Patent Grant
7932350
Multiple sclerosis (MS) is a demyelinating disease of the central nervous system (CNS) the cause of which remains as yet unknown.
Many studies have supported the hypothesis of a viral aetiology of the disease, but none of the known viruses tested has proved to be the causal agent sought: a review of the viruses sought for several years in MS has been compiled by E. Norrby (1) and R. T. Johnson (2).
Recently, a retrovirus different from the known human retroviruses has been isolated in patients suffering from MS (3, 4, and 5). The authors were also able to show that this retrovirus could be transmitted in vitro, that patients suffering from MS produced antibodies capable of recognizing proteins associated with the infection of leptomeningeal cells by this retrovirus, and that the expression of the latter could be strongly stimulated by the immediate-early genes of some herpes-viruses (6).
All these results point to the role in MS of at least one unknown retrovirus or of a virus having reverse transcriptase activity which is detectable according to the method published by H. Perron (3) and qualified as “LM7-like RT” activity. The content of the publication identified by (3) is incorporated in the present description by reference.
Recently, the Applicant's studies have enabled two continuous cell lines infected with natural isolates originating from two different patients suffering from MS to be obtained by a culture method as described in the document WO-A-93/20188, the content of which is incorporated in the present description by reference. These two lines, derived from human choroid plexus cells, designated LM7PC ind PLI-2, were deposited with the ECACC on 22 Jul. 1992 and 8 Jan. 1993, respectively, under numbers 92072201 and 93010817, in accordance with the provisions of the Budapest Treaty. Moreover, the viral isolates possessing LM7-like RT activity were also deposited with the ECACC under the overall designation of “strains”. The “strain” or isolate harboured by the PLI-2 line, designated POL-2, was deposited with the ECACC on 22 Jul. 1992 under No. V92072202. The “strain” or isolate harboured by the LM7PC line, designated MS7PG, was deposited with the ECACC on 8 Jan. 1993 under No. V93010816.
Starting from the cultures and isolates mentioned above, characterized by biological and morphological criteria, the next step was to endeavour to characterize the nucleic acid material associated with the viral particles produced in these cultures.
The portions of the genome which have already been characterized have been used to develop tests for molecular detection of the viral genome and immunoserological tests, using the amino acid sequences encoded by the nucleotide sequences of the viral genome, in order to detect the immune response directed against epitopes associated with the infection and/or viral expression.
These tools have already enabled an association to be confirmed between MS and the expression of the sequences identified in the patents cited later. However, the viral system discovered by the Applicant is related to a complex retroviral system. In effect, the sequences to be found encapsidated in the extracellular viral particles produced by the different cultures of cells of patients suffering from MS show clearly that there is coencapsidation of retroviral genomes which are related but different from the “wild-type” retroviral genome which produces the infective viral particles. This phenomenon has been observed between replicative retroviruses and endogenous retroviruses belonging to the same family, or even heterologous retroviruses. The notion of endogenous retroviruses is very important in the context of our discovery since, in the case of MSRV-1, it has been observed that endogenous retroviral sequences comprising sequences homologous to the MSRV-1 genome exist in normal human DNA. The existence of endogenous retroviral elements (ERV) related to MSRV-1 by all or part of their genome explains the fact that the expression of the MSRV-1 retrovirus in human cells is able to interact with closely related endogenous sequences. These interactions are to be found in the case of pathogenic and/or infectious endogenous retroviruses (for example some ecotropic strains of the murine leukaemia virus), and in the case of exogenous retroviruses whose nucleotide sequence may be found partially or wholly, in the form of ERVU, in the host animal's genome (e.g. mouse exogenous mammary tumor virus transmitted via the milk). These interactions consist mainly of (i) a trans-activation or coactivation of ERVU by the replicative retrovirus (ii) and “illegitimate” encapsidation of RNAs related to ERVS, or of ERVs—or even of cellular RNAS—simply possessing compatible encapsidation sequences, in the retroviral particles produced by the expression of the replicative strain, which are sometimes transmissible and sometimes with a pathogenicity of their own, and (iii) more or less substantial recombinations between the coencapsidated genomes, in particular in the phases of reverse transcription, which lead to the formation of hybrid genomes, which are sometimes transmissible and sometimes with a pathogenicity of their own.
Thus, (i) different sequences related to MSRV-1 have been found in the purified viral particles; (ii) molecular analysis of the different regions of the MSRV-1 retroviral genome should be carried out by systematically analyzing the coencapsidated, interfering and/or recombined sequences which are generated by the infection and/or expression of MSRV-1; furthermore, some clones may have defective sequence portions produced by the retroviral replication and template errors and/or errors of transcription of the reverse transcriptase; (iii) the families of sequences related to the same retroviral genomic region provide the means for an overall diagnostic detection which may be optimized by the identification of invariable regions among the clones expressed, and by the identification of reading frames responsible for the production of antigenic and/or pathogenic polypeptides which may be produced only by a portion, or even by just one, of the clones expressed, and, under these conditions, the systematic analysis of the clones expressed in the region of a given gene enables the frequency of variation and/or of recombination of the MSRV-1 genome in this region to be evaluated and the optimal sequences for the applications, in particular diagnostic applications, to be defined; (iv) the pathology caused by a retrovirus such as MSRV-1 may be a direct effect of its expression and of the proteins or peptides produced as a result thereof, but also an effect of the activation, the encapsidation or the recombination of related or heterologous genomes and of the proteins or peptides produced as a result thereof; thus, these genomes associated with the expression of and/or infection by MSRV-1 are an integral part of the potential pathogenicity of this virus, and hence constitute means of diagnostic detection and special therapeutic targets. Similarly, any agent associated with or cofactor of these interactions responsible for the pathogenesis in question, such as MSRV-2 or the glyotoxic factor which are described in the patent application published under No. FR-2,716,198, may participate in the development of an overall and very effective strategy for the diagnosis, prognosis, therapeutic monitoring and/or integrated therapy of MS in particular, but also of any other disease associated with the same agents.
In this context, a parallel discovery has been made in another autoimmune disease, rheumatoid arthritis (RA), which has been described in the French Patent Application filed under No. 95/02960. This discovery shows that, by applying methodological approaches similar to the ones which were used in the Applicant's work on MS, it was possible to identify a retrovirus expressed in RA which shares the sequences described for MSRV-1 in MS, and also the coexistence of an associated MSRV-2 sequence also described in MS. As regards MSRV-1, the sequences detected in common in MS and RA relate to the pol and gag genes. In the current state of knowledge, it is possible to associate the gag and pol sequences described with the MSRV-1 strains expressed in these two diseases.
The present patent application relates to various results which are additional to those already protected by the following French Patent Applications:
The present invention relates, in the first place, to a viral material, in the isolated or purified state, which may be recognized or characterized in different ways:
As indicated above, according to the present invention, the viral material as defined above is associated with MS. And as defined by reference to the pol or gag gene of MSRV-1, and more especially to the sequences SEQ ID NOS 51, 56, 57, 59, 60, 61, 88 and 89, this viral material is associated with RA.
The present invention also relates to different nucleotide fragments each comprising a nucleotide sequence chosen from the group including:
The term genomic sequences, partial or total, includes all sequences associated by coencapsidation or by coexpression, or recombined sequences.
Preferably, such a fragment comprises:
In particular, the invention relates to a nucleotide fragment comprising a coding nucleotide sequence which is partially or totally identical to a nucleotide sequence chosen from the group including:
The invention also relates to any nucleic acid probe for detection of a pathogenic and/or infective agent associated with MS, which is capable of hybridizing specifically with any fragment such as is defined above, belonging or lying within the genome of the said pathogenic agent. It relates, in addition, to any nucleic acid probe for detection of a pathogenic and/or infective agent associated with RA, which is capable of hybridizing specifically with any fragment as defined above by reference to the pol and gag genes, and especially with respect to the sequences SEQ ID NOS 40, 51, 56, 59, 60, 61, 62, 89 and SEQ ID NOS 39, 63 and 90.
The invention also relates to a primer for the amplification by polymerization of an RNA or a DNA of a viral material, comprising a nucleotide sequence identical or equivalent to at least one portion of the nucleotide sequence of any fragment such as is defined above, in particular a nucleotide sequence displaying, for any succession of 10 contiguous monomers, at least 70% homology with at least the said portion of the said fragment. Preferably, the nucleotide sequence of such a primer is identical to any one of the sequences chosen from the group including SEQ ID NO:47 to SEQ ID NO:50, SEQ ID NO:55 and SEQ ID NO:64 SEQ ID NO:86.
Generally speaking the invention also encompasses any RNA or DNA, and in particular replication vector, comprising a genomic fragment of the viral material such as is defined above, or a nucleotide fragment such as is defined above.
The invention also relates to the different peptides encoded by any open reading frame belonging to a nucleotide fragment such as is defined above, in particular any polypeptide, for example any oligopeptide forming or comprising an antigenic determinant recognized by sera of patients infected with the MSRV-1 virus and/or in whom the MSRV-1 virus has been reactivated. Preferably, this polypeptide is antigenic, and is encoded by the open reading frame beginning, in the 5′-3′ direction, at nucleotide 181 and ending at nucleotide 330 of SEQ ID NO:1.
In particular, the invention relates to an antigenic polypeptide recognized by the sera of patients infected with the MSRV-1 virus, and/or in whom the MSRV-1 virus has been reactivated, whose peptide sequence is partially or totally identical or is equivalent to the sequence defined by SEQ ID NO:39, SEQ ID NO:63 and SEQ ID NO:87; such a sequence is identical, for example, to any sequence chosen from the group including the sequences SEQ ID NO:41 to SEQ ID NO:44, SEQ ID NO:63 and SEQ ID NO:87.
The present invention also proposes mono- or polyclonal antibodies directed against the MSRV-1 virus, which are obtained by the immunological reaction of a human or animal body to an immunogenic agent consisting of an antigenic polypeptide such as is defined above.
The invention next relates to:
The invention also relates to any diagnostic, prophylactic or therapeutic composition, in particular for inhibiting the expression of at least one pathogenic and/or infective agent associated with MS comprising a nucleotide fragment such as is defined above or a polynucleotide, in particular oligonucleotide, whose sequence is partially identical to that of the said fragment, except for that of the fragment having the nucleotide sequence SEQ ID NO:1. Likewise, it relates to any diagnostic, prophylactic or therapeutic composition, in particular for inhibiting the expression of at least one pathogenic and/or infective agent associated with RA, comprising a nucleotide fragment such as is defined above by reference to the pol and gag genes, and especially with respect to the sequences SEQ ID NOS 40, 51, 56, 59, 60, 61, 62 and 89.
According to the invention, these same fragments or polynucleotides, in particular oligonucleotides, may participate in all suitable compositions for detecting, according to any suitable process or method, a pathological and/or infective agent associated with MS and with RA, respectively, in a biological sample. In such a process, an RNA and/or a DNA presumed to belong or originating from the said pathological and/or infective agent, and/or their complementary RNA and/or DNA, is/are brought into contact with such a composition.
The present invention also relates to any process for detecting the presence or exposure to such a pathological and/or infective agent, in a biological sample, by bringing this sample into contact with a peptide, in particular an antigenic peptide such as is defined above, or an anti-ligand, in particular an antibody to this peptide, such as is defined above.
In practice, and for example, a device for detection of the MSRV-1 virus comprises a reagent such as is defined above, supported by a solid support which is immunologically compatible with the reagent, and a means for bringing the biological sample, for example a sample of blood or of cerebrospinal fluid, likely to contain anti-MSRV-1 antibodies, into contact with this reagent under conditions permitting a possible immunological reaction, the foregoing items being accompanied by means for detecting the immune complex formed with this reagent.
Lastly, the invention also relates to the detection of anti-MSRV-1 antibodies in a biological sample, for example a sample of blood or of cerebrospinal fluid, according to which this sample is brought into contact with a reagent such as is defined above, consisting of an antibody, under conditions permitting their possible immunological reaction, and the presence of the immune complex thereby formed with the reagent is then detected.
Before describing the invention in detail, different terms used in the description and the claims are now defined:
a) any fragment capable of hybridizing at least partially with the complement of the reference fragment,
b) any fragment whose alignment with the reference fragment results in the demonstration of a larger number of identical contiguous bases than with any other fragment originating from another taxonomic group,
c) any fragment resulting, or capable of resulting, from the natural variability of the species from which it is obtained,
d) any fragment capable of resulting from the genetic engineering techniques applied to the reference fragment,
e) any fragment containing at least eight contiguous nucleotides encoding a peptide which is homologous or identical to the peptide encoded by the reference fragment,
f) any fragment which is different from the reference fragment by insertion, deletion or substitution of at least one monomer, or extension or shortening at one or both of its ends; for example, any fragment corresponding to the reference fragment flanked at one or both of its ends by a nucleotide sequence not coding for a polypeptide,
a) any polypeptide possessing a sequence in which at least one amino acid has been replaced by an analogous amino acid,
b) any polypeptide having an equivalent peptide sequence, obtained by natural or induced variation of the said reference polypeptide and/or of the nucleotide fragment coding for the said polypeptide,
c) a mimotope of the said reference polypeptide,
d) any polypeptide in whose sequence one or more amino acids of the L series are replaced by an amino acid of the D series, and vice versa,
e) any polypeptide into whose sequence a modification of the side chains of the amino acids has been introduced, such as, for example, an acetylation of the amine functions, a carboxylation of the thiol functions, an esterification of the carboxyl functions,
f) any polypeptide in whose sequence one or more peptide bonds have been modified, such as, for example, carba, retro, inverso, retro-inverso, reduced and methylenoxy bonds,
(g) any polypeptide at least one antigen of which is recognized by an antibody directed against a reference polypeptide,
In view of the fact that a virus possessing reverse transcriptase enzymatic activity may be genetically characterized equally well in RNA and in DNA form, both the viral DNA and RNA will be referred to for characterizing the sequences relating to a virus possessing such reverse transcriptase activity, termed MSRV-1 according to the present description.
The expressions of order used in the present description and the claims, such as “first nucleotide sequence”, are not adopted so as to express a particular order, but so an to define the invention more clearly.
Detection of a substance or agent is understood below to mean both an identification and a quantification, or a separation or isolation, of the said substance or said agent.
A better understanding of the invention will be gained on reading the detailed description which follows, prepared with reference to the attached figures, in which:
and
A PCR technique derived from the technique published by Shih (12) was used. This technique enables all trace of contaminant DNA to be removed by treating all the components of the reaction medium with DNase. It concomitantly makes it possible, by the use of different but overlapping primers in two successive series of PCR amplification cycles, to increase the chances of amplifying a cDNA synthesized from an amount of RNA which is small at the outset and further reduced in the sample by the spurious action of the DNAse on the RNA. In effect, the DNase is used under conditions of activity in excess which enable all trace of contaminant DNA to be removed before inactivation of this enzyme remaining in the sample by heating to 85° C. for 10 minutes. This variant of the PCR technique described by Shih (12) was used on a cDNA synthesized from the nucleic acids of fractions of infective particles purified on a sucrose gradient according to the technique described by E. Perron (13) from the “POL-2” isolate (ECACC No. V92072202) produced by the PLI-2 line (ECACC No. 92072201) on the one hand, and from the MS7PG isolate (ECACC No. V93010816) produced by the LM7PC line (ECACC No. 93010817) on the other hand. These cultures were obtained according to the methods which formed the subject of the patent applications published under Nos WO 93/20188 and WO 93/20189.
After cloning the products amplified by this technique with the TA Cloning Kit® and analysis of the sequence using an Applied Biosystems model 373A Automatic Sequencer, the sequences were analysed using the Geneworks® software on the latest available version of the Genebank® data bank.
The sequences cloned and sequenced from these samples correspond, in particular, to two types of sequence: a first type of sequence, to be found in the majority of the clones (55% of the clones originating from the POL-2 isolates of the PLI-2 culture, and 67% of the clones originating from the MS7PG isolates of the LM7PC cultures), which corresponds to a family of “pol” sequences closely similar to, but different from, the endogenous human retrovirus designated ERV-9 or HSERV-9, and a second type of sequence which corresponds to sequences very strongly homologous to a sequence attributed to another infective and/or pathogenic agent designated MSRV-2.
The first type of sequence, representing the majority of the clones, consists of sequences whose variability enables four subfamilies of sequences to be defined. These subfamilies are sufficiently similar to one another for it to be possible to consider them to be quasi-species originating from the same retrovirus, an is well known for the RIV-1 retrovirus (14), or to be the outcome of interference with several endogenous proviruses coregulated in the producing cells. These more or less defective endogenous elements are sensitive to the same regulatory signals possibly generated by a replicative provirus, since they belong to the same family of endogenous retroviruses (15). This new family of endogenous retroviruses, or alternatively this now retroviral species from which the generation of quasi-species has been obtained in culture, and which contains a consensus of the sequences described below, is designated MSRV-1B.
The second type of sequence representing the majority of the clones sequenced is represented by the sequence MSRV-2B presented in
The MSRV-2B sequence (SEQ ID NO:11) is sufficiently divergent from the retroviral sequences already described in the data banks for it to be suggested that the sequence region in question belongs to a new infective agent, designated MSRV-2. This infective agent would, in principle, on the basis of the analysis of the first sequences obtained, be related to a retrovirus but, in view of the technique used for obtaining this sequence, it could also be a DNA virus whose genome codes for an enzyme which incidentally possesses reverse transcriptase activity, as is the case, for example, with the hepatitis B virus, HBV (12). Furthermore, the random nature of the degenerate primers used for this PCR amplification technique may very well have permitted, as a result of unforeseen sequence homologies or of conserved sites in the gene for a related enzyme, the amplification of a nucleic acid originating from a prokaryotic or eukaryotic pathogenic and/or coinfective agent (protist).
The same PCR technique, modified according to the technique of Shih (12), was used to amplify and sequence the RNA nucleic acid material present in a purified fraction of virions at the peak of “LM7-like” reverse transcriptase activity on a sucrose gradient according to the technique described by H. Perron (13), and according to the protocols mentioned in Example 1, from a spontaneous lymphoblastoid line obtained by self-immortalization in culture of B lymphocytes from an MS patient who was seropositive for the Epstein-Barr virus (EBV), after setting up the blood lymphoid cells in culture in a suitable culture medium containing a suitable concentration of cyclosporin A. A representation of the reverse transcriptase activity in the sucrose fractions taken from a purification gradient of the virions produced by this line is presented in
It is particularly noteworthy that the MSRV-1 and MSRV-2 type sequences are to be found only in the material associated with a peak of “LM7-like” reverse transcriptase activity originating from the MS B lymphoblastoid line. These sequences were not to be found with the material from the control (non-MS) B lymphoblastoid line in 26 recombinant clones taken at random. Only Mo-MuLV type contaminant sequences, originating from the commercial reverse transcriptase used for the cDNA synthesis step, and sequences without any particular retroviral analogy were to be found in this control, as a result of the “consensus” amplification of homologous polymerase sequences which is produced by this PCR technique. Furthermore, the absence of a concentrated target which competes for the amplification reaction in the control sample permits the amplification of dilute contaminants. The difference in results is manifestly highly significant (chi-squared, p<0.001).
This approach is directed towards obtaining reverse-transcribed DNA sequences from the supposedly retroviral RNA in the isolate using the reverse transcriptase activity present in this same isolate. This reverse transcriptase activity can theoretically function only in the presence of a retroviral RNA linked to a primer tRNA or hybridized with short strands of DNA already reverse-transcribed in the retroviral particles (16). Thus, the obtaining of specific retroviral sequences in a material contaminated with cellular nucleic acids was optimized according to these authors by means of the specific enzymatic amplification of the portions of viral RNAs with a viral reverse transcriptase activity. To this end, the authors determined the particular physicochemical conditions under which this enzymatic activity of reverse transcription on RNAs contained in virions could be effective in vitro. These conditions correspond to the technical description of the protocols presented below (endogenous RT reaction, purification, cloning and sequencing).
The molecular approach consisted in using a preparation of concentrated but unpurified virion obtained from the culture supernatants of the PLI-2 line, prepared according to the following method: the culture supernatants are collected twice weekly, precentrifuged at 10,000 rpm for 30 minutes to remove cell debris and then frozen at −80° C. or used as they are for the following steps. The fresh or thawed supernatants are centrifuged on a cushion of 30% glycerol-PBS at 100,000 g (or 30,000 rpm in a type 45 T LKB-HITACHI rotor) for 2 h at 4° C. After removal of the supernatant, the sedimented pellet is taken up in a small volume of PBS and constitutes the fraction of concentrated but unpurified virion. This concentrated but unpurified viral sample was used to perform a so-called endogenous reverse transcription reaction, as described below.
A volume of 200 μl of virion purified according to the protocol described above, and containing a reverse transcriptase activity of approximately 1-5 million dpm, is thawed at 37° C. until a liquid phase appears, and then placed on ice. A 5-fold concentrated buffer was prepared with the following components: 500 mM Tris-HCl pH 8.2; 75 mM NaCl; 25 mM MgCl2; 75 mN DTT and 0.10% NP 40; 100 μl of 5× buffer+25 μl of a 100 mM solution of dATP+25 ml of a 100 mM solution of dTTP+25 ml of a 100 μM solution of dGTP+25 μl of a 100 mM solution of dCTP+100 ml of sterile distilled water+200 ml of the virion suspension (RT activity of 5 million DPM) in PBS were mixed and incubated at 42° C. for 3 hours. After this incubation, the reaction mixture is added directly to a buffered phenol/-chloroform/isoamyl alcohol mixture (Sigma ref. P 3803), the aqueous phase is collected and one volume of sterile distilled water in added to the organic phase to re-extract the residual nucleic acid material: The collected aqueous phases are combined, and the nucleic acids contained are precipitated by adding 3M sodium acetate pH 5.2 to 1/10 volume+2 volumes of ethanol+1 μl of glycogen (Boehringer-Mannheim ref. 901 393) and placing the sample at −20° C. for 4 h or overnight at +4° C. The precipitate obtained after centrifugation is then washed with 70% ethanol and resuspended in 60 ml of distilled water. The products of this reaction were then purified, cloned and sequenced according to the protocol which will now be described: blunt-ended DNAs with unpaired adenines at the ends were generated: a “filling-in” reaction was first performed: 25 μl of the previously purified DNA solution were mixed with 2 μl of a 2.5 mM solution containing, in equimolar amounts, dATP+dGTP+dTTP+dCTP/1 μl of T4 DNA polymerase (Boehringer-Mannheim ref. 1004 786)/5 μl of 10× “incubation buffer for restriction enzyme” (Boehringer-Mannheim ref. 1417 975)/1 μl of a 1% bovine serum albumin solution/16 μl of sterile distilled water. This mixture was incubated for 20 minutes at 11° C. 50 μl of TE buffer and 1 μl of glycogen (Boehringer-Mannheim ref. 901 393) were added thereto before extraction of the nucleic acids with phenol/chloroform/isoamyl alcohol (Sigma ref. P 3803) and precipitation with sodium acetate as described above. The DNA precipitated after centrifugation is resuspended in 10 μl of 10 mM Tris buffer pH 7.5. 5 μl of this suspension were then mixed with 20 μl of 5× Taq buffer, 20 μl of 5 mM dATP, 1 μl (5U) of Taq DNA polymerase (Amplitaq™) and 54 μl of sterile distilled water. This mixture in incubated for 2 h at 75° C. with a film of oil on the surface of the solution. The DNA suspended in the aqueous solution drawn off under the film of oil after incubation is precipitated as described above and resuspended in 2 μl of sterile distilled water. The DNA obtained was inserted into a plasmid using the TA Cloning™ kit. The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VZCTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the and of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmid incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analysed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA cloning kits. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxy-terminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “Automatic Sequencer, model 373 A” apparatus according to the manufacturer's instructions.
Discriminating analysis on the computerized data banks of the sequences cloned from the DNA fragments present in the reaction mixture enabled a retroviral type sequence to be revealed. The corresponding clone PSJ17 was completely sequenced, and the sequence obtained, presented in
Five oligonucleotides, M001, M002-A, M003-BCD, P004 and P005, were defined in order to amplify the RNA originating from purified POL-2 virions. Control reactions were performed so as to check for the presence of contaminants (reaction with water). The amplification consists of an RT-PCR step according to the protocol described in Example 2, followed by a “nested” PCR according to the PCR protocol described in the document EP-A-0,569,272. In the first RT-PCR cycle, the primers M001 and P004 or P005 are used. In the second PCR cycle, the primers M002-A or M003-BCD and the primer P004 are used. The primers are positioned as follows:
Their composition is:
The “nested” amplification product obtained, and designated M003-P004, is presented in
A PCR technique derived from the technique published by Frohman (19) was used. The technique derived makes it possible, using a specific primer at the 3′ end of the genome to be amplified, to elongate the sequence towards the 5′ region of the genome to be analysed. This technical variant is described in the documentation of the firm “Clontech Laboratories Inc.”, (Palo-Alto Calif., USA) supplied with its product “5′-AmpliFINDER™ RACE Kit”, which was used on a fraction of virion purified as described above.
The specific 3′ primers used in the kit protocol for the synthesis of the cDNA and the PCR amplification are, respectively, complementary to the following MSRV-1 sequences:
The products originating from the PCR were purified after purification on agarose gel according to conventional methods (17), and then resuspended in 10 ml of distilled water. Since one of the properties of Taq polymerase consists in adding an adenine at the 3′ end of each of the two DNA strands, the DNA obtained was inserted directly into a plasmid using the TA Cloning™ kit (British Biotechnology). The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10′ LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “mini-prep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analysed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit®. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “Automatic Sequencer model 373 A” apparatus according to the manufacturer's instructions.
This technique was applied first to two fractions of virion purified as described below on sucrose from the “POL-2” isolate produced by the PLI-2 line on the one hand, and from the MS7PG isolate produced by the LM7PC line on the other hand. The culture supernatants are collected twice weekly, precentrifuged at 10,000 rpm for 30 minutes to remove cell debris and then frozen at −80° C. or used as they are for the following steps. The fresh or thawed supernatants are centrifuged on a cushion of 30% glycerol-PBS at 100,000 g (or 30,000 rpm in a type 45 T LKB-HITACHI rotor) for 2 h at 4° C. After removal of the supernatant, the sedimented pellet is taken up in a small volume of PBS and constitutes the fraction of concentrated but unpurified virions. The concentrated virus is then applied to a sucrose gradient in sterile PBS buffer (15 to 50% weight/weight) and ultracentrifuged at 35,000 rpm (100,000 g) for 12 h at +4° C. in a swing-out rotor. 10 fractions are collected, and 20 μl are withdrawn from each fraction after homogenization to assay the reverse transcriptase activity therein according to the technique described by H. Perron (3). The fractions containing the peak of “LM7-like” RT activity are then diluted in sterile PBS buffer and ultra-centrifuged for one hour at 35,000 rpm (100,000 g) to sediment the viral particle. The pellet of purified virion thereby obtained is then taken up in a small volume of a buffer which is appropriate for the extraction of RNA. The cDNA synthesis reaction mentioned above is carried out on this RNA extracted from purified extracellular virion. PCR amplification according to the technique mentioned above enabled the clone F1-11 to be obtained, whose sequence, identified by SEQ ID NO:2, is presented in
This clone makes it possible to define, with the different clones previously sequenced, a region of considerable length (1.2 kb) representative of the “pol” gene of the MSRV-1 retrovirus, as presented in
In
A PCR technique was used to detect the MSRV-1 and MSRV-2 genomes in plasmas obtained after taking blood samples from patients suffering from MS and from non-MS controls onto EDTA.
Extraction of the RNAs from plasma was performed according to the technique described by P. Chomzynski (20), after adding one volume of buffer containing guanidinium thiocyanate to 1 ml of plasma stored frozen at −80° C. after collection.
For MSRV-2, the PCR was performed under the same conditions and with the following primers:
However, similar results were also obtained with the following PCR primers in two successive amplifications by “nested” PCR on samples of nucleic acids not treated with DNase.
The primers used for this first step of 40 cycles with a hybridization temperature of 48° C. are the following:
5′ GCCGATATCACCCGCCATGG 3′, corresponding to a 5′ MSRV-2 PCR primer, for a first PCR on samples from patients,
5′ GCATCCGGCAACTGCACG 3′, corresponding to a 3′ MSRV-2 PCR primer, for a first PCR on samples from patients.
After this step, 10 μl of the amplification product are taken and used to carry out a second, so-called “nested” PCR amplification with primers located within the region already amplified. This second step takes place over 35 cycles, with a primer hybridization (“annealing”) temperature of 50° C. The reaction volume is 100 μl.
The primers used for this second step are the following:
5′CGCGATGCTGGTTGGAGAGC 3′, corresponding to a 5′ MSRV-2 PCR primer, for a nested PCR on samples from patients,
5′ TCTCCACTCCGAATATTCCG 3′, corresponding to a 3′ MSRV-2 PCR primer, for a nested PCR on samples from patients.
For MSRV-1, the amplification was performed in two steps. Furthermore, the nucleic acid sample is treated beforehand with DNase, and a control PCR without RT (AMV reverse transcriptase) is performed on the two amplification steps so as to verify that the RT-PCR amplification comes exclusively from the MSRV-1 RNA. In the event of a positive control without RT, the initial aliquot sample of RNA is again treated with DNase and amplified again.
The protocol for treatment with DNase lacking RNAse activity in as follows: the extracted RNA is aliquoted in the presence of “RNAse inhibitor” (Boehringer-Mannheim) in water treated with DEPC at a final concentration of 1 μg in 10 μl; to these 10 μl, 1 μl of “RNAse-free DNAse” (Boehringer-Mannheim) and 1.2 μl of pH 5 buffer containing 0.1 M/l sodium acetate and 5 mM/l MgSO4 is added; the mixture is incubated for 15 min at 20° C. and brought to 95° C. for 1.5 min in a “thermocycler”.
The first MSRV-1 RT-PCR step is performed according to a variant of the RNA amplification method as described in Patent Application No. EP-A-0,569,272. In particular, the cDNA synthesis step is performed at 42° C. for one hour; the PCR amplification takes place over 40 cycles, with a primer hybridization (“annealing”) temperature of 53° C. The reaction volume is 100 μl.
The primers used for this first step are the following:
After this step, 10 μl of the amplification product are taken and used to carry out a second, so-called “nested” PCR amplification with primers located within the region already amplified. This second step takes place over 35 cycles, with a primer hybridization (“annealing”) temperature of 53° C. The reaction volume is 100 μl.
The primers used for this second step are the following:
The top photograph (
Well number 8 contains a mixture of DNA molecular weight markers, and wells 1 to 7 represent, in order, the products amplified from the total RNAs of plasmas originating from 4 healthy controls free from MS (wells 1 to 4) and from 3 patients suffering from MS at different stages of the disease (wells 5 to 7).
In this series, MSRV-2 nucleic acid material is detected in the plasma of one case of MS out of the 3 tested, and in none of the 4 control plasmas. Other results obtained on more extensive series confirm these results.
The bottom photograph (
well No. 1 contains the PCR product produced with water alone, without the addition of AXV reverse transcriptase; well No. 2 contains the PCR product produced with water alone, with the addition of AMV reverse transcriptase; well number 3 contains a mixture of DNA molecular weight markers; wells 4 to 13 contain, in order, the products amplified from the total RNAs extracted from sucrose gradient fractions (collected in a downward direction), on which gradient a pellet of virion originating from a supernatant of a culture infected with MSRV-1 and MSRV-2 was centrifuged to equilibrium according to the protocol described by H. Perron (13); to well 14 nothing was applied; to wells 15 to 17, the amplified products of RNA extracted from plasmas originating from 3 different patients suffering from MS at different stages of the disease were applied.
The MSRV-1 retroviral genome is indeed to be found in the sucrose gradient fraction containing the peak of reverse transcriptase activity measured according to the technique described by H. Perron (3), with a very strong intensity (fraction 5 of the gradient, placed in well No. 8). A slight amplification has taken place in the first fraction (well No. 4), probably corresponding to RNA released by lysed particles which floated at the surface of the gradient; similarly, aggregated debris has sedimented in the last fraction (tube bottom), carrying with it a few copies of the MSRV-1 genome which have given rise to an amplification of low intensity.
Of the 3 MS plasmas tested in this series, MSRV-1 RNA turned up in one case, producing a very intense amplification (well No. 17).
In this series, the MSRV-1 retroviral RNA genome, probably corresponding to particles of extracellular virus present in the plasma in extremely small numbers, was detected by “nested” RT-PCR in one case of MS out of the 3 tested. Other results obtained on more extensive series confirm these results.
Furthermore, the specificity of the sequences amplified by these PCR techniques may be verified and evaluated by the “ELOSA” technique as described by F. Mallet (21) and in the document FR-A-2,663,040.
For MSRV-1, the products of the nested PCR described above may be tested in two ELOSA systems enabling a consensus A and a consensus B+C+D of MSRV-1 to be detected separately, corresponding to the subfamilies described in Example 1 and
The ELOSA/MSRV-1 system for the capture and specific hybridization of the PCR products of the subfamily A uses a capture oligonucleotide cpV1A with an amine bond at the 5′ end and a biotinylated detection oligonucleotide dpV1A having an their sequence, respectively:
5′ GATCTAGGCCACTTCTCAGGTCCAGS 3′, corresponding to the ELOSA capture oligonucleotide for the products of MSRV-1 nested PCR performed with the primers identified by SEQ ID NO:16 and SEQ ID NO:17, optionally followed by amplification with the primers identified by SEQ ID N018 and SEQ ID NO:19 on samples from patients;
5′CATCTITTTGGICAGGCAITAGC 3′, corresponding to the ELOSA capture oligonucleotide for the subfamily A of the products of MSRV-1 “nested” PCR performed with the primers identified by SEQ ID NO:16 and SEQ ID NO:17, optionally followed by amplification with the primers identified by SEQ ID NO:18 and SEQ ID NO:19 on samples from patients.
The ELOSA/MSRV-1 system for the capture and specific hybridization of the PCR products of the subfamily B+C+D uses the same biotinylated detection oligonucleotide dpV1A and a capture oligonucleotide cpV1B with an amine bond at the 5′ end having as its sequence:
5′CTTGAGCCAGTTCTCATACCTGGA 3′, corresponding to the ELOSA capture oligonucleotide for the subfamily B+C+D of the products of MSRV-1 “nested” PCR performed with the primers identified by SEQ ID NO:16 and SEQ ID NO:17, optionally followed by amplification with the primers identified by SEQ ID NO: 18 and SEQ ID NO:19 on samples from patients.
This ELOSA detection system enabled it to be verified that none of the PCR products thus amplified from DNase-treated plasmas of MS patients contained a sequence of the subfamily A, and that all were positive with the consensus of the subfamilies B, C and D.
For MSRV-2, a similar ELOSA technique was evaluated on isolates originating from infected cell cultures, using the following PCR amplification primers,
5′ AGTGYTRCCMCARGGCGCTGAA 3′, corresponding to a 5′ MSRV-2 PCR primer, for PCR on samples from cultures,
5′ GMGGCCAGCAGSAKGTCATCCA 3′, corresponding to a 3 MSRV-2 PCR primer, for PCR on samples from cultures,
and the capture oligonucleotides with an amine bond at the 5′ end cpV2 and the biotinylated detection oligonucleotide dpV2 having as their respective sequences:
5 GGATGCCGCCTATAGCCTCTAC 3′, corresponding to an ELOSA capture oligonucleotide for the products of MSRV-2 PCR performed with the primers SEQ ID NO:34 and SEQ ID NO:35, or optionally with the degenerate primers defined by Shih (12).
5′ AAGCCTATCGCGTGCAGTTGCC 3′, corresponding to an ELOSA detection oligonucleotide for the products of MSRV-2 PCR performed with the primers SEQ ID NO:34 and SEQ ID NO:35, or optionally with the degenerate primers defined by Shih (12)
This PCR amplification system with a pair of primers different from those which were described previously for amplification on the samples from patients made it possible to confirm the infection with MSRV-2 of in vitro cultures and of samples of nucleic acids used for the molecular biology studies.
All things considered, the first results of PCR detection of the genome of pathogenic and/or infective agents show that it is possible that free “virus” may circulate in the blood stream of patients in an acute, virulent phase, outside the nervous system. This is compatible with the almost invariable presence of “gaps” in the blood-brain barrier of patients in an active phase of MS.
As has already been described in Example 5, a PCR technique derived from the technique published by Frohman (19) was used. The technique derived makes it possible, using a specific primer at the 3′ end of the genome to be amplified, to elongate the sequence towards the 5′ region of the genome to be analysed. This technical variant is described in the documentation of “Clontech Laboratories Inc., (Palo-Alto Calif., USA) supplied with its product “5′-AmpliFINDER™ RACE Kit”, which was used on a fraction of virion purified as described above.
In order to carry out an amplification of the 3′ region of the MSRV-1 retroviral genome encompassing the region of the “env” gene, a study was carried out to determine a consensus sequence in the LTR regions of the same type as those of the defective endogenous retrovirus HSERV-9 (18, 24), with which the MSRV-1 retrovirus displays partial homologies.
The same specific 3′ primer was used in the kit protocol for the synthesis of the cDNA and the PCR amplification; its sequence is as follows:
GTGCTGATTGGTGTATTTACAATCC (SEQ ID NO 45)
Synthesis of the complementary DNA (cDNA) and unidirectional PCR amplification with the above primer were carried out in one step according to the method described in Patent EP-A-0,569,272.
The products originating from the PCR were extracted after purification of agarose gel according to conventional methods (17), and then resuspended in 10 ml of distilled water. Since one of the properties of Taq polymerase consists in adding an adenine at the 3′ end of each of the two DNA strands, the DNA obtained was inserted directly into a plasmid using the TA Cloning™ kit (British Biotechnology). The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analysed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kite. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “automatic sequencer, model 373 A [lacuna] apparatus according to the manufacturer's instructions.
This technical approach was applied to a sample of virion concentrated as described below from a mixture of culture supernatants produced by B lymphoblastoid lines such as are described in Example 2, established from lymphocytes of patients suffering from MS and possessing reverse transcriptase activity which is detectable according to the technique described by Perron et al. (3): the culture supernatants are collected twice weekly, precentrifuged at 10,000 rpm for 30 minutes to remove cell debris and then frozen at −80° C. or used as they are for the following steps. The fresh or thawed supernatants are centrifuged on a cushion of 30% glycerol-PBS at 100,000 g for 2 h at 4° C. After removal of the supernatant, the sedimented pellet constitutes the sample of concentrated but unpurified virions. The pellet thereby obtained is then taken up in a small volume of an appropriate buffer for the extraction of RNA. The cDNA synthesis reaction mentioned above is carried out on this RNA extracted from concentrated extracellular virion.
RT-PCR amplification according to the technique mentioned above enabled the clone FBd3 to be obtained, whose sequence, identified by SEQ ID NO:46, is presented in
In
Four oligonucleotides, F1, B4, F6 and B1, were defined for amplifying RNA originating from concentrated virions of the strains POL2 and MS7PG. Control reactions were performed so as to check for the presence of contaminants (reaction with water). The amplification consists of a first step of RT-PCR according to the protocol described in Patent Application EP-A-0,569,272, followed by a second step of PCR performed on 10 ml of product of the first step with primers internal to the amplified first region (“nested” PCR). In the first RT-PCR cycle, the primers F1 and B4 are used. In the second PCR cycle, the primers F6 and the primer B1 are used. The primers are positioned as follows:
Their composition is:
The product of “nested” amplification obtained and designated “t pol” in presented in
A library of cDNA was produced according to the procedure described by the manufacturer of the “cDNA synthesis module, cDNA rapid adaptator ligation module, cDNA rapid cloning module and lambda gt10 in vitro packaging module” kits (Amersham, ref RPN1256Y/Z, RPN1712, RPN1713, RPN1717, N334Z), from the messenger RNA extracted from cells of a B lymphoblastoid line such as is described in Example 2, established from the lymphocytes of a patient suffering from MS and possessing reverse transcriptase activity which is detectable according to the technique described by Perron et al. (3).
Oligonucleotides were defined for amplifying the cDNA cloned into the nucleic acid library between the 3′ region of the clone PSJ17 (pol) and the 5′ (LTR) region of the clone FBd3. Control reactions were performed so as to check for the presence of contaminants (reaction with water). PCR reactions performed on the nucleic acids cloned into the library with different pairs of primers enabled a series of clones linking pol sequences to the MSRV-1 type env or LTR sequences to be amplified.
Two clones are representative of the sequences obtained in the cellular cDNA library:
The sequences of the clones JLBc1 and JLBc2 are homologous to that of the clone FBd3, as is apparent in
The homologies between the clones JLBc1 and JLBc2 on the one hand and the HSERV9 sequence on the other hand are presented, respectively, in
It will be noted that the region of homology between JLB1, JLB2 and FBd3 comprises, with a few sequence and size variations of the “insert”, the additional sequence absent (“inserted”) in the HSERV-9 env sequence, an described in Example 8.
It will also be noted that the cloned “pol” region in very homologous to HSERV-9, does not possess a reading frame (bearing in mind the sequence errors induced by the techniques used, including even the automatic sequencer) and diverges from the MSRV-1 sequences obtained from virions. In view of the fact that these sequences were cloned from the RNA of cells expressing MSRV-1 particles, it is probable that they originate from endogenous retroviral elements related to the ERV9 family; this is all the more likely for the fact that the pol and env genes are present on the same RNA which is clearly not the MSRV-1 genomic RNA. Some of these ERV9 elements possess functional LTRs which can be activated by replicative viruses coding for homologous or heterologous transactivators. Under theme conditions, the relationship between MSRV-1 and HSERV-9 makes probable the transactivation of the defective (or otherwise) endogenous ERV9 elements by homologous, or even identical, MSRV-1 transactivating proteins.
Such a phenomenon may induce a viral interference between the expression of MSRV-1 and the related endogenous elements. Such an interference generally leads to a so-called “defective-interfering” expression, some features of which were to be found in the MSRV-1-infected cultures studied. Furthermore, such a phenomenon does not lack generation of the expression of polypeptides, or even of endogenous retroviral proteins which are not necessarily tolerated by the immune system. Such a scheme of aberrant expression of endogenous elements related to MSRV-1 and induced by the latter is liable to multiply the aberrant antigens, and hence to contribute to the induction of autoimmune processes such as are observed in MS.
It is, however, essential to note that the clones JLBc1 and JLBc2 differ from the ERV9 or HSERV9 sequence already described, in that they possess a longer env region comprising an additional region totally divergent from ERV9. Their kinship with the endogenous ERV9 family may hence be defined, but they clearly constitute novel elements never hitherto described. In effect, interrogation of the data banks of nucleic acid sequences available in version No. 15 (1995) of the “Entrez” software (NCBI, NIH, Bethesda, USA) did not enable a known homologous sequence in the env region of these clones to be identified.
As has already been described in Example 5, a PCR technique derived from the technique published by Frohman (19) was used. The technique derived makes it possible, using a specific primer at the 3′ end of the genome to be amplified, to elongate the sequence towards the 5′ region of the genome to be analysed. This technical variant is described in the documentation of the firm “Clontech Laboratories Inc., (Palo-Alto Calif., USA) supplied with its product “5′-AmpliFINDER™ RACE Kit”, which was used on a fraction of virion purified as described above.
In order to carry out an amplification of the 5′ region of the MSRV-1 retroviral genome starting from the pol sequence already sequenced (clone F11-1) and extending towards the gag gene, MSRV-1 specific primers were defined.
The specific 3′ primers used in the kit protocol for the synthesis of the cDNA and the PCR amplification are, respectively, complementary to the following MSRV-1 sequences:
The products originating from the PCR were extracted after purification on agarose gel according to conventional methods (17), and then resuspended in 10 ml of distilled water. Since one of the properties of Taq polymerase consists in adding an adenine at the 3′ end of each of the two DNA strands, the DNA obtained was inserted directly into a plasmid using the TA Cloning™ kit (British Biotechnology). The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analysed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit®. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequences was carried out with an Applied Biosystems “automatic sequencer model 373 A” apparatus according to the manufacturer's instructions.
This technical approach was applied to a sample of virion concentrated as described below from a mixture of culture supernatants produced by B lymphoblastoid lines such as are described in Example 2, established from lymphocytes of patients suffering from MS and possessing reverse transcriptase activity which is detectable according to the technique described by Perron et al. (3): the culture supernatants are collected twice weekly, precentrifuged at 10,000 rpm for 30 minutes to remove cell debris and then frozen at −80° C. or used an they are for the following steps. The fresh or thawed supernatants are centrifuged on a cushion of 30% glycerol-PBS at 100,000 g for 2 h at 4° C. After removal of the supernatant, the sedimented pellet constitutes the sample of concentrated but unpurified virions. The pellet thereby obtained is then taken up in a small volume of an appropriate buffer for the extraction of RNA. The cDNA synthesis reaction mentioned above is carried out on this RNA extracted from concentrated extracellular virion.
RT-PCR amplification according to the technique mentioned above enabled the clone GM3 to be obtained, whose sequence, identified by SEQ ID NO 56, is presented in
In
In summary,
By means of the clone GM3 described above, a possible reading frame could be defined, covering the whole of the pol gone, referenced according to SEQ ID NO:57, shown in the successive
Identification of the sequence of the pol gene of the MSRV-1 retrovirus and of an open reading frame of this gene enabled the amino acid sequence SEQ ID NO:39 of a region of the said gene, referenced SEQ ID NO:40, to be determined (see
Different synthetic peptides corresponding to fragments of the protein sequence of MSRV-1 reverse transcriptase encoded by the pol gene were tested for their antigenic specificity with respect to sera of patients suffering from MS and of healthy controls.
The peptides were synthesized chemically by solid-phase synthesis according to the Merrifield technique (Barany G, and Merrifielad R. B, 1980, In the Peptides, 2, 1-284, Gross E and Meienhofer J, Edo., Academic Press, New York). The practical details are those described below.
a) Peptide Synthesis:
The peptides were synthesized on a phenylacetamidomethyl (PAM)/polystyrene/divinylbenzene resin (Applied Biosystems, Inc. Foster City, Calif.), using an “Applied Biosystems 430A” automatic synthesizer. The amino acids are coupled in the form of hydroxybenzotriazole (HOBT) esters. The amino acids used are obtained from Novabiochem (Liuflerlfingen, Switzerland) or Bachem (Bubendorf, Switzerland).
The chemical synthesis was performed using a double coupling protocol with N-methylpyrrolidone (NMP) as solvent. The peptides were cut from the resin, as well as the side-chain protective groups, simultaneously, using hydrofluoric acid (HF) in a suitable apparatus (type I cleavage apparatus, Peptide Institute, Osaka, Japan).
For 1 g of peptidyl resin, 10 ml of HF, 1 ml of anisole and 1 ml of dimethyl sulphide 5DMS are used. The mixture is stirred for 45 minutes at −2° C. The HF is then evaporated off under vacuum. After intensive washes with ether, the peptide is eluted from the resin with 10% acetic acid and then lyophilized.
The peptides are purified by preparative high performance liquid chromatography on a VYDAC C18 type column (250×21 mm) (The Separation Group, Hesperia, Calif., USA). Elution is carried out with an acetonitrile gradient at a flow rate of 22 ml/min. The fractions collected are monitored by an elution under isocratic conditions on a VYDAC® C18 analytical column (250×4.6 mm) at a flow rate of 1 ml/min. Fractions having the same retention time are pooled and lyophilized. The preponderant fraction is then analysed by analytical high performance liquid chromatography with the system described above. The peptide which is considered to be of acceptable purity manifests itself in a single peak representing not less than 95% of the chromatogram.
The purified peptides are then analysed with the object of monitoring their amino acid composition, using an Applied Biosystems 420H automatic amino acid analyser. Measurement of the (average) chemical molecular mass of the peptides is obtained using LSIMS mass spectrometry in the positive ion mode on a VG. ZAB.ZSEQ double focusing instrument connected to a DEC-VAX 2000 acquisition system (VG analytical Ltd, Manchester, England).
The reactivity of the different peptides was tested against sera of patients suffering from MS and against sera of healthy controls. This enabled a peptide designated POL2B to be selected, whose sequence is shown in
b) Antigenic Properties
The antigenic properties of the POL2B peptide were demonstrated according to the ELISA protocol described below.
The lyophilized POL2B peptide was dissolved in sterile distilled water at a concentration of 1 mg/ml. This stock solution was aliquoted and kept at +4° C. for use over a fortnight, or frozen at −20° C. for use within 2 months. An aliquot is diluted in PBS (phosphate buffered saline) solution so as to obtain a final peptide concentration of 1 microgram/ml. 100 microlitres of this dilution are placed in each well of microtitration plates (“high-binding” plastic, COSTAR ref: 3590). The plates are covered with a “plate-sealer” type adhesive and kept overnight at +4° C. for the phase of adsorption of the peptide to the plastic. The adhesive is removed and the plates are washed three times with a volume of 300 microlitres of a solution A (1×PBS, 0.05% Tween 20®), then inverted over an absorbent tissue. The plates thus drained are filled with 200 microlitres per well of a solution B (solution A+10% of goat serum), then covered with an adhesive and incubated for 45 minutes to 1 hour at 37° C. The plates are then washed three times with the solution A as described above.
The test serum samples are diluted beforehand to 1/50 in the solution B, and 100 microlitres of each dilute test serum are placed in the wells of each microtitration plate. A negative control is placed in one well of each plate, in the form of 100 microlitres of buffer B. The plates covered with an adhesive are then incubated for 1 to 3 hours at 37° C. The plates are then washed three times with the solution A as described above. In parallel, a peroxidase-labelled goat antibody directed against human IgG (Sigma Immunochemicals ref. A6029) or IgM (Cappel ref. 55228) is diluted in the solution B (dilution 1/5000 for the anti-IgG and 1/1000 for the anti-IgM). 100 microlitres of the appropriate dilution of the labelled antibody are then placed in each well of the microtitration plates, and the plates covered with an adhesive are incubated for 1 to 2 hours at 37° C. A further washing of the plates is then performed as described above. In parallel, the peroxidase substrate is prepared according to the directions of the “Sigma fast OPD kit” (Sigma Immunochemicals, ref. P9187). 100 microlitres of substrate solution are placed in each well, and the plates are placed protected from light for 20 to 30 minutes at room temperature.
When the colour reaction has stabilized, the plates are placed immediately in an ELISA plate spectrophotometric reader, and the optical density (OD) of each well in read at a wavelength of 492 nm. Alternatively, 30 microlitres of 1N HCL are placed in each well to stop the reaction, and the plates are read in the spectrophotometer within 24 hours.
The serological samples are introduced in duplicate or in triplicate, and the optical density (OD) corresponding to the serum tested is calculated by taking the mean of the OD values obtained for the same sample at the same dilution.
The not OD of each serum corresponds to the mean OD of the serum minus the mean OD of the negative control (solution B: PBS, 0.05% Tween 200, 10% goat serum).
c) Detection of Anti-MSRV-1 IaG Antibodies by ELISA:
The technique described above was used with the POLB2 peptide to test for the presence of anti-MSRV-1 specific IgG antibodies in the serum of 29 patients for whom a definite or probable diagnosis of MS was established according to the criteria of Poser (23), and of 32 healthy controls (blood donors).
The mean of the net OD values for the MS sera tested is 0.62. The diagram enables 5 controls to be revealed whose net OD rises above the grouped values of the control population. These values may represent the presence of specific IgGs in symptomless seropositive patients. Two methods were hence evaluated in order to determine the statistical threshold of positivity of the test.
The mean of the net OD values for the controls, including the controls with high net OD values, is 0.36. Without the 5 controls whose net OD values are greater than or equal to 0.5, the mean of the “negative” controls is 0.33. The standard deviation of the negative controls is 0.10. A theoretical threshold of positivity may be calculated according to the formula:
threshold value (mean of the net OD values of the seronegative controls)+(2 or 3×standard deviation of the net OD values of the seronegative controls).
In the first case, there are considered to be symptomless seropositives, and the threshold value is equal to 0.33+(2×0.10)=0.53. The negative results represent a non-specific “background” of the presence of antibodies directed specifically against an epitope of the peptide.
In the second case, if the set of controls consisting of blood donors in apparent good health is taken as a reference basis, without excluding the sera which are, on the face of it, seropositive, the standard deviation of the “non-MS controls” is 0.116. The threshold value then becomes 0.36+(2×0.116) =0.59.
According to this analysis, the test is specific for MS. In this respect, it is seen that the test is specific for MS, since, as shown in Table 1, no control has a net OD above this threshold. In fact, this result reflects the fact that the antibody titres in patients suffering from MS are, for the most part, higher than in healthy controls who have been in contact with MSRV-1.
In accordance with the first method of calculation, and as shown in
Five out of 32 blood donors in apparent good health show a positive result. Thus, it is apparent that approximately 15% of the symptomless population may have been in contact with an epitope carried by the POL2B peptide under conditions which have led to an active immunization which manifests itself in the persistence of specific serum IgGs. These conditions are compatible with an immunization against the MSRV-1 retrovirus reverse transcriptase during an infection with (and/or reactivation of) the MSRV-1 retrovirus. The absence of apparent neurological pathology recalling MS in these seropositive controls may indicate that they are healthy carriers and have eliminated an infectious virus after immunizing themselves, or that they constitute an at-risk population of chronic carriers. In effect, epidemiological data showing that a pathogenic agent present in the environment of regions of high prevalence of MS may be the cause of this disease imply that a fraction of the population free from MS has necessarily been in contact with such a pathogenic agent. It has been shown that the MSRV-1 retrovirus constitutes all or part of this “pathogenic agent” at the source of MS, and it is hence normal for controls taken from a healthy population to possess IgG type antibodies against components of the MSRV-1 retrovirus. Thus, the difference in seroprevalence between the MS and control populations is extremely significant: “chi-squared” test, p<0.001. These results hence point to an aetiopathogenic role of MSRV-1 in MS.
d) Detection of Anti-MSRV-1 IgM Antibodies by ELISA:
The ELISA technique with the POL2B peptide was used to test for the presence of anti-MSRV-1 IgM specific antibodies in the serum of 36 patients for whom a definite or probable diagnosis of MS was established according to the criteria of Poser (23), and of 42 healthy controls (blood donors).
The mean of the net OD values for the MS cases tested is 0.19.
The mean of the net OD values for the controls is 0.09.
The standard deviation of the negative controls is 0.05.
In view of the small difference between the mean and the standard deviation of the controls, the threshold of theoretical positivity may be calculated according to the formula:
threshold value=(mean of the net OD values of the seronegative controls)+(3×standard deviation of the net OD values of the seronegative controls).
The threshold value is hence equal to 0.09+(3×0.05)=0.26; or, in practice, 0.25.
The negative results represent a non-specific “background” of the presence of antibodies directed specifically against an epitope of the peptide.
According to this analysis, and as shown in
The difference in seroprevalence between the NS and control populations is extremely significant: “chi-squared” test, p<0.001.
These results point to an aetiopathogenic role of MSRV-1 in MS.
The detection of IgM and IgG antibodies against the POL2B peptide enables the course of an MSRV-1 infection and/or of the viral reactivation of MSRV-1 to be evaluated.
e) Search for Immunodominant Epitopes in the POL2B Peptide:
In order to reduce the non-specific background and to optimize the detection of the responses of the anti-MSRV-1 antibodies, the synthesis of octapeptides, advancing in successive one amino acid steps, covering the whole of the sequence determined by POL2B, was carried out according to the protocol described below.
The chemical synthesis of overlapping octapeptides covering the amino acid sequence 61-110 shown in the identifier SEQ ID NO:39 was carried out on an activated cellulose membrane according to the technique of BERG et al. (1989.—J. Ann. Chem. Soc., 111, 8024-8026) marketed by Cambridge Research Biochemicals under the trade name Spotscan. This technique permits the simultaneous synthesis of a large number of poptides and their analysis.
The synthesis is carried out with esterified amino acids in which the α-amino group is protected with an FMOC group (Nova Biochem) and the side-chain groups with protective groups such as trityl, t-butyl ester or t-butyl other. The esterified amino acids are solubilized in N-methylpyrrolidone (NMP) at a concentration of 300 nM, and 0.9 μl are applied to spots of deposit of bromophenol blue. After incubation for 15 minutes, a further application of amino acids is carried out according to another 15-minute incubation. If the coupling between two amino acids has taken place correctly, a coloration modification (change from blue to yellow-green) is observed. After three washes in DMF, an acetylation step is performed with acetic anhydride. Next, the terminal amino groups of the peptides in the process of synthesis are deprotected with 20% pyridine in DMF. The spots of deposit are restained with a 1% solution of bromophenol blue in DMF, washed three times with methanol and dried. This set of operations constitutes one cycle of addition of an amino acid, and this cycle is repeated until the synthesis is complete. When all the amino acids have been added, the NH2-terminal group of the last amino acid is deprotected with 20% piperidine in DMF and acetylated with acetic anhydride. The groups protecting the side chain are removed with a dichloromethane/trifluoroacetic acid/triisobutylsilane (5 ml/5 ml/250 ml) mixture. The immunoreactivity of the peptides is then tested by ELISA.
After synthesis of the different octapeptides in duplicate on two different membranes, the latter are rinsed with methanol and washed in TBS (0.1M Tris pH 7.2), then incubated overnight at room temperature in a saturation buffer. After several washes in TBS-T (0.1M Tris pH 7.2-0.05% Tween 20), one membrane is incubated with a 1/50 dilution of a reference serum originating from a patient suffering from MS, and the other membrane with a 1/50 dilution of a pool of sera of healthy controls. The membranes are incubated for 4 hours at room temperature. After washes with TBS-T, a β-galactosidase-labelled anti-human immunoglobulin conjugate (marketed by Cambridge Research Biochemicals) is added at a dilution of 1/200, and the mixture is incubated for two hours at room temperature. After washes of the membranes with 0.05% TBS-T and PBS, the immunoreactivity in the different spots is visualized by adding 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside in potassium. The intensity of coloration of the spots is estimated qualitatively with a relative value from 0 to 5 as shown in the attached
In this way, it is possible to determine two immunodominant regions at each end of the POL2B peptide, corresponding, respectively, to the amino acid sequences 65-75 (SEQ ID NO:41) and 92-109 (SEQ ID NO:42), according to
These regions make it possible to define new peptides which are more specific and more immunoreactive according to the usual techniques.
It is thus possible, as a result of the discoveries made and the methods developed by the inventors, to carry out a diagnosis of MSRV-1 infection and/or reactivation and to evaluate a therapy in MS on the basis of its efficacy in “negativing” the detection of these agents in the patients' biological fluids. Furthermore, early detection in individuals not yet displaying neurological signs of MS could make it possible to institute a treatment which would be all the more effective with respect to the subsequent clinical course for the fact that it would precede the lesion stage which corresponds to the onset of neurological disorders. Now, at the present time, a diagnosis of MS cannot be established before a symptomatology of neurological lesions has set in, and hence no treatment in instituted before the emergence of a clinical picture suggestive of lesions of the central nervous system which are already significant. The diagnosis of an MSRV-1 and/or MSRV-2 infection and/or reactivation in man is hence of decisive importance, and the present invention provides the means of doing this.
It is thus possible, apart from carrying out a diagnosis of MSRV-1 infection and/or reactivation, to evaluate a therapy in MS on the basin of its efficacy in “negativing” the detection of these agents in the patients' biological fluids.
A PCR technique derived from the technique published by Gonzalez-Quintial R at al. (19) and PLAZA et al. (25) was used. From the total RNA extracted from a fraction of virion purified as described above, the cDNA was synthesized using a specific primer (SEQ ID No.64) at the 3′ end of the genome to be amplified, using EXPAND™ REVERSE TRANSCRIPTASE (BOEHRINGER MANNHEIM).
After purification, a poly(G) tail was added at the 5′ end of the cDNA using the “Terminal transferases kit” marketed by the company Boehringer Mannheim, according to the manufacturer's protocol.
An anchoring PCR was carried out using the following 5′ and 3′-primers:
Next, a semi-nested anchoring PCR was carried out with the following 5′ and 3′ primers:
The products originating from the PCR were purified after purification on agarose gel according to conventional methods (17), and then resuspended in 10 microlitres of distilled water. Since one of the properties of Taq polymerase consists in adding an adenine at the 3′ end of each of the two DNA strands, the DNA obtained was inserted directly into a plasmid using the TA Cloning™ kit (British Biotechnology). The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “T4 DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analysed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit®. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxy-terminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “Automatic Sequencer, model 373 A” apparatus according to the manufacturer's instructions.
PCR amplification according to the technique mentioned above was used on a cDNA synthesized from the nucleic acids of fractions of infective particles purified on a sucrose gradient, according to the technique described by R. Perron (13), from culture supernatants of B lymphocytes of a patient suffering from MS, immortalized with Epstein-Barr virus (EBV) strain B95 and expressing retroviral particles associated with reverse transcriptase activity as described by Perron at al. (3) and in French Patent Applications MS 10, 11 and 12. the clone LB19, whose sequence, identified by SEQ ID NO:59, is presented in
The clone makes it possible to define, with the clone GM3 previously sequenced and the clone G+E+A (see Example 15), a region of 690 base pairs representative of a significant portion of the gag gene of the MSRV-1 retrovirus, as presented in
Extraction of viral RNAs: The RNAs were extracted according to the method briefly described below.
A pool of culture supernatant of B lymphocytes of patients suffering from MS (650 ml) is centrifuged for 30 minutes at 10,000 g. The viral pellet obtained is resuspended in 300 microlitres of PBS/10 mM MgCl2. The material is treated with a DNAse (100 mg/ml)/RNAse (50 mg/ml) mixture for 30 minutes at 37° C. and then with proteinase K (50 mg/ml) for 30 minutes at 46° C.
The nucleic acids are extracted with one volume of a phenol/0.1% SDS (V/V) mixture heated to 60° C., and then re-extracted with one volume of phenol/chloroform (1:1; V/V).
Precipitation of the material is performed with 2.5 V of ethanol in the presence of 0.1 V of sodium acetate pH=5.2. The pellet obtained after centrifugation is resuspended in 50 microlitres of sterile DEPC water.
The sample is treated again with 50 mg/ml of “RNAse free” DNAse for 30 minutes at room temperature, extracted with one volume of phenol/chloroform and precipitated in the presence of sodium acetate and ethanol.
The RNA obtained is quantified by an OD reading at 260 nm. The presence of MSRV-1 and the absence of DNA contaminant in monitored by a PCR and an MSRV-1-specific RTPCR associated with a specific ELOSA for the MSRV-1 genome.
Synthesis of cDNA:
5 mg of RNA are used to synthesize a cDNA primed with a poly(DT) oligonucleotide according to the instructions of the “cDNA Synthesis Module” kit (ref RPN 1256, Amersham) with a few modifications: The reverse transcription is performed at 45° C. instead of the recommended 42° C.
The synthesis product is purified by a double extraction and a double purification according to the manufacturer's instructions.
The presence of MSRV-1 is verified by an MSRV-1 PCR associated with a specific ELOSA for the MSRV-1 genome.
“Long Distance PCR”: (LD-PCR)
500 ng of cDNA are used for the LD-PCR step (Expand Long Template System; Boehringer (ref. 1681 842)).
Several pairs of oligonucleotides were used. Among these, the pair defined by the following primers: 5′ primer: GGAGAAGAGC AGCATAAGTG G (SEQ ID No. 66) 3′ primer: GTGCTGATTG GTGTATTTAC AATCC (SEQ ID No. 67).
The amplification conditions are as follows:
10 cycles, then 20 cycles with an increment of 20 seconds in each cycle on the elongation time. At the end of this first amplification, 2 microlitres of the amplification product are subjected to a second amplification under the same conditions as before.
The LD-PCR reactions are conducted in a Perkin model 9600 PCR apparatus in thin-walled microtubes (Boehringer).
The amplification products are monitored by electrophoresis of ⅕th of the amplification volume (10 microlitres) in 1% agarose gel. For the pair of primers described above, a band of approximately 1.7 Kb is obtained.
Cloning of the Amplified Fragment:
The PCR product was purified by passage through a preparative agarose gel and then through a Costar column (Spin; D. Dutcher) according to the supplier's instructions.
2 microlitres of the purified solution are joined up with 50 ng of vector PCRII according to the supplier's instructions (TA Cloning Kit; British Biotechnology)).
The recombinant vector obtained is isolated by transformation of competent DH5aF′ bacteria. The bacteria are selected using their resistance to ampicillin and the loss of metabolism for Xgal (=white colonies). The molecular structure of the recombinant vector is confirmed by plasmid minipreparation and hydrolysis with the enzyme EcoR1.
FBd13, a positive clone for all these criteria, was selected. A large-scale preparation of the recombinant plasmid was performed using the Midiprep Quiagen kit (ref 12243) according to the supplier's instructions.
Sequencing of the clone FBd13 is performed by means of the Perkin Prism Ready Amplitaq FS dye terminator kit (ref. 402119) according to the manufacturer's instructions. The sequence reactions are introduced into a Perkin type 377 or 373A automatic sequencer. The sequencing strategy consists in gene walking carried out on both strands of the clone Fbd13.
The sequence of the clone FBd13 is identified by SEQ ID NO 58.
In
This additional sequence determines a potential orf, designated ORF B13, which in represented by its amino acid sequence SEQ ID NO:87.
The molecular structure of the clone FBd13 was analyzed using the GeneWork software and Genebank and SwissProt data banks.
5 glycosylation sites were found.
The protein does not have significant homology with already known sequences.
It is probable that this clone originates from a recombination of an endogenous retroviral element (ERV), linked to the replication of MSRV-1.
Such a phenomenon does not lack generation of the expression of polypeptides, or even of endogenous retroviral proteins which are not necessarily tolerated by the immune system. Such a scheme of aberrant expression of endogenous elements related to MSRV-1 and/or induced by the latter is liable to multiply the aberrant antigens, and hence tends to contribute to the induction of autoimmune processes such as are observed in MS. It clearly constitutes a novel element never hitherto described. In effect, interrogation of the data banks of nucleic acid sequences available in version No. 19 (1996) of the “Entrez” software (NCBI, NIH, Bethesda, USA) did not enable a known homologous sequence comprising the whole of the env region of this clone to be identified.
A 3′RACE was performed on total RNA extracted from plasma of a patient suffering from MS. A healthy control plasma treated under the same conditions was used as negative control. The synthesis of cDNA was carried out with the following modified oligo(dT) primer:
and Boehringer “Expand RT” reverse transcriptase according to the conditions recommended by the company. A PCR was performed with the enzyme Klentaq (Clontech) under the following conditions: 94° C. 5 min then 93° C. 1 min, 58° C. 1 min, 68° C. 3 min for 40 cycles and 68° C. for 8 min, and with a final reaction volume of 50 μl.
A second, so-called “semi-nested” PCR was carried out with a 5′ primer located within the region already amplified. This second PCR was performed under the same experimental conditions as those used in the first PCR, using 10 μl of the amplification product originating from the first PCR.
Primers SEQ ID NO:69 and SEQ ID NO:70 are specific for the pol* region: position No. 403 to No. 422 and No. 641 to No. 670, respectively.
An amplification product was thus obtained from the extracellular RNA extracted from the plasma of a patient suffering from MS. The corresponding fragment was not observed for the plasma of the healthy control. This amplification product was cloned in the following manner.
The amplified DNA was inserted into a plasmid using the TA Cloning™ kit. The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning kit® (British Biotechnology). At the end of the procedure, the white columns of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analyzed on agarose gel. Plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide was selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA cloning kit®. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxyterminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “Automatic Sequencer, model 373 A” apparatus according to the manufacturer's instructions.
The clone obtained, designated FP6, enables a region of 467 bp which is 89% homologous to the pol* region of the MSRV-1 retrovirus and a region of 1167 bp which is 64% homologous to the pol region of ERV-9 (No. 1634 to 2856) to be defined.
The clone FP6 is represented in
Oligonucleotides specific for the MSRV-1 sequences already identified by the Applicant were defined in order to amplify the retroviral RNA originating from virions present in the plasma of patients suffering from MS. Control reactions were performed so as to monitor the presence of contaminants (reaction with water). The amplification consists of a step of RT-PCR followed by a “nested” PCR. Pairs of primers were defined for amplifying three overlapping regions (designated G, E and A) on the regions defined by the sequences of the clones GM3 and pol* described above.
Semi-nested RT-PCR for Amplification of the Region G:
primer 1: SEQ ID NO:71 (sense)
primer 2: SEQ ID NO:72 (antisense)
primer 1: SEQ ID NO:73 (sense)
primer 4: SEQ ID NO:74 (antisense)
Nested RT-PCR for Amplification of the Region E:
primer 5: SEQ ID NO:75 (sense)
primer 6: SEQ ID NO:76 (antisense)
primer 7: SEQ ID NO:77 (sense)
primer 8: SEQ ID NO:78 (antisense)
Semi-Nested RT-PCR for Amplification of the Region A:
primer 9: SEQ ID NO:79 (sense)
primer 10: SEQ ID NO:80 (antisense)
primer 9: SEQ ID NO:81 (sense)
primer 11: SEQ ID NO:82 (antisense)
The primers and the regions G, E and A which they define are positioned as follows:
The sequence of the region defined by the different clones G, E and A was determined after cloning and sequencing of the “nested” amplification products.
The clones G, E and A were assembled together by PCR with the primers 1 at the 5′ end of the fragment G and 11 at the 3′ end of the fragment A, the primers being described above. An approximately 1580-bp fragment G+E+A was amplified and inserted into a plasmid using the TA Cloning (trademark) kit. The sequence of the amplification product corresponding to G+E+A was determined and analysis of the G+E and E+A overlaps was carried out. The sequence in shown in
A reading frame coding for an MSRV-1 retroviral protease was found in the region E. The amino acid sequence of the protease, identified by SEQ ID NO:90, in presented in
A nested PCR was performed on the DNA extracted from a lymphoblastoid line (B lymphocytes immortalized with the EBV virus strain B95, as described above and as is well known to a person skilled in the art) expressing the MSRV-1 retrovirus and originating from peripheral blood lymphocytes of a patient suffering from MS.
In the first PCR step, the following primers are used:
This step comprises 35 amplification cycles with the following conditions: 1 min at 94° C., 1 min at 54° C. and 4 min at 72° C.
In the second PCR step, the following primers are used:
This step comprises 35 amplification cycles with the following conditions: 1 min at 94° C., 1 min at 54° C. and 4 min at 72° C.
The products originating from the PCR were purified after purification on agarose gel according to conventional methods (17), and then resuspended in 10 ml of distilled water. Since one of the properties of Taq polymerase consists in adding an adenine at the 3′ end of each of the two DNA strands, the DNA obtained was inserted directly into a plasmid using the TA Cloning™ kit (British Biotechnology). The 2 μl of DNA solution were mixed with 5 μl of sterile distilled water, 1 μl of a 10-fold concentrated ligation buffer “10× LIGATION BUFFER”, 2 μl of “pCR™ VECTOR” (25 ng/ml) and 1 μl of “TA DNA LIGASE”. This mixture was incubated overnight at 12° C. The following steps were carried out according to the instructions of the TA Cloning® kit (British Biotechnology). At the end of the procedure, the white colonies of recombinant bacteria (white) were picked out in order to be cultured and to permit extraction of the plasmids incorporated according to the so-called “miniprep” procedure (17). The plasmid preparation from each recombinant colony was cut with a suitable restriction enzyme and analyzed on agarose gel. The plasmids possessing an insert detected under UV light after staining the gel with ethidium bromide were selected for sequencing of the insert, after hybridization with a primer complementary to the Sp6 promoter present on the cloning plasmid of the TA Cloning Kit®. The reaction prior to sequencing was then performed according to the method recommended for the use of the sequencing kit “Prism ready reaction kit dye deoxy-terminator cycle sequencing kit” (Applied Biosystems, ref. 401384), and automatic sequencing was carried out with an Applied Biosystems “Automatic Sequencer, model 373 A” apparatus according to the manufacturer's instructions.
Thus, a clone designated LTRGAG12 could be obtained, and is represented by its internal sequence identified by SEQ ID NO:60.
This clone is probably representative of endogenous elements close to ERV-9, present in human DNA, in particular in the DNA of patients suffering from MS, and capable of interfering with the expression of the MSRV-1 retrovirus, hence capable of having a role in the pathogenesis associated with the MSRV-1 retrovirus and capable of serving as marker for a specific expression in the pathology in question.
Identification of the sequence of the pol gene of the MSRV-1 retrovirus and of an open reading frame of this gene enabled the amino acid sequence SEQ ID NO:63 of a region of the said gene, referenced SEQ ID NO: 62, to be determined.
Different synthetic peptides corresponding to fragments of the protein sequence of MSRV-1 reverse transcriptase encoded by the pol gene were tested for their antigenic specificity with respect to sera of patients suffering from MS and of healthy controls.
The peptides were synthesized chemically by solid-phase synthesis according to the Merrifield technique (22). The practical details are those described below.
a) Peptide Synthesis:
The peptides were synthesized on a phenylacetamidomethyl (PAM)/polystyrene-divinylbenzene resin (Applied Biosystems, Inc. Foster City, Calif.), using an “Applied Biosystems 430A” automatic synthesizer. The amino acids are coupled in the form of hydroxybenzotriazole (HOBT) esters. The amino acids used are obtained from Novabiochem (Läuflerlfingen, Switzerland) or Bachem (Bubendorf, Switzerland).
The chemical synthesis was performed using a double coupling protocol with N-methylpyrrolidone (NMP) as solvent. The peptides were cut from the resin, as well as the side-chain protective groups, simultaneously, using hydrofluoric acid (HF) in a suitable apparatus (type I cleavage apparatus, Peptide Institute, Osaka, Japan).
For 1 g of peptidyl resin, 10 ml of HF, 1 ml of anisole and 1 ml of dimethyl sulphide 5DMS are used. The mixture is stirred for 45 minutes at −2° C. The BF is then evaporated off under vacuum. After intensive washes with ether, the peptide in eluted from the resin with 10% acetic acid and then lyophilized.
The peptides are purified by preparative high performance liquid chromatography on a VYDAC C18 type column (250×21 mm) (The Separation Group, Hesperia, Calif., USA). Elution is carried out with an acetonitrile gradient at a flow rate of 22 ml/min. The fractions collected are monitored by an elution under isocratic conditions on a VYDAC® C18 analytical column (250×4.6 mm) at a flow rate of 1 ml/min. Fractions having the same retention time are pooled and lyophilized. The preponderant fraction is then analysed by analytical high performance liquid chromatography with the system described above. The peptide which is considered to be of acceptable purity manifesto itself in a single peak representing not less than 95% of the chromatogram.
The purified peptides are then analysed with the object of monitoring their amino acid composition, using an Applied Biosystems 420H automatic amino acid analyser. Measurement of the (average) chemical molecular mass of the peptides in obtained using LSIMS mass spectrometry in the positive ion mode on a VG. ZAB.ZSEQ double focusing instrument connected to a DEC-VAX 2000 acquisition system (VG analytical Ltd, Manchester, England).
The reactivity of the different peptides was tested against sera of patients suffering from MS and against sera of healthy controls. This enabled a peptide designated S24Q to be selected, whose sequence is identified by SEQ ID NO:63, encoded by a nucleotide sequence of the pol gene of MSRV-1 (SEQ ID NO:62).
b) Antigenic Properties:
The antigenic properties of the S24Q peptide were demonstrated according to the ELISA protocol described below.
The lyophilized S24Q peptide was dissolved in 10% acetic acid at a concentration of 1 mg/ml. This stock solution was aliquoted and kept at +4° C. for use over a fortnight, or frozen at −20° C. for use within 2 months. An aliquot is diluted in PBS (phosphate buffered saline) solution so as to obtain a final peptide concentration of 5 micrograms/ml. 100 microlitres of this dilution are placed in each well of Nunc Maxisorb (trade name) microtitration plates. The plates are covered with a “plate-sealer” type adhesive and kept for 2 hours at +37° C. for the phase of adsorption of the peptide to the plastic. The adhesive in removed and the plates are washed three times with a volume of 300 microlitres of a solution A (1×PBS, 0.05% Tween 20®), then inverted over an absorbent tissue. The plates thus drained are filled with 250 microlitres per well of a solution B (solution A+10% of goat serum), then covered with an adhesive and incubated for 1 hour at 37° C. The plates are then washed three times with the solution A as described above.
The test serum samples are diluted beforehand to 1/100 in the solution B, and 100 microlitres of each dilute test serum are placed in the wells of each microtitration plate. A negative control is placed in one well of each plate, in the form of 100 microlitres of buffer B. The plates covered with an adhesive are then incubated for 1 hour 30 min at 37° C. The plates are then washed three times with the solution A as described above. For the IgG response, a peroxidase-labelled goat antibody directed against human IgG (marketed by Jackson Immuno Research Inc.) is diluted in the solution B (dilution 1/10,000). 100 microlitres of the appropriate dilution of the labelled antibody are then placed in each well of the microtitration plates, and the plates covered with an adhesive are incubated for 1 hour at 37° C. A further washing of the plates is then performed as described above. In parallel, the peroxidase substrate is prepared according to the directions of the bioMérieux kits. 100 microlitres of substrate solution are placed in each well, and the plates are placed protected from light for 20 to 30 minutes at room temperature.
When the colour reaction has stabilized, 50 microlitres of Color 2 (bioMérieux trade name) are placed in each well in order to stop the reaction. The plates are placed immediately in an ELISA plate spectrophotometric reader, and the optical density (OD) of each well is read at a wavelength of 492 n.
The serological samples are introduced in duplicate or in triplicate, and the optical density (OD) corresponding to the serum tested is calculated by taking the mean of the OD values obtained for the same sample at the same dilution.
The net OD of each serum corresponds to the mean OD of the serum minus the mean OD of the negative control (solution B: PBS, 0.05% Tween 20®, 10% goat serum).
c) Detection of Anti-MSRV-1 IgG Antibodies (S24Q) by ELISA:
The technique described above was used with the S24Q peptide to test for the presence of anti-MSRV-1 specific IgG antibodies in the serum of 15 patients for whom a definite diagnosis of MS was established according to the criteria of Poser (23), and of 15 healthy controls (blood donors).
The mean of the net OD values for the controls, including the controls with high net OD values, is 0.129 and the standard deviation is 0.06. Without the 2 controls whose OD values are greater than 0.2, the mean of the “negative” controls is 0.107 and the standard deviation is 0.03. A theoretical threshold of positivity may be calculated according to the formula:
threshold value (mean of the net OD values of the negative controls)+(2 or 3×standard deviation of the net OD values of the negative controls).
In the first case, there are considered to be symptomless seropositives, and the threshold value is equal to 0.11+(3×0.03) =0.20. The negative results represent a non-specific “background” of the presence of antibodies directed specifically against an epitope of the peptide.
In the second case, if the set of controls consisting of blood donors in apparent good health is taken as a reference basis, without excluding the sera which are, on the face of it, seropositive, the standard deviation of the “non-MS controls” is 0.116. The threshold value then becomes 0.13+(3×0.06) =0.31.
According to this latter analysis, the test is specific for MS. In this respect, it is seen that the test is specific for MS, since, as shown in Table 1, no control has a net OD above this threshold in fact, this result reflects the fact that the antibody titres in patients suffering from MS are, for the most part, higher than in healthy controls who have been in contact with MSRV-1.
In accordance with the first method of calculation, and as shown in
Thus, approximately 40% of the MS patients tested have reacted against an epitope carried by the S24Q peptide and possess circulating IgGs directed against the latter.
Two out of 15 blood donors in apparent good health show a positive result. Thus, it is apparent that approximately 13% of the symptomless population may have been in contact with an epitope carried by the S24Q peptide under conditions which have led to an active immunization which manifests itself in the persistence of specific serum IgGs. These conditions are compatible with an immunization against the MSRV-1 retrovirus reverse transcriptase during an infection with (and/or reactivation of) the MSRV-1 retrovirus. The absence of apparent neurological pathology recalling MS in these seropositive controls may indicate that they are healthy carriers and have eliminated an infectious virus after immunizing themselves, or that they constitute an at-risk population of chronic carriers. In effect, epidemiological data showing that a pathogenic agent present in the environment of regions of high prevalence of MS may be the cause of this disease imply that a fraction of the population free from MS has necessarily been in contact with such a pathogenic agent. It has been shown that the MSRV-1 retrovirus constitutes all or part of this “pathogenic agent” at the source of MS, and it in hence normal for controls taken from a healthy population to possess IgG type antibodies against components of the MSRV-1 retrovirus.
Lastly, the detection of anti-S24Q antibodies in only one out of two MS cases tested here may reflect the fact that this peptide does not represent an immunodominant MSRV-1 epitope, that inter-individual strain variations may induce an immunization against a divergent peptide motif in the same region, or that the course of the disease and the treatments followed may modulate over time the antibody response against the S24Q peptide.
d) Detection of Anti-MSRV-1 IgM Antibodies by ELISA:
The ELISA technique with the S24Q peptide was used to test for the presence of anti-MSRV-1 IgM specific antibodies in the same sera as above.
The mean of the OD values for the MS cases tested is 1.6.
The mean of the net OD values for the controls is 0.7.
The standard deviation of the negative controls is 0.6.
The threshold of theoretical positivity may be calculated according to the formula:
threshold value−(mean of the OD values of the negative controls)+(3×standard deviation of the OD values of the negative controls).
The threshold value is hence equal to 0.7+(3×0.6)=2.5;
The negative results represent a non-specific “background” of the presence of antibodies directed specifically against an epitope of the peptide.
According to this analysis, and as shown in
The difference in seroprevalence between the MS and control populations is extremely significant: “chi-squared” test, p<0.002.
These results point to an aetiopathogenic role of MSRV-1 in MS.
Thus, the detection of IgM and IgG antibodies against the S24Q peptide makes it possible to evaluate, alone or in combination with other MSRV-1 peptides, the course of an MSRV-1 infection and/or of the viral reactivation of MSRV-1.
It is possible, as a result of the new discoveries made and the new methods developed by the inventors, to permit the improved implementation of diagnostic tests for MSRV-1 infection and/or reactivation and to evaluate a therapy in MS and/or RA on the basis of its efficacy in “negativing” the detection of these agents in the patient's biological fluids. Furthermore, early detection in individuals not yet displaying neurological signs of MS or rheumatological signs of RA could make it possible to institute a treatment which would be all the more effective with respect to the subsequent clinical course for the fact that it would precede the lesion stage which corresponds to the onset of the clinical disorders. Now, at the present time, a diagnosis of MS or RA cannot be established before a symptomatology of lesions has set in, and hence no treatment is instituted before the emergence of a clinical picture suggestive of lesions which are already significant. The diagnosis of an MSRV-1 and/or MSRV-2 infection and/or reactivation in man in hence of decisive importance, and the present invention provides the means of doing this.
It is thus possible, apart from carrying out a diagnosis of MSRV-1 infection and/or reactivation, to evaluate a therapy in MS on the basis of its efficacy in “negativing” the detection of these agents in the patients' biological fluids.
| Number | Date | Country | Kind |
|---|---|---|---|
| 95 09643 | Aug 1995 | FR | national |
This is a Division of application Ser. No. 10/430,442, filed May 7, 2003, which is a Division of application Ser. No. 09/374,766, filed Aug. 16, 1999, now U.S. Pat. No. 6,579,526, issued Jun. 17, 2003, which in turn is a Division of application Ser. No. 08/691,563, filed Aug. 2, 1996, now U.S. Pat. No. 6,001,987, issued Dec. 14, 1999. The entire disclosures of the prior applications are hereby incorporated by reference herein in their entirety.
| Number | Date | Country | |
|---|---|---|---|
| 20070117189 A1 | May 2007 | US |
| Number | Date | Country | |
|---|---|---|---|
| Parent | 10430442 | May 2003 | US |
| Child | 11463109 | US | |
| Parent | 09374766 | Aug 1999 | US |
| Child | 10430442 | US | |
| Parent | 08691563 | Aug 1996 | US |
| Child | 09374766 | US |
