Viral amplification of recombinant messenger RNA in transgenic plants

Abstract

A novel method of over expressing genes in plants is provided. This method is based on the RNA amplification properties of plus strand RNA viruses of plants. A chimeric multicistronic gene is constructed containing a plant promoter, viral replication origins, a viral movement protein gene, and one or more foreign genes under control of viral subgenomic promoters. Plants containing one or more of these recombinant RNA transcripts are inoculated with helper virus. In the presence of helper virus recombinant transcripts are replicated producing high levels of foreign gene RNA.Sequences are provided for the high level expression of the enzyme chloramphenicol acetyltransferase in tobacco plants by replicon RNA amplification with helper viruses and movement protein genes derived from the tobamovirus group.

Description

BACKGROUND OF THE INVENTION

The present invention relates to the field of genetically engineering transgenic plants. More specifically, the invention relates to the use of viral RNA to achieve high level expression of foreign genes in plants.

The use of transgenic plants for high level expression of foreign genes has been targeted as an inexpensive means for mass producing desired products. All higher plants are photoautotrophic, requiring only CO.sub.2, H.sub.2 O, NO.sub.3.sup.-1, SO.sub.4.sup.-2, PO.sub.4.sup.-3 and trace amounts of other elements for growth. From these inexpensive starting materials, plants are capable of synthesizing a variety of valuable products. Progress in utilizing transgenic plants as low cost factories will depend on both the characterization of biosynthetic pathways and on the further development of gene expression technologies.

In the past decade, a number of techniques have been developed to transfer genes into plants (Potrykus, I., Annual Rev. Plant Physiol. Plant Mol. Biol. 42:205-225 (1991)). For example, chromosomally integrated transgenes have been expressed by a variety of promoters offering developmental control of gene expression. (Walden and Schell, Eur. J. Biochem. 192:563-576 (1990)). This technology has been used primarily to improve certain agronomic traits such as disease resistance or food quality. (Joshi and Joshi, Febs. Lett. 281:1-8 (1991)). However, the utility of known transgene methodology is limited by 1) the difficulty of obtaining high level expression of individual transgenes 2) the lack of means necessary for coordinating control of several transgenes in an individual plant 3) the lack of means to enable precise temporal control of gene expression and 4) the lack of adequate means to enable shutting off introduced genes in the uninduced state (Walden and Schell, Eur. J. Biochem 192:563-576 (1990)).

The most highly expressed genes in plants are encoded in plant RNA viral genomes. Many RNA viruses have gene expression levels or host ranges that make them useful for development as commercial vectors. (Ahlquist, P., and Pacha, R. F., Physiol. Plant. 79:163-167 (1990), Joshi, R. L., and Joshi, V., FEBS Lett. 281:1-8 (1991), Turpen, T. H., and Dawson, W. O., Amplification, movement and expression of genes in plants by viral-based vectors, Transgenic plants: fundamentals and applications (A. Hiatt, ed.), Marcel Dekker, Inc., New York, pp. 195-217. (1992)). For example, tobacco (Nicotiana tabacum) accumulates approximately 10 mg of tobacco mosaic tombamovirus (TMV) per gram of fresh-weight tissue 7-14 days after inoculation. TMV coat protein synthesis can represent 70% of the total cellular protein synthesis and can constitute 10% of the total leaf dry weight. A single specific RNA transcript can accumulate to 10% of the total leaf mRNA. This transcript level is over two orders of magnitude higher than the transcription level observed for chromosomally integrated genes using conventional plant genetic engineering technology. This level of foreign gene expression has not yet been obtained using the prior art viral vectors in plants.

Most plant viruses contain genomes of plus sense RNA (messenger RNA polarity) (Zaitlin and Hull, Ann. Rev. Plant Physiol. 38:291-315 (1987)). Plus sense plant viruses are a very versatile class of viruses to develop as gene expression vectors since there are a large number of strains from some 22 plus sense viral groups which are compatible with a wide number of host plant species. (Martelli, G. P., Plant Disease 76:436 (1992)). In addition, an evolutionarily related RNA-dependent RNA polymerase is encoded by each of these strains. This enzyme is responsible for genome replication and MRNA synthesis resulting in some of the highest levels of gene expression known in plants.

In order to develop a plant virus as a gene vector, one must be able to manipulate molecular clones of viral genomes and retain the ability to generate infectious recombinants. The techniques required to genetically engineer RNA viruses have progressed rapidly. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is used to make all of the constructions. The genome of many plus sense RNA viruses can be manipulated as plasmid DNA copies and then transcribed in vitro to produce infectious RNA molecules (reviewed in Turpen and Dawson, Transgenic Plants, Fundamentals and Applications, Marcel Dekker, New York, pp 195-217 (1992)).

The interaction of plants with viruses presents unique opportunities for the production of complex molecules as typified by the TMV/tobacco system (Dawson, W. O., Virology 186:359-367 (1992)). Extremely high levels of viral nucleic acids and/or proteins accumulate in infected cells in a brief period of time. The virus catalyzes rapid cell-to-cell movement of its genome throughout the plant, with no significant tissue tropism. The infection is maintained throughout the life of the plant. The plants are not significantly adversely affected by the viral infection since the virus causes little or no general cytotoxicity or specific suppression of host gene expression.

The tobacco mosaic tobamovirus is of particular interest to the instant invention in light of its ability to express genes at high levels in plants. TMV is a member of the tobamovirus group. TMV virions are 300 nm.times.18 nm tubes with a 4 nm-diameter hollow canal, and consist of 2140 units of a single structural protein helically wound around a single RNA molecule. The genome is a 6395 base plus-sense RNA. The 5'-end is capped and the 3'-end contains a series of pseudoknots and a tRNA-like structure that will specifically accept histidine. The genomic RNA functions as mRNA for the production of proteins involved in viral replication: a 126-kDa protein that initiates 68 nucleotides from the 5'-terminus and a 183-kDa protein synthesized by readthrough of an amber termination codon approximately 10% of the time (FIG. 1). Only the 183-kDa and 126-kDa viral proteins are required for TMV replication in trans. (Ogawa, T., Watanabe, Y., Meshi, T., and Okada, Y., Virology 185:580-584 (1991)). Additional proteins are translated from subgenomic size mRNA produced during replication (reviewed in Dawson, W. O., Adv. Virus Res. 38:307-342 (1990)). The 30-kDa protein is required for cell-to-cell movement; the 17.5-kDa capsid protein is the single viral structural protein. The function of the predicted 54-kDa protein is unknown.

The minimal sequences required in cis for TMV replication are located at the extreme 5' and 3' noncoding regions (replication origins), as determined by analysis of deletion mutants in plant protoplasts (Takamatsu, N., et al., J. Virol. 64:3686-3693 (1990), Takamatsu, N., et al., J. Virol. 65:1619-1622 (1991)). In whole plants, helper-dependent RNA replicons, constructed by deletion of most of the 126/183-kDa replication protein sequence and most of the 30-kDa movement protein sequence, are replicated and spread systemically in the presence of wild type TMV (Raffo A. J., and Dawson W. O., Virology 184:277-289 (1991)).

Turpen, et al. discloses a simple and reliable gene transfer method wherein cDNA of TMV is engineered into A. tumefaciens for expression in plant cells (Turpen, T. H., Ph.D. Dissertation, University of California, Riverside, pp. 88-105 (1992)). This method provides an alternative to the use of synthetic infectious transcripts to inoculate plants based on host transcription of viral cDNA in vivo. Turpen showed successful transfection of tobacco (N. tabacum cv. Xanthi and Xanthi/nc) with wild type and defective viral genomes using this methodology.

Transfection also occurs spontaneously in transgenic lines containing defective or wild type cDNA of TMV integrated chromosomally (Turpen, T. H., Ph.D. Dissertation, University of California, Riverside, pp. 106-132 (1992), Yamaya, J., et al., Mol. Gen. Genet. 211:520-525 (1988)). Thus, once chromosomally integrated, viral replication can be derived from the process of host cell transcription.

Plant virus infections are initiated by mechanical damage to the plant cell wall. Following replication in the initially wounded cells, progeny viruses spread over short distances (cell-to-cell movement) before entering vascular tissue for long distance movement. Studies with chimeric tobamoviruses indicate that the coat protein is required for efficient long distance movement. However, a virus where the coat protein has been deleted or inactivated moves over short distances as does wild type virus (Dawson W. O. and Hilf, M. E., Ann. Rev. Plant Physiol. Plant Mol. Biol. 43:527-555 (1992)).

In the case of TMV, functional 30-kDa movement protein is absolutely required for cell-to-cell movement in whole plants, but can be deleted or inactivated without affecting replication in protoplasts or inoculated leaves (reviewed in Citovsky, V., Zambryski, P., BioEssays 13:373-379 (1991) and Deom, C. M., Lapidot, M., and Beachy, R. N., Cell 69:221-224 (1992)).

A sequence located within the 30 kDa movement protein gene of the U1 strain of TMV serves as the origin of assembly. It is at this origin of assembly that the TMV RNA and the viral capsid protein spontaneously aggregate to initiate the assembly of virions (Butler, P. J. G., Mayo, M. A., Molecular architecture and assembly of tobacco mosaic virus particles, The molecular biology of the positive strand RNA viruses. (D. J. Rowlands, M. A. Mayo, and B. W. J. Mahy, eds.), Academic Press, London. pp. 237-257 (1987)). A functional origin of assembly is also required for efficient long distance movement (Saito, T., Yamanaka, K., and Okada, Y., Virology 176:329-336 (1990)). There does not appear to be any additional requirements for packaging. A variety of heterologous sequences can be encapsidated yielding rod-shaped virions whose lengths are proportional to the size of the RNA molecule containing the origin of assembly (Dawson, W. O. et al., Virology 172:285-292 (1989)).

Construction of plant RNA viruses for the introduction and expression of foreign genes in plants is demonstrated by French, R., et al., Science 231:1294-1297 (1986); Takamatsu, N., et al., EMBO J 6:307-311 (1987); Ahlquist, P., et al., Viral Vectors, Cold Spring Harbor Laboratory, New York, 183-189 (1988); Dawson, W. O., et al., Phytopathology 78:783-789 (1988); Dawson, W. O., et al., Virology 172:285-292 (1989); Cassidy, B., and Nelson, R., Phytopathology 80:1037 (1990); Joshi, R. L., et al., EMBO J. 9:2663-2669 (1990); Jupin, I., et al., Virology 178:273-280 (1990); Takamatsu, N., et al., FEBS Letters 269:73-76 (1990); Japanese Published Application No. 63-14693 (1988); European Patent Application No. 067,553; and European Patent Application No. 194,809, European Patent Application No. 278,667. Most of the viral vectors constructed in these references were not shown to be capable of systemic movement in whole plants. Rather, gene expression has only been confirmed in inoculated leaves. In other cases, systemic movement and expression of the foreign gene by the viral vector was accompanied by rapid loss of the foreign gene sequence (Dawson, W. O., et al., Virology 172:285 (1989)).

With further improvements, successful vectors have been developed based on tobamoviruses for rapid gene transfer to plants. (Donson et al., Proc. Natl. Acad. Sci. 88:7204-7208 (1991)). For example, the .alpha.-trichosanthin gene was added to the genome of a tobamovirus vector under the transcriptional control of a subgenomic promoter obtained from a strain distantly related to wild type TMV (Turpen, T. H., Ph.D. Dissertation, University of California, Riverside, pp. 72-87 (1992)). This vector is an autonomous virus, containing all known viral functions. Two weeks post-inoculation, transfected Nicotiana benthamiana plants accumulated .alpha.-trichosanthin to levels of at least 2% total soluble protein. Purified recombinant .alpha.-trichosanthin produced by this method was correctly processed and had the same specific activity as the enzyme derived from the native source. Therefore, messenger RNA produced by viral RNA amplification in whole plants is fully functional. However, after prolonged replication of certain sequences using this vector, some genetic instability was observed primarily due to recombinational deletions and point mutations (Kearney, C. M., et al., Virology (in press)).

Recently, very similar results were obtained using gene vectors derived from additional plus sense RNA viruses infecting plants; a potyvirus, tobacco etch virus ((Dolja, V., et al., PNAS 89:10208-10212 (1992) and a potexvirus, potato virus X (Chapman, S., et al., Plant Journal 2:549-557 (1992)).

Therefore, the major functional disadvantages of existing prior art viral vectors are their genetic instability regarding the fidelity of maintenance of some non-viral foreign genes in systemically infected whole plants, after prolonged replication and passaging. For many products, it will be desirable to increase the genetic fidelity by lowering the proportion of deletion and other variants in amplified populations.

An additional concern regarding the use of viral vectors for the expression of foreign genes in transgenic plants is biological containment of the viral vectors encoding for foreign genes.

SUMMARY OF THE INVENTION

The present invention relates to a replicon transcribed from a transgene integrated into the chromosome of a plant cell. The replicon encodes for replication origins possessing substantial sequence identity to a plus sense, single stranded RNA plant virus and at least one gene non-native to a plus sense, single stranded RNA plant virus. However, the replicon does not encode for at least one protein necessary for replication. According to the present invention, expression of the non-native gene is regulated by a helper virus encoding for a protein needed by the replicon for replication.

According to the present invention, it is preferred that the sequence encoding the non-native gene be located 5' to the 3' replication origin of the replicon. It is further preferred that the replicon encode for a gene needed by the helper virus for systemic infection, most preferably a viral movement protein located 3' to the 5' replication origin of the replicon.

The present invention also relates to a protein expressed in a plant cell using a replicon of the present invention. The present invention also relates to an RNA sequence expressed in a plant cell using the replicon of the present invention. The present invention also relates to a primary or secondary metabolite accumulated in the tissues of a transfected plant as a result of the expression of the non-native gene encoded by a replicon of the present invention. The present invention also relates to a transgenic plant comprising a transgene integrated into the chromosome of a plant cell wherein the transgene encodes for a replicon of the present invention.

The present invention also relates to a method of expressing a gene in a plant by integrating a transgene into a chromosome of a plant cell, the transgene encoding for a replicon of the present invention. The transgenic plant is then infected with a helper virus encoding for the protein needed by the replicon for replication.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 depicts the genome of wild type TMV.

FIGS. 2A-2C depict the essential features of the instantly claimed viral replicons.

FIG. 3 depicts an embodiment where the replicon and helper virus are mutually dependent.

FIG. 4 depicts a preferred replicon gene arrangement where the foreign gene is situated at the 3' end of the genome 5' to the 3' replication origin.

FIG. 5 depicts the construction of a transgene for the synthesis of a replicon encoding Chloramphenicol Acetyltransferase (CAT) in an Agrobacterium transformation vector.

FIG. 6 provides a restriction map of the transgene portion of pBGC272.

FIG. 7 depicts an autoradiograph showing the separation and identification of pBGC272 and pBGC273.

Definitions

Foreign gene: A "foreign gene" refers to any sequence that is not native to the virus.

In cis: "In cis" indicates that two sequences are positioned on the same strand of RNA or DNA.

In trans: "In trans" indicates that two sequences are positioned on different strands of RNA or DNA.

Movement protein: A "movement protein" is a noncapsid protein required for cell to cell movement of replicons or viruses in plants.

Origin of Assembly: An "origin of assembly" is a sequence where self-assembly of the viral RNA and the viral capsid protein initiates to form virions.

Replication origin: A "replication origin" refers to the minimal terminal sequences in linear viruses that are necessary for viral replication.

Replicon: A "replicon" is an arrangement of RNA sequences generated by transcription of a transgene that is integrated into the host DNA that is capable of replication in the presence of a helper virus. A replicon may require sequences in addition to the replication origins for efficient replication and stability.

Transcription termination region: The "transcription termination region" is a sequence that controls formation of the 3' end of the transcript. Self-cleaving ribozymes and polyadenylation sequences are examples of transcription termination sequences.

Transgene: A "transgene" refers to the DNA sequence coding for the replicon that is inserted into the host DNA.

Virion: A "virion" is a particle composed of viral RNA and viral capsid protein.

DETAILED DESCRIPTION OF THE INVENTION

The instant invention provides high level expression of foreign genes in plants by viral replicons wherein the replicons possess improved genetic stability. The replicons of the instant invention are produced in host plant cells by transcription of integrated transgenes. The replicons of the instant invention are derived, in part, from single stranded plus sense plant RNA viruses.

The replicons of the instant invention code for at least one foreign gene and possess sequences required in cis for replication ("replication origins"). FIG. 2(c). The replicons are produced by host cell transcription of a chromosomally integrated transgene to form an RNA transcript. The transgene is a DNA sequence that codes for the replicon and also contains a promoter and a transcription termination region. FIG. 2(a). The replicon is generated from an RNA transcript of the transgene by RNA processing and replication in the presence of a helper virus. FIG. 2(b).

The replicons of the instant invention lack functional replication protein sequences. Because the replicons of the instant invention lack replication protein sequences, they must rely on genetic complementation with helper viruses for replication. The replicon's dependency on the helper virus for replication enables regulatable amplification of these replicons through the introduction of the helper virus.

Genetic complementation of the replicon with a helper virus provides many advantages over autonomous viral vectors for amplifying gene expression. Each infected cell of a transgenic plant contains a correct master copy of the gene to be amplified. This reduces the effects of genetic drift in replicating RNA populations that can result in sequence instabilities and point mutations after prolonged replication of an RNA vector (Kearney, C. M., et al., Virology (in press)).

In a further embodiment of the instant invention, the replicon codes for at least one sequence upon which the helper virus is dependent. Thus, in this further embodiment, the replicon and the helper virus are mutually dependent. �See FIG. 3!. Helper virus dependence on the replicon insures amplified expression of the replicon sequences by the helper virus in whole plants.

In a further embodiment, the replicon codes for a functional movement protein such as the 30 kDa TMV movement protein. The helper virus used in this embodiment does not possess a functional movement protein. Thus, the helper virus is dependent on the replicon for movement functionality. Movement proteins are necessary for cell to cell movement in plants. By placing a functional movement protein sequence on the replicon and either deactivating or deleting the same sequence on the helper virus or by using a host species with helper virus encoded movement protein incompatibility, the helper virus's dependency on the replicon enables systemic infection of the whole plant with the viral replicon plus helper virus.

This embodiment of the instant invention has the further advantage that the only virus released into the environment will be a debilitated helper virus. Thus, the helper virus will not be able to spread in plants that do not already contain a functional copy of the viral movement protein. This embodiment provides an option for more stringent levels of biological containment which may be desirable in some cases for large scale commercial production.

In a preferred embodiment, the replicon is formulated such that the sequences encoding the replication origins and the movement functions are linked to the foreign gene sequences. The chromosomally integrated transgene that codes for the replicon is transcribed by host RNA polymerase II producing recombinant mRNAs. In the presence of a helper virus, these transcripts are replicated as additional replicon components in a mixed population. During viral replication, subgenomic messenger RNA may be produced from replicon RNA resulting in amplified expression of foreign genes. The most preferred replicon gene arrangement places the foreign gene at the extreme 3' end of the genome where the viral structural protein is normally encoded. See FIG. 4. This position for the foreign gene at the extreme 3' end of the genome, as depicted in FIG. 4, is critical for high level expression (Culver, J. N., et al., Virology (in press)). However, the protein coding sequences or other gene sequences located between the replication origins may be functional in any order.

Additional preferred embodiments of the replicon sequence include the use of regulatable promoters to control expression of the foreign gene and/or movement protein. One promoter for expression of a fusion protein containing the foreign protein or a series of subgenomic promoters may be employed. Self-cleaving ribozymes or a polyadenylation region may also be employed as the transcription termination regions.

The replicons are generated in vivo in plants through transcription of transgenes that are integrated into the host plant cell chromosome and through replication in the presence of a helper virus. The transgenes can be introduced into the host plant cell chromosome by known transformation methods using a variety of promoters. After the replicon has been introduced into the host, the resulting transgenic plants are grown to an optimized stage at which point a helper virus strain is added. The replicons are then amplified by the introduced helper virus and the foreign gene is expressed.

The foreign gene product coded for and expressed by the replicon can be a very wide variety of RNA or proteins products and include, for example, antisense and ribozyme RNA, regulatory enzymes, and structural, regulatory and therapeutic proteins that may be expressed in their native form or as gene fusions. Typical therapeutic proteins include members of the interleukin family of proteins and colony stimulating factors such as CSF-G, CSF-GM and CSF-M. It is understood, however, that any therapeutic protein can be coded for and expressed in the instant invention.

If expression of the foreign gene results in the accumulation of a protein or other material in the plant tissues, that resulting product may be harvested once the desired concentration of that product is achieved. Significant quantities of recombinant proteins, nucleic acids or other metabolites can be inexpensively produced using this procedure. The low level of expression and wide variation that is observed in transgenic organisms chromosomally transformed with the same construct (a phenomenon attributed to "position effects"), is avoided by this method. RNA-based amplification is not critically dependent on initial transcript amounts. There is also no theoretical limit to the number of genes that can be amplified at the RNA level. The target gene remains "off" before amplification because subgenomic mRNA is only produced during viral replication. Therefore this approach might be particularly appropriate for controlling complex biochemical pathways or producing products that are toxic to the plant. It would be feasible for example, to overexpress critical enzymes in a pathway and simultaneously down-regulate other genes by amplifying antisense RNA only after inoculation with a helper virus. These types of manipulations are not possible using existing or proposed technologies for chromosomal transformation of plants or plant cell cultures or by using prior art viral vectors.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The following examples further illustrate the present invention.

EXAMPLE 1

Construction of a Transgene for Expression of Recombinant Messenger RNA

Construction of a transgene derived from TMV is set forth herein. The wild type TMV genome is set forth in FIG. 1. The construction of DNA plasmids containing the 5' replication origin fused to the CaMV 35S promoter are described in (Ow, D. W., et al., Science 234:856-859 (1986)) and the 3' replication origin fused to a ribozyme termination region are described by Turpen, T. H., Ph.D. Disertation, University of California, Riverside, pp. 88-105 (1992).

The substitution of the coat protein gene for the coding sequence of CAT is described in Dawson, et al., Phytopathol. 78:783-789 (1988).

Previously disclosed plasmids, pBGC43, pBGC44, pBGC75 (Turpen, T. H., Ph.D. Disertation, University of California, Riverside, pp. 88-136 (1992)) and pTMVS3CAT28 (Dawson, et al., Phytopathol. 78:783-789 (1988)) are used as precursors for the construction of the desired transgene for synthesis of replicon RNA (FIG. 5). Construction of plasmids pBGC43, pBGC44, pBGC75 are described in Table 1 taken from Turpen, T. H., Ph.D. Disertation, University of California, Riverside, pp. 92, 112 (1992). Construction of plasmids pBGC43, pBGC44, pBGC75 and pTMVS3CAT28 are also discussed below.

Preparation of pTMVS3-CAT-28

pTMVS3-CAT-28 containing a substitution of the chloramphenicol acetlytransferase (CAT) gene for the coat protein gene was constructed as follows. The CAT gene was removed from pCM1 (Pharmacia) with SalI and ligated into XhoI-cleaved pTMVS3-28. pTMVS3-28 was constructed by cloning genomic length TMV CDNA (6.4 kb) in pBR322 as described in Dawson W., et al., Proc. Natl. Acad. Sci. 83:1832-36, (1986). The CAT construction produced pTMVS3-CAT-28 from which the mutant cp S3-CAT-28 was transcribed. Correct sequence and orientation were confirmed by sequencing. Gene Anal. Technol. 2:89-94.

Preparation of pBGC43

pTK49 was constructed by cloning the 1.4 kb PstI-HindIII fragment of TMV cDNA in pUC19 as described by Dawson, W., et al., Proc. Natl. Acad. Sci. 83:1832-36 (1986). The 1.4 kb PstI-HindIII from pTK49 was recloned into pUC19 to form pTT1. The 1.6 kb HindIII-BamHI fragment from pDO432 described in Ow et al., Science 234:856-59, (1986) was cloned into pTT1. NotI linkers were added at the HindIII site of the fragment and the EcoRI site of the vector. pTT3 was constructed by digesting pTT2 with PstI-BamHI and mung bean nuclease to position the 35S promoter at the 5' end of TMV cDNA. The 1.9 kb NotI-SmaI fragment of pTT3 was cloned into pBStKs+ to form pBGC43.

Preparation of DBGC44

The 1.4 kb SalI-HindIII fragment from pTT1 was cloned into pstSk- to form pBGC8. The 3.6 kb HindIII fragment from pTMV204 disclosed in Dawson, et al., Proc. Natl. Acad. Sci. 83:1832-36, (1986) was cloned into pBGC8 to form pBGC9. The 4.8 kb SmaI-PstI fragment from pBGC9 was cloned into pBGC43 (described above) to form pBGC44.

Preparation of pBGC 75

The 2.1 kb EcoRI-PstI fragment from pTMV204 described in Dawson, W., et al., Proc. Natl. Acad. Sci. 83:1832-36, (1986) was cloned into pBstSk- to form pBGCll. The 3.6 HindIII fragment from pTMV204 was cloned into pBGCll to form pBGC14. The 0.4 kb NcoI-PstI fragment of pTMVcpS3-28 (0.5 kb coat protein deletion of pTMV304, described in Dawson, W., et al. Phytopathology 78:783-789) was substituted for the 0.9 kb NcoI-PstI fragment of pGC14 to form pGC15. pBGC19 was formed by deleting the 0.03 kb KpnI-HindIII polylinker region of pBGC14.

pBGC70 was formed by cloning a 0.05 kb synthetic ApaI-PstI ribozyme encoding fragment into pBstSk+. pBGC72 was formed by deleting the 3.5 kb ClaI fragment from pBGC19. pBGC73 was formed by cloning the 0.05 kb ApaI-PstI fragment of pBGC70 into pBGC72. pBGC74 was formed by substituting the 0.1 kb ClaI-NsiI fragment of pBGC15 for the 0.5 kb ClaI-NsiI fragment of pBGC73. The 3.5 kb ClaI fragment of pBGC19 was cloned into pBGC74 to form pBGC75.

TABLE 1______________________________________Designation Relevant Characteristics Source or Reference______________________________________E. coliJM109 recA1, endA1, gyrA96, Yanish-Perron et al. thi-, hsdR17(r.sub.K-, m.sub.K+), Gene 33:103-199 (1985) supE44, relA1, .DELTA.(kac-proAB), �F traD36, proAB, lacI.sup.q Z.DELTA.M15!HB101 hsdS20 (r.sub.B-, m.sub.B-), supE44, Sambrook et al. ara14, gelK2, lecY1, Molecular Cloning: proA2, rspL20, xyl-5, mtl-1 A Laboratory Manual Cold recA13 Spring Harbor Laboratory (1989)GJ23 General plasmid mobilizing Van Haute et al. strain containing pGJ28 EMBO J. 2:411-417 (1983) and pR64drd11A. tumefaciensC58C1 Rif.sup.r derivative of strain Zambryski et al. C58 containing pGV3850 EMBO J. 2:2143-2150 (1983)A. t.-17 TMV transfection Turpen, T. H., Ph.D. strain containing Dissertation, University of pGV3850::pBGC17 California, Riverside, pp. 106-132 (1992)A. t.-46 TMV transfection Turpen, T. H., Ph.D. strain containing Dissertation, University of pGV3850::pBGC46 California, Riverside, pp. 106-132 (1992)A. t.-49 TMV transfection Turpen, T. H., Ph.D. strain containing Dissertation, University of pGV3850::pBGC49 California, Riverside, pp. 106-132 (1992)A. t.-77 TMV transfection Turpen, T. H., Ph.D. strain containing Dissertation, University of pGV3850::pBGC77 California, Riverside, pp. 88-105 (1992)PlasmidspBstSK/ E. coli cloning plasmids, Stratagene, La Jolla,pBstKS pBluescript (+/-) CaliforniapUC18/pUC19 E. coli cloning plasmids Yanish-Perron et al. Gene 33:103-199 (1985)pT7/T3.alpha.19 E. coli cloning plasmid BRL, Gaithersburg, MDpTK49 1.4 kb PstI-HindIII Dawson et al. Proc. Natl. fragment of TMV cDNA Acad. Sci. U.S.A. in pUC19 83:1832-1836 (1986)pTMV204 Genomic length TMV Dawson, et al. Proc. Natl. cDNA (6.4 kb) in pBR322 Acad. Sci. U.S.A. 83:1832-1836 (1986)pTMV212 Genomic length TMV Dawson, unpublished cDNA in pT7/T3.alpha.19pTMVcpS3-28 Coat protein deletion Dawson et al. (0.5 kb) mutant of Phytopathology 78:783-789 pTMV204 (1988)pAP2034 pBR322- sed selection- Velton et al. Nucleic Acids expression vector for plant Res. 13:6981-6998 (1985) transformation, Cb.sup.r, Sp.sup.r, Kn.sup.rpDO432 Source of restriction site Ow et al. modified 35S promoter Science 234:856-859 (1986)pTT1 1.4 kb PstI-HindIII Turpen, T. H., Ph.D. fragment from pTK49 Dissertation, University of cloned in pUC19 California, Riverside, pp. 106-132 (1992)pTT2 1.6 kb HindIII-bamHI Turpen, T. H., Ph.D. fragment from pDO432 Dissertation, University of cloned in pTT1, NotI California, Riverside, linkers added at KindIII pp. 106-132 (1992) site of fragment and EcoRI site of vector Turpen, T. H., Ph.D.pTT3 PstI-BamHI + mung bean Dissertation, University of nuclease deletion of PTT2 California, Riverside, positioning 35S promoter at pp. 106-132 (1992) 5'-end of TMV cDNApBGC6 0.2 kb XhoI-PstI fragment Turpen, T. H., Ph.D. from pTMVcpS3-28 in Dissertation, University of pBstKS+ California, Riverside, pp. 106-132 (1992)pBGC8 1.4 kb SalI-HindIII Turpen, T. H., Ph.D. fragment from PTT1 Dissertation, University of cloned in pBstSK- California, Riverside, pp. 106-132 (1992)pBGC9 3.6 kb HindIII fragment Turpen, T. H., Ph.D. from pTMV204 cloned in Dissertation, University of pBGC8 California, Riverside, pp. 106-132 (1992)pBGC11 2.1 kb EcoRI-PstI fragment Turpen, T. H., Ph.D. from pTMV204 cloned in Dissertation, University of pBstSK- California, Riverside, pp. 106-132 (1992)pBGC14 3.6 kb HindIII fragment Turpen, T. H., Ph.D. from pTMV204 cloned in Dissertation, University of pBGC11 California, Riverside, pp. 106-132 (1992)pBGC15 0.4 kb NcoI-PstI of Turpen, T. H., Ph.D. pTMVcpS3-28 substituted Dissertation, University of for 0.9 kb NcoI-PstI California, Riverside, fragment of pBGC14 pp. 88-105 (1992)pBGC16 3.3 kb SalI-BamHI Turpen, T. H., Ph.D. fragment of pBGC9 cloned Dissertation, University of in pAP2034 California, Riverside, pp. 106-132 (1992)pBGC17 Full length wtTMV cDNA Turpen, T. H., Ph.D. in pAP2O34 Dissertation, University of California, Riverside, pp. 106-132 (1992)pBGC19 0.03 kb KpnI-HindIII Turpen, T. H., Ph.D. polylinker deletion of Dissertation, University of pBGCT4 California, Riverside, pp. 106-132 (1992)pBGC43 1.9 kb NotI-SmaI fragment Turpen, T. H., Ph.D. from pTT3 cloned in Dissertation, University of pBstKS+ California, Riverside, pp. 106-132 (1992)pBGC44 4.8 kb SmaI-PstI fragment Turpen, T. H., Ph.D. of pBGC9 cloned in Dissertation, University of pBGC43 California, Riverside, pp. 106-132 (1992)pBGC45 4.3 kb BgIII-BamHI Turpen, T. H., Ph.D. fragment of pBGC44 Dissertation, University of cloned in the BamHI site California, Riverside, of pAP2034 pp. 106-132 (1992)pBGC46 3.1 kb BamHI fragment of Turpen, T. H., Ph.D. pBGC44 cloned in the Dissertation, University of BamHI site of pAP2043 California, Riverside, pp. 106-132 (1992)pBGC49 2.6 kb BamHI fragment of Turpen, T. H., Ph.D. pBGC14 cloned in the Dissertation, University of BamHI site of pBGC45 California, Riverside, pp. 106-132 (1992)pBGC70 0.05 kb synthetic Turpen, T. H., Ph.D. ApaI-PstI ribozyme Dissertation, University of encoding fragment cloned California, Riverside, in pBstSK+ pp. 88-105 (1992)pBGC72 3.5 kb ClaI deletion of Turpen, T. H., Ph.D. pBGC19 Dissertation, University of California, Riverside, pp. 88-105 (1992)pBGC73 0.05 kb ApaI-PstL fragment Turpen, T. H., Ph.D. of pBGC70 cloned in Dissertation, University of pBGC72 California, Riverside, pp. 88-105 (1992)pBGC74 0.1 kb ClaI-Nsil fragment Turpen, T. H., Ph.D. of pBGC15 substituted for Dissertation, University of for 0.5 kb ClaI-Nsil California, Riverside, gragment of pBGC73 pp. 88-105 (1992)pBGC75 3.5 kb ClaI fragment of Turpen, T. H., Ph.D. pBGC19 cloned into Dissertation, University of pBGC74 California, Riverside, pp. 88-105 (1992)pBGC77 2.7 kb BamHI fragment of Turpen, T. H., Ph.D. pBGC75 cloned into Dissertation, University of pBGC45, 35S promoter California, Riverside, plus full length cp-TMV pp. 88-105 (1992) cDNA in pAP2034 with rebozyme self-cleaving fragment at 3'-terminus______________________________________

With regard to construction of the transgene, it is desired to place the 30-kDA movement protein gene at precisely the same position as the replicase gene (relative to 5' replication origin in the wild type TMV genome, See FIG. 5). To accomplish this, a NdeI site is introduced at the start codon of each gene by PCR-based mutagenesis using synthetic primers and unique adjacent cloning sites. A 270 bp mutagenesis product containing the internal NdeI site from the PCR primer is subcloned using the EcoRV site in the cauliflower mosaic virus 35S promoter and the HindIII site in the 30-kDa protein gene. The ligation product is then sequence verified.

The 3' segment of the replicon, containing the CAT gene will be placed adjacent to the 3'-ribozyme as a HindIII-NsiI fragment from the transient TMV vector pTMVS3CAT28 (FIG. 5). In the final cloning step, the 5' portion of the transgene and the 3' portion will be subcloned into the unique BamHI site of the plant transformation vector pAP2034 (Velton and Schell, NAR 13:6981-6998 (1985) as a BglII-BamHI fragment described previously (Turpen, T. H., Ph.D. Disertation, University of California, Riverside, pp. 88-132 (1992)). The sequence of the replicon RNA, produced by host transcription, RNA processing, and replication in the presence of a helper virus is given as SEQ. No. 1. Thus, the foreign gene (CAT) is placed on a RNA viral replicon, under control of the coat protein subgenomic promoter for messenger RNA synthesis (located at the 3' end of the movement protein gene).

EXAMPLE 2

Transformation of Plants

In one embodiment of this invention, Agrobacterium tumefaciens is used for insertion of this sequence into the plant chromosome as described previously (Turpen, T. H., Ph.D. Dissertation, University of California, Riverside, pp. 106-132 (1992)). The transformation vector pAP2034 is a cointegrating type Agrobacterium vector. pAP2034 containing the transcription unit for the production of replicon RNA is mobilized into A. tumefaciens by conjugation using the helper strain GJ23 (Van Haute, E., Joos, et al., EMBO J. 2:411-417 (1983)). Transconjugants are selected and the structure of the cointegrate between donor plasmid and the disarmed Ti plasmid pGV3850 (Zambryski, P., et al., EMBO J. 2:2143-2150 (1983)) is confirmed by Southern blot hybridization. A correct homologous recombination event places the transgene construct between the T-DNA borders.

Axenic leaf segments of N. tabacum cv. Xanthi are treated (Horsch, R.B., et al., Leaf disc transformation, Plant molecular biology manual. (S. B. Gelvin, R. A. Schilperoort, and D. P. S. Verma, eds.), Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. A5:1-9 (1988)) in the following sequence: day 1; leaf segments are dipped in A. tumefaciens liquid culture and placed on regeneration media (RM), day 3; explants are transferred to RM supplemented with cefotaxime (500 .mu.g/ml), day 5; explants are transferred to RM/cefotaxime (500 .mu.g/ml)+kanamycin (100 .mu.g/ml), day 30-40; shoots excised and placed onto rooting media containing cefotaxime (500 .mu.g/ml) and kanamycin (100 .mu.g/ml). Cultures are maintained under continuous fluorescent light (Sylvania GTE, Gro-Lux WS) at 20.degree. C.

Hardened plants are grown in commercial potting soil (Cascade Forest Products Inc., Arcata, Calif.) at a temperature of 21.degree.-29.degree. C., with a controlled release fertilizer (Osmocote, 14-14-14) using natural light (Vacaville, Calif.) supplemented with fluorescent light on a 16 hr day length in an indoor greenhouse. The antibiotic resistance trait carried in transgenic lines is scored by germinating seedlings in sterile agar in the presence of 100 ug/ml kanamycin (Dunsmuir, P., et al., Stability of introduced genes and stability of expression, Plant molecular biology manual. (S. B. Gelvin, R. A. Schilperoort, and D. P. S. Verma, eds.), Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. C1:1-17 (1988)).

EXAMPLE 3

Production of Replicon RNA in the Presence of Helper Virus

The sequence of the replicon RNA, produced by host transcription, RNA processing, and replication in the presence of a helper virus, is given as SEQ. No. 1. Tobamoviruses with mutations or naturally occurring variation in the 30-kDa protein gene are deficient in cell-to-cell movement on specific host species. Transgenic plants or alternate hosts can complement this defect. It will be appreciated to those skilled in the art that there are numerous methods of producing helper tobamoviruses by genetic engineering or by mutagenesis in addition to those helper variants or host species combinations occurring naturally. Likewise, methods for producing transgenic plants which express 30 kDa protein and which complement defective 30 kDa containing viruses have been published. For example, movement deficient helper viruses can be synthesized by transcription of TMV with known mutations for the production of RNA inoculum. Transgenic plants expressing the 30-kDa protein complement this defect (Deom, C. M., et al., Science 237:389-394 (1987)). Therefore, large quantities of a helper virus can be propagated. In one embodiment of this invention, a 30-kDa protein frameshift mutant, having a single base pair deletion at position 4931 thereby creating a EcoRV site in the cDNA, is used as helper virus. Transgenic tobacco (.about.100 plants) are regenerated containing this replicon transgene construction and assayed for CAT activity in the presence and absence of helper viruses using procedures described (Shaw, W. V., Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria, Methods in Enzymology, Vol. 53, (S. Fleischer and L. Packer, eds.), pp. 737-755 (1975)). 200 mg of leaf tissue is macerated in assay buffer followed by the addition of 0.5 mM acetyl CoA and 0.1 uCi �.sup.14 C!chloramphenicol, incubation for 45 min at 37.degree. C., extraction, resolution by thin-layer chromatography, and autoradiography.

EXAMPLE 4

Production of CAT in Tobacco Plants Using a Replicon RNA in the Presence of Helper Virus

Several tobacco plants (Nicotiana tabacum) were transformed with a transgene of the present invention in order to evaluate the ability of the transgene to be expressed within a plant cell as well as the ability of the transgene to systemically infect a plant and express a protein encoded by the transgene. In the present example, systemic expression of chloramphenicol acetyl transferase encoded by the transgene was achieved at a level two fold that of the background level and comparable to levels obtained for single copy tobacco genes.

In the present example, pBGC272 and pBGC273 were used to introduce the transgenes. A restriction map of the transgene portion of pBGC272 is provided in FIG. 6. pBGC272 has been deposited with the American Type Culture Collection, Rockville, Md. (ATCC) under Accession No. 75632. It is predicted that amplified expression of CAT from pBGC272 would be observed in the presence of a helper virus through complementation with the helper virus.

A control plasmid, pBGC273, was also prepared which differs from pBGC272 in that the 3' noncoding region has been deleted. Amplified expression of CAT is not expected with pBGC273 because deletion of the 3' noncoding region prevents synthesis of the minus strand.

Identification of Transcript Production

Tobacco plants were transformed with either pBGC272 or pBGC273 using the Agrobacterium tumefaciens leaf-dip method as described in Example 2. In order to save time, bacterial conjugation was avoided by using a binary plasmid vector system for plant transformation instead of employing cointegrate vectors. Bevan, M., et al. Nucleic Acid Res. 12:8711-8721 (1984).

The presence of the viral transcripts after inoculation was measured by northern hybridization. Specifically, total RNA was purified, glyoxalated, separated by electrophoresis, blotted to a nylon membrane (Nytran) and probed with the NdeI-NsiI fragment of pBGC272 which had been .sup.32 P-labeled by the random primer method. An autoradiograph showing the separation and identification of pBGC272 and pBGC273 is depicted in FIG. 7. Lanes 1, 2 and 20 contain control DNA restriction fragments from pBGC272. Lanes 3-10 and 13-18 contain total RNA from transgenic plant samples (pBGC272, pBGC273). Lanes 11 and 12 contain control samples from 30K transgenic plants (line 26C) known to complement helper virus TMMVDEcoRV. Lane 19 contains RNA (1/220 equivalent) from helper virus TMMVDEcoRV-infected line 26C control plants.

Out of 16 plants transformed with pBGC272, 12 contained abundant levels of transcript. Similarly, out of 6 plants transformed with pBGC273, 4 plants produced transcripts.

Identification of CAT Production

The ability of pBGC272 to systemically infect a plant and produce a marker protein, chloramphenicol acetyl transferase (CAT), was also evaluated. CAT concentrations were determined using an ELISA assay. Gendloff, E., et al. Plant Mol. Biol. 14:575-583 (1990). Leaf disc samples (#8 core bore) were used. Total soluble protein from the same leaf disk samples used for CAT/ELISA was determined by the method Bradford, M. Anal. Biochem. 72:248-254 (1976).

Three groups of plants containing pBGC272 or pBGC273 by the Agrobacterium tumefaciens leaf-dip method were infected with one of three helper viruses. The helper viruses used in the present example include the wild type TMV virus (TMVU1), TMVDEcoRV and TMV3OK-O. The helper viruses used in the present study are derived from the readily available tobamovirus strains, TMVU1 (also known as the common or wild type strain, ATCC No. PV 135) and odonoglossum ringspot tobamovirus (ORSV, ATCC No. PV274). Paul, H., C.M.I./A.A.B. Descriptions of Plant Viruses, No. 155 (TMVU1); Zaitlin, M., C.M.I./A.A.B. Descriptions of Plant Viruses, No. 151 (ORSV).

Helper virus TMVDEcoRV contains a point mutation in the TMV 30K gene. TMVDEcoRV was created by deleting nucleotide 4931 by oligonucleotide site directed mutagenesis of TMVUl cDNA, thereby introducing an EcoRV site at this position and causing a frame shift mutation in the 30K gene. Infectious RNA transcripts are then synthesized in vitro and used as inoculum.

TMV30K-O contains the 30K gene from odonoglossum ringspot tobamovirus (ORSV) in a U1 strain background. TMV30K-O is partially deficient in movement function, showing delated and sporadic systemic infection in Xanthi tobacco. Dawson, W., et al. Ann. Rev. Plant Physiol. Plant Mol. Biol. 43:527-555 (1992). Helper virus TMV30K-O may be prepared by substituting the cDNA encoding the 30K gene of the TMVU1 strain with the 30K gene from ORSV by routine genetic manipulation techniques. Infectious RNA transcripts are then synthesized in vitro and used as inoculum.

The first group of plants (147 individuals) were infected with TMVDEcoRV. Plants containing pBGC272 did not show symptoms of systemic infection and were thus unable to complement the helper virus or amplify CAT expression.

The second group of plants (9 individuals) were infected with TMVU1. These plants exhibited systemic infection of the wild type virus but were unable to amplify CAT expression above background control levels because genetic complementation is not necessary for systemic infection of the plant with a wild type helper virus.

The third group of plants (78 individuals) were infected with TMV30K-O. Of the 78 inoculated plants, 24 individuals became systemically infected earlier than plants inoculated solely with TMV30K, indicating complementation of the movement function debilitated helper virus with pBGC272.

Of the 24 systemically transformed plants, 19 plants had been infected with pBGC272 and 5 with pBGC273. Of the 19 plants transformed with pBGC272, 12 were found to contain elevated levels of CAT. Upon resampling and assaying in triplicate, 8 plants were found to have CAT levels of roughly 0.1 ng CAT/mg of total soluble protein which is two fold that of the background level.

Biological Deposits

The following plasmids have been deposited at the American Type Culture Collection (ATCC), Rockville, Md., U.S.A., under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure and Regulations thereunder (Budapest Treaty) and are thus maintained and made available according to the terms of the Budapest Treaty. Availability of such plasmids is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.

The deposited cultures have been assigned the indicated ATCC deposit numbers:

______________________________________ Plasmid ATCC No.______________________________________ pBGC272 75632______________________________________

Pursuant to 37 C.F.R. .sctn.1.808, applicants agree that all restrictions imposed by the depositor on the availability to the public of the deposited plasmids will be irrevocably removed upon the granting of a patent on the present application.

While the invention of this patent application is disclosed by reference to the details of preferred embodiments of the invention, it is to be understood that this disclosure is intended in an illustrative rather than limiting sense, as it is contemplated that modifications will readily occur to those skilled in the art, within the spirit of the invention and the scope of the appended claims. It is further understood that the instant invention applies to all viruses infecting plants and plants generally and is not limited to those plasmids, viruses or plants described herein.

__________________________________________________________________________SEQUENCE LISTING(1) GENERAL INFORMATION:(iii) NUMBER OF SEQUENCES: 3(2) INFORMATION FOR SEQ ID NO:1:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 1825 base pairs(B) TYPE: nucleic acid(C) STRANDEDNESS: unknown(D) TOPOLOGY: unknown(ii) MOLECULE TYPE: RNA (genomic)(ix) FEATURE:(A) NAME/KEY: CDS(B) LOCATION: 70..1527(xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:GUAUUUUUACAACAAUUACCAACAACAACAAACAACAAACAACAUUACAAUUACUAUUUA60CAAUUACAUAUGGCUCUAGUUGUUAAAGGAAAAGUGAAUAUCAAUGAG108MetAlaLeuValValLysGlyLysValAsnIleAsnGlu1510UUUAUCGACCUGACAAAAAUGGAGAAGAUCUUACCGUCGAUGUUUACC156PheIleAspLeuThrLysMetGluLysIleLeuProSerMetPheThr152025CCUGUAAAGAGUGUUAUGUGUUCCAAAGUUGAUAAAAUAAUGGUUCAU204ProValLysSerValMetCysSerLysValAspLysIleMetValHis30354045GAGAAUGAGUCAUUGUCAGAGGUGAACCUUUUUAAAGGAGUUAAGCUU252GluAsnGluSerLeuSerGluValAsnLeuPheLysGlyValLysLeu505560AUUGAUAGUGGAUACGUCUGUUUAGCCGGUUUGGUCGUCACGGGCGAG300IleAspSerGlyTyrValCysLeuAlaGlyLeuValValThrGlyGlu657075UGGAACUUGCCUGACAAUUGCAGAGGAGGUGUGAGCGUGUGUCUGGUG348TrpAsnLeuProAspAsnCysArgGlyGlyValSerValCysLeuVal808590GACAAAAGGAUGGAAAGAGCCGACGAGGCCACUCUCGGAUCUUACUAC396AspLysArgMetGluArgAlaAspGluAlaThrLeuGlySerTyrTyr95100105ACAGCAGCUGCAAAGAAAAGAUUUCAGUUCAAGGUCGUUCCCAAUUAU444ThrAlaAlaAlaLysLysArgPheGlnPheLysValValProAsnTyr110115120125GCUAUAACCACCCAGGACGCGAUGAAAAACGUCUGGCAAGUUUUAGUU492AlaIleThrThrGlnAspAlaMetLysAsnValTrpGlnValLeuVal130135140AAUAUUAGAAAUGUGAAGAUGUCAGCGGGUUUCUGUCCGCUUUCUCUG540AsnIleArgAsnValLysMetSerAlaGlyPheCysProLeuSerLeu145150155GAGUUUGUGUCGGUGUGUAUUGUUUAUAGAAAUAAUAUAAAAUUAGGU588GluPheValSerValCysIleValTyrArgAsnAsnIleLysLeuGly160165170UUGAGAGAGAAGAUUACAAACGUGAGAGACGGAGGGCCCAUGGAACUU636LeuArgGluLysIleThrAsnValArgAspGlyGlyProMetGluLeu175180185ACAGAAGAAGUCGUUGAUGAGUUCAUGGAAGAUGUCCCUAUGUCGAUC684ThrGluGluValValAspGluPheMetGluAspValProMetSerIle190195200205AGGCUUGCAAAGUUUCGAUCUCGAACCGGAAAAAAGAGUGAUGUCCGC732ArgLeuAlaLysPheArgSerArgThrGlyLysLysSerAspValArg210215220AAAGGGAAAAAUAGUAGUAAUGAUCGGUCAGUGCCGAACAAGAACUAU780LysGlyLysAsnSerSerAsnAspArgSerValProAsnLysAsnTyr225230235AGAAAUGUUAAGGAUUUUGGAGGAAUGAGUUUUAAAAAGAAUAAUUUA828ArgAsnValLysAspPheGlyGlyMetSerPheLysLysAsnAsnLeu240245250AUCGAUGAUGAUUCGGAGGCUACUGUCGCCGAAUCGGAUUCGUUUUAA876IleAspAspAspSerGluAlaThrValAlaGluSerAspSerPhe*255260265AUACGCUCGACGAGAUUUUCAGGAGCUAAGGAAGCUAAAAUGGAGAAA924IleArgSerThrArgPheSerGlyAlaLysGluAlaLysMetGluLys270275280285AAAAUCACUGGAUAUACCACCGUUGAUAUAUCCCAAUCGCAUCGUAAA972LysIleThrGlyTyrThrThrValAspIleSerGlnSerHisArgLys290295300GAACAUUUUGAGGCAUUUCAGUCAGUUGCUCAAUGUACCUAUAACCAG1020GluHisPheGluAlaPheGlnSerValAlaGlnCysThrTyrAsnGln305310315ACCGUUCAGCUGGAUAUUACGGCCUUUUUAAAGACCGUAAAGAAAAAU1068ThrValGlnLeuAspIleThrAlaPheLeuLysThrValLysLysAsn320325330AAGCACAAGUUUUAUCCGGCCUUUAUUCACAUUCUUGCCCGCCUGAUG1116LysHisLysPheTyrProAlaPheIleHisIleLeuAlaArgLeuMet335340345AAUGCUCAUCCGGAAUUCCGUAUGGCAAUGAAAGUUUUCCAUGAGCAA1164AsnAlaHisProGluPheArgMetAlaMetLysValPheHisGluGln350355360365ACUGAAACGUUUUCAUCGCUCUGGAGUGAAUACCACGACGAUUUCCGG1212ThrGluThrPheSerSerLeuTrpSerGluTyrHisAspAspPheArg370375380CAGUUUCUACACAUAUAUUCGCAAGAUGUGGCGUGUUACGGUGAAAAC1260GlnPheLeuHisIleTyrSerGlnAspValAlaCysTyrGlyGluAsn385390395CUGGCCUAUUUCCCUAAAGGGUUUAUUGAGAAUAUGUUUUUCGUCUCA1308LeuAlaTyrPheProLysGlyPheIleGluAsnMetPhePheValSer400405410GCCAAUCCCUGGGUGAGUUUCACCAGUUUUGAUUUAAACGUGGCCAAU1356AlaAsnProTrpValSerPheThrSerPheAspLeuAsnValAlaAsn415420425AUGGACAACUUCUUCGCCCCCGUUUUCACCAUGGGCAAAUAUUAUACG1404MetAspAsnPhePheAlaProValPheThrMetGlyLysTyrTyrThr430435440445CAAGGCGACAAGGUGCUGAUGCCGCUGGCGAUUCAGGUUCAUCAUGCC1452GlnGlyAspLysValLeuMetProLeuAlaIleGlnValHisHisAla450455460GUCUGUGAUGGCUUCCAUGUCGGCAGAAUGCUUAAUGAAUUACAACAG1500ValCysAspGlyPheHisValGlyArgMetLeuAsnGluLeuGlnGln465470475UACUGCGAUGAGUGGCAGGGCGGGGCGUAAUUUUUUUAAGGCAGUUA1547TyrCysAspGluTrpGlnGlyGlyAla480485UUGGUGCCCUUAAACGCCUGGUGCUACGCCUGAAUAAGUGAUAAUAAGCGGAUGAAUGGC1607AGAAAUUCGUCGAGGGUAGUCAAGAUGCAUAAUAAAUAACGGAUUGUGUCCGUAAUCACA1667CGUGGUGCGUACGAUAACGCAUAGUGUUUUUCCCUCCACUUAAAUCGAAGGGUUGUGUCU1727UGGAUCGCGCGGGUCAAAUGUAUAUGGUUCAUAUACAUCCGCAGGCACGUAAUAAAGCGA1787GGGGUUCGAAUCCCCCCGUUACCCCCGGUAGGGGCCCA1825(2) INFORMATION FOR SEQ ID NO:2:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 268 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:MetAlaLeuValValLysGlyLysValAsnIleAsnGluPheIleAsp151015LeuThrLysMetGluLysIleLeuProSerMetPheThrProValLys202530SerValMetCysSerLysValAspLysIleMetValHisGluAsnGlu354045SerLeuSerGluValAsnLeuPheLysGlyValLysLeuIleAspSer505560GlyTyrValCysLeuAlaGlyLeuValValThrGlyGluTrpAsnLeu65707580ProAspAsnCysArgGlyGlyValSerValCysLeuValAspLysArg859095MetGluArgAlaAspGluAlaThrLeuGlySerTyrTyrThrAlaAla100105110AlaLysLysArgPheGlnPheLysValValProAsnTyrAlaIleThr115120125ThrGlnAspAlaMetLysAsnValTrpGlnValLeuValAsnIleArg130135140AsnValLysMetSerAlaGlyPheCysProLeuSerLeuGluPheVal145150155160SerValCysIleValTyrArgAsnAsnIleLysLeuGlyLeuArgGlu165170175LysIleThrAsnValArgAspGlyGlyProMetGluLeuThrGluGlu180185190ValValAspGluPheMetGluAspValProMetSerIleArgLeuAla195200205LysPheArgSerArgThrGlyLysLysSerAspValArgLysGlyLys210215220AsnSerSerAsnAspArgSerValProAsnLysAsnTyrArgAsnVal225230235240LysAspPheGlyGlyMetSerPheLysLysAsnAsnLeuIleAspAsp245250255AspSerGluAlaThrValAlaGluSerAspSerPhe260265(2) INFORMATION FOR SEQ ID NO:3:(i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 217 amino acids(B) TYPE: amino acid(D) TOPOLOGY: linear(ii) MOLECULE TYPE: protein(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:IleArgSerThrArgPheSerGlyAlaLysGluAlaLysMetGluLys151015LysIleThrGlyTyrThrThrValAspIleSerGlnSerHisArgLys202530GluHisPheGluAlaPheGlnSerValAlaGlnCysThrTyrAsnGln354045ThrValGlnLeuAspIleThrAlaPheLeuLysThrValLysLysAsn505560LysHisLysPheTyrProAlaPheIleHisIleLeuAlaArgLeuMet65707580AsnAlaHisProGluPheArgMetAlaMetLysValPheHisGluGln859095ThrGluThrPheSerSerLeuTrpSerGluTyrHisAspAspPheArg100105110GlnPheLeuHisIleTyrSerGlnAspValAlaCysTyrGlyGluAsn115120125LeuAlaTyrPheProLysGlyPheIleGluAsnMetPhePheValSer130135140AlaAsnProTrpValSerPheThrSerPheAspLeuAsnValAlaAsn145150155160MetAspAsnPhePheAlaProValPheThrMetGlyLysTyrTyrThr165170175GlnGlyAspLysValLeuMetProLeuAlaIleGlnValHisHisAla180185190ValCysAspGlyPheHisValGlyArgMetLeuAsnGluLeuGlnGln195200205TyrCysAspGluTrpGlnGlyGlyAla210215217__________________________________________________________________________

Claims

1. A system comprising:

a replicon comprising:

a tobamovirus-derived replication origin,

at least one gene non-native to a tobamovirus and encoding a product non-native to the tobamovirus, and

a gene encoding a tobamovirus-derived viral movement protein,

wherein said replicon lacks a gene encoding a tobamovirus-derived replicase; and

a tobamovirus-derived helper virus comprising:

a gene encoding a tobamovirus-derived replicase, wherein said helper virus lacks a functional gene encoding the tobamovirus-derived viral movement protein; and

wherein a DNA sequence of said replicon is integrated as a transgene in the chromosome of a plant cell which is susceptible to a tobamovirus.

2. The system of claim 1, wherein the sequence comprising the non-native gene in the replicon is located 5' to the 3' replication origin of the replicon.

3. The system of claim 1, wherein the DNA encoding the tobamovirus-derived viral movement protein is located 3' to the 5' replication origin of the replicon.

4. The system of claim 1, wherein the tobamovirus-derived viral movement protein is native to a TMV.

5. The system of claim 4, wherein the DNA encoding the TMV movement protein is located 3' to the 5' replication origin of the replicon.

6. The system of claim 1, wherein the gene non-native to the tobamovirus is expressed systemically in the presence of the tobamovirus-derived helper virus.

7. The system of claim 4, wherein the gene non-native to the tobamovirus is expressed systemically in the presence of the tobamovirus-derived helper virus.

8. A plant cell containing the system of claim 1.

9. A transgenic plant containing a system comprising:

a replicon comprising:

a tobamovirus-derived replication origin,

at least one gene non-native to a tobamovirus and encoding a product non-native to the tobamovirus, and

a gene encoding a tobamovirus-derived viral movement protein, wherein said replicon lacks a gene encoding a tobamovirus-derived replicase; and

a tobamovirus-derived helper virus comprising:

a gene encoding a tobamovirus-derived replicase, wherein said helper virus lacks a functional gene encoding the tobamovirus-derived viral movement protein; and

wherein a DNA sequence of said replicon is integrated as a transgene in the chromosome of a plant cell which is susceptible to a tobamovirus.

10. The transgenic plant of claim 9, wherein the sequence comprising the non-native gene in the replicon is located 5' to the 3' replication origin of the replicon.

11. The transgenic plant of claim 9, wherein the DNA encoding the tobamovirus-derived viral movement protein is located 3' to the 5' replication origin of the replicon.

12. The transgenic plant of claim 9, wherein the tobamovirus-derived viral movement protein is native to a TMV.

13. The transgenic plant of claim 12, wherein the DNA encoding the TMV movement protein is located 3' to the 5' replication origin of the replicon.

14. The transgenic plant of claim 9, wherein the gene non-native to the tobamovirus is expressed systemically in the presence of the tobamovirus-derived helper virus.

15. The transgenic plant of claim 12, wherein the gene non-native to the tobamovirus is expressed systemically in the presence of the tobamovirus-derived helper virus.

16. A method for expressing a protein in plants comprising:

(a) integrating a transgene into a chromosome of a plant cell suspectable to a tobamovirus, the transgene comprising a replicon which comprises:

a tobamovirus-derived replication origin,

at least one gene non-native to a tobamovirus and encoding a protein product non-native to the tobamovirus, and

a gene encoding a tobamovirus-derived viral movement protein, wherein said replicon lacks a gene encoding a tobamovirus-derived replicase; and

(b) infecting the plant cell with a tobamovirus-derived helper virus comprising:

a gene encoding a tobamovirus-derived replicase, wherein said helper virus lacks a functional gene encoding the tobamovirus-derived viral movement protein; and

wherein the protein product is expressed and accumulates in the plant cell.

17. The method of claim 16, wherein the sequence comprising the non-native gene in the replicon is located 5' to the 3' replication origin of the replicon.

18. The method of claim 16, wherein the DNA encoding the tobamovirus-derived viral movement protein is located 3' to the 5' replication origin of the replicon.

19. The method of claim 16, wherein the tobamovirus-derived viral movement protein is native to a TMV.

20. The method of claim 19, wherein the DNA encoding the TMV movement protein is located 3' to the 5' replication origin of the replicon.