Patent Application
20130130990
The present invention relates to new use of spink6 gene and its encoded proteins. Specifically, the present invention relates to the use of the spink6 gene and the encoded proteins in the preparation of anti-tumor drugs.
The sequence of spink6 gene is a human-derived gene sequence published by NCBI in 2006, which has been reported in detail in Martin C. Wapenaar, Alienke J. Monsuur et al, Immunogenetics, 2007, 59:349-357. Its encoded SPINK6 protein contains a Kazal domain and classified into the SERPIN family of serine protease inhibitors of the Kazal type.
To date, there is no other report on specific functions of the spink6 gene and its encoded protein. Whether their applications in pharmaceutical field can be further studied is our main concern.
Cancer is currently one of the major diseases in humans, more and more investigators have turned their attentions to study tumor related genes in order to fundamentally resolve the problem of the occurrence of tumor diseases in terms of genes. Whether the spink6 gene and the encoded protein can be used to prepare a new drug for treating tumors will be very meaningful and clinically important.
The technical problem to be resolved in the present invention is to disclose a use of a gene and its encoded protein thereof in the manufacture of an anti-tumor drug.
The technical concept of the invention is as follows:
The SPINK6 protein belongs to a serine protease inhibitor, containing a signal peptide of 23 amino acids. The SPINK6 protein could be secreted extracellularly and acted via the receptors on the cell membrane. Therefore, we speculated that the SPINK6 protein plays a role via the transmembrane serine protease on the cell membrane. The known serine proteases are associated with many kinds of tumors and cancers. For example, Matriptase is a type II transmembrane serine protease and is significantly high expressed in epithelial ovarian cancer (Michael D. Oberst, Michael D. et al. Clinical Cancer Research, 2002 April, Vol. 8, 1101-1107); Hepsin is a transmembrane serine protease, and is significantly high expressed in prostate cancer patients (Klezovitch J., Chevillet J. et al. Cancer Cell, 2004, Volume 6, Issue 2, Pages 185-195). Therefore, it is speculated that spink6 gene sequence and the encoded protein thereof may also have tumor suppressing activity.
To this end, through extensive researches, we confirmed that spink6 gene, and the encoded proteins with or without the signal peptide of 23 amino acids can inhibit the growth and malignant of tumor cells, affect strongly the cell cycle. Therefore, spink6 gene and the encoded SPINK6 protein with or without the signal peptide of 23 amino acids have the application prospects in the preparation of anti-tumor drugs.
The tumors described herein include but are not limited to liver cancer, gastric cancer or prostate cancer and the like.
The gene described herein has the nucleotide sequence designated as SED ID NO:1 or SED ID NO:3.
The protein encoded by the gene described herein has the amino acid sequence designated as SED ID NO:2 or SED ID NO:4.
The use of the protein described herein in the manufacture of an anti-tumor drug is in the form of a pharmaceutical composition.
The term “SPINK6 protein” as used herein refers to the protein having the amino acid sequence of human spink6 designated as SED ID NO:2 or SED ID NO:4.
The difference between the nucleotide sequence designated as SED ID NO:1 and the nucleotide sequence designated as SED ID NO:3 lies in that the nucleotide sequence designated as SED ID NO:3 further includes a sequence of 69 nucleotides (i.e., nucleotide positions 1-69 of SED ID NO:3) encoding a signal peptide of 23 amino acids at 5′ end of the nucleotide sequence designated as SED ID NO:1.
The difference between the amino acid sequence designated as SED ID NO:2 and the amino acid sequence designated as SED ID NO:4 lies in that the amino acid sequence designated as SED ID NO:4 further includes a signal peptide of 23 amino acids (i.e., amino acid positions 1-23 of SED ID NO:4) at N-terminus of the amino acid sequence designated as SED ID NO:2.
The invention also relates to a vector comprising a spink6 polynucleotide according to the present invention, and a host cell produced via gene engineering by the vector or the sequence encoding SPINK6 protein-according to the present invention, as well as a method for producing the polypeptide described herein by recombinant technology.
The polynucleotide sequence according to the present invention can be used to express or produce the recombinant SPINK6 protein through conventional recombinant DNA technology, such as the technology reported in the literature (Science, 1984; 224: 1431). In general, the following steps are included:
(1) transforming or transducing a suitable host cell including E. coli, yeast or CHO with the polynucleotide encoding SPINK6 protein or a recombinant expression vector containing the polynucleotide according to the present invention;
(2) culturing the host cell in a suitable medium, which may be routinely chosen according to Molecular Cloning: A Laboratory Manual (3), Joe Sambrook, et al.;
(3) isolating and purifying the protein from the medium or the cell.
The recombinant SPINK6 protein has various applications. These applications include but are not limited to directly as a drug for the treatment of the diseases caused by dysfunction or loss of spink6, such as a variety of malignant tumors and abnormal cell proliferation, etc.
The protein according to the present invention can be used in combination with an appropriate pharmacologically acceptable carrier.
The carrier includes but is not limited to: a diluent, an excipient such as water, etc.; a filler such as starch, sucrose, etc.; an adhesive such as a fiber derivative, alginate, gelatin and polyvinylpyrrolidone; a wetting agent such as glycerol; a disintegrating agent such as agar, calcium carbonate and calcium bicarbonate; an absorption enhancer such as a quaternary ammonium compound; a surfactant such as cetyl alcohol; an adsorption carrier such as kaolin and bentonite; a lubricant such as talc, calcium and magnesium stearate, polyethylene glycol, and other.
The pharmaceutical composition can be administered to a patient in need of treatment in a convenient manner, such as via local, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal administration route. The dosage of SPINK6 protein administered to the patients is generally 0.5˜2 mg/kg body weight/day, and the specific range will depend on many factors, such as the administration manner, the health condition of the patient to be treated and the judgment of physician.
In addition, the polynucleotide of spink6 can also be used for various therapeutic purposes. Gene therapy techniques can be used to treat abnormalities of cell proliferation, development or metabolism caused by no expression of SPINK6 protein or the expression of abnormal/inactive SPINK6 protein. A recombinant gene therapy vector (such as a viral vector) can be designed to express SPINK6 protein, in order to compensate abnormalities of cell proliferation, development or metabolism caused by insufficient expression of intrinsic SPINK6 protein or the expression of abnormal/inactive SPINK6 protein. Therefore, the recombinant gene therapy vector can be used to treat the diseases caused by abnormalities of SPINK6 expression or activity, such as tumors. The expression vector derived from a virus, such as retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, parvovirus and the like, can be used to transfer spink6 gene into the cell. The method for constructing the recombinant virus vector carrying the spink6 gene can be found in the literatures (Sambrook, et al.). Furthermore, the recombinant spink6 gene can be packaged into a liposome and transferred into the cell.
The method for introducing the polynucleotide into a tissue or cell includes direct polynucleotide injection into the body tissue; or at first introducing the polynucleotide into the cell in vitro via a vector (such as a virus, phage or plasmid), then transplanting the cell into the body.
It has been demonstrated in cell and animal tests that spink6 gene and the encoded protein described herein can significantly inhibit the proliferation of the tumor cells with lower toxicity, without affecting the normal functions of the animal tissues and organs, have good anti-tumor activity, and provide a safe and effective gene therapy drug for the clinical treatment of cancers.
Lane 1: QGY-7703 cell
Lane 1: SP-vec cell
Lane 3: SP80 cell
Lane 4: SP57 cell
Lane M: the protein molecular weight standard
Lane 1: before induction
Lane 2: induction for 4 hours by IPTG
Lane 3: the recombinant protein after affinity purification using Ni Sepharose 6
FF (after desalination by dialysis, it was cleaved by enterokinase to obtain the SPINK6 protein).
Lane M: the protein molecular weight standard
Lane 1: the recombinant protein after purification
Lane 2: before induction
Lane 3˜7: induction by methanol for 36, 48, 60, 72 and 96 h, respectively.
Lane M: the protein molecular weight standard
Lane 1-2: the recombinant protein SPINK6b after purification
1-5 are as follows respectively: 1, infection volume 1 μl; 2, infection volume 2 μl; 3, infection volume 5 μl; 4, infection volume 10 μl; 5, infection volume 15 μl.
The invention will now be further illustrated through the following Examples. It should be understood that these Examples are merely illustrative of the invention and do not to limit the scope of the invention. The experimental methods without the specific experimental conditions in the following examples, are usually in accordance with the conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or in accordance with the recommended conditions by manufacturers.
In this example, human spink6 cDNA fragment was amplified by RT-PCR method from the total RNA of the human liver cancer cell line QGY-7703.
The QGY-7703 cell was purchased from Cell Bank of Type Culture Collection Committee of Chinese Academy of Sciences/Center of Cell Resource, Shanghai Institute of life sciences of Chinese Academy of Sciences.
QGY-7703 cells in one 60 mm Petri dish were washed twice with PBS, after which 1 ml Trizol reagents for extracting RNA were added to sufficiently lyse the cells, and then were transferred into a 1.5 ml centrifugal tube. After adding 200 n1 of chloroform and mixing homogeneously, centrifugation was performed at 12000 RPM for 10 min. The upper aqueous phase was transferred to another centrifugal tube, and then equal amount of isopropanol was added, allowing it standing at room temperature for 10 min and centrifugating at 12000 RPM for 10 min to obtain the total RNA pellets. The pellets were washed twice with 500 ml 75% ethanol, then dissolved in RNase-free de-ionized water. The quality identification of the extracted RNA was performed as follows: determining 260/280 ratio by UV spectrophotometer (ratio of 1.7 to 2.0); and observing the presence or absence of degradation in the MOPS formaldehyde denaturing gel.
2. Synthesis of cDNA
2 μg of total RNA, 1 μl of oligo d(T) and 5 μl of ddH2O were incubated at 70° C. for 5 min, and then transferred immediately on ice for denaturation for 5 min. Then 4 n1 of 5× buffer, 2 n1 of dNTPs (10 mM), 0.5 n1 of RNasin, 1.5 n1 of ddH2O and 1 n1 of M-MLV (TaKaRa, D2640A) were added and mixed thoroughly, and incubated at 42° C. for 1 h, and finally, incubated at 70° C. for 15 min, and cooled on ice immediately to terminate the reaction.
Primers were designed and synthesized based on the sequence of human spink6 gene. In order to insert the PCR product directly into the eukaryotic expression vector pcDNA3.1(+) (Invitrogen, USA), wherein EcoR I and Hind III restriction site (in italics) were designedly added into 5′ primer and 3′ primer respectively, and the sequences of the primers are as follows:
The primers for the sequence of spink6 gene encoding the full length of 80 amino acids are as follows:
CGAATGAAACTGTCAGGCATG3′
TCAGCATTTTCCAGGATG3′
The primers for the sequence of spink6 gene encoding the full length of 57 amino acids are ac follows:
CAG GGA GGACAGGTTGAC 3′
TCAGCATTTTCCAGGATG3′
The PCR reaction mixture consisted of 10× buffer, MgCl2 (25 mM), dNTP (10 mM), spink6(F), spink6(R), Taq DNA polymerase, ddH2O and cDNA template with the volume of 2.5, 2.0, 0.5, 0.3, 0.3, 0.5, 17, 2 μl, respectively. The reaction conditions were 5 min at 94° C. for denaturation, then 35 cycles of 30 s at 94° C., 30 s at 55° C. and 30 s at 72° C. for each cycle, and a final extension of 10 min at 72° C. After the completion of the reaction, the PCR fragments obtained via verification contained the sequence of spink6 gene encoding the full length of 80 amino acids and the sequence of spink6 gene encoding 57 amino acids, respectively.
The PCR products obtained in Example 1 were respectively cloned into the vector pcDNA3.1(+) (Invitrogen, USA) with the drug G418 (an antibiotic, also known as geneticin, having a molecular weight 692.7 Dalton, and routinely being used in screening for the selection of the resistant cells after transfection of neomycin resistant genes) resistant selection marker to construct expression plasmids pcDNA3.1(+)-sp80 and pcDNA3.1(+)-sp57, wherein the PCR products obtained in Example 1 were the sequence (SEQ ID NO:3) of spink6 gene encoding the full length 80 of amino acids, and the gene sequence (SEQ ID NO:1) encoding 57 amino acids with the 23 amino acids signal peptide removed.
(1) Before transfection, the cells were digested with 1% trypsin, and inoculated in the 24-well plate cultured in the medium without antibiotics for 24 h to ensure that cells were in the range of optimal transfection density (70˜80%) (Lipofectamine 2000 kit, Invitrogen)
(2) 0.8 μg of the constructed plasmids pcDNA3.1(+)-sp80 and pcDNA3.1(+)-sp57 were mixed thoroughly with 50 μl of 1640 medium (free of serum and antibiotics, GIBCO), and the empty vector pcDNA3.1(+) was used as a negative control. Another 2 μl of Lipofectamine 2000 was thoroughly mixed with 50 μl of 1640 medium (free of serum and antibiotics, GIBCO) and then left standing for 5 min; finally the liposome diluent added to the plasmid diluent, mixing gently and kept at room temperature for 20 min.
(3) The cell culture supernatant was discarded, and the cells were washed once with PBS. After adding 400 μl of 1640 medium (free of serum-free and antibiotics), then the transfection mixture added dropwise after standing for 20 min, and shaken gently.
(4) 6 hrs after the transfection, the medium was replaced with fresh complete 1640 medium (containing serum and antibiotics, i.e., containing 10% fetal bovine serum and 100 U/ml penicillin, 100 μg/ml streptomycin and 50 μg/ml gentamicin) and the culture was continued to the total transfection time of 48 h.
(1) After 48 h transfection, cells were digested and transferred to 100 mm Petri dishes and cultured for 24 h, G418 was further added to a final concentration of 600 mg/ml, and the culture was continued for 2 weeks until the formation of clones. Distinct single clones were picked with the cloning ring, transferred into the 96-well plates, and continued to culture with fresh complete 1640 culture medium (containing serum and antibiotics, i.e., containing 10% fetal bovine serum and 100 U/ml penicillin, 100 μg/ml streptomycin and 50 μg/ml gentamicin), where the G418 concentration was changed to 300 mg/ml, and then the culture was expanded continuously. A portion of cells were cryopreserved, and the rest continued to be expanded, after which the proteins and RNAs from cells were prepared for identification.
(3) The distinct single clones mentioned in step (1) were checked by RT-PCR, those strains expressing spink6 mRNA relatively higher than QGY-7703 cells, named SP80 cells and SP57 cells, were selected and could be used for checking the influence of cytological effects of spink6 over-expression. At the same time, a cell strain transfected with the empty vector pcDNA3.1(+), designated as SP-vec cell, was screened out as well (
Four types of cells, SP80, SP57, SP-vec and QGY-7703 were inoculated into the 96-well plates in a density of 5×103 cells/well. The cell growth state was measured every 24 h with a kit (Promega, CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay) and the cell growth curve was shown in
The SP80, SP57, SP-vec and QGY-7703 cells in Example 2 were inoculated into the 6-well plates in a density of 1×105 cells/well. 24 h after inoculation, the medium was replaced with the 1640 medium (free of serum and antibiotics) and cultured for 24 h to allow cell synchronization, then in complete 1640 medium (containing serum and antibiotics) for 24 h, after which the cells were collected and fixed in 75% ethanol for more than 24 h. The fixed cells were washed twice with PBS, stained with PI (propidium iodide, a fluorescent dye for staining the nucleus, and emitting red fluorescence after being embedded into the double-stranded DNA) for 30 min. Finally the distribution profile of the four kinds of cells in various cell division phases was checked by flow cytometry (FACS) (Table 1). In table 1, G1 phrase is the DNA pre-synthetic phase, the early stage of G1 phase is G0 phase, G0-G1 represents the DNA pre-synthetic phase; S phrase is the DNA synthetic phase; G2 phrase is the DNA post-synthetic phase, M phase is the mitotic phase, and G2-M represents after the synthesis of DNA until the next round of DNA pre-synthetic phase. The results indicated that, in contrast of QGY-7703 cells, the ratio of the SP80 and SP57 cells highly expressing the two SPINK6 proteins in different lengths at post-synthetic phase was increased by two folds, which shows that the two SPINK6 proteins of different lengths are both capable of resulting in the QGY-7703 cells to be arrested in G2/M phase and lowering the cell proliferation ability.
3 ml per dish of 1640 medium containing 10% fetal bovine serum, 0.6% agar by weight, 100 U/ml penicillin, 100 μg/ml streptomycin and 50 μg/ml gentamicin was prepared and added to 60 mm-diameter Petri dishes, solidified at room temperature. Then the single cell suspensions of the experimental group and the control group cells were prepared respectively and adjusted to the density of 1×105 cells/ml, 40 μl of which was taken and mixed rapidly with 2 ml of 0.6% agar and 2 ml of 2×1640 complete medium (the concentrations of 1640, bovine serum and antibiotics are twice the concentrations of the normal 1640 medium) pre-incubated at 42° C. 3 ml was plated on the bottom agar layer in triplicate for each sample. After solidified and cultured for 3 weeks in CO2 incubator, the clone formation could be observed. The results were shown in
Four cell strains, SP80, SP57, SP-vec and QGY-7703 in Example 2, were inoculated subcutaneously into 5-week-old nude mice with the amount of 2×105 cells/animal. The tumor growth was examined every four days, and the results were shown in
The synthetic gene fragment sp6 was digested with NcoI and HindIII restriction enzymes and inserted into the expression vector pET32a to construct the recombinant plasmid pET32a-SP6.
The spink6 gene fragment sp6 had the nucleotide sequence designated as SEQ ID NO:5:
After the transformation of BL21 (DE3) by the recombinant plasmid, the transformants were inoculated into 2 mL LB medium and cultured overnight at 37° C. 1 mL of the broth was inoculated into 100 mL LB medium, and cultured at 37° C. until OD600=0.8, at which IPTG was added to a final concentration of 1 mmol/L. After 4 h induction, the expression profile was checked by SDS-PAGE electrophoresis (
The synthetic gene fragments spink6a and spink6b containing spink6 gene were digested with XhoI and EcoRI restriction enzymes and inserted into the plasmid pPIC9 to obtain the recombinant plasmids pPIC9-SP6a and pPIC9-SP6b.
The gene fragment spink6a had the nucleotide sequence designated as SEQ ID NO:6:
pPIC9-SP6a and pPIC9-SP6b were digested with BamHI and EcoRI, and the released fragments were inserted into the expression vector pPIC9K to obtain the recombinant plasmids pPIC9K-SP6a and pPIC9K-SP6b, respectively. The derived plasmids were electroporated into GS115. The transformed cells were selected on MD plates. Subsequently, the high-copy transformants were screened out by G418.
The selected high-copy transformants of pPIC9K-SP6a and pPIC9K-SP6b were inoculated into 25 ml BMGY medium and cultured overnight at 30° C. The cells were collected by centrifugation ×3000 g. The pellet was resuspended in the BMMY medium to reach OD600 around 1.0, then cultured at 28˜30° C. Methanol was added every 24 h to a final concentration of 0.5% (v/v) to induce expression of the target protein. After induction, for 72 h, the expression profiles for SPINK6a (
The purified protein was structurally confirmed as the SPINK6 protein designated as SEQ ID NO:2.
The purified protein was structurally confirmed as the SPINK6 protein designated as SEQ ID NO:4.
5 ml of sterile water were added to 1 mg of the soluble recombinant SPINK6a protein and 1 mg of the soluble recombinant SPINK6b protein obtained in Example 8 to prepare the injection in a dosage of 200 μg/ml.
2×106 QGY-7703 cells were inoculated subcutaneously into the nude mice. The diameters of the transplanted tumors were measured with vernier caliper 2 to 3 times every week. When the tumor was grown to 100 mm3, the tumor animal model of the nude mice bearing QGY-7703 liver cancer cells was prepared successfully. The injections of the soluble recombinant SPINK6a and SPINK6b proteins prepared in Example 9 were administered intratumorally in a dosage of 0.1, 0.5, 1.0 mg/kg/day respectively, with the physiological saline as a negative control. Injection was performed every other day for 14 days. The mice were sacrificed at the time of 7 days after stopping the administration, and the weight of the tumor mass was measured. The result (Table 2) shows that spink6 can significantly inhibit the proliferation of QGY-7703 liver cancer cells in the nude mice.
The sequence of human spink6 gene (SEQ ID NO:3) encoding the whole length of 80 amino acids and the sequence of the gene (SEQ ID NO:1) encoding the 57 amino acids with the signal peptide of 23 amino acids removed were amplified via PCR, and the conditions for PCR are the same as “3. PCR amplification” in Example 1. The primers for PCR are as follows:
The primers for the amplification of SEQ ID NO:3 are as follows:
The primers for the amplification of SEQ ID NO:1 are as follows:
The amplified fragment via PCR was double-digested using XhoI and KpnI restriction enzymes and ligated into pAdTrack to obtain the recombinant plasmids pAdTrack-sp80 and pAdTrack-sp57, and then were linearized by PmeI and transformed into E. coli BJ5183 containing pAdEasy plasmid for recombination. The positive transformants were identified by PacI restriction enzyme single digestion, and the larger fragment recovered. The larger fragment was encapsulated in liposome, transfected into 293T cells for virus packaging, expression and amplification, with an empty virus Ad-GFP being amplified synchronously as control. Finally, a sufficient amount of recombinant viruses Ad-sp80 and Ad-sp57 and the empty virus Ad-GFP were recovered, frozen and thawed and then subpackaged, to ensure the uniform concentration and titer in each tube. The specific methods of operation can be found in the reference (A protocol for rapid generation of recombinant adenoviruses using the ADEasy system [J]. Nature Protocols, 2007, 2:1236-1247).
The gradient transfection was carried out with the recombinant adenovirus and the empty virus in the 24-well plates. After 24 h, the average virus infection volume (μL/well) with 100% fluorescence was taken, and the number of 293T cells in the wells was counted, and the viral titer was calculated using follow formula and was expressed as PFU (plaque formation unit, representing the number of infectious or living viruses).
Viral titer=Number of cells/Average virus infection volume
The results were shown in
The QGY-7703 cells were inoculated into the 96-well plates in a density of 5×103 cells/well. A multiplicity of infection 10 (MOI 10) of the recombinant adenoviruses Ad-GFP (empty virus), Ad-sp80 and Ad-sp57 obtained in Example 11 was selected for the infection of QGY-7703 cells inoculated in the 96-well plates. The cell growth state was detected every 24 h with the kit (Promega, CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay), and the cell growth curve was depicted as shown in
Twenty of KM mice, half male and half female, were singly injected the recombinant soluble SPINK6a and SPINK6b proteins obtained in Example 8 in the maximum concentration (10%) and the maximum dosing volume (25 ml/kg) via the tail vein. The administration was carried out once, and the observation was carried out continuously for 2 weeks. After the administration, observation was carried out continuously for 30 min, and once an hour for 4 hours, then once every morning and evening. The results indicated that the mice did not show discernable symptoms of poisoning after the injection of the recombinant SPINK6a and SPINK6b proteins via the tail vein, and none of the 20 animals died.
| Filing Document | Filing Date | Country | Kind | 371c Date |
|---|---|---|---|---|
| PCT/CN2009/074410 | 10/12/2009 | WO | 00 | 4/9/2012 |
