Uses of avian interferon gamma (IFN-γ)

Information

  • Patent Grant
  • 6642032
  • Patent Number
    6,642,032
  • Date Filed
    Friday, November 19, 1999
    25 years ago
  • Date Issued
    Tuesday, November 4, 2003
    21 years ago
Abstract
The present invention provides compositions comprising recombinant avian IFN-γ polypeptides and methods using said recombinant avian IFN-γ polypeptides and compositions to enhance the immune responses of birds, and to enhance growth and/or prevent weight loss in birds. The present invention is particularly useful in the prophylactic and therapeutic treatment of birds against coccidiosis and the causative agent thereof.
Description




STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT




Not Applicable




FIELD OF THE INVENTION




The present invention relates generally to recombinant avian interferon polypeptides and genetic sequences encoding same, and uses therefor. In particular, the present invention is directed to the use of recombinant avian IFN-γ polypeptides as an immune response modulator and as a growth enhancing agent in avian species. The present invention is particularly useful in the prophylactic and therapeutic treatment of birds against coccidiosis and the causative agent thereof.




BACKGROUND OF THE INVENTION




1. Field of the Invention




The rapidly increasing sophistication of recombinant DNA technology is greatly facilitating research into the medical and veterinary fields. Cytokine research is of particular importance, especially as these molecules regulate the proliferation, differentiation and function of a great variety of cells, such as cells involved in mediating an immune response. Administration of recombinant cytokines or regulating cytokine function and/or synthesis is becoming, increasingly, the focus of medical research into the treatment of a range of disease conditions in humans and animals. The present invention seeks to provide novel reagents and methods that employ recombinant cytokine polypeptides, for the treatment of disease conditions in birds.




2. Description of Related Art Including Information Disclosed Under 37 C.F.R. 1.97 and 1.98




In mammals, interferons (IFN) represent a family of cytokines that share the capacity to inhibit viral replication and to exert effects on immune function. There are two distinct types of IFN. Type I IFN is produced by a variety of cell types in response to viral infection and includes IFN-α and -β. Typically, IFN-α is produced by leukocytes such as monocytes and macrophages while fibroblasts and epithelial cells are the major source of IFN-β. Type I IFNs share a high degree of amino acid homology, bind to the same cell surface receptor and there biological functions are resistant to heat and low pH treatment. (Weissmann and Weber, 1986).




In contrast, the production of IFN-γ in mammals is restricted to activated T cells and NK cells and is encoded by a gene that is unrelated to those which express IFN-α or IFN-β. Features that distinguish IFN-γ from -α/β include their binding to different cell surface receptors and that the former is exquisitely sensitive to heat and low pH treatment (Weissmann and Weber, 1986). Another distinction is the ability of IFN-γ, but not IFN-α or IFN-β, to stimulate macrophages to produce reactive nitrogen intermediates such as nitric oxide, nitrate and nitrite (Fast et al, 1993; Huang et al, 1993).




Chicken T cells produce IFN following stimulation with antigen or mitogen (Prowse and Pallister, 1989; Lowenthal et al, 1993; Pusztai et al, 1986; Weiler and von Bulow, 1987; Dijkmans et al, 1990) as measured by the ability to protect chick embryonic fibroblasts (CEF) from virus-mediated lysis. There has been controversy as to whether this IFN activity is the Type I interferon, or alternatively, an avian equivalent of mammalian IFN-γ (Lillehoj et al, 1992).




The gene for chicken Type I IFN (ChIFN-α) has recently been cloned (Sekellick et al, 1994) and when the protein was compared to mammalian IFNs it was shown to have 20-24% amino acid sequence identity to Type I IFNs, whereas it was unrelated to known mammalian IFN-γ polypeptides. Furthermore, recombinant ChIFN-α was shown to have antiviral activity, but lacked macrophage activating function in that it was unable to induce nitrite secretion in monocytes (Schultz et al, 1995), consistent with the properties of mammalian Type I IFN.




U.S. Ser. No. 08/765,381, which is incorporated herein by way of reference, teaches genetic sequences encoding avian IFN-γ from chicken reticuloendotheliosis virus (REV)-transformed spleen cell cultures (Lowenthal et al, 1995 a, b). That specification further teaches the isolation of homologous IFN-γ-encoding genetic sequences from species other than chickens, gene constructs and viral vectors comprising said genetic sequences, methods for the production of recombinant avian IFN-γ using the said gene constructs and viral vectors, and methods of prophylaxis and treatment using the recombinant polypeptides. The avian and mammalian IFN-γ polypeptides are only 30% identical, as determined using the ClustalW programme and the algorithm of Thompson et al., 1994), or alternatively, 32% identical as determined using the ClustalV programme.




Birds suffer from a variety of diseases that represent a considerable cost to the poultry industry, including diseases that are produced by bacteria and viruses, such as, for example, infectious bronchitis virus, avian infectious laryngeotracheitis virus, infectious bronchitis virus, Newcastle disease virus, Marek's Disease virus, chicken anemia virus, avian influenza virus,


E. coli,


Salmonella ssp., Eimeria ssp. and Mycoplasma ssp., amongst others.




For example, the causative agent of coccidiosis in birds, Eimeria ssp., in particular


E. acervulina,


is capable of infecting birds at any period in their life cycle. Coccidiosis represents a considerable cost in terms of reduced productivity, because the disease in birds prevents digestion for about 4-5 days, thereby leading to a considerable weight loss, costing the industry approximately $700 million per annum. Current treatments for coccidiosis include the use of chemicals in feed stocks.




SUMMARY OF THE INVENTION




This application is a continuation-in-part application of U.S. Ser. No. 08/765,381, the entire contents of which are incorporated herein by way of reference.




Bibliographic details of the publications referred to in this specification by author are collected at the end of the description.




Sequence Identity Numbers (SEQ ID NOs.) for the nucleotide and amino acid sequences referred to in the specification appear after the claims.




Throughout this specification and the claims that follow, unless the context requires otherwise, the word “comprise”, or variations such as “comprises” or “comprising” will be understood to imply the inclusion of a stated element or integer or group of elements or integers, but not the exclusion of any other element or integer or group of elements or integers.




Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. the invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.




In work leading up to the present invention, the inventors sought to produce improved methods for the prophylactic and therapeutic treatment of a wide range of diseases in birds, and, in particular, the prophylactic and therapeutic treatment of coccidiosis.




The inventors cloned avian IFN-γ cDNAs and genes and produced recombinant gene constructs comprising same for the expression of recombinant IFN-γ polypeptides therefrom, as described in U.S. Ser. No. 08/765,381 which is incorporated herein by way of reference.




Immunoreactive molecules, in particular polyclonal and monoclonal antibodies have been produced to the recombinant avian IFN-γ polypeptide of the invention.




Additionally, the inventors have discovered that avian IFN-γ administered to birds is capable of promoting the growth of birds, as well as preventing weight loss associated with pathogenic infections when administered thereto as a prophylactic or therapeutic reagent by any means. The present invention clearly encompasses the use of avian IFN-γ as an immunomodulatory molecule both in homologous species and across species boundaries.




Accordingly, one aspect of the present invention provides a method of treatment or prophylaxis of birds exposed to or infected with a pathogenic organism, said method comprising administering thereto an immunoresponsive effective amount of an avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to maintain, stimulate or enhance the immmunoresponsiveness of said bird, wherein said avian IFN-γ cytokine polypeptide is selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




Because of the maintenance, stimulation or enhancement of the immmunoresponsiveness of birds administered with the subject cytokine polypeptide, this aspect of the invention relates further to the enhancement and/or stimulation of an immune response to one or more antigens in a bird, wherein an immunomodulatingly effective amount of an avian IFN-γ cytokine polypeptide is optionally administered with an antigen or pathogenic agent against which an immune response is desired. In such an embodiment of the invention, the administered avian IFN-γ cytokine polypeptide acts essentially as an adjuvant, such as, for example, may be used in a vaccine composition.




A second aspect of the invention provides a method of enhancing the growth performance of a healthy or diseased bird, said method comprising administering to said bird an avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to induce weight gain in said healthy or diseased bird or to prevent weight loss in said diseased bird, wherein said avian IFN-γ cytokine polypeptide is selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




This aspect of the invention particularly relates to the prevention of weight loss associated with coccidiosis of birds, wherein said avian IFN-γ cytokine polypeptide is administered to a bird selected from the group consisting of:




(i) healthy birds that are susceptible to infection by Eimeria spp.;




(ii) asymptomatic birds infected with Eimeria spp.; and




(iii) birds suffering from coccidiosis.




According to this embodiment, it is preferred to administer a composition comprising the avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to induce weight gain in said healthy or infected bird or to prevent weight loss in said infected bird.




The present invention clearly extends to compositions for use in performing the inventive methods supra, such as, for example, those compositions of matter comprising avian IFN-γ cytokine polypeptides and antibodies capable of binding thereto in combination with one or more suitable carriers and/or excipients and/or diluents, in particular those carriers and/or excipients and/or diluents suitable for veterinary use.




Accordingly, a third aspect of the invention provides an antibody molecule that is capable of binding to an avian IFN-γ cytokine polypeptide as described supra, in particular antibodies that bind to chicken IFN-γ.




A fourth aspect of the invention provides a composition for enhancing the growth performance of a bird comprising a carrier, excipient or diluent in combination with an amount of a recombinant avian IFN-γ cytokine polypeptide selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




The invention also provides a vaccine composition for the prophylactic treatment of a bird against a pathogenic organism comprising an antigen in combination with an amount of a recombinant avian IFN-γ cytokine polypeptide selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




In particularly preferred embodiments of the present invention, the inventive compositions described herein utilize recombinant chicken IFN-γ, or cells infected with recombinant FAV expressing chicken IFN-γ, or alternatively, recombinant FAV expressing chicken IFN-γ, or nucleic acid encoding chicken IFN-γ.











BRIEF DESCRIPTION OF THE DRAWINGS





FIG. 1

shows graphical representations comparing the efficacies of the nitrite-release bioassay and ELISA using Mab 80.9 to measure recombinant avian IFN-γ produced in a variety of cell types. ChIFN-γ was produced in COS cells (o), Concanavalin A-activated chicken T cells (CS cells; ▴),


E coli


(▪), or CK cells infected with recombinant FAV expressing ChIFN-γ (X), and either used as an active non-denatured protein (unbroken lines), or alternatively, following heat-denaturation at 65° C. for 15 min in order to reduce the biological activity of ChIFN-γ (broken lines).

FIG. 1A

shows the biological activity of various ChIFN-γ preparations as measured by the HD11 nitrite release assay.

FIG. 1B

shows the quantitation of various ChIFN-γ preparations as measured by ELISA.





FIG. 2

is a graphical representation showing the correlation between biological function of ChIFN-γ, as determined by nitrite release bioassay, and immunological cross-reactivity as determined by sandwich ELISA using Mab 80.9. Sources of rChIFN-γ were as follows: COS cells (▴); Concanavalin A-activated chicken T cells (CS cells; X);


E. coli


native protein(□); CK cells infected with recombinant FAV expressing ChIFN-γ (▪); heat-denatured COS-cell derived ChIFN-γ (∘);


E. coli


protein at room temperature (▾); and heat-denatured


E. coli


derived ChIFN-γ (★).





FIG. 3

shows graphical representations of the half lives of ChIFN-γ as determined by bioassay and ELISA, following intravenous injection (

FIG. 3A

) or intraperitoneal injection (

FIG. 3B

) of 5000 Units of


E coli


-derived ChIFN-γ. The x-axis indicates the time after injection in both figures. The y-axis indicates serum titre of ChIFN-γ.





FIG. 4

provides diagrammatic representations of polyacrylamide gels showing expression of recombinant ChIFN-γ in


E. coli


and subsequent purification. In FIG.


4


A: S, standard Mr markers; Lane 1, crude sonication supernatant; Lane 2, soluble fraction; Lane 3, Ni column flow through; Lane 4 and 5, column washes; Lane 6, eluted recombinant ChIFN-γ. In FIG.


4


B: S, standard Mr markers; Lanes 1-4, purified recombinant ChIFN-γ serially diluted 2-fold (lane 1), 4-fold (lane 2), 8-fold (lane 3) or 16-fold (lane 4).





FIG. 5

provides graphical representations showing biological activity of recombinant ChIFN-γ on chicken (CEF) and turkey cells (TEF). In

FIG. 5A

the capacity of purified recombinant ChIFN-γ (ED: dialyzed to remove imidazole; E: non-dialyzed), to induce nitrite secretion by HD11 chicken macrophages is shown. In

FIG. 5B

; the capacity of purified recombinant ChIFN-γ (ED: dialyzed; E: non-dialyzed) and chicken spleen cell conditioned media (CM) to protect CEFs from virus mediated lysis is shown. In

FIG. 5C

, the capacity of purified recombinant ChIFN-γ (ED: dialyzed; E: non-dialyzed) and recombinant ChIFN-α to protect TEFs from virus mediated lysis is shown.





FIG. 6

is a graphical representation showing stability of recombinant ChIFN-γ following storage at room temperature [6.2D (RT)] or at 40° C. (6.2D) as measured using the nitrite assay.





FIG. 7

is a graphical representation showing biological activity of supernatants from COS cells transfected with single clones of the CC8.1h library that were known to express ChIFN-γ (U.S. Ser. No. 08/765,381). Plasmid pools containing 100 clones were sequentially subpooled into pools of 10 and then into single clones. Clones 148.1.7 and 148.1.9 were transfected into COS cells and ChIFN-γ activity was measured in the supernatant 3 days later. The effect of heating the recombinant ChIFN-γ to 60° C. for 30 min is shown.





FIG. 8

is a graphical representation showing production of recombinant ChIFN-γ. COS cells were transfected with #148 (pool of 100 clones), #148.1 (a pool of 10 clones derived from 148) and #148.1.9 (a single clone derived from 148.1). Supernatant from CC8.1h (AGAL Accession No. N94/46035) is used as a positive control. The effect of heating the supernatants to 60° C. for 30 min is also shown.





FIG. 9

is a graphical representation of the ChIFN-γ activity of CK cells infected with recombinant FAV8 expressing ChIFN-γ derived from plasmid pJJ464, at 1 day, 3 days, 5 days, 7 days and 9 days post-infection (hatched bars). The activity of a negative control sample infected with FAV8 lacking the ChIFN-γ-encoding expression cassette is also indicated (▪). The activity of CK cells infected with recombinant FAV8 expressing ChIFN-γ derived from plasmid pJJ464, following incubation with an antibody that blocks ChIFN-γ activity is also indicated (stippled bars). Data indicate that effective amounts of authentic avian IFN-γ are produced by CK cells infected with rFAV expressing IFN-γ under the control of the FAV MLP.





FIG. 10

provides graphical representations showing the induction of MHC class II antigen Cla expression on HD11 cells by recombinant ChIFN-γ protein.




In

FIG. 10A

, there is provided a graphical representation showing the dosage-dependent increase in Cla on the surface of HD11 cells that were cultured for 24 h in the presence of rChIFN-γ produced by COS cells,


E. coli,


or in a baculovirus system.




In

FIG. 10B

, there is provided a graphical representation showing the dosage-dependent increase in Cla on the surface of HD11 cells that were cultured for 24 h in the presence of rChIFN-γ produced by


E. coli.


The level of Cla expression and nitrite secretion was measured 24 hr after incubation with various concentrations of ChIFN-γ.




In

FIG. 10C

, there is provided a graphical representation showing the dosage-dependent increase in Cla on the surface of HD11 cells that were cultured for 24 h in the presence of rChIFN-γ produced by COS cells. The level of Cla expression and nitrite secretion was measured 24 hr after incubation with various concentrations of ChIFN-γ.





FIG. 11

is a diagrammatic representation of a Western Blot showing binding of rabbit anti-ChIFN-γ sera to recombinant ChIFN-γ. Recombinant ChIFN-γ was electrophoresed on an acrylamide gel, blotted onto nitrocellulose which was then cut into strips. Individual strips were incubated in sera; (76 P/B, normal rabbit serum; ITA, serum raised against an irrelevant antigen; sera 76, 77, 78, and 79 are sera from 4 rabbits immunized with recombinant ChIFN-γ).





FIG. 12

provides graphical representations showing the ability of rabbit anti-recombinant ChIFN-γ antisera to block the function of both recombinant (r) and native (n) ChIFN-γ as measured using either the nitrite assay

FIG. 12A

;

FIG. 12B

) or using the CEF assay (FIG.


12


C).





FIG. 13

provides graphical representations showing the ability of mouse anti-recombinant ChIFN-γ antisera (

FIG. 13A

) and purified rabbit anti-recombinant ChIFN-γ IgG (

FIG. 13B

) to block the function of native ChIFN-γ in the nitrite assay.





FIG. 14

provides graphical representations showing the inhibition of ChIFN-γ biological activity by monoclonal antibodies. In

FIG. 14A

, COS cell-derived rChIFN-γ (10 U/ml) was incubated for 1 hr in the presence of the various Mabs indicated in the Figure, followed by the addition of HD11 cells and the determination of nitrite release therefrom.





FIG. 14B

shows the percentage inhibition by Mab 80.9 of ChIFN-γ biological activity derived from COS cells,


E. coli,


CS cells, and CK cells infected with rFAV expressing ChIFN-γ. Isolated rChIFN-γ (10 U/ml) samples, or CK cells infected with rFAV expressing rChIFN-γ, were incubated for 1 hr in the presence of various concentrations of Mab 80.9, followed by the addition of HD11 cells and the determination of nitrite release therefrom.

FIG. 14C

shows competition ELISA results for various anti-ChIFN-γ Mabs indicated in the figure. Biotinylated Mab 80.9 (bio80.9; 0.5 ug/ml) was mixed with varying concentrations of different non-labelled Mabs prior to incubation in wells coated with


E. coli


-derived ChIFN-γ. After washing, the amount of bio80.9 bound to the wells was detected by addition of HRP-streptavidin followed by tetra-methyl benzidine (TMB) peroxidase substrate.





FIG. 15

is a graphical representation showing the effect of recombinant ChIFN-γ treatment in vivo on the antibody response to SRBC. Groups of birds were injected with 200 μl (Groups 1 and 2) or 20 μl (Groups 3 and 4) of SRBC and re-immunised after 3 weeks. Groups 1 and 3 were treated with recombinant ChIFN-γ (on the day before, on the day of, and on the day after primary immunisation) and Groups 2 and 4 were not treated. HA titres for total Ig and for IgG (2 mercaptoethanol-resistant Ig titres) were determined weekly for 6 weeks. A, Total Ig HA titres 3 weeks after the primary immunisation; B. Total Ig HA titres 3 weeks after secondary immunisation; C, Total Ig HA titres (there are significant differences between Group 1 and 2 and between Group 3 and 4: *p<0.02, **p<0.05, ***p<0.005, ****p<0.002); D, IgG HA titres.





FIG. 16

is a graphical representation showing the effect of recombinant ChIFN-γ treatment in vivo on the ratio of bursa to body weight 7 days following infection with IBDV.





FIG. 17

is a graphical representation showing the effect of recombinant ChIFN-γ treatment in vitro on the ability to protect CEFs from infection with IBDV. CEFs were prepared as described for the CEF interferon assay. Recombinant ChIFN-γ and IBDV were added to the cultures together. Cell survival was measured 3 days later on a scale of 0 to 4, where 0 represents the level of cell survival observed in the presence IBDV and the absence of IFN (<5% cell survival) and 4 represents the level of cell survival observed in the absence of IBDV (>90% cell survival).





FIG. 18

is a graphical representation showing the effect of recombinant ChIFN-γ treatment in vivo on weight gain. Groups of 10 birds were injected with recombinant ChIFN-γ or with diluent and their body weight was monitored.





FIG. 19

provides graphical representations showing the effect of recombinant ChIFN-γ treatment in vivo on weight gain. Birds were injected with recombinant ChIFN-γ or with diluent and their body weight was determined at days 6 (

FIG. 19A

) and 12 (FIG.


19


B). Weight gain between days 6 and 7 is shown in FIG.


19


C and between days 7 and 10 is shown in FIG.


19


D.





FIG. 20

provides graphical representations showing the effect of recombinant ChIFN-γ treatment in vivo on weight gain during infection with


E. acervulina.


Birds were injected with recombinant ChIFN-γ or with diluent, infected with


E. acervulina


oocytes, and their body weight was determined at day 8 (

FIG. 20A

) and day 11 (

FIG. 20B

) post-infection. Changes in weight between days 4 and 5 are shown in

FIG. 20C

, and changes in weight between day 6 and day 8, are shown in FIG.


20


D.





FIG. 21

is a graphical representation showing the effect of recombinant ChIFN-γ treatment in vivo on weight gain in non-infected birds and those infected with coccidiosis.





FIG. 22

is a graphical representation showing ELISA detection of ChIFN-γ in the serum of chickens following i/v, s/c or i/p injection of 5000 Units of


E coli


-derived ChIFN-γ. Similar results were obtained in 2 experiments.





FIG. 23

is a graphical representation showing the quantization of biological activity of ChIFN-γ modified by CC-PEG. Nitrite release from HD11 cells was determined following treatment of


E. coli


-produced rChIFN-γ protein with 5-fold, 10-fold, and 50-fold molar excesses of CC-PEG. Data indicate no difference in activity compared to unmodified ChIFN-γ.





FIG. 24

is a graphical representation showing the quantization of biological activity of ChIFN-γ following treatment with a 30-fold molar excess of CC-PEG (□) compared to unmodified ChIFN-γ (∘), as determined by ELISA.





FIG. 25

is a graphical representation showing the quantization of biological activity of ChIFN-γ following treatment with a 30-fold molar excess of CC-PEG (▪), or a 30-fold molar excess of NC-PEG (∘), compared to unmodified ChIFN-γ (□), as determined by ELISA.





FIG. 26

is a graphical representation comparing the half-lives of CC-PEG modified ChIFN-γ (∘) and unmodified ChIFN-γ (▪) in the serum of chickens following intravenous injection thereto, as determined by ELISA.





FIG. 27

is a graphical representation comparing the half-lives of CC-PEG modified ChIFN-γ (∘) and unmodified ChIFN-γ (▪) in the serum of chickens following intraperitoneal injection thereto, as determined by ELISA.





FIG. 28

provides graphical representations showing the ability of ChIFN-γ and ChIFN-α to synergise. In

FIG. 28A

, the IFN activity is determined using the CEF assay. In FIG.


28


B and

FIG. 28C

, IFN activity is measured using the nitrite assay. Recombinant ChIFN-γ was serially diluted in the presence of limiting amounts of recombinant ChIFN-α or natural ChIFN-β.











DETAILED DESCRIPTION OF THE INVENTION




1. General




Recombinant avian IFN-γ or interferon-like molecules contemplated herein or cells expressing same, will find particular application in the intensive livestock industries such as the live animal export trade, feed-lots and intensive rearing industries. In particular, livestock such as poultry, domestic birds and game birds are highly susceptible to infectious diseases, such as those transmitted by viruses, bacteria or Mycoplasma. Important viral infectious agents include infectious bursal disease virus, avian infectious bronchitis virus, avian infectious laryngeotracheitis virus, infectious bronchitis virus, Newcastle disease virus, Marek's Disease virus, chicken anemia virus or avian influenza virus, amongst others. Important bacterial agents include


E. coli,


Salmonella ssp. or Eimeria ssp., amongst others. Conditions in poultry, domestic bird or game birds for which treatment might be required include infectious disease induced by any viral or bacterial agent such as those discussed supra, cancer, immunosuppression, allergy and to enhance or suppress reproductive systems. Conditions would also include situations where animals are in an immuno-compromised state such as during or following stress, due to overcrowding and transport process, changes in climate.




Whilst not being bound by any theory or mode of action, avian cytokines such as IFN-γ or interferon-like molecules, in particular ChIFN-γ induce macrophages to become activated, as measured by the increased expression of Class II molecules on their surfaces and/or the increased secretion of active nitrogen intermediates such as nitrites, thereby increasing the capacity of the immune system to destroy invading pathogens and to enhance the immune response thereto.




The present invention provides an opportunity to enhance the immune responsiveness and growth performance of birds and in particular poultry, domestic birds or game birds, by the administration of an avian cytokine, in particular a IFN-γ such as ChIFN-γ or a derivative thereof, either directly or via the expression of recombinant genetic sequences. This is of particular importance since most subunit and synthetic peptide vaccines are only weakly antigenic. The administration of the cytokines may be alone, in combination with an antigen or as a fusion molecule. Administration may be via an attenuated virus, recombinant viral vector or bacterial vector or may be by administration of the cytokine by, for example, injection or oral ingestion (e.g. in medicated foodstuff).




2. Description of the Preferred Embodiments




One aspect of the present invention provides a method of treatment or prophylaxis of birds exposed to or infected with a pathogenic organism, said method comprising administering thereto an immunoresponsive-effective amount of an avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to maintain, stimulate or enhance the immmunoresponsiveness of said bird, wherein said avian IFN-γ cytokine polypeptide is selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




By prophylaxis” is meant the prevention of infection by a viral or bacterial pathogen of birds, such as, for example, that achieved by vaccination.




The term “avian” means a member of the class of vertebrates commonly referred to as birds. As used herein, the term “avian” includes both sexes and all developmental stages of poultry species, domestic birds and game birds selected from the list comprising chickens, turkeys, bantams, quails, guinea fowl, ducks, geese, ostriches, emus, pigeons, canaries, budgerigars, parrots and finches, amongst others.




Hereinafter the term “cytokine polypeptide” shall be taken to refer to a polypeptide molecule comprising at least one subunit of a biologically-active protein which possesses one or more of the characteristic biological features of a cytokine, in particular the ability to affect the functions of a cell which functions in the immune system of an animal.




Hereinafter the term “IFN-γ” shall be taken to refer to a cytokine polypeptide as hereinbefore defined wherein said cytokine possesses at least one, preferably at least two, more preferably at least three, even more preferably at least four, still even more preferably at least five and most preferably six of the following characteristic properties:




(i) It is capable of preventing virus-mediated lysis of an avian cell such as, but not limited to a chicken embryonic fibroblast cell or a turkey embryonic fibroblast cell;




(ii) It is sensitive to treatment comprising high temperature, preferably temperatures of at least 500° C., more preferably at least 60° C.;




(iii) It is sensitive to exposure to low pH, preferably pH values between 1 and 6, more preferably pH values between 1 and 3, in particular a pH value of 2.0;




(iv) It is capable of inducing macrophages to secrete reactive nitrogen intermediates such as nitrite, nitrate or nitric oxide, amongst others;




(v) It functions as an immunomodulatory molecule in an avian species; and




(vi) It functions as a growth-enhancing or growth-promoting agent in an avian species.




Reference herein to “IFN-γ” shall also be taken to include all possible fusion molecules between a said polypeptide as hereinbefore defined and another polypeptide, in particular a Type I interferon molecule such as IFN-α or IFN-β or, alternatively, a second Type II interferon or Type II interferon-like molecule.




As used herein, the term “immunomodulatory molecule” shall be taken to refer to a composition of matter that is capable of altering any immune response of an animal to any antigen, such as, for example, a composition of matter that is a peptide, polypeptide, protein, vaccine, vaccine, hapten, adjuvant, or organism, amongst others. Accordingly, an “immunomodulatory molecule” includes a peptide, polypeptide, protein, subunit vaccine, or killed organism that is capable of altering the immune response of an animal to an agent, such as, for example, a disease-promoting agent, an infectious agent, or a cancer-inducing agent, amongst others. The present invention is particularly directed to avian IFN-γ polypeptides which are at least capable of altering an immune response in a bird or alternatively a fusion molecule comprising same which is at least capable of altering an immune response in a bird or mammal to an antigen or infectious agent such as, but not limited to infectious bursal disease virus (IBDV), infectious bronchitis virus, avian infectious laryngeotracheitis virus, infectious bronchitis virus, Newcastle disease virus, Marek's Disease virus, chicken anemia virus, avian influenza virus,


E. coli,


Salmonella ssp., Eimeria ssp. or Mycoplasma ssp. amongst others, to alleviate symptoms associated therewith, in particular reduced growth performance.




As used herein, the terms “immunoresponsive-effective amount” and “immunomodulatingly effective amount” or similar, shall be taken to refer is an amount of cytokine sufficient to effect immunomodulation in a target animal or to enhance the ability of the immune system to develop an effective immune response to an antigen or pathogenic organism and/or to enhance the immunogenicity of an antigen administered to said animal in a vaccine composition and/or to generally enhance the immunocompetence of the animal.




The administered IFN-γ molecule according to the present invention may be any Type II interferon molecule, preferably an avian IFN-γ polypeptide, the only requirement being that said Type II interferon molecule possesses functional and/or structural similarity to an avian IFN-γ cytokine polypeptide, such as, for example, sufficient structural similarity so as to be immunologically cross-reactive with an avian IFN-γ polypeptide, or to be at least 40% identical thereto at the amino acid sequence level as determined using any algorithm known by those skilled in the art.




The term “growth-enhancing or growth promoting agent” or similar term shall be taken to refer to the capability of a substance to lead to increased weight in an avian species or to prevent weight losses normally detectable during or following pathogenic infection of an avian species, when administered thereto, either in any form such as a vaccine, adjuvant, recombinant polypeptide, synthetic polypeptide, pharmaceutical composition or therapeutic foodstuff, amongst others.




The present inventors have shown that an avian IFN-γ cytokine polypeptide may function as a growth-enhancing or growth-promoting agent in an avian species, and that it may stimulate, enhance or maintain the immmunoresponsiveness of a bird, and the possibility exists that the growth-promoting effect of said polypeptide may be a consequence of immune-enhancement, however the present invention is not to be limited by any theory or mode of action of said polypeptide.




In a preferred embodiment, the avian IFN-γ cytokine polypeptide is derived from a species of poultry selected from the list comprising chickens, ducks, geese, turkeys, bantams, quails or guinea fowl, amongst others. In a particularly preferred embodiment, the avian IFN-γ cytokine polypeptide is derived from chickens.




As used herein, the term “derived from” shall be taken to indicate that a particular integer or group of integers has originated from the species specified, but has not necessarily been obtained directly from the specified source.




Several recombinant avian IFN-γ cytokine polypeptides have now been described, including those polypeptides derived from chickens (U.S. Ser. No. 08/765,381) and having the amino acid sequence set forth herein as SEQ ID NO: 2, ducks (SEQ ID NO: 3; personal communications of Dr Ursula SCHULTZ of Scripps Research Institute 10550 North Torrey Pines Road, La Jolla, Calif. 92037, United States of America); turkey (SEQ ID NO: 4; Kaiser et al., 1990); Ring-necked pheasant (SEQ ID NO: 5), Japanese quail (SEQ ID NO: 6); and Guinea fowl (SEQ ID NO: 7). All of the gene sequences encoding these Polypeptides have been isolated based upon the nucleotide sequence of the chicken IFN-γ cDNA set forth in the present specification as SEQ ID NO: 1. The IFN-γ activity of recombinant duck IFN-γ-encoding clone has been confirmed by measuring the anti-viral protection conferred in both chicken and duck cells and, as expected for authentic duck IFN-γ, recombinantly-expressed duck IFN-γ has significant anti-viral activity in both duck cells and chicken cells, however approximately 32-fold the anti-viral activity in duck cells that is observed in chicken cells. Recombinant turkey IFN-γ also has anti-viral activity in chicken cells.




There are no gaps in the amino acid sequence alignments between chicken, duck, Guinea fowl, pheasant, quail and turkey IFN-γ polypeptides and these sequences are all highly-conserved. Based on the proportion of identical residues in the alignment between chicken and duck IFN-γ polypeptides, there is 67% amino acid sequence identity between these sequences over the entire length of chicken IFN-γ (i.e. amino acids −19 to 145 of SEQ ID NO: 2 in the present specification) and 64% identity in the mature secreted protein region (i.e. amino acids 1 to 145 of SEQ ID NO: 2 in the present specification). The derived amino acid sequences of the Guinea fowl, pheasant, quail and turkey IFN-γ polypeptides have 87.8% (guinea fowl) to 97.6% (turkey and pheasant) amino acid sequence identity with chicken IFN-γ over their entire length (i.e. amino acids corresponding to positions −19 to 145 of SEQ ID NO: 2 in the present specification) and 86.2% (guinea fowl) to 97.2% (turkey and pheasant) identity in the mature secreted protein region (i.e. amino acids corresponding to positions 1 to 145 of SEQ ID NO: 2 in the present specification). These percentage identities to chicken IFN-γ were determined by simple calculation of the number of identical residues, expressed as a proportion of the total number of residues in the aligned sequences, because of the absence of any gaps in the alignments.




In contrast to the high homology between avian IFN-γ polypeptide, the aligned avian and mammalian IFN-γ polypeptides set forth in

FIG. 13

of the present specification reveals only 30% identity using the ClustalW programme and the algorithm of Thompson et al., 1994) or alternatively, 32% calculated using the ClustalV programme.




Based upon the high sequence conservation and function of the various IFN-γ polypeptides, it will be apparent to those skilled in the art that the present invention is readily performed using any avian IFN-γ polypeptide.




Additional avian IFN-γ polypeptides may be obtained by standard procedures known to those skilled in the art, such as, for example, by isolating the corresponding nucleic acid molecules using PCR or hybridisation approaches, and expressing the recombinant polypeptides therefrom. For example, homologous avian IFN-γ-encoding nucleic acid molecules may be obtained by hybridising avian nucleic acid under at least low stringency conditions to the nucleic acid molecule set forth in SEQ ID NO: 1, or to a complementary strand thereof. A “low stringency” is defined herein as being a hybridisation and/or a wash carried out in 6×SSC buffer, 0.1% (w/v) SDS at 28° C., or equivalent. Those skilled in the art will be aware that the stringency is increased by reducing the concentration of SSC buffer, and/or increasing the concentration of SDS and/or increasing the temperature of the hybridisation and/or wash, and that the conditions for hybridisation and/or wash may vary depending upon the nature of the hybridisation membrane or the type of hybridisation probe used. Such conditions are well understood by one normally skilled in the art. For the purposes of clarification of the parameters affecting hybridisation between nucleic acid molecules, reference is found in Ausubel et al (1987), which is herein incorporated by reference.




Particularly preferred homologues of the chicken IFN-γ gene exemplified herein as SEQ ID NO: 1 may be obtained by hybridization under conditions of at least moderate stringency (i.e. 2×SSC buffer, 0.1% (w/v) SDS at 28° C., or equivalent) with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1. Such homologues clearly include nucleotide sequences that are degenerate with SEQ ID NO: 1 (i.e. they encode the amino acid sequence set forth herein as SEQ ID NO: 2), and nucleic acid molecules that encode functional IFN-γ polypeptides and comprise at least 10 contiguous amino acids of SEQ ID NO: 2.




In the case of PCR, one or more nucleic acid primer molecules of at least about 10 nucleotides in length derived from the Ch IFN-γ gene may be used to isolate such variant sequences.




Preferably, the administered polypeptide is a recombinant molecule. By “recombinant molecule” or “recombinant polypeptide” is meant a peptide, oligopeptide, polypeptide, protein or enzyme molecule that is produced by expressing non-endogenous nucleic acid encoding IFN-γ in a cell, tissue, organ or whole organism, such as, for example, the expression of foreign nucleic acid in a cell tissue, organ or whole organism that is different from the original cell, tissue, organ or organism from which said nucleic acid was derived, albeit not necessarily of a different species. Accordingly, a recombinant chicken IFN-γ polypeptide may be produced by expressing chicken IFN-γ-encoding nucleic acid in a chicken cell provided that said chicken cell is not the same cell from which said nucleic acid was originally derived (i.e. Provided that the nucleic acid is non-endogenous), or alternatively, by expressing chicken IFN-γ-encoding nucleic acid in a non-chicken cell.




Several means may be employed to produce a recombinant polypeptide. Generally, a recombinant avian IFN-γ polypeptide will be produced following transfection of cells with the nucleic acid molecule encoding said polypeptide, wherein the introduced nucleic acid is maintained as an extrachromosomal element for a time and under conditions sufficient for expression to occur. In an alternative embodiment, the nucleic acid molecule may be expressed following its integration into the genome of a cell as an addition to the endogenous cellular complement of cytokine genes. Generally, to obtain expression, the introduced nucleic acid molecule contains a promoter sequence derived from the same or another gene, which regulates the expression of the IFN-γ gene sequence contained therein. Means for the introduction of nucleic acid to prokaryotic and eukaryotic cells will be well-known to those skilled in the art.




Preferably, the nucleic acid molecule that is used to produce a recombinant avian IFN-γ polypeptide comprises a sequence of nucleotides substantially the same as or complementary to the nucleotide sequence set forth in SEQ ID NO: 1 or a homologue, analogue or derivative thereof including any single or multiple nucleotide substitutions, deletions and/or additions thereto. For the purposes of nomenclature, the nucleotide sequence set forth in SEQ ID NO: 1 relates to the chicken IFN-γ cDNA sequence, referred to hereinafter as the “ChIFN-γ gene”, which is expressed in activated T cells and NK cells to produce a polypeptide which is capable of stimulating macrophages to produce reactive nitrogen intermediates such as nitric oxide, nitrate or nitrite.




For the present purpose, “homologues” of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as the nucleic acid molecule of the present invention or its complementary nucleotide sequence, notwithstanding the occurrence within said sequence, of one or more nucleotide substitutions, insertions, deletions, or rearrangements.




“Analogues” of a nucleotide sequence shall be taken to refer to an isolated nucleic acid molecule which is substantially the same as a nucleic acid molecule of the present invention or its complementary nucleotide sequence, notwithstanding the occurrence of any non-nucleotide constituents not normally present in said isolated nucleic acid molecule, for example carbohydrates, radiochemicals including radionucleotides, reporter molecules such as, but not limited to DIG, alkaline phosphatase or horseradish peroxidase, amongst others.




“Derivatives” of a nucleotide sequence shall be taken to refer to any isolated nucleic acid molecule which contains significant sequence similarity to said sequence or a part thereof. Generally, the nucleotide sequence is subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or insertions. Nucleotide insertional derivatives of the nucleotide sequence of the present invention include 5′ and 3′ terminal fusions as well as intra-sequence insertions of single or multiple nucleotides or nucleotide analogues. Insertional nucleotide sequence variants are those in which one or more nucleotides or nucleotide analogues are introduced into a predetermined site in the nucleotide sequence of said sequence, although random insertion is also possible with suitable screening of the resulting product being performed. Deletional variants are characterised by the removal of one or more nucleotides from the nucleotide sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide or nucleotide analogue inserted in its place.




The present inventors have produced several N-terminal and C-terminal addition and deletion variants of the chicken IFN-γ cDNA sequence set forth in SEQ ID NO: 1 of the present specification. In particular, the inventors have produced variants wherein the N-terminal 4 amino acid residues and/or the C-terminal 12 amino acid residues of chicken IFN-γ have been deleted and/or an additional 8 amino acid residues in the form of a polyhistidine tag (His-His-His-His-His-His-Gly-Ser) have been added to the N-terminal or C-terminal ends of the chicken IFN-γ polypeptide. The variant IFN-γ polypeptides were produced in


E. coli


cells, or alternatively, expressed in tobacco plants using the tobacco mosaic virus (TMV) vector and their specific activities determined using the HD11 nitrite assay described in Example 6 of the present specification. Accordingly, the present inventors have shown that there is no difference in IFN-γ specific activity between the variant sequences (His1-Cys145 with a C-terminal or N-terminal tag; His1-Lys133 with or without an N-terminal tag; and Ser5-Cys145 with an N-terminal tag) and the wild-type mature chicken IFN-γ polypeptide (i.e. His1-Cys145 without any N-terminal or C-terminal tag). There is also no difference in the activities of wild-type mature chicken IFN-γ or the variant sequences over a wide range of dilutions. Moreover, the IFN-γ activity of the variant sequences expressed from TMV in tobacco plant cells, which is inhibited by antisera prepared against recombinant chicken IFN-γ, is not significantly different from the activity of the wild-type mature chicken IFN-γ polypeptide over a wide range of dilutions. Accordingly, derivatives of SEQ ID NO: 2 can be produced which exhibit biological-activity in a wide range of cell and tissue types, without undue experimentation, in particular derivatives that comprise up to 4 amino acids deleted from the N-terminus and/or up to 12 amino acids deleted from the C-terminus and/or up to 8 amino acids added to the N-terminus or the C-terminus of said amino acid sequence.




The nucleic acid that is used to produce a recombinant polypeptide may comprise RNA or DNA or a combination thereof. Preferably, the nucleic acid is a gene that encodes an avian IFN-γ polypeptide. Reference herein to a “gene”, including the “ChIFN-γ gene”, is to be taken in its broadest context and includes:




(i) a classical genomic gene consisting of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. introns, 5′- and 3′-untranslated sequences); and/or




(ii) mRNA or cDNA corresponding to the coding regions (i.e. exons) optionally comprising 5′- or 3′-untranslated sequences of the gene; and/or




(iii) synthetic or fusion nucleic acid molecules encoding all or part of a functional product.




Synthetic avian IFN-γ genes may be derived from a naturally-occurring IFN-γ gene by standard recombinant techniques. Generally, an IFN-γ gene may be subjected to mutagenesis to produce single or multiple nucleotide substitutions, deletions and/or additions. Nucleotide insertional derivatives of the IFN-γ cytokine gene include 5′ and 3′ terminal fusions as well as intra-sequence insertions of single or multiple nucleotides. Insertional nucleotide sequence variants are those in which one or more nucleotides are introduced into a predetermined site in the nucleotide sequence although random insertion is also possible with suitable screening of the resulting product. Deletional variants are characterised by the removal of one or more nucleotides from the sequence. Substitutional nucleotide variants are those in which at least one nucleotide in the sequence has been removed and a different nucleotide inserted in its place. Such a substitution may be “silent” in that the substitution does not change the amino acid defined by the codon. Alternatively, substituents are designed to alter one amino acid for another similar acting amino acid, or amino acid of like charge, polarity, or hydrophobicity.




To produce a recombinant avian IFN-γ polypeptide, the nucleic acid molecule encoding said polypeptide may be conveniently positioned within a gene construct, in operable connection with a suitable promoter sequence capable of conferring expression in the cell, tissue, organ or organism in which expression is desired.




By “gene construct” is meant a gene as hereinbefore defined operably connected to one or more non-encoding nucleotide sequences, such as, for example, a promoter sequence, an origin of replication or other sequence required for maintenance and/or replication in a cell, tissue, organ or whole organism. The term “gene construct” clearly includes within its scope isolated an isolated or synthetic nucleic acid molecule (or more particularly, an oligonucleotide) containing an IFN-γ-encoding sequence that is operably connected to a promoter; and a plasmid vector, cosmid vector, bacteriophage vector, virus vector, or recombinant virus comprising said IFN-γ-encoding sequence. As used herein, the term “vector” shall be taken to mean a nucleic acid molecule that is capable of being used to express an avian IFN-γ polypeptide in a cell, tissue, organ or organism (also known as an “expression vector”) and preferably being maintained and/or replicated in a cell, tissue, organ or organism, and/or inserted into the chromosome of a cell, tissue, organ or organism.




Any number of expression vectors can be employed depending on whether expression is required in a eukaryotic or prokaryotic cell or a virus particle. Furthermore, it is well-known in the art that the promoter sequence used in the expression vector will also vary depending upon the level of expression required and whether expression is intended to be constitutive or regulated.




Preferred expression vectors are virus vectors. For expression in avian cells, it is particularly preferred to use a fowl adenovirus vector (FAV), such as described in U.S. Ser. Nos. 08/448,617 and 09/272,032, the contents of which are incorporated herein by way of reference. In a particularly preferred embodiment, the vector comprises the right-hand end of FAV serotype 8 (hereinafter “FAV8”). The entire nucleotide sequence of the right-hand end of FAV8 is set forth herein as SEQ ID NO: 8. The entire nucleotide sequence of the FAV8 expression vector is also contained in GenBank Accession No. AF155911.




More particularly, the expression vector is plasmid pJJ383, which contains an 8.5 kilobase NheI fragment of the right-hand end of FAV8 wherein nucleic acid encoding IFN-γ in operable connection with a suitable promoter sequence may be substituted for the 1.3 kilobase SnaBI/SmaI FAV8 fragment of SEQ ID NO: 8, as is described in detail in U.S. Ser. No. 09/272,032.




For expression in plant cells, it is particularly preferred to use a tobacco mosaic virus (TMV) vector, however any plant virus-derived vector system may be used, such as, for example, Gemini virus vectors, nanovirus vectors, and caulimovirus vectors, amongst others. Those skilled in the expression of proteins in plant cells will be aware of publicly available vectors within the scope of this description.




For expression in eukaryotic cells, the gene construct generally comprises, in addition to the nucleic acid molecule of the invention, a promoter and optionally other regulatory sequences designed to facilitate expression of said nucleic acid molecule. The promoter may be derived from a genomic clone encoding an avian IFN-γ molecule, in particular ChIFN-γ or, alternatively, it may be a heterologous promoter from another source. Promoter sequences suitable for expression of genes in eukaryotic cells are well-known in the art. In a preferred embodiment, the promoter is capable of expression in an avian cell.




In connection with this invention, a nucleic molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1 has been cloned into the plasmid vector pCDNA1, which is suitable for expression in eukaryotic COS cells, to produce the plasmid pCDNA3/avian G-IFN. Isolated COS cells containing the pCDNA3/avian G-IFN gene construct have been deposited on Feb. 28, 1995 pursuant to and in satisfaction of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, with the Australian Government Analytical Laboratories (AGAL), 1 Suakin Street, Pymble, New South Wales 2073, Australia, under AGAL Accession No. N95/12388.




Promoter sequences and culture conditions for cells or virus particles which produce high levels of expression are particularly preferred, and, according to this embodiment of the invention, it is particularly preferred for such promoter sequences to be capable of expressing avian IFN-γ polypeptide for a time and at a level sufficient to produce an immunomodulatingly-effect amount of said polypeptide. Those skilled in the art will be aware that highly-active constitutive promoters will be particularly preferred. Such promoter sequences will be well-known to those skilled in the relevant art.




Particularly preferred promoters suitable for expression in animal cells, in particular avian cells, include the SV40 major later promoter (MLP), FAV major later promoter (MLP), cytomegalovirus immediate early promoter (CMVIE), or human adenovirus major late promoter, amongst others. Particularly preferred promoters for use in plant cells include the CaMV 35S or 19S promoter sequences, and nanovirus promoters, amongst others.




The prerequisite for producing intact polypeptides in


E. coli


is the use of a strong promoter with an effective ribosome binding site. Typical promoters suitable for expression in bacterial cells such as


E. coli


include, but are not limited to, the lacz promoter, temperature-sensitive λ


L


or λ


R


promoters, T7 promoter or the IPTG-inducible tac promoter. A number of other vector systems for expressing the nucleic acid molecule of the invention in


E. coli


are well-known in the art and are described for example in Ausubel et al (1987) or Sambrook et al (1989).




Numerous plasmid vectors with suitable promoter sequences for expression in bacteria and efficient ribosome binding sites have been described, such as for example, pKC30 (λL: Shimatake and Rosenberg, 1981). pKK173-3 (tac: Amann and Brosius, 1985), pET-3 (T7: Studier and Moffat, 1986) or the pQE series of expression vectors (Qiagen, Calif.), amongst others.




In connection with this invention, a nucleic molecule comprising the nucleotide sequence set forth in SEQ ID NO: 1 has been cloned into a plasmid vector suitable for expression in a bacterial cell and transformed into the bacterium


Escherichia coil


to produce


E. coli


strain pQE ChIFN-γ 3.1. The


E. coli


strain pQE ChIFN-γ3.1 has been deposited on Feb. 16, 1996 pursuant to and in satisfaction of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure, with the Australian Government Analytical Laboratories (AGAL), 1 Suakin Street, Pymble, New South Wales 2073, Australia, under AGAL Accession No. N96/9464.




In an alternative embodiment, the present invention extends to a gene construct comprising a nucleic acid molecule which encodes or is complementary to a nucleic acid molecule which encodes an avian cytokine polypeptide or a homologue, analogue or derivative thereof, wherein said polypeptide is a fusion polypeptide between a IFN-γ or IFN-γ-like molecule and either a second IFN-γ or interferon-like molecule or a Type I interferon selected from the list comprising IFN-α, IFN-β, Ch IFN-α or Ch IFN-β, amongst others. To produce such a fusion polypeptide, the nucleic acid molecule which encodes a first coding region comprising an avian cytokine polypeptide or a homologue, analogue or derivative thereof is cloned adjacent to a second coding region, optionally separated by a spacer nucleic acid molecule such that the first coding region and the second coding region are in the same open reading frame, with no intervening stop codons between the two coding regions. When translated, the polypeptide thus produced comprises a fusion between the polypeptide products of the first and second coding regions. A gene construct which encodes a fusion polypeptide further comprises at least one start codon and one stop codon, capable of being recognised by the cell's translational machinery in which expression is intended. Methods for the production of a fusion polypeptide are well-known to those skilled in the art.




Recombinantly-produced avian IFN-γ may be produced in a wide range of cell types. Examples of eukaryotic cells contemplated herein to be suitable for expression include avian, mammalian, yeast, insect, plant cells or cell lines such as COS, VERO, HeLa, mouse C127, Chinese hamster ovary (CHO), WI-38, baby hamster kidney (BHK) or MDCK cell lines. In particular, biologically-active chicken IFN-γ may be produced in


E. coli


cells, yeast cells, tobacco cells, COS cells, and chick kidney (CK) cells. Such cell lines are readily available to those skilled in the art.




Suitable prokaryotic cells include Corynebacterium, salmonella,


Escherichia coli,


Bacillus sp. and Pseudomonas sp, amongst others. Bacterial strains which are suitable for the present purpose are well-known in the relevant art (Ausubel et al, 1987; Sambrook et al, 1989).




According to the present invention, recombinant avian IFN-γ is generally produced according to the method comprising:




(i) introducing into said cell a gene construct comprising a nucleic acid molecule which encodes or is complementary to a nucleic acid molecule which encodes said avian cytokine, placed under the control of a suitable promoter sequence;




(ii) culturing said cell for a time and under conditions sufficient for said nucleic acid molecule to be expressed; and




(iii) optionally isolating from said cell said recombinant cytokine molecule.




The present invention is of particular use in the treatment or prophylaxis of poultry, domestic birds or game birds against infection by pathogens selected from the list comprising infectious bursal disease virus (IBDV), avian infectious bronchitis virus, avian infectious laryngeotracheitis virus, infectious bronchitis virus, Newcastle disease virus, Marek's Disease virus, chicken anemia virus, avian influenza virus,


E. coli,


Salmonella ssp., Eimeria ssp. or Mycoplasma ssp. amongst others.




The avian cytokine of the present invention may be administered throughout the life cycle of a bird for which treatment or prophylaxis is indicated. The developmental stage of the bird during which treatment or prophylaxis is most effective will vary depending upon the nature of the pathogen against which protection is sought, including its mode of transmission and period of highest infectivity. By “period of highest infectivity” is meant the developmental stage of the host during which it is most vulnerable to attack by a particular pathogen and/or during which there is a greater probability of incurring livestock losses or reduced productivity as a result of the pathogen infection. The parameters affecting optimum developmental stages of animals for administration of the subject cytokines will be well-known to those skilled in the art.




Accordingly, the method of treatment or prophylaxis of the present invention extends to administration of the subject avian cytokine at any developmental stage in the life cycle of poultry, domestic or game birds for which treatment or prophylaxis is indicated.




The cytokine of the invention may be administered by any means including for example, by injection either in ovo or post-hatching by injection such as intra-peritoneal, intra-dermal, intra-muscular, intra-ocular, intra-venous, subcutaneous or other injection means, by ingestion as a medicated foodstuff or therapeutic foodstuff or by introducing to said avian an isolated nucleic acid molecule which encodes or is complementary to a nucleic acid molecule which encodes said cytokine or, alternatively, a vector comprising a gene construct capable of expressing said cytokine in vivo or in ovo, for example a live recombinant viral vector, live recombinant bacterial vector.




Wherein the cytokine of the invention is administered via the introduction of an isolated nucleic acid molecule encoding said cytokine, such as a DNA or RNA molecule, or a vector comprising a gene construct capable of expressing said cytokine, the nucleic acid molecule or gene construct must be transcribed and translated to produce the biologically-active cytokine molecule following its administration to an appropriate avian subject.




Advances in slow-release technology and the development of live non-pathogenic bacteria and viruses as delivery vectors for these molecules will ensure their cost-effectiveness when administered to poultry, domestic birds or game birds. They may also be used in nucleic acid vaccination. Accordingly, the avian cytokine or vaccine of the present invention may also be delivered by genetic means. For example, recombinant avian ChIFN-γ may be encoded by a gene construct present in a delivery system such as a virus, yeast, bacterium, protozoan, insect, avian or mammalian cell. The expression of such a delivery system in a target animal will enable delivery of the recombinant avian cytokine.




It will be apparent from the disclosure herein that the administered avian IFN-γ polypeptide, with or without additional Type I or Type II molecules, or alternatively, as a fusion polypeptide with another cytokine polypeptide, has application as a natural adjuvants for vaccines, particularly for subunit or synthetic peptide vaccines produced by recombinant DNA technology.




The term “adjuvant” as used herein shall be taken to mean a substance that, when administered to an animal in combination with a second substance or antigen, enhances the production of immunointeractive molecules, such as antibodies, which recognise the second substance or antigen molecule. An adjuvant may be used therapeutically to produce antibodies against small amounts of antigen or to prolong the period of antibody production or to increase the amount of antibody produced.




According to this embodiment, an adjuvant is preferably administered in combination with a pharmaceutically-acceptable carrier, excipient or diluent.




According to this embodiment, there is contemplated a gene construct comprising:




(i) a first nucleotide sequence encoding an avian IFN-γ or interferon-like molecule or a fusion cytokine molecule between said IFN-γ and a second cytokine, placed operably under the control of a first promoter sequence;




(ii) a second nucleotide sequence defining an antigen against which immunisation is required, placed operably under the control of a second promoter sequence; and




(iii) a delivery vehicle comprising genetic sequences which facilitate replication of said gene construct in a delivery cell such as a bacterial, yeast, insect, a protozoan animal or a mammalian cell.




According to this embodiment, the delivery cell would not in normal use be harmful or pathogenic to the target animal. Conveniently, attenuated delivery cells are employed. Particularly useful delivery vectors are attenuated viruses and recombinant viral and bacterial vectors.




For example, an attenuated viral vector is used. The genetic sequence encoding an avian cytokine such as ChIFN-γ or a derivative thereof is cloned into the viral sequence and the recombinant virus used to infect target animals. The recombinant virus causes infection and replicates in the animal cells resulting in production of the recombinant cytokine. The infecting recombinant virus may subsequently be eliminated after production of an immunomodulatingly effective amount of the recombinant cytokine. A similar protocol is adopted with live bacterial carriers. Alternatively, a non-replicating, non-infectious viral vector may be used. A non-replicating viral vector provides a means of introducing a genetic sequence which is transiently capable of expression of the desired cytokine because the non-replicating viral vector is not capable of cell-to-cell transmission.




The cytokine molecule of the present invention, in particular ChIFN-γ, is also useful as a growth-enhancing or growth-promoting agent and/or maturation-promoting agent when administered to an avian species such as a species of poultry, domestic bird or a game bird. The present invention is particularly useful as a growth performance enhancer and, as the inventors have demonstrated in the Examples described herein, administration of ChIFN-γ to immature birds leads to significant increases in weight, addition to the prevention of weight loss usually associated with various disease states.




A second aspect of the invention provides a method of enhancing the growth performance of a healthy or diseased bird, said method comprising administering to said bird an avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to induce weight gain in said healthy or diseased bird or to prevent weight loss in said diseased bird, wherein said avian IFN-γ cytokine polypeptide is selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




As used according to this aspect of the invention, the term “healthy bird” or similar shall be taken to mean a bird that exhibits no symptoms of a disease associated with or known to cause weight loss or loss of appetite in birds. The term “healthy bird” clearly encompasses a bird that is susceptible to a disease associated with or known to cause weight loss or loss of appetite in birds, notwithstanding that it may not exhibit any symptoms associated therewith at the time of administration of said cytokine polypeptide.




As used according to this aspect of the invention, a “diseased bird” means a bird that has a disease, such as, for example, a disease associated with weight loss or loss of appetite in birds, or is infected with a causative agent thereof. Accordingly, a “diseased bird” includes a bird that exhibits one or more symptoms of a disease associated with, or known to cause, weight loss or loss of appetite in birds, including actual weight loss and/or loss of appetite. A “diseased bird” may also include a bird that exhibits no actual symptoms however has been diagnosed as carrying a causative agent of a disease associated with weight loss or loss of appetite in birds.




By enhancing growth performance is meant to increase the weight of an avian species or to prevent weight losses therein normally detectable during or following pathogenic infection of an avian species.




This aspect of the invention is particularly related to the treatment of weight loss in birds that are susceptible to coccidiosis or suffer from coccidiosis or are infected with Eimeria spp., in particular


E. acervulina,


or are susceptible to infection with Eimeria spp., in particular


E. acervulina.






In performing this aspect of the invention, it will be apparent to those skilled in the art that the methods discussed supra for the expression of avian IFN-γ polypeptides in various cell type, including the use of gene constructs and expression vector systems therefor, and subsequent administration of avian IFN-γ polypeptides to birds, are equally applicable to this purpose.




Recombinant avian IFN-γ polypeptides, or a homologue, analogue or derivative thereof, in particular ChIFN-γ, are useful in the production of immunological interactive molecules such as antibodies or functional derivatives thereof including Fabs or SCABS (single-chain antibodies), antibodies conjugated to an enzyme, radioactive or fluorescent tag, the only requirement being that said immunologically interactive molecules are able to bind to an avian IFN-γ or interferon-like molecule described herein.




Accordingly, a further aspect of the present invention provides an antibody which binds to an avian IFN-γ molecule. In an even more preferred embodiment, said immunologically-interactive molecule binds to a IFN-γ or interferon-like molecule or a homologue, analogue or derivative thereof comprising at least 10 amino acid residues, preferably at least 20 amino acid residues and more preferably at least 50 amino acid residues contained within the amino acid sequence set forth in SEQ ID NO: 2 or having at least 40% similarity thereto. The antibody molecule may be monoclonal or polyclonal and may be used for developing enzyme-immunosorbent assays for the rapid diagnosis of infectious diseases of poultry, domestic birds or game birds.




Immunoassays are useful in detecting the presence of a cytokine in a target animal, particularly birds, in particular to detect an immune response in which the level of said avian cytokine is altered, for example following infection with a pathogen. As a consequence, such an immunoassay is of particular use in determining whether a bird has been exposed to a pathogen or is currently infected with a pathogen or has a prolonged low-grade pathogenic infection. Immunoassays are also useful for the quantization of cytokines, in particular for screening genetic stocks for high cytokine-expressing lines with improved disease-resistance to a pathogen. The invention described herein extends to all such uses of immunointeractive molecules and diagnostic assays which require said immunoassays for their performance.




A wide range of immunoassay techniques may be such as those described in U.S. Pat. Nos. 4,016,043, 4,424,279 and 4,018,653. These methods may be employed for detecting a IFN-γ or interferon-like molecule related to ChIFN-γ. By way of example only, an antibody raised against ChIFN-γ is immobilised onto a solid substrate to form a first complex and a biological sample from an animal to be tested for the presence of cytokine brought into contact with the bound molecule. After a suitable period of incubation, for a period of time sufficient to allow formation of an antibody-cytokine secondary complex, a second ChIFN-γ antibody labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing sufficient time for the formation of a tertiary complex of antibody-cytokine-labelled antibody. Any unreacted material is washed away, and the presence of the tertiary complex is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal or may be quantitated by comparison with a control sample containing known amounts of hapten. Variations of this assay include a simultaneous assay, in which both sample and labelled antibody are added simultaneously to the bound antibody, or a reverse assay in which the labelled antibody and sample to be tested are first combined, incubated and then added simultaneously to the bound antibody. These techniques are well known to those skilled in the art, and the possibility of minor variations will be readily apparent. The antibodies used above may be monoclonal or polyclonal.




The solid substrate is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs or micro plates, or any other surface suitable for conducting an immunoassay. The binding processes are well-known in the art and generally consist of cross-linking covalently binding or physically adsorbing the molecule to the insoluble carrier.




By “reporter molecule”, as used in the present specification, is meant a molecule which, by its chemical nature, produces an analytically identifiable signal which allows the detection of antigen-bound antibody. Detection may be either qualitative or quantitative. The most commonly used reporter molecule in this type of assay are either enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes). In the case of an enzyme immunoassay, an enzyme is conjugated to the second antibody, generally by means of glutaraldehyde or periodate. As will be readily recognised, however, a wide variety of different conjugation techniques exist which are readily available to one skilled in the art. Commonly used enzymes include horseradish peroxidase, glucose oxidase, β-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable colour change. It is also possible to employ fluorogenic substrates, which yield a fluorescent product.




Alternatively, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to antibodies without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome-labelled antibody adsorbs the light energy, inducing a state of excitability in the molecule, followed by emission of the light at a characteristic colour visually detectable with a light microscope. As in the EIA, the fluorescent labelled antibody is allowed to bind to the first antibody-hapten complex. After washing off the unbound reagent, the remaining complex is then exposed to the light of the appropriate wavelength, the fluorescence observed indicates the presence of the hapten of interest. Immunofluorescence and EIA techniques are both very well established in the art and are particularly preferred for the present method. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed. It will be readily apparent to the skilled technician how to vary the procedure to suit the required purpose.




The antibodies of the invention are also useful in combination with the inventive avian cytokine polypeptide, as an adjuvant for enhancing the immunogenicity of an antigen following administration to a bird. Without being bound by any theory or mode of action, the antibody:cytokine combination will have a longer half-life and/or slower release than compositions comprising the cytokine polypeptide in an unmodified form.




Preferably, the antibody used in such a composition will be one that binds specifically to the cytokine polypeptide, and, more preferably, without significantly reducing its activity. Without being bound by any theory or mode of action, antibodies that do not inhibit cytokine activity are useful for protecting the cytokine from proteloysis. However, the use of antibodies that also inhibit activity of the cytokine may be desirable in cases where delayed action of the cytokine is required, wherein the activity of said cytokine is restored following release of the cytokine from the antibody complex, such as, for example, following degradation of the antibody.




Similarly, the present invention also provides, as exemplified herein, avian IFN-γ polypeptides that have been modified chemically to extend the half-life or longevity of said polypeptide, such as, for example, by the addition of one or more protecting groups. Those skilled in the art will be aware of protecting groups other than the PEG substituents exemplified herein, that may be used to modify the avian IFN-γ polypeptides of the invention. The present invention clearly extends to the use of chemical modificaitons other than those exemplified herein to extend the half-life or longevity of said polypeptide.




Further aspects of the invention provide compositions for enhancing the growth performance of a bird, and/or for modulating the immune response(s) of a bird, said compositions comprising a carrier, excipient or diluent in combination with an amount of a recombinant avian IFN-γ cytokine polypeptide selected from the group consisting of:




(a) a polypeptide having the amino acid sequence set forth in any one of SEQ ID NOs: 2-7;




(b) a polypeptide having the amino acid sequence set forth as the mature protein region of any one of SEQ ID NOs: 2-7;




(c) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1;




(d) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (c); and




(e) a polypeptide comprising at least 10 contiguous amino acids of any one of SEQ ID NOs: 2-7, wherein said polypeptide has immunomodulatory activity.




The present invention clearly extends to a veterinary pharmaceutical composition for use in poultry, domestic bird or game birds such as to enhance the immune system or accelerate its maturation or improve its immunocompetence or to facilitate immunomodulation in said birds, said composition comprising a recombinant avian IFN-γ or a fusion molecule between a IFN-γ and a second cytokine, in combination with an antigen or pathogenic organism against which it is desired to obtain immuno-protection, and optionally one or more carriers and/or diluents acceptable for veterinary use.




In accordance with the present invention, an avian cytokine such as a IFN-γ or interferon-like molecule, in particular ChIFN-γ, is used in vaccines to enhance the immunogenicity of antigens, particularly in subunit vaccines, leading to increased antibody titre in individual birds, increased protection of birds that are immunised against a specific antigen (i.e. enhanced flock immunity) and/or increased persistence of protective antibodies in immunised birds. A further advantage provided by the present invention is a reduction in the quantity of specific antigen required to effectively immunise animals, thereby leading to reduced production costs.




Preferably, the above-mentioned compositions comprise a recombinant avian cytokine and are injected into the bird in ovo or post-hatching, or administered via aerosol or ingestion.




In an alternative embodiment, the present invention clearly contemplates the use of genetic vaccines and pharmaceutical compositions, wherein nucleic acid encoding the proteinaceous components is administered to the bird for expression therein. Wherein the composition comprises genetic material such as nucleic acid, it is administered as part of a viral vector, bacterial vector or as a nucleic acid molecule.




The bird to be treated and the cytokine in the composition might be “homologous” in the sense that both are of the same species, or may be “heterologous” where the avian cytokine is effective in another bird species than the species from which it has been derived. The compositions may also contain other active molecules such as antibiotics or antigen molecules. Combinations of cytokine molecules with antigen molecules may increase the efficacy of the compositions.




The present invention extends to a veterinary pharmaceutical composition comprising an immunomodulatingly effective amount of a fusion molecule between an avian IFN-γ and a second cytokine or genetic sequences capable of expressing same and one or more carriers and/or diluents acceptable for veterinary use.




The active ingredient(s) of the pharmaceutical composition is/are contemplated to exhibit excellent activity in stimulating, enhancing or otherwise facilitating an immune response in an animal species and in particular a poultry, domestic bird or game bird when administered in an amount which depends on the particular case. The variation depends, for example, on the cytokine and, in some cases, the antigen involved in stimulating the immune response. For example, from about 0.5 μg to about 20 mg of a particular cytokine which may be combined with other cytokines, per kilogram of body weight per day may be required. Dosage regimen may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered in one or more of daily, weekly or monthly or in other suitable time intervals or the dose may be proportionally reduced as indicated by the exigencies of the situation. The active compound may be administered by injection either in ovo or post-hatching or by oral ingestion in any convenient manner or may be administered via a genetic sequence such as in a viral or bacterial vector.




The active compounds may also be administered in dispersions prepared in glycerol, liquid polyethylene glycols, and/or mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.




The pharmaceutical forms suitable for parenteral administration include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, antibiotics, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example.




Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilisation. Generally, dispersions are prepared by incorporating the various sterilised active ingredient(s) into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying technique which yield a powder of the active ingredient plus any additional desired ingredient from previously sterile-filtered solution thereof.




Carriers and/or diluents suitable for veterinary use include any and all solvents, dispersion media, aqueous solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the composition is contemplated. Supplementary active ingredients can also be incorporated into the compositions. The latter is particularly contemplated as far as the present invention extends to multivalent vaccines or multi-component cytokine molecules.




The pharmaceutical veterinary compositions of the present invention may comprise in addition to an avian IFN-γ or interferon-like molecule or a fusion molecule comprising same, one or more other active compounds such as antigens and/or immune stimulating compounds.




The cytokine may also be delivered by a live delivery system such as using a bacterial expression system to express the cytokine protein in bacteria which can be incorporated into gut flora. Alternatively, a viral expression system can be employed or incorporated into a recombinant vaccine. In this regard, one form of viral expression is the administration of a live vector generally by spray, feed or water where an infecting effective amount of the live vector (e.g. virus or bacterium) is provided to the animal. Another form of viral expression system is a non-replicating virus vector which is capable of infecting a cell but not replicating therein. The non-replicating viral vector provides a means of introducing genetic material for transient expression into a cytokine. The mode of administering such a vector is the same as a live viral vector.




The present invention is further described by reference to the following non-limiting Examples.




EXAMPLE 1




Reagents and Starting Materials




Specific Pathogen Free (SPF) Hybrid White Leghorn (HWL) chickens produced by the CSIRO SPF poultry unit (Maribymong, Victoria) were raised in flexible plastic isolators and fed fumigated feed and acidified water.




All cell lines and vectors referred to herein were publicly available or fully-described in U.S. Ser. No. 08/765,381 or Ser. No. 09/272,032, which are incorporated herein by way of reference.




EXAMPLE 2




Cloning of Avian IF-γ-Encoding Genes




The cloning of a cDNA encoding IFN-γ of chickens is described in detail in U.S. Ser. No. 08/765,381 which is incorporated herein by way of reference.




The ChIFN-γ nucleotide and derived amino acid sequences are shown in SEQ ID NOs: 1 and 2, respectively. The ChIFN-γ cDNA codes for a predicted protein of 164 amino acids with a signal peptide of 19 amino acids. The predicted mature protein is 145 amino acids in length with a molecular mass of 16.8 kD. Two potential N-glycosylation sites are predicted, the most likely site is at position 42-44, with the other at position 23-25. Like other IFN-γ proteins, ChIFN-γ contains few cysteine residues. The mature protein has only two cysteine residues which are located at the C-terminus.




Other avian IFN-γ-encoding genes have been cloned from ducks (Schultz et al., Scripps Research Institute 10550 North Torrey Pines Road, La Jolla, Calif. 92037, United States of America, personal communications), and from Guinea fowl, pheasant, quail and turkey (Kaiser et al., 1998), all of which have been isolated using SEQ ID NO: 1 as a hybridization probe, in standard nucleic acid hybridization reactions or by 5′-RACE and 3′-RACE (i.e.


R


apid


A


mplification of


c


DNA


E


nds, a variation of PCR).




The IFN-γ activity of the duck IFN-γ-encoding clone has been confirmed by measuring the anti-viral protection conferred in both chicken and duck cells and, as expected for authentic duck IFN-γ, recombinantly-expressed duck IFN-γ has significant anti-viral activity in both duck cells and chicken cells, however approximately 32-fold the anti-viral activity in duck cells that is observed in chicken cells.




The identity of the turkey IFN-γ-encoding sequence has also been confirmed by measuring the anti-viral activity of the recombinantly-produced polypeptide product of this sequence in chicken cells.




The amino acid sequences of the derived duck, Guinea fowl, pheasant, quail and turkey IFN-γ polypeptides are set forth herein as SEQ ID NOs: 3-7.




There are no gaps in the alignment between chicken and duck IFN-γ polypeptides and only 54 amino acid differences, 26 of which are conservative amino acid substitutions (eg. Ser-Thr, Ser-Ala, Arg-Lys, Lys-Glu, Asn-His, Asp-Glu, Glu-Gln, Ile-Leu, Ile-Val, Leu-Met, Met-Val, Phe-Tyr, Val-Ile, Val-Leu). Based on the proportion of identical residues in the alignment between chicken and duck IFN-γ polypeptides, there is 67% amino acid sequence identity between these sequences over the entire length of chicken IFN-γ (i.e. amino acids −19 to 145 of SEQ ID NO: 2) and 64% identity in the mature secreted protein region (i.e. amino acids 1 to 145 of SEQ ID NO: 2).




There are also no gaps in the alignments of chicken IFN-γ and other avian polypeptides Accordingly, these sequences are all highly-conserved, having 87.8% (guinea fowl) to 97.6% (turkey and pheasant) amino acid sequence identity with chicken IFN-γ over their entire length (i.e. amino acids corresponding to positions −19 to 145 of SEQ ID NO: 2) and 86.2% (guinea fowl) to 97.2% (turkey and pheasant) identity in the mature secreted protein region (i.e. amino acids corresponding to positions 1 to 145 of SEQ ID NO: 2).




In contrast, there is only very low homology between avian IFN-γ and a number of mammalian IFN-γ and avian IFN-α polypeptides, and there is no functional cross-protection from virus-mediated lysis of fibroblasts conferred by avian versus non-avian IFN-γ polypeptides, as is described in U.S. Ser. No. 08/765,381.




EXAMPLE 3




Methods




1. Chicken Embryonic Fibroblast (CEF) Interferon Assay




IFN was measured by the ability to protect CEF and turkey embryonic fibroblasts (TEF) from virus-mediated as described by Prowse and Pallister (1989), Lowenthal et al (1995 a) and Lowenthal et al (1995 b). Secondary fibroblasts were seeded into 96 well microtitre plates (5×10


4


/well) and grown in the presence of 10% FBS at 41° C. After 24 hr the culture medium was replaced with 100 μl of serum-free growth medium and 2-fold serial dilutions of test supernatants were made in duplicate. Control wells contained cells cultured in medium alone or cultured in the presence of a reference supernatant of known IFN activity. After overnight incubation at 37° C., the culture medium was replaced with 100 μl of medium containing Semliki Forest virus or Vesicular Stomatitis virus (10


3


tissue culture infective dose/ml) and the cells were incubated at 37° C. After 24 hr, cell viability was measured by uptake of neutral red dye and absorbance at 540 nm was quantitated using an ELISA reader.




2. Nitrite Assay




Production of nitric oxide by HD11 chicken macrophages (Beug et al, 1979) was quantitated by accumulation of nitrite in the culture medium (Sung et al, 1991) and was used as a measure of IFN-γ activity. Two-fold serial dilutions of test supernatants were made in duplicate wells of 96 well plates in a volume of 100 μl of growth medium containing 5% FBS. HD11 cells were added to each well (10


5


in 100 μl) and the plates were incubated at 37° C. After 24 hr, 50 μl of culture supernatant was added to 100 μl of Griess reagent (1.1 mixture of 1% sulfanilamide and 0.1% naphthylethylene diamine in 2.5% H


3


PO


4


) and absorbance was read at 540 nm. The level of nitrite was determined using sodium nitrite as a standard.




3. ELISA for ChIFN-γ




Monoclonal antibodies for use in ELISA are described in detail below (see Example 6). Microtitre plates were coated with Mab 80.9 (1 ug/ml in carbonate buffer, pH 8, 100 ul/well) overnight at 4° C. All subsequent incubation steps were carried out at room temperature (RT) for 1 h with three washes (PBS with 0.5% tween) between each step. The plates were blocked (1% Powerblock, 100 ul/well) and serial dilutions of ChIFN-γ or control preparations (100 ul/well) were added. Biotinylated Mab or polyclonal rabbit antisera (1:1000 dilution) was added to each well as the detection antibody, followed by the addition of HRP-labelled streptavidin (Amersham) or HRP-goat anti-rabbit Ig (Zymed). ChIFN-γ binding was revealed by the addition of tetra-methyl benzidine (TMB) peroxidase substrate followed by quenching with 0.5 M H


2


SO


4


. Plates were read on an ELISA reader at 450 nm. The ELISA titre is defined as the reciprocal of the dilution giving an OD reading above the cut off value which is calculated as [mean background±3SEM].




To confirm that this ELISA provides an accurate representation of avian IFN-γ activity, native and denatured (i.e. heat-denatured) samples of recombinant chicken IFN-γ produced by various expression systems as described herein were quantitated in the HD11 nitrite assay and the results compared to the results derived from ELISA (FIGS.


1


A and


1


B). As shown in

FIG. 2

, there is a strong correlation between the level of biological activity (biological titre as determined using nitrite release assay) and detectability by ELISA (ELISA titre). Additionally, heating samples of ChIFN-γ or exposure to low pH conditions (not shown) results in a concomitant decrease in both biological and ELISA titres. These data indicate that the ELISA described herein detects only biologically active molecules (i.e. homodimers) of ChIFN-γ and not inactive molecules, and, as a consequence, is useful for reliably quantitating the biological activity of ChIFN-γ with a sensitivity comparable to that of the conventional HD11 bioassay.




Data presented in

FIG. 3

show the improved sensitivity of ELISA compared to the nitrite release bioassay, in detecting ChIFN-γ in sera following intravenous (i.e. i/v;

FIG. 3A

) and intraperitoneal (i.e. i/p;

FIG. 3B

) injection. ELISA was consistently 3-10 fold more sensitive than the bioassay in detecting serum levels of IFN-γ. In particular, the bioassay has difficulty in measuring ChIFN-γ in the presence of chicken serum, particularly at low levels of the cytokine. Addition of high concentrations of serum (greater than 10% v/v) to HD11 cells results in lowered responsiveness to ChIFN-γ, a problem not encountered in the ELISA.




4. Injection of ChiFN-γ in ovo




This procedure describes the technique to be used for manual egg injection of test materials. Alternatively, eggs can be injected using an automated Inovoject® system.




a) Egg Candling




Eggs are maintained under warm room conditions during candling and transfer, if possible. It is best not to keep eggs out of the incubator/hatcher for more than three hours. Eggs are candled by illumination of egg contents with an egg candler in a darkened room. Eggs that have a clear demarcation between air cell and embryo, a rosy color, obvious veins or that show movement, are retained. Eggs that are clear (infertile), nonviable, cracked, excessively dirty, have green discoloration, or are upside down (no air cell in blunt end of egg), are discarded.




b) Needle/Punch and Egg Sanitizer Preparation




An 18 gauge 1.5 inch needle is inserted through a rubber stopper so that the needle cannot penetrate to a depth beyond 2 mm. A 0.5% chlorine solution is prepared by 1:10 (v/v) dilution of 5.25% sodium hypochlorite (commercial bleach).




c) Administration of ChIFN-γ in ovo




The blunt end of the egg is swabbed with a 0.5% chlorine solution (1:10 dilution of commercial bleach [5.25% sodium hypochlorite]). All eggs are manually punched with an 18 gauge needle attached to a rubber stopper. The ChIFN-γ preparation is delivered 2.5 cm through the blunt end of the egg, below the air cell membrane, using a 20 gauge×1″ needle attached to a 1 ml tuberculin syringe. The injection needle is sterilized between deliveries to each egg by punching into 1.5″ thick sponge soaked in 0.5% chlorine solution. New needles and syringes are used each time the sample is withdrawn from the original container. Dose volume for in ovo administration is usually 100 ul (with 1 ml syringe). The injection hole is then covered using nail varnish and the injected eggs incubated in a hatcher. Administration by in ovo injection as described herein does not reduce hatch ability of eggs.




EXAMPLE 4




Expression of Recombinant Avian IFN-γ Polypeptides




1. Expression of Recombinant ChIFN-γ in


E coli.






The mature coding region of ChIFN-γ (SEQ ID NO: 1) was cloned into the pQE expression vector (QIAexpress Type IV construct, Qiagen, Calif.) according to manufacturers instructions. The sequences of the oligonucleotides used to amplify the mature region of the gene using PCR are as follows:













5′ ACTAGATCTCATACTGCAAGTCTAAAT 3′:




SEQ ID NO:9













5′ ACTAAGCTTTTAGCAATTGCATCTCCTCTG 3′:




SEQ ID NO:10











All procedures used for the expression of recombinant ChIFN-γ using Ni columns and purification was according to manufacturers instructions.




Recombinant ChIFN-γ (r ChIFN-γ) bearing a poly-HIS tag was expressed in


E. coli


using the pQE expression system and purified using a Ni affinity column (FIG.


4


A). Two forms of recombinant ChiFN-γ were produced (Mr 16 and 18 kDa).




The activity of recombinant ChIFN-γ was determined using the CEF assay, nitrite assay, or a Turkey Embryonic Fibroblast (TEF) protection assay. Recombinant ChIFN-γ was active in the nitrite assay (FIG.


5


A), in the CEF assay (

FIG. 5B

) and in a Turkey TEF protection assay (FIG.


5


C).




The stability of recombinant ChIFN-γ was also monitored over various time intervals. Data provided in

FIG. 6

indicate that recombinant ChIFN-γ is stable when stored at 4° C. or at room temperature. The inventors have shown further that recombinant ChIFN-γ can be stored for several months.




2. Expression of Recombinant ChIFN-γ in COS Cells.




Avian IFN-γ-encoding cDNA clones were transfected into COS cells and supernatants were shown to exhibit IFN-γ bioactivity 2 to 4 days after transfection, in both the CEF and nitrite assays. In particular, supernatants of COS cells transfected with the chicken IFN-γ plasmid produced very high levels of recombinant ChIFN-γ (FIGS.


7


and


8


). Recombinant ChIFN-γ showed the same degree of heat sensitivity and pH 2 sensitivity as that shown by native ChIFN-γ (data not shown).




3. Expression of Recombinant ChIFN-γ in CK Cells.




a) Construction of a Recombinant FAV Vector Expressing Avian IFN-γ




(i) FAV Vector Sequences:




The 17.1 kb nucleotide sequence of the right-hand end of FAV serotype 8 (FAV8) is set forth in SEQ ID NO: 8. The right-hand end was identified by cloning and sequencing three restriction fragments of FAV8 (CFA40) as follows:




1. Plasmid pJJ383, deposited under the provisions of The Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure (hereinafter “The Budapest Treaty”) with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999, and assigned AGAL Accession No. NM99/08170. Plasmid pJJ383 contains a NheI fragment of 8.5 kb in length derived from the FAV8 right-hand end, cloned into the vector pGEM-11f(+/−);




2. Plasmid pJJ698, deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999, and assigned AGAL Accession No. NM99/08172. Plasmid pJJ698 contains a Bg/II fragment of 7.5 kb in length derived from the FAV8 right-hand end, cloned into the vector pUC18; and




3. Plasmid pJJ407, deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999, and assigned AGAL Accession No. NM99/08173. Plasmid pJJ407 contains a Bg/II fragment of 1.7 kb in length derived from the FAV8 right-hand end, cloned into the vector pUC18.




(ii) Avian IFN-γ Expression Cassette




An expression cassette was produced to facilitate the expression of IFN-γ from recombinant FAV, said cassette comprising the FAV MLP sequence (Johnson et al, 1988) operably connected to the ChIFN-γ coding region, and placed upstream of the SV40 transcription termination signal, by cloning the cassette into the NotI site of the bacterial plasmid vector pUC18. The plasmid produced that contains this expression cassette was designated plasmid pJJ427.




Plasmid pJJ427 was deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999 and assigned AGAL Accession No. NM99/08169.




The NotI site in plasmid pJJ427 is also useful for subsequent insertion of the expression cassette into FAV8 sequences, either directly, or following end-filling and blunt-end ligation.




(iii) Recombinant FAV Containing the Avian IFN-γ Expression Cassette




There are unique XbaI, SnaBI and SmaI sites in the NheI fragment of plasmid pJJ383 to facilitate the insertion of foreign DNA.




In one vector construct, the 1.3 kb region between the unique SnaBI and SmaI sites of plasmid pJJ383 was deleted and replaced by the IFN-γ expression cassette of plasmid pJJ427. The resultant plasmid, designated pJJ464, was deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999 and assigned AGAL Accession No. NM99/08171.




In a second vector construct, the 2.2 kb XbaI-SnaBI fragment of pJJ383 was deleted and replaced by the expression cassette of plasmid pJJ427. The resultant plasmid, designated pJJ677, was deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999, and assigned AGAL Accession No. NM99108174.




In a third vector construct, the 50 bp region between two SpeI sites of pJJ383 was deleted and replaced by the expression cassette of plasmid pJJ427, leaving most of the FAV8 vector sequence intact. The resultant plasmid, designated pJJ486, was deposited under the provisions of The Budapest Treaty with Australian Government Analytical Laboratories at 1 Suakin Street, Pymble, New South Wales 2073, Australia on Nov. 11, 1999 and assigned AGAL Accession No. NM99/08175.




The deposits referred to herein will be maintained under the terms of The Budapest Treaty and are provided merely as a convenience to those skilled in the art and not as an admission that any one or more of said deposits is required under 35 U.S.C. §112.




To produce recombinant FAV expressing ChIFN-γ, each of the three plasmids pJJ464, pJJ677, and pJJ486, containing the expressible ChIFN-γ encoding region, was transfected with SpeI-digested FAV viral genomic DNA. The recombinant FAVs were plaque-purified and characterized by Southern blotting and PCR using standard procedures.




b) Transcriptional Mapping




To confirm expression of IFN-γ from recombinant FAV, mRNA was isolated from infected cell cultures at 6 hr and 20 hr post-infection with either wild-type FAV8 or recombinant FAV8 comprising the IFN-γ coding region produced as described supra. The mRNA was purified using Qiagen Direct mRNA Maxi kit, and transferred directly to nylon membranes using the Ambion Northern Max-Gly kit. Fragments derived from the right-hand end of the FAV8 genome were probed, using the protein-coding region of the ChIFN-γ cDNA, radiolabelled with


32


P, as a probe. This analysis confirmed the presence of ChIFN-γ transcripts in the recombinant FAV only.




To confirm these results, mRNA was also used as a substrate for RT-PCR employing the Promega Reverse Transcription System, employing primers that were specific to ChIFN-γ. This analysis confirmed the presence of ChIFN-γ transcripts in recombinant FAV-ChIFNγ-infected cells at 20 hr post-infection. The amplified product was also confirmed as ChIFN-γ, by subsequent sequence determination.




c) Biological Activity of Recombinant ChIFN-γ Produced in Recombinant FAV-ChIFNγ-Infected Cells




The biological activity of rChIFN-γ was determined using the nitrite release assay. Two-fold serial dilutions of test supernatants from cultures of CK cells that were infected with either wild-type FAV8 or with r FAV-ChIFNγ were made in duplicate wells of 96 well plates. HD11 cells were added to each well and the plates incubated at 37° C. After 24 hr, 50 μl of culture supernatant was added to 100 μl of Griess Reagent and the absorbance determined at 540 nm. Duplicate cultures were also incubated in the presence or absence of 1% (v/V) rabbit anti-ChIFN-γ serum, which blocks ChIFN-γ, but not Type I molecules. The results (

FIG. 9

) indicate that rChIFN-γ is expressed and is biologically-active.




EXAMPLE 5




Recombinant Avian IFN-γ Induces Cell Surface Expression of Cla




1. Expression of Class II Molecules




Data presented in U.S. Ser. No. 08/765,381 show that HD11 cells cultured in the presence of recombinant or native ChIFN-γ for 48 hr showed enhanced levels of cell surface expression of Class II molecules relative to cells grown in media alone (88% and 52% increase in expression, respectively). In contrast, the presence of another macrophage stimulator, LPS, induced only an 8% increase in Class II expression.




Here we demonstrate that avian IFN-γ induces expression of the MHC Class II antigen Cla on the surface of HD11 cells. HD11 cells were cultured for 24 hr in the presence of various preparations of recombinant ChIFN-γ and then analyzed for the cell surface expression of MHC class II antigen (Cla). Approximately 15% of HD11 cells constitutively express Cla, however this proportion increases in a dose-dependent manner, following exposure to recombinant ChIFN-γ (FIG.


10


). Recombinant ChIFN-γ expressed by insect cells using a baculovirus expression system, and recombinant IFN-γ produced by COS cells and


E. coli


as described supra, showed similar dose-response curves (FIG.


10


A), and, for both types of protein preparation, the dose response for nitrite secretion is equivalent to that seen for induction of Cla expression (FIGS.


10


B-


10


C).




EXAMPLE 6




Antibodies that Bind to Avian IFN-γ Polypeptides




a) Polyclonal Antibodies




Rabbit antisera was raised against purified recombinant ChIFN-γ protein. Rabbits were immunized three times with 400 μg of protein and sera was collected 10 days after the final injection. Specific reactivity of the sera to ChIFN-γ was confirmed using immune and pre-immune sera in Western blots and in assays measuring the ability to inhibit the release of nitrite by HD11 cells. Sera from each rabbit recognised recombinant ChIFN-γ as shown by Western blots (FIG.


11


). Some of these rabbit sera also inhibit the biological function of native and recombinant ChIFN-γ in vitro but did not block the function of ChIFN-β (FIG.


12


).




Furthermore, protein G-purified rabbit anti-recombinant ChIFN-γ antibodies also inhibit the function of recombinant ChIFN-γ (FIG.


13


).




b) Monoclonal Antibodies (Mabs)




Balb/C mice were immunized three times with


E. coli


-derived, poly-HIS tagged ChIFN-γ, as follows:




(i) ChIFN-γ (10 ug) in Freund's complete adjuvant, was injected sub-cutaneously (s/c);




(ii) ChIFN-γ (10 ug) in Freund's incomplete adjuvant, was injected intra-peritoneally (i/p); and




(ii) ChIFN-γ (10 ug) in PBS, was injected intra-peritoneally (i/p).




Hybridomas were generated by fusion of spleen cells and SP2/0 myeloma cells. Mabs were screened for their ability to bind to ChIFN-γ-coated ELISA plates. Antibody isotypes were determined using anti-IgG1, anti-G2a, anti-G2b, anti-M, anti-κ and anti-λ antibodies. Mab Ig was purified by protein G chromatography. The specific reactivities of various monoclonal antibodies to ChIFN-γ was determined using ELISA (Table 1). The ability of the various monoclonal antibodies to block recombinant ChIFN-γ-induced nitrite secretion by HD11 macrophages was also determined (Table 1). Data presented in Table 1 further indicates the relative utilities of the various monoclonal antibodies to detect ChIFN-γ in western blots.












TABLE 1











Characteristics of anti-ChIFN-γ Mabs














Inhibition in HD11
















ELISA




bioassay




Relative

















Mab





Titre




COS




CK





activity in






Clone




Isotype




(IgG)




cells




cells






E. coli






western blots




















13.1




M




2 × 10


5









a
















++++






80.9




G1




5 × 10


5






200


b






200




1200











149.1




G1




1 × 10


5






>


c






>


c






>


c













68.6




G1




1 × 10


5






>


c






>


c






>


c













85.6




G2a




2 × 10


5






50




100




160











31.9




G2a




1 × 10


6





















+++






9.1




G2b




1 × 10


5





















+++






19.1




G2b




6 × 10


4





















+













a


Non inhibitory at 100 ug/ml












b


Concentration of Ig (ng/ml) giving 50% inhibition of activity in HD11 assay.












c


>20 ug/ml Ig required to give 50% inhibition of activity in HD11 assay.














FIG. 14A

shows that the Mabs listed in Table 1 differ in their ability to block the biological activity of COS-derived ChIFN-γ in the HD11 nitrite assay. As shown in

FIG. 14B

, Mab 80.9 was able to block the activity of recombinant ChIFN-γ derived from either


E. coli


or COS cells, as well as native ChIFN-γ derived from Con A-activated chicken T cells, and from chicken fibroblasts (CK cells) infected with recombinant FAV expressing ChIFN-γ produced as described supra. The dose inhibition curves for Mab 80.9 were indistinguishable for all sources of ChIFN-γ.




Competition ELISAs were performed, in which biotinylated Mab 80.9 was mixed with various concentrations of different anti-ChIFN-γ Mabs prior to their addition to plates coated with ChIFN-γ, to determine the affinity of Mab 80.9 for ChIFN-γ relative to other Mabs. As shown in

FIG. 14C

, some Mabs were able to block the binding of Mab 80.9 to recombinant ChIFN-γ, whereas other were not, indicating that they seem to recognise different determinants of the ChIFN-γ molecule.




EXAMPLE 7




Enhancement of Immune Reactions Using Recombinant Avian IFN-γ Polypeptides




1. ChIFN-γ as an Adjuvant




Four Groups (n=10) of 3-week old SPF chickens were injected intramuscularly (i/m) with either 0.2 or 0.02 ml of sheep red blood cells (SRBC). One group at each dose was also injected intra-peritoneally with 500 Units of recombinant ChIFN-γ the day before and on the day of immunization. Birds were bled weekly and haemaglutination titres of the sera were determined.




Chickens were injected with SRBC (with or without recombinant ChIFN-γ) and weekly haemaglutination (HA) titres of the sera were determined. Results are shown in FIG.


15


. Treatment with recombinant ChIFN-γ resulted in a higher mean HA titre, a prolonged antibody response and increased the effectiveness of the low dose of antigen. This indicates that recombinant ChIFN-γ is an effective adjuvant.




2. Effect of Recombinant ChIFN-γ on Infection with IBDV in vivo




One group (n=10) of three-week old SPF chickens was injected intraperitoneally with 500 Units of recombinant ChIFN-γ on 2 consecutive days and another group of control birds (n=10) was injected with diluent alone. Both groups of birds were infected intra-ocularly with infectious Bursal Disease Virus (IBDV). Birds were sacrificed 7 days later and the bursa and whole body weights were determined.




Birds injected with recombinant ChIFN-γ displayed an enhanced ratio of body:bursa weight from a mean of 1.36 to 1.51 (FIG.


16


), indicating that recombinant ChIFN-γ was effective in reducing virus growth in vivo.




The effect of recombinant ChIFN-γ to protect CEFs from infection with IBDV in vitro was also measured. CEFs were prepared as described for the CEF interferon assay and recombinant ChIFN-γ and IBDV were added to the cultures together. Cell survival was measured 3 days later on a scale of 0 to 4, where 0 represents the level of cell survival observed in the presence IBDV and the absence of IFN (<5% cell survival) and 4 represents the level of cell survival observed in the absence of IBDV (>90% cell survival). As shown in

FIG. 17

, recombinant ChIFN-γ was effective in protecting CEFs from infection with IBDV in vitro.




In conclusion, recombinant ChIFN-γ has been shown to effective in the prevention of infection by IBDV both in vivo and in vitro.




EXAMPLE 8




Growth-Promoting Effects of Avian IFN-γ




1. Enhancement of Growth Performance in Healthy Birds




a) Use of Isolated Recombinant ChIFN-γ Protein




One group (n=10) of one-day old SPF chickens was injected intraperitoneally with 500 Units of recombinant ChIFN-γ on 2 consecutive days and another group of control birds was injected with diluent alone. Birds were weighed over a 12 day period. Birds injected with recombinant ChIFN-γ displayed enhanced weight gain (FIGS.


18


and


19


). The increase in body weight was from 5.8 to 9.0% (Table 2). These data indicate that recombinant ChIFN-γ was effective in enhancing growth performance.












TABLE 2











Effect of recombinant ChlFN-γ on weight gain in broilers.














Body weight (g)


a



















Day




rChlFN-γ


b






Control


c






% Increase




















3




154.0 ± 18




143.5 ± 24




7.3







4




204.9 ± 23




188.2 ± 35




9.0







5




235.4 ± 26




217.0 ± 40




8.5







6




262.3 ± 28




244.3 ± 47




7.4







7




290.1 ± 30




269.5 ± 49




7.6







10




390.8 ± 39




360.1 ± 62




8.6







12




475.6 ± 43




449.5 ± 75




5.8















a


Mean weight of chickens (n = 10) ± standard deviation.













b


Birds injected i/p with 500 U of recombinant ChlFN-γ on days 0 and 1.













c


Birds injected intra peritoneal with diluent on days 0 and 1.













b) Use of Recombinant FAV to Deliver rChIFN-γ




Commercial broiler chickens at 1 day, 3 days, 6 days, or 10 days post-hatching, were infected by eye-drop with rFAV-ChIFN-γ produced from plasmid pJJ464, as described supra. Birds were housed in positive pressure isolators and maintained on a constant feed regime. Birds were weighed weekly for a period of 7 weeks. All treated birds receiving rFAV-ChIFN-γ showed increased weight gains which were significantly different from control untreated birds in paired t-tests carried out at 34 days and 42 days post-treatment (Table 3). As shown in Table 3, the most significant weight gains were observed in birds infected at 3 days or later post-hatching with recombinant FAV expressing ChIFN-γ, compared to uninfected birds. Less-significant differences were observed between birds that had been infected at different ages post-hatching. Similar effects are observed using rFAV derived from plasmid pJJ486.












TABLE 3











Significance of weight gains in commercial broilers infected with






rFAV expressing ChlFN-γ














p-value




p-value






Treatments comparated in t-test




(34 days)




(42 days)
















untreated birds vs. birds infected day 1




<0.001




>0.05






untreated birds vs. birds infected day 3




<0.002




<0.05






untreated birds vs. birds infected day 6




<0.001




<0.05






birds infected day 1 vs. birds infected day 3




>0.2




>0.2






birds infected day 1 vs. birds infected day 6




>0.2




>0.2














2. Reduction of Weight Loss in Birds During Infection with


E. acervulina






a) Use of Isolated ChIFN-γ Protein




One group (n=10) of one-day old SPF chickens was injected intraperitoneally with 500 Units of recombinant ChIFN-γ on 2 consecutive days (day 0 and day 1) and another group of control birds was injected with diluent alone. All birds were infected with 5×10


5


oocytes on day 1 and then weighed over a 12 day period.




Birds injected with recombinant ChIFN-γ displayed enhanced weight gain (FIGS.


20


A and


20


B). Infection with coccidiosis normally results in weight loss between day 4 and 6 of infection. Treatment with ChIFN-γ reduced the weight loss (

FIG. 20C

) and enhanced the rate of weight gain following natural recovery from infection (FIG.


20


D). Treatment with ChIFN-γ resulted in a 7.3 to 12.5% increase in weight (Tables 4 and 5; and FIG.


21


). This indicates that recombinant ChIFN-γ was effective in reducing the effect of coccidiosis on growth performance.












TABLE 4











Effect of rChlFN-γ on weight gain in commercial broilers following






infection with


E. acervulina.
















Body weight (g)


a

















Day




rChlFN-γ


b






Control


c






% Increase

















4




198.7 ± 26




185.1 ± 30




7.3






5




195.2 ± 26




176.8 ± 29




10.2






6




202.2 ± 23




185.4 ± 31




9.1






8




248.4 ± 35




220.9 ± 42




12.5






11




353.6 ± 52




315.6 ± 56




12.0













a


Mean weight of chickens (n = 10) ± standard deviation












b


Birds injected i/p with 500 U rChlFN-γ on days 0 and 1, and 5 × 10


5


oocysts on day 1.












c


Birds injected i/p with diluent on days 0 and 1, and 5 × 10


5


oocysts on day 1.





















TABLE 5











Effect of rChlFN-y on weight gain in commercial broilers following






infection with


E. acervulina.
















Body weight (g)

















Day




rChlFN-γ


b






Control


c






Increase (g)


d






















1-4




52.0


a






52.1




−0.1







4-5




−3.5




−8.3




4.8







5-6




7.0




8.6




−1.6







6-8




46.2




35.5




10.7







 8-11




105.2




94.7




10.5







 1-11




206.9




182.6




24.3















a


Mean weight gain (n = 10) ± standard deviation between the indicated days













b


Birds injected i/p with 500 U rChlFN-γ on days 0 and 1 and 5 × 10


5


oocysts day 1.













c


Birds injected i/peritoneal with diluent on days 0 and 1 and 5 × 10


5


oocysts day 1.













d


Increase in body weight due to recombinant ChlFN-γ.













b) Use of Recombinant FAV to Deliver rChIFN-γ




Commercial broiler chickens at 1 day or 6 days post-hatching were infected by eye-drop with rFAV-ChIFN-γ produced from plasmid pJJ464, as described supra. At 7 days post-hatch, birds were challenged with 5,000 sporulated oocysts of


E. acervulina.


A control group remained unchallenged. Birds were housed in positive pressure isolators and maintained on a constant feed regime. Birds were weighed daily post-challenge. All treated birds receiving rFAV-ChIFN-γ showed increased weight gains compared to controls that were not treated with ChIFN-γ, and those birds maintained these weight gains under coccidiosis challenge, compared to birds that were not treated with ChIFN-γ. Similar effects are observed using rFAV derived from plasmid pJJ486.




EXAMPLE 9




Pharmacokinetics of ChIFN-γ in vivo




1. Measurement of Serum ChIFN-γ Levels




ChIFN-γ samples were injected into 4 week old birds via i/v, i/p, i/m or s/c routes. Blood sample were taken by wing bleeds at various times and serum was tested in ELISA or bioassay.




2. Clearance of Wild-Type rChIFN-γ




ChIFN-γ derived from


E. coli


(

FIG. 4

) was injected either intra-venously (i/v), sub-cutaneously (s/c) or intra-peritoneally (i/p). Blood samples were taken over time and serum ChIFN-γ levels were measured by ELISA as described supra.




Data are presented in FIG.


22


. Following i/v injection, the level of ChIFN-γ reached peak serum levels within 1-3 minutes, and thereafter declined rapidly with about 90% clearance within 30 min. The initial t


1/2


for ChIFN-γ was approximately 10 min, a value similar to that reported in several studies on mammalian IFN-γ. The remaining ChIFN-γ was cleared at a slower rate and persisted in the circulation over several hours. After 24 h about 0.3-1.0% of the initial levels was still detectable. Following s/c and i/p injection (FIG.


22


), or i/m injection (data not shown), ChIFN-γ appeared more slowly in the serum, reaching peak levels by 1-7 hr post-injection. These routes of injection resulted in lower maximum serum levels compared to i/v injection, however serum levels of ChIFN-γ were sustained for longer periods (FIGS.


3


and


22


).




2. Clearance of Modified rChIFN-γ




In an attempt to improve the half-life of avian IFN-γ administered to birds,


E coli


-produced ChIFN-γ was modified using two different forms of methoxypolyethylene glycol (PEG) as described by Kita et al. (1990), namely p-nitrophenyl-PEG (NC-PEG) and cyanic chloride-PEG (CC-PEG). Briefly, ChIFN-γ was dialyzed against 10 mM sodium phosphate (pH 8.4) and reacted with various molar excesses of NC-PEG or CC-PEG for 24 hr at room temperature followed by the addition of amino caproic acid. Successful coupling of PEG was confirmed by increased molecular weight of ChIFN-γ, as measured by SDS page electrophoresis.




Treatment of ChIFN-γ by CC-PEG at 5- to 50-fold molar excesses resulted in the coupling of two PEG molecules per molecule of ChIFN-γ (data not shown). Modification of ChIFN-γ by CC-PEG did not reduce its biological activity as measured by the HD11 bioassay (

FIG. 23

) or ELISA (

FIG. 24

) Similar results were obtained following treatment with NC-PEG (FIG.


25


).




PEG modification of ChIFN-γ reduced its rate of clearance from the serum following i/v injection (

FIG. 26

) and i/p injection (FIG.


27


), thereby allowing prolonged persistence of biologically active ChIFN-γ.




EXAMPLE 10




Synergy Between Avian IFN-γ and Type II IFNs




ChIFN-γ shows synergy with ChIFN-α and ChIFN-β in both the CEF and nitrite assays. CEFs were cultured in the presence of ChIFN-γ that had been serially diluted in a limiting amount of recombinant ChIFN-α. The combination of the two IFNs was up to 5 times more effective than either type of IFN alone (FIG.


28


A). A similar level of synergy was shown in the nitrite assay (FIG.


28


B). Native ChIFN-β was also able to synergise with ChIFN-γ (FIG.


28


C).




REFERENCES




1. Amann and Brosius (1985).


Gene


40, 183.




2. Ausubel, F. M. et al. (1987) In Current Protocols in Molecular Biology, Wiley Interscience (ISBN 047140338).




3. Beug, H. et al (1979).


Cell


18, 375-390.




4. Dalton, D. K., et al. (1993).


Science


259, 1739-1742.




5. Digby, M. R., et al. (1995)


J. Interferon Cyt. Res.


15, 939-945.




6. Dijkmans, R. et al. (1990)


Vet. Immunol Immunopathol


26, 319-332.




7. Ding, A. H., et al. (1988).


J. Immunol.


141, 2407-2412.




8. Fast, D. J. et al (1993).


J. Interferon Res.


13, 271-277.




9. Huang, S. et al (1993).


Science


259, 1742-1745.




10. Johnson, D. C., et al. (1988)


Virology


164, 1-14.




11. Landolfo, S., and Forni, G. (1988)


J. Immunol.,


141, 2831-2836.




12. Kaiser, P., et al. (1998)


J. Interferon Cytokine Res.,


18, 711-720.




13. Kita, Y., et al. (1990)


Drug Design Delivery,


6, 157-167.




14. Lambrecht, B., et al. (1999)


Vet. Imm. Immunopathol., in press.






15. Lillehoj, H. S. et al (1992)


Poult. Sci. Rev.


4, 67-85.




16. Lowenthal, J. W. et al (1993) Immunol.


Cell Biol.


72, 115-122.




17. Lowenthal, J. W. et al (1995a) In:


Adv. Avian Immunol. Res.


(Eds, Davison T. F., et al.) Carfax, Oxford. pp179-186.




18. Lowenthal, J. W., et al (1995b)


J. Interferon Cyt. Res.


15, 933-938.




19. Lowenthal, J. W., et al (1997)


J. Interferon Cytokine Res.,


17, 551-558.




20. Lowenthal, J. W., et al (1999)


J. Interferon Cytokine Res.,


in press.




21. Prowse, S. J. et al. (1989)


Avian Pathol.


18, 619-630




22. Pusztai, R. et al. (1986).


Acta Virol.,


30, 131-136.




23. Rose, M. E., et al. (1991)


Infection Immun.,


59, 580-586.




24. Sambrook, J. et al (1989). In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press.




25. Schultz, U. et al (1995).


Eur. J. Immunol.


25, 847-851.




26. Sekellick, M. J. and Marcus, P. I. (1986).


Methods Enzymol.


119, 115-125.




27. Sekellick, M. J. et al (1994).


J. Interferon Res.


14, 71-79.




28. Shimatake and Rosenberg (1981)


Nature


292, 128




29. Snapper, C. M., et al. (1987)


Science,


236, 944-947




30. Steeg, P. S., et al. (1982)


J. Exp. Med.,


156, 1780-1793.




31. Studier and Moffat (1986)


J. Mol. Biol.


189, 113




32. Sung, Y. J. et al (1991).


J. Leukocyte Biol.


50, 49-56.




33. Thacore, H. R. et al (1985).


Interferon Res.


5, 279-288.




34. Thompson et al., (1994)


Nucl. Acids Res.


22, 4673-4680.




35. Von Bulow, V. et al (1984).


Avian Pathol.


13, 621-637.




36. Weiler, H. and Von Bulow, V. (1987).


Avian Pathol.


16, 439-452.




37. Weissmann, C., and Weber, H. (1986).


Prog. Nucleic Acid Res.


33, 251-300.




38. Wheelock, E. F. (1965)


Science,


141, 30-311.

















                  






#             SEQUENCE LISTING




















<160> NUMBER OF SEQ ID NOS: 10













<210> SEQ ID NO 1






<211> LENGTH: 1079






<212> TYPE: DNA






<213> ORGANISM: Gallus sp. (chicken)






<220> FEATURE:






<221> NAME/KEY: CDS






<222> LOCATION: (134)..(625)






<221> NAME/KEY: mat_peptide






<222> LOCATION: (191)..(625)






<221> NAME/KEY: 3′UTR






<222> LOCATION: (626)..(1079)






<221> NAME/KEY: 5′UTR






<222> LOCATION: (1)..(133)













<400> SEQUENCE: 1













ggatccacta gtaacggccg ccagtgtggt ggaattcaga agacataact at






#tagaagct     60













gaagctcact gagcttatat ctgacatctc ccagaagcta tctgagcatt tg






#aactgagc    120













catcaccaag aag atg act tgc cag act tac aac tt






#g ttt gtt ctg tct       169






               Met Thr 






#Cys Gln Thr Tyr Asn Leu Phe Val Leu Ser






                  






#             -15    






#             -10













gtc atc atg att tat tat gga cat act gca ag






#t agt cta aat ctt gtt      217






Val Ile Met Ile Tyr Tyr Gly His Thr Ala Se






#r Ser Leu Asn Leu Val






         -5         






#     -1   1         






#      5













caa ctt caa gat gat ata gac aaa ctg aaa gc






#t gac ttt aac tca agt      265






Gln Leu Gln Asp Asp Ile Asp Lys Leu Lys Al






#a Asp Phe Asn Ser Ser






 10                 






# 15                 






# 20                 






# 25













cat tca gat gta gct gac ggt gga cct att at






#t gta gag aaa ctg aag      313






His Ser Asp Val Ala Asp Gly Gly Pro Ile Il






#e Val Glu Lys Leu Lys






                 30 






#                 35 






#                 40













aac tgg aca gag aga aat gag aaa agg atc at






#a ctg agc cag att gtt      361






Asn Trp Thr Glu Arg Asn Glu Lys Arg Ile Il






#e Leu Ser Gln Ile Val






             45     






#             50     






#             55













tcg atg tac ttg gaa atg ctt gaa aac act ga






#c aag tca aag ccg cac      409






Ser Met Tyr Leu Glu Met Leu Glu Asn Thr As






#p Lys Ser Lys Pro His






         60         






#         65         






#         70













atc aaa cac ata tct gag gag ctc tat act ct






#g aaa aac aac ctt cct      457






Ile Lys His Ile Ser Glu Glu Leu Tyr Thr Le






#u Lys Asn Asn Leu Pro






     75             






#     80             






#     85













gat ggc gtg aag aag gtg aaa gat atc atg ga






#c ctg gcc aag ctc ccg      505






Asp Gly Val Lys Lys Val Lys Asp Ile Met As






#p Leu Ala Lys Leu Pro






 90                 






# 95                 






#100                 






#105













atg aac gac ttg aga atc cag cgc aaa gcc gc






#g aat gaa ctc ttc agc      553






Met Asn Asp Leu Arg Ile Gln Arg Lys Ala Al






#a Asn Glu Leu Phe Ser






                110  






#               115  






#               120













atc tta cag aag ctg gtg gat cct ccg agt tt






#c aaa agg aaa agg agc      601






Ile Leu Gln Lys Leu Val Asp Pro Pro Ser Ph






#e Lys Arg Lys Arg Ser






            125      






#           130      






#           135













cag tct cag agg aga tgc aat tgc taatggcatc tt






#atgacctc ctgtgctcaa     655






Gln Ser Gln Arg Arg Cys Asn Cys






        140          






#       145













ctattttaaa ttttacaatg cacaattttt atgttgtgat tttttaactg ag






#tttatata    715













catttattta ttaatattta agtattttaa ataattattt atattaaaaa aa






#aaccaggc    775













aaacaatgaa agtatttata cctcctactg ctgtgtaaga aacggattgt gg






#tcttaaaa    835













tactgtctat ctgttgtgtg tgggttgact gaaaataccg aatgaggtgg at






#gtttacca    895













gtttctgtgt gggaaatact gaattggagg tggatctgta ctcaagaaaa cc






#cactcatc    955













ccggtcagtc tagtatttct aaatccaaat caaggagtgg cttgtttaaa gg






#gaaaaaat   1015













gtgagcactc tctgactggg tcttagagat tttactgatg gtttggcatg ac






#taagaatt   1075













tagg                 






#                  






#                  






#           1079




















<210> SEQ ID NO 2






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: Gallus sp. (chicken)













<400> SEQUENCE: 2













Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Le






#u Ser Val Ile Met Ile






                -15  






#               -10  






#                -5













Tyr Tyr Gly His Thr Ala Ser Ser Leu Asn Le






#u Val Gln Leu Gln Asp






         -1   1      






#         5         






#         10













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Se






#r Ser His Ser Asp Val






     15             






#     20             






#     25













Ala Asp Gly Gly Pro Ile Ile Val Glu Lys Le






#u Lys Asn Trp Thr Glu






 30                 






# 35                 






# 40                 






# 45













Arg Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Ser Met Tyr Leu






                 50 






#                 55 






#                 60













Glu Met Leu Glu Asn Thr Asp Lys Ser Lys Pr






#o His Ile Lys His Ile






             65     






#             70     






#             75













Ser Glu Glu Leu Tyr Thr Leu Lys Asn Asn Le






#u Pro Asp Gly Val Lys






         80         






#         85         






#         90













Lys Val Lys Asp Ile Met Asp Leu Ala Lys Le






#u Pro Met Asn Asp Leu






     95             






#    100             






#    105













Arg Ile Gln Arg Lys Ala Ala Asn Glu Leu Ph






#e Ser Ile Leu Gln Lys






110                 1






#15                 1






#20                 1






#25













Leu Val Asp Pro Pro Ser Phe Lys Arg Lys Ar






#g Ser Gln Ser Gln Arg






                130  






#               135  






#               140













Arg Cys Asn Cys






            145




















<210> SEQ ID NO 3






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: duck













<400> SEQUENCE: 3













Met Thr Cys Gln Thr Tyr Cys Leu Phe Val Le






#u Ser Val Ile Met Ile






  1               5 






#                 10 






#                 15













Tyr Phe Gly Cys Ser Gly Ser Ala Leu Phe Le






#u Gly Gln Leu Gln Asn






             20     






#             25     






#             30













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Al






#a Ser Asn Ser Asp Val






         35         






#         40         






#         45













Ala Asp Gly Asn Pro Val Phe Ile Glu Lys Va






#l Lys Asn Trp Thr Glu






     50             






#     55             






#     60













Arg Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Thr Leu Tyr Leu






 65                 






# 70                 






# 75                 






# 80













Glu Met Leu Lys Lys Thr Asp Met Ser Lys Pr






#o His Ile Lys Asn Leu






                 85 






#                 90 






#                 95













Ser Glu Gln Leu Asn Thr Leu Arg Asn Thr Le






#u Ser Asn Asp Tyr Lys






            100      






#           105      






#           110













Lys Phe Arg Asp Leu Val Glu Leu Ser Asn Le






#u Gln Leu Thr Gly Leu






        115          






#       120          






#       125













Lys Ile Gln Arg Lys Ala Val Ser Glu Leu Ph






#e Ser Val Leu Gln Lys






    130              






#   135              






#   140













Leu Val Glu Thr Ser Thr Ser Lys Arg Lys Ar






#g Ser Gln Ser Pro Lys






145                 1






#50                 1






#55                 1






#60













Arg Cys Arg Cys




















<210> SEQ ID NO 4






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: turkey













<400> SEQUENCE: 4













Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Le






#u Ser Val Ile Met Ile






  1               5 






#                 10 






#                 15













Tyr Tyr Gly His Thr Ala Ser Ser Leu Asn Le






#u Val Gln Leu Gln Asp






             20     






#             25     






#             30













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Se






#r Ser His Ser Asp Val






         35         






#         40         






#         45













Ala Asp Gly Gly Pro Ile Ile Val Glu Lys Le






#u Lys Asn Trp Thr Glu






     50             






#     55             






#     60













Arg Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Ser Met Tyr Leu






 65                 






# 70                 






# 75                 






# 80













Glu Met Leu Glu Asn Thr Asp Lys Ser Lys Pr






#o His Ile Lys His Ile






                 85 






#                 90 






#                 95













Ser Glu Glu Leu Tyr Thr Leu Lys Asn Asn Le






#u Pro Asp Gly Val Lys






            100      






#           105      






#           110













Lys Val Lys Asp Ile Met Asp Leu Ala Lys Le






#u Gln Met Asn Asp Leu






        115          






#       120          






#       125













Arg Ile Gln Arg Lys Ala Ala Asn Glu Leu Ph






#e Ser Ile Leu Gln Lys






    130              






#   135              






#   140













Leu Val Asp Pro Pro Ser Ser Lys Arg Lys Ar






#g Ser His Pro Gln Arg






145                 1






#50                 1






#55                 1






#60













Arg Cys Asn Cys




















<210> SEQ ID NO 5






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: pheasant













<400> SEQUENCE: 5













Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Le






#u Ser Val Ile Met Ile






  1               5 






#                 10 






#                 15













Tyr Tyr Gly His Thr Ala Ser Ser Leu Asn Le






#u Val Gln Leu Gln Asp






             20     






#             25     






#             30













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Se






#r Ser His Ser Asp Val






         35         






#         40         






#         45













Ala Asp Gly Gly Pro Ile Ile Val Glu Lys Le






#u Lys Asn Trp Thr Glu






     50             






#     55             






#     60













Arg Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Ser Met Tyr Leu






 65                 






# 70                 






# 75                 






# 80













Glu Met Leu Glu Asn Thr Asp Lys Ser Lys Pr






#o His Ile Lys His Ile






                 85 






#                 90 






#                 95













Ser Glu Glu Leu Tyr Thr Leu Lys Asn Asn Le






#u Pro Asp Gly Val Lys






            100      






#           105      






#           110













Lys Val Lys Asp Ile Met Asp Leu Ala Lys Le






#u Arg Met Asn Asp Leu






        115          






#       120          






#       125













Arg Ile Gln Arg Lys Ala Ala Asn Glu Leu Ph






#e Ser Val Leu Gln Lys






    130              






#   135              






#   140













Leu Val Asp Pro Pro Ser Ser Lys Arg Lys Ar






#g Ser Gln Ser Gln Arg






145                 1






#50                 1






#55                 1






#60













Lys Cys Asn Cys




















<210> SEQ ID NO 6






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: guinea fowl













<400> SEQUENCE: 6













Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Le






#u Ser Val Ile Met Ile






  1               5 






#                 10 






#                 15













Tyr Tyr Gly His Thr Ala Ser Ser Leu Asn Le






#u Val Gln Leu Gln Asp






             20     






#             25     






#             30













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Se






#r Ser His Ser Asp Val






         35         






#         40         






#         45













Ala Asp Gly Gly Pro Ile Phe Ile Glu Lys Le






#u Lys Asn Trp Thr Gly






     50             






#     55             






#     60













Ser Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Ser Met Tyr Leu






 65                 






# 70                 






# 75                 






# 80













Glu Met Phe Glu Asn Thr Asp Gln Ser Lys Pr






#o His Ile Lys His Ile






                 85 






#                 90 






#                 95













Ser Glu Glu Leu Cys Thr Leu Arg Asp Ser Le






#u Ser Asp Gly Val Lys






            100      






#           105      






#           110













Lys Val Lys Asp Leu Met Asp Leu Ala Lys Le






#u Leu Met Thr Asp Leu






        115          






#       120          






#       125













Arg Ile Gln Arg Lys Ala Ala Asn Glu Leu Ph






#e Ile Val Leu Gln Lys






    130              






#   135              






#   140













Leu Val Asp Pro Pro Ser Leu Lys Arg Lys Ar






#g Asn Gln Pro Gln Arg






145                 1






#50                 1






#55                 1






#60













Arg Cys Asn Cys




















<210> SEQ ID NO 7






<211> LENGTH: 164






<212> TYPE: PRT






<213> ORGANISM: Japanese quail













<400> SEQUENCE: 7













Met Thr Cys Gln Thr Tyr Asn Leu Phe Val Le






#u Ser Val Ile Met Ile






  1               5 






#                 10 






#                 15













Tyr Tyr Gly His Thr Ala Ser Ser Leu Asn Le






#u Val Gln Leu Gln Asp






             20     






#             25     






#             30













Asp Ile Asp Lys Leu Lys Ala Asp Phe Asn Se






#r Ser His Ser Asp Val






         35         






#         40         






#         45













Ala Asp Gly Gly Pro Ile Ile Val Glu Lys Le






#u Lys Asn Trp Thr Glu






     50             






#     55             






#     60













Arg Asn Glu Lys Arg Ile Ile Leu Ser Gln Il






#e Val Ser Met Tyr Leu






 65                 






# 70                 






# 75                 






# 80













Glu Met Leu Glu Asn Thr Asp Lys Ser Lys Pr






#o His Ile Lys His Ile






                 85 






#                 90 






#                 95













Ser Glu Glu Leu Tyr Thr Leu Lys Asn Asn Le






#u Asn Asp Gly Thr Lys






            100      






#           105      






#           110













Lys Val Lys Asp Ile Met Asp Leu Ala Lys Le






#u Gln Met Asn Asp Leu






        115          






#       120          






#       125













Arg Ile His Arg Lys Ala Ala Asn Asp Leu Ph






#e Ser Val Leu Gln Lys






    130              






#   135              






#   140













Leu Val Asp Pro Pro Ser Ser Lys Arg Lys Ar






#g Ser Gln Cys Leu Arg






145                 1






#50                 1






#55                 1






#60













Arg Cys Ser Cys




















<210> SEQ ID NO 8






<211> LENGTH: 19056






<212> TYPE: DNA






<213> ORGANISM: fowl adenovirus serotype 8 (FAV8)






<220> FEATURE:






<223> OTHER INFORMATION: Description of Artificial 






#Sequence:






      oligonucleotide used to amplify matu






#re interferon coding sequence.













<400> SEQUENCE: 8













agacctcgtc ttcgccacgg tcaaggagaa gatcggctgg cggcggttcg tg






#gaagctat     60













ccaacggtac gtggctgacg cctacggtgc tttcctgaca ctcaatgcgg aa






#accgcacc    120













cgtcgggggt gacgaagata acgccgtcag tgtgctcatt gacactttag gc






#gaagaaag    180













ggctatttta gcagcttatc gggtggcgga aaagctatta gacgataagc cg






#ctgccaaa    240













cgacggcgag aacaatgggt ccgaaaatcc ccgggacgcc gcgcatactt tt






#gcggagag    300













tcccgaatcg gacgaggacg tacaaaaggc gtccgccgag agctctcccg ac






#acaccagc    360













tcgagacttt accgcggaag ccgtaaccgt gtacatcgac tcggacggcg gt






#tgcgagga    420













cagcagcgaa gaagatcagg aggaagagga ggaggacgat gaagaagaag ac






#gaagaaga    480













agaagacgaa gaggaggagg aggaagagga ggaggaggag gacgacggaa ca






#cccgagtc    540













taccccttct accgtcatcg aagcggcgaa tctctcgccg gtcggcaccg ac






#gaaaagca    600













cggggaaccc gacggcgagc ccgatgatgg tgacaatgac gacggagagg ac






#gagggaag    660













aaattctgac gaggatagcg gatactattg gggggatgac acccccctgg aa






#ttggttcg    720













cgatcgcggg acaggcgatc acggtgagcc agatagcacc gctccttccg ac






#ggtcctgg    780













ggaagctccg tcggccgacg gggtagacga ggagcaggag caagacgaac aa






#gagggaga    840













gaccgccgtc cccgccgcca ccgctcagcc cgctttcgac aaatgcctcc aa






#cggcaagc    900













catgatgctc accggcgctt tgaaagacgc cttacccgag caggaacgcg ac






#gtgcccct    960













ctgcgtcgat agcgtgcaat accagctcga gcgctacatc tttaaccccg at






#atgcgtgt   1020













ccctccggaa taccgcgaag tgcgctttaa cttctatccg cccttcatgc gc






#cccaaagc   1080













gatcgcgaac taccacattt tcgccgtcac ggcgcccatt ccggcaagtt gc






#aaagccaa   1140













ccgcagcggg agccagctct tagaagcttg tcgcgacatg aaagtgttca ag






#cgcttacc   1200













tcgttggcgc ctcaacgtcc aatccgacga cgggctcggg gacgaagtgg ta






#cctgtaac   1260













agagctgaca gatgccaaat tagtccctct caaggacgac atctcgcggt tg






#cagtgggc   1320













taaaatgcgc ggtgaacaca tccgcttttt tagctaccct tccctgcaca tg






#cctcccaa   1380













gatctcacgt atgctcatgg agtgtctgct ccaacctttc gcaaacgaaa ac






#gacaaggc   1440













ggaacaggtc gccccctgcg tgagcgaaga ggaaatgcgt tttattgtag at






#ccggagca   1500













gagaatgaga ggcgaggaac tctacaaggc catgctcaaa aggagggccg tc






#gttaccat   1560













ggccgtgcgg tacaccgctt tgctcgagct catggaacgc gtcttccgag ag






#ccttcctc   1620













cgtcaaaaaa gcccaagaag tgctccatca cacccttcat cacggcttcg tg






#gcccaagt   1680













gcgcgaaacg gccaaagtga acctgagcaa ctacgccacc taccacggcg tc






#acctacaa   1740













cgacccgctc aacaactgca cgtcagccaa gcttttcgaa ggcagggaca ag






#gaggatta   1800













cgtgctcgac accgtctacc ttttcttggt cctcaattgg caaaccgcga tg






#ggtatgtg   1860













gcagcaagcc atcgatgata ccaccctgga catctacgcg aaagccttta cg






#cgccagcg   1920













acgcgccatt tacggcctcg gaagcgtcac cgaggtcagc aaggccatcg tc






#gacatcct   1980













gatggacggg gacaggctca cggaggaaat gcggaaagcc ctccccaact tc






#gtgacgca   2040













gagccagatc tccgattttc ggcactttgt caccgaaagg tcgaacgtcc cc






#tccatggc   2100













cgccccgttc tacccctccg atttcgtccc gttggctttc cggcaaagcg cc






#cctctgct   2160













ctgggaccag gtctacctcc tccagatcgc ctttttcctc accaaccacg ga






#ggatacct   2220













gtgggaaccg cccgagagcg aagcggaggt gccgcagcac cgcacttact gc






#ccctgcaa   2280













tctctgcagc ccgcaccgca tgccggcgga taacgtcgct ctgcacaacg aa






#gtgctcgc   2340













catcggcact ttcgagattc gcagcgccga aggcaaatct ttcaggctca cg






#cccgaact   2400













ctgggccaac gcctatctcg ataaattcgt gcccgaggac ttccatcctt tc






#accgtgtt   2460













ccactttccc gaaaaccgct cttccttcac caaaaatcac accggttgcg tc






#acggaaag   2520













tccggaaatc ctctctctga ttcgtcagat ccaggcctcc agggaggagt tt






#ctcctccc   2580













cgagcaaggg gctctacaaa gacccgcaga ccggcgaaac gctcaccact tc






#ggtcgggg   2640













cagagaaccg tcctggagcc tccggcggag cgcctctacc gcccgctgcc gc






#cagtacct   2700













gcggaggagc tcgagcgccg ccgaaacctc ctagggctct acggtctgcc tg






#ccctgctg   2760













cagacccgga ctcccagagc gactacgggg aagctgctct cgcgtccaac ta






#cggccgat   2820













atggctcaga ggatgctgga cgagaaaatc agagttaccg aagaccctcc gg






#aacccgag   2880













aacgccgttc ccttccctac ggacgcccgg ttcgtggggg ttcgcccgtg cg






#gaggacct   2940













gaagtgagcg aatcagacgg agaaacgtta gaagccggac accgagagat ct






#gagtacca   3000













tctcggagag gaggaggacc tcgaagagat ggagaaagag aatatcccac cg






#cggccctc   3060













ctcgctgcct ctggacggga cgcggaaccg caagcgccgc tccgcatcct cg






#cccgggaa   3120













ggagctgaag aggcctccga tccgaaagag agccaaatcc gataaagacg cg






#gagaccgc   3180













gcccgcgtcc aaaaagcgcc gtcctcgagg taactataga agctgggtca gg






#caccgcgt   3240













ggcgatctgc caagcgctcc gcgacgccgt tttcgaccga aggctggcgg cc






#gaaatcct   3300













aaagagagcg cgcggtatct tcgtaccgcc caccgtattg ggctactacg cc






#cgcaaact   3360













cctagaactt cccgacgaag atcactgatc gtcggctttt tctttctcct tt






#ccttctta   3420













gcggctcccg ctaccgcctc tgacacgctc cctccgcctc tcccgccgaa aa






#aacgcccc   3480













aaaaatacgc cgcggaccga ctcgtccttc gaattggtcc ctcccgaggt cg






#cagacttg   3540













aaagccaaca tcctcgacgt gctcgtcgaa atcgaaaata tcgccaaaaa cg






#acccttca   3600













cggcgcgttt ccatccgcaa ccgcacccgg gaaagcatca ctcggcagtt ac






#actacgtc   3660













aaggacgagc aaaaactcac caagcttaag gcagatgcgg aaaaaatcct gc






#acctgtgg   3720













aaatcccttt cctaatcccg cttcttttat agcgctacag accgcgtgac tg






#agcccgcg   3780













gcaacatcat gaacctcctc gaagccactc ctaccgagta cgtgtggaaa ta






#caaccccc   3840













tctccgggat tcccgccggc gcgcaacaga attacggagc gaccataaac tg






#ggtggtgc   3900













ccggaggtaa cagtttcgct tacgcggcgg acgagataag acggcacacc ct






#aagccctg   3960













ccgccacccg cgcgatcacc gaacgtttcg aagctgagtc agaccagcaa cc






#cttcgcca   4020













acgcccggga aaccgcctac atcaccgcca acgtgctgga ctctggcttt cc






#aaagtccg   4080













ccgtgtaccc cgtggaccct tccggagttc aacgggttca gctctcgggc gg






#cgccgagg   4140













gccggatgca actcgcgggt ggcctcaccg aaggtcgagt gcaactttcg gg






#aggtgtcc   4200













taggacacgt cgtgcctcct ggggggagaa gacgcgccgg cgggcgtccg cc






#gcgatggt   4260













gtgggaccgc tctcgcggga aacgggcttc ccgaggacgc cgaagtggtt tc






#ggatacct   4320













acaagtactt cctccgcacc cagggaccca gccaagtcgt gcaagaaccc gg






#cgtgtact   4380













cgcggaggca gttcatgacc accttcctgc cggccgtggt gccccgacct tt






#cagcagtc   4440













ccaatccgcg cgactttccc gcgcagtaca gcgccatcta caaaggcacc aa






#cgcgtacg   4500













aggacgtatt ttgggactgg tgaagtccct cttcgcggct tacccgttgc tg






#acggtgct   4560













ctgtttcgca ataaagttct tccaattcag cctcgctgaa cggttcccgc ct






#cgttattg   4620













tcacgcgttc gcctccgtcg ctcaccacgc gcgcgcgaaa ccgtcttttg at






#ccaaaaga   4680













cgtaaccggg gtttaggggt tgcgcaaacc tcacgatcgc ctggtcgttg ac






#tttcaacc   4740













aatatttttt aggagcctgc gactccgtct ccgacatggc gacctcgact cc






#tcacgcct   4800













tctcctttgg ccaaatcggc tcccgaaaac gccctgcggg tggcgatggc ga






#gcgagacg   4860













cctccaaagt gccgaaaatg cagacccccg ctccgagcgc gaccgccaac gg






#aaatgacg   4920













agctggacct ggtctacccc ttttggctcc aaaacggctc taccggagga gg






#cggcggcg   4980













gcggttccgg tggaaacccg tccctcaacc cgccgttttt ggaccccaac gg






#acccctgg   5040













ccgtccaaaa cagcctcctg aaggtcaata ccgcagcccc catcaccgtc ac






#caataagg   5100













ccctgacact cgcctatgaa ccggagagtc tcgagctcac taaccaacag ca






#actggcgg   5160













tcaaaatcga ccccgaagga cctctgaaag ccacgaccga gggaatacag ct






#gtcggtcg   5220













accctacgac gttggaggtt gatgacgtcg actgggagtt aaccgtgaaa ct






#cgaccccg   5280













atggccccct ggattcctca gccgcaggaa tcacggtccg agtcgatgag ac






#cttgctca   5340













tcgaagatgc tggatccgga cagggcaaag aactcggagt caatctcaac cc






#cacgggac   5400













cgattacggc cgacgaacag ggcctggact tagaaataga caaccagaca ct






#caaggtca   5460













acagtgtcac cggcgggggc gtcctagctg tacaactcaa atcccaaggt gg






#acttaccg   5520













tacagactga cggtatccaa gtgaacactc aaaacagcat caccgttact aa






#cggagctc   5580













tggacgtgaa agtagccgcc aacggacctt tggaatcaac cgacaccggg ct






#cacactta   5640













attatgaccc cggagacttc acagttaatg cgggcacgtt gagcattatt ag






#ggacccgg   5700













ctctcgtagc caatgcgtac ctcacatccg gcgcctccac ccttcagcaa tt






#tacagcta   5760













agagtgaaaa ttccagtcaa ttttctttcc catgcgcata ctatctgcaa ca






#gtggcttt   5820













ccgatgggtt gatttttagc tccctctatc tgaagctcga caggcacagt tc






#acgaacat   5880













accaacgggt gaaaattatc agaacgccaa gtactttacc ttctgggttg ga






#gcgggcac   5940













ttcatttaat ctttctaccc ttacccaacc cactattaca cccaacacca ca






#caatggaa   6000













tgcattcgca cctgctcttg attactcagg tgctcctccc ttcatctacg ac






#gcgtcttc   6060













cgtagttaca atttattttg aacccaccag tggtcgactg gaaagctatc tc






#cccgtcct   6120













taccgataac tggagccaaa caacctacaa ccccggcacc atcaccctgt gt






#gtaagaac   6180













ggtaagggtt caattgagat cgcaagggac cttcagcact ctagtctgtt ac






#aacttccg   6240













ctgtcagaac gcgggcattt ttaacagcaa cgctacaacg ggaaccatga cc






#ctgggtcc   6300













tatcttctgt agttatcctg ccttgagcac cgccaacgct ccttaattca at






#aaaaaatg   6360













atccacacaa tatgaaggtc tactgtgatt ttttattaaa gcagccatac ta






#attctcct   6420













ggatacccat cagtctgtcc cactctccgc gttgccagta gtacaggcag tt






#cacggcgt   6480













ccacgtacca cgattcgctc accagaaaga cccgctgctc gggaaaatcc ac






#catcattc   6540













tgcggatgta gtgacaaggg agcgccccca tctggccgag cgtggccacc gc






#ttccacga   6600













acacaccggt gttgtgcgga gggacataga tgatcatgcc cagaactcct cc






#gcgggcgc   6660













ggcgcagaag acgggataaa attcggtaaa catgacagag gcccacgccg ct






#acgaagta   6720













caccccttcc agactagggt cgccttccag cctgctccaa aggtacacgg ag






#agaccact   6780













gctgtcgggt tgactgcaca cggccatcgg cacgcgtctc atctcgaatc cg






#tggcagtg   6840













acaccgctcc ggaatcatct cgaattcttc caaacataga aactggtgcg cg






#tggacggc   6900













cggcacgaaa cgcaaatctc cttcccctgc tcccaccgcg ggttgatgtt cc






#cctatgtc   6960













ttcgccccat aacctctgag cggccatgat ctacacctgg gattcttcgc gc






#tctatctc   7020













agtatacacg tgttccacag agccgccgta gacctcttcc tcgtcgctac ct






#gccggtgg   7080













cgctctcagc aacgacagtt ccagtggtgt cggcggcggt ggaacagaag ga






#ggcggtga   7140













acgggtatcc gagcgggagt cgtaaaacgg attgctgctc acagtccaat tg






#ggggaacg   7200













agcgggaaac tgagacaggg aacgcagcca ggagaaccga cgtgatggct cg






#cggttatt   7260













aggcaatggt gggggtaaag cagaacaccg gcgacggata ctccaacggt gt






#cctcggat   7320













gctcttgagg acctcccgca atgattctcc gccactgcgc gatcagcaat ac






#aaacgcga   7380













tcgtggctag aagagtgcaa cagccaaaca tcataaacac gtagggaacg gc






#atgtaaat   7440













attgactgag gaagagataa ctggcggcca ccgcaccgca gtgaatgact cc






#cacggtca   7500













cagccagaag cagcagaagg catgcctctc tgcggcgccg gcggatccgc ac






#ctatcaat   7560













agaaaaaagg ggactttcta tcaccctcca cgcgtgcccg gcgcttggac at






#gcaattcc   7620













gcaaatagga caactgagct atagtggcta ggggcaaggg ctgtctaaga gg






#gcatccgg   7680













ggcaagaagc ttcggggtga tggtcgcagt acgtgccgtg aacatgcagt ac






#ccattctt   7740













ctacatccac aaacgtggcg gtacgggaag cggaatgtag cataaccccc gc






#gacaccat   7800













gctccagcaa gcggggtcgg ccatctcttt cagcatggat cgggtcatca ga






#ggctgggt   7860













cacgggactg cccttcccgc aagttttaag aatgacggtc gctaccacat tg






#gtgcgaca   7920













cgcacccaga tagagaacgg gatatttcaa aaaaggcagg tgctcaggca cg






#accgtctg   7980













ggaaacctca taacataatg attgaagagc caaccgaaag gcaacaccgg tc






#tctagaac   8040













gagtcccgta tctacaaaca gaaagtcggt tttgtttttg cgaaccatcc at






#tcccgatg   8100













tttctctatc agaggttccc gcgctacgaa cagacgcctc gaaaccgctc gc






#aggatctc   8160













ctccttttcc gcgggtgata aagacaaccg agactgcagt ctcagtatga cg






#ttcaacag   8220













aacgcacggt cccgtcttga gtctgagata cttcgaacac ctgcagctca ct






#accgtata   8280













cagggactcg tgccacgagt aatgctgggg tttatcgaag agactaatgg ag






#gctacgga   8340













acggctcgtg tgatactcca tcatgcgttc cgctgcttct tgggacggac cc






#tgtctgac   8400













caggatgctg aaccatatgg ctccgcattc gttttgatag ccgcaaccgc gg






#gtaacggc   8460













aaccacctcc tacacgaaag aaaggggcgc cttaagttac tcaaggaaac cg






#cccgggaa   8520













aaatcggggc aatgaaaagc tatcactcac cgaatcagaa cacagaggca tg






#atgcgtaa   8580













ctaagacagc tcttttattg atcaggtacc gtcacctgta aagatacaca ca






#ttaaacga   8640













tacggtaaga gtcaccgcgg taacaccgac atcggtagtg gcagaatata ta






#gagcacga   8700













ctgctgtcgt gaacagagca gctacgacac cacccgtaac aatcgcgagg cg






#cgcggcat   8760













cgtcttccca aaattcacgg atcagagagt agaactctcc tccgagctga gg






#agacgtag   8820













ggaaggatcc cgtagaccca ttgctacttt tttccgtcgg atagcggtag ag






#accaacac   8880













agctaccata gccaaaaaca caagccccac aaccgttaaa aaaagagttc cg






#gtagatgc   8940













acccgaggcc gctactcgag agccctcgtc tatggctcgc aaggcgacgg ct






#tgaaccgg   9000













ttcggtttcg tttagctgga cggtcactac ctcctcttct gacgcggttt cc






#gaagtgct   9060













ccaaaaatcg cttgaactcg gtgtagctgc tgagaaattc caggtcgaaa cg






#gtcgatgc   9120













ggagtctgtc gatgtagagt tcaaagacgc agtaggttct ggcgggaact cc






#acagaaac   9180













gggttccagt gggcttaccg ttaccttcaa ttttataact tcaaattcaa ga






#aagaattc   9240













cagttcgaat acgtcggcat taaagaaggt gacggtaaat tctttcttca tt






#ctgtccaa   9300













ttggaagaca cactgcgcag ctgtctgaca cacgtcccag aaactgtaca gt






#ttatgggt   9360













ccccgaagaa tccgtaagtt ggatactcgt cagccagaaa ggagacttgc ta






#agatctac   9420













cttgagtcca tgtcccactt tcacttctac atcagccagc tggatcggaa tc






#atagctat   9480













cgaggcatct ctatccgcca ggcaaccaga ctgaggagga acactgactt ga






#gatccgcc   9540













gttcggattt aacatcgtgc gataactcat tagggggaat cgctccttgg tt






#accatgca   9600













gtagtgcgca ggccgaccga acggatctct tgtagggtta cagtgcatgg ta






#cgcacaca   9660













ccctccagtc attactttac ggtcctttat cgagggagcg cttgacgaat cc






#tgatagaa   9720













tccctgtggt gtgatcacgt acaccaggta gatacttgca gaaggattcc ag






#tgacggat   9780













ccacaacacc tcttctgcaa gctcggtgta acccaccgcg gtaagtacat ca






#tacctccc   9840













ataccgaagt gtttgctcac tgtaacctcc gatgaacatt cgactcccac ta






#gaagctac   9900













tactatgatc atgatcggag ttacaaagtc ctgcttgagt acgggtgagt ac






#gtaatctc   9960













agtcatgtag ctaatgctaa tatgattgaa gtagctagcg tatctgtaat ct






#cgactcat  10020













agtataccca ttccaagtgc tccggacagg acccactttg aaaccctcat ta






#agcaagtg  10080













aaacatgggt aacccagttc tcacatccaa agtctttaga aacttcggta ct






#atcaatct  10140













atgaaaacag ccgcttttac tccacgtatc cctccatgag aattcttcgc ag






#accgtctg  10200













tccccataca ctttctgcac acactcttcc cgaccatccc ccatgaatcc ca






#caacctct  10260













accgccctta tcctccaaca tgatatcctc agaagccgta taccctcctg ta






#atccacga  10320













cccttccgtt ttcaggactg ccacgtaatc cgcatcattt ttatctaagc ct






#ccggtaac  10380













aaacgtgggc tctaacccga ctattctggt acaccgtcta tccccagaaa ta






#tatgtcca  10440













ctgtctgcag atagtagagc aagcgtgagc gccggcagaa tgtcctatac ag






#tgtaacct  10500













tttcgaatgt ggtatgtccg acagaaactt cccgaaatca acatacagac cg






#tcatagtc  10560













gtagtacagg ttccagtcca ccaggagcag cgcgactgca ggcgtcatat tc






#tgatggac  10620













acgcaacacc tgtctaaaac tttgatagcc catgtaatac cccggtataa gc






#acaatgat  10680













atcggtcttg ccggctaaag cactgtgcaa tcgatggtag acaccgtact gg






#tacgtcac  10740













gtcgtgaaat ttcggcacac ccccgtgagc tccataccac gtaatcttcg at






#ggcggtcg  10800













gctcaatctt ccaacgcctc tcggagcatc aagttttaga gaatccggtc tc






#gccacgca  10860













tgaccgattg cccgaatcgg gacatgcaac tgccgatttc gcacacgaaa gc






#acggaggc  10920













tccgaagagc accccgacca actgaaacag aacgcatgat ttagacccac tc






#ccgacaga  10980













ggattaacgc gacccaatca agggatatca aaaaagaatc cttaccgcgg ag






#agattcat  11040













agaccgaaga gttgagagcg ctcctgtttc tctgaagatc tctcaccccg ac






#tgtgacag  11100













atccacaaag cagcactcaa tttatactgt caaatggtta atgtttaatg ct






#agaaaagc  11160













gctgacaccc agtaaatatt tacttagttt gcagttccac tgtttcctta tt






#gccatgac  11220













tggacaaaaa ccacagataa gatgttccat tcaagggaac ccgatgttcc ct






#cgataact  11280













tcccggtaca aagtccaaaa atagaactag gtgctttata aatactaaga gt






#cgactcct  11340













tggtgtttca gaagaacaca gacgatctac aaacaggatg aacctcggaa ga






#ctcaacac  11400













cgccggtaag aacatcttaa tttttacttt gtatgatttt caattctgaa aa






#acacgttt  11460













cctggttcgt gcacgtacgc ggaaacgaag ttcgaaaaat cagagttgga at






#tttccagc  11520













tatggttaac tattaactat atgacgtcac ttagttaatt attaacgata ta






#aagtaaat  11580













gattaactcg ggctagttaa tgattaacta tacctggtta atgattaact ga






#cttagtta  11640













atgattaact agaagttaat gattaactag aagttaatga ttaactagaa gt






#taatgatt  11700













aatctattac gtcactcgtt atatattaac tagtgacgtc actcgttata ca






#ttaaccca  11760













ttacgtcact cgttatacat taactagtga cgtcatgagt aaatcattaa cc






#ttcatgca  11820













tatgcatgag gagctactga atatgcatga gagcctcata catatgcatg ga






#acttatgc  11880













atattcacga cactcatgca tatgcatgca ttggttaaag agtaacccta tg






#actcagtg  11940













tgtatgttta cgttgcctag caacgttaat gatttacctg ctgacgtggc ag






#ctccgcct  12000













ccaggtaaat catttacctg aactttgttc tttatgttta ttcaccatgg ca






#acgctacc  12060













atatatggac atccgactcc gcctcccccg ttatacatta acgatggcgt ga






#taggcgga  12120













gctctccccc attggctctc aatgacgtag ttcaggttaa ccataagcca ga






#accgccta  12180













tataggtaga gcaggtagac ccggaacacc attcccatcc ggacctccat ag






#agtgcgga  12240













cctctacggg ctctccatac cggtaaatat tttattccat ttaatccaat cg






#aataaatc  12300













aataatcaac tcaatgctgt gattctgcct caaattcaat ggtgattttc tt






#taataaaa  12360













agcccacccc ccttggcacc cccctgtaca cccccctgta caggcgacca cc






#ccctatgg  12420













acacccccct gtacaggcga ccacccccta tggacacccc cctgtacagg cg






#accacccc  12480













ctatggacac ccccctgtac acccccctgt acaggcgacc accccctatg ga






#cacccccc  12540













tgtacaggcg accaccccct atggacaccc ccctgtacac ccccctgtac at






#tttctccc  12600













ataggctaca atggaatact gccccctagt gtctcctgct gtatgggacc cc






#tatgatgt  12660













gggcgccatt acctttgcca ctatggagct ccttcacgag ggggcgccat tg






#aaattggg  12720













agaccgcata gagagcctag ccaatggggt gctttggaat ccggatatcc cc






#gtccaact  12780













cttcaactgc ctttccattc gctcatgggg atcacatggg aagcgcgtca tg






#taccgtgg  12840













ccacacctac cggatgtacc acgcccagtt acgggtccga agctccgccc cc






#gttactag  12900













gaaacaggcc ggaagcctgc tcctcagcct atcacagaag ctcctctgtt tc






#gccgcccg  12960













ctttaatacc catcccctcg tgatgcaatt gggggtggag tctaacccta tg






#ggcctacc  13020













tgtatatacc aagagggccc tccagatggc gctacagagt atgcgggtgc gc






#attgcccc  13080













tgacggccag aaggtggcgc caccggagat aggcaagacc tgtacggtga ag






#cccctcaa  13140













gaccccggag accctccagc agggggtctt cagtaccacc gatttaaaaa ag






#acacttcc  13200













agattgggct tttcgccgac tttttaacca aaccccctat atttgtggat gg






#aagattgg  13260













caccgcgcca gaaggggcgg agagttggat cgttacgctc cacccccagc ct






#tcgactcc  13320













gccccccaca gggaccaaga ctccgcccac tctgcaggac cttgcccggc tg






#ggcgtggt  13380













cgagcaatgc ctcaagatga ggaggcgtgg cctggaccgc aggcaccacc cc






#tatgctca  13440













ataaaccaat cagattccag tacttggctc ctcctatttg tgggcgggac tt






#tgcacgcc  13500













tcttagcggc gccccctggc ggccgagggc cgccactgca cccctgtcgg ac






#ttagtctc  13560













tggcgcgggg ccggtcaatc attaacccga cggccggcac gggcgccccc tg






#gcggcggg  13620













cgcccgccac tgcaccctgc gcctcttagc ggcgccccct ggcggccgag gg






#ccgccact  13680













gcacccctgt cggacttagt ctctggcgcg gggccggtca atcattaacc cg






#acggccgg  13740













cacgggcgcc ccctggcggc gggcgcccgc cactgcaccc tgcgcctctt ag






#cggcgccc  13800













cctggcggcc gagggccgcc actgcacccc tgtcggactt agtctctggc gc






#ggggccgg  13860













tcaatcatta acccgacggc cggcacgggc gccccctggc ggcgggcgcc cg






#ccactgca  13920













ccctgcgcct cttagcggcg ccccctggcg gccgagggcc gccactgcac cc






#ctgtcgga  13980













cttagtctct ggcgcggggc cggtcaatca ttaacccgac ggccggcacg gg






#cgccccct  14040













ggcggcgggc gcccgccact gcaccctgcg cctcttagcg gcgccccctg gc






#ggccgagg  14100













gccgccactg cacccctgtc ggacttagtc tctggcgcgg ggccggtcaa tc






#attaaccc  14160













gacggccggc acgggcgccc cctggcggcg ggcgcccgcc actgcaccct gc






#gcctctta  14220













gcggcgcccc ctggcggccg agggccgcca ctgcacccct gtcggactta gt






#ctctggcg  14280













cggggccggt caatcattaa cccgacggcc ggcacgggcg ccccctggcg gc






#gggcgccc  14340













gccactgcac cctgcgcctc ttagcggcgc cccctggcgg ccgagggccg cc






#actgcacc  14400













cctgtcggac ttagtctctg gcgcggggcc ggtcaatcat taacccgacg gc






#cggcacgg  14460













gcgccccctg gcggcgggcg cccgccactg caccctgcgc ctcttagcgg cg






#ccccctgg  14520













cggccgaggg ccgccactgc acccctgtcg gacttagtct ctggtgcggg cc






#cgagtcac  14580













ggatggagta gtttcccttg cggccagcag agggcatacc tttattctca gc






#tcgcaagt  14640













ctcaatagat acacacctca tcggtgtaca gcgtgtccgc gtagcgcagc cc






#cgtgcacc  14700













tcacccaacc acctatatcg cgaacggctc cggtactcac tatgtatttc cc






#gacgcgat  14760













agttcggatc attgcaccac ttattcaagt acattctaaa ccattgccct tc






#ggggactt  14820













ggcgctgata aaaacattcc ctgaagtacc gtttcaccgc gcgagaacac tt






#atacaagt  14880













atctgtcccg caggttgaac atggttaagc acagaagcaa ggtcatgtgg ca






#ggaacaag  14940













aaccgccagg ctgcaacccc acgcagtatc ccatcggatg accgatctcc ga






#gttcgcct  15000













cctcgtggaa cgggtaccat agctgcttca cgtcttgaac cagcttccag aa






#cactgcat  15060













cgtgcataca ccacggcggc acggcaactc cgaagatcac gtacagtggc at






#gttccgga  15120













tacatctacg acacaggtac tgtgacacct tgcgcgtacg cgaaaaggga ac






#ccgaccct  15180













cccccgtaac gctccactta cggacagccg gcgatgcgca ctgcgaacga aa






#aataaatc  15240













tgcgccgttg tgcgctccag gcggaaacag gggaatatat aagccaactc tt






#atctttat  15300













tgttgccacg cccgacacta tccagatttc gagacctgct gacaccaccg ga






#acacgcga  15360













cctcgccctc tctttatcat ccatacgccc aggtgactca gtcaaatccc tt






#atataaag  15420













accgttttta cctgaccgct tccacgtaca caaggcggca catgaaagca cc






#atgctgcg  15480













ccccgtatcc gccatcgcgt tcctctcgtg cctatgtctc acgcggaccg cg






#caacaggt  15540













cggtaagtcc tttaatctta cgacccactc caacctcact gtgcacccgc ag






#accaaagg  15600













aacctcaaag caagagtggc ggctagggcg cgataccaag attgcgatgt gg






#gagaaagg  15660













ctacgggtac agctacccgt cgggaccctt taaaggccgc gtagaaatga ac






#gagaccag  15720













tgtcaccttt tttgacctcc gtcccaacga ttctgccata ctgacttact tc






#tccgaaga  15780













tagctccggc acggagagtg aatatccgta cgccatcagc gtaagaggtg ag






#cccttccc  15840













tacctttgtt ccattccgcc catcgagcac ctcagccgac accacacatt tt






#cagatccc  15900













ctccgccctc ccattctacg gctgatgact aacaattccc gtccgcggac cg






#agagccgc  15960













atgagcttgc agtgcatcgc gctcgataac gatagttcca ttacgtacgc ct






#ggtacact  16020













gacaccttag agagcgggga caacatccga gaagtaaccg tccgaacgga tt






#ctgaggta  16080













gcagttacct gtcggatatc ggatggacat tccaccaatt ccgcgactct cg






#tcgtgccg  16140













ctaaaccgag gtcagtaata tcccctccct caccgcaaca gatccgcaca gt






#caggatcc  16200













caggctttca cgatcctttc cccactcctt tagaacctgc cgctccctac gg






#cgcggata  16260













tgactacggt gttcctggcc atcttagccc ttattcttct aaccgtcatc gg






#cggctacg  16320













ccctcagaaa gctgtgtatg cgaaacgagc gcgtttttat ttgtaacccg ta






#cagagaat  16380













gttttggcgg tcatctctag gacaaataaa cttctacttg aaatgagttt at






#ttttcccc  16440













ctgcctgttt gtgatgggaa atgatcggtg ctgcttatgg accgagatag at






#ggaaggga  16500













cgggggcatt caaatttcta ggtccaggga cataaaaaag agatcaaatt ta






#catctccg  16560













gtaaagatca cctctataac cccgctgtga atcccagcac tcccttccga ta






#cgcaaact  16620













gactagcagt tcctgtgtat agacaaacgg aatcctggtg tacagacaaa cg






#gaatcctg  16680













agttcccaac gcattcattt atttgaatat ttacacattt acacactgta ca






#cggtcatt  16740













cgatttcatt gccaacagaa agactaatcg atgtcccctt tcagtatgtg ga






#ctgtgaca  16800













gcagggtctt cgctcacttc actgtccgtg tcatcctctg tacgcccaca ca






#gcatcgcc  16860













cgatagtgaa agctgacact cagcatggag aaccaaacag cagggagcaa tg






#tgagaggc  16920













agccaacaca gggaaacttt tttcttctcc cttcagaccc cctcccgtcg ag






#acattgtg  16980













atggactact ggtacttcgc cctgatgttc ccaggtagga acgaccgtaa gg






#gtgaacct  17040













ctgaacgctg ttctgcatca ggtcccgtgt cacttgatac atgccggaat cc






#gcgccact  17100













taagttcttg atagtcacgc agttctcgga tctgttatac gacagcctcc ct






#tgatacgc  17160













cccgtagacc atcggctcct tcagcgcctg gtagtcctgc agcacgaact tg






#cgcacggc  17220













gcccgcatcc accgcggtca cttcccattc tctgatctga aaactctcgg ta






#gaaccgca  17280













cagagtcaca gcgtcccgtt cgttagccac gacccgggat acgttctcca tt






#ttcaccgt  17340













accgttctcg ggaagccccg acacggtgaa atatacagtc tcgggcttgg aa






#cccaccgc  17400













gaatgattgt gatagccagc acccgttatt agctttgatt gcttcgacat gc






#attgaatt  17460













acaggatgaa tttagccgcg ccctcgtcat atagcccaga tccagcccct ct






#ttgatcga  17520













aggaatcacg aaagccactt tctgccatct gttacagacc ttccccggag cg






#tggtacca  17580













tagcagcagc gtgaaatcag cgcatctgcc cgtagtcaga gtcacctcct ta






#cggcccct  17640













cacggcggca ccggagacgg tggcagacaa gcagaggacg gcggcacaca gc






#aggagcga  17700













gccatgactg cggagtccga gccgagcggt gtgctgctcg atcctccgct ac






#ctttttat  17760













gcaccaccca cctttattgt cggtcacaca ttaattcgcc ccgtcagcaa ac






#acgtgagt  17820













aacgtatgcc gttgttctga tcggtcagca ccgcgcccgc gacgtttgaa cg






#aagacgta  17880













cggtgacttc cgcataggga gctataagga agtcagttag gaaaaatcga tc






#ctcgacac  17940













accccacgga aacgctgacc taggcgaaac ctatcaggta aaacattcac ta






#tacgcacc  18000













acgcgttgaa taaacagtta acccatacgg ggtatatatt ctaccccgac tg






#cagtcagc  18060













gatcaggacg cgtccacaga gagatccgtg cgcgaccgcc tgtccgggct cc






#tctagaat  18120













caagaattcc ataaccatgc aggtaagaac tcctttctct tcctcctatt tg






#atccgagc  18180













ctttttttac gctactcaac cgcaacccgt ttcttccacc acagttactg ct






#ccttctat  18240













gcctttgccc tctgatgggc agcggaacac tagcacccct cgtctcggta ga






#caactcct  18300













actccgtgtt cggatccggc aaacccccac tttctacctc cgaatccgcc ac






#caccgcct  18360













actccgaaac cgcggttccc gaaaactctt acccccatcc gaagccacca cg






#ccctgcga  18420













cgacttgctg gaagaggact gctggttcgc ggagagcagc gcggactacg ca






#cccatacc  18480













ctggaacacc aaagagaata cgtccgtggt tatcccggca caggtagccg tc






#tcgccatc  18540













gcagtccact actccccctg cggtcatgct cggcatcgca cagaaagccg ta






#aaccgcgg  18600













agcctccagc aaggatcaca cgtcccatat cgccacgggc gttaccgtag cc






#ggaatagt  18660













catactcatt gccctcgtca tcatagcctt ccgtacaaag gttaaggaac cg






#cgcccaac  18720













ccgctccatc tacctgggcg tgcctccccc tgacgttaga ccttaccgta ta






#atagagca  18780













ataaagattt ggccgccaca tcgcacaaga atctttccgt gtcctgtgtc tg






#tctcggcg  18840













ccgtccgcgg gaaaaggtta acgcggaatc tatttccctg cggatttccg ta






#tccgtcag  18900













ttcctgggcg tcgccgaaaa tgctcacgga agacacgccc atgcgggcgt gg






#ctaaccga  18960













tgattcgaaa aacgattcgc gagcgccctc tgccggcggc ggcgggaata gg






#gggtgtgg  19020













ggggagtgta ttttaagtag atatatatag atgatg      






#                  






#    19056




















<210> SEQ ID NO 9






<211> LENGTH: 27






<212> TYPE: DNA






<213> ORGANISM: Artificial Sequence






<220> FEATURE:






<223> OTHER INFORMATION: Description of Artificial 






#Sequence:






      oligonucleotide used to amplify matu






#re interferon coding sequence.













<400> SEQUENCE: 9













actagatctc atactgcaag tctaaat          






#                  






#             27




















<210> SEQ ID NO 10






<211> LENGTH: 30






<212> TYPE: DNA






<213> ORGANISM: Artificial Sequence






<220> FEATURE:






<223> OTHER INFORMATION: Description of Artificial 






#Sequence:






      oligonucleotide used to amplify codi






#ng sequence for mature






      interferon.













<400> SEQUENCE: 10













actaagcttt tagcaattgc atctcctctg         






#                  






#           30













Claims
  • 1. A method of enhancing the growth performance of a healthy or diseased bird, said method comprising administering to said bird an avian IFN-γ cytokine polypeptide for a time and under conditions sufficient to induce weight gain in said healthy or diseased bird or to prevent weight loss in said diseased bird, wherein said avian IFN-γ cytokine polypeptide is selected from the group consisting of:(a) a polypeptide encoded by DNA present in an avian DNA library, wherein said DNA hybridizes under conditions of at least moderate stringency with a probe having a sequence complementary to at least 50 contiguous nucleotides of SEQ ID NO: 1; and (b) a polypeptide encoded by a nucleotide sequence that is degenerate with a DNA molecule according to (a).
  • 2. The method according to claim 1, wherein the avian IFN-γ cytokine polypeptide is administered by a method comprising administering to the bird nucleic acid encoding said avian IFN-γ cytokine polypeptide.
  • 3. The method according to claim 2, wherein the nucleic acid is in an attenuated live viral vector and in a form suitable for expressing the avian IFN-γ cytokine polypeptide in a bird.
  • 4. The method according to claim 3 wherein the viral vector is fowl adenovirus vector.
  • 5. The method according to claim 2, wherein the nucleic acid is in a non-replicating viral vector and in a form suitable for expressing the avian IFN-γ cytokine polypeptide in a bird.
  • 6. The method according to claim 2, wherein the nucleic acid is in a plasmid vector and in a form suitable for expressing the avian IFN-γ cytokine polypeptide in a bird.
Priority Claims (2)
Number Date Country Kind
PL 8297 Apr 1993 AU
PN 1542/95 Mar 1995 AU
CROSS REFERENCE TO RELATED APPLICATIONS

The present application is a continuation-in-part of U.S. Ser. No. 08/765,381, filed Apr. 25, 1997, now U.S. Pat. No. 6,083,724, issued Jul. 4, 2000, and U.S. Ser. No. 09/272,032 filed Mar. 18, 1999, now U.S. Pat. No. 6,296,852B1, issued Oct. 2, 2001. U.S. Ser. No. 08/765,381 is the United States national phase application of International application No. PCT/AU96/00114 filed on Mar. 5, 1996, which claims priority from Australian Patent Application No. PN 154295, filed Mar. 6, 1995. U.S. Ser. No. 09/272,032 is a continuation-in-part application of U.S. Ser. No. 08/448,617, filed Sep. 8, 1995, now abandoned, which is the United States national phase application of International application No. PCT AU94/00189 filed Apr. 14, 1994, which claims priority from Australian Patent Application No. PL 8297 filed Apr. 14, 1993.

US Referenced Citations (3)
Number Name Date Kind
4456748 Goeddel Jun 1984 A
4935233 Bell et al. Jun 1990 A
5641656 Sekellick et al. Jun 1997 A
Foreign Referenced Citations (3)
Number Date Country
4036855 May 1992 DE
0 088 540 Sep 1983 EP
0492179 Nov 1991 EP
Non-Patent Literature Citations (11)
Entry
Digby, et al., (1995) “Cloning and Expression of the chicken Interferon-gamma gene,” Journal of Interferon and Cytokine Research, 15:939-945.
Fredericksen, et al. (1987) “Purification of Avian T Cell Growth Factor and Immune Interferon Using Gel Filtration High Resolution Chromatography,” UCLA Symposia on Molecular and Cellular Biology: 1:145-156.
Gray, et al., (1982) “Expression of human immune interferon cDNA in E. coli and monkey cells,” Nature, 295:503-508.
Lillehoj, et al., (1993) “Avian Interleukin-2 and Interferon,” Colloques De L'Inra (Avian Immunology In Progress), 62:105-111.
Lillehoj, et al., (1993) “Biochemical and functional characterizations of avian gamma-Interferon and Interleukin-2,” Colloques De L'Inra (Avian Immunology In Progess), 62:131-136.
Lowenthal, et al., (1995) “Production of Interferon-gamma by chicken T cells,” Journal of Interferon and Cytokine Research, 15:933-938.
Schultz, et al. (1995) “Recombinant Chicken Interferon: A Potent Antiviral Agent that Lacks Intrinsic Macrophage Activating Factor Activity”, Eur. J. Immunol., 25:847-851.
Schultz, et al. (1995) “Recombinant Chicken Interferon from Escherichia coli and Transfected COS Cells is Biologically Active”, Eur. J. Immunol., 229:73-76.
Sekkellick, et al., (1994) “Chicken Interferon gene: Cloning, expression and analysis,” Journal of Interferon Research, 14:71-79.
Weinig, et al, (1996) “Biological properties of recombinant chicken Interferon-gamma,” European Journal of Immunology, 26:2440-2447.
Weiler, H., et al. (1987) Avian Pathol 16:439-452.
Continuation in Parts (4)
Number Date Country
Parent 08/765381 US
Child 09/443218 US
Parent 09/443218 US
Child 09/443218 US
Parent 09/272032 Mar 1999 US
Child 09/443218 US
Parent 08/448617 US
Child 09/272032 US