Patent Application
20130227715
The present invention concerns the endonucleases capable of cleaving a target sequence located in a “safe harbor loci”, i.e. a loci allowing safe expression of a transgene. The present invention further concerns the use of such endonucleases for inserting transgenes into a cell, tissue or organism.
Meganucleases
Meganucleases, also referred to as homing endonucleases, were the first endonucleases used to induce double-strand breaks and recombination in living cells (Rouet et al. PNAS 1994 91:6064-6068; Rouet et al. Mol Cell Biol. 1994 14:8096-8106; Choulika et al. Mol Cell Biol. 1995 15:1968-1973; Puchta et al. PNAS 1996 93:5055-5060). However, their use has long been limited by their narrow specificity. Although several hundred natural meganucleases had been identified over the past years, this diversity was still largely insufficient to address genome complexity, and the probability of finding a meganuclease cleavage site within a gene of interest is still extremely low. These findings highlighted the need for artificial endonucleases with tailored specificities, cleaving chosen sequences with the same selectivity as natural endonucleases.
Meganucleases have emerged as scaffolds of choice for deriving genome engineering tools cutting a desired target sequence (Paques et al. Curr Gen Ther. 2007 7:49-66). Combinatorial assembly processes allowing to engineer meganucleases with modified specificities has been described by Arnould et al. J Mol. Biol. 2006 355:443-458; Arnould et al. J Mol. Biol. 2007 371:49-65; Smith et al. NAR 2006 34:e149; Grizot et al. NAR 2009 37:5405). Briefly, these processes rely on the identifications of locally engineered variants with a substrate specificity that differs from the substrate specificity of the wild-type meganuclease by only a few nucleotides. Up to four sets of mutations identified in such proteins can then be assembled in new proteins in order to generate new meganucleases with entirely redesigned binding interface.
These processes require two steps, wherein different sets of mutations are first assembled into homodimeric variants cleaving palindromic targets. Two homodimers can then be co-expressed in order to generate heterodimeric meganucleases cleaving the chosen non palindromic target. The first step of this process remains the most challenging one, and one cannot know in advance whether a meganuclease cleaving a given locus could be obtained with absolute certainty. Indeed, not all sequences are equally likely to be cleaved by engineered meganucleases, and in certain cases, meganuclease engineering could prove difficult (Galetto et al. Expert Opin Biol Ther. 2009 9:1289-303).
Other Enzymes Suitable for Site-Specific Genome Modifications
Specialized enzymes like integrases, recombinases, transposases and endonucleases have been proposed for site-specific genome modifications. For years, the use of these enzymes remained limited, due to the challenge of retargeting their natural specificities towards desired target sites. Indeed, the target sites of these proteins, or sequences with a sufficient degree of sequence identity, should be present in the sequences neighboring the mutations to be corrected, or within the gene to be inactivated, which is usually not the case, except in the case of pre-engineered sequences. The main challenge that would allow the use of these DNA modifying enzymes in gene therapy relies on the possibility of redesigning their DNA binding properties. Many strategies have been developed, aiming to obtain artificial proteins with tailored substrate specificities,
The integrase from the Streptomyces phage PhiC31 was used early for targeted gene transfer in an endogenous locus. This enzyme mediates recombination of the phage genome into the bacterial chromosome through a site-specific reaction between the phage attachment site (attP) and the bacterial attachment site (attB) (Kuhstoss et al. J Mol Biol 1991 222:897-908; Rausch et al. NAR 1991 19:5187-5189). This can occur from plasmids carrying attB sites into native genomic sequences harboring partial identity with attP, called pseudo attP sites (attP′). The PhiC31 integrase has been used to transfer several transgenes, including hFIX, in the human genome (Olivares et al. Nat Biotech 2002 20:1124-1128; Ginsburg et al. Adv Genet. 2005 54:179-187; Calos Curr Gene Ther 2006 6:633-645; Chalberg et al. J Mol Biol 2006 357:28-48; Aneja et al. J Gene Med 2007 9:967-975). The drawback here is that the site where integration can occur cannot be chosen (Chalberg et al. J Mol Biol 2006 357:28-48), and one has to rely on pseudo attP sites within the human genome loci, for precise integration. Whereas a major integration site is found on chromosome 19, hundreds other integration loci have been identified (Chalberg et al. J Mol Biol 2006 357:28-48). In recent work, the PhiC31 integrase was mutated in order to increase efficiency and specificity for integration at an attP′ site, paving the way for the development of engineered integrases that target chosen sites (Keravala et al. Mol Ther 2009 17:112-120). However, development of engineered integrases has lagged behind similar efforts focused on targeted recombinase and endonuclease systems.
Site-specific recombinases, such as the Cre recombinase from bacteriophage P1, or the Flp protein from Saccharomyces cerevisiae have been used to induce recombination between pre-engineered sequences containing their cognate sites. The Cre recombinase recognizes and mediates recombination between two identical 34 bp sites known as loxP (Abremski et al. Cell 1983 32:1301-1311). For many years, a limitation of Cre derived recombinases has been that repeated loxP, or pseudo loxP sites, must be present in order to allow DNA integration between these two sites. However, directed evolution of the DNA binding interface of this molecule has been used to create recombinases with new specificities (Buchholz et al. Nat Biotech 2001 19:1047-1052; Santoro et al. PNAS 2002 99:4185-4190). The Cre recombinase system has also been useful in providing a framework for the use of DNA targeting enzymes to induce the excision of viral sequences. Indeed, work with a retroviral Moloney murine leukemia virus vector system has shown that, when loxP sites are introduced in the LTR of an integrative retroviral vector, the expression of Cre can result in the deletion of all the sequences between the two loxP sites (Choulika et al. J Virol 1996 70:1792-1798). More recently, an engineered Cre recombinase variant has been used to excise an HIV type 1 provirus (Sarkar et al. Science 2007 316:1912-1915) from cells. The recombinase was redesigned to target the proviral LTRs, and used to induce the excision of all intervening sequences. Engineering attempts have also been made with the Flp recombinase, targeting the FRT (Flp Recombination Target) sequence (Buchholzt et al. Nat Biotech 1998 16:657-662), and variants recognizing non-native Flp recombination targets have been obtained (Voziyanov et al. J Mol Biol 2003 326:65-76). However, there is no example of targeted insertion in a non-pre-engineered locus with such enzymes today.
Transposons such as Piggy Back and Sleeping Beauty can provide efficient tools for insertion of sequences into vertebrate cells and have been proposed as an alternative to viral mediated gene delivery to achieve long-lasting expression (Izsvak et al. Mol ther 2004 9:147-156; Ivics et al. Curr Gene Ther 2006 6:593-607; Mates et al. Nat Genet. 2009 41:753-761). Transposons are a natural means of gene delivery in which a DNA sequence present in a DNA molecule is inserted in another location, through the action of the transposase. An engineered SB transposase, called SB100X was recently shown to increase the efficiency of the process (Mates et al. Nat Genet. 2009 41:753-761). Transposition is random on a genomic level (for example, SB integrates into TA dinucleotides (Vigdal et al. J Mol Biol 2002 323:441-452), and should therefore not be considered as tools for targeted approaches. However, further work has shown the possibility of chromosomal transposition mediated by engineered transposases in human cells, by fusing the transposase catalytic domain to specific DNA binding domains (Ivics, et al. Mol Ther 2007 15:1137-1144), paving the way for the development of a new category of targeted tools.
Gene Therapy
The successful treatment of several X-SCID patients by gene therapy nearly 10 years ago was one of the most significant milestones in the field of gene therapy. This tremendous achievement was followed by significant success in other clinical trials addressing different diseases, including another form of SCID, Epidermolysis Bullosa and Leber Amaurosis and others. However, these initial successes have long been overshadowed by a series of serious adverse events, i.e. the appearance of leukemia in X-SCID treated patients (Hacein-Bey-Abina et al. Science 2003 302:415-419; Hacein-Bey-Abina et al. J Clin Invest. 2008 118:3132-3142; Howe et al. J Clin Invest. 2008 118:3143-3150). All cases of leukemia, but one, could eventually be treated by chemotherapy, and the approach appears globally as a success, but these serious adverse effects highlighted the major risks of current gene therapy approaches.
There is thus a need in the art for a safe method for inserting a gene into the genome of a subject.
Most of the gene therapy protocols that are being developed these days for the treatment of inherited diseases are based on the complementation of a variant allele by an additional and functional copy of the disease-causing gene. In non-dividing tissues, such as retina, delivering this copy can be accomplished using a non integrative vector, derived for example, from an Adeno Associated Virus (AAV). However, when targeting stem cells, such as hematopoietic stem cells (HSCs), whose fate is to proliferate, persistent expression becomes an issue, and there is a need for integrative vectors. Retroviral vectors, which integrate in the genome and replicate with the hosts' chromosomes, have proved efficient for this purpose, but the random nature of their insertion has raised various concerns, all linked with gene expression. The cases of leukemia observed in the X-SCID trials were clearly linked to the activation of a proto-oncogene in the vicinity of the integration sites. In addition, inappropriate expression of the transgene could result in metabolic or immunological problems. Finally, insertion could result in the knock-out of endogenous genes.
Site-specific integration would be a promising alternative to random integration of viral vectors since it could alleviate the risks of insertional mutagenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat. Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, it is relatively tedious to engineer tools for targeted recombination. In addition, each tool has its intrinsic properties in terms of activity and specificity.
Therefore, there is a need in the art for a tool allowing the targeted insertion of transgenes into loci of the genome that can be considered as “safe harbors” for gene addition. In addition, it would be extremely advantageous if this tool could be used for inserting transgenes irrespective of their sequences, thereby allowing the treatment of numerous diseases by gene therapy using a same tool. Moreover, it would be extremely advantageous if this tool allowed inserting transgenes into the genome with a high efficacy, and led to stable expression of the transgene at high levels.
The invention is notably drawn to the following embodiments:
A variant endonuclease capable of cleaving a target sequence for use in inserting a transgene into the genome of an individual, wherein
The endonuclease according to embodiment 1, wherein insertion of said transgene does not substantially modify expression of genes located in the vicinity of the target sequence.
The endonuclease according to embodiment 1 or 2, wherein said target sequence is located at a distance of at least 100 kb from the nearest genes.
The endonuclease according to any one of embodiments 1 to 3, wherein said RIS has been identified in cells from a patient treated by gene therapy by transduction of stem cells.
The endonuclease according to any one of embodiments 1 to 3, wherein said RIS has been identified in cells from a patient treated by gene therapy by transduction of hematopoietic stem cells.
The endonuclease according to any one of embodiments 1 to 5, wherein said endonuclease is a homing endonuclease.
The endonuclease according to embodiment 6, wherein said homing endonuclease is a member of the family of LAGLIDADG endonucleases.
The endonuclease according to embodiment 7, wherein said member of the family of LAGLIDADG endonucleases is I-CreI.
The endonuclease according to any one of embodiments 1 to 8, wherein said locus is selected from the SH3 locus on human chromosome 6p25.1, the SH4 locus on human chromosome 7q31.2, the SH6 locus on human chromosome 21q21.1, the SH12 locus on human chromosome 13q34, the SH13 locus on human chromosome 3p12.2, the SH19 locus on human chromosome 22, the SH20 locus on human chromosome 12q21.2, the SH21 locus on human chromosome 3p24.1, the SH33 locus on human chromosome 6p12.2, the SH7 locus on human chromosome 2p16.1 and the SH8 locus on human chromosome 5.
In vitro or ex vivo use of an endonuclease as defined in any one of embodiments 1 to 9 for inserting a transgene into the genome of a cell or a tissue.
A variant dimeric I-CreI protein comprising two monomers that comprise a sequence at least 80% identical to SEQ ID NO: 1 or SEQ ID NO: 42, wherein:
The dimeric I-CreI protein according to embodiment 11, wherein said dimeric I-CreI protein is capable of cleaving a target sequence located within the SH3 locus on human chromosome 6p25.1.
The dimeric I-CreI protein according to embodiment 12, wherein said target sequence comprises the sequence of SEQ ID NO: 2.
The dimeric I-CreI protein according to embodiment 12 or 13, wherein said protein comprises:
The dimeric I-CreI protein according to embodiment 14, wherein said polypeptide comprises:
The dimeric I-CreI protein according to embodiment 14, wherein said polypeptide comprises:
The dimeric I-CreI protein according to embodiment 14, wherein said polypeptide comprises:
The dimeric I-CreI protein according to embodiment 11, wherein said dimeric I-CreI protein is capable of cleaving a target sequence located within the SH4 locus on human chromosome 7q31.2.
The dimeric I-CreI protein according to embodiment 18, wherein said target sequence comprises the sequence of SEQ ID NO: 3.
The dimeric I-CreI protein according to embodiment 18 or 19, wherein said protein comprises:
The dimeric I-CreI protein according to embodiment 20, wherein said polypeptide comprises:
The dimeric I-CreI protein according to embodiment 11, wherein said dimeric I-CreI protein is capable of cleaving a target sequence located within the SH6 locus on human chromosome 21q21.1.
The dimeric I-CreI protein according to embodiment 22, wherein said target sequence comprises the sequence of SEQ ID NO: 59.
The dimeric I-CreI protein according to embodiment 22 or 23, wherein said protein comprises:
The dimeric I-CreI protein according to embodiment 24, wherein said polypeptide comprises:
The dimeric I-CreI protein according to embodiment 24, wherein said polypeptide comprises:
A fusion protein comprising the monomers of the dimeric I-CreI protein according to any one of embodiments 11 to 26.
The fusion protein according to embodiment 27, wherein said monomers are connected by a peptidic linker comprising a sequence of SEQ ID NO: 43.
The fusion protein according to embodiment 27 or 28, wherein the C-terminal monomer further comprises K7E and K96E mutations, and wherein the N-terminal monomer further comprises E8K, E61R and G19S mutations.
The fusion protein according to any one of embodiments 27 to 29, wherein said fusion protein comprises a sequence selected from the group consisting of SEQ ID Nos. 25-40 and 76-96.
A nucleic acid encoding the endonuclease according to any one of embodiments 1-9 or the protein according to any one of embodiments 11 to 30.
An expression vector comprising the nucleic acid according to embodiment 31.
The expression vector according to embodiment 32, further comprising a targeting construct comprising a transgene and two sequences homologous to the genomic sequence flanking a target sequence recognized by the endonuclease as defined in one of embodiments 1-9 or by the protein as defined in any one of embodiments 11 to 30.
The expression vector of embodiment 33, wherein said transgene encodes a therapeutic polypeptide.
The expression vector according to any one of embodiments 32 to 34 for use in gene therapy.
A combination of:
A pharmaceutical composition comprising the expression vector as defined in any one of embodiments 32 to 34 or the combination as defined in embodiment 36 and a pharmaceutically active carrier.
A method of treating an individual by gene therapy comprising administering an effective amount of the expression vector as defined in any one of embodiments 32 to 34 or of the combination as defined in embodiment 36 to an individual in need thereof.
A method for obtaining an endonuclease suitable for inserting a transgene into the genome of an individual, comprising the step of:
Use of the endonuclease according to any one of embodiments 1 to 9, or of the protein according to any one of embodiments 11 to 30, or of the nucleic acid according to embodiment 31, or of the expression vector according to any one of embodiments 32 to 34, or of the combination according to embodiment 36, for inserting a transgene into the genome of a cell, tissue or non-human animal, wherein said use is not therapeutic.
The use of embodiment 40, for making a non-human animal model of a hereditary disorder.
The use of embodiment 40, for producing a recombinant protein.
A non-human transgenic animal comprising a nucleic acid according to embodiment 31, or an expression vector according to any one of embodiments 32-34, or a combination according to embodiment 36 in its genome.
The inventors have identified “safe harbors” loci within the genome allowing safe expression of a transgene through targeted insertion wherein (i) said loci are close to a retroviral insertion site identified in a cell from a patient treated by gene therapy, and (ii) said retroviral insertion are not associated with cancer or abnormal cell proliferation. As immediately apparent from the following description and examples, the safe harbor loci according to the invention may either be located within the intron of a gene, or within an intergenic region.
In particular, the inventors have found that endonucleases could be engineered in such a way as to target said safe harbors for gene addition.
More specifically, the inventors have engineered several I-CreI meganucleases that are capable of recognizing and cleaving target sequences located within different safe harbors loci, for instance the SH6, the SH3 locus, the SH4 locus, the SH12 locus, the SH13 locus, the SH19, the SH20 locus, the SH21 locus, the SH33 locus, the SH7 locus, the SH8 locus, the SH18 locus, the SH31 locus, the SH38 locus, the SH39 locus, the SH41 locus, the SH42 locus, the SH43 locus, the SH44 locus, the SH45 locus, the SH46 locus, the SH47 locus, the SH48 locus, the SH49 locus, the SH50 locus, the SH51 locus, the SH52 locus, the SH70 locus, the SH71 locus, the SH72 locus, the SH73 locus, the SH74 locus, the SH75 locus, the SH101 locus, the SH106 locus, the SH107 locus, the SH102 locus, the SH105 locus, the SH103 locus, the SH104 locus, the SH113 locus, the SH109 locus, the SH112 locus, the SH108 locus, the SH110 locus, the SH114 locus, the SH116 locus, the SH111 locus, the SH115 locus, the SH121 locus, the SH120 locus, the SH122 locus, the SH117 locus, the SH118 locus, the SH119 locus, the SH123 locus, the SH126 locus, the SH128 locus, the SH129 locus, the SH124 locus, the SH131 locus, the SH125 locus, the SH127 locus, the SH130 locus, the SH11 locus, the SH17 locus, the SH23 locus, the SH34 locus, the SH40 locus, the SH53 locus, the SH54 locus, the SH55 locus, the SH56 locus, the SH57 locus, the SH58 locus, the SH59 locus, the SH60 locus, the SH61 locus, the SH62 locus, the SH65 locus, the SH67 locus, the SH68 locus and the SH69 locus that are further described herein.
It has further been shown that these meganucleases can cleave their target sequences efficiently.
These meganucleases, as well as other enymes like integrases, recombinases and transposases, can therefore be used as a tool for inserting a transgene into safe harbors, thereby avoiding the appearance of adverse events such as leukemia in the frame of gene therapy. In addition, these meganucleases, as well as other enymes like integrases, recombinases and transposases can be used for inserting any transgene into the safe harbor starting from a single targeting construct irrespective of the sequence of the transgene.
Endonucleases According to the Invention and Uses Thereof.
The invention therefore relates to:
As used herein, the term “endonuclease” refers to any wild-type or variant enzyme capable of catalyzing the hydrolysis (cleavage) of bonds between nucleic acids within of a DNA or RNA molecule, preferably a DNA molecule. The endonucleases according to the present invention do not cleave the DNA or RNA molecule irrespective of its sequence, but recognize and cleave the DNA or RNA molecule at specific polynucleotide sequences, further referred to as “target sequences” or “target sites”. Target sequences recognized and cleaved by an endonuclease according to the invention are referred to as target sequences according to the invention.
The endonuclease according to the invention can for example be a homing endonuclease (Paques et al. Curr Gen Ther. 2007 7:49-66), a chimeric Zinc-Finger nuclease (ZFN) resulting from the fusion of engineered zinc-finger domains with the catalytic domain of a restriction enzyme such as Fokl (Porteus et al. Nat. Biotechnol. 2005 23:967-973) or a chemical endonuclease (Arimondo et al. Mol Cell Biol. 2006 26:324-333; Simon et al. NAR 2008 36:3531-3538; Eisenschmidt et al. NAR 2005 33:7039-7047; Cannata et al. PNAS 2008 105:9576-9581). In chemical endonucleases, a chemical or peptidic cleaver is conjugated either to a polymer of nucleic acids or to another DNA recognizing a specific target sequence, thereby targeting the cleavage activity to a specific sequence.
The endonuclease according to the invention is preferably a homing endonuclease, also known under the name of meganuclease. Such homing endonucleases are well-known to the art (see e.g. Stoddard, Quarterly Reviews of Biophysics, 2006, 38:49-95). Homing endonucleases recognize a DNA target sequence and generate a single- or double-strand break. Homing endonucleases are highly specific, recognizing DNA target sites ranging from 12 to 45 base pairs (bp) in length, usually ranging from 14 to 40 bp in length. The homing endonuclease according to the invention may for example correspond to a LAGLIDADG endonuclease, to a HNH endonuclease, or to a GIY-YIG endonuclease. Examples of such endonuclease include I-Sce I, I-Chu I, I-Cre I, I-Csm I, PI-Sce I, PI-Tli I, PI-Mtu I, I-Ceu I, I-Sce II, I-Sce III, HO, PI-Civ I, PI-Ctr I, PI-Aae I, PI-Bsu I, PI-Dha I, PI-Dra I, PI-Mav I, PI-Mch I, PI-Mfu I, PI-Mfl I, PI-Mga I, PI-Mgo I, PI-Min I, PI-Mka I, PI-Mle I, PI-Mma I, PI-Msh I, PI-Msm I, PI-Mth I, PI-Mtu I, PI-Mxe I, PI-Npu I, PI-Pfu I, PI-Rma I, PI-Spb I, PI-Ssp I, PI-Fac I, PI-Mja I, PI-Pho I, PI-Tag I, PI-Thy I, PI-Tko I, PI-Tsp I, I-MsoI.
In a preferred embodiment, the homing endonuclease according to the invention is a LAGLIDADG endonuclease such as I-SceI, I-CreI, I-CeuI, I-MsoI, and 1-DmoI.
In a most preferred embodiment, said LAGLIDADG endonuclease is I-CreI. Wild-type I-CreI is a homodimeric homing endonuclease that is capable of cleaving a 22 to 24 bp double-stranded target sequence. The sequence of a wild-type monomer of I-CreI includes the sequence shown as SEQ ID NO: 1 (which corresponds to the I-CreI sequence of pdb accession number 1g9y) and the sequence shown in SwissProt Accession n° P05725 (in particular the sequence shown in version 73, last modified Nov. 3, 2009).
In the present patent application, the I-CreI variants may comprise an additional alanine after the first methionine of the wild type I-CreI sequence, and three additional amino acid residues at the C-terminal extremity (see sequence of SEQ ID NO: 42 and
In the present application, I-CreI variants may be homodimers (meganuclease comprising two identical monomers), heterodimers (meganuclease comprising two non-identical monomers) and single-chains.
The invention encompasses both wild-type (naturally-occurring) and variant endonucleases. In a preferred embodiment, the endonuclease according to the invention is a “variant” endonuclease, i.e. an endonuclease that does not naturally exist in nature and that is obtained by genetic engineering or by random mutagenesis. The variant endonuclease according to the invention can for example be obtained by substitution of at least one residue in the amino acid sequence of a wild-type, naturally-occurring, endonuclease with a different amino acid. Said substitution(s) can for example be introduced by site-directed mutagenesis and/or by random mutagenesis. In the frame of the present invention, such variant endonucleases remain functional, i.e. they retain the capacity of recognizing and specifically cleaving a target sequence.
The variant endonuclease according to the invention cleaves a target sequence that is different from the target sequence of the corresponding wild-type endonuclease. For example, the target sequence of a variant I-CreI endonuclease is different from the sequence of SEQ ID NO: 4. Methods for obtaining such variant endonucleases with novel specificities are well-known in the art.
The present invention is based on the finding that such variant endonucleases with novel specificities can be used for inserting a gene into a “safe harbor” locus of the genome of a cell, tissue or individual.
As used herein, the term “locus” is the specific physical location of a DNA sequence (e.g. of a gene) on a chromosome. As used in this specification, the term “locus” usually refers to the specific physical location of an endonuclease's target sequence on a chromosome. Such a locus, which comprises a target sequence that is recognized and cleaved by an endonuclease according to the invention, is referred to as “locus according to the invention”.
Ideally, insertion into a safe harbor locus should have no impact on the expression of other genes. Testing these properties is a multi-step process, and a first pre-screening of candidate safe harbor loci by bioinformatic means is desirable. One can thus first identify loci in which targeted insertion is unlikely to result in insertional mutagenesis.
One of the major features of a locus according to the invention is that (i) it is located in a region wherein retroviral insertion was observed in a cell from a patient, in a gene therapy clinical trial, and (ii) said retroviral insertion has not been associated with a cancer or an abnormal cell proliferation.
Indeed, one way to identify safe habor loci according to the invention is to use the data generated by former gene therapy trials. In the X-SCID trial, insertions of retroviral vector-borne transgenes next to the LMO2 and CCND2 genes have been shown to be associated with leukemia. The follow up of vector insertions in patients have clearly demonstrated that cells carrying this insertion had outnumbered the other modified cells after a several years process (Hacein-Bey-Abina et al. Science 2003 302:415-9; Deichmann et al. J. of Clin. Invest. 2007 117:2225-32, Cavazzana-Calvo et al. Blood 2007 109:4575-4581). In another clinical trial, insertion in several loci were found to trigger a high proliferation rate in two patients (Ott et al. Nat Med 2006 12:401-9). In these cases, proliferation seemed to be a consequence of the insertional activation of the MDS1-EVI1, PRDM16, or SETBP1 genes. Although malignancy was not observed initially, EVII activation eventually resulted in myelodysplasia in both patients (Stein et al., Nat. Med. 2010 16: 198-205). More generally, even if non oncogenic, cell proliferation resulting from activation of a gene close to the insert could represent a first step towards malignancy, and therefore lead to potential problems in terms of safety. In order to better understand the pattern of viral vector integration, and its potential consequences on the fate of transformed cells, several large scale studies of Retroviral Insertion Sites (RIS) have been conducted in patients from gene therapy trials (Mavilio et al., Nat Med 2006:1397-1402; Recchia et al. PNAS 2006:1457-62; Aiuti, et al. J Clin Invest 2007:2233-40; Schwarzwaelder et al. J Clin Invest 2007:2241-9; Deichmann et al. J Clin Invest 2007:2225-32). RIS which are not associated with leukemia or with abnormal cell proliferation can be considered as safe harbors. Therefore, the locus according to the invention preferably overlaps or is close to a RIS identified in a clinical trial, and yet not associated with cancer or abnormal cell proliferation.
More specifically, the locus according to the invention is defined as a locus comprising a target sequence that is located at a distance of at most 200, 180, 150, 100 or 50 kb from a retroviral insertion site (RIS), said RIS being neither associated with cancer nor with abnormal cell proliferation. Such loci are referred to as “safe harbor” loci according to the invention (or loci according to the invention), i.e. loci that are safe for insertion of transgenes.
By “Retroviral insertion sites” (RIS) is meant a genomic site which was identified as an insertion site for a retroviral vector in a cell from a patient treated by gene therapy with said retroviral vector. Such RIS are well-known to the art. They include but are not limited to those described in Schwarzwaelder et al. (J. Clin. Invest. 2007 117:2241), Deichmann et al. (J. of Clin. Invest. 2007 117:2225), Aiuti et al. (J. Clin. Invest. 2007 117:2233), Recchia et al. (PNAS 2006 103:1457) and Mavilio et al. (Nature Medicine 12:1397, 2006).
By “retroviral vector” is meant any vector derived from a virus from the retroviridae family.
The RIS according to the invention is neither associated with cancer nor with abnormal cell proliferation. RIS known to be associated with leukemia or with abnormal cell proliferation are well known in the art and can easily be excluded by the skilled in the art. Such RIS known to be associated with leukemia or with abnormal cell proliferation include, e.g., insertion sites next to the LMO2, CCND2, MDS1-EVI1, PRDM16, and SETBP1 genes.
In a more preferred embodiment according to the invention, the RIS used to define safe harbor loci have been identified in a clinical trial, with the transduced cells being stem cells. The RIS can thus have been identified in cells from a patient treated by gene therapy by transduction of stem cells.
In another most preferred embodiment according to the invention, the RIS used to define safe harbor loci have been identified in a clinical trial for SCID patients, with the transduced cells being hematopoietic stem cells (HSCs). The RIS can thus have been identified in cells from a patient treated by gene therapy by transduction of hematopoietic stem cells.
Furthermore, more stringent criteria for definition of a RIS according to the invention can be used.
Among RIS, Common Integration sites (CIS) are loci in which the statistical over representation of RIS could be interpreted as the consequence of cell high proliferation rate upon insertion. (Mikkers et al., 2003, Nat. Genet. 32:153; Lund et al., 2002, Nat. Genet. 32:160; Hemati et al. 2004, PLOS Biol. 2:e423; Suzuki et al., 2002, Nat. Genet. 32:166-174; Deichman et al. J. of Clin. Invest. 2007 117:2225-32). For example, Deichman et al. (J. of Clin. Invest. 2007 117:2225-32) made a survey of RIS from 9X-SCID patients treated by gene therapy, and found 572 unique RIS that could be mapped unequivocally to the human genome. Among them, they defined CIS of second, third, fourth, fifth, and higher order. CIS of second orders were defined by the occurrence of two retroviral insertions within a 30 kb distance, CIS of third, fourth and fifth order by the occurrence of 3, 4 or 5 insertions within 50, 100 or 200 kb, respectively. 122 RIS were found in 47 different CIS loci, 33-fold the value expected under random distribution of the RIS. Eleven CIS were found to localize next to proto-oncogenes, including ZNF217, VAV-3, CCND2, LMO2, MDS1, BCL2L1, NOTCH2, SOCS2, RUNX1, RUNX3, and SEPT6.
To ensure maximal safety, it could be preferred to avoid RIS located within CIS. Therefore, in a preferred embodiment according to the invention, the target sequence according to the invention is not located in a CIS, In addition, said target sequence or locus is preferably located at a distance of at least 50, 100 or 200 kb from a RIS being part of a common integration site (CIS).
By “Common Integration site” (CIS) is meant a genomic region of 30 kb, 50 kb, 100 kb or 200 kb wherein RIS identified in clinical trials are overrepresented (assuming a random distribution of insertions). Such CIS are well known in the art and are described in Schwarzwaelder et al. (J. Clin. Invest. 2007 117:2241), Deichmann et al. (J. of Clin. Invest. 2007 117:2225), Aiuti et al. (J. Clin. Invest. 2007 117:2233), Recchia et al. (PNAS 2006 103:1457), Mavilio et al. (Nature Medicine 12:1397, 2006) and Gabriel et al. (Nat. Med. 2009 15(12):143.
In addition to be close to a RIS, targeted integration into the locus according to the invention should not result in the disruption of essential functions in the targeted cell.
Therefore, in a specific embodiment according to the invention, insertion into the locus according to the invention does preferably not substantially modify expression of genes located in the vicinity of the target sequence, for example of the nearest genes.
In addition, in another specific embodiment, insertion of a genetic element into said locus does preferably not substantially modify the phenotype of said cell, tissue or individual (except for the phenotype due to expression of the genetic element). By “phenotype” is meant a cell's, a tissue's or an individual's observable traits. The phenotype includes e.g. the viability, the cellular proliferation and/or the growth rate. The skilled in the art can easily verify that a locus is a safe harbor locus according to the invention e.g. by analyzing the expression pattern of adjacent genes, by carrying out micro-array studies of transcriptome and/or by characterizing proliferation and/or differentiation abnormalities (if any).
In still another specific embodiment, the locus according to the invention does not comprise any gene. A locus that does not comprise any gene refers to a locus that does not comprise any referenced or known gene. In other terms, such a locus does not comprise any known gene according to sequence databases such as those available on the National Center for Biotechnology Information (NCBI) website. Therefore, the target sequence according to the invention and/or the locus according to the invention can advantageously be located at a distance of at least 1, 5, 10, 25, 50, 100, 180, 200, 250, 300, 400 or 500 kb from the nearest genes.
By “gene” is meant the basic unit of heredity, consisting of a segment of DNA arranged in a linear manner along a chromosome, which codes for a specific protein or segment of protein. A gene typically includes a promoter, a 5′ untranslated region, one or more coding sequences (exons), optionally introns, a 3′ untranslated region. The gene may further comprise a terminator, enhancers and/or silencers.
By “nearest genes” is meant the one, two or three genes that are located the closest to the target sequence, centromeric and telomeric to the target sequence respectively.
In a preferred embodiment, the locus according to the invention further allows stable expression of the transgene.
In another preferred embodiment, the target sequence according to the invention is only present once within the genome of said cell, tissue or individual.
Once such a safe harbor locus according to the invention has been selected, one can then (i) either construct a variant endonuclease specifically recognizing and cleaving a target sequence located within said locus, e.g. as described in Examples 1, 2 and 5, or (ii) determine whether a known wild-type endonuclease is capable of cleaving a target sequence located within said locus. Alternatively, once a safe harbor locus according to the invention has been selected, the skilled in the art can insert therein a target sequence that is recognized and cleaved by a known wild-type or variant endonuclease.
Therefore, the invention is drawn to a method for obtaining an endonuclease suitable for inserting a transgene into the genome of an individual, comprising the step of:
All criteria presented hereabove in connection with the locus according to the invention can of course be applied when carried out the above method. For example, RIS being part of a CIS may be excluded, and/or the genomic region defined at step (b) may only extend 50 kb upstream and 50 kb downstream of said RIS, and/or the locus comprising the target sequence may not comprise any gene.
The locus according to the invention may for example correspond to any one of the SH3, SH4, SH6, SH12, SH13, SH19, SH20, SH21, SH33, SH7 or SH8 loci which are described in Tables A to C below.
Table A provides the location of the locus within the human genome, a target sequence comprised within the locus, the location of the closest RIS as well as the reference to a publication describing the RIS, and examples of endonucleases according to the invention that cleave the locus.
Table B provides information about the nearest genes that are located immediately upstream (at 5′) and downstream (at 3′) of the locus according to the invention. The distance indicates the distance between the target sequence and the nearest coding sequence of the gene.
Table C and D provide similar information as Table B, but for the second nearest genes and for the third nearest genes, respectively.
Tables A′, B′, C′ and D′ provide updated information similar to that in Tables A, B, C and D, respectively, for some loci and associated examples of target sequences within these loci, namely SH3, SH4, SH6, SH8 and SH19. Updated localization information is given by reference to GRCh37/hg19 version of the human genome assembly.
The locus according to the invention may also correspond to any one of the SH18, SH31, SH38, SH39, SH41, SH42, SH43, SH44, SH45, SH46, SH47, SH48, SH49, SH50, SH51, SH52, SH70, SH71, SH72, SH73, SH74 and SH75 which are described in Tables A″ to D″ below.
Table A″ provides the location of the locus within the human genome, a target sequence comprised within the locus, the location of the closest RIS as well as the reference to a publication describing the RIS, the distance between said target and the closest RIS and examples of endonucleases according to the invention that cleave the locus.
Table B″ provides information about the nearest genes that are located immediately upstream (at 5′) and downstream (at 3′) of the locus according to the invention. The distance indicates the distance between the target sequence and the nearest coding sequence of the gene.
Table C″ and D″ provide similar information as Table B″, but for the second nearest genes and for the third nearest genes, respectively.
Locations of loci, targets in this loci and genes are given according to GRCh37/hg19 version of the human genome assembly.
The locus according to the invention may also correspond to any one of the SH101, SH106, SH107, SH102, SH105, SH103, SH104, SH113, SH109, SH112, SH108, SH110, SH114, SH116, SH111, SH115, SH121, SH120, SH122, SH117, SH118, SH119, SH123, SH126, SH128, SH129, SH124, SH131, SH125, SH127 and SH130 which are described in Tables E and F below.
Table E provides the location of the locus within the human genome, a target sequence comprised within the locus, the location of the closest RIS as well as the reference to a publication describing the RIS, the distance between said target and the closest RIS and examples of endonucleases according to the invention that cleave the locus.
Table F provides information about the nearest genes that are located immediately upstream (at 5′) and downstream (at 3′) of the locus according to the invention. The distance indicates the distance between the target sequence and the nearest coding sequence of the gene.
Locations of loci, targets in this loci and genes are given in Tables E and F according to GRCh36.3/hg19 version of the human genome assembly.
The locus according to the invention may also correspond to any one of the SH125, SH127, SH130, SH102, SH105, SH103, SH104, SH117, SH118, SH119 and SH123 which are described in Table G below.
Table G provides examples of target sequences located in introns of genes which are mentioned and examples of endonucleases according to the invention that cleave said intronic locus.
The locus according to the invention may also contains any one of the SH11, SH12, SH13, SH17, SH19, SH20, SH21, SH23, SH33, SH34, SH40, SH53, SH54, SH55, SH56, SH57, SH58, SH59, SH60, SH61, SH62, SH65, SH67, SH68 and SH69 which are given in Tables H below.
Table H provides target sequences comprised within these loci as well as examples of endonucleases according to the invention that cleave these target sequences.
In a specific embodiment, the locus according to the invention is the SH3 locus. The term “SH3 locus” refers to the region of human chromosome 6 that is located at about 120 kb centromeric to the gene encoding the lymphocyte antigen 86 (see e.g. the world wide web site ncbi.nlm.nih.gov/projects/mapview/maps.cgi?TAXID=9606&CHR=6&MAPS=ideogr%2Ccn tg-r%2CugHs%2Cgenes&BEG=6432845&END=7232845&thmb=on, which shows the 6,430K-7,230K region of chromosome 6), and to homologous regions in other species. More precisely, the SH3 locus extends from position 6850510 to 6853677 of the sequence shown in NC 000006.11. It comprises a sequence of SEQ ID NO: 54.
In another specific embodiment, the locus according to the invention is the SH4 locus. The SH4 locus is defined herein as the region of human chromosome 7 that is located at about 320 kb telomeric to MyoD family inhibitor domain containing locus (MDFIC), or to the homologous region in another species (see e.g. the world wide web site ncbi.nlm.nih.gov/projects/mapview/maps.cgi?TAXID=9606&CHR=7&MAPS=ideogr,cntg-r,ugHs,genes[113908811.00%3A114908811.00]&CMD=DN, which shows the 114,660K-115,660K region of chromosome 7). More precisely, the SH4 locus extends from position 114972751 to 114976380 of the sequence shown in NC 000007.13. It comprises a sequence of SEQ ID NO: 55.
As used herein, the term “transgene” refers to a sequence encoding a polypeptide. Preferably, the polypeptide encoded by the transgene is either not expressed, or expressed but not biologically active, in the cell, tissue or individual in which the transgene is inserted. Most preferably, the transgene encodes a therapeutic polypeptide useful for the treatment of an individual.
In the frame of the present invention, the individual may be a human or non-human animal. The individual is preferably a human. Alternatively, the individual can be a non-human animal, preferably a vertebrate and/or a mammalian animal such as e.g. a mouse, a rat, a rabbit, a Chinese hamster, a Guinea pig or a monkey. The cells and tissues according to the invention are preferably derived from such human or non-human animals.
Endonucleases According to the Invention that are Derived from I-CreI
The variant endonuclease according to the invention can for example be derived:
Therefore, the invention pertains to a dimeric I-CreI protein comprising or consisting of two monomers, each monomer comprising or consisting of a sequence at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO: 1 or to SEQ ID NO: 42, wherein said dimeric I-CreI protein is capable of cleaving a target sequence located within a safe harbor locus.
Preferably, the target sequence neither comprises nor consists of a sequence of SEQ ID NO: 4.
Most preferably, the dimeric I-CreI protein according to the invention is a heterodimeric protein.
By a protein having a sequence at least, for example, 95% “identical” to a query sequence of the present invention, it is intended that the sequence of the protein is identical to the query sequence except that the sequence may include up to five nucleotide mutations per each 100 amino acids of the query sequence. In other words, to obtain a protein having a sequence at least 95% identical to a query sequence, up to 5% (5 of 100) of the amino acids of the sequence may be inserted, deleted, or replaced with another nucleotide. The <<needle>> program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970 J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used. The needle program is for example available on the ebi.ac.uk world wide web site. The percentage of identity in accordance with the invention can thus be calculated using the EMBOSS::needle (global) program with a “Gap Open” parameter equal to 10.0, a “Gap Extend” parameter equal to 0.5, and a Blosum62 matrix.
Each monomer of the dimeric I-CreI protein according to the invention may for example comprise at least, at most or about 2, 5, 8, 10, 12, 15, 18, 20 or 25 mutations compared with the sequence of a wild-type monomer (SEQ ID NO: 1) or with a monomer of SEQ ID NO: 42. In other terms, the monomer according to the invention comprises a sequence that differs from SEQ ID NO: 1 or SEQ ID NO: 42 by at least, at most or about 2, 5, 8, 10, 12, 15, 18, 20, 25 or 30 mutations.
In the frame of the present invention, the mutation preferably corresponds to a substitution of one amino acid with another amino acid. Therefore, a preferred embodiment according to the invention is directed to a dimeric I-CreI protein comprising or consisting of two monomers comprising a sequence at least 80%, identical to SEQ ID NO: 1 or SEQ ID NO: 42, wherein said sequence only differs from SEQ ID NO: 1 or SEQ ID NO: 42 by the presence of amino acid substitutions.
The monomers of the dimeric I-CreI protein according to the invention are preferably derived from monomers comprising or consisting of the sequence of SEQ ID NO: 42.
The mutations are preferably located at positions of the I-CreI sequence that are involved in recognition of the target sequence. Indeed, introducing such mutations allow designing meganucleases with novel specificities.
In addition to such mutations, the monomers may also have mutations corresponding to:
In addition to the sequence homologous to SEQ ID NO: 1 or SEQ ID NO: 42, the monomers of the protein according to the invention may comprise one or more amino acids added at the NH2 terminus and/or COOH terminus of the sequence, such as a Tag useful in purification of the protein, a propeptide and/or a nuclear localization signal. In particular, the monomers of the protein according to the invention may comprise AAD amino acids added at the COOH terminus of the sequence of SEQ ID NO: 1, as is the case in a monomer of SEQ ID NO: 42.
In the present specification, the mutations are indicated by the position on SEQ ID NO: 1 followed by the nature of the amino acid replacing the amino acid located at this position in SEQ ID NO: 1. For example, a monomer comprising a 44A mutation refers to a I-CreI monomer in which the amino acid at position 44 of SEQ ID NO: 1 (i.e. a glutamine, Q) is replaced with an alanine (A). Thus this monomer differs from the wild-type I-CreI monomer of SEQ ID NO: 1 by at least the following amino acid substitution: Q44A. As explained hereabove, the I-CreI monomer of SEQ ID NO: 42 comprises some additional amino acid residues compared to the I-CreI monomer of SEQ ID NO: 1 (see
For the purpose of illustration, a monomer comprising 44A 54L 64A 70Q 75N 158R 162A mutations may for example have the sequence of SEQ ID NO: 57 (when this monomer is directly derived from a I-CreI monomer of SEQ ID NO: 1) or the sequence of SEQ ID NO: 58 (when this monomer is directly derived from a I-CreI monomer of SEQ ID NO: 42).
Examples of dimeric I-CreI proteins according to the invention, capable of cleaving target sequences located in the SH3, SH4 or SH6 locus, are further described below.
Dimeric I-CreI Protein According to the Invention Capable of Cleaving the SH3 Locus
In a preferred embodiment, the target sequence is located within the SH3 locus (defined hereabove). The target sequence located within SH3 may for example comprise or consist of SEQ ID NO: 2, or of nucleotides 2 to 23 of SEQ ID NO: 2. Example 1 discloses several examples of heterodimeric I-CreI proteins according to the invention capable of cleaving such a target sequence. In addition, methods for constructing other such proteins are well-known in the art and include e.g. those described in PCT applications WO 2006/097784, WO 2006/097853 and WO 2009019614, and in Arnould et al. (J. Mol. Biol., 2006, 355:443-458).
The monomers of such a dimeric protein preferably comprise at least one, preferably at least 3, 4, 5 or 6, amino acid substitutions located at a position selected from the group consisting of positions 4, 24, 26, 28, 30, 32, 33, 38, 44, 50, 54, 57, 64, 66, 70, 71, 75, 77, 81, 86, 92, 105, 142, 151, 154, 158 and 162 of SEQ ID NO: 1, preferably positions 4, 30, 38, 44, 50, 54, 57, 64, 66, 70, 71, 75, 77, 81, 86, 92, 105, 142, 151, 154, 158 and 162 of SEQ ID NO: 1. Said substitutions may for example be selected from the following substitutions: 4E, 30G, 38R, 44A, 50R, 54L, 57E, 64A, 66C, 70Q, 70D, 71 R, 75N, 75Y, 77V, 81T, 86D, 92R, 105A, 142R, 151A, 154G, 158R, 158W and 162A. The dimeric protein may optionally comprise a mutation at position 1, however, such a mutation has no influence on cleavage activity or on cleavage specificity.
Such dimeric I-CreI proteins may for example comprise or consist of:
In a specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
In another specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
In still another specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
The monomers of the dimeric I-CreI protein may also comprise additional mutations, for example allowing the obtention of an obligate heterodimer. Such mutations are known to the skilled in the art and include those described in Fajardo-Sanchez et al. (Nucleic Acids Res. 2008 36:2163-73).
In a specific embodiment, the above monomers are directly derived from a monomer of SEQ ID NO: 42, and differ from the sequence of SEQ ID NO: 42 only by the presence of the indicated mutations.
Dimeric I-CreI Protein According to the Invention Capable of Cleaving the SH4 Locus
In a preferred embodiment, the target sequence is located within the SH4 locus (defined hereabove). The target sequence located within SH4 may for example comprise or consist of SEQ ID NO: 3, or of nucleotides 2 to 23 of SEQ ID NO: 3. Example 2 discloses several examples of dimeric I-CreI proteins according to the invention capable of cleaving such a target sequence.
The monomers of such a dimeric protein preferably comprise at least one, preferably at least 3, 4, 5 or 6, amino acid substitutions located at a position selected from the group consisting of positions 24, 44, 68, 70, 75 and 77 of SEQ ID NO: 1. Said substitutions may for example be selected from the following substitutions: 24V, 44R, 44Y, 68Y, 68A, 70S, 70D, 75Y, 75N, 77R, 77N and 77V.
Such dimeric I-CreI proteins may for example comprise or consist of:
In a specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
The monomers of the dimeric I-CreI protein may also comprise additional mutations, for example allowing the obtention of an obligate heterodimer. Such mutations are known to the skilled in the art and include those described in Fajardo-Sanchez et al. (Nucleic Acids Res. 2008 36:2163-73).
In a specific embodiment, the above monomers are directly derived from a monomer of SEQ ID NO: 42, and differ from the sequence of SEQ ID NO: 42 only by the presence of the indicated mutations.
Dimeric I-CreI Protein According to the Invention Capable of Cleaving the SH6 Locus
In a preferred embodiment, the target sequence is located within the SH6 locus (defined hereabove). The target sequence located within SH6 may for example comprise or consist of SEQ ID NO: 59, or of nucleotides 2 to 23 of SEQ ID NO: 59. Example 5 discloses several examples of dimeric I-CreI proteins according to the invention capable of cleaving such a target sequence.
The monomers of such a dimeric protein preferably comprise at least one, preferably at least 3, 4, 5 or 6, amino acid substitutions located at a position selected from the group consisting of positions 7, 24, 27, 28, 34, 40, 44, 68, 70, 75, 77, 81, 85, 96, 99, 103, 108, 111, 121, 132, 144 and 160 of SEQ ID NO: 1. Said substitutions may for example be selected from the following substitutions: 7R, 24F, 27V, 28Q, 34R, 40R, 44A, 44K, 68T, 70L, 70G, 70S, 75N, 77V, 81T, 81V, 85R, 96R, 99R, 103T, 103S, 108V, 111H, 121E, 132V, 144S, 160R and 160E.
Such dimeric I-CreI proteins may for example comprise or consist of:
In a specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
In another specific embodiment, the dimeric I-CreI protein according the invention comprises or consists of:
The monomers of the dimeric I-CreI protein may also comprise additional mutations, for example allowing the obtention of an obligate heterodimer. Such mutations are known to the skilled in the art and include those described in Fajardo-Sanchez et al. (Nucleic Acids Res. 2008 36:2163-73).
In a specific embodiment, the above monomers are directly derived from a monomer of SEQ ID NO: 42, and differ from the sequence of SEQ ID NO: 42 only by the presence of the indicated mutations.
Fusion Proteins According to the Invention
Fusion proteins comprising the two monomers of a dimeric I-CreI protein fused together and retaining the biological activity of the parent dimeric I-CreI protein can be constructed (Grizot et al. NAR 2009 37:5405; Li et al. Nucleic Acids Res. 2009 37:1650-62; Epinat et al. Nucleic Acids Res. 2003 31:2952-62). Such fusion proteins are commonly referred to as “single-chain meganucleases”.
Therefore, the invention further relates to a fusion protein comprising the two monomers of the dimeric I-CreI protein as defined hereabove, or biologically active fragments of such monomers. In such a fusion protein, the first and second monomers of a dimeric I-CreI protein as defined hereabove are fused together and are optionally connected to each other by a linker such as a peptidic linker. The linker may for example comprise or consist of SEQ ID NO: 43 or SEQ ID NO: 326.
In the frame of the present invention, it is understood that such a fusion protein according to the invention is capable of cleaving a target sequence according to the invention, i.e., it is capable of cleaving the same target sequence as the dimeric I-CreI protein from which it is derived. The single chain meganuclease of the present invention further comprises obligate heterodimer mutations as described above so as to obtain single chain obligate heterodimer meganuclease variants.
In the first version of I-CreI single chain (Epinat et al. NAR 2003 3:2952-2962; WO 03/078619), the N-terminal monomer of the single-chain meganuclease consisted essentially of positions 1 to 93 of I-CreI amino acid sequence whereas the C-terminal (positions 8 to 163 of I-CreI amino acid sequence) was a nearly complete I-CreI monomer. More recently, a new way to design a single chain molecule derived from the I-CreI homodimeric meganuclease consisted in two nearly complete C-terminal and N-terminal I-CreI monomers (see, e.g. WO 2009/095793). This design greatly decreases off-site cleavage and toxicity while enhancing efficacy. The structure and stability of this single-chain molecule are very similar to those of the dimeric variants and this molecule appears to be monomeric in solution. In all respects, this single-chain molecule performs as well as I-SceI considered to be gold standard in terms of specificity. These properties place this new generation of meganucleases among the best molecular scissors available for genome surgery strategies and should facilitate gene correction therapy for monogenetic diseases, such as for example severe combined immunodeficiency (SCID), while potentially avoiding the deleterious effects of previous gene therapy approaches.
In addition to the mutations described hereabove, additional mutations may be introduced into the sequence of each of the two monomers of the fusion protein. For example, the C-terminal monomer may comprise the K7E and K96E mutations, and the N-terminal monomer may comprise the E8K, E61 R and G19S mutations.
Examples 1, 2 and 5 disclose several examples of such fusion proteins according to the invention.
In a specific embodiment, the fusion protein according to the invention comprises or consists of a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to any one of SEQ ID Nos. 25-40 and 76-96, or to a fragment of at least 50, 100, 150 or 200 amino acids thereof.
Nucleic Acids, Vectors and Combinations According to the Invention
When inserting a transgene into the genome of a cell, tissue or animal, the endonuclease according to the invention is preferably introduced to said cell, tissue or animal as a nucleic acid molecule rather than as a protein.
Therefore, the invention pertains to a nucleic acid encoding the endonuclease according to the invention, e.g. encoding a dimeric I-CreI protein or a fusion protein described hereabove. When the endonuclease is a dimeric I-CreI protein, said nucleic acid comprises at least two coding sequences, one for each monomer. When the endonuclease is a fusion protein, said nucleic acid comprises at least one coding sequence. The endonuclease protein can be combined with a variety of cell-penetrating peptide leading to a recombinant protein; such combined molecules are able to enter target cells at much higher levels of efficiency than the endonuclease alone. These cell-penetrating peptides were developed by Diatos S. A. (WO01/64738; WO05/016960; WO03/018636; WO05/018650; WO07/069,068). The applicant has previously shown that endonuclease cell-penetrating peptides combinations can enter target cells efficiently and that the internalized endonuclease can act upon the target cell genome so as to generate a DSB and in turn stimulate a homologous recombination event. The applicant has shown that the complex three dimensional structure of the endonuclease is not affected by the presence of the cell-penetrating peptide and that the all important specificity of the endonuclease also remains unaffected (data not shown).
Another aspect of the invention is a vector comprising such a nucleic acid according to the invention. By “vector” is meant a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
Vectors which can be used in the present invention includes but is not limited to viral vectors, plasmids and YACs, which may consist of chromosomal, non chromosomal, semisynthetic or synthetic nucleic acids. Preferred vectors are those capable of autonomous replication (episomal vector) and/or expression of nucleic acids to which they are linked (expression vectors). Large numbers of suitable vectors are known to those of skill in the art and commercially available.
In a preferred embodiment, the vector is a viral vector such as e.g. a vector derived from a retrovirus, an adenovirus, a parvovirus (e.g. an adeno-associated viruses), a coronavirus, a negative strand RNA virus (e.g. an orthomyxovirus such as influenza virus, a rhabdovirus such as rabies and vesicular stomatitis virus, a paramyxovirus such as measles and Sendai virus), a positive strand RNA virus such as picornavirus and alphavirus, or a double-stranded DNA virus such as adenovirus, herpesvirus (e.g. Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus) and poxvirus (e.g. vaccinia, fowlpox and canarypox). Preferred vectors include lentiviral vectors, and particularly self-inactivacting lentiviral vectors.
In addition to the sequence coding for the endonuclease according to the invention, the vector can also comprise elements such as:
In a preferred embodiment, said vector is an “expression vector”, i.e. a vector in which at least one coding sequence is operatively linked to transcriptional and translational control elements. In the frame of this embodiment, the nucleic acid encoding the endonuclease according to the invention (e.g. encoding the dimeric I-CreI protein or the fusion protein described hereabove) is operatively linked to transcriptional and translational control elements.
In a preferred embodiment, the vector according to the invention comprises a targeting construct comprising a transgene and two sequences homologous to the genomic sequence flanking the target sequence as defined herein (e.g. the target sequence of SEQ ID NO: 2 or 3). The genomic sequences flanking the target sequence are preferably immediately adjacent to the target site.
Such targeting constructs are well-known to the skilled in the art. For insertion of a transgene, such constructs typically comprise a first sequence that is homologous to the upstream (5′) genomic sequence flanking the target sequence, the transgene to be inserted, and a second fragment that is homologous to the downstream (3′) genomic sequence flanking the target sequence.
By “homologous” is intended a sequence with enough identity to another one to lead to a homologous recombination between sequences, more particularly having at least 95% identity, preferably 97% identity and more preferably 99% identity to each other.
Preferably, homologous sequences of at least 50 bp, preferably more than 100 bp and more preferably more than 200 bp are used. Therefore, the targeting DNA construct is preferably from 200 pb to 6000 pb, more preferably from 1000 pb to 2000 pb. Indeed, shared DNA homologies are located in regions flanking upstream and downstream the site of the break and the DNA sequence to be introduced should be located between the two arms.
The targeting construct may also comprise a positive selection marker between the two homology arms and eventually a negative selection marker upstream of the first homology arm or downstream of the second homology arm. The marker(s) allow(s) the selection of cells having inserted the sequence of interest by homologous recombination at the target site.
Methods for constructing targeting constructs suitable for inserting a transgene into the SH3 or SH4 locus are given in Example 4.
The nucleic acid encoding the endonuclease according to the invention and the targeting construct can also be located on two separate vectors. Therefore, the invention also pertains to a combination of two vectors, namely:
Pharmaceutical Uses According to the Invention
The vectors and combinations described hereabove can for example be used as a medicament. In particular, these vectors and combinations can be used in gene therapy.
Therefore, the invention relates to a vector or combination according to the invention for use as a medicament. In such vectors and combinations, the transgene encodes a therapeutic polypeptide.
In particular, diseases that may be treated by gene therapy using the vectors and combinations according to the invention include but are not limited to X-SCID, SCID, epidermolysis bullosa, leber amaurosis, hemophilia, thalassemia, fanconi anemia and muscular dystrophy.
In these diseases, the transgene encodes the following therapeutic polypeptides, respectively: IL2RG, GI7A1, Rp 65, Blood factors VIII and IX, haemoglobin A and B, Fanc-A, Fanc-C (or other Fanconi Anemia related genes), Dystrophine.
The invention further relates to a pharmaceutical composition comprising the vectors and combinations according to the invention and a pharmaceutically active carrier.
The invention also relates to a method of treating an individual by gene therapy comprising administering an effective amount of a vector or combination according to the invention to an individual in need thereof.
By “effective amount” is meant an amount sufficient to achieve insertion of the transgene into the genome of the individual to be treated. Such concentrations can be routinely determined by those of skilled in the art.
By “subject in need thereof” is meant an individual suffering from or susceptible of suffering from a genetic disease that can be treated or prevented by insertion of the transgene. The individuals to be treated in the frame of the invention are preferably human beings.
Non Pharmaceutical Uses According to the Invention
The vectors and combinations described hereabove not only find use in gene therapy but also in non pharmaceutical uses such as, e.g., production of animal models and production of recombinant cell lines expressing a protein of interest.
Therefore, the invention relates to:
In a preferred embodiment, the above use or method aims at inserting a transgene encoding a protein of interest into the genome of a cell order to obtain a recombinant cell line for protein production. Suitable cells for constructing recombinant cell lines for protein production include but are not limited to human (e.g. PER.C6 or HEK), Chinese Ovary hamster (CHO) and mouse (NSE0) cells.
In another preferred embodiment, the above use aims at making a non-human animal model of a hereditary disorder.
The invention is also directed to a non-human transgenic animal comprising a nucleic acid, an expression vector or a combination according to the invention in its genome.
All references cited herein, including journal articles or abstracts, published patent applications, issued patents or any other references, are entirely incorporated by reference herein, including all data, tables, figures and text presented in the cited references.
The invention will be further evaluated in view of the following examples and figures.
SEQ ID NO: 1 shows the amino acid sequence of a wild-type I-CreI monomer.
SEQ ID NO: 2 shows the sequence of a target sequence according to the invention that is located within the SH3 locus.
SEQ ID NO: 3 shows the sequence of a target sequence according to the invention that is located within the SH4 locus.
SEQ ID NO: 4 shows the sequence of the target sequence of the wild-type I-CreI homodimeric protein.
SEQ ID Nos. 5 to 10 represent sequences shown on
SEQ ID Nos. 11 to 15 represent oligonucleotides, primers and linkers used in Example 1.
SEQ ID Nos. 16 to 19 represent sequences shown on
SEQ ID Nos. 20 to 24 represent oligonucleotides, primers and linkers used in Example 2.
SEQ ID Nos. 25 to 32 represent the single-chain meganucleases constructed in Example 1, referred to as SCOH-SH3-b56-A, SCOH-SH3-b56-B, SCOH-SH3-b56-C, SCOH-SH3-b56-D, SCOH-SH3-b1-A, SCOH-SH3-b1-B, SCOH-SH3-b1-C and SCOH-SH3-b1-D respectively.
SEQ ID Nos. 33 to 40 represent the single-chain meganucleases constructed in Example 2, referred to as SCOH-SH4-b56-A, SCOH-SH4-b56-B, SCOH-SH4-b56-C, SCOH-SH4-b56-D, SCOH-SH4-b1-A, SCOH-SH4-b1-B, SCOH-SH4-b1-C and SCOH-SH4-b1-D respectively.
SEQ ID NO: 41 represents the positive control SCOH-RAG.
SEQ ID NO: 42 shows the amino acid sequence of a I-CreI monomer with an additional alanine at position 2, and with three additional residues after the final proline.
SEQ ID NO: 43 shows the amino acid sequence of the RM2 linker.
SEQ ID Nos. 44 to 49 represent oligonucleotides, primers and linkers used in Example 3.
SEQ ID Nos. 50 to 53 represent oligonucleotides, primers and linkers used in Example 4.
SEQ ID Nos. 54 to 55 show sequences comprised in the SH3, SH4 and SH6 loci, respectively.
SEQ ID NO: 57 shows a monomer derived from a monomer of SEQ ID NO: 1 that comprises 44A 54L 64A 70Q 75N 158R 162A mutations.
SEQ ID NO: 58 shows a monomer derived from a monomer of SEQ ID NO: 42 that comprises 44A 54L 64A 70Q 75N 158R 162A mutations.
SEQ ID NO: 59 shows the sequence of a target sequence according to the invention that is located within the SH6 locus.
SEQ ID Nos. 60 to 64 represent sequences shown on
SEQ ID Nos. 65 to 75 represent oligonucleotides, primers and linkers used in Example 5.
SEQ ID Nos. 76 to 85 represent the single-chain meganucleases constructed in Example 5, referred to as SCOH-SH6-b1-B, SCOH-SH6-b1-C, SCOH-SH6-b1-C, QCSH61-A01, QCSH61-E01, QCSH61-H0, QCSH62-A02, QCSH61-H01b, QCSH61-H01c and QCSH61-H01d respectively.
SEQ ID Nos. 86 to 96 represent the single-chain meganucleases capable of cleaving the SH7 locus (SEQ ID Nos. 86 and 87), SH8 locus (SEQ ID NO: 88), the SH12 locus (SEQ ID NO: 89), the SH13 locus (SEQ ID NO: 90), the SH19 locus (SEQ ID NO: 91), the SH20 locus (SEQ ID NO: 92), the SH21 locus (SEQ ID Nos. 93 to 95) and the SH33 locus (SEQ ID NO: 96).
SEQ ID Nos. 97 to 104 represent sequences comprised within the SH12, SH13, SH19, SH20, SH21, SH33, SH7 and SH8 loci, respectively.
SEQ ID Nos. 105 to 325 represent sequences disclosed in Examples 6 to 9 and/or in any one of Tables A′, A″, E, G and H.
SEQ ID NO: 326 shows the amino acid sequence of the BQY linker.
In the following examples, all the I-CreI variants were constructed by genetic engineering of I-CreI monomers of SEQ ID NO: 42.
SH3 is a locus comprising a 24 bp non-palindromic target (SEQ ID NO: 2) that is present on chromosome 6. As shown in Table A, SH3 is located in the vicinity of a RIS disclosed in Deichmann et al. (J. of Clin. Invest. 2007 117:2225). The SH3 sequence is not included in any of the CIS described in Deichmann et al.
I-CreI heterodimers capable of cleaving a target sequence of SEQ ID NO: 2 were identified using methods derived from those described in Chames et al. (Nucleic Acids Res., 2005, 33, e178), Arnould et al. (J. Mol. Biol., 2006, 355, 443-458), Smith et al. (Nucleic Acids Res., 2006, 34, e149), Arnould et al. (Arnould et al. J Mol. Biol. 2007 371:49-65). Some of these heterodimers were then cloned into mammalian expression vectors for assessing SH3 cleavage in CHO cells. These results were then utilized to design single-chain meganucleases directed against the target sequence of SEQ ID NO: 2. These single-chain meganucleases were cloned into mammalian expression vectors and tested for SH3 cleavage in CHO cells. Strong cleavage activity of the SH3 target could be observed for these single chain molecules in mammalian cells.
Example 1.1. Identification of Meganucleases Cleaving SH3
I-CreI variants potentially cleaving the SH3 target sequence in heterodimeric form were constructed by genetic engineering. Pairs of such variants were then co-expressed in yeast. Upon co-expression, one obtains three molecular species, namely two homodimers and one heterodimer. It was then determined whether the heterodimers were capable of cutting the SH3 target sequence of SEQ ID NO: 2.
a) Construction of Variants of the I-CreI Meganuclease Cleaving Palindromic Sequences Derived from the SH3 Target Sequence
The SH3 sequence is partially a combination of the 10AAT_P (SEQ ID NO: 5), 5AAG_P (SEQ ID NO: 6), 10AGG_P (SEQ ID NO: 7) and 5TTT_P (SEQ ID NO: 8) target sequences which are shown on
Two palindromic targets, SH3.3 and SH3.4, were derived from SH3 (
b) Construction of Target Vector
An oligonucleotide of SEQ ID NO: 11, corresponding to the SH3 target sequence flanked by gateway cloning sequences, was ordered from PROLIGO. This oligo has the following sequence: TGGCATACAAGTTTCCAATACAAGGTACAAAGTCCTGACAATCGTCTGTCA). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned into the pCLS1055 yeast reporter vector using the Gateway protocol (INVITROGEN).
Yeast reporter vector was transformed into the FYBL2-7B Saccharomyces cerevisiae strain having the following genotype: MAT a, ura3Δ851, trp1Δ63, leu2Δ1, lys2A202. The resulting strain corresponds to a reporter strain (MilleGen).
c) Co-Expression of Variants
The open reading frames coding for the variants cleaving the SH3.4 or the SH3.3 sequence were cloned in the pCLS542 expression vector and in the pCLS1107 expression vector, respectively. Yeast DNA from these variants was extracted using standard protocols and was used to transform E. coli. The resulting plasmids were then used to co-transform yeast. Transformants were selected on synthetic medium lacking leucine and containing G418.
d) Mating of Meganucleases Coexpressing Clones and Screening in Yeast
Mating was performed using a colony gridder (QpixII, Genetix). Variants were gridded on nylon filters covering YPD plates, using a low gridding density (4-6 spots/cm2). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30° C. for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (2%) as a carbon source, and incubated for five days at 37° C., to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7 mM β-mercaptoethanol, 1% agarose, and incubated at 37° C., to monitor β-galactosidase activity. Results were analyzed by scanning and quantification was performed using an appropriate software.
e) Results
Co-expression of different variants resulted in cleavage of the SH3 target in 58 tested combinations. Functional combinations are summarized in Table I herebelow. In this table, “+” indicates a functional combination on the SH3 target sequence, i.e., the heterodimer is capable of cleaving the SH3 target sequence.
In conclusion, several heterodimeric I-CreI variants, capable of cleaving the SH3 target sequence in yeast, were identified.
Example 1.2. Validation of SH3 Target Cleavage in an Extrachromosomal Model in CHO Cells
I-CreI variants able to efficiently cleave the SH3 target in yeast when forming heterodimers are described hereabove in example 1.1. In order to identify heterodimers displaying maximal cleavage activity for the SH3 target in CHO cells, the efficiency of some of these variants was compared using an extrachromosomal assay in CHO cells. The screen in CHO cells is a single-strand annealing (SSA) based assay where cleavage of the target by the meganucleases induces homologous recombination and expression of a LagoZ reporter gene (a derivative of the bacterial lacZ gene).
a) Cloning of SH3 Target in a Vector for CHO Screen
An oligonucleotide corresponding to the SH3 target sequence flanked by gateway cloning sequences, was ordered from PROLIGO (SEQ ID NO: 12; TGGCATACAAGTTTCCAATACAAGGTACAAAGTCCTGACAATCGTCTGTCA). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into the pCLS1058 CHO reporter vector. Cloned target was verified by sequencing (MILLEGEN).
b) Re-Cloning of Meganucleases
The open-reading frames coding for these variants identified in Table I hereabove sub-cloned into the pCLS2437 expression vector. ORFs were amplified by PCR on yeast DNA using primers of SEQ ID Nos. 13 and 14 (5′-AAAAAGCAGGCTGGCGCGCCTACACAGCGGCCTTGCCACCATG-3′ and 5′-AGAAAGCTGGGTGCTAGCGCTCGAGTTATCAGTCGG-3′). PCR products were cloned in the CHO expression vector pCLS2437 using the AscI and XhoI restriction enzymes for internal fragment replacement. Selected clones resulting from ligation and E. coli transformation steps were verified by sequencing (MILLEGEN).
c) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected with Polyfect® transfection reagent according to the supplier's protocol (QIAGEN). 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for β-galactosidase liquid assay was added (typically 1 liter of buffer contained 100 ml of lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM, Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors), 10 ml of Mg 100× buffer (MgCl2 100 mM, β-mercaptoethanol 35%), 110 ml ONPG 8 mg/ml and 780 ml of sodium phosphate 0.1M pH7.5). After incubation at 37° C., OD was measured at 420 nm. The entire process was performed on an automated Velocity11 BioCel platform.
Per assay, 150 ng of target vector was cotransfected with 12.5 ng of each one of both variants.
d) Results
The four following variants described in Table I were re-cloned into pCLS2437:
These I-CreI variants were assayed together as heterodimers against the SH3 target in the CHO extrachromosomal assay.
Table II shows the functional combinations obtained for nine heterodimers.
Analysis of the efficiencies of cleavage and recombination of the SH3 sequence demonstrates that all of the four tested combinations of I-CreI variants were capable to transpose their cleavage activity from yeast to CHO cells without additional mutation.
Example 1.3. Covalent Assembly as Single Chain and Improvement of Meganucleases Cleaving SH3
Co-expression of the variants identified in example 1.1. leads to a high cleavage activity of the SH3 target in yeast. Some of the heterodimers have been validated for SH3 cleavage in a mammalian expression system (example 1.2.). One of them, shown in Table III, was selected for further optimization.
The MA×M1 SH3 heterodimer gives high cleavage activity in yeast. SH3.3-MA is a SH3.3 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 44A 54L 70Q 75Y 92R 158R 162A. SH3.4-M1 is a SH3.4 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 30G 38R 70D 75N 86D.
Single chain constructs were engineered using the linker RM2 of SEQ ID NO: 15 (AAGGSDKYNQALSKYNQALSKYNQALSGGGGS), thus resulting in the production of the single chain molecule: MA-linkerRM2-M1. During this design step, the G195 mutation was introduced in the C-terminal M1 variant. In addition, mutations K7E, K96E were introduced into the MA variant and mutations E8K, E61 R into the M1 variant to create the single chain molecule: MA (K7E K96E)-linkerRM2-M1 (E8K E61R G195) that is further called SCOH-SH3-b1 scaffold. Some additional amino-acid substitutions have been found in previous studies to enhance the activity of I-CreI derivatives: the replacement of Isoleucine 132 with Valine (I132V) is one of them. The I132V mutation was introduced into either one, both or none of the coding sequence of N-terminal and C-terminal protein fragments.
The same strategy was applied to a second scaffold, termed SCOH-SH3-b56 scaffold, based on the best variants cleaving SH3.3 (44A 54L 70Q 75Y 92R 158R 162A) and SH3.4 (30G 38R, 50R 70D 75N 142R) as homodimers, respectively.
The resulting proteins are shown in Table IV below. All the single chain molecules were assayed in CHO for cleavage of the SH3 target.
a) Cloning of the Single Chain Molecule
A series of synthetic gene assembly was ordered to MWG-EUROFINS. Synthetic genes coding for the different single chain variants targeting SH3 were cloned in pCLS1853 using AscI and XhoI restriction sites.
b) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected as described in example 1.2. 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for 1-galactosidase liquid assay was added. After incubation at 37° C., OD was measured at 420 nm. The entire process is performed on an automated Velocity11 BioCel platform. Per assay, 150 ng of target vector was cotransfected with an increasing quantity of variant DNA from 3.12 to 25 ng (25 ng of single chain DNA corresponding to 12.5 ng+12.5 ng of heterodimer DNA). Finally, the transfected DNA variant DNA quantity was 3.12 ng, 6.25 ng, 12.5 ng and 25 ng. The total amount of transfected DNA was completed to 175 ng (target DNA, variant DNA, carrier DNA) using an empty vector (pCLS0002).
d) Results
The activity of the single chain molecules against the SH3 target was monitored using the previously described CHO assay along with our internal control SCOH-RAG and I-Sce I meganucleases. All comparisons were done at 3.12 ng, 6.25 ng, 12.5 ng, and 25 ng transfected variant DNA (
Variants shared specific behaviour upon assayed dose depending on the mutation profile they bear (
All of the variants described are active and can be used for inserting transgenes into the SH3 locus.
SH4 is a locus that is present on chromosome 7. The SH4 locus comprises a 24 bp non-palindromic sequence of SEQ ID NO: 3. As shown in Table A, SH4 is located in the vicinity a RIS disclosed in Schwarzwaelder et al. (J. Clin. Invest. 2007 117:2241). The SH4 sequence is not included in any of the CIS described in Deichman et al.
Experiments similar to those described hereabove in Example 1 were carried out to identify I-CreI heterodimers and single-chain meganucleases capable of cleaving a target sequence of SEQ ID NO: 3.
Example 2.1. Identification of Meganucleases Cleaving SH4
I-CreI variants potentially cleaving the SH4 target sequence in heterodimeric form were constructed by genetic engineering. Pairs of such variants were then co-expressed in yeast. Upon co-expression, one obtains three molecular species, namely two homodimers and one heterodimer. It was then determined whether the heterodimers were capable of cutting the SH4 target sequence of SEQ ID NO: 3.
a) Construction of Variants of the I-CreI Meganuclease Cleaving Palindromic Sequences Derived from the SH4 Target Sequence
The SH4 sequence is partially a combination of the 10AAA_P (SEQ ID NO: 4), 5ACT_P (SEQ ID NO: 16), 10AAA_P (SEQ ID NO: 4), 5GGT_P (SEQ ID NO: 17) targets shown on
The screening procedure was performed using methods derived from those described in Chames et al. (Nucleic Acids Res., 2005, 33, e178), Arnould et al. (J. Mol. Biol., 2006, 355, 443-458), Smith et al. (Nucleic Acids Res., 2006, 34, e149) and Arnould et al. (Arnould et al. J Mol Biol. 2007 371:49-65) on the two following palindromic sequences: the SH4.3 sequence of SEQ ID NO: 18 and the SH4.4 sequence of SEQ ID NO: 19.
b) Construction of Target Vector
The experimental procedure is as described in Example 1.1, with the exception that an oligonucleotide corresponding to the SH4 target sequence of SEQ ID NO: 20 (5′-TGGCATACAAGTTTTTAAAACACTGTACACCATTTTGACAATCGTCTGTCA-3′) was used.
c) Co-Expression of Variants
Yeast DNA from variants cleaving the SH4.3 and SH4.4 target in the pCLS542 and pCLS1107 expression vectors was extracted using standard protocols and was used to transform E. coli. The resulting plasmid DNA was then used to co-transform yeast strain. Transformants were selected on synthetic medium lacking leucine and containing G418.
d) Mating of Meganucleases Coexpressing Clones and Screening in Yeast
Mating was performed using a colony gridder (QpixII, Genetix). Variants were gridded on nylon filters covering YPD plates, using a low gridding density (4-6 spots/cm2). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30° C. for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (2%) as a carbon source, and incubated for five days at 37° C., to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7 mM β-mercaptoethanol, 1% agarose, and incubated at 37° C., to monitor β-galactosidase activity. Results were analyzed by scanning and quantification was performed using appropriate software.
e) Results
Co-expression of variants cleaving the SH4.3 target and of variants cleaving the SH4.4 target resulted in cleavage of the SH4 target in 6 cases. Functional combinations are summarized in Table V.
Example 2.2. Validation of SH4 Target Cleavage in an Extrachromosomal Model in CHO Cells
In order to identify heterodimers displaying maximal cleavage activity for the SH4 target in CHO cells, the efficiency of several combinations of variants to cut the SH4 target was assessed using an extrachromosomal assay in CHO cells. The screen in CHO cells is a single-strand annealing (SSA) based assay where cleavage of the target by the meganucleases induces homologous recombination and expression of a LagoZ reporter gene (a derivative of the bacterial lacZ gene).
a) Cloning of SH4 Target in a Vector for CHO Screen
The target was cloned as follows. An oligonucleotide of SEQ ID NO: 21, corresponding to the SH4 target sequence flanked by gateway cloning sequence, was ordered from PROLIGO (5′-TGGCATACAAGTTTTTAAAACACTGTACACCATTTTGACAATCGTCTGTCA-3′). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into CHO reporter vector (pCLS1058). The cloned fragment was verified by sequencing (MILLEGEN).
b) Re-Cloning of Meganucleases
The ORFs of I-CreI variants cleaving the SH4.5 and SH4.6 targets obtained hereabove were sub-cloned in pCLS2437. ORFs were amplified by PCR on yeast DNA using primers of SEQ ID NO: 22 and 23 (5′-AAAAAGCAGGCTGGCGCGCCTACACAGCGGCCTTGCCACCATG-3′ and 5′-AGAAAGCTGGGTGCTAGCGCTCGAGTTATCAGTCGG-3′) primers. PCR products were cloned in the CHO expression vector pCLS2437 using the AscI and NheI restrictions sites for internal fragment replacement. Selected clones resulting from ligation and E. coli transformation steps were verified by sequencing (MILLEGEN).
c) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected with Polyfect® transfection reagent according to the supplier's protocol (QIAGEN). 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for β-galactosidase liquid assay was added (typically 1 liter of buffer contained: 100 ml of lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM, Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors), 10 ml of Mg 100× buffer (MgCl2 100 mM, β-mercaptoethanol 35%), 110 ml ONPG 8 mg/ml and 780 ml of sodium phosphate 0.1M pH7.5). After incubation at 37° C., OD was measured at 420 nm. The entire process is performed on an automated Velocity11 BioCel platform. Per assay, 150 ng of target vector was cotransfected with 12.5 ng of each one of both variants (12.5 ng of variant cleaving palindromic SH4.3 target and 12.5 ng of variant cleaving palindromic SH4.4 target).
d Results
The four variants shown in Table VI and described herebaove in Example 2.1, were selected for further analysis.
These variants were cloned in pCLS2437. Then, I-CreI variants cleaving the SH4.3 or SH4.4 targets were assayed together as heterodimers against the SH4 target in the CHO extrachromosomal assay. Analysis of the efficiencies of cleavage and recombination of the SH4 sequence demonstrates that all tested combinations of I-CreI variants were able to transpose their cleavage activity from yeast to CHO cells without additional mutation (Table VII).
Example 2.3. Covalent Assembly as Single Chain and Improvement of Meganucleases Cleaving SH4 by Site-Directed Mutagenesis
Co-expression of the variants described in Example 2.1. leads to a high cleavage activity of the SH4 target in yeast. In addition, some of them have been validated for SH4 cleavage in a mammalian expression system (Example 2.2.).
The MA×M2 SH4 heterodimer gives high cleavage activity in yeast. SH4.3-MA is a SH4.3 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 24V 44R 68Y 70S 75Y 77N. SH4.4-M2 is a SH4.4 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 24V 44Y 70S 77V.
As described in example 1.3, single chain constructs were engineered using the linker RM2, thereby resulting in the production of a single chain molecule referred to as MA-LinkerRM2-M2. During this design step, the G19S mutation was introduced in the C-terminal M2 mutant. In addition, K7E and K96E mutations were introduced into the MA mutant, and E8K and E61R mutations into the M2 mutant in order to create a single chain molecule referred to as MA (K7E K96E)-linkerRM2-M2 (E8K E61R G19S) that is called further SCOH-SH4-b1 scaffold.
The Isoleucine 132 to Valine (I132V) mutation was introduced into the coding sequence of either, one, none or both N-terminal and C-terminal protein fragment.
The same strategy was applied to a second scaffold based on the good cutters on SH4.3 (44R 68Y 70S 75Y 77N) and SH4.4 (24V 44Y 70S 77V). This scaffold is further referred to as SCOH-SH4-b56 scaffold.
The design of the derived single chain constructs is shown in Table VIII. The single chain constructs were tested in CHO for their ability to induce cleavage of the SH4 target.
a) Cloning of the Single Chain Molecule
A series of synthetic gene assembly was performed to MWG-EUROFINS. Synthetic genes, coding for the different single chain variants targeting SH4, were cloned in pCLS1853 using AscI and XhoI restriction sites.
b) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected as described hereabove. 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for β-galactosidase liquid assay was added. After incubation at 37° C., OD was measured at 420 nm. The entire process is performed on an automated Velocity11 BioCel platform. Per assay, 150 ng of target vector was cotransfected with an increasing quantity of variant DNA from 3.12 to 25 ng (25 ng of single chain DNA corresponding to 12.5 ng+12.5 ng of heterodimer DNA). Finally, the transfected DNA variant DNA quantity was 3.12 ng, 6.25 ng, 12.5 ng and 25 ng. The total amount of transfected DNA was completed to 175 ng (target DNA, variant DNA, carrier DNA) using an empty vector (pCLS0002).
c) Results
The single chain molecules described in Table VIII were monitored for their activity against the SH4 target using the previously described CHO assay by comparison to our internal control SCOH-RAG and I-Sce I meganucleases. All activity evaluation was done upon DNA transfected dose of 3.12 ng, 6.25 ng, 12.5 ng, and 25 ng. All single chain molecules were displaying activity on SH4 target as reported in Table VIII.
Variants shared specific behaviour upon assayed dose depending on the mutation profile they bear (
All of these variants are active at different levels of intensity and can thus be used for SH4 genome targeting.
I-CreI variants able to efficiently cleave the SH3 and SH4 targets in yeast and in mammalian cells (CHO K1 cells) have been identified in Examples 1 and 2. The efficiency of the SH3 and SH4 meganucleases to cleave their endogenous DNA target sequences was next tested. This example will demonstrate that meganucleases engineered to cleave the SH3 and SH4 target sequences cleave their cognate endogenous sites in human cells.
Repair of double-strand break by non homologous end-joining (NHEJ) can generate small deletions and insertions (InDel) (
Example 3.1: Detection of Induced Mutagenesis at the Endogenous Site
The assays based on cleavage-induced recombination in mammal or yeast cells, which are used for screening variants with altered specificity, are described in International PCT Application WO 2004/067736; Epinat et al., Nucleic Acids Res., 2003, 31:2952-2962; Chames et al., Nucleic Acids Res., 2005, 33:e178, and Arnould et al., J. Mol. Biol., 2006, 355:443-458. These assays result in a functional LacZ reporter gene which can be monitored by standard methods.
Single Chain I-CreI variants for SH3 and SH4 cloned in the pCLS1853 plasmid were used for this experiment. The day previous experiment, cells from the human embryonic kidney cell line, 293-H (Invitrogen) were seeded in a 10 cm dish at density of 1.2 106 cells/dish. The following day, cells were transfected with 3 μg of an empty plasmid or a meganuclease-expressing plasmid using lipofectamine (Invitrogen). 72 hours after transfection, cells were collected and diluted (dilution 1/20) in fresh culture medium. After 7 days of culture, cells were collected and genomic DNA extracted.
200 ng of genomic DNA were used to amplify the endogenous locus surrounding the meganuclease cleavage site by PCR amplification. A 377 bp fragment corresponding to the SH3 locus was amplified using specific PCR primers A (SEQ ID NO 44; 5′-tgggggtcttactctgtttccc-3′) and B (SEQ ID NO 45; 5′-aggagagtccttctttggcc-3′). A 396 bp fragment corresponding to the SH4 locus was amplified using PCR primers C (SEQ ID NO 46; 5′-gagtgatagcataatgaaaacc-3′) and D (SEQ ID NO 47; 5′-ctcaccataagtcaactgtctc-3′). PCR amplification was performed to obtain a fragment flanked by specific adaptator sequences (SEQ ID NO 48; 5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′ and SEQ ID NO: 49 5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3′) provided by the company offering sequencing service (GATC Biotech AG, Germany) on the 454 sequencing system (454 Life Sciences). An average of 18,000 sequences was obtained from pools of 2 amplicons (500 ng each). After sequencing, different samples were identified based on barcode sequences introduced in the first of the above adaptators. Sequences were then analyzed for the presence of insertions or deletions in the cleavage site of SH3 or SH4 respectively.
Example 3.2: Results
The analysis of the genomic DNA extracted from cells transfected with the meganuclease targeting the SH3 locus showed that 56 out of the 12841 analyzed sequences (0.44%) contained InDel events within the recognition site of SH3. Similarly, after transfection with the meganuclease targeting the SH4 locus, 18 out of the 8259 analyzed sequences (0.22%) contained InDel events within the recognition site of SH4.
Since small deletions or insertions could be related to PCR or sequencing artefacts, the same loci were analyzed after transfection with a plasmid that does not express the meganuclease. The analysis of the SH3 and SH4 loci revealed that virtually no InDel events could be detected. Indeed, only 0.05% (1/2153) and 0.02% (3/12811) of the analyzed sequences contained mutations.
Moreover, the analysis of the size of the DNA insertion or deletion sequences (
These data demonstrate that the meganucleases engineered to target respectively the SH3 or SH4 loci are active in human cells and can cleave their cognate endogenous sequence. Moreover, it shows that meganucleases have the ability to generate small InDel events within a sequence which would disrupt a gene ORF and thus inactivate the corresponding gene expression product.
To validate the cleavage activity of engineered single-chain SH3 and SH4 meganucleases, their ability to stimulate homologous recombination at the endogenous human SH3 and SH4 loci was next evaluated. Cells were transfected with mammalian expression plasmids for single chain molecules SCOH-SH3-b1-C or SCOH-SH4-b1-C and a vector comprising a targeting construct. The vector comprising a targeting construct (also referred to as “donor repair plasmid”) was the pCLS3777 or pCLS3778 plasmid containing a 2.8 kb sequence consisting of an exogenous DNA sequence, flanked by two sequences homologous to the human SH3 or SH4 loci. The sequences homologous to the human SH3 or SH4 loci had a length of 1.5 kb. Cleavage of the native SH3 or SH4 loci by the meganuclease yields a substrate for homologous recombination, which may use the donor repair plasmid as a repair matrix. Thus, the frequency with which targeted integration occurs at the SH3 or SH4 loci is indicative of the cleavage efficiency of the genomic SH3 or SH4 target site.
Example 4.1: Material and Methods
a) Meganuclease Expression Plasmids
The meganucleases used in this example are SCOH-SH3-b1-C and SCOH-SH4-b1-C cloned in a mammalian expression vector, resulting in plasmid pCLS2697 and pCLS2705, respectively.
b) Donor Repair Plasmids
For SH3 gene targeting experiments, the donor plasmid contained:
For both SH3 and SH4, the left and right homology arms were inserted upstream (using an AscI site) and downstream (using a SbfI site), respectively, of an exogenous 2.8 kb DNA fragment containing two CMV promoters and a neomycin resistance gene. The resulting plasmids are referred to as pCLS3777 (for SH3) and pCLS3778 (for SH4).
c) Sh3 and Sh4 Gene Targeting Experiments
Human embryonic kidney 293H cells (Invitrogen) were plated at a density of 1×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone) (0.25 μg/ml) (Invitrogen-Life Science) and 10% FBS). The next day, cells were transfected with Lipofectamine 2000 transfection reagent (Invitrogen) according to the supplier's protocol. Briefly, 2 μg of the donor plasmid was co-transfected with 3 μg of single-chain meganuclease expression vectors. After 72 hours of incubation at 37° C., cells were trypsinized and plated in complete medium at 10 or 100 cells per well in 96-well plates.
Once cells were 80 to 100% confluent, genomic DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier's protocol.
d) PCR Analysis of Gene Targeting Events
The gene targeting frequency was determined by PCR on genomic DNA using the following primers: 5′-CTGTGTGCTATGATCTTGCC-3′ (SH3 GHGF4; SEQ ID NO: 50) and 5′-CCTGTCTCTTGATCAGATCC-3′ (NeoR2; SEQ ID NO: 51) for SH3, and 5′-GTGGCCTCTCAGTCTGTTTA-3′ (SH4 GHGF2; SEQ ID NO: 52) and 5′-AGTCATAGCCGAATAGCCTC-3′ (NeoR5; SEQ ID NO: 53) for SH4. The PCRs result in a 2500 bp (SH3) or a 2268 bp (SH4) gene targeting specific PCR product. The SH3 GHGF4 and SH4 GHGF2 primers are forward primers located upstream of the left homology arms of the donor repair plasmids. The NeoR primers are reverse primers located in the exogenous DNA inserted between the two homology arms of the donor repair plasmid.
Example 4.2: Results
Human embryonic kidney 293H cells were co-transfected with a plasmid expressing one of the two single-chain SH3 or SH4 meganucleases and the donor repair plasmid pCLS3777 or pCLS3778. As a control for spontaneous recombination, 293H cells were also transfected with the donor repair plasmid alone. The cells were then plated at 10 or 100 cells per well in 96-well microplates. Genomic DNA derived from these cells was analyzed for gene targeting by PCR as described in Material and Methods.
In the absence of meganuclease (repair plasmid alone), no PCR positive signal was detected among the 22560 and 18800 cells (for SH3 and SH4, respectively) that were analyzed in pools of 10 or 100 cells.
In contrast to this, in the presence of the SH3 meganuclease, 12 positive clones were detected among the 18800 cells analyzed in pools of 100 cells, thereby indicating a frequency of recombination of 0.064%. In the presence of the SH4 meganuclease, 11 positives were detected among the 3760 cells analyzed in pools of 10 cells indicating a frequency of recombination of 0.29%. The results are presented in Table X below. The recombination frequencies indicated here are underestimated because not all plated cells start dividing again. Estimate survival upon plating can thus be estimated to be about 33%. Therefore, frequencies of recombination are probably underestimated by a 3-fold factor.
These results demonstrate that the two single chain molecules SCOH-SH3-b1-C and SCOH-SH4-b1-C are capable of inducing high levels of gene targeting at the endogenous SH3 and SH4 locus, respectively.
SH6 is a locus comprising a 24 bp non-palindromic target (TTAATACCCCGTACCTAATATTGC, SEQ ID NO: 59) that is present on chromosome 21. SH6 is located in the vicinity of a RIS disclosed in Schwarzwaelder et al. (J Clin Invest 2007:2241-9). The SH6 sequence is not included in any of the CIS described in Deichman et al.
Example 5.1. Identification of Meganucleases Cleaving SH6
I-CreI variants potentially cleaving the SH6 target sequence in heterodimeric form were constructed by genetic engineering. Pairs of such variants were then co-expressed in yeast. Upon co-expression, one obtains three molecular species, namely two homodimers and one heterodimer. It was then determined whether the heterodimers were capable of cutting the SH6 target sequence of SEQ ID NO: 59.
a) Construction of Variants of the I-CreI Meganuclease Cleaving Palindromic Sequences Derived from the SH6 Target Sequence
The SH6 sequence is partially a combination of the 10AAT_P (SEQ ID NO: 60), 5CCC_P (SEQ ID NO: 61), 10AAT_P (SEQ ID NO: 60), 5TAG_P (SEQ ID NO: 62) target sequences which are shown on
Two palindromic targets, SH6.3 and SH6.4, were derived from SH6 (
b) Construction of Target Vector
The experimental procedure is as described in Example 1.1., with the exception that an oligonucleotide corresponding to the SH6 target sequence (5′-TGGCATACAAGTTTTTAATACCCCGTACCTAATATTGCCAATCGTCTGTCA-3′ (SEQ ID NO: 65) was used.
c) Co-Expression of Variants
Yeast DNA was extracted from variants cleaving the SH6.3 and SH6.4 targets in the pCLS542 and pCLS1107 expression vectors using standard protocols and was used to transform E. coli. Transformants were selected on synthetic medium lacking leucine and containing G418.
d) Mating of Meganucleases Coexpressing Clones and Screening in Yeast
Mating was performed using a colony gridder (QpixII, Genetix). Variants were gridded on nylon filters covering YPD plates, using a low gridding density (4-6 spots/cm2). A second gridding process was performed on the same filters to spot a second layer consisting of different reporter-harboring yeast strains for each target. Membranes were placed on solid agar YPD rich medium, and incubated at 30° C. for one night, to allow mating. Next, filters were transferred to synthetic medium, lacking leucine and tryptophan, adding G418, with galactose (2%) as a carbon source, and incubated for five days at 37° C., to select for diploids carrying the expression and target vectors. After 5 days, filters were placed on solid agarose medium with 0.02% X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1% SDS, 6% dimethyl formamide (DMF), 7 mM β-mercaptoethanol, 1% agarose, and incubated at 37° C., to monitor β-galactosidase activity. Results were analyzed by scanning and quantification was performed using appropriate software.
e) Results
Co-expression of ten variants cleaving the SH6.4 target and of two variants cleaving the SH6.3 target resulted in cleavage of the SH6.1 target in all but two cases. These two cases corresponded in which double transformants were not obtained. Functional combinations are summarized in Table XI.
Example 5.2. Validation of SH6 Target Cleavage in an Extrachromosomal Model in CHO Cells
I-CreI variants able to efficiently cleave the SH6 target in yeast when forming heterodimers are described hereabove in example 5.1. In order to identify heterodimers displaying maximal cleavage activity for the SH3 target in CHO cells, the efficiency of some of these variants was compared using an extrachromosomal assay in CHO cells. The screen in CHO cells is a single-strand annealing (SSA) based assay where cleavage of the target by the meganucleases induces homologous recombination and expression of a LagoZ reporter gene (a derivative of the bacterial lacZ gene).
a) Cloning of SH6 Target in a Vector for CHO Screen
The target was cloned as follows: oligonucleotide corresponding to the SH6 target sequence flanked by gateway cloning sequence was ordered from PROLIGO 5′-TGGCATACAAGTTTTTAATACCCCGTACCTAATATTGCCAATCGTCTGTCA-3′ (SEQ ID NO: 65). Double-stranded target DNA, generated by PCR amplification of the single stranded oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into CHO reporter vector (pCLS1058). Cloned target was verified by sequencing (MILLEGEN).
b) Re-Cloning of Meganucleases
The ORF of I-CreI variants cleaving the SH6.3 and SH6.4 targets identified in example 5.1 were sub-cloned in pCLS2437. ORFs were amplified by PCR on yeast DNA using the following primers: 5′-AAAAAGCAGGCTGGCGCGCCTACACAGCGGCCTTGCCACCATG-3′ (SEQ ID NO: 66) and 5′-AGAAAGCTGGGTGCTAGCGCTCGAGTTATCAGTCGG-3′ (SEQ ID NO: 67) primers. PCR products were cloned in the CHO expression vector pCLS2437 using the AscI and XhoI for internal fragment replacement. Selected clones resulting from ligation and E. coli transformation steps were verified by sequencing (MILLEGEN).
c) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected with Polyfect® transfection reagent according to the supplier's protocol (QIAGEN). 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for β-galactosidase liquid assay was added (typically 1 liter of buffer contained: 100 ml of lysis buffer (Tris-HCl 10 mM pH7.5, NaCl 150 mM, Triton X100 0.1%, BSA 0.1 mg/ml, protease inhibitors), 10 ml of Mg 100× buffer (MgCl2 100 mM, β-mercaptoethanol 35%), 110 ml ONPG 8 mg/ml and 780 ml of sodium phosphate 0.1M pH7.5). After incubation at 37° C., OD was measured at 420 nm. The entire process is performed on an automated Velocity11 BioCel platform. Per assay, 150 ng of target vector was cotransfected with 12.5 ng of each one of both variants (12.5 ng of variant cleaving palindromic SH6.3 target and 12.5 ng of variant cleaving palindromic SH6.4 target).
d) Results
One couple of variants forming an heterodimeric endonuclease able to cleave SH6 in yeast was chosen for confirmation in CHO using extrachromosomal assay in a transient transfection.
The monomer capable of cleaving SH6.3 comprised the following mutations: 44K 70S 75N (referred to as SH6-3-M1-44K 70S 75N) and the monomer capable of cleaving SH6.4 comprised the following mutations: 28Q 40R 44A 70L 75N 96R 111H 144S (referred to as SH6-4-MB-28Q 40R 44A 70L 75N 96R 111 H 144S).
Analysis of the efficiencies of cleavage and recombination of the SH6 sequence demonstrates that the tested combination of I-CreI variants was able to transpose its cleavage activity from yeast to CHO cells without additional mutation.
Example 5.3. Covalent Assembly as Single Chain and Improvement of Meganucleases Cleaving SH6
Co-expression of the cutter described in example 5.1 leads to a high cleavage activity of the SH6 target in yeast. One of them have been validated for SH6 cleavage in a mammalian expression system (example 5.2).
The M1×MA SH6 heterodimer gives high cleavage activity in yeast. M1 is a SH6.3 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 44K 70S 75N. MA is a SH6.4 cutter that bears the following mutations in comparison with the I-CreI wild type sequence: 7R 28Q 40R 44A 70L 75N 103T 121E 132V 160R.
Single chain constructs were engineered using the linker RM2 (AAGGSDKYNQALSKYNQALSKYNQALSGGGGS; SEQ ID NO: 15) resulting in the production of the single chain molecule: MA-RM2-M1. During this design step, the G19S mutation was introduced in the C-terminal M1 mutant. In addition, mutations K96E was introduced into the MA mutant and mutations E8K, E61 R into the M1 mutant to create the single chain molecule: MA(K96E)-RM2-MA(E8K E61R) that is called further SCOH-SH6 b1 scaffold.
Four additional amino-acid substitutions have been found in previous studies to enhance the activity of I-CreI derivatives: these mutations correspond to the replacement of Phenylalanine 54 with Leucine (F54L), Glutamic acid 80 with Lysine (E80K), Valine 105 with Alanine (V105A) and Isoleucine 132 with Valine (I132V). Some combinations were introduced into the coding sequence of N-terminal and C-terminal protein fragment, and the first batch of resulting proteins were assayed for their ability to induce cleavage of the SH6 target.
a) Introduction of Additional Mutations into the SC-OH Single Chain Construct
Additional mutations were introduced by use of the QuikChange Multi Site-Directed Mutagenesis Kit from Stratagene/Agilent technologies Inc according to the manufacturer's instructions. A first set of oligonucleotides was used to introduce the mutations in the part of the single chain molecule corresponding to the first monomer. A second set of oligonucleotides was designed to introduce the same mutations specifically in the second part of the single chain molecule corresponding to the second monomer as shown in (see Table XII).
Isolated clones obtained at the term of this process were sequenced to confirm the specific mutation profiles obtained. Profiles of interest were then tested in CHO SSA assay in comparison with the initial construct as described.
b) Extrachromosomal Assay in Mammalian Cells
CHO K1 cells were transfected as described above. 72 hours after transfection, culture medium was removed and 150 μl of lysis/revelation buffer for β-galactosidase liquid assay was added. After incubation at 37° C., OD was measured at 420 nm. The entire process is performed on an automated Velocity11 BioCel platform.
Per assay, 150 ng of target vector was cotransfected with an increasing quantity of variant DNA from 3.12 ng to 25 ng (25 ng of single chain DNA corresponding to 12.5 ng+12.5 ng of heterodimer DNA). Finally, the transfected DNA variant DNA quantity was 3.12 ng, 6.25 ng, 12.5 ng and 25 ng. The total amount of transfected DNA was completed to 175 ng (target DNA, variant DNA, carrier DNA) using empty vector (pCLS0001).
c) Results
The activity of the SCOH-SH6-b1-C (pCLS2796) and SCOH-SH6-b1-B-(pCLS2928) single chain molecules (see Table XIII) against the SH6 target was monitored using the previously described CHO assay by comparison to the SH6.3-M1×SH6.4-MB forming heterodimer and our internal control SCOH-RAG and I-Sce I meganucleases. All comparisons were done at 3.12 ng, 6.25 ng, 12.5 ng, and 25 ng transfected variant DNA (
Additional mutations were further introduced into the single chain scaffold according material and method. The molecules obtained and tested are listed in Table XIV.
All the variants were active in the described conditions and shared specific behaviour upon assayed dose depending on the mutation profile they bear (
To validate the cleavage activity of engineered single-chain SH6 meganucleases, their ability to stimulate homologous recombination at the endogenous human SH6 loci was evaluated. Cells were transfected with mammalian expression plasmids for single chain molecules SCOH-QCSH6-H01 (SEQ ID NO: 81; pCLS3690) or SCOH-QC-SH6-H01-V2-7E-70R75D (SEQ ID NO: 85; pCLS4373) and the donor repair plasmid pCLS3779 (
Example 6.1. Materials and Methods
a) Meganuclease Expression Plasmids
The meganucleases used in this example are SCOH-QCSH6-H01 (SEQ ID NO: 81) or SCOH-QC-SH6-H01-V2-7E-70R75D (SEQ ID NO: 85) cloned in a mammalian expression vector, resulting in plasmid pCLS3690 (
b) Donor Repair Plasmid
The donor plasmid contains a PCR generated 1517 bp fragment of the SH6 locus (position 18437771 to 18439287 on chromosome 21, NC—000021.8) as the left homology arm and a 1571 bp fragment of the SH6 locus (position 18439343 to 18440846 on chromosome 21, NC—000021.8) as the right homology arm. The left and right homology arms were inserted upstream (using an AscI site) and downstream (using a SbfI site), respectively, of an exogenous 2.8 kb DNA fragment containing two CMV promoters and a neomycin resistance gene. The resulting plasmid is pCLS3779 (
c) Sh6 Gene Targeting Experiments
Human embryonic kidney 293H cells (Invitrogen) were plated at a density of 1×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone) (0.25 μg/ml) (Invitrogen-Life Science) and 10% FBS). The next day, cells were transfected with Lipofectamine 2000 transfection reagent (Invitrogen) according to the supplier's protocol. Briefly, 2 μg of the donor plasmid was co-transfected with 3 μg of single-chain meganuclease expression vectors. After 72 hours of incubation at 37° C., cells were trypsinized and plated in complete medium at 10 or 100 cells per well in 96-well plates. Alternatively, after 72 hours of incubation at 37° C., cells were trypsinized and plated in complete medium at 300 cells per dish in 10 cm-dishes. After 2 weeks of incubation at 37° C., individual clonal cellular colonies were picked and plated in complete medium in 96-well plates. Once cells were 80 to 100% confluent, genomic DNA extraction was performed with the ZR-96 genomic DNA kit (Zymo research) according to the supplier's protocol.
d) PCR Analysis of Gene Targeting Events
The frequency of gene targeting was determined by PCR on genomic DNA using the primers SH6 GHGF3: 5′-CAATGGAGTTTTGGAGCCAC-3′ (SEQ ID NO: 280) and NeoR9: 5′-ATCAGAGCAGCCGATTGTCT-3′ (SEQ ID NO: 281). The PCRs result in a 2300 bp gene targeting specific PCR product (
Example 6.2. Results
Human embryonic kidney 293H cells were co-transfected with 2 vectors: a plasmid expressing one of the two single-chain SH6 meganucleases and the donor repair plasmid pCLS3779 (
To validate the capacity of sh6 locus to support transgene expression at sh6 locus cleavage activity of engineered single-chain SH6 meganucleases, gene targeting experiments were conducted with a repair plasmid containing a neomycin-resistance gene expression cassette and the ability of modified cells to grow in Neomycin-containing media was measured. The survival and growth of cells in the presence of Neomycin is dependent on the expression of the neomycin-resistance gene and is therefore indicative of transgene expression at the SH6 locus following targeted integration.
Example 7.1. Materials and Methods
a) Meganuclease Expression Plasmids
The meganuclease used in this example is SCOH-QCSH6-H01 (SEQ ID NO: 81) cloned in a mammalian expression vector, resulting in plasmid pCLS3690.
b) Donor Repair Plasmid
The donor plasmid contains a PCR generated 1517 bp fragment of the SH6 locus (position 18437771 to 18439287 on chromosome 21, NC—000021.8) as the left homology arm and a 1571 bp fragment of the SH6 locus (position 18439343 to 18440846 on chromosome 21, NC—000021.8) as the right homology arm. The left and right homology arms were inserted upstream (using an AscI site) and downstream (using a SbfI site), respectively, of an exogenous 2.8 kb DNA fragment containing two CMV promoters and a neomycin resistance gene. The resulting plasmid is pCLS3779 (
c) Sh6 Gene Targeting Experiments
Human embryonic kidney 293H cells (Invitrogen) were plated at a density of 1×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone) (0.25 μg/ml) (Invitrogen-Life Science) and 10% FBS). The next day, cells were transfected with Lipofectamine 2000 transfection reagent (Invitrogen) according to the supplier's protocol. Briefly, 2 μg of the donor plasmid was co-transfected with 3 μg of single-chain meganuclease expression vectors. After 72 hours of incubation at 37° C., cells were trypsinized and plated in complete medium at 300 cells per dish in 10 cm-dishes. After 2 weeks of incubation at 37° C., individual clonal cellular colonies were picked and plated in complete medium in 96-well plates. After one week of incubation at 37° C., cells were trypsined, plated into 2 replicate 96-well plates and incubated at 37° C. Once cells were 80 to 100% confluent, genomic DNA extraction was performed on one of the replicate plate with the ZR-96 genomic DNA kit (Zymo research) according to the supplier's protocol. The other replicate was used to isolate gene-targeted clone and expand them.
d) PCR Identification of Gene Targeted Clones
Gene targeting was determined by PCR on genomic DNA using the primers SH6 GHGF3: 5′-CAATGGAGTTTTGGAGCCAC-3′ (SEQ ID NO: 280) and NeoR9: 5′-ATCAGAGCAGCCGATTGTCT-3′ (SEQ ID NO: 281). The PCRs result in a 2300 bp gene targeting specific PCR product (
e) Validation of Targeted Integration by Southern Blot:
Genomic DNA from cellular clones was digested with StuI or HindIII restriction enzymes (New England Biolabs), separated by electrophoresis on a 0.8% agarose gela and transferred onto a nitrocellulose membrane. A DNA probe was prepared from 25 ng of a DNA fragment homologous to the Neomycin resistance gene with 32P-radiolabeled dCTP and Rediprime II random prime labelling system (GE Healthcare) according to supplier's protocol and added to the nitrocellulose membrane tha had preincubated in hybridization buffer (NaPi 20 mM, 7% SDS, 1 mM EDTA). After overnight incubation at 65° C., the membrane was washed and exposed to a radiography film. The size of expected bands on the radiograph are 5.3 kb for StuI digestion and 6.8 kb for HindIII digestion (
f) Neomycin-Resistance Test:
Cellular clones identified by PCR as targeted at SH6 locus were plated at 300 cells per well in 96-well microplates in the presence of G418 antibiotics (PAA laboratories). After 10 days of incubation at 37° C., viability was measured using Vialight bioassay kit (Lonza) and a Victor luminescence reader (Perkin Elmer) according to supplier's protocol.
Example 7.2. Results
Human embryonic kidney 293H cells were co-transfected with 2 vectors: a plasmid expressing one of the two single-chain SH6 meganucleases and the donor repair plasmid pCLS3779. The cells were then plated at 300 cells per 10-cm dish and 2 weeks later clonal colonies were isolated and plated in 96-well microplates. Genomic DNA derived from these cells was analyzed for gene targeting by PCR as described in Material and Methods. Genomic DNA was then used to validate targeted integration by southern blot analysis. The clones number 7 and 8 showed bands of the expected size whereas negative control clones number 5 and 6 did not (
To validate the capacity of sh6 locus to support transgene integration without disturbing the expression of neighboring genes, gene targeting experiments were conducted with a repair plasmid containing a 2.8 kb exogenous DNA fragment and cellular clones were identified that contained the targeted integration. The expression of genes upstream and downstream of the sh6 integration site was measured and compared to that of cellular clones that had not undergone targeted integration.
Example 8.1. Materials and Methods
a) Meganuclease Expression Plasmids
The meganucleases used in this example is SCOH-QCSH6-H01 (SEQ ID NO:81) cloned in a mammalian expression vector, resulting in plasmid pCLS3690.
b) Donor Repair Plasmid
The donor plasmid contains a PCR generated 1517 bp fragment of the SH6 locus (position 18437771 to 18439287 on chromosome 21, NC—000021.8) as the left homology arm and a 1571 bp fragment of the SH6 locus (position 18439343 to 18440846 on chromosome 21, NC—000021.8) as the right homology arm. The left and right homology arms were inserted upstream (using an AscI site) and downstream (using a SbfI site), respectively, of an exogenous 2.8 kb DNA fragment containing two CMV promoters and a neomycin resistance gene. The resulting plasmid is pCLS3779 (
c) Sh6 Gene Targeting Experiments
Human embryonic kidney 293H cells (Invitrogen) were plated at a density of 1×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone) (0.25 μg/ml) (Invitrogen-Life Science) and 10% FBS). The next day, cells were transfected with Lipofectamine 2000 transfection reagent (Invitrogen) according to the supplier's protocol. Briefly, 2 μg of the donor plasmid was co-transfected with 3 μg of single-chain meganuclease expression vectors. After 72 hours of incubation at 37° C., cells were trypsinized and plated in complete medium at 300 cells per dish in 10 cm-dishes. After 2 weeks of incubation at 37° C., individual clonal cellular colonies were picked and plated in complete medium in 96-well plates. After one week of incubation at 37° C., cells were trypsined, plated into 2 replicate 96-well plates and incubated at 37° C. Once cells were 80 to 100% confluent, genomic DNA extraction was performed on one of the replicate plate with the ZR-96 genomic DNA kit (Zymo research) according to the supplier's protocol. The other replicate was used to isolate gene-targeted clone and expand them.
d) PCR Identification of Gene Targeted Clones
Gene targeting was determined by PCR on genomic DNA using the primers SH6 GHGF3: 5′-CAATGGAGTTTTGGAGCCAC-3′ (SEQ ID NO: 280) and NeoR9: 5′-ATCAGAGCAGCCGATTGTCT-3′ (SEQ ID NO: 281). The PCRs result in a 2300 bp gene targeting specific PCR product (Figure XX). The SH6 GHGF3 primer (SEQ ID NO: 280) is a forward primer located upstream of the left homology arms of the donor repair plasmids. The NeoR9 primer (SEQ ID NO: 281) is a reverse primer located in the exogenous DNA inserted between the two homology arms of the donor repair plasmid.
e) Expression of Genes Upstream and Downstream from Sh6 Locus:
Gene expression was measured by quantitative RT-PCR. RNA was isolated from subconfluent cellular clones using RNeasy RNA isolation kit (Qiagen) according to manufacturer's protocol. 3 μg of RNA was used to generate cDNA using Superscript III First-strand kit (Invitrogen). Quantitative PCR was performed on 10 ng of cDNA per 12 μl-reaction, in duplicate samples, using SYBR® Premix Ex Taq™ DNA Polymerase (Lonza) on Stratagene MPX3000 instrument. For each gene, the primers used are listed in the following table:
The threshold cycles (Ct) were determined with Stratagene software on fluorescence (dRn) after normalization by the ROX reference dye. The intensity of gene expression was calculated using the formula 2Ct(HPRT)-Ct(Gene), the expression of the housekeeping gene HPRT being used as an internal normalizing factor.
Example 8.2. Results
Human embryonic kidney 293H cells were co-transfected with 2 vectors: a plasmid expressing one of the three single-chain SH6 meganucleases and the donor repair plasmid pCLS3779. The cells were then plated at 300 cells per 10-cm dish and 2 weeks later clonal colonies were isolated and plated in 96-well microplates. Genomic DNA derived from these cells was analyzed for gene targeting by PCR as described in Material and Methods. RNA was isolated from clones showing targeted integration and negative controls. Quantitative RT-PCR was performed to measure expression of genes surrounding the locus of targeted integration. The data are presented in
To validate the cleavage activity of engineered single-chain Safe Harbor meganucleases, their ability to stimulate mutagenesis at endogenous human safe harbor loci was evaluated. Cells were transfected with mammalian expression plasmids for single chain molecules. Cleavage of a native safe harbor locus by the meganuclease yields a substrate for non-homologous end joining, which is an error-prone process and can result in small insertion or deletions at the meganuclease target site. Thus, the frequency at which mutations occur at an endogenous safe harbor locus is indicative of the cleavage efficiency of the genomic target site by the meganuclease.
Example 9.1. Materials and Methods
a) Meganuclease Expression Plasmids
The coding sequences for the meganucleases used in this example were cloned in a mammalian expression vector, resulting in the plasmids listed in table XVI.
b) Safe Harbor Locus Mutagenesis Experiments
Human embryonic kidney 293H cells (Invitrogen) were plated at a density of 1×106 cells per 10 cm dish in complete medium (DMEM supplemented with 2 mM L-glutamine, penicillin (100 UI/ml), streptomycin (100 μg/ml), amphotericin B (Fongizone) (0.25 μg/ml) (Invitrogen-Life Science) and 10% FBS). The next day, cells were transfected with 3 μg of single-chain meganuclease expression vector using Lipofectamine 2000 transfection reagent (Invitrogen) according to the supplier's protocol. After 2 to 6 days of incubation at 37° C., cells were trypsinized and genomic DNA extraction was performed with the DNeasy blood and tissue kit (Qiagen) according to the supplier's protocol.
c) Deep Sequencing Analysis of Mutagenesis Events
The frequency of mutagenesis was determined by deep sequencing analysis. Oligonucleotides were designed for PCR amplification of a DNA fragment surrounding each safe harbour target and are listed in table XVII.
Nucleotides were added to obtain a fragment flanked by specific adaptator sequences (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′; SEQ ID NO 324) and (5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3′; SEQ ID NO 325) provided by the company offering sequencing service (GATC Biotech AG, Germany) on the 454 sequencing system (454 Life Sciences). An average of 18,000 sequences was obtained from pools of 2 to 3 amplicons (500 ng each). After sequencing, different samples were identified based on barcode sequences introduced in the first of the above adaptators.
Example 9.2. Results
Human embryonic kidney 293H cells were transfected with a plasmid expressing a single-chain safe harbor meganuclease. After 2 to 6 days of incubation at 37° C., genomic DNA was isolated and PCR was used to amplify the genomic sequence surrounding the meganuclease target site. Sequences were then analyzed for the presence of insertions or deletions events (InDel) in the cleavage site of each safe harbor target. Results are summarized in table XVIII.
In conclusion, Examples 1, 2, 3 and 5 demonstrate that both I-CreI heterodimeric proteins and single-chain meganucleases capable of cleaving the SH3, the SH4 and the SH6 loci can be obtained. Moreover, these endonucleases are capable of cleaving these loci with a strong cleavage activity.
Example 4 demonstrates that single-chain meganucleases capable of cleaving the SH3 and the SH4 loci allow efficiently inserting a transgene into a target site of a human cell.
These endonucleases can thus advantageously be used to insert a transgene into the SH3, the SH4 loci or the SH6 loci of an individual.
Example 6 demonstrates that at least two single chain molecules according to the invention are capable of inducing high levels of gene targeting at an endogenous sh6 locus.
Example 7 demonstrates that targeted integration a locus can support functional transgene expression.
Example 8 demonstrates that a targeted integration at a locus does not substantially modify expression of five genes located in the vicinity of the target sequence.
Example 9 demonstrates mutagenesis frequencies for different meganucleases targeting safe harbor sequences, which are indicative of the cleavage efficiency of the genomic target site by said meganucleases.
| Number | Date | Country | Kind |
|---|---|---|---|
| 10305202.3 | Feb 2010 | EP | regional |
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/EP2011/052916 | 2/28/2011 | WO | 00 | 4/30/2013 |
| Number | Date | Country | |
|---|---|---|---|
| 61308509 | Feb 2010 | US |
