD-opt_D, p3ER_ΔBD-opt_E, p3ER_ΔBD-opt_F, p3ER_ΔBD-opt_EF, p3ER_ΔBD-opt_DEF and p3ER_BD(−)_D were cloned into the parental using NheI and BbvCI. To further study the effects of these sub-optimal trans-splicing constructs in context to splice mutants, they were cloned into the p3ER_ΔBD-opt_Δss1 and p3ER_ΔBD-opt_Δss2 for 3′ set and p5ER_ΔBD-opt_HH_Δss1 and p5ER_ΔBD-opt_HH_Δss2 for 5′set. The 3′structured BDs (6 different constructs: p3ER_ΔBD-struc1/2/opt-inv_Δss1/2), 3′ no mismatch BDs (2 constructs: p3ER_BD-opt_Δss1/2) and 3′ no BDs (2 constructs: p3ER_BD(−)_Δss1/2) were cloned using NheI and BbvCI. The 5′structured BDs(4 different constructs: p5ER_ΔBD-struc1/opt-inv_HH_Δss1/2), 5′ no mismatch BDs (2 constructs: p5ER_BD-opt_HH_Δss1/2), 5′ no BDs_wt HH (2 constructs: p5ER_BD(−)_HH_Δss1/2) and 5′no BD_mut HH (2 constructs: p5ER_BDH_ΔHH_Δss1/2) were cloned using KpnI and BbvCI. To study the effect of sub-optimal trans-splicing constructs in context of no mismatch or state-of-the-art BDs, the structured BDs were made perfect complementary with the target and cloned into p3ER_ΔBD-opt with NheI and BbvCI (total 3 constructs: p3ER_BD-struc1/2/opt-inv), cloned into p5ER_ΔBD-opt_HH with KpnI and BbsI (total 2 constructs: p5ER_BD-struc1/opt-inv_HH).
To improve overall trans-splicing, constructs were designed to target two pre-mRNAs (one against AFP and the other against either HCCA2, CD24 or VEGF) simultaneously in the 3′ER context, p3ER_ΔBD-opt_AFP+HCCA2 and p3ER_ΔBD-opt_HCCA2+AFP were sub-cloned into the p3ER parental vector using NheI and BbvCI. The other targets namely p3ER_ΔBD-opt_AFP+CD24 and p3ER_ΔBD-opt_AFP+VEGF were further sub-cloned into the p3ER_ΔBD-opt_AFP+HCCA2 vector with EcoRI and BbvCI by replacing the HCCA2 serving as the second BD. Similarly p3ER_ΔBD-opt_CD24+AFP and p3ER_ΔBD-opt_EGF+AFP were sub-cloned into the p3ER_ΔBD-opt_HCCA2+AFP vector with EcoRI and NheI by replacing the HCCA2 BD serving as the first BD. For flow cytometry analyses, the GFP gene (amplified from pEGFP.C2) was cloned into pGL3-control using HindIII and XbaI, the SV40 promoter-GFP-SV40 polyA-SV40 enhancer cassette from pGL3 plasmid was cloned into a self-generated MCS site in pVAX1-trans-splicing vectors using BgIII and SalI. The GFP cassette in pVAX1-AFP negative control vector was cloned directly using KpnI and BamHI. To generate the trans-splicing constructs targeting HPV16 genes, the BD from the parental vector p3ER_ΔBD-opt was digested with Bam HI and XhoI and replaced with BDs E1a and E5 to generate p3ER_ΔBD-opt_E1a and p3ER_ΔBD-opt_E5 respectively. Similarly BDs E2 and E6 were cloned into p3ER_ΔBD-opt by replacing AFP BD using XhoI and XbaI to generate p3ER_ΔBD-opt_E2 and p3ER_ΔBD-opt_E6. For 5′ER, the parental vector p5ER_ΔBD-opt_HH containing AFP BD was replaced with HPV16 BD E1b with enzymes HindIII and BamHI to generate p5ER_ΔBD-opt_E1b_HH and p5ER_ΔBD-opt_HH(−) vector's AFP BD was replaced with E6 BD to form p5ER_ΔBD-opt_E6_HH(−) with HindIII and BamHI.
Dumbbell (db) construction: Generating dumbbells for trans-splicing from the plasmid vectors was done using the ELAN method of db production. The Enzymatic Ligation Assisted by Nucleases (ELAN) is a three step process which includes digestion of the transcription cassette from the plasmid, ligation of the closing loops on either side followed by exonuclease treatment to eliminate the unclosed db plasmids.
(a) Phosphorylation of Stem-Loop Primers
The stem loops consisting of individual RE site were synthesised by AIT Biotech (Singapore) and was phosphorylated using the following reaction shown in Table 1:
The Stem-loop primers were Stem loop-SpeI and Stem-loop-BamHI.
(b) ELAN Method
In the ELAN loop-ligation method, the gene expression cassette was directly cut out from parental plasmid. 50 times more stem-loops were added in the ligation reaction to ensure that most of the gene expressing cassettes could be capped. By-products such as loop dimers were cleaved by the restriction enzymes and were destroyed during the exonuclease treatment. Detailed setups of the reaction are shown in Table 2.
The generated dumbbells were run on a 1% agarose gel to confirm their integrity.
Cell Culture: Human hepatocytes (HepG2), human cervical cancer cell lines (Siha, HeLa) and mouse cervical cancer cell line (C3) were maintained at 37° C. in a humidified incubator with 5% CO2 in Dulbecco's Modified Eagle's Medium (HyClone, Thermo Scientific), supplemented with 10% Fetal Bovine Serum (HyClone) and 1% penicillin-streptomycin. The cells were passaged every 3-4 days at desired density.
Transfection of plasmid DNAs: HepG2 cells were transfected at ˜70-90% confluency in a 6-well plate for Western blotting, 12-well for FACS analyses and 24-well plate for all other analyses using either Lipofectamine 3000 (for FACS studies only) or Lipofectamine 2000, (Life Technologies) according to manufacturer's protocol. A total of 1 μg DNA was co-transfected or transfected in a 24-well plate format (500 ng:500 ng of ts construct: AFP_E3_E6 minigene) in over-expression studies and 1 μg of ts constructs only in endogenous studies. For 12-well and 6-well formats, the amount of total DNA was scaled up to 2 μg and 4 μg respectively. For FACS experiments, either 500 ng of pEGFP-C2 plasmid was co-transfected along with the ts and AFP mini-gene vectors to perform experiments with some 3′ER and 5′ER plasmids and dumbbells, or the GFP infused ts vectors were used along with/without AFP mini-gene for over-expression and endogenous studies respectively.
Total RNA isolation: RNA was isolated 24 hours post-transfection using RNeasy plus kit (Qiagen) following the manufacturer's protocol. RNA concentrations were measured using NanoDrop 2000.
cDNA conversion and real-time RT-PCR: 500 ng RNA from all samples was converted into cDNA using the First Strand SuperScript RTIII (Invitrogen) kit with 200 ng of random hexamers and 10 uM of dNTPs. The reaction conditions were 25° C. for 5 min, followed by 50° C. for 2 h and enzyme inactivation at 70° C. for 15 min. 20 ng of cDNA was used as template for real time RT-PCR. TaqMan quantification was performed in ABI 7900HT of the cDNAs by designing specific probe and primer sets for each cis- and trans-splicing detection. One set of probes were designed in the AFP regions; namely AFP probe exon 5 and AFP probe exon 4 to detect 3′ER and 5′ER cis and trans-splicing respectively. Primers to detect 3′ER cis-splicing along with AFP probe were FP afp exon 5(set1) and RP afp exon 6 and for 3′ER trans-splicing were FP afp exon 5(set1) and RP HSVtk. Primers to detect 5′ER cis-splicing along with AFP probe were FP afp exon 3 and RP afp exon 4(set1) and for 5′ER trans-splicing were FP HSVtk (set1) and RP afp exon 4 (set1). Another set of probes were designed in the distal HSVtk region to detect 3′ER, named HSVtk probe for 3′ER and proximal HSVtk region to detect 5′ER, named HSVtk probe for 5′ER trans-splicing alone. The primers to detect 3′ER trans-splicing along with HSVtk probes were FP afp exon 5 (set2) and RP HSVtk. Primers to detect 5′ER trans-splicing along with HSVtk probes were FP HSVtk (set2) and RP afp exon 4 (set2). The number of cycles in over-expression studies and endogenous studies were 40 and 50 respectively. RT-PCR: Reverse transcription PCR was performed on the cDNA samples using Taq DNA polymerase (Fermentas) with 60 cycles of two-step PCR (30+30 cycles or 35+35 cycles) to detect 3′ and 5′ cis and trans-splicing and the bands were visualized on a 1% agarose gel. The primers used to detect 3′ER cis-splicing and mock were FP afp exon 5(set1) and RP afp exon 6, to detect 3′ER trans-splicing were FP afp exon 5(set1) and RP HSVtk. To detect 5′ER cis-splicing and mock were primers FP afp exon 3 and RP afp exon 4(set1), to detect 5′ER trans-splicing were primers FP HSVtk (set1) and RP afp exon 4(set1). To visualize specific versus alternative on-target trans-splicing, the p3ER_ΔBD and p3ER_BD(−) cDNAs were amplified using primers FP afp exon 5(set2) and RP HSVtk for specific ts and with primers FP afp exon 3 and RP HSVtk for alternative on-target ts. The p5ER_ΔBD_HH and p5ER_BD(−)_HH cDNAs were amplified with primers FP HSVtk(set2) and RP afp exon 4(set2) for specific ts and with primers FP HSVtk(set2) and RP afp exon 6 for alternative on-target ts.
Alamar assay: To check the functional activity of trans-splicing, drug Ganciclovir (GCV) (Sigma) was added to the cells at a concentration of 10 μM, 100 μM and no GCV (internal negative control) 24 hours post-transfection followed by addition of alamarBlue® cell viability reagent (Thermo Scientific) 24 hours post drug for a duration of 6 days with replacement of fresh media and drug every day after each alamar reading. The fluorescence was measured at 230/290 nm after 90 minutes of incubation at 37° C. The positive and negative controls for the assay were designed as mentioned in the manufacturer's protocol.
Single cell gel electrophoresis: Also known as the Comet Assay, it was carried out to check for double-stranded DNA breaks upon 10 μM GCV administration 24 hours post-transfection and cells harvested 24 hours post-drug treatment using alkaline lysis method (Olive, et al., 2006). The comets were stained with Propidium Iodide 10 μg/ml (Life Technologies) and analysed under a fluorescent microscope at 10× and 20× magnifications. Approximately 150-200 comets were scored/sample.
Flow Cytometry: To check for apoptosis, cells were harvested 48 hours post 100 μM GCV treatment and stained using Propidium Iodide and Alexa Fluor 647 Annexin V (Life Technologies) in Annexin-binding buffer according to manufacturer's protocol. The samples were gated based on single live cell populations which were positive for GFP. The final % apoptosis values are indicated as (early and late apoptosis+GCV)−(early and late apoptosis-GCV).
Western Blotting: To detect both AFP and HSVtk proteins, cells were harvested 24 hours post-transfection and a total of 50 μg protein was loaded in a 10% SDS-PAGE, transferred on a PVDF membrane and blocked with 5% milk (w/v). The respective primary antibodies (HSV-tk vL-20 goat polyclonal Santa Cruz cat no. sc-28038, AFP goat polyclonal Santa Cruz cat no. sc-8108 and Beta actin (internal control) rabbit polyclonal Santa Cruz cat no.sc-130656) were incubated in 5% milk overnight at 4° C., followed by 2 hour incubation with secondary antibodies (HSVtk and AFP anti goat Santa Cruz cat no. sc-2020 and Beta actin anti-rabbit Santa Cruz cat no. sc-2357. The blots underwent chemiluminescence using Pierce ECL Western Blotting substrate (Thermo Scientific) and developed in an imager (BioRad).
Prediction of splice sites: The strength and nature of the splice sites were predicted using softwares Alternative Splice Site Predictor (ASSP) (Wang, 2006) http://wangcomputing.com/assp/overview.html and Berkeley Drosophila Genome Project Splice Site Prediction (BDGP SSP) (Reese, et al., 1997) fruitfly.org/seqtools/splice.html using default cut-off values for the splice site predictions. To predict the nature of splice sites in HPV16 genome, ASSP was used to document constitutive or cryptic splice acceptors and donors based on the overall score and confidence generated by the software. The alternative splice sites with confidence >0.89 and score >5.5 and constitutive splice sites with confidence >0.1 and score >7.7 besides the documented splice sites (Johansson, 2013 and Schmitt, et al, 2011) were selected for the trans-splicing analyses.
De Novo Designed Trans-Splicing RNA for 5′ and 3′ Exon Replacement (ER) Triggers Targeted Trans-Splicing Towards an Overexpressed or Endogenous Pre-mRNA Target
This invention refers to novel optimized RNA sequences and structures designed to achieve higher trans-splicing activity and specificity. We designed parental trans-splicing RNA (tsRNA) molecules both for 5′ER or 3′ER comprising the following molecular features (
In addition, we furnished the tsRNA for 5′ER with a tertiary structure-stabilised hammerhead ribozyme (HHRz) (Saksmerprome, et al. 2004) positioned downstream of the BD to crop itself together with the SV40 polyA site in order to trigger nuclear RNA retention and to avoid trans-splicing-independent HSVtk expression. Formation of the active ribozyme structure was supported by inserting a spacer between the ribozyme and the polyA site. The tsRNA for 3′ER, on the other hand, was equipped with the P2A proteolytic cleavage site (Kim J H, et al. 2011) positioned immediately downstream of the splice acceptor SA site to trigger proteolytic release of the HSVtk from the chimeric fusion protein which results from the trans-splice reaction. The constructs were designed for maximum activity.
Central 2 nt target mismatches were included into the binding domains (ABD) to avoid that target binding generates long double-stranded nuclear RNA which might trigger antisense effects, including A-to-I editing by adenosine deaminases acting on RNA (ADARs), which could impair the trans-splice strategy. That way optimised BDs for 3′ or 5′ER were termed p3ER_ΔBD-opt or p5ER_ΔBD-opt_HH. As controls we designed for 5′ and 3′ER each two splice site mutants (Δss1 and Δss2), the partly inactive HSVtk mutant (A to G mutation at position 115 and a G to A mutation at position 649 of HSVtk gene), and for 5′ER a control harbouring an inactive HHRz cleavage site (
Design of Binding Domain Sequence and Structure Substantially Improves 3′ but not 5′ Exon Replacement
We investigated the role of BD RNA secondary in RNA trans-splicing. Using our previously described software tool foldanalyse (Senger, et al. 1995) we identified the least structured BDs of about 50 nt in length that can be targeted against the AFP pre-mRNA: 3ER_BD-opt or 5ER_BD-opt for 3′ or 5′ER which bind to intron 5 or intron 3, respectively (
Multiple Binding Domains Enhance Targeted Trans-Splicing and Suppress Alternative On-Target Trans-Splicing Thereby Increasing the Specificity of 3′ER
To suppress alternative on-target trans-splicing and to improve the trans-splicing specificity we designed novel RNAs for 3′ER which harbor multiple target and/or self-binding domains (
S=TSspec/TSalt*100% (1)
All secondary BDs increased the specificity of trans-splicing as reflected by an increase in the specificity factor. While BD-F and more pronounced BD-D suppressed both specific and alternative on-target trans-splicing, BD-E and the combination of BD-E and —F enhanced specific but suppressed alternative on-target trans-splicing. Most successful, however, was the combination of all three additional BDs D, E, and F which enhanced specific trans-splicing about 2-fold and reduced alternative splicing about 5-fold thus exhibiting a 10-fold higher specificity of trans-splicing as compared with the parental construct. In the construct without any target binding domain, internal BD-D suppressed trans-splicing towards the strong splice donor D1 or the moderately strong donor D2 20-fold or 130-fold presuming trans-splicing to any other cellular off-targets was suppressed to a similar extent. Notably, a comparable reduction of trans-splicing was observed in BD(−) constructs harbouring splice sites that were weakened by mutagenesis.
Trans-Splicing Towards Over-Expressed or Endogenous AFP Pre-mRNA Triggers Death in a Human Liver Carcinoma Cell Line
As suicide gene system we chose the combination of the herpes simplex virus thymidine kinase (HSVtk) and the prodrug ganciclovir (GCV). Trans-splicing will trigger HSVtk expression in a target RNA-dependent manner which then catalyses phosphorylation of GCV into its monophosphate, which is subsequently converted into its di- and tri-phosphate derivatives by cellular kinases. The toxic GCV-triphosphate then acts as a deoxyguanosine triphosphate (dGTP) analogue, thus sitting on the DNA chain during replication, causing chain termination and cell death. We investigated death of human liver carcinoma cells HepG2 triggered by 5′ or 3′ER towards the overexpressed or the endogenous AFP pre-mRNA using three different assays. Firstly, the alamar blue cell viability assay. Cells were transfected and 10 or 100 μM GCV was added to the medium 24 hours post-transfection, alamar dye was added 24 hours post drug treatment and fluorescence was measured after an incubation time of 90 min. After alamar reading, the media and drug was replenished and the process repeated for 6 consecutive days. Highest levels of cell death, i.e. up to 80% at 100 μM GCV (
Trans-Splicing RNA Simultaneously Targeting Two Endogenous Liver Cancer Markers Triggered Enhanced Cell Death at 10-Fold Lower Ganciclovir Doses
As many other human diseases, the carcinogenesis of hepatocellular carcinoma (HCC) is a multi-factorial, multistep, complex process and a single biomarker is not accurately indicating the disease and its stages. To increase both HCC specificity and sensitivity of our approach, we investigated bispecific (dual targeting) tsRNAs targeting two HCC biomarkers simultaneously using distinct BDs. Multiple HCC biomarkers have been reported in the literature and we measured the abundance of 12 corresponding pre-mRNAs and mRNAs in different cell lines or cells (Supplementary
HPV-16-Targeting Suicide RNA Specifically Killed HPV-16-Transformed Tissue Culture Cells
The universal design of our tsRNA facilitates replacement of the BD together with the spacer in order to target any pre-mRNA of interest. As a second clinically relevant target we chose the human papillomavirus type 16 (HPV-16). HPVs establish productive infections in keratinocytes of the skin and the mucous membranes causing benign papilloma's, premalignant lesions, and cancer. HPV infection is the most frequent sexually transmitted disease worldwide and the two high risk types HPV-16 and HPV-18 cause about 70% of all cervical cancer cases. Prior to cell transformation, HPV-16 genomes integrate into the host cell genome and there is no way to erase the viral DNA from an infected individual. However, selective destruction of the infected cells by suicide gene therapy may represent an approach to solving this problem. In HPV infections, alternative splicing generates multiple isoforms of viral mRNA. We computationally selected the five most favourable unstructured antisense BDs (opt_E6, _E1a, _E1b, _E2 and _E5) which can be directed against HPV-16 transcripts targeting the early viral genes E6, E1, E2, and E5 (
Minimalistic Dumbbell-Shaped DNA Vectors for Cellular Delivery of Trans-Splicing Molecules
Dumbbell-shaped DNA minimal vectors, or dumbbell vector, have several advantages over traditional plasmid vectors or viral vectors. While many viral vectors are fraught with safety risks, plasmids being much larger can trigger side effects including immunotoxicity and suffer from transgene silencing in primary cells. Dumbbells do not have these disadvantages and compared with plasmids are more efficient in terms of cellular delivery, nuclear diffusion, and gene expression. First-time we generated dumbbell vectors to deliver RNA trans-splicing. That was achieved by cutting the trans-splicing cassette out from the plasmid and subsequently closing the ends by ligation of hairpin loop structures (
List of Oligonucleotides, Probes and Primers
GCTAGCACCTCTCTAAACCTAAATTAAATTTT
GCTAGCACCTCTCTAAACCTAAAAAAAATTTT
GCTAGCGGACTGCTTGAAGCAAGTAGTTAAT
GCTAGCCTTCTCAGTTACAAAAAATACGATGT
GCTAGCACCTCTCTAAACCTAAATTAAATTTT
GCTAGCGGACTGCTGGTAGCAAGTAGTTAAT
GCTAGCCTTCTCAGTTACAAAAAATACGATTG
GCTAGCACCTCTCTAAACCTAAAAAAAATTTT
GGTACCcctccttcctcctcctcctcctcctcctcctATATAC
GGTACCcctccttcctcctcctcctcctcctcctcctATATAC
GGTACCcctccttcctcctcctcctcctcctcctcctGATGTA
GGTACCctgaaatgtgtagattgtgtgtgtggtgtatatgtaatA
GGTACCcctccttcctcctcctcctcctcctcctcctGATGTA
GGTACCctgaaatgtgtagattgtgtgtgtggtgtatatgtaatA
GGTACCcctccttcctcctcctcctcctcctcctcctATATAC
GGTACCcctccttcctcctcctcctcctcctcctcctATATAC
Number | Date | Country | Kind |
---|---|---|---|
1605586.5 | Apr 2016 | GB | national |
Number | Date | Country | |
---|---|---|---|
Parent | 16090226 | Sep 2018 | US |
Child | 17984846 | US |