Patent Application
20200165613
The disclosure relates to the assembly of Virus Like Particles [VLPs] using native and artificial nucleic acid packaging signals and their use in vaccines, immunological and pharmaceutical compositions; methods of vaccination or immunisation against human and animal viral pathogens and also as a delivery vehicle for therapeutic agents such as pharmaceutical proteins, siRNAs or gene therapy vectors or diagnostic agents.
Viruses cause various debilitating diseases in humans and animals with often detrimental effects or even death. Viral infections cause a huge financial burden to the healthcare systems around the world, and also result in vast losses of animal related products, such as in the meat or dairy industries.
In contrast to bacterial infections which can be treated with antibiotic agents after the infections starts, prevention of viral infections is typically the preferred route as there are often no effective anti-viral drug options available. Vaccination is the most effective form of disease prevention and has been successfully developed for some viral diseases such as influenza, polio, measles and Human Papilloma Virus [HPV]. Vaccination is the administration of antigenic material to stimulate an individual's immune system to develop adaptive immunity to a pathogen. The active agent of a vaccine may be, for example, an inactivated form of the pathogen, a highly immunogenic component of the pathogen or in the form of a weakened so called attenuated virus. However, all these different types of vaccines vary in their effectiveness and safety record and moreover can often be unsuitable for administration to immune compromised subjects, pregnant women or children.
Inactivated vaccines are made from viruses which have been killed through physical or chemical processes. These types of vaccines are very safe, as they cannot cause disease because they lack infectious genetic material, and are therefore suitable for immune compromised subjects. However, such inactivated vaccines are often ineffective in inducing an appropriate or long lasting immune response, and therefore frequently require multiple administration steps. Vaccines containing highly immunogenic components of the pathogen, so called subunit vaccines, provide similar benefits to the inactivated vaccines such as a high safety record as they do not contain live components of the virus which can cause disease. However, effective immune responses are not guaranteed, and even if a response is elicited, immunological memory, providing protection against the desired pathogen for a prolonged period, may not be achieved.
Alternatively, live attenuated vaccines can be used. Live attenuated vaccines comprise weakened pathogens which although still capable of replication in the host organism cause no or a very mild disease. Vaccinations using an attenuated virus result in excellent protection; however, they are intrinsically less safe when compared to inactivated or subunit vaccines since they can revert to their original more virulent form and cause disease. Therefore attenuated vaccines are unsuitable for subjects with compromised immune systems, can harm the unborn child when given during pregnancy and have an increased potential for immunisation errors by health professionals such as e.g. reconstitution errors of lyophilised attenuated pathogens which, when given in a higher dose, are more potent. Moreover, attenuated vaccines are less stable than inactivated vaccines and require sophisticated logistics to maintain cold storage and transport to maintain the, although weakened, activity. This is of particular concern in third world countries with a less established health system.
Attenuated vaccines are common and are available for a variety of diseases such as measles, mumps, rubella, chicken pox, smallpox and polio. Most of the live attenuated vaccines in use today are derived from serial passage in cultured cells such as for example fibroblasts or and chicken embryos, resulting in a gradual loss of virulence. This method relies on the random accumulation of point mutations to confer avirulence and is time consuming and inefficient. Other methods to produce attenuated viral strains are based on genetic engineering and are disclosed in application WO2005/012535.
Virus-like particles (VLPs) comprise multiple capsid proteins that mimic the conformation of native viruses but lack the viral DNA or RNA and thus are unable to replicate in a host cell. The use of VLPs as a tool for the production of safe and efficient vaccines has been recognised and some VPL-based vaccines against human papilloma virus have been developed. U.S. Pat. No. 8,062,642 discloses the production of papillomavirus capsid proteins and VLPs with antigenic characteristics similar to those of native infectious virus. Similarly, WO9913056 discloses methods of disassembly of papilloma VLPs.
Despite the enormous success of the types of vaccines listed above they are in general very difficult to prepare/formulate with the desired properties and in many viruses their natural antigenic variation across circulating populations means that these strategies are not viable in these cases.
The present disclosure relates to the formation of VLPs using nucleic acid packaging signals derived from viruses and the design of nucleic acid cassettes comprising native and/or artificial packaging signals that provide a substrate for artificial VLP assembly and the use of artificial VLPs as vaccines and in the delivery of agents to cells, for example therapeutic or diagnostic agents. The knowledge of the RNA packaging signal-mediated assembly mechanisms of positive-sense, single-stranded (ss) RNA viruses has enabled the identification of the critical properties of their genomic RNA molecules with respect to being assembly substrates, allowing the production of artificial, efficient RNA substrates for the efficient assembly of VLPs. The latter have similar properties to the natural virions formed by viruses. In particular, artificial VLP capsids retain the native immunological properties of those viruses as well as their cell tropism. They also retain many of the stability and mechanical properties of the original virus particle. VLPs have utility in a wide range of applications in relation to the cell specific delivery of agents and as safe, attenuated vaccines and vectors for targeted delivery of drugs and in gene therapy.
According to an aspect of the invention there is provided an artificial nucleic acid cassette for use in the assembly of a virus like particle comprising: one or more packaging signals, wherein the more than one packaging signals are arranged in series and separated by nucleic acid, said packaging signals composed of a nucleic acid loop domain comprising a nucleotide binding motif for cognate viral capsid protein(s), and a nucleic acid stem domain consisting of a double stranded region by intramolecular base pairing, wherein said artificial nucleic acid cassette, when contacted with a plurality of cognate viral capsid proteins, assembles said cognate viral capsid proteins into a VLP that protects said nucleic acid packaging signals contained within said VLP from ribonuclease digestion.
In a preferred embodiment of the invention said artificial nucleic acid cassette is a non-replicating nucleic acid.
In a preferred embodiment of the invention said VLP provokes an immune response similar to an immune response of the native virus particle when administered to an animal subject.
In a further preferred embodiment of the invention said artificial nucleic acid cassette is not a native virus particle.
In a preferred embodiment of the invention said artificial nucleic acid cassette does not comprise protein encoding nucleic acid.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least two nucleic acid packaging signals.
Preferably, said artificial nucleic acid cassette comprises at least 2, 3, 4, 5, 6, 7, 8, 9 or at least 10 nucleic acid packaging signals.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least 1 nucleic acid packaging signal.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least 2 nucleic acid packaging signals.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least 3 nucleic acid packaging signals.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least 4 nucleic acid packaging signals
In an alternative preferred embodiment of the invention said artificial nucleic acid cassette comprises at least 5 nucleic acid packaging signals.
In a preferred embodiment of the invention said non-coding viral nucleic acid separating said nucleic acid packaging signals is at least 5 nucleotides in length.
In a preferred embodiment of the invention said non-coding viral nucleic acid separating said nucleic acid packaging signals is at least between 5 and 50 nucleotides in length. Preferably, greater than 50 nucleotides.
In a preferred embodiment of the invention said loop domain comprising said capsid binding motif is at least 4 nucleotides in length. Preferably, said loop domain is at least 5, 6, 7 or 8 nucleotides in length.
In a preferred embodiment of the invention said stem domain is at least 4 base pairs (bp) in length. Preferably said stem domain is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, or at least 70 bp in length.
In a preferred embodiment of the invention said artificial nucleic acid cassette is at least 50 nucleotides in length. Preferably said nucleic acid cassette is between 50 and 1000 nucleotides in length.
In a preferred embodiment of the invention said artificial nucleic acid cassette is at least 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950 or at least 1000 or nucleotides in length.
In a preferred embodiment of the invention said nucleic acid packaging signal is isolated from an RNA virus; preferably said RNA virus is a human pathogen.
Preferably said packaging signal is a modified packaging signal that retains the characteristic nucleotide recognition motif and spacing between packaging signals but alters stability of/stabilises individual packaging signals.
Several diseases in humans, animals and plants are caused by so called RNA viruses. Single-stranded RNA viruses are divided into three groups: Positive-sense ssRNA viruses (Group IV), negative-sense ssRNA viruses (Group V) and retroviruses (Group VI). On infection, the viral RNA enters the host cells and, dependent on the type of virus, RNA is directly translated (Group IV) into the viral proteins necessary for replication or is, prior to translation, transcribed into a more suitable form of RNA by an RNA-dependent RNA polymerase (Group V). Group VI RNA viruses utilise a virally encoded reverse transcriptase to produce DNA from the RNA genome, which is often integrated into the host genome and so replicated and transcribed by the host. Non-limiting examples of positive-sense ssRNA viruses include hepatitis C, West Nile virus, Dengue virus, Zika virus, SARS and MERS coronavirus and rhinovirus. Negative sense ssRNA viruses include, by example, Ebola virus, measles, mumps, influenza and hepatitis D virus. Retroviruses of the genus Lentivirus include Human Immune deficiency virus I and II and Hepatitis B virus. Examples of zoonotic viral pathogens include Ebola virus, Rabies virus and influenza A virus. Non-limiting examples of plant ssRNA viruses include Turnip Crinkle Virus, Cowpea Chlorotic Mottle Virus 1, 2 and 3, Brome Mosaic Virus 1, 2 and 3, and Satellite Tobacco Necrosis Virus. In our co-pending application U.S. Ser. No. 14/916,945, the content of which is incorporated by reference in its entirety, and in particular the packaging signals and mimetic aptamers disclosed therein, are disclosed packaging signals for a range of ssRNA viruses.
In a preferred embodiment of the invention said RNA virus is a positive sense single stranded RNA virus.
In a preferred embodiment of the invention said nucleic acid packaging signal RNA virus is isolated from Hepatitis B virus.
In a preferred embodiment of the invention said Hepatitis B virus packaging signal comprises a nucleotide binding motif wherein said nucleotide binding motif comprises the nucleotide sequence RGAG wherein R is either G or A.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises at least one, two or three Hepatitis B virus packaging signals wherein one or more of said nucleic acid packaging signals includes the nucleotide binding motif RGAG.
In a preferred embodiment of the invention said nucleic acid cassette comprises at least one of the PSs identified for Hepatitis B wherein each of said nucleic acid packaging signals includes the binding motif RGAG.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group consisting of:
In a further preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
In a further preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence that is at least 30%, 35%, 40%, 45%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence comprising SEQ ID NO: 1 and/or SEQ ID NO: 2 and/or SEQ ID NO: 3.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence comprising SEQ ID 4: CUGGGAGGAGUUGGGGGAGGAGAUUAGGUUAAAGGUCUUUGUACUAGGAGGCUGU AGGC
In an alternative embodiment of the invention said RNA virus is a zoonotic species that infects of a human subject.
In a further alternative embodiment of the invention said RNA virus is a species that infects a veterinary animal subject.
In a further alternative embodiment of the invention said RNA virus is a species that infects a plant cell or plant.
In a preferred embodiment of the invention said RNA virus is Satellite Tobacco Necrosis Virus.
In a preferred embodiment of the invention said nucleic acid cassette comprises at least one nucleic acid packaging signal isolated from Satellite Tobacco Necrosis Virus.
In a preferred embodiment of the invention said nucleic acid cassette comprises at least one nucleic acid packaging signal wherein said nucleic acid packaging signal comprises the nucleotide binding motif AXXA or AXXXA wherein X is any nucleotide base.
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence selected from the group:
i) a nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 8 [GGGCCCCGCAACAAUGCGGGGAAGGAAGGAAGGAAGAAAACGUACAAACGUUUUAAG GAACAACGCAACAAUGCGUUGAAGGAAGGAAGGAAGGGGCGUACAAACGCCCCAAGGA AUUUUGCAACAAUGCAAAAAAGGAA]
In a preferred embodiment of the invention said artificial nucleic acid cassette comprises a nucleotide sequence that is at least 30%, 35%, 40%, 45%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence set forth in SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 or SEQ ID NO: 8.
In a preferred embodiment of the invention said artificial nucleic acid cassette further comprises a transcription cassette comprising a nucleic acid molecule adapted to transcribe a nucleic acid encoding a polypeptide or a functional RNA.
In a preferred embodiment of the invention said adaptation is the provision of a promoter sequence and termination sequence to enable expression of said nucleic acid molecule encoding said polypeptide or functional RNA.
In a preferred embodiment of the invention said polypeptide is a therapeutic polypeptide, for example an antibody or antibody fragment.
Antibody fragments include nucleic acids encoding single chain antibody fragments. Antibodies include nucleic acid molecules encoding humanised and chimeric antibodies, prepared according to conventional methodology. Chimeric antibodies are recombinant antibodies in which all of the V-regions of a mouse or rat antibody are combined with human antibody C-regions. Humanised antibodies are recombinant hybrid antibodies which fuse the complementarity determining regions from a rodent antibody V-region with the framework regions from the human antibody V-regions. The C-regions from the human antibody are also used. The complementarity determining regions (CDRs) are the regions within the N-terminal domain of both the heavy and light chain of the antibody to where the majority of the variation of the V-region is restricted. These regions form loops at the surface of the antibody molecule. These loops provide the binding surface between the antibody and antigen.
In an alternative embodiment of the invention said functional nucleic acid is an mRNA encoding a therapeutic polypeptide, an antisense oligonucleotide or a siRNA.
A technique to specifically ablate gene function which has broad acceptance is through the introduction of double-stranded RNA, also referred to as small inhibitory or interfering RNA (siRNA), into a cell which results in the destruction of mRNA complementary to the sequence included in the siRNA molecule. The siRNA molecule comprises two complementary strands of RNA (a sense strand and an antisense strand) annealed to each other to form a double-stranded RNA molecule. The siRNA molecule is typically derived from exons of the gene which is to be ablated. Many organisms respond to the presence of double-stranded RNA by activating a cascade that leads to the formation of siRNA. The presence of double-stranded RNA activates a protein complex comprising RNase III which processes the double-stranded RNA into smaller fragments (siRNAs, approximately 21-29 nucleotides in length) which become part of a ribonucleoprotein complex. The siRNA acts as a guide for the RNase complex to cleave mRNA complementary to the antisense strand of the siRNA thereby resulting in destruction of the mRNA.
According to a further aspect of the invention there is provided a virus like particle comprising an artificial nucleic acid cassette according to the invention.
In a preferred embodiment of the invention said virus like particle is immunogenic when administered to a subject. Preferably said virus like particle provokes an immune response similar to an immune response to the cognate native virus.
In a preferred embodiment of the invention said immune response is induction of an antibody response wherein said antibody response induces antibodies that specifically bind native virus particles.
In a preferred embodiment of the invention said virus like particle retains or has enhanced cell tropism when compared to native virus particles.
According to a further aspect of the invention there is provided a vaccine or immunogenic composition comprising a virus like particle according to the invention.
In a preferred embodiment of the invention said vaccine or immunogenic composition further comprises an adjuvant and/or carrier.
Adjuvants (immune potentiators or immunomodulators) have been used for decades to improve the immune response to vaccine antigens. The incorporation of adjuvants into vaccine formulations is aimed at enhancing, accelerating and prolonging the specific immune response to vaccine antigens. Advantages of adjuvants include the enhancement of the immunogenicity of weaker antigens, the reduction of the antigen amount needed for a successful immunisation, the reduction of the frequency of booster immunisations needed and an improved immune response in elderly and immunocompromised vaccinees. Selectively, adjuvants can also be employed to optimise a desired immune response, e.g. with respect to immunoglobulin classes and induction of cytotoxic or helper T lymphocyte responses. In addition, certain adjuvants can be used to promote antibody responses at mucosal surfaces. Aluminium hydroxide and aluminium or calcium phosphate have been used routinely in human vaccines. More recently, antigens incorporated into IRIV's (immunostimulating reconstituted influenza virosomes) and vaccines containing the emulsion-based adjuvant MF59 have been licensed in countries. Adjuvants can be classified according to their source, mechanism of action and physical or chemical properties. The most commonly described adjuvant classes are gel-type, microbial, oil-emulsion and emulsifier-based, particulate, synthetic and cytokines. More than one adjuvant may be present in the final vaccine product. They may be combined together with a single antigen or all antigens present in the vaccine, or each adjuvant may be combined with one particular antigen. The origin and nature of the adjuvants currently being used or developed is highly diverse. For example, aluminium based adjuvants consist of simple inorganic compounds, PLG is a polymeric carbohydrate, virosomes can be derived from disparate viral particles, MDP is derived from bacterial cell walls; saponins are of plant origin, squalene is derived from shark liver and recombinant endogenous immunomodulators are derived from recombinant bacterial, yeast or mammalian cells. There are several adjuvants licensed for veterinary vaccines, such as mineral oil emulsions that are too reactive for human use. Similarly, complete Freund's adjuvant, although being one of the most powerful adjuvants known, is not suitable for human use.
The term carrier is construed in the following manner. A carrier is an immunogenic molecule which, when bound to a second molecule augments immune responses to the latter. Some antigens are not intrinsically immunogenic yet may be capable of generating antibody responses when associated with a foreign protein molecule such as keyhole-limpet haemocyanin or tetanus toxoid. Such antigens contain B-cell epitopes but no T cell epitopes. The protein moiety of such a conjugate (the “carrier” protein) provides T-cell epitopes which stimulate helper T-cells that in turn stimulate antigen-specific B-cells to differentiate into plasma cells and produce antibody against the antigen.
According to a further aspect of the invention there is provided a pharmaceutical composition comprising a virus like particle according to the invention and including a pharmaceutically acceptable excipient.
When administered the compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and supplementary therapeutic agents'. The compositions of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal or trans-epithelial.
The compositions of the invention are administered in effective amounts. An “effective amount” is that amount of an agent that alone, or together with further doses, produces the desired response. In the case of treating a disease, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods. Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.
The compositions used in the foregoing methods preferably are sterile and contain an effective amount of an agent according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient. The doses of agent administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits.
In general, doses of nucleic acid therapeutics such as siRNA and antisense RNA are between 1 nM-1 mM. Preferably doses can range from 1 nM-500 nM, 5 nM-200 nM, and 10 nM-100 nM.
Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.
When administered, the compositions of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents' (e.g. those typically used in the treatment of the specific disease indication). When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.
The pharmaceutical compositions containing agents according to the invention may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. Compositions containing agents according to the invention may be administered as aerosols and inhaled. Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of agent, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.
According to a further aspect of the invention there is provided a virus like particle according to the invention for use in the delivery of an agent to a cell.
According to an aspect of the invention there is provided a method to vaccinate or immunise a subject to prevent or treat a viral infection comprising administering an effective amount of a virus like particle according to the invention.
Throughout the description and claims of this specification, the words “comprise” and “contain” and variations of the words, for example “comprising” and “comprises”, means “including but not limited to”, and is not intended to (and does not) exclude other moieties, additives, components, integers or steps. “Consisting essentially” means having the essential integers but including integers which do not materially affect the function of the essential integers.
Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith.
An embodiment of the invention will now be described by example only and with reference to the following figures:
The icosahedrally-averaged cryo-EM structures of
ARD within a Cp dimer inhibit formation of a dimer of dimers, the first intermediate on the pathway to NC assembly. Reducing the net charge on the ARD by phosphorylation or PS RNA binding allows this structure to form more easily, triggering NC formation. At concentrations higher than those mimicking in vivo conditions as used here, the unmodified dimer of dimers forms and particles self-assemble without RNA or will bind RNA non-specifically to produce the same outcome;
Slabs (˜30 Å thick) through the structures of the icosahedrally-averaged T=4 particle at 4.7 Å (left), the same T=4 structure low pass filtered to 7 Å (middle), and the T=3 particle at 5.6 Å (right). A Cp dimer is fitted into each. Even at a slightly lower resolution than the T=3 VLP, there is no equivalent density for the ARD in the T=4 VLP, confirming that it has different conformations in each particle.
Anisotropy was used to determine if 15 nM of Alexa-Fluor-488 labelled RNA PS oligos can bind to, or enter, 125 nM of preformed shells of Cp. The latter were formed by reassembly in the absence of RNA at high concentration(3) (
We obtained an E. coli Cp-expressing plasmid (a gift of Prof. Nicola Stonehouse), known to produce assembled HBV VLPs containing host RNAs(5). The Cp encoded has the following amino acid sequence differences compared to the current GenBank reference strain (NC_003977.2): A61, E77-FAGAS (single letter amino acid code) -D78 insertion, S92N, F102I, I121L, R156-RD-R157 insertion. Since the wild-type C61 has been implicated in assembly(6), this was restored to the gene before expression in a PET28b plasmid in BL21(DE3) E. coli cells. The inserted FAGAS epitope was also removed. Induction with 1 mM IPTG at 0.6 OD was followed by growth for 20 hrs at 21° C. Cells were lysed using a Soniprep 150 with 5×30 sec bursts on ice. The lysate was then clarified by spinning at 11,000 g for 1 hr. VLPs were then pelleted by centrifugation at 120,000 g for 14 hr, resuspended in 20 mM Hepes (pH 7.5), 250 mM NaCl, and 5 mM DTT and applied to an XK50 column packed with 25 ml of Capto™core 700 resin (GE Life Sciences). Fractions containing VLPs were pooled and precipitated with 40% (w/v) ammonium sulphate. The Cp appeared pure on SDS-PAGE and its identity, and that of variants, was confirmed by mass spectrometry (Table 1). Cp lacking the ARD, i.e. Cp149, was produced by mutagenesis (Q5 site-directed mutagenesis kit, NEB) and prepared similarly. Note, the Cp149 VLP expressed in E. coli lacks significant encapsidated cellular RNA. VLPs were visualised by negative stain transmission electron microscopy (TEM). Full length Cp VLPs were additionally purified by sucrose density gradient before dye-labelling using Alexa Fluor-488 SDP ester (Invitrogen) over 4 hrs at room temperature in 200 mM sodium carbonate buffer (pH 8.3), followed by desalting over a NAPS column. There were two over-lapping VLP peaks on the gradient and it was impossible to separate them. TEM and smFCS confirm that they are the expected T=3 and T=4 shells, with the latter the predominant form (
All HBV variants used for assembly assays were dissociated from VLPs into protein dimers as previously described(3), with the exception that dissociation was at pH 9.5, as opposed to 7.5. This was done in the presence of Complete Protease Inhibitor Tablets (Thermofisher Scientific). HBV core dimer concentration was determined by UV absorbance. Fractions with an A260:A280 ratio of approximately 0.6 or lower were used in assembly assays. SRPKΔ kinase was expressed and purified from a pRSETb plasmid, as previously described(8).
Purified HBV capsids (˜360 μg) were immobilised onto 6 mg of M270 carboxylic acid Dynabeads (Thermofisher Scientific) following the manufacturer's protocol. Beads were washed twice with selection buffer (25 mM Hepes, pH 7.5, 250 mM NaCl, 2 mM DTT, EDTA-free complete protease inhibitor) and unreacted N-hydroxysuccinamide blocked with a 15 m 50 mM Tris-HCl pH 7.4 wash. Beads were washed a further three times with selection buffer. Immobilised capsids were dissociated with a 30 minute incubation of 2 M guandinium chloride in 0.5 M LiCl2. Beads were then washed three times with B&W buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl) and then washed three times with selection buffer. Beads were resuspended in selection buffer so that concentration of beads was 10 mg/mL. Negative selection beads were also prepared in the same manner but with no capsids. Ten rounds of SELEX were performed in vitro using a synthetic, combinatorial N40 2′OH RNA library (˜1024 potential sequences) as described previously(9). The amplified DNA of round 10 was then subjected to Next Generation Sequencing on an IIlumina MiSeq platform. This yielded ˜1.6M sequence reads, in which one sequence occurs 65,802 times and there are 1149 aptamers with a multiplicity of 100 or higher. The overall frequencies of the four nucleotides in this aptamer pool is A34.30%; C9.09%; G40.97% & U15.64%, and compares with the same data for the unselected naïve library of A26.10%; C22.03%; G24.64% & U27.22%. The highest multiplicity for sequences in the latter pool is 4. These data confirm that selection from the naïve pool occurred, and that the base composition of the selected aptamers is consistent with the RGAG motif identified within the HBV genomes.
PS identification was carried out using the laboratory HBV strain (*NC_003977.1). The aptamer library contained 1,664,890 unique sequences, each 40 nts in length that have been aligned against the genome as follows: Each aptamer sequence was slid along the genome in increments of 1 nt. For each such position of the reference frame, the subset of the aptamer sequence with the best alignment to the genome was identified according to the Bernoulli score B, which benchmarks the probability of a non-contiguous alignment to that of a contiguous alignment of B nucleotides. The Bernoulli scores for all reference frames of a given aptamer sequence in the library were rank-ordered starting from the largest score, and all matches with the genome up to a Bernoulli score of 12 counted. The procedure was then repeated for the other aptamer sequences and corresponding matches added, resulting in the peaks in
HBV genome sequences with the following accession numbers were randomly extracted from 750 complete HBV genomes found in GenBank: KCS10648.1; *AF223955.1; AY781181.1; *AB116266.1; AB195943.1; KR014086.1; *KR014072.1; KR014055.1; KR013939.1; KR013921.1; KR013816.1; KR013800.1; EU796069.1; AB540582.1, and the NCBI HBV reference strain (GenBank Seq ID *NC_003977.2) and the laboratory strain (GenBank Seq ID NC_003977.1) were added to the ensemble. Sequences used for the statistical analysis in
PS1, PS2 and PS3 (47 nucleotides long) were purchased from Integrated DNA Technologies with a 5′ C6-amino group. To label RNA, 6 μL of RNA (200 μM) was mixed with 1 μL 1 M sodium borate buffer, pH 8 and 3 μL 10 mM Alexa-488-SDP (Thermofisher Scientific) and rolled at room temperature for 4 hours. 10 μL of 2× denaturing loading dye was then added to the RNA, boiled for 5 minutes and loaded onto a pre-warmed denaturing PAGE. RNA was gel extracted, isopropanol precipitated and finally re-suspended in DEPC-H2O and frozen at −80° C. until needed.
Assembly reactions were performed by adding HBV Cp in dissociation buffer (50 mM Tris (pH 9.5), 1.5 M GuHCl, 500 mM LiCl and 5 mM DTT) to 15 nM Alexa-488 labelled RNA in a reassembly buffer containing 20 mM Hepes (pH 7.5), 250 mM NaCl, 5 mM DTT and 0.05% (v/v) Tween-20 at 25° C. Successive additions of dimer were performed until assembly was deemed complete by the measured Rh value plateauing, but never exceeded 10% of total reaction volume. Each addition of Cp is marked by a vertical dashed grey line in the titration plots and the expected hydrodynamic radii of T=3 and T=4 particles (as determined for dye-labelled particles expressed in E. coli) are marked by an orange horizontal dashed line within figures.
Manual mixing throughout the reactions caused an approximate 1 min delay at the start of FCS data collection. FCS measurements were made using a custom-built FCS setup with 30 sec data accumulation per autocorrelation function (CF). Individual CFs were decomposed into triplet state relaxation and diffusion (characterized by diffusion time, TD) components, and the latter was converted into an apparent hydrodynamic radius, Rh(11). Samples for TEM were taken at the end of each measurement. Plots of Rh over time (thin dashed line) were smoothed (thick solid line) using the FFT filter in Origin Pro-8 with a cutoff percentage of 35%. Plots of Rh distribution were also fitted using Origin Pro-8 software, to a normal single or multiple peak Gaussian function. Samples taken for negative stain TEM analysis were placed on to a glow discharged carbon coated formvar 300 mesh Cu grid. Grids were stained with 2% uranyl acetate and dried.
Assembly was carried out as in smFCS experiments. In particular, Cp was titrated into reassembly buffer with and without 15 nM unlabelled PS1 to a final concentration of 250 nM. This was allowed to incubate at room temperature for 1 hour, and then buffer exchange was carried out via dialysis to remove guanidinium hydrochloride present. Labelling of protein was then carried out by adding Alexa Fluor-488 SDP ester (1:50 ratio of dye to Cp dimer) and incubating overnight at 4° C. The resulting sample was then measured via smFCS in 30 s bins for 100 min and the Rh data plotted as above in a hydrodynamic radial distribution plot. A sample was then removed for analysis via TEM. Post labelling, Cp dimer became assembly incompetent, therefore Cp could not be tracked during real time assembly.
HBV VLPs containing Alexa-488 labelled PS1 were assembled as described in smFCS assembly assays. Under those conditions all RNA is bound to protein as judged from fluorescence quenching and photon counting in the FCS experiments. VLPs were then added to two glow discharge-irradiated Carbon/Formvar 300-mesh grids (Agar Scientific), and one grid stained with 2% (w/v) uranyl acetate and viewed with a Jeol 1400 microscope at 40,000× magnification. The remaining, unstained grid was positioned Formvar side down onto a clean microscope coverslip and mounted onto an inverted TIRF microscope. The laser (Coherent Sapphire, 488 nm, 25 mW) power was adjusted to excite and photobleach the labelled RNA within the time frame of several minutes. Sequential images were taken with an emCCD camera (Andor iXon) with 0.2 sec exposures and em gain of 200. An unexposed field of view was used for each series.
Fluorescent spots were identified in the collected frames using previously described procedures and converted into time traces(12). These were then inspected and classified according to the number of photobleaching steps. Frequencies of traces with a defined number of steps were collated in a histogram. Several bright spots per field of view exhibited continuous intensity decay, presumably representing larger aggregates. These were used to estimate the overall photobleaching rate (0.003 per frame) and formally included in the histogram as representing 10 steps. The histogram without the bin representing continuum events was modelled as a weighted sum of binomial distributions for up to quadruple occupancy and probability of labelling of 0.56 estimated from UV-Vis spectra.
smFCS experiments were scaled up into 96 well plates. Two 96 well plates (Non-Binding Surface, Corning) were used. PS1 RNA was labelled and gel purified as described earlier and HBV dimer was purified as described above. Each well contained 200 μL of 15 nM PS1 in re-assembly buffer. As in smFCS, ten 2 μL injections of 2.5 μM dimer in dissociation buffer were performed. A Perkin-Elmer Envision plate reader was used to carry out the injections and record the anisotropy of the PS1 RNA (FITC excitation and emission filters). VLPs were purified away from free RNA and capsid using a 1.33 g/mL caesium chloride gradient and spun at 113,652×g for 90 hours using an SW40Ti rotor. A single band was observed and fractionated. The band was dialysed into reassembly buffer to remove caesium chloride. The 2 mL fraction of VLP was concentrated to 200 μL using an Amicon 100 kDa MWCO spin concentrator.
After recovery of the PS1-containing VLPs and removal of caesium chloride by dialysis, their structures were analysed using single-particle cryo-EM. VLPs were vitrified. 200 mesh EM grids with Quantifoil R 2/1 support film and an additional ˜5 nm continuous carbon film were washed using acetone and glow discharged for 40 s prior to use. CryoEM grids were prepared by placing 3 μl of ˜3.2 mg/ml HepB VLP on the grid, before blotting and plunge freezing using a Leica EM GP freezing device. Chamber conditions were set at 8° C. and 95% relative humidity, with liquid ethane temperature at −175° C. Data was collected on a FEI Titan Krios (eBIC, Diamond Light Source, UK) transmission electron microscope at 300 keV using an electron dose of 27 e−/Å2/s, 2.5 s exposure, yielding a total electron dose of 67.5 e−/Å2. Data was recorded on a 17 Hz FEI Falcon 11 direct electron detector. The dose was fractionated across 33 frames. Final object sampling was 1.34 Å per pixel. A total of 2397 micrographs were recorded using EPU (FEI) automated data collection software.
2397 micrographs were motion corrected and averages of each movie were generated using MotionCorr(13), and contrast transfer function (CTF) parameters for each were determined using CTFFIND4(14). Micrographs with unacceptable astigmatism or charging, as determined by examining the output from CTFFIND4, were discarded leaving a total dataset of 1710 micrographs. All particle picking, classification and alignment was performed in RELION 1.3(15).
Approximately 57,000 particles were manually picked and classified using reference-free 2D classification in RELION 1.3. This classification confirmed the initial visual impression that although the VLPs were purified as a single band on a caesium gradient, two sizes of VLPs were present. A selection of resulting 2D class averages were used as templates for automated particle picking. The particle stack generated using auto-picking was subject to 2D classification to separate T=3 and T=4 particles, and to remove particles not corresponding to VLPs. The subsequent particle stacks (5589 for T=3, 42,411 for T=4) were subject to 3D classification, using a sphere with the approximate diameter of the VLP as a starting model. Subsets of the data were reconstructed including data out to the Nyquist frequency using the 3D autorefine option in RELION with 13 symmetry imposed to generate all structures presented in this work. Within the T=4 42,411 particle dataset it was clear that a further subset (10,851 particles) of the data contained a significant asymmetric feature inside the Cp shell where RNA binding would be expected to occur. An asymmetric (C1) reconstruction was performed on a relatively homogenous set of 10,851 such particles, giving the reconstruction at 11.5 Å resolution.
The 3D model of PS1 RNA was made using RNA Composer(16). The cryoEM figures were rendered using USCF Chimera(17).
Recombinant STNV VLPs were purified from E. coli(18). STNV charge-change mutant plasmids were created using primers designed using Agilent, and a Quikchange site directed mutagenesis kit (Agilent). CP monomers were purified by disassembly in 50 mM Tris (pH 8.5), 10 mM EDTA, in the presence of Complete Protease Inhibitor Cocktail (Roche, United Kingdom). STNV CP was separated from the mRNA by sequential Q-Sepharose, and SP-Sepharose columns (GE Healthcare, Sweden). STNV CP was washed with 20 column volumes of 50 mM HEPES (pH 7.5) and 25 mM NaCl to remove residual EDTA, and subsequently eluted using a 0.025-2 M NaCl gradient in buffer. CP elutes at 0.8 M NaCl. STNV CP was analysed by SDS-PAGE and its concentration determined by UV absorbance. Fractions with an A260:A280 ratio of 0.6 or lower were used in assembly assays. Mutant CPs that did not form VLPs during overexpression were purified using the same sequential Q-Sepharose and SP-Sepharose columns method.
dsDNA transcripts encoding the RNA oligonucleotides used in this study were produced using primers and the KAPA2G system (KAPA biosystems) following the manufacturer's protocol. Transcriptions were carried out using a Highscribe T7 High yield RNA synthesis kit (NEB). Products were run on a denaturing RNA gel. The Alexa Fluor 488 labelled B3 oligonucleotide used throughout was synthesised and HPLC purified by DNA Technology A/S (Denmark). Other RNA oligonucleotides requiring a 5′ fluorophore were labelled with an amino GMP during transcription and cross linked to an Alexa Fluor 488 SDP ester (Invitrogen) prior to gel purification as described previously(19).
Genomic chimeras were created by purchasing Gene blocks of the Synthetic, stabilised and Unstable+Δ1-127 STNV-1 constructs with a 5′ T7 promoter (IDT DNA technology), possessing BamHI and HindIII cleavage sites at either end to create sticky ends after restriction digestion and dephosphorylation using Antarctic phosphatase (NEB). This gene block was then ligated into a PACYC184 plasmid using T4 DNA ligase (NEB). Transcription was carried out as above after linearization using BarnHI.
RNA was annealed prior to each experiment by heating to 80° C. for 90 s and cooling slowly to 4° C. in a buffer containing 50 mM NaCl, 10 mM HEPES and 1 mM DTT at pH 7. Genomes were only heated to 65° C.
STNV Reassembly in the Presence of B3 Variants and Sedimentation Velocity Analytical Ultracentrifugation (svAUC) Reassembly reactions were carried out in the presence and absence of B3 variants in a 1:3 RNA:CP ratio at a final CP concentration of 4.5 μM, by dialysis into a buffer containing 50 mM HEPES (pH 7.5) and 2 mM Ca2+. All samples were analysed by TEM and AUC. For AUV, 0.32 mL of each sample was placed in a 1.2 cm path length 2-sector meniscus matching epon centrepiece cell constructed with sapphire windows. The samples were centrifuged at 15,000 rpm in an Optima XL-1 analytical ultracentrifuge at 20° C. in an An50-Ti rotor. Changes in absorbance at 260 nm were detected by absorbance optics with 100 scans taken in approximately 11 hrs 30 min. Data were fitted and analysed using the program Sedfit.
smFCS Data Collection and Analysis
FCS measurements were performed on a custom-built smFCS facility. Excitation laser (Sapphire CW blue laser, 488 nm, Coherent, USA) power was set to 65 μW. The focus position was adjusted to 20 μm from the cover slip inner surface (maintained by piezoelectric feedback loop, Piezosystems Jena, Germany). Immersion oil (refractive index 1.515, type DF, Cargille Laboratories, USA) was used with immersion oil objective (63× magnification, numerical aperture 1.4). The photon count was recorded and analysed by an ALVL5000 multiple tau digital correlator (ALV-GmbH) in single channel mode. FCS data was analysed using non-linear, least-squares fitting with a single component diffusion model autocorrelation function corrected for the triplet state in Matlab. Diffusion time was used in the calculation of apparent hydrodynamic radius (Rh) and plotted as a function of assembly time. Rh calculations were based on the measured diffusion time for Alexa Fluor 488 dye with the estimated Rh of the dye (=˜0.7 nm in assembly buffer).
smFCS Assembly and Competition Assays
Initial measurements of Alexa Fluor 488 labelled RNA oligonucleotides were taken for at least 10 runs of 30 secs (5 min). Purified STNV CP was titrated into labelled RNA. Each titration was measured for a minimum of 10 30 secs runs. In assembly assays this was repeated until full capsid assembly had occurred. At this point RNase A was added to confirm RNA protection. In competition assays, once the sample had formed a capsomer structure (Rh=˜5 nm) the sample was monitored for a further 120 runs of 10 secs (20 min to ensure stability). At this point unlabelled B3 short/B3 variant competitor was added in 100-fold molar excess and measured for 120 runs of 10 secs.
Transcribed oligonucleotides were diluted to 1.5 μM in 300 μl, in a buffer containing 10 mM MES, 50 mM NaCl and 1 mM DTT at pH 6. Measurements were performed on a Jasco J715 spectropolarimeter, from 200 to 350 nm, with a bandwidth of 2 nm. Each Ca2+ and STNV titration was inverted 5 times and allowed to reach equilibria for 2 min prior to the next measurements. Thermal denaturations were performed using a Peltier temperature control from 10-95° C. in 5° C. steps, and an end scan was performed at 10° C. to check for cleavage. Each measurement was performed in triplicate and averaged. Data was converted to molar ellipticity using the equation: Δε (cm2 mM-1)=θ/(32980 C(mM) L(cm) N(no. of nt)).
Light Scattering Assay of Reassembly with Genomic RNA Variants
Reassemblies were performed with genomic chimeras in a 96 well plate as in the smFCS assays, with 1 nM genome and CP titrated in until a final concentration of 400 nM STNV CP was reached. This was concentrated through a 100 kDa centricon (millipore) at 10 k×g for 5 min and run on a TSKgel G6000PW×I SEC column (Tosoh) with an AKTA pure system (GE Healthcare) connected to a DAWN HELEOS and Optilab TrEX for QELS and refractive index measurements. The column flow-rate was 0.4 ml min-1 for 50 min. Peaks were fractionated, A260/280 ratios measured and EM images obtained (
The HBV pgRNA Contains Preferred Cp Binding Sites
HBV VLPs assembled from (full-length) Cp subunits expressed in E. coli were purified as described(3) (
The RNA sequences that bind Cp in the selected library were aligned to the HBV pre-genome most closely related to the protein used for the SELEX experiments (the laboratory strain, GenBank Seq id NC_003977.1 (21)). Statistically significant matches (a Bernoulli score of 12 or more, Methods) to the pgRNA of this strain (the blue peaks in
We computed the frequency of this motif in stem-loops across the 16 HBV strains analysed. Across all strains, the RGAG motif occurs in stem-loops on average ˜25.4 times (precisely 25 times in the laboratory strain). Compared to 10,000 randomised versions of the pgRNAs, the frequency of occurrence of RGAG in the actual genome is 4.68 standard deviations above the average (
pgRNA Oligonucleotides Trigger VLP Formation In Vitro
PS1, 2 & 3 oligonucleotides (
Each of the PS fragments stimulates assembly of both T=3 and T=4 complete VLPs with roughly equal efficiency under these conditions (
We then probed the RNA sequence-specificity of these reactions (
The C-terminal ARD of the HBV Cp is believed to mediate interactions with the pgRNA, and the 1-149 Cp fragment that lacks the ARD readily assembles in the absence of nucleic acid(23). We therefore assessed the ability of Cp149 to respond to PSs in the smFCS assay. No RNA-dependent assembly, or PS binding by Cp149, occurs under these conditions (
The VLPs assembled around PS1 were purified on a larger scale and their structures determined by cryo-EM, yielding icosahedrally-averaged reconstructions of the T=3 and T=4 particles (
From the EM map at this resolution it is not possible to determine the number of PS oligonucleotides present in the complex. The A260/280 ratio of the purified VLP suggests that the RNA content, assuming T=4 morphology, is ˜5 oligos/particle(25). An additional estimate of this stoichiometry was obtained by studying photobleaching of PS1 VLPs (
The cryo-EM data hint at a further insight into HBV biology. A minority of HBV particles, whether from assembly reactions or wild-type virus infections, assemble with T=3 quasi-symmetry and both types of particles are visible in our cryo-EM data. Using 2D and 3D classification the T=3 (˜11%) and T=4 (89%) particles are readily separable.
There are multiple consequences of sequence-specific RNA-CP recognition in the STNV system (
These results highlight the importance of PS3 recognition by CP for assembly. In order to identify the critical features of that recognition, we produced a series of SLs encompassing variant loop sequences with the PS3 stem (
In order to examine their relative importance for CP affinity, we adapted the smFCS assay (
PS-mediated assembly explains features of viral genome packaging that purely electrostatically driven reactions do not, although there is clearly a beneficial effect of charge neutralisation in supplying some of the free energy to drive encapsidation. We therefore examined the importance of these effects on STNV assembly using a series of charge-change CP variants. Mutations at three positively charged residues R8, R14 and K17 in the N-terminal arm of the CP (
All the variant proteins were examined for their abilities to bind RNA oligos encompassing either a single PS (B3) or the 127-mer fragment (
The interpretation of these results is non-trivial. The effects are clearly not purely electrostatic in nature since the PS2-4 fragment (66 nts) is shorter than PS1-3 (76 nts) and 1 nt shorter than PS3-5. To understand the specificity of the reactions we need to consider the folding propensity of each of the PS-encompassing sites. The secondary structure of the 127-mer shown (
When such structures are examined for the three PS-containing fragments, a possible explanation for their assembly competencies emerges. For PS1-3, the dominant folds encompass PS1 with a minority also containing PS3 (Table 5). In principle, that minor conformer could promote assembly, but the critical spacing between PS1 and PS3 is too large to facilitate the co-operative effects of multiple PSs. A similar analysis of PS2-4 suggests that the dominant secondary structure does not contain any of the PS folds expected for the 127-mer. However, its predicted secondary structure contains two alternative SLs that are almost always present, one of which presents an -A.X.X.A- sequence (
The conformational scrambling behaviour described above for the fragments encompassing three PSs probably reflects events in vivo where it is known that sequences within the 127-mer participate in formation of a translational enhancer with sequences in the 3′ UTR(29). That complex cannot be present in the assembly competent conformer. In order to explore the effects of such secondary structure folding propensity further, we turned to the design of artificial PS-containing sequences.
In order to investigate the requirements for an efficient assembly substrate, we produced synthetic cassettes mimicking aspects of the wild-type 127 mer (PS1-5) in which most of the natural viral sequence has been replaced (˜77%). Attempts to create these sequences using a simple base substitution scheme, e.g. swapping all As for Us; Cs for Gs, Gs for Cs and Us for As in the regions other than the CP recognition motifs, all resulted in unstable secondary structures. We therefore chose to modify the existing SLs by conversion of base pairs to G-C, inversion of existing G-C pairs, or adding extra base pairs and then checking that they would likely fold into similar secondary structures to those in the wild-type 127-mer. The natural viral sequences connecting these SLs were then replaced with strings of As and Gs until only one fold was most likely (
To assess the importance of the folding propensity of the dominant PS3 site we also created the following synthetic versions: 1) Unstable PS1-5, in which the folding free energy of PS3, the central PS, is positive (0.3 vs −2.6 kcal/mol), i.e. a scenario in which PS3 is unlikely to fold spontaneously; 2) Stable PS1-5, in which the folding free energy of the central PS is more negative (−3.5 vs −2.6 kcal/mol for the 127-mer), i.e. where PS3 is more stable; 3) All PS3, in which all five PSs mimick PS3, with stems of all PSs extended to the same length (7 bp) and all CP recognition motifs identical to that in wild-type PS3; & 4) Synthetic, stabilised PS1-5, containing the artificial PSs 1, 2, 4 and 5 from Stable PS1-5, and the artificial extended stem-loop for PS3 from the All PS3 construct. The latter is hyper-stabilised with respect to the PS3 in both the wild-type 127-mer and the Stable PS1-5 (−7.6 vs −2.6 or −3.5 kcal/mol, respectively).
In order to compare the behaviours of these test variant oligonucleotides we examined their potential secondary structures. Table 5 lists the frequency of occurrence of each PS in ensembles created using the suboptimality feature in Mfold, together with their relative spacings. In addition, we compared their circular dichroism (CD) spectra. CD provides a physical signal(30), the molar ellipticity at 260 nm, that is proportional to the percentage of base-paired residues and/or tertiary structure. The measurements were made in a buffer containing calcium ions since these are required in the reassembly buffer, there being several Ca2+ binding sites within the STNV capsid (38, 39). Titration of the test RNAs up to 2 mM calcium, the concentration in reassembly buffers, results in mild increases (9-17%) in the 260 nm ellipticity, as expected (
All these synthetic variants trigger assembly of T=1 capsids and are able to protect the encapsidated RNA from challenge by nuclease but with very different CP concentration dependences. All but the Unstable PS1-5 show similar initial decreases in Rh to the 127-mer (
These results suggest that it is possible to abstract the critical assembly features from a viral genomic RNA fragment. Given the alterations in the stem lengths and loop sizes in the synthetic fragments it would also appear that there is considerable scope for engineering templates with improved PS folding propensity.
As a test of whether these experiments have successfully identified essential assembly features we examined how inclusion of this improved RNA “cassette” alters the assembly efficiency of a natural RNA. That RNA must be inherently able to be assembled into the small volume of the STNV virion. The genomic fragment from 128-1239 nts of the STNV-1 RNA is the obvious test fragment. We therefore constructed two genomic chimeras: [Unstable PS1-5+Δ1-127STNV-1], which is 1242 nts long and [Synthetic, stabilised PS1-5+Δ1-127STNV-1], 1248 nts long, and compared their assembly efficiencies in vitro relative to the wild-type STNV-1 RNA (
We have shown that the dual code inherent in RNA PS-mediated virus assembly, i.e. that genomic RNAs simultaneously encode a genetic message as well as instructions for efficient capsid assembly, are separable. An important question is why do the codes not separate during the course of viral evolution, especially as replication in ssRNA viruses occurs via error-prone processes that lead to creation of a quasi-species of genome variants. There are now three examples of viruses using RNA PS-mediated virus assembly where we have structural information that partially answer this question. In bacteriophage MS2(31), human parechovirus-1(32) and STNV(19), at least one of the PS sites in the genome also encodes amino acid residues forming part of the PS binding site. This intimate embedding of both codes has the consequence of favouring assembly only of progeny RNAs in which PS-mediated assembly persists. Similarly the density of functions encoded within such RNAs is well known. The natural 5′ 127-mer in the STNV genome also forms an essential transcriptional/translational enhancer contact with the 3′ end sequence. Since that structure and assembly are mutually excluding functions, the natural sequence has evolved to balance the propensity that they form such that the viral lifecycle can proceed efficiently.
The focus here is the property of the assembly code liberated from the wild-type viral RNA sequence. Indeed, by sequentially investigating each aspect of the STNV assembly sequence in its natural context we have been able to reproduce its effects in triggering in vitro assembly of STNV CPs using a synthetic non-viral RNA. Additional refinements allow us to produce sequences that are either less or more efficient than the wild-type STNV 127-mer. These results confirm the nature of PS-mediated assembly for STNV. Assembly in vitro initiates within the 127-mer by recognition by CP subunits of the PS3 stem-loop. Higher-order CP binding is dependent on the correct positioning and folding of the neighbouring PSs (PS2 and 4), each presenting a consensus CP recognition motif in the loop. The 127-mer potentially encompasses five PSs that make the initial binding co-operative with respect to protein concentration leading to a collapse in the hydrodynamic radius of the RNA, a necessary precursor to encapsidation. Electrostatic interactions contribute to these protein-RNA contacts but are not the major driving force, which instead is a high-affinity sequence-specific interaction of the stem and loop regions of the PSs with the inner surface of the protein capsid. Despite its minimal sequence content, the -A.U.U.A- sequence is bound with low nanomolar affinity by the CP. Remarkably, grafting the synthetic variant 127-mers onto the remainder of the natural STNV-1 genome results in chimeras whose assembly properties are dominated by the first ˜10% of the RNA.
Previously, Wilson and colleagues showed they could direct assembly of non-viral RNAs into rods of Tobacco Mosaic Virus (TMV) CP by creating RNA chimeras encompassing the TMV assembly initiation site(33, 34). This was successful, with the length of the protein-coated rods formed being determined by the length of the RNA being packaged, as expected from the known assembly mechanism(35). This approach was less successful when applied to spherical ssRNA viruses(36), the highest affinity MS2 PS having positive effects on in vitro encapsidation of short RNAs but being less important on longer ones(37). Note, all these experiments were done at micromolar concentrations where the effects of PS-mediated assembly are lost(31, 37). The results described above suggest an efficient route for encapsidation of bespoke, non-viral RNAs in shells of viral CPs. In vitro assembly may be possible for a large number of CP-RNA combinations, but it differs from in vivo assembly where, in many viruses, there is good evidence suggesting that only nascent genomic transcripts emerging from the viral polymerase complex are packaged into progeny virions. In such reactions, the RNA is very likely to fold kinetically, avoiding some of the issues with RNA conformational ensembles in the in vitro reactions such as those described here.
Viruses and virus-like particles are finding increasing potential medical applications as gene therapy or drug-delivery vectors, as well as acting as non-replicating synthetic vaccines. Viral protein shells are also of interest for nanotechnology applications. The results described here offer an important insight into ways to create such structures with high efficiency and potentially carrying non-viral RNAs with advantageous properties. This will be essential for the production of designer synthetic virions.
| Number | Date | Country | Kind |
|---|---|---|---|
| 1708709.9 | Jun 2017 | GB | national |
This is the U.S. National Stage of International Application No. PCT/GB2018/051475, filed May 31, 2018, which was published in English under PCT Article 21(2), which in turn claims the benefit of Great Britain Application No. 1708709.9, filed Jun. 1, 2017.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/GB2018/051475 | 5/31/2018 | WO | 00 |
