Viral vaccines

Abstract
A mutant virus for use as a vaccine for prophylaxis or therapy, wherein the genome of the virus is defective in respect of a gene essential for the production of infectious virus. In one aspect the mutant virus, e.g. a herpesvirus, e.g HSV-1 or HSV-2, is capable of protecting a susceptible species immunised therewith against infection by the corresponding wild-type virus. In another aspect, the mutant virus acts as a vector for an immunogenic protein derived from a pathogen, encoded by foreign DNA incorporated in the mutant virus. The mutant virus can be produced by a recombinant host cell which expresses a gene complementing the defect. The mutant virus can be infectious for the host to be protected, and the genetic defect can allow expression in the infected host of at least some of the viral genes, which can provoke a cell-mediated immune response. The defect can be in a glycoprotein gene such as gH.
Description

The present invention relates to viral vaccines. In particular, it relates to genetically engineered mutant viruses for use as vaccines; to vaccines comprising the mutant viruses; recombinant cells; and to methods relating to the production of vaccines.


Viral vaccines are traditionally of two sorts. The first sort are ‘killed’ vaccines, which are virus preparations which have been killed by treatment with a suitable chemical such as beta-propiolactone. The second type are live ‘attenuated’ vaccines, which are viruses which have been rendered less pathogenic to the host, either by specific genetic manipulation of the virus genome, or, more usually, by passage in some type of tissue culture system. These two types of vaccine each have their own disadvantages.


Killed vaccines do not replicate in the host, and they must be administered by injection, and hence may generate an inappropriate kind of immune response. For example the Salk vaccine, a killed preparation of poliovirus, produces an immunoglobulin (Ig) G antibody response, but does not stimulate the production of IgA in the gut, the natural site of primary infection. Hence this vaccine, though it can protect the individual from the neurological complications of poliomyelitis, does not block primary infection, and so does not confer “herd immunity”.


In addition, killed viruses do not enter and replicate inside host cells. Hence any beneficial immunological response to non-structural proteins produced during replication is not available. They also cannot stimulate the production of cytotoxic T cells directed against virus antigens. “Dead” antigens can be picked up by antigen presenting cells and presented to T cells. However, the presentation occurs via MHC Class II molecules and leads to stimulation of T helper cells. In turn, the T helper cells help B cells to produce specific antibody against the antigen. In order to stimulate the production of cytotoxic T cells, virus antigens must be processed through a particular pathway inside the infected cell, and presented as broken-up peptide fragments on MHC Class I molecules. This degradation pathway is thought to work most effectively for proteins that are synthesised inside the infected cell, and hence the only virus that enters host cells and expresses immunogenic viral protein is capable of generating virus-specific cytotoxic T cells. Therefore, killed vaccines are poor inducers of cellular immunity (cytotoxic T cells) against virus infection. From this point of view, live attenuated vaccines are more satisfactory.


Live attenuated viruses have been made hitherto by deleting an inessential gene or partly damaging one or more essential genes (in which case, the damage is such that the genes are still functional, but do not operate so effectively). However, live attenuated viruses often retain residual pathogenicity which can have a deleterious effect on the host. In addition, unless the attenuation is caused by a specific deletion, there remains the possibility of reversion to a more virulent form. Nevertheless, the fact that some viral protein production occurs in the host means that they are often more effective than killed vaccines which cannot produce such viral protein.


Live attenuated viruses, as well as being used as vaccines in their own right, can also be used as “vaccine vectors” for other genes, in other words carriers of genes from a second virus (or other pathogen) against which protection is required. Typically, members of the pox virus family, e.g. vaccinia virus, are used as vaccine vectors. When a virus is used as a vaccine vector, it is important that it causes no pathogenic effects. In other words it may need to be attenuated in the same way that a simple virus vaccine is attenuated. The same disadvantages as those described above therefore apply in this case.


It has been found possible to delete a gene (especially, an essential gene) from a viral genome and (also) provide a so-called “complementing” cell which provides the virus with the product of the deleted gene. This has been achieved for certain viruses, for example adenoviruses, herpesviruses and retroviruses. For adenoviruses, a human cell line was transformed with fragments of adenovirus type 5 DNA (F L Graham, J Smiley, W C Russell and R Nairn, J Gen Virol, 36 (1977) 59-72). The cell line expressed certain viral genes, and it was found that it could support the growth of virus mutants which had those genes deleted or inactivated (T Harrison, F Graham and J Williams, Virology 77 (1977), 319-329). Although the virus grew well on this cell line (the “complementing cell line”) and produced standard viral particles, it could not grow at all on normal human cells. Cells expressing the T-antigen-encoding region of the SV40 virus genome (a papovavirus) have also been shown capable of supporting the replication of viruses specifically deleted in this region (Y Gluzman, Cell, 23 (1981), 182-195). For herpes simplex virus, cell lines expressing the gB glycoprotein (W Cai et al, J Virol 62 (1987), 714-721) the gD glycoprotein (M W Ligas and D C Johnson, J Virol 62 (1988) 1486-1494) and the Immediate Early protein ICP4 (N A Deluca et al, J Virol 56 (1985) 558-570) have been produced, and these have been shown capable of supporting the replication of viruses with specifically inactivated copies of the corresponding genes.


According to the present invention, there is provided a mutant virus for use as a vaccine, in which a viral gene encoding a protein which is essential for the production of infectious virus has been deleted or inactivated: and wherein said virus can be grown in a cell which has a heterologous nucleotide sequence which allows said cell to express the essential protein encoded by said deleted or inactivated viral gene. Such a mutant virus with a genome defective in respect of an essential gene can protect a susceptible species immunised therewith against infection by e.g. the corresponding wild-type virus. As discussed below, the mutant virus in such a vaccine can be infectious for cells of a susceptible species, e.g. a mammalian species, immunised therewith. Viral protein can thereby be expressed in the cells.


The present invention also provides a vaccine which comprises a virus as described above, together with one or more excipients and/or adjuvants. The viral genome may itself provide the immunogen. In certain embodiments it can contain genetic material such as a heterologous gene insert expressing an immunogenic protein, e.g. from a pathogen exogenous to the virus. In such a case exogenous immunogenic protein can be expressed in cells of a susceptible species immunised with the vaccine containing the mutant virus and infected by the mutant virus of the vaccine. Immunity against the pathogen can thereby be conferred in a species normally susceptible to the pathogen. The exogenous protein can be from e.g. an immunodeficiency virus, and can be an immunodeficiency virus glycoprotein.


The mutant virus of the vaccine can be one that is capable in an infected species of establishing a latent infection with periodic reactivation. The mutant virus can be such that the defect in the essential gene allows the mutant virus still to infect normal cells and replicate therein to give rise to the production and release from the cells of non-infectious viral particles, but not to give rise to infectious viral particles.


The present invention also provides a complementing cell transfected with an attenuated virus as described above, for use in the preparation of a vaccine.


The present invention also provides a method which comprises the use of a virus as described above in the preparation of a vaccine for the therapeutic or prophylactic treatment of a disease, and for prophylactic or therapeutic use in generating an immune response in a subject infected therewith.


The present invention also provides a method for the production of a vaccine which comprises: culturing a cell infected with a virus having a deleted or inactivated viral gene encoding a protein which is essential for the production of infectious virus, and wherein the host cell has a heterologous nucleotide sequence comprising said viral gene and which is able to express the essential protein encoded by said gene; harvesting the viral thus produced, and using it in a vaccine.


The mutant can be from a double-stranded DNA virus, e.g. a herpesvirus, e.g. a herpes simplex virus (HSV). The mutant can be a type-1 HSV or a type-2 HSV. The defect can be in for example the glycoprotein gH gene.


It can be seen that the invention provides a mutant non-retroviral virus whose genome is defective in respect of a gene essential for the production of infectious virus, such that the virus can infect normal cells and undergo replication and expression of viral antigen genes in those cells but cannot produce normal infectious virus.


The applicants have termed the mutant viruses described herein DISC viruses (standing for ‘defective infectious single cycle viruses’) and an outline of the concept is illustrated in FIG. 35 of the accompanying drawings. Such DISC viruses can provide the sort of immune response traditionally obtainable from live virus vaccines, but without the deleterious side effects that live attenuated viruses pose, such as residual pathogenicity and reversion to virulence.


The virus may be derived from herpes simplex virus (HSV) in which, for example, the gene encoding glycoprotein H (gH) has been inactivated or deleted. The mutant virus may also comprise a heterologous sequence encoding an immunogen derived from a pathogen. The host cell will suitably be a recombinant eukaryotic cell line containing the gene encoding HSV glycoprotein H. As another example the virus may be derived from an orthopox virus, for example, vaccinia virus, which again may comprise a heterologous sequence encoding an immunogen derived from a pathogen.


The general teaching hereof may be exemplified by (i) the creation of a cell line expressing the HSV-1 gH glycoprotein gene (a gH+ complementing cell line): (ii) the production of HSV-1 virus with an interrupted gH gene (an HSV-1 gH-virus) and carrying a heterologous gene (beta-galactosidase); (iii) the growth of the HSV-1 gH− virus in the gH+ complementing cell line. It is shown herein that in experiments investigating the ability of HSV-1 gH-virus and killed HSV-1 to protect against infection with wild-type HSV-1, the HSV-1 gH-virus provided good protection.


The present application provides in certain examples mutant type-2 HSV (HSV-2 virus) for use as a vaccine, whose genome is defective in respect of a gene essential for the production of infectious HSV-2 such that the virus can infect normal cells and replicate therein to give rise to the production and release from the cells of non-infectious viral particles. The defect can be such that the gH gene encoding the gH protein which is essential for the production of infectious virus has been deleted or inactivated; this mutant HSV-2 defect allows the production and release from the cells of non-infectious virus particles. Such mutant HSV-2 virus can be grown in a cell which has a heterologous nucleotide sequence which allows said cell to express the essential gH protein encoded by said deleted or inactivated gH gene. Such mutant type-2 HSV can infect normal cells and undergo replication and expression of viral antigens in those cells but cannot produce normal infectious virus. Such mutant virus can be used prophylactically or therapeutically in generating an immune response in a subject infected with HSV eg with HSV-2.


This invention shows a unique way of combining the efficacy and safety of a killed vaccine with the extra immunological response induced by the in-vivo production of viral protein by the attenuated vaccine. In preferred embodiments it comprises two features. Firstly, a selected gene is inactivated within the virus genome, usually by creating a specific deletion. This gene will be involved in the production of infectious virus, but preferably not preventing replication of the viral genome. Thus the infected cell can produce more viral protein from the replicated genetic material, and in some cases new virus particles may be produced, but these would not be infectious. This means that the viral infection cannot spread from the site of the inoculation.


A second feature of the invention is a cell which provides the virus with the product of the deleted gene, thus making it possible to grow the virus in tissue culture. Hence, although the virus lacks a gene encoding an essential protein, if it is grown in the appropriate host cell, it will multiply and produce complete virus particles which are to outward appearances indistinguishable from the original virus. This mutant virus preparation is inactive in the sense that it has a defective genome and cannot produce infectious virus in a normal host, and so may be administered safely in the quantity required to generate directly a humoral response in the host. Thus, the mutant virus need not be infectious for the cells of the host to be protected and merely operates in much the same way as a conventional killed or attenuated virus vaccine. However, preferably the immunising virus is itself still infectious, in the sense that it can bind to a cell, enter it, and initiate the viral replication cycle and is therefore capable of initiating an infection within a host cell of the species to be protected, and producing therein some virus antigen. There is thus the additional opportunity to stimulate the cellular arm of the host immune system.


The deleted or inactivated gene is preferably one involved as late as possible in the viral cycle, so as to provide as many viral proteins as possible in vivo for generating an immunogenic response. For example, the gene may be one involved in packaging or some other post-replicative event, such as the gH glycoprotein of HSV. However, the selected gene may be one involved in the viral genome replication, and the range of proteins expressed in vivo will depend upon the stage at which that gene is normally expressed. In the case of human cytomegalovirus (HCMV) the selected gene may be one (other than the Immediate Early gene) that effectively prevents viral genome replication in vivo, since the Immediate Early gene which is produced prior to viral genome replication (and indeed is essential for it) is highly immunogenic.


This invention can be applied to any virus where one or more essential gene(s) can be identified and deleted from or inactivated within the virus genome. For DNA viruses, such as Adeno, Herpes, Papova, Papilloma and Parvo viruses, this can be achieved directly by (i) the in vitro manipulation of cloned DNA copies of the selected essential gene to create specific DNA changes; and (ii) re-introduction of the altered version into the virus genome through standard procedures or recombination and marker rescue. The invention however, is also applicable to RNA viruses. Techniques are now available which allow complementary DNA copies of a RNA virus genome to be manipulated in vitro by standard genetic techniques, and then converted to RNA by in vitro transcription. The resulting RNAs may then be re-introduced into the virus genome. The technique has been used to create specific changes in the genome of both positive and negative stranded RNA viruses, e.g. poliovirus (V R Racaniello and D Baltimore, Science 214 (1981) 916-919) and influenza virus (W Luytjes et al, Cell 59 (1989) 1107-1113).


In theory, any gene encoding an essential protein should be a potential target for this approach to the creation of attenuated viruses. In practice however, the selection of the gene will be driven by a number of considerations.

  • 1. The gene should preferably be one which is required later in infection.


Thus replication of the attenuated virus is not interrupted in the early phase. This means that most and possibly all other virus antigens will be produced in the infected cell, and presented to the host immune system in conjunction with host cell MHC class 1 molecules. Such presentation leads to the development of cellular immunity against virus infection through the production of cytotoxic T cells. The cytotoxic T cells can recognise these antigens, and therefore kill virus infected cells. It is possible that the deleted gene could represent one which is not required at all for virus assembly, but is necessary for the assembled virus to be able to infect new cells. An example of such a protein is the HSV gH protein. In the absence of this protein, HSV virions are still produced, but they are non-infectious.

  • 2. Ideally, the product of the selected gene should not, on its own, be toxic to the eukaryotic cell, so that a complementing cell can be produced relatively easily. This however is not an absolute requirement, since the gene may be placed under the control of an inducible promoter in the complementing cell, such that its expression may be switched on only when required.


The nature of the mutation created in the target gene is also a matter of choice. Any change which produces a non-functional gene product is satisfactory, as long as the risk of reversion of a wild type structure is minimised. Such changes include interruption of the target with extraneous sequences and creation of specific deletions. The most satisfactory strategy for a vaccine to be used as a therapeutic and/or prophylactic however, would be one where a deletion is made that encompasses the entire sequence to be introduced into the complementing cell. The approach minimises the risk of regenerating wild type virus through recombination between the virus and cell DNA in the complementing cell.


Although there are several examples of combinations of specifically inactivated viruses and complementing cells, (see earlier discussion), to date, these have been used either for basic research on the virus, or, as in the case of retroviruses, to make a safer vector for producing transgenic animals. They have not been used for vaccine purposes, and to the applicants knowledge no suggestion of this kind of use has been proposed.


As well as using such an inactivated virus/complementing cell combination to produce safe vaccines against the wild-type virus, this invention also deals with the use of the same system to produce safe viral vectors for use as vaccines against foreign pathogens.


An example of such a vector is one based on HSV. The HSV genome is large enough to accommodate considerable additional genetic information and several examples of recombinant HSV viruses carrying and expressing foreign genetic material have been described (e.g. M W Ligas and D C Johnson, J Virol 62 (1988) 1486-1494, op. cit.). Thus a virus with a deletion in an essential virus gene as described above, and also carrying out and expressing a defined foreign gene, could be used as a safe vector for vaccination to generate an immune response against the foreign protein.


A particular characteristic of HSV is that it may become latent in neurones of infected individuals, and occasionally reactivate leading to a local lesion. Thus an HSV with a deletion in an essential virus gene and expressing a foreign gene could be used to produce deliberately latent infection of neurones in the treated individual. Reactivation of such a latent infection would not lead to the production of a lesion, since the virus vector would be unable to replicate fully, but would result in the onset of the initial part of the virus replication cycle. During this time expression of the foreign antigen could occur, leading to the generation of immune response. In a situation where the deleted HSV gene specified a protein which was not needed for virus assembly, but only for infectivity or assembled virions, such a foreign antigen might be incorporated into the assembled virus particles, leading to enhancement of its immunogenic effect. This expression of the foreign gene and incorporation of its protein in a viral particle could of course also occur at the stage where the mutant virus is first produced in its complementing host, in which case the mutant virus when used as a vaccine could present immediately the foreign protein to the species being treated.


In another example, vaccinia virus, a poxvirus, can carry and express genes from various pathogens, and it has been demonstrated that these form effective vaccines when used in animal experimental systems. The potential for use in humans is vast, but because of the known side effects associated with the widespread use of vaccinia as a vaccine against smallpox, there is reluctance to use an unmodified vaccinia virus on a large scale in humans. There have been attempts to attenuate vaccinia virus by deleting non-essential genes such as the vaccinia growth factor gene (R M L Buller, S Chakrabarti, J A Cooper, D R Twardzik and B Moss, J Virology 62 (1988), 866-874). However, such attenuated viruses can still replicate in vivo, albeit at a reduced level. No vaccinia virus with a deletion in an essential gene has yet been produced, but such a virus, deleted in an essential gene as described above, with its complementing cell for growth, would provide a safer version of this vaccine vector.


A further advantage of this general strategy for immunisation against heterologous proteins is that it may be possible to perform multiple effective vaccinations with the same virus vector in a way not possible with conventional live virus vectors. Since a standard live virus vaccine probably relies for its efficacy on its ability to replicate in the host animal through many cycles of infection, its usefulness will be severely curtailed in an individual with immunity against that virus. Thus a second challenge with the same virus, whether to provide a booster immunisation against the same protein, or a new response against a different protein, is likely to be ineffective. Using a virus vector with a deletion in an essential gene however, where multi-cycle replication is not desired or required, the events leading to effective immunisation will occur very soon after immunisation. The dose of the mutant virus can be relatively large (since it should be completely safe), and it is therefore unlikely that these early events will be blocked by the host immune response, which will require some time to be mobilised completely.


Although we have referred above to a mutant virus being defective in an essential gene, and optionally containing a gene for an immunogenic pathogen protein, the mutant could be defective in more than one essential gene, and/or contain more than one immunogenic pathogen protein gene. Thus, the mutant virus might include the gene for HIV gp 120, to act as a vaccine in the manner suggested above, and also the gene for the HSV gag protein to be expressed within the vaccinated host and presented at the surface of the host cell in conjunction with MHC-I to stimulate a T-cell response in the host.


The present invention also provides a pharmaceutical preparation which comprises a mutant non-retroviral virus whose genome is defective in respect of a gene essential for the production of infectious virus such that the virus can infect normal cells and undergo replication and expression of viral antigen genes in those cells but cannot produce normal infectious virus, for prophylactic or therapeutic use in generating an immune response in a subject infected therewith.


The mutant virus of the pharmaceutical preparation can be a mutant non-retroviral virus whose genome is defective in respect of a gene essential for the production of infectious virus such that the virus can infect normal cells and replicate therein to give rise to the production and release from the cells of non-infectious viral particles. The pharmaceutical can be a vaccine capable of protecting a patient immunised therewith against infection or the consequences of infection by a non-retroviral virus. The pharmaceutical can be a vaccine capable of protecting a patient immunised therewith against infection or the consequences of infection by the corresponding wild-type virus.


The pharmaceutical can be a therapeutic capable of treating a patient with an established non-retroviral virus infection, e.g. an infection established by the corresponding wild-type virus.


The pharmaceutical can be adminstrable sub-cutaneously, intra-muscularly, intra-dermally, epithelially-, (with or without scarification), nasally-, vaginally-, or orally- and can comprise excipient(s) suitable for the selected administration route.


The mutant virus contained in the pharmaceutical preparation can be capable of protecting a patient immunised therewith against infection or the consequences of infection with HSV eg infection by the corresponding wild-type virus.


The present invention also provides use of a mutant type-1 HSV whose genome is defective in respect of a gene essential for the production of HSV-1 such that the virus can infect normal cells and undergo replication and expression of viral antigen genes in those cells but cannot produce normal infectious virus, for preparation of a pharmaceutical for prophylactic or therapeutic use in generating an immune response in a subject against type-2 HSV infection.


The use may be in respect of pharmaceuticals for intra-epithelial (with or without scarification), intra-vaginal, intra-nasal or per-oral administration.


The present invention also provides an assembly comprising a pharmaceutical (for prophylaxis ie a vaccine or for therapy ie a therapeutic) as described above in a container preferably a pre-filled syringe or glass vial/ampoule with printed instructions on or accompanying the container concerning the administration of the pharmaceutical to a patient to prevent or treat conditions caused by infection with a non-retroviral virus, e.g. HSV infection by HSV-1 and/or HSV-2. The printed instructions may concern the prevention or treatment of facial or genital lesions.


Vaccines containing the mutants as described can be prepared in accordance with methods well known in the art wherein the mutant is combined in admixture with a suitable vehicle. Suitable vehicles include, for example, saline solutions, or other additives recognised in the art for use in compositions applied to prevent viral infections. Such vaccines will contain an effective amount of the mutant as hereby provided and a suitable amount of vehicle in order to prepare a vaccine useful for effective administration to the host.


Dosage rates can be determined according to known methods.


For example, dosage rate may be determined by measuring the optimum amount of antibodies directed against a mutant resulting from administration of varying amounts of the mutant in vaccine preparations. Attention is directed to ‘New Trends and Developments in Vaccines’, editors A Voller and H Friedman, University Park Press, Baltimore, 1978, for further background details on vaccine preparation.


Therapeutics comprising a mutant as herein provided can be formulated according to known methods to provide therapeutically useful compositions, whereby the mutant is combined in admixture with a pharmaceutically acceptable carrier vehicle. Suitable vehicles and their formulation are described in ‘Remington’s Pharmaceutical Sciences' (Mack Publishing Co, Easton, Pa., ed. A R Gennaro), by E W Martin, and by F Rola. Such compositions contain an effective amount of the mutant virus hereof together with a suitable amount of carrier vehicle in order to prepare therapeutically acceptable compositions suitable for effective administration to the host.


Typically vaccines are prepared as injectables, (traumatic or non-traumatic) either as liquid solutions or suspensions: solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared. Preparations may also be encapsulated in liposomes. The active immunogenic ingredients are often mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, trehalose, or the like and combinations thereof. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as other stabilisers and/or pH buffering agents, which enhance the stability and thus the effectiveness of the vaccine.


The vaccines may be administered parenterally, by injection, for example, subcutaneously, intraepithelially (with or without scarification). Additional formulations which are suitable for other modes of administration eg oral, vaginal and nasal formulations are also provided. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of trehalose mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. The compositions may take the form of solutions, suspensions, tablets, pills, capsules sustained release formulations or powders.


The vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically effective. The quantity to be administered will have been predetermined from preclinical and clinical (phase I) studies to provide the optimum immunological response.


The vaccine may be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1-3 separate doses, followed by other doses given at subsequent time intervals required to maintain and or re-enforce the immune response, for example, at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. The dosage regimen will also, have been determined from preclinical and clinical studies as maintaining the optimum immunological response over time.


The invention is further described herein by way of example only, and not by way of limitation, with reference to the following sections of detailed description, and to the accompanying Figures.


Sections of detailed description in the present application are:

    • A. Generation of a Cell line expressing the HSV type 1 gH gene.
    • B. Production of HSV type 1 virus with an interrupted gH gene.
    • C. Studies on the protective effect of gH-negative HSV compared to heat killed virus. The data given herein include in-vivo data which show that intra-epithelial vaccination of mice via the ear with a gH-negative mutant form of HSV-1 gave better protection against later challenge with wild-type HSV-1, than similar vaccination with killed HSV-1. A clear protective effect against the establishment of latent infection in the cervical ganglia was also shown for vaccination with the mutant HSV-1.
    • D. HSV lacking the gH gene as a vector for immunisation against a foreign antigen: introduction of a gp120 gene.
    • E. Preparation of a DISC HSV-2 mutant virus and complementing gH+ cell line.
    • F,G. Sections F and G of the detailed description show results indicated as follows:
    • (1) In a study using the mouse ear model the results reported in section C of the detailed description herein were confirmed. Intra-epithelial vaccination of mice with DISC HSV-1 led to complete protection against replication of the challenge virus wild type (w.t.) HSV-1. Little effective protection was provided by equivalent doses of inactivated HSV-1. DISC HSV-1 also protected against the establishment of latent infection in the cervical ganglia.
    • (2) Also in the mouse ear model it is shown that no significant differences in antibody titres were observed between animals vaccinated with DISC HSV-1 and an equivalent amount of inactivated HSV-1.
    • (3) Also in the mouse ear model it is shown that at low vaccination doses, inactivated HSV-1 failed to established a delayed-type hypersensitivity (DTH) response, whilst equivalent doses of DISC HSV-1 established a DTH response. At high doses, both DISC HSV-1 and inactivated HSV-1 induced similar DTH responses.
    • (4) Also in a mouse study it was shown that in contrast to vaccination with inactivated HSV-1, vaccination with DISC HSV-1 induced HSV-1 specific cytotoxic T cell activity.
    • (5) The in vivo mouse ear model was used to study long term prophylactic effect of DISC HSV-1. Two vaccinations of DISC HSV-1 was found to provide better long term protection against challenge with w.t. HSV-1 than two vaccinations of inactivated DISC HSV-1
    • (6) The in vivo mouse ear model was used to investigate the prophylactic effect of DISC HSV-2 against HSV-2 infection. Intra-epithelial vaccination of mice with DISC HSV-2 provided better protection against replication of the challenge virus w.t. HSV-2 than inactivated DISC HSV-2.
    • (7) The in vivo guinea-pig vaginal model was used to study the prophylactic effect of DISC HSV-1 against HSV-2 infection. It was shown that intra-epithelial or intra-vaginal vaccination with DISC HSV-1 provided a high degree of protection against the primary symptoms of HSV-2 infection. Immunisation with DISC HSV-1 or inactivated virus retarded growth of challenge virus w.t. HSV-2 in the vagina. Further intra-vaginal vaccination with DISC HSV-1 lessened the number of recurrent HSV-2 lesions in a 100 day follow-up period. Intra-epithelial vaccination with DISC HSV-1 and inactivated virus also resulted in reduced recurrent lesions, but compared to intra-vaginal vaccination with DISC HSV-1, the reduction was less.
    • (8) Oral and intranasal vaccination of guinea-pigs with DISC HSV-1 led to protection against acute disease symptoms following challenge with w.t. HSV-2. The intranasal route appeared to be more effective than the oral route.
    • (9) In guinea-pigs which had recovered fully from primary HSV-2 disease, the therapeutic administration of DISC HSV-1 either intra-vaginally or intra-epithelially resulted in an apparent reduction in the frequency of recurrent of disease symptoms compared with mock vaccinated animals. The per vaginum vaccination route in comparison to oral or intra-nasal vaccination resulted in significantly lower levels of recovered virus following challenge.
    • (10) In guinea-pigs which had recovered fully from primary HSV-2 disease, intra-vaginal therapeutic administration of DISC HSV-2 was more effective in reducing the frequency of recurrence of disease symptoms than treatment with DISC HSV-1.





Referring to the Figures herein:



FIG. 1 illustrates the production of plasmid pGH1.



FIG. 2 illustrates the production of plasmid pGH2.



FIG. 3
a shows the pair of complementary oligonucleotides (SEQ ID NO:1, SEQ ID NO:2) used to generate the plasmid pSP64Ta.



FIG. 3
b illustrates the production of plasmid pSP64TA.



FIG. 4
a shows the two oligonucleotides (SEQ ID NO:3, SEQ ID NO:4) used to generate the plasmid pCMVIEP.



FIG. 4
b illustrates the plasmid pCMVIEP.



FIG. 5 illustrates the plasmid pCMVlacZ.



FIG. 6 illustrates the plasmid pGH3.



FIG. 7 illustrates the strategy for construction of plasmid pGH-120.



FIG. 8 shows clearance of wild-type HSV-1 (w.t. HSV-1) strain SC16 virus in the ears of mice vaccinated with either live DISC HSV-1 or inactivated (β-propiolactone treated) w.t. HSV-1 (strain SC16). Groups of 4 mice were vaccinated at the doses indicated by scarification of the left ear pinna. Mice were challenged 14 days post-vaccination with 2×106 pfu w.t. HSV-1 strain SC16 in the right ear pinna and virus titres were measured 5 days post challenge. Data are expressed as the geometric means and standard errors of the means.



FIG. 9 shows measurement of titres of neutralising and ELISA antibody to w.t. HSV-1 in mice vaccinated with either w.t. HSV-1 (strain SC16), live DISC HSV-1, killed DISC HSV-1 or PBS. Sera from mice were assayed in the presence of complement for neutralising antibodies to w.t. HSV-1 in a plaque reduction assay. Individual titres are expressed as the reciprocal dilution of sera required to neutralise 50% of the infectivity obtained in the absence of antibody.



FIG. 10 shows delayed-type hypersensitivity (DTH) responses in mice vaccinated with either w.t. HSV-1 (strain SC16), live DISC HSV-1, killed DISC HSV-1 or PBS. Mice were vaccinated in the left ear pinna at the doses indicated 14 days prior to challenge with 106 pfu w.t. HSV-1 (strain SC16) in the opposite ear. Ear thickness was measured 24 and 48 hours post-challenge and is expressed as the difference between the challenged and vaccinated ear. Data are presented as the means of differences in ear thickness (in μm).



FIG. 11 shows cytotoxic T cell (CTL) responses in mice vaccinated with either live DISC HSV-1, killed DISC HSV-1, MDK (a thymidine kinase negative HSV-1 strain) or PBS. Mice were immunised twice intraperitoneally three weeks apart and cell suspensions made from spleens 10 days after the second injection. Cells were stimulated in vitro for 4 days before being tested in a CTL assay using 51Cr-labelled A20/2J as target cells. Data are presented as mean % 51Cr release from quadruplicate samples at each point. Standard errors of the means are all <10%.



FIG. 12 shows clinical symptoms as assessed by erythema score in guinea-pigs post challenge with 105.2 pfu w.t. HSV-2 (strain MS) subsequent to vaccination with doses of 2×107 pfu DISC HSV-1 at a 3 week interval either by the intra-epithelial or the intra-vaginal route;



FIG. 13 shows clinical symptoms as assessed by total lesion score in guinea-pigs post challenge with 105.2 pfu w.t. HSV-2 (strain MS) subsequent to vaccination with doses of 2×107 pfu DISC HSV-1 at a 3 week interval either by the intra-epithelial or the intra-vaginal route.



FIG. 14 shows post challenge virus w.t. HSV-2 (strain MS) replication in guinea-pigs post challenge with 105.2 pfu w.t. HSV-2 (strain MS) subsequent to vaccination with doses of 2×107 pfu DISC HSV-1 at a 3 week interval either by the intra-epithelial or the intra-vaginal route.



FIGS. 15
a and 15b show recurrent disease in guinea-pigs post challenge with 105.2 pfu w.t. HSV-2 (strain MS) subsequent to vaccination with doses of 2×107 pfu DISC HSV-1 at a 3 week interval by the intra-epithelial or the intra-vaginal route. FIG. 15a shows recurrent disease as the cumulative mean erythema index per animal. FIG. 15b shows recurrent disease as cumulative mean number of days with disease per animal.



FIG. 16 shows mean lesion score per animal (guinea-pigs) with w.t. HSV-2 (strain MS) infection and which have been vaccinated via the vaginal, oral or nasal routes with a mock virus preparation, DISC HSV-1 or inactivated DISC HSV-1.



FIG. 17 shows mean erythema score per animal (guinea-pigs) with w.t. HSV-2 (strain MS) infection and which have been vaccinated via the vaginal, oral or nasal routes with a mock virus preparation, DISC HSV-1 or inactivated DISC HSV-1.



FIG. 18 shows the mean log titre of w.t. HSV-2 (strain MS) per animal (guinea-pigs) with w.t. HSV-2 (strain MS) infection and which have been vaccinated via the vaginal, oral or nasal routes with a mock virus preparation, DISC HSV-1 or inactivated DISC HSV-1.



FIG. 19 shows recurrent disease following therapeutic vaccination. This is shown as mean cumulative number of days on which disease was observed (disease/days) in groups of guinea-pigs vaccinated with DISC HSV-1 either intra-epithelially or intra-vaginally or with a mock virus preparation intra-vaginally after challenge with w.t. HSV-2 (strain MS). Disease was classified as either presence of one or more lesions or an erythema score of 1 or more. Animals were monitored from 4 weeks after initial challenge with w.t. HSV-2 (strain MS) (day o) for 100 days. Animals were vaccinated at Day 0, Day 24 and Day 44 with 2×107 pfu or equivalent dose as indicated.



FIG. 20 relates to the long-term protective effect in mice of vaccination with DISC HSV-1 against challenge with w.t. HSV-1 (strain SC16). The graph shows the mean log titre of w.t. HSV-1 in the ears 5 days post challenge and 223 days post vaccination.



FIG. 21 relates to the long-term protective effect in mice of vaccination with DISC HSV-1 against challenge with w.t. HSV-1 (strain SC16). The graph shows neutralising antibody titres days 15, 27, 90, 152 and 218 post vaccination as stated.



FIG. 22 relates to the protective effect in mice of vaccination with DISC HSV-2 against challenge with w.t. HSV-2 (strain HG52) for vaccinations with live DISC HSV-2, killed DISC HSV-2 and w.t. HSV-2 (strain HG52) at varying doses, the graph shows mean log titre of w.t. HSV-2 in the ear post challenge.



FIG. 23 illustrates the construction of a single plasmid containing the complete HSV-2 gH gene.



FIG. 24 shows the sequence (SEQ ID NO:5) of HSV-2 strain 25766 in the region of the gH gene including a translation of the gH gene in single letter amino acid code (SEQ ID NO:6).



FIG. 25 shows a comparison of the DNA sequence of HSV-1 (SEQ ID NO:7) and HSV-2 strain 25766 (SEQ ID NO:6) in the region of the gH gene.



FIG. 26 shows a comparison of the deduced amino acid sequences of the HSV-1 strain 17 (SEQ ID NO:8) an HSV-2 strain 25766 (SEQ ID NO:6) gH proteins.



FIG. 27 shows graphically the level of similarity between the DNA sequences of HSV-1 and HSV-2 (SEQ ID NO:5) in the region of the gH gene (from UWGCG program Plotsimilarity).



FIG. 28 shows graphically the level of similarity between the amino acid sequences of the HSV-1 (SEQ ID NO:8) and HSV-2 (SEQ ID NO:6) gH proteins (from UWGCG program Plotsimilarity).



FIG. 29 shows the construction of pIMMB26; two fragments from the left and right sides of the HSV2 gH gene were amplified by PCR and cloned into pUC119. The four oligonucleotides MB57 (SEQ ID NO:9), MB58 (SEQ ID NO:10), B59 (SEQ ID NO:11), MB60 are shown.



FIG. 30 shows the construction of pIMMB45.



FIG. 31 shows construction of the first stage recombination vector pIMMB47+.



FIG. 32 shows construction of the second stage recombination vector pIMMB46.



FIG. 33 shows a restriction map analysis for recombinants HG52-D, TK minus DISC virus, TK plus DISC virus.



FIG. 34 shows Southern blots of BamHI digestions of various viruses, probed with the right-hand flanking sequence as shown in FIG. 33. Lane 5: HG52-D virus, lane 2: TK-minus “first stage” DISC virus and lanes 3, 4, 6, 7 and 8: TK-plus “second stage” DISC viruses.



FIG. 35 illustrates diagrammatically the DISC virus concept.





HERPES SIMPLEX VIRUS DELETED IN GLYCOPROTEIN H GENE (gH− HSV)

Herpes simplex virus (HSV) is a large DNA virus which causes a wide range of pathogenic symptoms in man, including recurrent facial and genital lesions, and a rare though often fatal encephalitis. Infection with this virus can be controlled to some extent by chemotherapy using the drug Acyclovir, but as yet there is no vaccine available to prevent primary infection. A difficulty with vaccination against HSV is that the virus generally spreads within the body by direct transfer from cell to cell. Thus humoral immunity is unlikely to be effective, since circulating antibody can only neutralise extracelluar virus. Of more importance for the control of virus infection, is cellular immunity, and so a vaccine which is capable of generating both humoral and cellular immunity, but which is also safe, would be a considerable advantage.


A suitable target gene for inactivation within the HSV genome is the glycoprotein H gene (gH). The gH protein is a glycoprotein which is present on the surface of the virus envelope. This protein is thought to be involved in the process of membrane fusion during entry of the virus into the infected cell. This is because temperature sensitive virus mutants with a lesion in this gene are not excreted from virus infected cells at the non-permissive temperature (P J Desai et al, J Gen Virol 69 (1988), 1147-1156). The protein is expressed late in infection, and so in its absence, a considerable amount of virus protein synthesis may still occur.


All procedures are carried out using standard procedures in the art, in particular genetic manipulation procedures are carried out according to methods described in “Molecular Cloning, A Laboratory Manual”, eds. Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory Press, 1989.


The present description refers to certain strains of HSV-1 and HSV-2. It is not necessary that the description contained herein is put into effect with precisely the mentioned strains. Strains of HSV-1 and HSV-2 having high sequence homology to one another by which the invention may be put into effect are readily available. For example, one source of HSV is the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852 USA. The following are available from ATCC under the indicated accession numbers.


















HSV-1 strain F
ATCC accession no. VR-733



HSV-1 strain MacIntyre
ATCC accession no. VR-539



HSV-1 strain MP
ATCC accession no. VR-735



HSV-2 strain G
ATCC accession no. VR-734



HSV-2 strain MS
ATCC accession no. VR-540











Section A. Generation of a Cell Line Expressing the HSV Type 1 gH Gene


The gH gene is present in the Unique Long region (UL) of the HSV type 1 genome, between nucleotides 46382 and 43868 (DJ McGeoch et al, J Gen Virol 69 (1988), 1531-1574). A cloned copy of this gene is available within the plasmid pAF2. This plasmid was produced by excising a BgIII-Xhol fragment, encompassing the complete gH coding sequence, from the plasmid pTZgH, and cloning it into the BgIII site of plasmid pSP64T as described (U A Gompels and A C Minson. J Virol, 63 (1989), 4744-4755). A HindIII fragment containing the promoter sequence for the glycoprotein D (gD) gene (extending from nucleotides −392 to +11, with respect to the start of the gD gene) is then excised from the plasmid pSVD4 (R D Everett, Nucl Acids Res, 11 (1983), 6647-6666), and cloned into the unique HindIII site of pAF2 to generate pGH1 (FIG. 1) such that the promoter sequence is in the correct orientation to drive expression of the gH gene. Thus this plasmid contains the complete gH coding sequence under the control of the HSV type 1 gD gene promoter. This plasmid is then purified and then co-transfected into Vero cells with the plasmid pNE0 (from Pharmacia LKB Biotechnology Inc.) using the standard calcium phosphate co-precipitation technique (F L Graham and A J Van der Eb, Virology 52 (1973), 456-467).


Vero cells which have acquired resistance to neomycin are then selected by passage of the cells in the drug G418, and colonies of these cells cloned by limiting dilution. These neomycin resistant cells are then amplified in tissue culture, and samples are then infected with HSV type 2 virus. Infection with the HSV type 2 virus has the effect of inducing transcription from the type 1 gD promoter present in the complementing cell genome, and so of stimulating production of the type 1 gH protein in the complementing cell. Lysates of the infected cells are then screened for expression of the gH protein by western blotting, using a polyclonal antiserum known to recognise specifically the type 1 gH protein (P J Desai et al, J gen Virol 69 (1988) 1147-1156, op. cit.). Cells which express the required protein are then retained and frozen stocks prepared. This material represents the gH+ complementing cell line.


Section B. Production of HSV Type 1 Virus with an Interrupted gH Gene


A 6432 base pair BgIII fragment containing the coding sequence of gH together with HSV flanking sequences is excised from the plasmid pUG102 (U A Gompels and A C Minson, Virology 153 (1986), 230-247) and cloned into the plasmid pAT153 (A J Twigg and D Sherrat, Nature, 283 (1980), 216-218) to generate pGH2 (FIG. 2). This plasmid is digested with PvuII which cuts only within the gH coding sequence at two positions (nucleotides 44955 and 46065 according to the numbering scheme of D J McGeoch et al, 1988, op cit.), and the larger of the two fragments purified. A fragment of DNA consisting of the complete B-galactosidase gene from E coli downstream of the Immediate Early gene promoter from Cytomegalovirus (CMV) is then prepared by the following procedure. First of all a pair of complementary oligonucleotides (SEQ ID NO:1, SEQ ID NO:2) (shown in FIG. 3a) are annealed and ligated with BgIII-digested, phosphatase-treated pSP64T (P A Krieg and D A Melton, Nucl Acids Res 12 (1984), 7057-7070) to generate the plasmid pSP64Ta as shown in FIG. 3b. The added linker also includes the initiation codon and first three codons of the B-galactosidase gene (lacZ) of E. coli. Next the “core region” of the Immediate Early gene promoter of CMV is amplified from plasmid pUG-H1 (U A Gompels and A C Minson, 1989, op. cit.) by the Polymerase Chain Reaction technique (PCR—Molecular Cloning, ed. Sambrook et al., op cit.) using the two oligonucleotides (SEQ ID NO:3, SEQ ID NO:4) shown in FIG. 4a, which correspond to sequences from −302 to −288 (SEQ ID NO:3) from −13 to −36 (SEQ ID NO:4) respectively (numbered in relation to the start of the CMV Immediate Early gene as described by A Akrigg et al, Virus Research, 2 (1985), 107-121). These oligonucleotides (SEQ ID NO:3, SEQ ID NO:4) also contain, at their 5′ ends, sites for the restriction enzyme HindIII, and in the case of the oligonucleotide annealing upstream of the promoter (SEQ ID NO:3), an additional SmaI site. The PCR-amplified product DNA is then digested with HindIII, and cloned into HindIII-digested pSP64Ta, to generate the plasmid pCMVIEP (FIG. 4b). Finally, a DNA fragment containing a complete copy of the E. coli B-galactosidase gene, lacking only the extreme 5′ end of the coding sequence, is isolated by digestion of the plasmid pSC8 (S Chakrabarti et al, Mol Cell Biol, 5 (1985), 3403-3409) with BamHI, and cloned into the unique BgIII site of pCMVIEP to generate pCMVlacZ (FIG. 5). A fragment of DNA containing the B-galactosidase gene under the control of the CMV IE promoter is then isolated by digestion of pCMVlacZ with SmaI, and ligated with the purified PvuII fragment of pGH2 described above, to generate pGH3, which consists of a copy of the gH gene interrupted by a functional B-galactosidase gene (FIG. 6).


The next step is to replace the wild type gH gene in the HSV genome with this interrupted version, and this is done by allowing recombination between HSV DNA and plasmid pGH3, followed by selection of those viruses which have acquired a functional B-galactosidase gene. Plasmid pGH3 DNA is therefore cotransfected into cells expressing the gH gene (the gH+ complementing cell line described in section A) along with purified HSV DNA isolated from purified HSV virions (R A Killington and K L Powell, in “Growth, Assay and Purification of Heprpesviruses”, ch. 10 in “Techniques in Virology: A practical Approach” (ed. B W J Mahy) pp 207-236, IRL Press, Oxford, 1985) by the standard calcium phosphate precipitation technique (F L Graham and A J Van der Eb, 1973, op. cit.).


The progeny HSV virus produced from this transfection experiment is then plated on monolayers of gH+ complementing cells by standard plaque assay, using an agar overlay, in the presence of 5-bromo-chloro-3-indolyl-β-D-galactoside (X-gal), a chromogenic substrate which is converted to a blue substance by the enzyme β-galactosidase. Thus plaques resulting from infection by virus genomes containing and expressing the β-galactosidase gene will appear blue. These virus genomes should therefore carry an interrupted version of the gH gene. Virus is recovered from these plaques by picking plugs of agar from the appropriate part of the plate, and virus stocks prepared through growth of virus in the gH+ complementing cell line. These viruses, since they bear non-functional versions of the gH gene, should be unable to form plaques on cells which do not contain and express an endogenous functional copy of the gH gene, and so to confirm this, a sample of the virus is assayed for its ability to form plaques on wild type Vero cell monolayers in comparison with the gH-complementing cells.


Finally, virus DNA is prepared from these stocks, and checked for the expected DNA structure around the gH gene by Southern blotting. After confirmation of the correct genetic structure, a large stock of the gH gene-deficient virus is then prepared by inoculation of a sample of the virus into a large-scale culture of the gH+ complementing cell line (multiplicity of infection=0.01), and three days later, the infected cells are harvested. The infected cells are disrupted by sonication in order to release the cell-associated virus, and the total sonicated mixture stored at −70° as the virus master stock. The titre of the virus as the stock is then established by plaque assay on the gH+ complementing cell line. Samples of this virus stock are then used to prepare working stocks as before, and these working stocks are then used to infect laboratory animals as described below.


Publications relevant to these mutant viruses are A Forrester et al, J Virol, 66 (1992), pp 341-348, and H E Farrell et al, J Virol 68 (1994), pp 927-932.


Section C. Studies on the Protective Effect of gH-Negative HSV Compared to Heat Killed Virus


In order to assess the host immunological response to this virus, challenge experiments were conducted in mice according to the experimental plan described below.


The protective effect of a live gH virus preparation was compared with an inactivated preparation of wild type (WT) virus (strain SC16) as follows.


Preparation of Inactivated Wild Type Virus for Vaccination:


HSV type 1 (strain SC16) was grown by low multiplicity infection (0.01 pfu/cell) of Vero cells. After three days, the virus was harvested, and cytoplasmic virus recovered by Dounce homogenisation. Nuclei were removed by centrifugation at 500×g for 15 min, and the virus was recovered from the supernatant by centrifugation on to a 40% sucrose cushion at 12K for 60 min Beckman Sw27 rotor. The banded virus was diluted, pelleted and purified by sucrose gradient centrifugation (Killington and Powell, 1985, op. cit.). The virus band was harvested from the gradient, and the virus recovered by centrifugation. Virus was resuspended in phosphate-buffered saline (PBS), assayed for infectivity by plaque titration on baby hamster kidney (BHK) cells, and the particle count determined by electron microscopy. The particle:infectivity ratio of the preparation was 110 particles/pfu. The virus was diluted to 2.5×1010 pfu/ml in PBS, and inactivated by treatment with β-propiolactone for 60 min at 20° C. Aliquots were then stored at −70° C.


Preparation of Live gHVirus for Vaccination:


This material was prepared as described for the wild type virus, except that the virus was grown in the gH+ complementing cell line containing and expressing the HSV type 1 gH gene, and it was not inactivated by treatment with β-propiolactone. The particle:infectivity ratio of this preparation was 150:1. The concentration of this preparation was adjusted to 2.5×1010 pfu/ml and aliquots were stored in PBS at −70° C.


Vaccination Protocol:


4 week-old female balb/C mice (purchased from Tucks U.K. Ltd) were vaccinated with various doses of inactivated WT virus or live gH− virus in 2 μl volumes of phosphate-buffered saline by droplet application and needle scarification of the right ear as follows:















Group A
Control - no virus


Group B
5 × 104 pfu virus vaccine


Group C
5 × 105 pfu virus vaccine


Group D
5 × 106 pfu virus vaccine


Group E
5 × 107 pfu virus vaccine









After 14 days, all mice were challenged by similar inoculation of the left ear with 2×106 pfu HSV-1 strain SC16 (wild type virus). Mice were killed after 5 days and assayed for virus infectivity in the left ear and left cervical ganglia cII, cIII and cIV (combined). For latency studies, other vaccinated and challenged animals were killed after 1 month, and tested for latent infection by dissecting out the cII, cIII and cIV ganglia. These were incubated in medium for five days then homogenised and assayed for the presence of infectious virus by standard plaque assay. All the following results are expressed as pfu/organ.









TABLE C-1







Titre of challenge virus present during the acute phase of


infection after vaccination with live gH- virus


Virus titre - log10pfu (WT SC16)


















cervical





Mouse no.
Ears
mean
ganglia*
mean


















Group A
1
4.2
4.3
3.3
3.4




2
4.2

3.4




3
4.6

3.4




4
4.3

3.4



Group B
1
3.4
0.85
1.5
1.8




2
none

2.4




3
none

2.0




4
none

1.5



Group C
1
none

none





2
none

none




3
none

none




4
none

none



Group D
1
none

none





2
none

none




3
none

none




4
none

none



Group E
1
none

none





2
none

none




3
none

none




4
none

none







*Pooled cervical ganglia cII, cIII and cIV













TABLE C-2







Titre of challenge virus present during the acute phase of


infection after vaccination with inactivated WT HSV-1


Virus titre - log10pfu (WT SC16)


















cervical





Mouse no.
Ears
mean
ganglia*
mean







Group A
1
5.7
5.2
2.6
2.3




2
4.4

2.3




3
5.7

2.1



Group B
1
4.2
3.8
1.9
1.2




2
3.6

3.1




3
3.5

none




4
3.8

none



Group C
1
none
2.0
none





2
2.5

none




3
2.9

none




4
2.7

none



Group D
1
3.9
2.6
none





2
2.0

none




3
2.0

none




4
2.3

none



Group E
1
none

none





2
none

none




3
none

none




4
none

none







*Pooled cervical ganglia cII, cIII and cIV













TABLE C-3







Titre of challenge virus present as latent virus in the cervical


ganglia after vaccination with live gH-HSV-1














Virus titre in






cervical






ganglia*
Reactivation




Mouse No.
(log10pfu WT)
frequency







Group A
1
5.4
5/5




2
4.6




3
5.0




4
4.8




5
5.3



Group B
1
none
3/4




2
1.5




3
5.1




4
5.3



Group C
1
none
1/3




2
none




3
3.2



Group D
1
none
0/4




2
none




3
none




4
none



Group E
1
none
0/4




2
none




3
none




4
none







*Pooled cervical ganglia cII, cIII and cIV













TABLE C-4







Titre of latent challenge virus in the cervical ganglia after


vaccination with inactivated WT HSV-1














Virus titre in






cervical






ganglia*
Reactivation




Mouse No.
(log10pfu WT)
frequency







Group A
1
none
3/4




2
5.0




3
5.0




4
5.2



Group B
1
3.5
3/4




2
4.0




3
5.5




4
none



Group C
1
3.6
2/4




2
5.1




3
none




4
none



Group D
1
none
1/4




2
4.8




3
none




4
none



Group E
1
none
0/4




2
none




3
none




4
none







*Pooled cervical ganglia cII, cIII and cIV



(p.f.u. = plaque forming units; gH- is a virus with a defective gH gene).






These results show the titre of the challenge virus wt SC16 present in the ears and cervical ganglia during the acute phase of infection. Thus, a low titre indicates good effectiveness of the vaccination regimen with gH− virus whereas a higher titre, indicates poorer effectiveness. It is clear from the results that vaccination with live gH− HSV virus is very much more effective than an equivalent amount of inactivated WT virus. With the inactivated preparation, a dose of 5×107 pfu was required to prevent challenge virus replication in the ear, whereas with the live gH− virus; 100-1000 fold less virus was required. Live gH− virus vaccination with 5×105 pfu and over, was also able to block replication of the challenge virus in the cervical ganglia during the acute phase of infection, and furthermore showed a clear protective effect against the establishment of latent infection in the cervical ganglia.


Section D. HSV Lacking the gH Gene as a Vector for Immunisation Against a Foreign Antigen: Introduction of the gp120 Gene of SIVmac Strain 142 into the Genome of gH− HSV Virus


Viruses with deletions in essential genes may, as described above, be used as safe vectors for the delivery of foreign antigens to the immune system, and the gH− HSV virus described above provides a suitable example of a such a vector. This virus could be used to express any desired foreign antigen, but a particularly attractive possibility would be the major antigenic proteins of the AIDS virus human immunodeficiency virus (HIV). Thus these sequences would be inserted into the gH− HSV genome in a way that would ensure their expression during infection of normal cells (i.e. non-complementing cells) by the recombinant virus. Infection of an individual with such a virus could lead to a latent infection which, from time to time upon reactivation, would lead to a burst of production of the foreign antigen, resulting in stimulation of the immune response to that protein.


Since studies to test this approach directly in humans are not feasible at present, as an initial stage, the approach may be tested in monkeys using the Simian AIDS virus SIVmac (Simian immunodeficiency virus isolated from macaques). A suitable SIV gene for this purpose is that encoding the gp120 protein, one of the major antigenic targets for this virus. This gene is therefore introduced into the gH− HSV genome, and the efficacy of this virus as a vaccine to protect monkeys against challenge with SIV assessed.


The SIV gp120 gene is first of all cloned next to the cytomegalovirus IE core promoter (U A Gompels and A C Minson, 1989, op. cit.), and subsequently a DNA cassette consisting of the gp120 gene and the upstream CMV promoter is cloned into plasmid pGH2 (FIG. 2). The resulting plasmid is then co-transfected into the gH+ complementing cell line along with DNA purified from the gH− HSV, and recombinant virus which has acquired the gp120 gene in place of the β-galactosidase gene present in the gH− HSV virus is isolated by screening for interruption of the β-galactosidase gene.


D-A. Construction of Plasmid for Recombinant of the SIV gp120 Coding Sequence into the HSV Genome


The overall scheme for this procedure is shown in FIG. 7. A SacI restriction enzyme fragment (corresponding to bases 5240-8721) is excised from a cloned DNA copy of the SIV genome (L Chakrabarti et al, Nature 328 (1987), 543-547), and cloned into the SacI site of plasmid pUC118 (J Vieira and J Messing, in Methods in Enzymology, 153 (1987), 3-11) in order to generate plasmid pSIV1 which may be converted to single stranded DNA for manipulation by site directed metagenesis. This DNA region, which includes the SIV env gene (lying between 6090-8298) is then altered by site directed mutagenesis (I Brierley et al, Cell, 57 (1989), 537-547) to introduce a restriction enzyme site for the enzyme EcoRV at positions 6053-6058 using the synthetic oligonucleotide (SEQ ID NO:13)

    • 5′GAAGAAGGCTATAGCTAATACAT.


A second EcoRV site is then introduced at position 7671-7676 within the SIV env gene corresponding to the cleavage site between the gp120 and gp40 domains of the env gene sequence, using the synthetic oligonucleotide (SEQ ID NO:14)

    • 5′CAAGAAATAAACTATAGGTCTTTGTGC


      to generate the plasmid pSIV2. A DNA fragment (1617 base pairs) corresponding to the gp120 portion of the SIV env gene is then prepared by digestion of SIV2 with EcoRV.


The core region of the CMV immediate early gene promoter is obtained from the plasmid pUG-H1 (U A Gompels and A C Minson, 1989, op. cit.) by the PCR technique using the following two synthetic oligonucleotides (SEQ ID NO:15, SEQ ID NO:16).


upstream primer






    • 5′ ATC GAATTCCTATAG CCTGGCATTATGCCCAGTACATG
      • EcoRI EcoRV


        downstream primer

    • 5′TCAAAGCTT CTATAG CCCGGGGAGCTCTGATTATATAGACCTCCC
      • HindIII EcoRV SmaI





The product of this reaction is then cleaved with the enzymes EcoRi and HindIII to generate a DNA fragment which is then cloned into EcoRI- and HindIII-digested plasmid pUC118 to generate the plasmid pCMVIE2 which has a unique SmaI site located just downstream of the CMV promoter sequence. The EcoRV fragment containing the SIVmac gp120 coding sequence prepared as described above, is then cloned into this SmaI site, and plasmid pSIV3, with the SIV coding region oriented correctly to allow expression of the coding sequence from the promoter, is then selected. This plasmid is then digested with EcoRV to yield a blunt-ended DNA fragment consisting of the SIV sequence together with the CMV promoter, which is then cloned into PvuII-digested pGH2 (FIG. 2) to produce pGH-120).


D-B. Construction of the SIV gp120 Carrying Recombinant gH− HSV


DNA is purified from the gH− HSV virus constructed as detailed in the previous section, and co-transfected into gH+ complementing cells along with purified pGH-120 DNA. Progeny virus isolated from this transfection procedure is then plated on monolayers of the gH+ complementing cell line by standard plaque assay as before using an agar overlay in the presence of X-gal. The parental gH− virus carries a functional β-galactosidase gene, located within the residual gH coding sequences, and in the presence of X-gal, will form blue plaques. Recombinant viruses however, which have acquired the SIV gp120 coding sequence in place of the β-galactosidase gene, will produce white plaques. Virus is recovered from these white plaques by picking plugs of agar, and virus stocks prepared through growth of the virus in the gH+ complementing cell line. Virus DNA is prepared from these stocks, and checked for the presence of the correct DNA structure around the gH gene by Southern Blotting using appropriate probes derived from the SIV coding sequence. Finally stocks of the virus are prepared as before for vaccination studies in animals.


Vaccines comprising the attenuated virus can be prepared and used according to standard techniques known in the art. For example, the vaccine may also comprise one or more excipients and/or adjuvants. The effective dose of the attenuated virus to be provided by the vaccine may be determined according to techniques well known in the art.


Section E. Construction of a gH Defective Recombinant Type 2 Herpes Simplex Virus (DISC HSV-2)


E-A. The HSV2 gH Gene


(a) The Herpes Simplex type 2 (HSV2) gH gene is contained within two BamH1 restriction fragments of the 25766 strain of HSV2. pTW49 is the BamH1 R fragment of HSV2 strain 25766 cloned into pBR322. pTW54 is the BamH1 S Fragment of HSV2 strain 25766 cloned into pBR322. The construction of a single plasmid containing the complete gH gene is shown in FIG. 23. pTW49 was digested with BamH1 and Sall, and an 870 base pair (bp) fragment isolated from an agarose gel. Similarly pTW54 was digested with BamH1 and Kpn1 and a 2620 bp fragment isolated from an agarose gel. The two fragments were ligated together with the plasmid pUC119 cut with Sall and Kpn1, resulting in the plasmid pIMMB24.


(b) pIMMB24 was digested with Sall and Kpn1. In addition the plasmid was digested with Dra1 (which cuts in the vector sequences), to aid in isolation of the 3490 bp insert. The 3490 bp insert containing the HSV2 sequences was purified from an agarose gel. It was then sonicated, the ends repaired using T4 DNA polymerase and Klenow, and size fractionated on an agarose gel. A fraction containing DNA molecules of approximately 300-600 bp in length was ligated into M13mp11 cut with Smal (Amersham International UK). The ligated mixture was transformed into E. coli strain TG1, and individual plaques were picked. Single-stranded DNA was made from each plaque picked, and was sequenced using the dideoxy method of sequencing, either with Klenow enzyme or with Sequenase, and using 35S dATP.


In addition to sequencing in M13 using an oligonucleotide priming from within the M13 sequences, sequence data was also obtained by sequencing directly from the pIMMB24 plasmid using oligonucleotide primers designed from sequence already obtained. In order to obtain sequence from regions flanking the gH gene, some sequence information was also obtained from the plasmid pTW49.


Because of the high G+C ratio of HSV2 DNA, there were several sequence interpretation problems due to ‘compressions’ on the gels. These have yet to be resolved. In a small number of places therefore, the present sequence represents the best guess as to what the correct sequence is, based on comparisons with the previously published HSV1 sequence.


(c) The sequence of HSV2 strain 25766 (SEQ ID NO:5) in the region of the gH gene is shown in FIG. 24, along with a translation of the gH in single letter amino acid code (SEQ ID NO:6). FIG. 25 shows a comparison of the DNA sequence of HSV1 (SEQ ID NO:7) and HSV2 (SEQ ID NO:5) in this region. FIG. 26 shows a comparison of the deduced amino acid sequences of the HSV1 (SEQ ID NO:8) and HSV2 (SEQ ID NO:6) gH proteins. At the DNA level the overall identity is 77%. At the protein level the overall identity is also 77%, with a further 9.7% of amino acids being similar in properties. The degree of sequence similarity varies to some extent along the length of the gene, as can be seen from FIG. 27, which shows graphically the level of similarity. Even more marked than the variation along the gH gene is the difference in levels of identity between HSV1 and HSV2 at the DNA level between the coding and non-coding regions. As can be seen from FIG. 25, the nucleotide sequence identity is higher within the coding sequence of the gH gene than it is in the intergenic regions. FIG. 27 shows this in a graphical form, with the positions of the TK, gH and UL21 genes marked.


(d) The availability of nucleotide sequence data from around the HSV-2 gH gene enables further constructs to be made eg it allows the design of recombination vectors which enables precise deletion of the gene from the viral genome. Because of the differences between HSV1 and HSV2, particularly between the genes, may not have been possible from knowledge of the HSV1 sequence alone.


Oligonucleotides MB57 (SEQ ID NO:9), MB58 (SEQ ID NO:10), MB59 (SEQ ID NO:11), and MB75 (SEQ ID NO:17) were designed to isolate and clone the regions of sequence flanking the HSV2 gH gene. As shown in FIG. 29, the oligonucleotides were used in a polymerase chain reaction (PCR) to amplify fragments of DNA from either side of the gene. Restriction sites were included in the oligonucleotides so that the resultant fragments contained these sites at their ends, enabled cloning of the fragments into a suitably cut plasmid. The following oligonucleotides, based on the HSV2 sequence, were used for this purpose:

    • Hpal


      Inside right MB57 (SEQ ID NO:9) TCAGTTAACGCCTCTGTTCCTTTCCCTTC
    • EcoR1


      Outside right MB58 (SEQ ID NO:10) TCAGAATTCGAGCAGCTCCTCATGTTCGAC
    • Hpal


      Inside left MB75 (SEQ ID NO:17) TCAGTTAACCGTCGTCCCGGCTGCCAGTC
    • Hind111


      Outside left MB59 (SEQ ID NO:11) TCAAAGCTTCTGCAGCGCGGCGGGAGGTGG


The position of these oligonucleotides is also shown on FIG. 25.


On the basis of the description given above in relation to HSV-1 and common general knowledge, such a plasmid allows the skilled person to produce a defective HSV-2 virus lacking precisely the sequences for the gH gene (see below). If these same sequences are cloned into a suitable cell carrying a copy of the gH gene deleted from the HSV-2 genome, this ‘complementing cell’ can then support the growth of the defective HSV-2 virus by providing the gH protein. Because the sequences have been chosen so that there is no overlap between the sequences in the cell and the sequences in the virus, the possibility of the virus acquiring the gene from the cell by recombination is virtually eliminated.


E-B. Complementing Cell Lines


It was found that cells expressing the HSV-1 gH gene (F6 cells, see also A Forrester et al, Journal of Virology, 66 (1992), pp 341-348) can support the growth of an HSV-2 virus lacking the gH gene. However two new cell lines were made. CR1 cells use the same promoter and gH gene as F6 cells, but the sequences downstream of the gene are truncated so that there is no overlap of sequences between the final DISC virus and the cell line. This is very useful since it means that homologous recombination cannot occur between the DISC virus and the cell line DNA. In the case of F6 cells and the gH-deleted virus in the Forrester paper, where there is overlap, wild-type gH-plus viruses occur by recombination at about 1 in 106 viruses. Another cell line, CR2, was also made, which expresses the gH gene from the HSV-2 strain 25766. This also supports the growth of a DISC HSV-2 and also has no overlapping sequences between the virus and the cell.


Polymerase Chain Reaction (PCR) of Flanking Sequences


Viral DNA is purified from virus by standard methods. Flanking sequences to either side of the gH gene are amplified by PCR using Vent DNA polymerase (from New England Biolabs) which has a lower error rate than Taq DNA polymerase (see FIG. 30). The oligonucleotides used for PCR include restriction site recognition sequences, as well as the specific viral sequences (see below). Two vectors are made, one for the first stage and one for the second stage of recombination. For both vectors the right hand flanking sequences start at the same position to the right of the gH gene. The first stage vector has left hand flanking sequences that, in addition to deleting the HSV-2 gH gene, also delete the 3′ portion of the viral TK gene. The second stage vector has left hand flanking sequences which restore the complete TK gene, and extend right up to the 5′ end of the gH gene, as desired in the final virus.


The oligonucleotides used are as follows:

    • HindIII


      MB97 (SEQ ID NO:18) TCGAAGCTTCAGGGAGTGGCGCAGC
    • Hpal


      MB96 (SEQ ID NO:19) TCAGTTAACGGACAGCATGGCCAGGTCAAG
    • Hpal


      MB57 (SEQ ID NO:9) TCAGTTAACGCCTCTGTTCCTTTCCCTTC
    • EcoRI


      MB58 (SEQ ID NO:10) TCAGAATTCGAGCAGCTCCTCATGTTCGAC


      Construction of Vectors


The first stage recombination vector, pIMMB47+:


The two PCR fragments made by oligos MB97 (SEQ ID NO:18)-MB96 (SEQ ID NO:19) and by oligos MB57 (SEQ ID NO:9)-MB58 (SEQ ID NO:10) are digested with the restriction enzymes appropriate to the sites that have been included in the PCR oligonucleotides. The MB97-MB96 fragment is digested with HindIII and Hpal. The MB57-MB58 fragment is digested with Hpal and EcoRI. These fragments are then ligated into the vector pUC119 which has been digested with HindIII and EcoRI. The resultant plasmid is called pIMMB45 (see FIG. 30).


To allow for easy detection of the first stage recombinants, the E. coli beta-galactosidase gene, under the control of the Cytomegalovirus (CMV) immediate early promoter is inserted into pIMMB45. The CMV promoter plus beta-galactosidase gene is excised from a suitable plasmid carrying the promoter and gene using one or more appropriate restriction enzymes. If necessary, the ends are filled in using the Klenow fragment of DNA polymerase. This is the approach taken by the present applicants. However alternative methodologies will be apparent to those skilled in the art. For example, the beta-galactosidase gene may be under the control of the SV40 promoter, in which case, the gene and promoter can be excised from the plasmid pCH110 (Pharmacia PL Biochemicals) using BamHI and TthlllI, and the ends are filled in using the Klenow fragment of DNA polymerase (MS Ecob-Prince et al, J Gen Virol, 74 (1993), pp 985-994). The fragment is gel-purified. The plasmid pIMMB45 is digested with Hpal, phosphatased with Calf Intestinal Alkaline Phosphatase (CIAP) to abolish self ligation, and gel-purified. The gel-purified fragments are then ligated together to produce the plasmid pIMMB47+ (see FIG. 31).


The second stage recombination vector, pIMMB46:


The two PCR fragments made by oligos MB94-109 (SEQ ID NO:20) and by oligos MB57 (SEQ ID NO:9)-MB108 (SEQ ID NO:21) are digested with the restriction enzymes appropriate to the sites that have been included in the PCR oligonucleotides. The MB94-MB109 fragment is digested with HindIII and Hpal. The MB57-MB108 fragment is digested with Hpal and EcoRI. These fragments are then ligated into the vector pUC119 which has been digested with HindIII and EcoRI. The resultant plasmid is called pIIMB46 (see FIG. 32).


The oligonucleotides used are as follows:

    • EcoRI


      MB108 (SEQ ID NO:21) TCAGAATTCGTTCCGGGAGCAGGCGTGGA
    • Hpal


      MB109 (SEQ ID NO:20) TCAGTTAACTGCACTAGTTTTAATTAATACGTATGCCGTCCGTCCCGGCTGCCAGTC


      E-C. Construction of Recombinant Viruses


      a) First Stage.


Virus DNA was made from strain HG52-D, which is a plaque-purified isolate of the HSV-2 strain HG52. Virus DNA (2.5 μg) and pIMMB47+ plasmid DNA (0.25 μg) was transfected into CR1 cells using the CaPO4 precipitation method (Chen & Okayama, Molecular and Cellular Biology, 7, p. 2745). Recombination takes place within the cells, and a mixture of recombinant and wild type virus is produced. The mixture was plaque-purified three times on CR1 cells in the presence of acyclovir (10 μg/ml), to select for TK-minus virus. A single plaque was then grown up and analysed. The virus was titrated on normal Vero cells and on CR1 cells. If the virus is a gH-deleted virus, it should only grow on CR1 cells and not on Vero cells. Table E-1 shows that this is the case. It can be seen that the virus does not grow at all on the non-complementing Vero cells even at the highest virus concentrations, but does grow well on the CR1 complementing cell line, which expresses the HSV-1 gH gene. The virus also grows well on CR2 cells which express the HSV-2 gH gene (data not shown).









TABLE E-1







Growth of first stage recombinant virus on complementing (CR1)


and non-complementing (Vero) cells.










CR1 (gH+)
Vero
















Virus dilutions
10−4
10−5
10−6
10−1
10−2
10−3
10−4







Numbers of
>350
174
22
0
0
0
0



plaques
>350
169
19
0
0
0
0











b) Second Stage.


DNA was made from this TK-minus DISC virus and a recombination was carried out as above with the plasmid pIMMB46. In this case TK-plus recombinants were selected, on a gH-expressing TK-minus BHK cell line, by growth in medium containing methotrexate, thymidine, glycine, adenosine and guanosine. Virus was harvested and grown again under selective conditions twice more before a final plaque purification was carried out on CR1. Virus was grown up and analysed by Southern blotting. Virus DNA from the original HG52-D, the TK-minus DISC virus, and the TK-plus DISC virus were digested with BamHI and separated on an agarose gel. The DNA bands were then transferred to nylon membrane by the Southern blotting method, and probed with radiolabelled fragments from the right hand flanking sequences. FIG. 33 shows the structures of these viruses, with the expected band sizes after BamHI digestion. The probe used is marked as ‘R’ beneath a dashed line. The probe should hybridise to a different size band in each of these viruses, as follows:

















Band size hybridising



Virus
(base pairs)









HG52-D
3481



TK-minus “first stage” DISC virus
3140



TK-plus “second stage” DISC virus
4225











FIG. 34 shows that this is the case. Lane 5 shows the HG52-D virus, Lane 2 contains the TK-minus “first stage” DISC virus, and lanes 3, 4, 6, 7 and 8 contain TK-plus “second stage” DISC viruses. This confirms that the DNA structure in each of these viruses is as expected.


The defective HSV-2 can be used as a vaccine. After growth in the complementing cell line, the HSV-2 virus is phenotypically identical to a wild type HSV-2 virus, and can infect cells in a normal manner. In normal cells the defective HSV-2 virus undergoes a single cycle of replication. Viral particles are produced, but because normal cells do not express the gH gene, these HSV-2 viral particles lack the gH protein, and are subsequently unable to infect further cells.


Furthermore the sequence of the HSV-2 gH gene as hereby provided can be very useful for several purposes. In the context of the DISC virus system, it can be useful in that the detailed knowledge of the sequence allows the making of precise deletions around the gH gene. In addition, should it prove desirable to use the HSV-2 gH gene in the complementing cell line, either to provide better complementation of the gH-deleted virus, or to produce a type 2 DISC virus with improved immunogenicity, then again the sequences will prove invaluable. Uses in different areas can also be envisaged, such as subunit vaccines using the HSV-2 gH protein as an immunogen, or recombinant viruses (either HSV or other viruses) expressing the HSV-2 gH gene. For diagnostic purposes PCR primers can be designed using the HSV-2 gH sequence, in order, if desired, to distinguish between HSV-1 and HSV-2.


Section F. In Vivo Mouse Studies


Protection Studies


The in vivo mouse ear model was used to study prophylactic effects. Equivalent doses of inactivated wild-type (‘w.t.’) HSV-1 (strain SC16, see T J Hill et al, J Gen Virol. 28 (1975), pp 341-353) and DISC HSV-1 were compared for their effect on the replication of w.t. HSV-1, their ability to provide protection against w.t. HSV-1 challenge and to induce HSV-specific neutralising antibodies.


4-5 week old BALB/c mice were vaccinated with varying doses of DISC HSV-1 or inactivated virus by scarification in the left ear pinna. Virus was inactivated using β-propiolactone (see description above in relation to HSV-1). The mice were challenged with 2×106 pfu w.t. HSV-1 (strain SC16) in the opposite ear two weeks after vaccination. The amount of virus present in that ear 5 days post challenge was assayed by plaquing on BHK cells. (See FIG. 8.)


It can be seen from FIG. 8 that vaccination with 5×105 and 5×106 pfu DISC HSV-1 (pfu measured on complementing cell line for DISC viruses) led to complete protection against replication of the challenge virus, whilst mice vaccinated with inactivated virus still had live challenge virus present.


A similar result was obtained when virus titres were assayed from the ganglia of vaccinated animals 5 days after challenge (data not shown).


Serological Response to Disc HSV-1 Vaccination


The role of antibody in protection conferred by the DISC HSV-1 vaccination was investigated. Both neutralising antibody titres and total antibody titres, as determined by ELISA, were measured.


Groups of 6 mice were vaccinated with 5×105 pfu of DISC HSV-1, killed DISC HSV-1, w.t. HSV-1 (strain SC16) or with PBS and serum samples taken at 2 and 14 weeks post vaccination. Neutralising antibodies were measured in the presence of complement and expressed as the inverse of the serum dilution which reduced the number of plaques by 50%. ELISA antibody titres were measured on plates coated with HSV-1 infected BHK cell lysates and titrated to endpoint. (See FIG. 9.)


It can be seen from FIG. 9 that no significant differences in antibody titres were observed between animals vaccinated with DISC HSV-1 and an equivalent amount of killed DISC HSV-1.


Delayed-Type Hypersensitivity (DTH) Response to Disc HSV-1 Vaccination


The importance of a DTH response in protection against herpes virus infection has been well documented. The ability of, the DISC HSV-1 to raise a DTH response was investigated by vaccinating groups of mice with DISC HSV-1, killed DISC HSV-1, and live w.t. HSV-1, by scarification of the left ear pinna. Four doses (5×103, 5×104, 5×105 and 5×106 pfu) of vaccine were used, and two weeks later the vaccinated animals were challenged in the opposite ear with 106 pfu w.t. HSV-1 (strain SC16). The DTH response at the site of challenge was assessed by measurement of ear thickness at 24 and 48 hours post challenge and expressed as the difference between the challenged and unchallenged ears. (See FIG. 10.)


It can be seen from FIG. 10 that at low vaccine doses (5×103, 5×104 pfu), no DTH response was observed with killed DISC HSV-1, whilst a clear DTH response was demonstrated after DISC HSV-1 vaccination. At high doses (eg 5×106 pfu), both the DISC HSV-1 vaccine and killed DISC HSV-1 preparations induced similar DTH responses.


The DTH responses induced by different doses of the various vaccine preparations thus correlate with their protective effect against challenge virus replication. The efficacy of vaccination with low doses of the DISC HSV-1 vaccine may therefore be due to the induction of T cell-mediated immunity.


Demonstration that Disc HSV Type 1 Virus is Capable of Generating Cytotoxic T Cells


Cytotoxic T cells have been shown to be involved in the protection against, and recovery from, primary HSV infection. DISC HSV-1 vaccinated mice were therefore studied for the presence of HSV-1 specific cytotoxic T cell activity.


Cytotoxic T cell activity following immunisation was generated and assayed according to standard procedures eg as exemplified in S Martin et al, J Virol, 62 (1988), 2265-2273, and W S Gallichan et al, J Infect Dis, 168 (1993), 622-629. More specifically, groups of female BALB/c mice were immunised intra-peritoneally with 2×107 pfu of virus (DISC HSV-1; killed DISC HSV-1; MDK a thymidine kinase negative HSV-1 strain) on day 0 and the immunisations repeated (same dose and route) after 3 weeks. A group of control mice received 0.1 ml of PBS intraperitoneally at the same time points. Ten days after the second immunisation the spleens of the mice were removed and pooled for each group.


Spleens were also removed from unimmunised BALB/c mice for the preparation of feeder cells (16 feeder spleens being sufficient for 4 groups of six effector spleens). All subsequent steps were performed in a laminar flow hood using aseptic technique. The spleens were passed through a sterile tea-strainer to produce a single cell suspension in RPMI 1640 medium supplemented with 10% heat inactivated foetal calf serum (effector medium). Debris was allowed to settle and the single cell suspension was transferred to a fresh container. The cell suspensions were washed twice in effector medium (1100 rpm, 10 minutes) and then passed through sterile gauze to remove all clumps. The effector spleen cell suspensions were then stored on ice until required.


Feeder spleen cells were resuspended to 1×107 cells/ml in effector medium and mitomycin C was added to a final concentration of 20 μg/ml. The feeder cells were incubated at 37° C. for 1 hour. Feeder cells were washed four-times in PBS supplemented with 1% FCS and once in PBS with no protein. Live virus (MDK) was added to the mitomycin C treated feeder cell pellet at a concentration of 3 pfu of virus per spleen cell. Following a one hour incubation at 37° C. the feeder cells were washed once with effector cell medium.


Effector cells were resuspended to 5×106 cells/ml, whilst feeder cells were resuspended to 2.5×106 cells/ml. 500 μl of effector cell suspension and 500 μl feeder cell suspension were added to the wells of a 24 well plate. The plates were incubated in a humid atmosphere at 37° C. (5% CO2) for 4 days.


The effector and feeder cells were harvested from the 24 well plate. The cells were spun down once and the pellet resuspended in effector medium (5 ml of medium per 2 plates). The cell suspension was layered onto lymphocyte separation medium and spun at 2500 rpm for 20 minutes. The live effector cells were harvested from the interface and washed twice, once at 1500 rpm for 15 minutes and once at 1100 rpm for 10 minutes. The effector cells were finally resuspended at the required concentration in effector medium and stored on ice until required.


Labelled target cells were prepared for the cytotoxicity assay. Uninfected syngeneic A202J target cells A20/2J cells were harvested from tissue culture flasks: 2×107 cells were added to each of 2 containers (to become infected and uninfected targets). The cells were washed with DMEM (with no additions). To the infected cells live MDK virus was added at 10 pfu per cell and an equivalent volume of EMEM was added to the uninfected cells. One mCi of 51Cr was added to each of the universals and the cells were incubated at 37° C. (in a waterbath) for 1 hour. The target cells were then washed three times (10 minutes, 1100 rpm) in target medium (DMEM supplemented with 10% FCS) and finally resuspended to the required cell concentration in target cell medium. Both uninfected and infected target cells were resuspended to 1×106 cells/ml and 1×105 cells/ml and 100 μl (ie to give 1×105 targets/well and 1×104 targets/well respectively) was plated out into the appropriate wells of a round bottomed 96 well plate. All experimental points were set up in quadruplicate. Each effector cell type was resuspended to 8×106 cells/ml in effector medium and two-fold dilutions were prepared. 100 μl of the effector cell suspensions were added to the wells containing the labelled target cells to give 8×105 effector cells/well, 4×105 effector cells/well, 2×105 effector cells/well and 1×105 effector cells/well. Thus with 105 target cells per well, effector to target ratios were: 8:1, 4:1, 2:1 and 1:1. With 104 target cells per well the effector to target ratios were 80:1, 40:1, 20:1 and 10:1. Maximum chromium release for each target cell type was obtained by adding 100 μl of 20% Triton X-100 to wells containing target cells only (ie no effectors). The spontaneous release for each target cell type was obtained by the addition of 100 μl effector cell medium to wells containing target cells only.


The plates were incubated at 37° C. for four hours in a humid atmosphere. After this time the plates were spun for four minutes at 1500 rpm and 100 μl of supernatant was removed from each of the wells. The supernatant was transferred to LP2 tubes and radioactivity contained in the tubes was then counted for 1 minute on a gamma counter. The % specific chromium release was determined using the formula












%





specific





release

=





Exp
.




mean






cpm

-


spon
.




mean






cpm





Max
.




mean






cpm

-


spon
.




mean






cpm



×
100












Exp
.

=
Experimental







Spon
.

=
Spontaneous







Max
.

=
Maximum







The results are shown in FIG. 11 and Table F-1













TABLE F-1







Inactivated




E:T ratio
DISC HSV-1
Virus
MDK
Unvaccinated







8:1
53.9
1.5
48.3
ND


4:1
49.6
0.0
42.2
0.0


2:1
36.9
0.0
31.0
0.0


1:1
23.9
0.0
21.9
0.0





% HSV-1 Specific Lysis (% lysis of HSV-infected cells minus % lysis of uninfected cells).






DISC HSV-1 vaccination induced HSV-1 specific CTL activity comparable to that produced by infection with the fully replicative MDK virus. In contrast no HSV-1 specific CTL activity was observed in mice immunised with killed DISC HSV-1 or in PBS treated animals, although some non-specific killing was observed in these animals. The reason for this is not clear, but it could represent a high level of NK cell activity.


Vaccination of mice with the DISC HSV-1 has thus been shown to induce antibody, CTL and DTH activity against HSV-1 virus antigens. The ability to activate both humoral and cell-mediated immune responses against a broad spectrum of virus proteins may explain the effectiveness of the DISC virus vaccination.


Long-Term Protection


The in vivo mouse ear model was used to study long term prophylactic effect of DISC HSV-1


4-5 week old BALB/c mice were divided into groups containing 6 animals each.


The groups were vaccinated as follows:













Group
Vaccination







PBS
Mock immunisation with PBS


1K
1 immunisation with inactivated DISC HSV-1


2K
2 immunisations with inactivated DISC HSV-1


1L
1 immunisation with (live) DISC HSV-1


2L
2 immunisations with (live) DISC HSV-1


1S
1 immunisation with w.t. HSV-1 (strain SC16)


2S
2 immunisations with w.t. HSV-1 (strain SC16)









All groups were immunised by scarification of the left ear pinna with 5×105 pfu on day 0 and blood samples taken on days 15, 27, 90, 152 and 218. Groups PBS, 2K, 2L and 2S received additional immunisations of PBS or 5×105 pfu on day 20. All groups were challenged with 5×105 w.t. HSV-1 (strain SC16) on day 223. The amount of virus present in the challenged ear (right) 5 days post challenge was assayed by plaquing on BHK cells. The results as depicted by FIG. 20 show that two vaccinations with DISC HSV-1 (group 2L) provides goods protection compared to inactivated DISC HSV-1 (group 2K), but that better protection was obtained with w.t. HSV-1 (strain SC16). The efficacy of vaccination with w.t. HSV-1 is of course, to be expected. However the use of normal live viruses as vaccines is generally undesirable. FIG. 21 shows the neutralising antibody titres induced by the various vaccinations. This shows that since 2 doses of DISC HSV-1 produce the same titre as two doses of the inactivated DISC HSV-1, the protective effect of DISC HSV-1 cannot be simply explained by antibody induction.


Prophylactic Effect of Disc HSV-2


The in vivo mouse ear model was used to study the prophylactic effect of DISC HSV-2.


Six week old BALB/c mice were divided into groups. They were immunised by scarification of the left ear pinna as follows.













Group
Vaccination Material and Dose
















1
5 × 102 pfu live DISC HSV-2


2
5 × 103 pfu live DISC HSV-2


3
5 × 104 pfu live DISC HSV-2


4
5 × 105 pfu live DISC HSV-2


5
5 × 102 pfu killed DISC HSV-2


6
5 × 103 pfu killed DISC HSV-2


7
5 × 104 pfu killed DISC HSV-2


8
5 × 105 pfu killed DISC HSV-2


9
5 × 104 pfu w.t. HSV-2 (strain HG52)


10
5 × 105 pfu w.t. HSV-2 (strain HG52)


11
PBS





(The DISC HSV-2 was a gH deletion mutant of strain HG52.)






Three weeks later, all groups were challenged by scarification of the right ear pinna with 5×104 of w.t. HSV-2 (strain HG52).


The amount of virus present in the challenged ear (right) 5 days post challenge was assayed by plaquing on BHK cells (see FIG. 22). The results as depicted by the figure show that vaccination with DISC HSV-2 at doses of 5×103, 5×104 and 5×105 pfu provides good protection against challenge with w.t. HSV-2 (strain HG52) compared to killed DISC HSV-2. However and as is to be expected, better protection was obtained with w.t. HSV-2 at doses of 5×104 and 5×105 pfu, but the use of normal live wild type viruses as vaccines is undesirable.


Section G. In Vivo Guinea Pig Studies


As mentioned earlier, HSV-2 appears to be closely associated with genital lesions. The guinea pig currently provides the best animal model for primary and recurrent genital disease in humans (L R Stanberry et al, J Infect Dis 146 (1982), pp 397-404).


Therefore the applicants have extended the above-described mouse studies to the guinea pig vaginal model of HSV-2 infection which provides a useful system to assess the immunogenicity of candidate vaccines against genital HSV-2 infection in humans. It permits a comprehensive assessment of primary clinical symptoms following intra-vaginal challenge with HSV-2, and also analysis of the frequency of subsequent recurrences.


(1) Groups of 14 animals were immunised with two doses of the DISC HSV-1 vaccine (2×107 pfu, 3 weeks apart) either by non-traumatic introduction into the vagina (intra-vaginal route), or by scarification of the ear pinna (intra-epithelial route). A control group of 21 animals was vaccinated intra-vaginally with a mock virus preparation and a further group of 14 animals was vaccinated intra-epithelially with two equivalent doses of β-propiolactone-inactivated w.t. HSV-1.


Vaccinated animals were challenged 3 weeks later with 105.2 pfu w.t. HSV-2 virus (strain MS) and monitored for the symptoms of primary and recurrent disease.


(a) Following w.t. HSV-2 challenge, animals were assessed daily over a two week period for symptoms of primary infection. Clinical lesions were scored as a direct numerical value, and erythema was scored on a scale of 1-5. The vaginal area was also measured as an index of oedema (data not shown). The results are shown in FIGS. 12 and 13. Points on the graphs represent mean erythema score per animal per day (FIG. 12) and mean total lesion score per day per animal (FIG. 13).


The results show that intra-epithelial and intra-vaginal vaccination with the DISC HSV-1 both provided a high degree of protection against the primary symptoms of HSV-2 infection. Surprisingly, inactivated HSV-1 administered by the intra-epithelial route also provided substantial protection, though apparently less than that afforded by the DISC virus vaccine.


(b) Daily vaginal swabs were taken from all animals over a 12 day period post-challenge and virus titres determined by plaquing on Vero cells in order to monitor growth of the challenge virus in the vagina. The results as depicted in FIG. 14 shows that infection virus titres in mock-vaccinated animals rose to a maximum of 3×104 at day 2 post challenge, and could be detected until day 10. By contrast, virus titres in the vaccinated animals declined steadily from day 1, and were undetectable by day 7. No significant different was observed between the groups immunised with the DISC HSV-1 or the inactivated virus preparation.


(c) Following HSV-2 challenge, animals which had fully recovered from the acute phase of disease by 28 days were monitored daily for a further 100 days for the recurrence of disease. Numbers of animals in each group were: DISC/Intra-vaginal—14; DISC/Intra-epithelial—12: Inactivated/Intra-epithelial—14; Mock/Intra-vaginal—12. Clinical lesions were scored as a direct numerical value, and erythema was scored on a scale of 1-5. The results are shown in FIGS. 15a and 15b. Points on the graphs represent the cumulative totals of mean values per day per animal.


The results show that animals vaccinated with the DISC HSV-1 by the intra-vaginal route showed approximately a 50% reduction in the number of recurrent HSV-2 lesions occurring over the 100 day follow-up period. Intra-epithelial vaccination with DISC HSV-1 and inactivated virus also resulted in a reduction of recurrent lesions, but to a lesser extent.


(2) The following experiment was also designed to assess the immunogenicity of candidate DISC vaccines based on HSV-1 against genital HSV-2 infection. The experiment was designed to compare different vaccination routes (per vaginum, oral and nasal ie different mucosal surfaces) and different doses of either DISC HSV-1 or inactivated HSV-1 in the guinea pig.


Materials and Methods


Virus:


(i) DISC HSV-1 was propagated on Vero cells (F6) which had been transfected with the HSV-1 gH gene as described above. Briefly, confluent monolayers of F6 cells were infected with DISC HSV-1 at a multiplicity of 0.1 pfu per cell and harvested when 90-100% cpe was observed. Cells were harvested with a cell scraper, pelleted by centrifugation and the pellet resuspended in a small volume of Eagles Minimum Essential Medium (EMEM). The suspension was sonicated for 1 minute and stored in aliquots at −70° C. Virus titres were determined on F6 cells.


(ii) DISC HSV-1 was inactivated by the addition of β-propiolactone at a concentration of 0.05% for one hour at room temperature. Inactivation was checked by adding the virus to F6 cells.


(iii) HSV-2 strain MS was propagated and titred on Vero cells in the same manner as DISC HSV-1 as described above.


Animals: Female Dunkin-Hartley guinea-pigs (300-350 g) were obtained from Davis Hall, Darley Oaks Farms, Newchurch, Nr. Burton-on-Trent.


Experimental design: Groups of 12 animals were immunised with two doses of 8×106 pfu DISC HSV-1 or with equivalent doses of inactivated DISC HSV-1, on days 1 and 17 of the experiment. Immunisation was performed with either 0.05 ml of virus intravaginally, with 0.2 ml of virus intranasally or with 0.2 ml virus orally. A control group of 12 animals was vaccinated intravaginally with a mock preparation of virus consisting of sonicated Vero cells. All groups were challenged intravaginally on day 34 with 105.2 pfu HSV-2 (strain MS) and the experiment blinded by randomisation of the cages by an independent worker. For a period of 11 days following challenge, animals were monitored for the symptoms of primary disease. Clinical observations were scored as the number of lesions present in the vaginal area and the presence of erythema (scored on a scale of 1-5). In addition, daily vaginal swabs were taken from all animals over a 12 day period post challenge and virus titres were determined by plaquing on Vero cells in order to monitor growth of the challenge virus in the vagina.


Statistical methods: Differences in group clinical scores were tested for significance using the Mann-Whitney U test. Values of p<0.1 were considered significant.


Results:


Clinical disease profile. The mean lesion score per animal, the mean erythema score and the effect of vaccination on post challenge virus replication for each of the immunisation groups are shown in FIGS. 16, 17 and 18 respectively. As compared to mock vaccinated animals, vaccination with DISC HSV-1 by the intravaginal route provided a high degree of protection from primary symptoms of infection. In contrast, vaccination with inactivated DISC HSV-1 at an equivalent dose did not lead to any significant protection.


Intranasal immunisation with DISC HSV-1 resulted in an even higher degree of protection than intravaginal vaccination. This was particularly apparent when looking at the number of days with severe disease, as defined by a lesion score of 6 or more (see table G-1). Inactivated DISC HSV-1 gave some protection via the intranasal route, but it was not as effective as vaccination with DISC HSV-1.


Vaccination via the oral route also led to protection, but to a lesser degree than intranasal or intravaginal vaccination. Again vaccination with DISC HSV-1 virus protected more efficiently than vaccination with inactivated DISC HSV-1.









TABLE G-1







INCIDENCE OF PRIMARY DISEASE SYMPTOMS












Any dis-


Disease on-



ease symp-
Lesion score
Duration of
going on day


Immunisation
toms (%
>5 (% of
disease (mean
11 (% of


with
of animals)
animals)
no. days)
animals)














mock
92
75
6.8
75


DISC HSV-1
33
17
4.5
8


i.vag


HSV-1
92
67
6.2
83


inactivated


i.vag


DISC HSV-1
33
0
2.3
0


i.nas


HSV-1
67
17
6.3
42


inactivated


i.nas


DISC HSV-1
90
20
4.1
20


oral


HSV-1
91
36
5.8
64


inactivated


oral









Thus the following conclusions can be drawn from this experiment with the in vivo guinea pig model.


A. Vaccination with DISC HSV-1 via the intravaginal and intranasal routes led to a high degree of protection from acute disease symptoms following a challenge with HSV-2.


B. Intranasal administration of DISC HSV-1 gave the highest degree of protection when considering the number of days of severe disease (as defined by the presence of 6 or more lesions).


C. Intravaginal vaccination with inactivated virus resulted in clinical disease symptoms similar to those observed in mock-infected guinea-pigs. Intranasal vaccination with inactivated DISC HSV-1 gave a significant degree of protection, but not as high as DISC HSV-1 vaccination via this route.


D. A significant difference was observed between disease symptoms in animals vaccinated orally with DISC HSV-1 and mock-infected animals. However, this degree of protection was less than that observed in animals vaccinated with DISC HSV-1 via the intranasal or intravaginal route.


E. Symptoms in animals vaccinated orally with inactivated DISC HSV-1 were not significantly different from those in the mock-infected group.


F. The data on shed virus is interesting. Surprisingly the per vaginum vaccination route resulted in significantly lower levels of recovered virus following the challenge dose. This may be due to local antibody production.


(3) The following experiment was designed to investigate HSV-2 induced recurrent disease following therapeutic vaccination.


This was of interest as it has previously been shown that therapeutic administration of certain recombinant HSV-2 antigens, together with adjuvant, can decrease the frequency of subsequent recurrences (see L R Stanberry et al, J Infect Dis 157 (1988), pp 156-163; L R Stanberry et al, J Gen Virol, 70 (1989) pp 3177-3185; and R J Y Ho et al, J Virol, 63 (1989), pp 2951-2958).


Accordingly 21 animals which had recovered fully from primary HSV-2 disease four weeks after challenge were randomised into three groups, and treated with live DISC HSV-1 intravaginally (10 animals), or intra-epithelially (11 animals). A group of 12 animals, which had previously acted as controls for prophylactic vaccination (see (2) above) and which had also recovered fully from primary disease were treated with an equivalent mock preparation (12 animals). The animals were given further identical treatments 24 and 48 days later. The frequency of recurrent disease was monitored from the day of first treatment for a further 100 days, and the cumulative results are shown in FIG. 19 and summarised in Table G-2 below.









TABLE G-2







Effect of therapeutic vaccination on recurrent disease










DISC HSV-1
DISC HSV-1











Mock
Intra-epithelial
Intra-vaginal














Total
% of Mock
Total
% of Mock
Total
% of Mock





1 Mean total disease/days
9.41
100
6.90
73
7.32
78


per animal


2 Mean total episodes per
6.27
100
4.67
74
5.10
81


animal


3 Disease incidence
12/12
100
9/11
82
10/10
100


4 Severity per episode
3.21
100
3.00
93
2.86
89


Mean duration of
1.49

1.27

1.38


episode (days)





1 Total number of days where disease was observed (either lesions or erythema) over the whole observation period (100 days from 1 month after challenge with HSV-2)


2 Total of days disease episodes over the whole observation period (episode length defined as period between two consecutive disease-free days


3 Proportion of animals showing any lesion or erythema score during whole observation period


4 Total sum of erythema scores and lesion numbers over the whole observation period divided by number of episodes observed






It can be seen that each of the groups treated with DISC HSV-1 appeared to experience a modest reduction (about 25%) in the overall number of disease/days and episodes especially over the 50 day period following second vaccination.


Sera were collected from these animals at the end of the 100 day observation period. The ELISA and NT antibody titres in the sera were not significantly higher than those recorded post-challenge but before therapeutic treatment and there were no significant differences in titres between the mock-treatment group and the DISC HSV-1 treated groups. Thus therapeutic administration of DISC HSV-1 virus either intra-vaginally or intra-epithelially resulted in an apparent reduction (20-25%) in the frequency of recurrence compared with mock-treated animals.


(4) The following experiment was designed to investigate the therapeutic value of a DISC virus based on HSV-2. A DISC HSV-2 (strain HG 52) having a deletion of the gH gene was made as described earlier and in accordance with the general teaching hereof, also using standard procedures in the art. The DISC version of the strain was grown in Vero cells transfected with the HSV-2 gH gene also in accordance with the teaching hereof.


The experiment was a head to head comparison of DISC HSV-1 with DISC HSV-2 in female 350-400 gms guinea-pigs. Guinea-pigs were divided into three groups. All guinea-pigs were infected with 105.8 pfu HSV-2 strain MS. Four weeks were then allowed for the primary disease to have both developed and resolved and for recurrences to have started. The animals were then treated. A first group of 15 animals was treated intravaginally with a mock preparation of virus consisting of sonicated Vero cells. A second group of 13 animals was treated intravaginally with 107 pfu DISC HSV-1. A third group of 14 animals was treated intravaginally with 107 pfu DISC HSV-2. Treatment was repeated in 14 days. The results are shown in Table G-3. Days 1-13 covers the period between the two treatments. Days 14-27 covers the two week period subsequent to the second treatment. Days 1-27 covers the complete period.


As shown by the results, it appears that treatment with DISC HSV-2 was effective in alleviating symptoms caused by infection with HSV-2 strain MS. Treatment with DISC HSV-2 was more effective than treatment with DISC HSV-1.


The invention described and the disclosure made herein are susceptible of many modifications and variations as will be apparent to, and readily performable by, the skilled reader: and the disclosure extends to combinations and subcombinations of the features mentioned and/or described herein. Documents cited herein are hereby incorporated by reference.













TABLE G-3









Erythema scores
Lesions scores
Disease Days
















Group
Total
Per animal
% of Mock
Total
Per animal
% of Mock
Total
Per animal
% of Mock



















Days 1-13











Mock
38
2.53
100
66
4.40
100
42
2.80
100


DISC HSV-1
34
2.62
103
48
3.69
84
34
2.62
93


DISC HSV-2
22
1.57
62
40
2.86
65
26
1.86
66


Days 14-27


Mock
13
0.87
100
23
1.53
100
17
1.13
100


DISC HSV-1
9
0.69
80
14
1.08
70
11
0.85
75


DISC HSV-2
2
0.14
16
3
0.21
14
3
0.21
19


Days 1-27


Mock
51
3.40
100
89
5.93
100
59
3.93
100


DISC HSV-1
43
3.31
97
62
4.77
80
45
3.46
88


DISC HSV-2
24
1.71
50
43
3.07
52
29
2.07
53








Claims
  • 1. A vaccine comprising a pharmaceutically acceptable excipient and an effective immunizing amount of a mutant virus, wherein said mutant virus is a mutant poxvirus and has a genome which has an inactivating mutation in a viral gene, said viral gene being essential for the production of infectious new virus particles, wherein said mutant virus is able to cause production of infectious new virus particles in a complementing host cell expressing a gene which complements said essential viral gene, but is unable to cause production of infectious new virus particles when said mutant virus infects a host cell other than a complementing host cell; for prophylactic or therapeutic use in generating an immune response in a subject.
  • 2. The vaccine of claim 1 wherein the poxvirus is an orthopoxvirus.
  • 3. The vaccine of claim 2 wherein the poxvirus is a vaccinia virus.
Priority Claims (6)
Number Date Country Kind
9020799.4 Sep 1990 GB national
9104903.1 Mar 1991 GB national
PCT/GB91/01632 Sep 1991 WO international
9226172.6 Dec 1992 GB national
9305710.7 Mar 1993 GB national
9324964.7 Dec 1993 GB national
Parent Case Info

This application is a continuation-in-part of copending U.S. Ser. No. 08/384,963 filed 7 Feb. 1995, which is itself a continuation of U.S. Ser. No. 08/030,073, corresponding to International patent application PCT/GB91/01632, which was published on 2 Apr. 1992 as WO 92/05263, having an international filing date of 23 Sep. 1991 and entered into US national phase with serial number U.S. Ser. No. 08/030,073 and date 20 May 1993. This application is also a continuation-in-part of copending U.S. Ser. No. 08/216,260 filed 21 Mar. 1994, which is itself a continuation-in-part of U.S. Ser. No. 08/168,643 filed 16 Dec. 1993. The specifications of the above-mentioned applications are hereby incorporated by reference.

US Referenced Citations (16)
Number Name Date Kind
4722848 Paoletti et al. Feb 1988 A
4996152 Carter et al. Feb 1991 A
5110587 Paoletti et al. May 1992 A
5155020 Paoletti Oct 1992 A
5166057 Palese et al. Nov 1992 A
5174993 Paoletti Dec 1992 A
5204243 Paoletti Apr 1993 A
5225336 Paoletti Jul 1993 A
5338683 Paoletti Aug 1994 A
5364773 Paoletti et al. Nov 1994 A
5453364 Paoletti Sep 1995 A
5494807 Paoletti et al. Feb 1996 A
5505941 Paoletti Apr 1996 A
5583028 Paoletti et al. Dec 1996 A
5766882 Falkner et al. Jun 1998 A
5770212 Falkner et al. Jun 1998 A
Foreign Referenced Citations (15)
Number Date Country
0213894 Mar 1987 EP
0386882 Sep 1990 EP
0453242 Oct 1991 EP
0 753 581 Jan 1997 EP
WO 8909271 Oct 1989 WO
WO 9005538 May 1990 WO
WO 9010693 Sep 1990 WO
WO 9105055 Apr 1991 WO
9205263 Apr 1992 WO
WO 94032074 Feb 1994 WO
WO-9527507 Oct 1995 WO
WO-9621727 Jul 1996 WO
WO-9639177 Dec 1996 WO
WO-9639491 Dec 1996 WO
WO-9640241 Dec 1996 WO
Continuations (1)
Number Date Country
Parent 08030073 May 1993 US
Child 08168643 US
Continuation in Parts (3)
Number Date Country
Parent 08384963 Feb 1995 US
Child 08459040 US
Parent 08216260 Mar 1994 US
Child 08384963 US
Parent 08168643 Dec 1993 US
Child 08216260 US