Patent Application
20120190580
The present invention relates to a nucleic acid molecule for use in the treatment or preventive treatment of a patient after stent implantation or balloon dilatation, wherein the nucleic acid molecule is selected from (a) a single-stranded nucleic acid molecule comprising or consisting of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (b) a hairpin RNA, wherein one of the regions forming the double-stranded portion of said hairpin RNA comprises or consists of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (c) an at least partially double-stranded RNA comprising two separate single strands, wherein a region within one of the strands, said region being located within the double-stranded portion of said double-stranded RNA, comprises or consists of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4; (d) a nucleic acid molecule encoding the nucleic acid molecule of (a) or the RNA (b); and (e) a nucleic acid molecule or a two nucleic acid molecules encoding the two separate single strands of the RNA of (c). The present invention also relates to a drug eluting stent comprising the nucleic acid molecule according to the invention.
In this specification, a number of documents including patent applications and manufacturer's manuals are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
The technical field of the invention is the treatment of patients after stent implantation or balloon dilatation. After such surgical interventions complications like restenosis, and/or thrombosis can occur.
The reason for the occurrence of restenosis after stent implantation or balloon dilatation is normally an increased proliferation of cells in the vessel wall. One of this proliferating cell types in the vessel wall (tunica) is vascular smooth muscle cells (VSCMs) found within the tunica media of large and small arteries and veins. Proliferation of VSCMs stimulates in turn the proliferation of fibroblasts in the tunica. VSMCs are highly specialized cells, which regulate the lumenal diameter of small arteries/arterioles called resistance vessels thereby contributing significantly to the regulation of blood pressure. The tone of VSMCs is controlled by angiotensin II and adrenergic stimulation although numerous other signalling molecules affect the contractile status of VSMCs (1). VSMCs proliferate rarely under normal physiological conditions in adult tissues but will undergo major phenotypic changes from the contractile to the synthetic phenotype in response to environmental cues such as hypertension, vascular injury, and arteriosclerosis (2). Early atherosclerotic lesions are often characterized by focal accumulation of VSMCs within the intima (vessel wall). The exact function of VSMCs in atherosclerosis, however, is still a matter of debate (3). VSMCs might contribute to the development of atherosclerotic plaques by synthesizing pro-inflammatory mediators, vascular cell adhesion molecules, and matrix molecules required for the retention of lipoproteins (4). The ability for contraction, proliferation and secretion depends on the differentiation status of VSMC, which is affected by a large number of factors including mechanical forces, contractile agonists such as angiotensin II, extracellular matrix components, neuronal factors, reactive oxygen species, endothelial-VSMC interactions, thrombin, PDGF and TGF-1. Transcriptional responses to these factors are mostly mediated by SRF and its co-factor myocardin, which play a key role in the regulation of VSMC markers, as well as by members of the Kruppel-like transcription factor family of zinc finger proteins (reviewed in (1)). SRF-dependent gene transcription is controlled at various posttranscriptional levels including—among others—differential splicing, phosphorylation and RhoA/Rho kinase (ROK)-dependent SRF nuclear translocation and/or activation (reviewed in (1)). In summary, a lot of information has been compiled about VSCMs. This information, however, has not led to the development of means or methods to treat a patient after stent implantation or balloon dilatation.
Disturbances in the blood flow, like restenosis after stent implantation or balloon dilatation occurs in about 10%-30% of patients within 6 months after implantation of the stent. In patients with a repeated stent implantation or balloon dilatation the risk of restenosis is 30-60%. In risk patients, like diabetic patients or patients with small or elongated vessel, restenosis after stent implantation or balloon dilatation occurs in up to 70% of patients. Therefore, restenosis after stent implantation or balloon dilation is also called the Achilles' heel of stent implantation and balloon dilatation. Although stent implantation and balloon dilatation are successful surgical interventions they often cannot prevent further surgical steps like a bypass operation. Therefore, presently many research projects seek to find substances to prevent restenosis after stent implantation or balloon dilatation. The presently used or developed substances are substances which inhibit the proliferation of cells, e.g. via inhibiting degradation of microtubles or blocking cellular signal transduction pathways. Such cell proliferation inhibitor substances are also used to coat stents in order to provide drug eluting stents. In addition to the substances inhibiting cell proliferation, it is presently required to treat patients after stent implantation and balloon dilatation with inhibitors of blood coagulation for a long term. Such blood coagulation inhibitors, like Phenprocoumon (Marcumar) have severe side effects.
Therefore, there is a need to find novel means and methods for use in the treatment of patients after stent implantation and balloon dilatation. This need is addressed by the present invention.
Accordingly, the present invention relates to a nucleic acid molecule for use in the treatment or preventive treatment of a patient after stent implantation or balloon dilatation, wherein the nucleic acid molecule is selected from
The term “nucleic acid molecule”, in accordance with the present invention, includes DNA, such as cDNA, antisense DNA or genomic DNA, and RNA. It is understood that the term “RNA” as used herein comprises all forms of RNA including mRNA, miRNA (micro RNA), hnRNA, siRNA and asRNA (antisense). Preferably the term “nucleic acid molecule” is an RNA. More preferably the nucleic acid molecule is a single stranded RNA, hnRNA (hairpin RNA) or an at least partially double stranded RNA. The nucleic acid sequence may also comprise regulatory regions or other untranslated regions. The nucleic acid molecule is most preferably a miRNA. Where the nucleic acid molecule od (d) or (e) is a nucleic acid molecule encoding an RNA or another nucleic acid molecule, said nucleic acid molecule of (d) or (e) is usually a DNA molecule such as cDNA or genomic DNA, and the enclosed nucleic acid molecule is usually an RNA. The term “nucleic acid molecule” is interchangeably used in accordance with the invention with the term “polynucleotide”.
The term “siRNA” in accordance with the present invention refers to small interfering RNA, also known as short interfering RNA or silencing RNA. siRNAs are a class of 18 to 30, preferably 20 to 25, most preferred 21 to 23 or 21 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. Most notably, siRNA is involved in the RNA interference (RNAi) pathway where the siRNA interferes with the expression of a specific gene. In addition to their role in the RNAi pathway, siRNAs also act in RNAi-related pathways, e.g. as an antiviral mechanism or in shaping the chromatin structure of a genome. siRNAs have a well defined structure: a short double-strand of RNA (dsRNA), advantageously with at least one RNA strand having an overhang. Each strand has a 5′ phosphate group and a 3′ hydroxyl (—OH) group. This structure is the result of processing by dicer, an enzyme that converts either long dsRNAs or small hairpin RNAs into siRNAs. siRNAs can also be exogenously (artificially) introduced into cells to bring about the specific knockdown of a gene of interest. Thus, any gene of which the sequence is known can in principle be targeted based on sequence complementarity with an appropriately tailored siRNA. The double-stranded RNA molecule or a metabolic processing product thereof is capable of mediating target-specific nucleic acid modifications, particularly RNA interference and/or DNA methylation. Also preferably at least one RNA strand has a 5′- and/or 3′-overhang. Preferably, one or both ends of the double-strand has a 3′-overhang from 1-5 nucleotides, more preferably from 1-3 nucleotides and most preferably 2 nucleotides. In general any RNA molecule suitable to act as siRNA is envisioned in the present invention. The most efficient silencing was so far obtained with siRNA duplexes composed of 21-nt sense and 21-nt antisense strands, paired in a manner to have 2-nt 3′-overhangs. The sequence of the 2-nt 3′ overhang makes a small contribution to the specificity of target recognition restricted to the unpaired nucleotide adjacent to the first base pair (Elbashir et al. Nature. 2001 May 24; 411(6836):494-8). 2′-deoxynucleotides in the 3′ overhangs are as efficient as ribonucleotides, but are often cheaper to synthesize and probably more nuclease resistant.
A “miRNA” in accordance with the present invention is a micro RNA, which is a single-stranded RNA molecule regulating gene expression. The term “miRNA” includes pri-miRNA, pre-miRNA and mature miRNA. miRNAs are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (i.e. they are non-coding RNAs); instead each primary transcript (a pri-miRNA) is processed into a short stem-loop structure called a pre-miRNA, then in a miRNA duplex (an at least partially double stranded miRNA of preferably 21-23 nt) and finally into a functional mature miRNA. Mature miRNA molecules are single-stranded and partially complementary to one or more messenger RNA (mRNA) molecules, and their main function is to down-regulate gene expression. The genes encoding miRNAs are generally much longer than the processed mature miRNA molecule; miRNAs are first transcribed as primary transcripts or pri-miRNA with a cap and poly-A tail and processed to short, usually about 70-nucleotide stem-loop structures known as pre-miRNA in the cell nucleus. This processing is performed in animals by a protein complex known as the Microprocessor complex, consisting of the nuclease Drosha and the double-stranded RNA binding protein Pasha. These pre-miRNAs are then processed to mature miRNAs (normally 21 to 23 nucleotides in length) in the cytoplasm by interaction with the endonuclease Dicer, which also initiates the formation of the RNA-induced silencing complex (RISC). This complex is responsible for the gene silencing observed due to miRNA expression and RNA interference.
A “shRNA” in accordance with the present invention is a short hairpin RNA, which is a sequence of RNA that makes a (tight) hairpin turn that can also be used to silence gene expression via RNA interference. shRNA preferably utilizes the U6 promoter for its expression. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the shRNA that is bound to it.
In those embodiments where the nucleic acid molecule of the invention comprises (rather than consists of) the recited sequence, additional nucleotides extend over the specific sequence either on the 5′ end or the 3′ end or both. Those additional polynucleotides may be of heterologous or preferably homologous nature and may comprise stretches of about 3 to 100 nucleotides although higher or lower values are not excluded.
The nucleic acid molecule as defined in (a) supra include single-stranded RNA molecules such as mature miRNA as well as antisense DNA. Hence, the nucleic acid molecule of embodiment (a) may be DNA, RNA, or a nucleic acid comprising both ribonucleotides and desoxyribonucleotides. It is preferred that the nucleic acid molecule of (a) is human or mouse mature miR-145 as shown in SEQ ID Nos. 1 and 3 or human or mouse mature miR-143 as shown SEQ ID Nos. 2 and 4. The hairpin RNA as defined in (b) supra is includes pre-miRNA and pri-miRNA. It is preferred that the pri-mRNA or pre-miRNA is the pri-mRNA or pre-miRNA consisting of or comprising the SEQ ID Nos. 5, 6, 7 or 8 or comprising SEQ ID Nos. 1, 2, 3, or 4. The at least in part double-stranded RNA as defined in (c) supra includes RNAi agents such as siRNAs and miRNA duplexes.
The nuclei acid molecules according to the invention, may also comprise chemically modified nucleotides. Modifications of nucleotides acids are well known to person skilled in the art and include locked nucleic acids. Envisaged are modified internucleotide linkages such as phosphorothioates.
In RNAs according to the invention one or more nucleotides, but less than 50% of the total number of nucleotides may be replaced with their counterparts.
As mentioned, also encompassed by the present invention are nucleic acid molecules comprising or consisting of a sequence having at least 90% identity (such as at least 92.5%, more preferred at least 95%, even more preferred at least 97.5%, and most preferred 100% identity) at the nucleic acid level with the sequence of SEQ ID NOs: 1, 2, 3, or 4 over the entire length of SEQ ID NOs: 1, 2, 3, or 4. It is to be understood that the comparison or alignment of sequences referred to herein means an alignment with the nucleotide sequence. In one embodiment, the two sequences, when aligned, display the at least 90% identity over the same length, i.e. without either sequence extending 3′ or 5′ over the other sequence. Those having skill in the art will know how to determine percent sequence identity between/among sequences using, for example, algorithms such as those based on CLUSTALW computer programme (Thompson Nucl. Acids Res. 2 (1994), 4673-4680) or FASTA (Pearson and Lipman, Proc. Natl. Acad. Sci., 1988, 85; 2444), as known in the art. Although the FASTA algorithm typically does not consider internal non-matching deletions or additions in sequences, i.e., gaps, in its calculation, this can be corrected manually to avoid an overestimation of the % sequence identity. CLUSTALW, however, does take sequence gaps into account in its identity calculations. Also available to those having skill in this art are the BLAST and BLAST 2.0 algorithms (Altschul, Nucl. Acids Res., 1977, 25:3389). The BLASTN programme for nucleic acid sequences uses as default a word length (W) of 11, an expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLOSUM62 scoring matrix (Henikoff, Proc. Natl. Acad. Sci., 1989, 89:10915) uses alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. All those programmes may be used for the purposes of the present invention. However, preferably the BLAST programme is used. Accordingly, all the nucleic acid molecules having the prescribed function and further having a sequence identity of at least 90% as determined with any of the above recited or further programmes available to the skilled person and preferably with the BLAST programme fall under the scope of the invention.
The term “patient” in accordance with the invention is a vertebrate. It is preferred that the vertebrate is a mammal. It is even more preferred that the mammal is a domestic mammal or primate. It is mostly preferred that the patient is a mouse or human.
The term “stent” in accordance with the present invention refers to is a man-made ‘tube’ inserted into a natural passage/conduit in the body to prevent, or counteract, a disease-induced, localized flow constriction. Stents are used in a variety of vessels aside from the coronary arteries also as a component of peripheral artery angioplasty. Stents are preferably coronary stents. A coronary stent is a stent placed in a coronary artery to treat coronary heart disease, for example as part of a procedure called percutaneous coronary intervention (PCI). Similar stents and procedures are used in non-coronary vessels, e.g., in the legs in peripheral artery disease. A stent is composed of special fabric supported by a rigid structure, usually metal. An stent on its own has no covering, and therefore is usually just a metal mesh. Although there are many types of stent, these stents are used mainly for vascular intervention. The device is used primarily in endovascular surgery. Stent are used to support weak points in arteries, such a point commonly known as an aneurysm. Stent are most commonly used in the repair of an abdominal aortic aneurysm, in a procedure called an EVAR. One theory behind the procedure is that once in place inside the aorta, the stent acts as a false lumen for blood to travel through, instead of flowing into the aneurysm sack.
The term “balloon dilatation” in accordance with the invention refers to a method to widen narrowed blood vessels. The method comprises tightly folded balloons to be passed into the narrowed locations and then inflated to a fixed size using water pressures some 75 to 500 times normal blood pressure (6 to 20 atmospheres). Peripheral balloon dilatation refers to the use of mechanical widening in opening blood vessels other than the coronary arteries. It is often called percutaneous transluminal angioplasty or PTA for short. PTA is most commonly done to treat narrowings in the leg arteries, especially the common iliac, external iliac, superficial femoral and popliteal arteries. PTA can also be done to treat narrowings in veins, etc. It is preferred that the balloon dilatation is a coronary balloon dilatation, which is also know as percutaneous coronary intervention (PCI) or coronary angioplasty. Coronary balloon dilatation is a therapeutic procedure to treat the stenotic (narrowed) coronary arteries of the heart found in coronary heart disease.
In recent years it has been revealed that posttranscriptional regulation of gene expression critically depends on miRNAs, a class of approximately 22 nucleotide non-coding RNAs, which repress protein expression of target mRNAs by mRNA degradation or translational repression (5). Using miRNA target prediction algorithms hundreds of potential target mRNAs for a specific miRNA can be identified and miRNA target binding sites have been predicted in almost any transcript. Many miRNAs are expressed in a tissue-specific manner and play pivotal roles in the control of proliferation and differentiation of different cell types (6-9). According to the invention, to understand the role of miRNAs in the control of VSMC differentiation and function the presence of miRNAs in organs with a high content of SMCs using miRNA microarray hybridization was screened. It has been found by the inventors that the expression of the miR-143/145 cluster becomes confined to smooth muscle cells during embryonic development. SEQ ID No. 1 and SEQ ID No. 3 shows the human and mouse mature microRNA miR-145, respectively. SEQ ID No. 2 and SEQ ID No. 4 shows the human and mouse mature micro RNA miR-143, respectively. According to the invention, the miR-143/145 cluster is instrumental to acquire and/or maintain the contractile phenotype of VSMCs and controls the concentration of proteins, which regulate contractility of the VSMCs. Loss of the miRNA cluster assumingly results in deregulated blood pressure and formation of neointimal lesions in normolipidemic mice. The present invention defines the miR-143/145 gene cluster as a major regulator of the contractile phenotype of VSMCs. It is demonstrated that the miR-143/145 gene cluster governs the expression level of molecules, which control the balance between the synthetic (proliferating) and the contractile (nonproliferating) state of smooth muscle cells and directly affect contractility of VSMCs. The restricted expression of miR-143/145 initially in early cardiomyocytes and then in smooth muscle cells identifies this miRNA family as a cell type-specific regulator of smooth muscle cells, which enlarges the relatively small group of smooth muscle cell specific regulators. The microarray and reporter-gene based expression analysis according to the examples of the invention did not reveal major expression sites of miR-143 and miR-145 in other cell types although low level or context-dependent expression patterns cannot be ruled out. Defects during early embryogenesis in miR-145 knock-out mice were not observed, which is in contrast to the recently acclaimed function of miR-145 as an inducer of lineage-restricted differentiation (28). Thus, the role of miR-143/145 identified according to the invention allows to use a nucleic acid molecule as defined by the invention for the purpose according to the invention. The use of the nucleic acid molecule of the invention allows for the specific inhibition of the proliferation of VSMCs and thus for the specific treatment or preventive treatment of patients after stent implantation or balloon dilatation. As described herein above, methods for inhibiting restenosis known in the state of the art are based on inhibiting cell proliferation of any cell type, mostly dependent on the proliferation rate. Moreover, the influence of miR-143/145 on blood pressure may allow for omitting or at least decrease the treatment of patients with blood coagulation after stent implantation or balloon dilatation.
A preferred embodiment of the invention relates to the nucleic acid molecule as defined in accordance with the invention for use in the preventive treatment of a patient after stent implantation or balloon dilatation, wherein the treatment is for the prevention of restenosis.
“Restenosis” in accordance with the invention refers to renarrowing of a blood vessel after stent implantation or balloon dilatation in said blood vessel. The renarrowing results in response to the vascular injury that takes place during interventional procedure. As explained above, restenosis occurs in about 10-30% of patients after stent implantation. Generally restenosis is caused by hyperproliferation of cell in the blood vessel wall, which inhibits the blood flow.
Another preferred embodiment of the invention relates to the nucleic acid molecule as defined in accordance with the invention for use in the treatment or preventive treatment of a patient after stent implantation or balloon dilatation, wherein said treatment or preventive treatment is for the prevention or treatment of thrombosis.
“Thrombosis” in accordance with the invention is the formation of a blood clot (thrombus) inside a blood vessel, obstructing the flow of blood through the circulatory system. When a blood vessel is injured, the body uses platelets and fibrin to form a blood clot, because the first step in repairing it (hemostasis) is to prevent loss of blood. If that mechanism causes too much clotting, and the clot breaks free, an embolus is formed. When a thrombus occupies more than 75% of surface area of the lumen of an artery, blood flow to the tissue supplied is reduced enough to cause symptoms because of decreased oxygen (hypoxia) and accumulation of metabolic products like lactic acid. More than 90% of obstruction can result in anoxia, the complete deprivation of oxygen, and infarction, a mode of cell death.
An even other preferred embodiment of the invention relates to the nucleic acid molecule as defined in accordance with the invention for use in the treatment or preventive treatment of a patient after stent implantation or balloon dilatation, wherein said treatment or preventive treatment is for the prevention or treatment of hypertension.
“Hypertension” (also referred to as high blood pressure) in accordance with the invention is a medical condition in which the blood pressure is chronically elevated. Hypertension can be further classified with increasing preference as prehypertension (diastolic blood pressure 120-139 mmHg and/or diastolic blood pressure 80-89 mmHg), stage 1 hypertension (diastolic blood pressure 140-159 mmHg and/or diastolic blood pressure 90-99 mmHg) and stage 2 hypertension (diastolic blood pressure at least 160 mmHg and/or diastolic blood pressure at least 100 mmHg). Methods of quantifying the blood pressure are well know to the skilled person. Blood pressure in accordance with the invention is the pressure (force per unit area) exerted by circulating blood on the walls of blood vessels, and constitutes one of the principal vital signs. The pressure of the circulating blood decreases as it moves away from the heart through arteries and capillaries, and toward the heart through veins. When unqualified, the term blood pressure usually refers to brachial arterial pressure: that is, in the major blood vessel of the upper left or right arm that takes blood away from the heart. Blood pressure may, however, sometimes be measured at other sites in the body, for instance at the ankle. The ratio of the blood pressure measured in the main artery at the ankle to the brachial blood pressure gives the Ankle Brachial Pressure Index (ABPI). Normal systolic blood pressure is 90-119 mmHg and normal diastolic blood pressure is 60-79 mmHg.
In accordance with the invention the nucleic acid molecule of the invention may be modified. Means and methods for such modifications are described in Soutschek et al. 2005 (Nature 432, 173-178). Such modified nucleic acid molecules can be prepared by stepwise solid-phase synthesis. In some cases, it may be desirable to add additional chemical moieties to the nucleic acid molecule of the invention, e.g. to enhance pharmacokinetics of the compound. Such a moiety may be covalently attached, typically to a terminus of the nucleic acid molecule, according to standard synthetic methods. For example, addition of a polyethyleneglycol moiety or other hydrophilic polymer, e.g., one having 10-100 monomeric subunits, may be useful in enhancing solubility. One or more charged groups, e.g., anionic charged groups such as an organic acid, may enhance cellular uptake. In selecting a moiety for attachment or modification of an antisense oligomer, it is generally desirable to select chemical compounds of groups that are biocompatible and likely to be tolerated by a subject without undesirable side effects.
In another preferred embodiment of the invention, the nucleic acid molecule as defined in accordance with the invention is fused to a lipid.
In an even more preferred embodiment of the invention, the lipid fused to the nucleic acid molecule as defined in accordance with the invention is a cholesterol.
Means and methods to introduce lipid modifications and in particular a cholesterol modification to a nucleic acid molecule are described in Krützfeldt et al. 2005 (Nature 438, 685-689). Accordingly, a cholesterol may be linked through a hydroxylprolinol linkage to a nucleic acid molecule. Such modifications increase the efficiency of the uptake of a nucleic acid molecule and in particular of small RNAs, like miRNAs into the cell.
It is also preferred that the nucleic acid molecule according to the invention is present in a pharmaceutical composition. The pharmaceutical composition may, just as the nucleic acid molecule, be used in the treatment of a patient after stent implantation or balloon dilatation, wherein the treatment preferably prevents restenosis or thrombosis and prevents or treats hypertension.
The pharmaceutical composition prepared in accordance with the invention comprises a nucleic acid molecule as defined above, preferably a RNA like a antisense RNA, siRNA, shRNA or miRNA. Even more preferred the pharmaceutical composition may comprise a miRNA. The ability of antisense molecules, siRNA, shRNA and miRNA to potently, but reversibly, silence genes in vivo makes these molecules particularly well suited for use in the mentioned pharmaceutical composition. Ways of administering siRNA to humans are described in De Fougerolles et al., Current Opinion in Pharmacology, 2008, 8:280-285. Such ways are also suitable for other administering other small RNA molecules like shRNA or miRNA. Accordingly, such pharmaceutical compositions may be administered directly formulated as a saline, via liposome based and polymer-based nanoparticle approaches, as conjugated or complexation pharmaceutical compositions, or via viral delivery systems. Direct administration comprises injection into tissue, intranasal and intratracheal administration. Liposome based and polymer-based nanoparticle approaches comprise the cationic lipid Genzyme Lipid (GL) 67, cationic liposomes, chitosan nanoparticles and cationic cell penetrating peptides (CPPs). Conjugated or complexation pharmaceutical compositions comprise PEI-complexed antisense molecules, siRNA, shRNA or miRNA. Further, viral delivery systems comprise influenza virus envelopes and virosomes.
The pharmaceutical composition is preferably administered to mammals such as domestic and pet animals. Most preferred it is administered to humans. The pharmaceutical compositions described herein can be administered to the subject at a suitable dose.
The pharmaceutical composition for use in accordance with the present invention can be formulated in conventional manner according to methods found in the art, using one or more physiological carriers or excipient, see, for example Ansel et al., “Pharmaceutical Dosage Forms and Drug Delivery Systems”, 7th edition, Lippincott Williams & Wilkins Publishers, 1999. The pharmaceutical composition may, accordingly, be administered orally, parenterally, such as subcutaneously, intravenously, intramuscularly, intraperitoneally, intrathecally, transdermally, transmucosally, subdurally, locally or topically via iontopheresis, sublingually, by inhalation spray, aerosol or rectally and the like in dosage unit formulations optionally comprising conventional pharmaceutically acceptable excipients.
The pharmaceutical composition is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
The pharmaceutical composition can be administered as sole active agent or can be administered in combination with other agents. It is preferred that such other agents are inhibitors of cell proliferation. Such inhibitors comprise but are not limited to inhibitors of microtuble degradation (e.g. Taxol) and inhibitors of cellular signalling (e.g. Rapamycin).
A further embodiment of the invention, refers to a drug eluting stent comprising a nucleic acid molecule as defined in accordance with the present invention.
According to this embodiment of the invention, the nucleic acid molecule of the invention or the pharmaceutical composition comprising the nucleic acid molecule of the invention may be delivered using a drug eluting stent, which is covered (the term “covered” encompasses the terms “attached, linked, coated and the like”) by the nucleic acid molecule of the invention or the pharmaceutical composition. Means and methods for producing drug eluting stents are described in Udipi et al. 2007 (Journal of Biochemical Materials Research Part A, p. 1065-1071). In this regard, the nucleic acid molecule of the invention may be delivered by way of diffusion, or more preferably, by degradation of a polymeric matrix covering the drug eluting stent. Exemplary synthetic polymers which can be used to form the biodegradable delivery system covering a drug eluting stent include: polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terepthalates, polyvinyl alcohols, polyvinyl ethers, polyvinyl esters, poly-vinyl halides, polyvinylpyrrolidone, polyglycolides, polysiloxanes, polyurethanes and co-polymers thereof, alkyl cellulose, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitro celluloses, polymers of acrylic and methacrylic esters, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxy-propyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxylethyl cellulose, cellulose triacetate, cellulose sulphate sodium salt, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butylmethacrylate), poly(isobutyl methacrylate), pory(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate), polyethylene, polypropylene, poly(ethylene glycol), poly(ethylene oxide), poly(ethylene terephthalate), poly(vinyl alcohols), polyvinyl acetate, poly vinyl chloride, polystyrene, polyvinylpyrrolidone, and polymers of lactic acid and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butic acid), poly(valeric acid), and poly(lactide-cocaprolactone), and natural polymers such as alginate and other polysaccharides including dextran and cellulose, collagen, chemical derivatives thereof (substitutions, additions of chemical groups, for example, alkyl, alkylene, hydroxylations, oxidations, and other modifications routinely made by those skilled in the art), albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, by surface or bulk erosion. Examples of nonbiodegradable polymers suitable for covering a drug eluting stents include ethylene vinyl acetate, poly(meth)acrylic acid, polyamides, copolymers and mixtures thereof. Bioadhesive polymers of particular interest include bioerodible hydrogels described by H. S. Sawhney, C. P. Pathak and J. A. Hubell in Macromolecules, (1993) 26:581-587, the teachings of which are incorporated herein, polyhyaluronic acids, casein, gelatin, glutin, polyanhydrides, polyacrylic acid, alginate, chitosan, poly(methyl methacrylates), poly(ethyl methacrylates), poly(butylmethacrylate), poly(isobutyl methacrylate), poly(hexylmethacrylate), poly(isodecyl methacrylate), poly(lauryl methacrylate), poly(phenyl methacrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate). In certain embodiments of the invention, the administration of the nucleic acid molecule of the invention maybe designed so as to result in sequential exposures to the composition over a certain time period, for example, hours, days, weeks, months or years. This may be accomplished, for example, by a sustained or controlled release delivery system covering the drug eluting stent in which the composition is delivered over a prolonged period without repeated administrations. Maintaining a constant concentration of the composition may be preferred in some cases. Other drug eluting stents suitable for use with the present invention include time-release, delayed release, sustained release, or controlled release of the nucleic acid according to the invention. Such systems may avoid repeated administrations in many cases, increasing convenience to the subject and the physician. Many types of release delivery systems suitable for covering drug eluting stents are available and known to those of ordinary skill in the art. They include, for example, polymer-based systems such as polylactic and/or polyglycolic acids, polyanhydrides, polycaprolactones, copolyoxalates, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and/or combinations of these. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Other examples include nonpolymer systems that are lipid-based including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di- and triglycerides; hydrogel release systems. liposome-based systems; phospholipid based-systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; or partially fused implants. Specific examples include, but are not limited to, erosional systems in which the composition is contained in a form within a matrix (for example, as described in U.S. Pat. Nos. 4,452,775, 4,675,189, 5,736,152, 4,667,013, 4,748,034 and 5,239,660), or diffusional systems in which an active component controls the release rate (for example, as described in U.S. Pat. Nos. 3,832,253, 3,854,480, 5,133,974 and 5,407,686). The formulation may be as, for example, microspheres, hydrogels, polymeric reservoirs, cholesterol matrices, or polymeric systems. In some embodiments, the system may allow sustained or controlled release of the nucleic acid molecule of the invention to occur, for example, through control of the diffusion or erosion/degradation rate of the formulation containing the nucleic acid molecule of the invention. Examples of systems in which release occurs in bursts includes, e.g., systems in which the nucleic acid molecule of the invention is entrapped in liposomes which are encapsulated in a polymer matrix, the liposomes being sensitive to specific stimuli, e.g., temperature, pH, light or a degrading enzyme and systems in which the nucleic acid molecule of the inventuion is encapsulated by an ionically-coated microcapsule with a microcapsule core degrading enzyme. Examples of systems in which release of the nucleic acid molecule is gradual and continuous include, e.g., erosional systems in which the nucleic acid molecule is contained in a form within a matrix and effusional systems in which nucleic acid molecule permeates at a controlled rate, e.g., through a polymer. Such sustained release systems can be e.g., in the form of pellets, or capsules covering the drug eluting stents. Use of a long-term drug eluting stent may be particularly suitable in some embodiments of the invention. “Long-term release,” as used herein, means that the stent covered by the nucleic acid molecule of the invention is constructed and arranged to deliver therapeutically effective levels of the nucleic acid molecule for at least 1 month or 2 months, and preferably at least 3 months or 4 months, or even longer in some cases. Long-term release formulations suitable to cover a drug eluting stent are well known to those of ordinary skill in the art, and include some of the release systems described above.
In another embodiment of the invention, the invention relates to an in vitro method of identifying an activator of expression of a microRNA, said microRNA comprising or consisting of the sequence of SEQ ID NO: 1, 2, 3 or 4 or a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 1, 2, 3 or 4, said method comprising:
The term “activator of expression of a microRNA” designates a compound which, in accordance with the present invention, specifically interacts with/specifically binds to the nucleic acid sequence of SEQ ID NOs: 1, 2, 3 or 4 including regulatory regions thereof and activates or increases the transcription of the target microRNA. It is preferred that the activator interacts with the native promoter of SEQ ID NOs: 1, 2, 3 or 4. Preferably, transcription is enhanced by at least 50%, more preferred at least 75% such as at least 90% or 95%, and even more preferred at least 98%.
In a preferred embodiment, the test compound is a small organic molecule. Small organic molecules are compounds of natural origin or chemically synthesized compounds. The term “small organic molecule” in accordance with the invention has the same meaning as in the art and preferably refers to molecules having a molecular weight less than 5000 g/mol, preferably less than 1000 g/mol, more preferably less than 750 g/mol and most preferably between 300 g/mol and 500 g/mol.
The efficiency of the activator compound can be quantified by methods comparing the level of activity in the presence of the activator to that in the absence of the activator. For example, as an activity measure may be used: the change in amount of microRNA formed, the change in the cellular phenotype and/or in the phenotype of an organism. Preferably, said method is effected in high-throughput format. High-throughput assays, independently of being biochemical, cellular or other assays, generally may be performed in wells of microtiter plates, wherein each plate may contain 96, 384 or 1536 wells. Handling of the plates, including incubation at temperatures other than ambient temperature, and bringing into contact of test compounds with the assay mixture is preferably effected by one or more computer-controlled robotic systems including pipetting devices. In case large libraries of test compounds are to be screened and/or screening is to be effected within short time, mixtures of, for example 10, 20, 30, 40, 50 or 100 test compounds may be added to each well. In case a well exhibits the expected activity, said mixture of test compounds may be de-convoluted to identify the one or more test compounds in said mixture giving rise to said activity.
Moreover, it is preferred that the activator is a pharmaceutically active agent for the treatment of a patient after stent implantation or balloon dilatation, or a lead compound suitable for developing a pharmaceutically active agent for the treatment of a patient after stent implantation or balloon dilatation, wherein the treatment prevents restenosis and/or treats or prevents a thrombosis or hypertension after stent implantation or balloon dilatation.
According to this aspect of the invention, it is also preferred that the activator is used to cover a drug eluting stent, wherein the stent elutes the activator. Means and methods for a drug eluting stent are described herein above.
The examples illustrate the invention.
A 129S7AB2.2 genomic BAC clone (bMQ-446B20; Sanger) was used to generate the targeting vector. Recombination in SW102 cell was employed to replace the miR-143 to miR-145 genomic region by a galK cassette (45) that was amplified by the primers flanking premiR-143 to pre-miR-145 (CACTCCTCCTGCCCAAGAAGAAAGCCGCGCGGCCTGCGTGCGGAGCGCCTGTCTCCCA GCggcgcgcctcagcactgtcctgctcctt; TACTCCCCGGAAGGAAATGCCAGGGTGGGAGGGAGACAGATCCAGCTGCTAAGCCATG ACggcgcgcctgttgacaattaatcatcggca). The genomic sequence was inserted via gap repair into a pKO targeting vector containing a DTA expression cassette and 450 bp homology arms for BAC recombination resulting in a vector containing 6.5 kb of sequence 5′ of miR-143 and 5.5 kb 3′ of miR-145 from genomic sequence TGAGCTGCTGGAGGCAAGGCTTGG to AGCCCAGCCTGGTCTATAGAGGGAG. The AscI restriction sites flanking the galK cassette were used to replace the galK by a floxed IRESIacZ-NeoR cassette. The vector was electroporated into MPI II ES cells (46) and recombinant clones were identified. Recombinant ES cells were injected into blastocysts and transferred to pseudopregnant mice. Chimeric animals were backcrossed to C57BL/6 mice. Heterozygous animals were used to obtain WT and KO littermates. ES cells and mice were genotyped using an EcoRV restriction digest and a 5′ outside probe amplified from genomic DNA using oligonucleotides (GACGGTCCTGAACACCTGGATCCC; TGCTGTGAGCTCTGAGAACCTCGG). For chronic ACE or AT1 inhibition drinking water of mice was supplemented with 600 μg/ml captopril (Sigma#C-8856) and 100 g/ml losartan (Fluka#61188) for at least 3 weeks. The experiments were performed in accordance with German legislation on protection of animals and were approved by the local governmental animal care committee (Regierungspraesidium Darmstadt).
Arteries were perfused using a PBS solution via the heart apex at 100 mmHg pressure for 2 min, followed by perfusion with 4% paraformaldehyde in PBS. After the dissection of different arteries, these were additionally fixed in 3% glutaraldehyde for another 12 hours at 40° C. and embedded in Epon. Ultra-thin sections were stained with uranyl acetate and lead citrate, viewed and photographically recorded using a Philips CM 10 electron microscope. The phenotype of VSMC was determined ultrastructurally following criteria as previously reported (47). Morphological assessments were done by two different persons, who were unaware of the identity of analyzed samples, In brief, contractile VSMC are characterized by highly compacted contractile filaments and numerous intracellular electron dense puncta (arrowheads,
10 g of protein lysates were separated on 4%-12% SDS-PAGE gradient gels and transferred onto nitrocellulose membranes (Invitrogen). Immunoreactive proteins were visualized with corresponding HRP-conjugated secondary antibodies using the SuperSignal West Femto detection solutions (Perbio Science). Signals were detected and analysed with a Biorad Versadoc System and Quantity One. We used polyclonal antisera against ACE-1 (Abcam#ab39172), NCS-1 (Santa Cruz#sc-13037), collagen type I (Sigma#C-2456) and monoclonal antibodies against “-smooth muscle actin (Sigma#C-6198), F4/80 (Invitrogen#MF48004), caveolin-3 (BD#610420), caldesmon-1 (Sigma#C-4562; clone hHCD), GAPDH (NEB#2118) calponin (Sigma#C2687; clone hCP). Secondary antibodies were from Pierce: goat anti-rabbit HRP (#1858415), goat anti mouse HRP (#1858413) or Invitrogen (Alexa Fluor).
Tissues were dissected from PBS perfused animals and total RNA was isolated using the Trizol method (Invitrogen). RNA quality was checked on the Agilent 2100 Bioanalyser using the RNA 6000 Nano Kit. For mRNA expression analysis the Affymetrix GeneChip Mouse Genome 430 2.0 Array was employed with the respective one-cycle target labelling protocol. Data were analysed by the RMA algorithm using the Affymetrix Expression Console. Data are available at http://www.mpi-bn.mpg.de/en/research/heart/boettger/downloads.html An unpaired t-test was performed with log 2-transformed data to identify significantly differentially expressed transcripts and a fold change was calculated using DNAStar ArrayStar3.0 software. 507 probe sets were identified with p<0.05 and FC>1.5 or FC<0.666. For miRNA expression analysis 384 3′ C6 aminolinker DNA-oligonucleotides complementary to published miRNA (Sanger, miRBase) sequences were synthesised and spotted with eight replicates per array to Nexterion E slides. Probe labelling and hybridization followed the Agilent miRNA labelling protocol, but P-CTTTT-Alexa555 or P-CTTTTAlexa647 oligonucleotides (MWG-Biotech) were ligated to the miRNAs. Arrays were scanned and analysed with an Axon 4200B scanner and GenePix Pro 6.0. Normalisation and data analysis was performed using Acuity 4.0. For multiple tissue comparison, miRNA from tissues was labelled with the Alexa555 dye, miRNA from whole E15.5 embryos labelled with Alexa647 dye was used as a reference. Data were linear normalized to a log ratio of 1 for the ratio of medians of let-7a-g and let-7i signals. The log 2 ratio data were centered for the single miRNA expression signals (by subtracting the row mean from each value), log 2 ratio data are visualized. For Northern blot analysis 3 μg (aorta 1.5 μg) of total RNA were separated on a 15% Polyacrylamide-Urea gel (Invitrogen) and blotted on Hybond XL (Amersham). miR-145, miR-143 and U6 antisense oligonucleotides were labeled with γ-ATP and PNK (NEB) and purified using Micro Bio-Spin® 6 columns (Biorad). Hybridization was performed in Ultrahyb hybridization buffer (Ambion) at 30° C. over night. Blots were washed 2 times in 2×SSC/0.1% SDS at 25° C. (5 min) and at 42° C. (15 min). Signals were detected using a BAS-2500 imager (Fujifilm).
Aortae were dissected from 13C6-lysine labelled “heavy” WT mice and from non-labeled wildtype and knockout litter mates. Protein extracts were processed and mass spectroscopy was performed as described (15). Briefly, all LC-MS/MS measurements were performed with an LTQ-Orbitrap (Thermo Fisher Scientific) combined with an Agilent 1200 nanoflow HPLC system. The mass spectrometer was operated in the data-dependent mode to automatically measure full MS scans and MS/MS spectra. Peptides were identified by searching against the International Protein Index sequence database (mouse IPI, version 3.24) using the Mascot search algorithm (www.matrixscience.com). Mass spectra were analyzed by the MaxQuant software package (48, 49), which performs peak lists, SILAC quantification and false positive rate determination (50). Ratio and p-values were calculated from the mean of three 13C6Lys-WT/WT and three 13C6Lys-WT/KO ratios.
Identification of miRNA Targets
miRNA target predictions were downloaded from miRBase (http://microrna.sanger.ac.uk; Mus musculus Targets Release Version v5, release: 2008 Jan. 8, miRanda-based), from microrna.org (http://www.microrna.org/; mouse miRNA Target Site predictions release 2008 Jan. 8; miRanda-based) (17) and from TargetScan.org (www.targetscan.org, v4.2, predicted targets of conserved families) (19). Lists of significantly regulated mRNAs WT vs KO, but not affected by chronic captopril treatment (via Affymetrix ID) or proteins (via gene symbol) were compared to lists of targets predicted for miR-143 and miR-145 using the MatchMiner database at http://discover.nci.nih.gov/matchminer/ (20).
Aortic catheterization was performed using a 1.4 F pressure-volume catheter. Data were recorded and analyzed with Chart v5.4 as described before (51). Mice were anaesthetized with isoflurane (2 vol % in O2) and their body temperature was kept at 37° C. as monitored by a rectal probe. Captopril (30 mg/kg body weight, 50 μl) and angiotensin II (5 to 50000 ng/kg body weight, 50 μl) were applied via the left jugular vein. For measurements of conscious, unrestrained mice, hemodynamic parameters were recorded by telemetry (DSI, Transoma Medical, USA, TA11PA-C10 transmitters) after a recovery period from surgery of more than 7 days. Recordings were obtained every 2 minutes for 20 seconds at a sampling frequency of 1000 Hz and were analyzed for day (07:00-19:00) and nighttime (19:00-07:00) periods, respectively, to evaluate circadian variation in hemodynamics.
Isolated segments of femoral and mesenteric arteries were examined in an isometric microvessel myograph as described previously (52). Mounted vessels were stimulated with 80 mM K+, 30 nM angiotensin II or increasing concentrations of phenylephrine (100 nM to 10 μM). The pCa-force relationships (13, 14) were obtained in permeabilized mouse femoral artery segments. In brief, arteries were permeabilized for 30 minutes using 0.5% Triton X-100 in relaxation solution. The latter consisted of (in mM): EGTA 1, Pipes 30, Na2ATP 5.16, MgCl2 7.31, sodium creatine phosphate 10 and potassium gluconate 74.1. For contraction curves the buffer was supplemented with 160 U/ml calmodulin and 100 U/ml creatine phosphokinase. The concentration of free Ca2+ ions was calculated as described previously (53).
Blood was collected after decapitation of mice and was analysed using an i-Stat 1 Analyser with EG6+ cartridges. For analysis of gut transit time, after a 20 h fasting period mice were force fed with 0.3 ml 2.5% Evans Blue (Sigma#E-2129) in 1.5% methylcellulose (Fluka#64632). Mice were returned to cages with water and food and time until appearance of stained faeces was recorded.
Analysis of Blood Circulating Angiotensin II and Aortic cGMP Concentration
Blood serum samples were obtained by cardiac puncture using Bestatin angiotensinase inhibitor solution (Bühlmann GmbH, Germany). Angiotensin II concentrations were determined using a angiotensin II RIA after reverse phase extraction of plasma samples using columns provided with the RIA (Bühlmann GmbH, Germany). To match the volume requirement of the RIA a part of the plasma samples analysed (n=5/4; WT/KO) were obtained by pooling plasma of max. two animals of the same genotype. Aortae from WT and KO mice were snap frozen in liquid nitrogen and homogenized in 5% TCA. cGMP concentration was determined with a cGMP EIA Kit (Cayman Chemicals) using the acetylated cGMP protocol.
Data are presented as means±SEM and tested by t test, one or two way ANOVA. P values less than 0.05 were considered to be statistically significant.
To understand the role of miRNAs in the development and regulation of the cardiovascular system a series of miRNA microarray hybridization experiments using a number of different mouse tissues derived from various developmental stages was performed. This microarray analysis revealed that the expression of miR-143 and miR-145, which form a small cluster on mouse chromosome 18, strongly correlated with the number of smooth muscle cells in all organs studied (
To study consequences of the loss of miR-143/145 heterozygous miR-143/145 knockout animals were crossed. Homozygous mutants were viable and fertile and did not show gross macroscopical alterations. Microarray-based and northern blot-based miRNA expression analysis of different knockout tissues confirmed the loss of the expression of both miRNAs and demonstrated the specificity of the signals detected by microarray hybridization (
Next the contractility of arterial smooth muscle in isolated arterial rings of WT and KO mice was analyzed directly. Reduced contractility of femoral artery explants from KO mice (−39.1%, down from 4608+596 μN to 2793+214 μN, n=8-12 vessels per genotype, p<0.05) was observed after stimulation with 80 μM extracellular potassium, which causes cellular depolarization and therefore probes the basic ability for contraction (
To elucidate the molecular changes, which resulted in the impairment of the contractile phenotype in VSMCs of miR-143/145 knockout animals a novel high-throughput approach was utilized. This experimental system was based on quantitative, mass spectrometry (MS)-based proteomics using reference mice that were completely labeled with 13C6Lys-substituted version of lysine (“SILAC mice”) (15), combined with microarray-based transcriptional profiling. SILAC analysis from aortae lacking expression of miR-143/145 (n=3/3) was employed to determine the relative changes of approximately 1600 proteins in mutant mice relative to wildtype controls (
To directly test the relevance of the proposed miR-145 target ACE for the observed phenotype ACE and the AT1 receptor was chronically inhibited, by oral administration of captopril and losartan, respectively. According to our model the lack of ACE repression in miR-143/145 knockout animals causes a local increase of angiotensin II signaling in smooth muscle cells, which should be rescued by pharmacological inhibition of ACE. It was found that a 20 day treatment with captopril markedly improved the contractile response of mutant, but not of WT arteries to phenylephrine and angiotensin II (FIG. 4B,D). Maximal angiotensin II-induced force of contraction was 3.2±0.7 mN in untreated WT vessels as compared with 3.4±0.6 mN in captopril-treated WT vessels (p=0.84, 12/8 untreated/treated WT vessels). In femoral arteries from KO mice, contractile force was greater after captopril-treatment (0.30±0.05 mN) than in untreated KO specimens (0.11±0.03 mN, p=0.007, 9/9 treated/untreated KO vessels). While the absolute functional improvement after ACE inhibition was significant but relatively small for angiotensin II-induced contraction (9% of K+ contraction,
Transitions of the phenotypic state of VSMCs play a key role in the repair of vascular injuries and in the development and/or progression of atherosclerosis, which is also reflected by the rapid down-regulation of multiple miRNAs during neointima development after vascular injury (24). Therefore, the focus was turned to long-term changes of the vascular system that might arise as a result of the accumulation of synthetic VSMCs. Importantly, neointimal lesions in the femoral arteries of 18 months old miR-143/145 mutant mice (n=7) were found, which comprised 49.12+5.75% of the media. Neointimal lesions were absent in wild-type controls (n=9) and negligible in younger miR-143/145 mutants (n=8), (
activated leukocyte cell
Alcam
0.0239
2.4
miR-145
#
adhesion molecule
tropomyosin 4
Tpm4
0.0002
2.0
miR-143,
#
miR-145
crystallin, zeta
Cryz
0.0041
1.7
miR-143
# *
glia maturation factor,
Gmfb
0.0002
1.5
miR-145
# §
beta
FK506 binding protein 3
Fkbp3
0.0041
1.3
miR-145
# * §
crystallin, zeta
Cryz
0.0271
9.2
miR-143
# *
activated leukocyte cell
Alcam
0.0351
5.5
miR-145
#
adhesion molecule
FK506 binding protein 3
Fkbp3
0.0430
3.4
miR-145
# * §
glia maturation factor,
Gmfb
0.0024
2.7
miR-145
# §
beta
Tropomyosin 4
Tpm4
0.0466
2.1
miR-143,
#
miR-145
| Number | Date | Country | Kind |
|---|---|---|---|
| 09010572.7 | Aug 2009 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP10/61828 | 8/13/2010 | WO | 00 | 4/10/2012 |
