Patent Application
20240390517
The disclosure relates to variant AAV8 capsid polypeptides that exhibit altered capsid properties, e.g., improved transduction efficiency and/or specificity for the liver. The present disclosure further relates to nucleic acids encoding the variant AAV8 capsid polypeptides, recombinant AAV (rAAV) vectors comprising the variant AAV8 capsid polypeptides, as well as host cells and pharmaceutical compositions comprising the same. The present disclosure further relates to methods of delivering a gene product to a subject, the methods generally involving administering an effective amount of the rAAV vectors to a subject in need thereof. The present disclosure also relates to methods of treating a liver-borne blood disorder in a human subject in need thereof, the methods generally involving administering an effective amount of the rAAV vectors to a subject in need thereof.
Introduction and expression of therapeutic genes in the liver has great therapeutic value in treating a variety of disorders or diseases that arise from or are related to liver cells or liver function. Recombinant adeno-associated virus (AAV) has shown great promise as a gene therapy vector in multiple aspects of pre-clinical and clinical applications. Previous AAV vectors in clinical development are based on naturally occurring AAV serotypes (e.g., AAV2, AAV8) or recombinant modified capsid surface viruses. These AAV vectors often have low tissue specificity or insufficient tissue transduction. Improved AAV vectors with high liver specificity and/or efficient liver transduction are in need for successful liver-targeted gene therapy.
In one aspect, provided herein is a variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 1-50. In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 11, 15, 16, 18, 19, 26, 27, 29, 32, 34, 35, 36, 38, 40, 42, 43, and 45. In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 19, 26, 27, and 42. In one embodiment, the peptide insertion comprises an amino acid sequence of SEQ ID NO: 27. In some embodiments, the peptide insertion further comprises a G at the N-terminus and an A at the C-terminus. In some embodiments, the three amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQS or GQR and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA. In some embodiments, the variant AAV8 capsid polypeptide has tropism for liver.
In another aspect, provided herein is a variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 51-100, and wherein N590 is deleted. In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95. In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 69, 76, 77, and 92. In one embodiment, the peptide insertion comprises an amino acid sequence of SEQ ID NO: 77. In some embodiments, the peptide insertion further comprises an A at the C-terminus. In some embodiments, the two amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQ or GQ and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA. In some embodiments, the variant AAV8 capsid polypeptide has tropism for liver.
In various embodiments, the variant AAV8 capsid polypeptide is a VP1, VP2, or VP3.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and 200.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, and 190.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 154.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and 200.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, and 190.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NO: 154.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of amino acids 138-747 of any one of the variant AAV8 capsid polypeptides described above.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of amino acids 204-747 of any one of the variant AAV8 capsid polypeptides described above.
In another aspect, provided herein is a nucleic acid encoding a variant adeno-associated virus 8 (AAV8) capsid polypeptide described herein.
In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, and 199.
In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189.
In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity to an amino acid sequence selected from SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
In some embodiments, the nucleic acid comprises a nucleotide sequence having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 153.
In some embodiments, the nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, and 199.
In some embodiments, the nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189.
In some embodiments, the nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
In some embodiments, the nucleic acid comprises a nucleotide sequence of SEQ ID NO: 153.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of nucleotides 412-2244 of any one of the nucleotide sequences described above.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of nucleotides 610-2244 of any one of the nucleotide sequences described above.
In another aspect, provided herein is a recombinant DNA comprising the nucleic acid of any one of those described herein.
In another aspect, provided herein is an isolated host cell comprising the nucleic acid of any one of those described herein or the recombinant DNA described herein.
In another aspect, provided herein is an adeno-associated virus (AAV) vector comprising a variant AAV8 capsid polypeptide described herein. In some embodiments, the AAV vector further comprises a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid comprises a nucleotide sequence encoding a therapeutic protein. In some embodiments, the therapeutic protein is an antibody. In some embodiments, the therapeutic protein is coagulation factor VIII or coagulation factor IX. In some embodiments, the nucleotide sequence encoding a therapeutic protein is operably linked to a liver-specific promoter. In some embodiments, the liver-specific promoter is selected from liver albumin promoter, alpha-fetoprotein promoter, alpha 1-antitrypsin promoter, and transferrin transthyretin promoter. In one embodiment, the liver-specific promoter is a transferrin transthyretin promoter.
In some embodiments, the AAV vector exhibits higher transduction efficiency of the liver compared to the AAV8 wild-type vector. In some embodiments, the transduction efficiency of the AAV vector is between 1 to 2220-fold higher compared to the AAV8 wild-type vector.
In some embodiments, the AAV vector exhibits higher transduction specificity of the liver compared to the AAV8 wild-type vector. In some embodiments, the transduction specificity of the AAV vector is between 1 to 1.1-fold higher compared to the AAV8 wild-type vector.
In another aspect, provided herein is a pharmaceutical composition comprising the AAV vector described herein, and a pharmaceutically acceptable carrier and/or excipient.
In another aspect, provided herein is a method of delivering a gene product to a liver cell, said method comprising contacting the liver cell with an effective amount of the AAV vector described herein or the pharmaceutical composition described herein. In some embodiments, the liver cell is a hepatic stellate cell, a Kupffer cell, or a liver endothelial cell. In one embodiment, the liver cell is a hepatocyte.
In another aspect, provided herein is a method of delivering a gene product to the liver of a subject in need thereof, said method comprising administering to the subject an effective amount of the AAV vector described herein or the pharmaceutical composition described herein.
In some embodiments, the AAV vector or the pharmaceutical composition is administered at about 1×1011 to about 1×1014 vg/kg. In some embodiments, the AAV vector or the pharmaceutical composition is administered at about 5×1011 vg/kg.
In some embodiments, the AAV vector or the pharmaceutical composition is administered via intravenous, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprostatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection.
In some embodiments, the subject has hemophilia A or hemophilia B.
In various embodiments, the subject is human. In various embodiments, the subject is a non-human. In some embodiments, the non-human is a mouse, a rat, a rabbit, a dog, a cat, a sheep, a pig, or a non-human primate.
In another aspect, provided herein are methods of treating a liver-borne blood disorder in a human subject in need thereof, said methods comprising administering to the subject an effective amount of an adeno-associated virus (AAV) vector described herein or a pharmaceutical composition described herein, wherein the AAV vector comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a therapeutic protein, wherein the therapeutic protein is a protein used for the treatment of a liver-borne blood disorder.
In some embodiments, the therapeutic protein is a blood coagulation factor.
In some embodiments, the liver-borne blood disorder is a coagulation disorder. In some embodiments, the coagulation disorder is hemophilia. In some embodiments, the hemophilia is hemophilia A or hemophilia B.
In some embodiments, the AAV vector or the pharmaceutical composition is administered at about 1×1011 to about 1×1014 vg/kg. In some embodiments, the AAV vector or the pharmaceutical composition is administered at about 5×1011 vg/kg.
In some embodiments, the AAV vector or the pharmaceutical composition is administered via intravenous, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprostatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection.
The foregoing summary is not intended to define every aspect of the invention, and additional aspects are described in other sections, such as the following detailed description. The entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. Other features and advantages of the invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, because various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.
The present disclosure provides, among other things, variant AAV8 capsid polypeptides that allow for more efficient and more specific transduction of the liver compared to a wild-type AAV8 capsid. These variant AAV8 capsids are useful for targeted delivery of a gene product (e.g., a therapeutic protein) to the liver of a subject in need thereof.
AAV capsid re-targeting was achieved through insertion of short (e.g., about 7 to 9 amino acids) peptides into an exposed capsid region. These peptides were inserted into one of the protein loops of the viral capsid which (i) permits their display on the capsid surface and hence their interaction with cellular receptors, and which (ii) represents the binding site for the natural receptor. Accordingly, the displayed peptide not only triggered or enhanced the transduction of liver cells, but concurrently also disrupted the inherent tropism of the underlying AAV capsid, hence yielding a combined increase in specificity and/or efficiency.
As detailed in the Examples section below, AAV8 variants containing short peptide insertions on the viral capsid surface were selected via several selection steps. These peptide insertions allow efficient transduction of the liver and improved gene expression compared to wild-type AAV8 capsids. Furthermore, the presence of the peptides on the capsid surface results in improved liver specificity.
As used herein, the term “nucleic acid” means a chain of two or more nucleotides such as RNA (ribonucleic acid) and DNA (deoxyribonucleic acid). The terms “nucleic acid”, “nucleotide”, and “polynucleotide” encompass both DNA and RNA unless specified otherwise. The terms “nucleic acid sequence” or “nucleotide sequence” means the nucleic acid sequence encoding an amino acid and may also refer to the nucleic acid sequence including the portion coding for any amino acids added as an artifact of cloning, including any amino acids coded for by linkers.
The phrases “cap nucleic acid,” “cap gene,” and “capsid gene” as used herein mean a nucleic acid that encodes a capsid protein. Examples of cap nucleic acids include “wild-type” (WT) cap-encoding nucleic acid sequences from AAV serotype 8; a native form cap cDNA; a nucleic acid having sequences from which a cap cDNA can be transcribed; and/or allelic variants and homologs of the foregoing.
As used herein, “protein” or “polypeptide” mean any peptide-linked chain of amino acids, regardless of length or post-translational modification, e.g., glycosylation or phosphorylation.
The phrases “capsid protein,” “capsid polypeptide,” “cap protein,” or “cap polypeptide” refer to an expression product of a cap nucleic acid from an AAV serotype, such as a wild-type capsid protein from serotypes 8; or a protein that shares at least 50% (alternatively at least 75, 80, 85, 90, 95, 96, 97, 98, or 99%) amino acid sequence identity with a wild-type capsid protein and displays a functional activity of a wild-type capsid protein. The capsid homology of commonly used AAV serotypes is described in e.g., Daya and Berns (2008) Clin. Microbiol. Rev. 21(4):583-593, which is incorporated herein by reference in its entirety. A “functional activity” of a protein is any activity associated with the physiological function of the protein. For example, functional activities of a wild-type capsid protein may include the ability to form a capsid. In some embodiments, the capsid protein is a variant of the wild-type capsid protein (e.g., AAV8 cap protein) with an altered functional activity such as tissue tropism. In some embodiments, the capsid protein is a variant of an AAV8 wild-type capsid protein with improved liver tropism. The wild-type AAV genome encodes three capsid proteins: VP1, VP2 and VP3. As used herein, the capsid protein includes VP1, VP2 and VP3. The amino acid positions described herein with reference to an AAV8 capsid protein are denoted according to VP1 numbering, unless noted otherwise.
A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil (U) for thymine (T) when the polynucleotide is RNA). Thus, the term polynucleotide sequence is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching.
As defined herein, a nucleotide sequence is intended to refer to a natural or synthetic linear and sequential array of nucleotides and/or nucleosides, and derivatives thereof. The terms “encoding” and “coding” refer to the process by which a nucleotide sequence, through the mechanisms of transcription and translation, provides the information, e.g., to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce a polypeptide.
An “isolated polynucleotide” molecule is a nucleic acid molecule separate and discrete from the whole organism with which the molecule is found in nature; or a nucleic acid molecule devoid, in whole or part, of sequences normally associated with it in nature; or a sequence, as it exists in nature, but having heterologous sequences in association therewith.
The term “variant” as used herein refers to a modified or altered form of a wild-type AAV sequence, such as the amino acid sequence of a wild-type AAV8 capsid protein (e.g., SEQ ID NO: 202) or the nucleotide sequence encoding a wild-type AAV8 capsid protein (e.g., SEQ ID NO: 201). The variant may contain an insertion, a deletion, or a substitution of at least one amino acid residue or nucleotide.
“Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.
Techniques for determining nucleic acid and amino acid “sequence identity” also are known in the art. Typically, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby and comparing these sequences to a second nucleotide or amino acid sequence. In general, “identity” refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their “percent identity.” The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. Percent identity may also be determined, for example, by comparing sequence information using the advanced BLAST computer program, including version 2.2.9, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268 and as discussed in Altschul et al. (1990) J. Mol. Biol. 215:403-410; Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877; and Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Briefly, the BLAST program defines identity as the number of identical aligned symbols (i.e., nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program may be used to determine percent identity over the entire length of the proteins being compared. Default parameters are provided to optimize searches with short query sequences in, for example, blastp with the program. The program also allows use of an SEG filter to mask-off segments of the query sequences as determined by the SEG program of Wootton and Federhen (1993) Comput. and Chem. 17:149-163. Ranges of desired degrees of sequence identity are approximately 70% to 100% and integer values therebetween. Typically, the percent identities between a disclosed sequence and a claimed sequence are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%.
The terms “vector”, “cloning vector” and “expression vector” mean the vehicle by which a DNA or RNA sequence (e.g., a foreign gene) can be introduced into a host cell, so as to promote expression (e.g., transcription and translation) of the introduced sequence. Vectors include plasmids, synthesized RNA and DNA molecules, transposons, phages, viruses, etc. In certain embodiments, the vector is a viral vector such as, but not limited to, an adenoviral, adeno-associated, alphaviral, herpes, lentiviral, retroviral, or vaccinia vector. In certain embodiments, the vector is an adeno-associated virus (AAV).
The term “regulatory element” refers to any cis-acting or trans-acting genetic element that controls some aspect of the expression of a nucleic acid. In some embodiments, the term “promoter” comprises essentially the minimal sequences required to initiate transcription. In some embodiments, some regulatory elements can upregulate or downregulate transcription, commonly termed “enhancer elements” and “repressor elements”, respectively.
The term “operably linked” in reference to a nucleic acid means a nucleic acid is placed in a functional relationship with another nucleic acid. For example, if a coding nucleic acid sequence is operably linked to a promoter nucleic acid sequence, this generally means that the promoter may promote transcription of the coding nucleic acid. Operably linked means that the DNA sequences being linked are typically contiguous and, where necessary to join two protein coding regions, contiguous and in reading frame. However, since enhancers may function when separated from the promoter by several kilobases and intronic sequences may be of variable length, some nucleic acid sequences may be operably linked but not contiguous.
As used herein, the term “transduction” refers to the process of transferring genetic material into a target cell with a viral particle (e.g., an AAV vector). The term “liver transduction” refers to the process of transferring genetic material via a viral particle (e.g., an AAV vector) into liver cells or liver tissue, such as a hepatotrophic cell line, primary hepatocytes and/or a liver of a subject. Transduction may occur in vitro, in vivo, or ex vivo.
As used herein, the term “transduction efficiency” refers to the percentage of target cells or proportion of target tissue transduced with at least one copy of a vector (e.g., AAV vector). In some embodiments, transduction efficiency of the AAV vectors of the present disclosure may be determined by the amount of viral genomes on gDNA level and/or viral transcripts on RNA level and/or transgene protein expression as quantified after application of AAV vectors on target cells or tissue, such as a hepatotrophic cell line and/or primary mouse hepatocytes in vitro and/or primary human hepatocytes in vitro and/or mouse liver upon intravenous administration in vivo.
The term “higher transduction efficiency” refers to the ability of a vector (e.g., AAV vector) to transduce a higher percentage of target cells or higher proportion of target tissue as compared to a control vector. In some embodiments, higher transduction efficiency is defined as the number of viral genomes and/or viral transcripts and/or transgene protein expression in target cells or tissue with a value above 1 when normalized relative to AAV8 WT set to 1.
As used herein, the term “transduction specificity” refers to the ability of a vector (e.g., AAV vector) to preferentially transduce a particular cell or tissue type. In some embodiments, the AAV vector of the present disclosure has a transduction specificity for liver. In some embodiments, the AAV vector of the present disclosure has a transduction specificity for a liver cell (e.g., hepatocyte). For example, transduction specificity may be determined by the presence of viral genomes on gDNA level and/or viral transcripts on RNA level and/or transgene protein expression in the mouse liver as quantified after application of AAV vectors by intravenous administration with concurrent depletion from any other tissues, such as spleen and/or lung and/or muscle, or any of the remaining tissues analyzed in the Examples section below.
The term “higher transduction specificity” refers to increased or enhanced ability of a vector (e.g., AAV vector) to preferentially transduce a particular cell or tissue type as compared to a control vector. In some embodiments, higher transduction specificity is defined as the relative number of viral genomes and/or viral transcripts and/or transgene protein expression in the mouse liver in comparison with all other tissues with a value above 1 when normalized relative to AAV8 WT set to 1.
The terms “treat” or “treatment” of a state, disorder or condition include: (1) preventing, delaying, or reducing the incidence and/or likelihood of the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition, but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof or at least one clinical or sub-clinical symptom thereof, or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms. The benefit to a subject to be treated is either statistically significant or at least perceptible to the patient or to the physician.
The term “effective” applied to dose or amount refers to that quantity of a compound or pharmaceutical composition that is sufficient to result in a desired activity upon administration to a subject in need thereof. Note that when a combination of active ingredients is administered, the effective amount of the combination may or may not include amounts of each ingredient that would have been effective if administered individually. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular drug or drugs employed, the mode of administration, and the like.
The phrase “pharmaceutically acceptable”, as used in connection with compositions described herein, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a mammal (e.g., a human). The term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in mammals, and more particularly in humans.
The terms “patient”, “individual”, “subject”, and “animal” are used interchangeably herein and refer to mammals, including, without limitation, human and non-human animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.) and experimental animal models. In a particular embodiment, the subject is a human.
The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions may be employed as carriers, particularly for injectable solutions. Alternatively, the carrier can be a solid dosage form carrier, including but not limited to one or more of a binder (for compressed pills), a glidant, an encapsulating agent, a flavorant, and a colorant. Suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
Singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to “a method” includes one or more methods, and/or steps of the type described herein and/or which will become apparent to those persons skilled in the art upon reading this disclosure. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted.
The term “about” or “approximately” includes being within a statistically meaningful range of a value. Such a range can be within an order of magnitude, e.g., within 50%, within 20%, within 10%, and within 5% of a given value or range. The allowable variation encompassed by the term “about” or “approximately” depends on the particular system under study, and can be readily appreciated by one of ordinary skill in the art.
Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range and each endpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein.
The technology illustratively described herein suitably may be practiced in the absence of any element(s) not specifically disclosed herein.
The terms and expressions which have been employed are used as terms of description and not of limitation and use of such terms and expressions do not exclude any equivalents of the features shown and described or portions thereof, and various modifications are possible within the scope of the technology claimed.
In one aspect, the present disclosure provides a variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion in a wild-type AAV8 capsid polypeptide.
Although not wishing to be bound by any particular theory, the AAV capsid is formed by 60 protein subunits, VP1, VP2 and VP3, which assemble in a stoichiometric ratio of about 1:1:10 (VP1:VP2:VP3) arranged in T=1 icosahedral symmetry. VP1 (AAV8: 738 amino acids, aa) represents the largest subunit followed by VP2 (AAV8: 601 aa) and the main capsid component VP3 (AAV8: 535 aa).
AAV8 capsid polypeptides referred to herein include AAV8 capsid proteins VP1, VP2 and VP3, and functional fragments thereof. VP1, VP2 and VP3 are alternative splice variants of the AAV cap protein. In some embodiments, the variant AAV8 capsid polypeptide is VP1. In some embodiments, the variant AAV8 capsid polypeptide is VP2. In some embodiments, the variant AAV8 capsid polypeptide is VP3.
The amino acid sequence and nucleotide sequence encoding the wild-type AAV8 capsid polypeptide are set forth in SEQ ID NOs: 202 and 201, respectively. The amino acid sequence of AAV8 capsid VP1 comprises amino acids 1 to 738 of SEQ ID NO: 202, AAV8 capsid VP2 comprises amino acids 138 to 738 of SEQ ID NO: 202, and AAV8 capsid VP3 comprises amino acids 204 to 738 of SEQ ID NO: 202 (See, e.g., U.S. Pat. Nos. 7,790,449; 9,493,788; 9,677,089, which are incorporated herein by reference in their entirety for all purposes). Accordingly, the nucleotide sequence encoding AAV8 capsid VP1 comprises nucleotides 1 to 2217 of SEQ ID NO: 201, the nucleotide sequence encoding AAV8 capsid VP2 comprises nucleotides 412 to 2217 of SEQ ID NO: 201, and the nucleotide sequence encoding VP3 comprises nucleotides 610 to 2217 of SEQ ID NO: 201.
Other desirable fragments of the capsid protein include the hypervariable regions (HPV) of the variant AAV8 capsid polypeptide. Yet other desirable fragments of the capsid protein include the constant and variable regions, located between HPV regions. Positions of HPV regions, constant and variable regions of an AAV8 capsid protein are as defined in the art (See, e.g., U.S. Pat. Nos. 7,790,449; 9,493,788; 9,677,089, which are incorporated herein by reference in their entirety for all purposes).
In some embodiments, the present disclosure provides a variant AAV8 capsid VP1 polypeptide comprising a peptide insertion after amino acid 590 of a wild-type AAV8 VP1 capsid polypeptide.
In some embodiments, the present disclosure provides a variant AAV8 capsid VP2 polypeptide comprising a peptide insertion after amino acid 453 of a wild-type AAV8 VP2 capsid polypeptide.
In some embodiments, the present disclosure provides a variant AAV8 capsid VP3 polypeptide comprising a peptide insertion after amino acid 387 of a wild-type AAV8 VP3 capsid polypeptide.
The peptide insertion may comprise a short peptide of about 5-12 amino acids. In some embodiments, the peptide insertion comprises a short peptide of about 7-9 amino acids. In some embodiments, the peptide insertion comprises a short peptide of 7 amino acids. In some embodiments, the peptide insertion comprises a short peptide of 8 amino acids. In some embodiments, the peptide insertion comprises a short peptide of 9 amino acids.
In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 1-50. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 1-50.
In some embodiments, peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 11, 15, 16, 18, 19, 26, 27, 29, 32, 34, 35, 36, 38, 40, 42, 43, and 45. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 11, 15, 16, 18, 19, 26, 27, 29, 32, 34, 35, 36, 38, 40, 42, 43, and 45.
In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 19, 26, 27, and 42. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 2, 8, 9, 19, 26, 27, and 42.
In some embodiments, the peptide insertion comprises an amino acid sequence of amino acid sequence of SEQ ID NO: 27. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to the amino acid sequence of SEQ ID NO: 27.
In some embodiments, the peptide insertion comprises an amino acid sequence of amino acid sequence of SEQ ID NO: 19. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to the amino acid sequence of SEQ ID NO: 19.
In some embodiments, the peptide insertion comprises an amino acid sequence of amino acid sequence of SEQ ID NO: 42. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to the amino acid sequence of SEQ ID NO: 42.
In some embodiments, the peptide insertion further comprises a glycine (G) at the N-terminus and/or an alanine (A) at the C-terminus. In some embodiments, the peptide insertion further comprises a glycine (G) at the N-terminus. In some embodiments, the peptide insertion further comprises an alanine (A) at the C-terminus. In some embodiments, the peptide insertion further comprises a glycine (G) at the N-terminus and an alanine (A) at the C-terminus.
In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 51-100. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 85% identity to an amino acid sequence selected from SEQ ID NOs: 51-100.
In some embodiments, peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 85% identity to an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95.
In some embodiments, the variant AAV8 capsid polypeptide comprises one or more amino acid substitutions of the wild-type AAV8 capsid protein at amino acid positions (VP1 numbering): (a) glutamine 588; (b) asparagine 590; (c) threonine 591; and/or (d) proline 593.
In some embodiments, the variant AAV8 capsid polypeptide comprises one or more amino acid substitutions of the wild-type AAV8 capsid protein at amino acid positions (VP1 numbering): (a) Q588G; (b) N590S or N590R; (c) T591Q; and/or (d) P593A.
In some embodiments, the variant AAV8 capsid polypeptide comprises amino acid substitutions of the wild-type AAV8 capsid protein at amino acid positions (VP1 numbering): (a) Q588G; (b) N590S; (c) T591Q; and (d) P593A.
In some embodiments, the variant AAV8 capsid polypeptide comprises amino acid substitutions of the wild-type AAV8 capsid protein at amino acid positions (VP1 numbering): (a) Q588G; (b) N590R; (c) T591Q; and (d) P593A.
In some embodiments, the three amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQS or GQR and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA.
In some embodiments, the three amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQS and the three amino acids following the site into which said peptide is inserted have been changed to QAA.
In some embodiments, the three amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQR and the three amino acids following the site into which said peptide is inserted have been changed to QAA.
In some embodiments, provided herein is a variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 51-100, or an amino acid sequence having at least 75% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 51-100, and wherein N590 is deleted. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 51-100. In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 51-100.
In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95.
In some embodiments, the peptide insertion comprises an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 69, 76, 77, and 92. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 52, 58, 59, 69, 76, 77, and 92.
In some embodiments, the peptide insertion comprises an amino acid sequence of SEQ ID NO: 77. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence of SEQ ID NO: 77.
In some embodiments, the peptide insertion comprises an amino acid sequence of SEQ ID NO: 69. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence of SEQ ID NO: 69.
In some embodiments, the peptide insertion comprises an amino acid sequence of SEQ ID NO: 92. In some embodiments, the peptide insertion comprises an amino acid sequence having at least 75% or 85% identity to an amino acid sequence of SEQ ID NO: 92.
In some embodiments, the peptide insertion further comprises an A at the C-terminus.
In some embodiments, the two amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQ or GQ and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA.
The variant AAV8 capsid polypeptide described herein may have tropism for a liver cell. The liver cell may be a hepatocyte, a hepatic stellate cell, a Kupffer cell, or a liver endothelial cell. In some embodiments, the liver cell is a hepatocyte.
In some embodiments, the present disclosure provides a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, or 190, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, or 190, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 154, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NO: 154, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 138, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NO: 138, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 184, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide comprises an amino acid sequence of SEQ ID NO: 184, or a functional fragment thereof.
In some embodiments, the present disclosure provides a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of amino acids 138-747 of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide, comprising an amino acid sequence of amino acids 138-747 of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200.
In some embodiments, the present disclosure provides a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of amino acids 204-747 of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the variant AAV8 capsid polypeptide, comprising an amino acid sequence of amino acids 204-747 of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200.
It will be appreciated that conservative amino acid substitutions may be introduced to the polypeptide of any of those described above, to achieve a polypeptide having, for example, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity the referenced sequence, and retaining the same or similar activity of that sequence. Conservative amino acid substitutions, as known in the art and as referred to herein, involve substituting amino acids in a protein with amino acids having similar side chains in terms of, for example, structure, size and/or chemical properties. For example, the amino acids within each of the following groups may be interchanged with other amino acids in the same group: amino acids having aliphatic side chains, including glycine, alanine, valine, leucine and isoleucine; amino acids having non-aromatic, hydroxyl-containing side chains, such as serine and threonine; amino acids having acidic side chains, such as aspartic acid and glutamic acid; amino acids having amide side chains, including glutamine and asparagine; basic amino acids, including lysine, arginine and histidine; amino acids having aromatic ring side chains, including phenylalanine, tyrosine and tryptophan; and amino acids having sulfur-containing side chains, including cysteine and methionine. Additionally, amino acids having acidic side chains, such as aspartic acid and glutamic acid, are considered interchangeable herein with amino acids having amide side chains, such as asparagine and glutamine.
In another aspect, the present disclosure provides a nucleic acid encoding a variant AAV8 capsid polypeptide described herein.
In some embodiments, the nucleic acid of the present disclosure encodes a variant AAV8 capsid VP1 polypeptide. In some embodiments, the nucleic acid of the present disclosure encodes a variant AAV8 capsid VP2 polypeptide. In some embodiments, the nucleic acid of the present disclosure encodes a variant AAV8 capsid VP3 polypeptide.
In another aspect, the present disclosure provides a nucleic acid encoding a variant AAV8 capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence having at least 70% or 85% identity to an amino acid sequence selected from SEQ ID NOs: 1-50.
In another aspect, the present disclosure provides a nucleic acid encoding a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs:102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and 200, or a functional fragment thereof.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, or 189.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of SEQ ID NO: 153.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of SEQ ID NOs: 153.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of SEQ ID NO: 137.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of SEQ ID NOs: 137.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of SEQ ID NO: 183.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of SEQ ID NOs: 183.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of nucleotides 412-2244 of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of nucleotides 412-2244 of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of nucleotides 610-2244 of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide comprises a nucleotide sequence of nucleotides 610-2244 of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199.
Polynucleotides of the present disclosure encompass variants of the specific nucleic acid sequences recited herein. Such variants may represent orthologs, paralogs or other homologs of a polynucleotide of the present disclosure. The polynucleotide variants may comprise a nucleic acid sequence characterized in that the sequence can be derived from the specific nucleic acid sequences recited herein by at least one nucleotide insertion, deletion and/or substitution, whereby the variant nucleic acid sequence still encodes a capsid polypeptide having the activity as specified above. Variants also encompass polynucleotides comprising a nucleic acid sequence which is capable of hybridizing to the specific nucleic acid sequences recited herein, e.g., under stringent hybridization conditions. These stringent conditions are known to a skilled artisan and can be found in for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989) 6.3.1-6.3.6. An example of stringent hybridization conditions are hybridization conditions in 6× sodium chloride/sodium citrate (=SSC) at approximately 45° C., followed by one or more wash steps in 0.2×SSC, 0.1% SDS at 50 to 65° C. It will be understood by a skilled artisan that these hybridization conditions differ depending on the type of nucleic acid and, for example when organic solvents are present, with regard to the temperature and concentration of the buffer. For example, under “standard hybridization conditions” the temperature differs depending on the type of nucleic acid between 42° C. and 58° C. in aqueous buffer with a concentration of 0.1 to 5×SSC (pH 7.2). If organic solvent is present in the abovementioned buffer, for example 50% formamide, the temperature under standard conditions is approximately 42° C. The hybridization conditions for DNA:DNA hybrids may be for example 0.1×SSC and 20° C. to 45° C., in particular between 30° C. and 45° C. The hybridization conditions for DNA:RNA hybrids may be, for example, 0.1×SSC and 30° C. to 55° C., in particular between 45° C. and 55° C. Such hybridization temperatures may be determined for example for a nucleic acid with approximately 100 base pairs (bp) in length and a G+C content of 50% in the absence of formamide. The skilled artisan can readily determine the required hybridization conditions by referring to textbooks such as the textbook mentioned above.
Polynucleotide variants may also be obtained by PCR-based techniques such as mixed oligonucleotide primer-based amplification of DNA, i.e., using degenerated primers against conserved domains of the capsid polypeptides of the present disclosure. Conserved domains of the capsid polypeptides of the present disclosure may be identified by a sequence comparison of the nucleic acid sequence of the polynucleotide or of the amino acid sequence of the capsid polypeptides described herein. Suitable PCR conditions are well known in the art. As a template, DNA or cDNA from AAVs (e.g., AAV8) may be used. Further, variants include polynucleotides comprising nucleic acid sequences which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the nucleic acid sequences recited herein. Moreover, also encompassed are polynucleotides which comprise nucleic acid sequences encoding amino acid sequences which are at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequences referred to above. The percent identity values may be calculated over the entire amino acid or nucleic acid sequence region. A series of programs based on a variety of algorithms is available to the skilled artisan for comparing different sequences. For example, the algorithms of Needleman and Wunsch or Smith and Waterman may be used. To carry out the sequence alignments, the program PileUp (Feng and Doolittle (1987) J. Mol. Evol. 25:351-360; Higgins et al. (1989) CABIOS 5:151-153) or the programs Gap and BestFit (Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453) and Smith and Waterman (Smith and Waterman (1981) Adv. Appl. Math. 2:482-489), which are part of the GCG software packet (Genetics Computer Group, 575 Science Drive, Madison, Wis., USA 53711 (1991)), may also be used. The sequence identity values recited above in percent (%) are to be determined, for example, using the program GAP over the entire sequence region with the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10.000 and Average Mismatch: 0.000, which, unless otherwise specified, can be used as standard settings for sequence alignments.
A polynucleotide comprising a fragment of any of the nucleic acid sequences described herein is also contemplated as a polynucleotide of the present disclosure. The fragment may encode a capsid polypeptide which still has the biological activity (e.g., improved liver transduction specificity and/or efficiency) as specified above. Accordingly, the polypeptide may comprise or consist of the domains of the polypeptide of the present invention conferring the said biological activity. A fragment may comprise at least 50, at least 60, at least 90, at least 100, at least 150, at least 240, at least 250, at least 300, at least 450, at least 500, at least 600, at least 750, at least 800, at least 900, or at least 1000, at least 1200, at least 1500 consecutive nucleotides of any one of the nucleic acid sequences described herein or encodes an amino acid sequence comprising at least 20, at least 30, at least 50, at least 80, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, or at least 500 consecutive amino acids of any one of the amino acid sequences described herein.
Polynucleotides of the present disclosure may either consist essentially of the nucleic acid sequences described herein or comprise the nucleic acid sequences described herein. In some embodiments, a polynucleotide of the present disclosure may contain other nucleic acid sequences as well. For example, the polynucleotides of the present invention may encode fusion proteins wherein one partner of the fusion protein is a capsid polypeptide being encoded by a nucleic acid sequence recited above. Such fusion proteins may comprise as additional part polypeptides for monitoring expression (e.g., green, yellow, blue or red fluorescent proteins, alkaline phosphatase and the like) or so called “tags” which may serve as a detectable marker or as an auxiliary measure for purification purposes. Tags for the different purposes are well known in the art and examples include FLAG-tags, 6-histidine-tags, MYC-tags and the like.
Polynucleotides of the present invention may be provided either as an isolated polynucleotide (i.e., isolated from its natural context) or in genetically modified form. The polynucleotide may be DNA including cDNA or RNA. The term encompasses both single and double stranded polynucleotides. Moreover, also encompassed are chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificially modified ones such as biotinylated polynucleotides.
In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide is a DNA. In some embodiments, the nucleic acid encoding a variant AAV8 capsid polypeptide is an RNA.
The present disclosure further provides vectors generated using the nucleic acid and amino acid sequences of the variant AAV8 capsid polypeptide described herein.
In one aspect, the present disclosure provides a recombinant vector comprising the nucleic acid encoding a variant AAV8 capsid polypeptide described herein.
In some embodiments, the recombinant vector is a viral vector. In some embodiments, the recombinant vector is a non-viral vector.
In some embodiments, the recombinant vector is a recombinant AAV vector. In some embodiments, the recombinant vector is a recombinant AAV8 vector.
In some embodiments, the recombinant vector is a recombinant DNA. The recombinant DNA of the present disclosure is useful for delivering the nucleic acid of the present disclosure to cells in vitro, ex vivo or in vivo and imparting the ability to express the variant AAV8 capsid protein to the cells. Then, the cell to which the nucleic acid of the present disclosure is delivered is useful for producing AAV particles. The recombinant DNA can be particularly used for delivery or introduction of the nucleic acid of the present disclosure into animal cells, in particular, mammal cells.
The recombinant DNA of the present disclosure can be prepared by making a DNA used as a vector containing the nucleic acid of the present disclosure. For example, a plasmid DNA, a phage DNA, a transposon, a cosmid DNA, an episomal DNA, or a viral genome can be used.
In one aspect, the present disclosure provides a recombinant vector comprising a variant AAV8 capsid polypeptide described herein.
A skilled artisan will readily understand that the variant AAV8 capsid polypeptide described herein can be readily adapted for use in AAV and other viral vector systems for in vitro, ex vivo or in vivo gene delivery. Similarly, one of skill in the art can readily select other fragments of the AAV genome (e.g., rep, ITR) for use in a variety of rAAV and non-rAAV vector systems. Such vectors systems may include, e.g., lentiviruses, retroviruses, poxviruses, vaccinia viruses, and adenoviral systems, among others. Selection of these vector systems is not a limitation of the present invention.
The vectors of the present disclosure are useful for a variety of purposes, including for delivery of therapeutic molecules to a liver cell or to the liver of a subject. Particularly desirable for delivery of therapeutic molecules are recombinant AAV vectors comprising the variant AAV8 capsid polypeptides, which are specially described below.
In one aspect, the present invention provides an AAV vector comprising a variant AAV8 capsid polypeptide described herein. In some embodiments, the AAV vector comprises one or more variant AAV8 VP1 capsid polypeptide, variant AAV8 VP2 capsid polypeptide, and/or variant AAV8 VP3 capsid polypeptide described herein.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, or 200, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide comprising an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to an amino acid sequence selected from SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, or 190, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide comprising an amino acid sequence of SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, or 190, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide encoded by a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide encoded by a nucleotide sequence of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, or 199, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide encoded by a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to a nucleotide sequence selected from SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189, or a functional fragment thereof.
In some embodiments, the AAV vector comprises a variant AAV8 capsid polypeptide encoded by a nucleotide sequence of SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, or 189, a functional fragment thereof.
One of skill in the art may readily prepare other recombinant AAV viral vectors containing the variant AAV8 capsid polypeptides provided herein using a variety of techniques known to those of skill in the art. One may similarly prepare other chimeric recombinant AAV viral vectors containing a variant AAV8 capsid polypeptide provided herein and AAV capsid protein(s) of another serotype.
In some embodiments, a recombinant AAV vector comprises, in addition to one or more variant AAV8 capsid polypeptides, wild-type Rep78, Rep68, Rep52, and Rep40 proteins. In other embodiments, a recombinant AAV vector comprises, in addition to one or more variant AAV8 capsid polypeptides, one or more mutations in one or more of Rep78, Rep68, Rep52, and Rep40 proteins.
The recombinant AAV vectors of the present disclosure may further comprise a heterologous nucleic acid. In some embodiments, the heterologous nucleic acid comprises a nucleotide sequence encoding a gene of interest. The gene of interest can be any gene, including and not limited to, proteins, peptides and RNAs (e.g., mRNA, siRNA, miRNA). Many suitable genes for expression for therapeutic or non-therapeutic purposes are readily identified by a skilled artisan.
Recombinant AAV vectors can be constructed using known techniques to at least provide as operatively linked components in the direction of transcription, for example, control elements including a transcriptional initiation region, the gene of interest and a transcriptional termination region. The control elements can be selected to be functional in a mammalian liver cell. The resulting construct which contains the operatively linked components is typically bounded (5′ and 3′) with functional AAV ITR sequences.
The nucleotide sequences of AAV ITR regions are known. See, e.g., Kotin (1994) Hum. Gene Ther. 5:793-801; Berns “Parvoviridae and their Replication” in Fundamental Virology, 2nd Edition, (Fields and Knipe, eds.; incorporated herein by reference in its entirety) for the AAV2 sequence. AAV ITRs that can be used in the present disclosure may be derived from any of several AAV serotypes, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV7, AAV8, etc. AAV ITRs used in the vectors of the invention may have a wild-type nucleotide sequence, or may be altered, e.g., by the insertion, deletion or substitution of nucleotides. Furthermore, 5′ and 3′ ITRs which flank a selected nucleotide sequence in an AAV expression vector need not necessarily be identical or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., to allow for excision and rescue of the sequence of interest from a host cell genome or vector, and to allow integration of the DNA molecule into the recipient cell genome when AAV Rep gene products are present in the cell. ITRs allow replication of the vector sequence in the presence of an appropriate mixture of Rep proteins. ITRs also allow for the incorporation of the vector sequence into the capsid to generate an AAV particle.
A suitable heterologous nucleic acid for use in a rAAV vector of the present disclosure may generally be less than about 5 kilobases (kb) in size and include, for example, a gene that encodes a protein that is defective or missing from a recipient subject; a gene that encodes a protein having a desired biological or therapeutic effect (e.g., an antibacterial, antiviral or antitumor function); a nucleotide sequence that encodes an RNA that inhibits or reduces production of a deleterious or otherwise undesired protein; a nucleotide sequence that encodes an antigenic protein; or a nucleotide sequence that encodes an RNA that inhibits or reduces production of a protein.
In some embodiments, the heterologous nucleic acid comprises a nucleotide sequence encoding a therapeutic protein or peptide. The therapeutic protein or peptide can be used to correct or replace a deficient gene, or ameliorate gene deficiencies in a subject, which may include deficiencies in which normal genes are expressed at less than normal levels or deficiencies in which the functional gene product is not expressed. In some embodiments, the heterologous nucleic acid comprises nucleotide sequences encoding multiple transgenes, which can be helpful to correct or replace multiple defective genes or ameliorate a gene defect caused by a multi-subunit protein. In certain embodiments, two or more transgenes may be used to encode different subunits of a protein, or to encode different peptides or proteins. This is desirable when the size of the DNA encoding the protein subunit is large, for example, in the cases of an immunoglobulin, the platelet-derived growth factor, or a dystrophin protein. In order for the cell to produce the multi-subunit protein, a cell is infected with a population of recombinant viruses containing each of the different subunits. Alternatively, different subunits of a protein may be encoded by the same transgene. For example, a single transgene may include the DNA encoding each of the subunits, with the DNA for each subunit separated by an internal ribozyme entry site (IRES) or a self-cleaving sequence. This is desirable when the size of the DNA encoding each of the subunits is small, e.g., the total size of the DNA encoding the subunits and the IRES is less than 5 kilobases. As an alternative to an IRES, the DNA may be separated by sequences encoding a self-cleaving sequence such as a 2A peptide. See, e.g., Donnelly et al., (1997) J. Gen. Virol. 78(Pt 1):13-21; Furler et al. (2001) Gene Ther. 8(11):864-873; Klump et al. (2001) Gene Ther. 8(10):811-817. The 2A peptide is significantly smaller than an IRES, making it well suited for use when space is a limiting factor. In some embodiments, when the transgene is large, consists of multi-subunits, or when two or more transgenes are co-delivered, rAAVs carrying the desired transgene(s) or subunits may be co-administered to allow them to concatamerize in vivo to form a single vector genome. In such an embodiment, a first AAV may carry an expression cassette which expresses a single transgene and a second AAV may carry an expression cassette which expresses a different transgene for co-expression in the host cell.
A variety of therapeutic proteins and peptides, either in single or split into two or more vectors (See, e.g., Truong et al. (2015) Nucleic Acids Res. 43, 6450-6458; Moretti et al. (2020) Nat Med. 26(2):207-214), are suitable for inclusion in a recombinant AAV vector of the present disclosure. Suitable proteins include, but are not limited to, an antibody (e.g., a monoclonal antibody such as Orthoclone Okt3@ (muromonab-CD3), Centoxin® (nebacumab), Panorex® (edrecolomab), Removab® (catumaxomab), Zinbryta® (daclizumab), Reopro® (abciximab), Rituxan® (rituximab), Simulect® (basiliximab), Synagis® (palivizumab), Remicade® (infliximab), Herceptin® (trastuzumab), Humira™ (adalimumab), Xolair® (omalizumab), Bexxar® (tositumomab), Raptiva™ (efalizumab), Erbitux™ (cetuximab), Avastin® (bevacizumab), Tysabri® (natalizumab), Vectibix® (panitumumab), Lucentis® (ranibizumab), Soliris® (eculizumab), Stelara® (ustekinumab), Ilaris® (canakinumab), Simponi® (golimumab), Arzerra® (ofatumumab), RoActemra® (tocilizumab), Prolia® (denosumab), Benlysta® (belimumab), Yervoy® (ipilumumab), Perjeta® (pertuzumab), raxibacumab, Gazyva® (obinutuzumab), Sylvant® (siltuximab), Cyramza® (ramucirumab), Entyvio® (vedolizumab), Opdivo® (nivolumab), Keytruda® (pembrolizumab), Blincyto® (blinatumomab), Lemtrada® (alemtuzumab), Repatha® (evolocumab), Praxbind® (idarucizumab), Portrazza® (necitumumab), Unituxin® (dinutuximab), Cosentyx® (secukimumab), Nucala® (mepolizumab), Praluent® (alirocumab), Darzalex® (daratumumab), Empliciti® (elotuzumab), Taltz® (ixekizumab), Cinqaero® (reslizumab), Lartruvo® (olaratumab), Zinplava® (bezlotoxumab), Tecentriq® (atezolizumab), Anthim® (obiltoxaximab), Siliq® (brodalumab), Dupixent® (dupilumab), Tremfya® (guselkumab), Kevzara® (sarilumab), Bavencio® (avelumab), Hemlibra® (emicizumab), Ocrevus® (ocrelizumab), Fasenra® (benralizumab), Imfinzi® (durvalumab), Aimovig® (erenumab), Emgality® (galcanezumab), Crysvita® (burosumab), Takhzyro® (lanadelumab), Poteligeo® (mogamulizumab), Ilumya® (tildrakizumab), Ajovy® (fremanezumab), Ultomiris® (ravulizumab), Libtayo® (cemiplimab), Trogarzo® (ibalizumab), Gamifant® (emapalumab), Cablivi® (caplacizumab), Skyrizi® (risankizumab), Polivy® (polazuzumab), Evenity® (romosozumab), Beovu® (brolucizumab), Adakveo® (crizanlizumab), Padcev® (enfortumab), Tepezza® (teprotumumab), Vyepti® (eptinezumab), Sarclisa® (isatuximab), Uplizna® (inebilizumab), Monjuvi® (tafasitamab), Enspryng® (satralizumab), sutimlimab, naxitamab, margetuximab, tanezumab, narsoplimab, evinacumab, aducanumab, tralokinumab, dostarlimab, teplizumab, omburtamab, inolimomb, ansuvimab, bimekizumab, balstilimab, anifrolumab, and the like; antibodies for use in the treatment or prevention of infectious diseases such as, e.g., antibodies binding to the CoV spike (S) glycoprotein of SARS-CoV-2 (e.g., CR3022, see Wrapp et al. (2020) Science 367:1260-1263) for use in the treatment or prevention of COVID-19), or an antibody fragment (e.g., antigen-binding fragment of a monoclonal antibody, a single chain variable fragment (scFv), a Fab, a Fab′, a F(ab′)2, and a Fv fragment); an angiogenic agent (e.g., vascular endothelial growth factor (VEGF); an anti-angiogenic agent (e.g., a soluble VEGF receptor); a blood factor (e.g., Activase® (alteplase) tissue plasminogen activator, NovoSeven® (recombinant human factor VIIa), coagulation Factor VIIa, coagulation Factor VIII (e.g., Kogenate®), coagulation Factor IX, β-globin hemoglobin, and the like); a chemokine (e.g., IP-10, Mig, Groa/IL-8, RANTES, MIP-1α, MIP-1β, MCP-1, PF-4, and the like); a cytokine; a colony stimulating factor (e.g., Neupogen® (filgrastim GCSF) Neulasta® (pegfilgrastim); granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor, macrophage colony stimulating factor, megakaryocyte colony stimulating factor and the like); an enzyme (e.g., α-glucosidase, Cerazyme® (imiglucarase β-glucocerebrosidase, Ceredase® (alglucerase), an enzyme activator (e.g., tissue plasminogen activator); an erythropoietin (“EPO”, e.g., Procrit®, Eprex®, or Epogen® (epoetin-α), Aranesp® (darbepoietin-α), NeoRecormon®, Epogin® (epoetin-β) and the like); a growth hormone (e.g., a somatotropin, e.g., Genotropin®, Nutropin®, Norditropin®, Saizen®, Serostim®, Humatrope®, etc., a human growth hormone and the like); a growth factor (e.g., Regranex® (beclapermin PDGF), Fiblast® (trafermin bFGF), Stemgen® (ancestim stem cell factor), keratinocyte growth factor, an acidic fibroblast growth factor, a stem cell factor, a basic fibroblast growth factor, a hepatocyte growth factor, and the like); an insulin (e.g., Novolin®, Humulin®, Humalog®, Lantus®, Ultralente, etc.); an interferon (e.g., IFN-γ, IFN-α, IFN-β, IFN-ω, IFN-τ); an interleukin (e.g., IL-1, IL-2, including, e.g., Proleukin®, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, etc.); a soluble receptor (e.g., a TNF-α-binding receptor such as Enbrel® (etanercept), a VEGF receptor, an interleukin receptor, a γ/δT cell receptor, and the like); a protein vaccine; a neuroactive peptide such as bradykinin, cholecystokinin, gastin, secretin, oxytocin, gonadotropin-releasing hormone, beta-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone-releasing hormone, bombesin, dynorphin, neurotensin, motilin, thyrotropin, neuropeptide Y, luteinizing hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II, thyrotropin-releasing hormone, vasoactive intestinal peptide, a sleep peptide, etc.; other proteins such as a thrombolytic agent, an atrial natriuretic peptide, bone morphogenic protein, thrombopoietin, relaxin, glial fibrillary acidic protein, follicle stimulating hormone, a human alpha-1 antitrypsin, a leukemia inhibitory factor, a transforming growth factor, an insulin-like growth factor, a luteinizing hormone, a macrophage activating factor, tumor necrosis factor, a neutrophil chemotactic factor, a nerve growth factor a tissue inhibitor of metalloproteinases; a vasoactive intestinal peptide, angiogenin, angiotropin, fibrin, hirudin, a leukemia inhibitory factor, an IL-1 receptor antagonist (e.g., Kineret® (anakinra)), an ion channel, e.g., cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin, utrophin, a tumor suppressor, lysosomal enzyme acid a-glucosidase (GAA) and the like. Proteins that can be delivered using a recombinant AAV vector of the present disclosure also include a functional fragment of any of the aforementioned proteins; or functional variants of any of the aforementioned proteins.
In some embodiments, the heterologous nucleic acid comprises a nucleotide sequence encoding an antigenic protein. Suitable antigenic proteins include, but are not limited to, tumor-associated antigens, autoantigens (“self” antigens), viral antigens, bacterial antigens, protozoal antigens, and allergens; and antigenic fragments thereof. In some embodiments, a cytotoxic T lymphocyte (CTL) response to the rAAV-encoded antigenic protein may be induced in the mammalian host. In other embodiments, a humoral response to the rAAV-encoded antigenic protein may be induced in the mammalian host, such that antibodies specific to the antigenic protein are generated. In many embodiments, a TH1 immune response to the rAAV-encoded antigenic protein may be induced in the mammalian host. Whether an immune response to the antigenic protein has been generated is readily determined using well-established methods. For example, an enzyme-linked immunosorbent assay can be used to determine whether antibody to an antigenic protein has been generated. Methods of detecting antigen-specific CTL are well known in the art. For example, a detectably labeled target cell expressing the antigenic protein on its surface is used to assay for the presence of antigen-specific CTL in a blood sample.
In some embodiments, the therapeutic protein encoded by the recombinant AAV vector of the present disclosure is a blood coagulation factor. In some embodiments, the therapeutic protein encoded by the recombinant AAV vector of the present disclosure is Factor V (FV), FVII, FVIII, FIX, FX, FXI, FXIII, FII, Protein C, C1-inhibitor, prekallikrein, high molecular weight kininogen (HMWK) or von Willebrand's factor. In some embodiments, the therapeutic protein encoded by the recombinant AAV vector of the present disclosure is Factor VIII or Factor IX.
In some embodiments, the therapeutic protein is a protein used for the treatment of a liver-borne blood disorder. Such proteins are, e.g., the blood coagulation factors disclosed in the preceding paragraph.
In some embodiments, the heterologous nucleic acid may comprise a nucleotide sequence encoding a reporter sequence, which upon expression produces a detectable signal. Such reporter sequences include, without limitation, DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), yellow fluorescent protein (YFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane bound proteins including, for example, CD2, CD4, CD8, the influenza hemagglutinin protein, and others well known in the art, to which high affinity antibodies directed thereto exist or can be produced by conventional means, and fusion proteins comprising a membrane bound protein appropriately fused to an antigen tag domain from, among others, hemagglutinin or Myc.
In some embodiments, the heterologous nucleic acid may comprise a nucleotide sequence encoding an RNA molecule. Exemplary RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNAs (e.g., ribozymes), siRNA, miRNA, small hairpin RNA (shRNA), trans-splicing RNA, antisense RNAs, and CRISPR guide RNAs (e.g., sgRNA). The RNA sequence may be designed such that it inhibits or eliminates expression of a targeted nucleic acid sequence in the treated subject. Suitable target sequences for the inhibitory RNAs include oncologic targets (e.g., oncogenes such as myb, myc, fyn, and the translocation gene bcr/abl, ras, src, P53, neu, trk and EGRF) and viral targets (e.g., HIV, Hepatitis A, B or C, influenza virus). Whether a therapeutically effective amount of a non-translated RNA has been delivered to a mammalian host using a subject method is readily determined using any appropriate assay. For example, where the gene product is an siRNA that inhibits HIV, viral load can be measured.
The recombinant AAV vectors described herein are contemplated for use in methods of expressing a gene of interest in a variety of cells or in a mammal. Transduction into cells lines in addition to the cell lines described herein, for example in Example 4, and other cells lines, particularly stem cells, are contemplated. In terms of in vivo use, the method may comprise introducing a recombinant AAV into the mammal, the recombinant AAV encoding the gene of interest and comprising a variant AAV8 capsid polypeptide described herein. The vector expressing a gene of interest is introduced to the mammal, typically by injection, intravenously, subcutaneously, parenterally, or the like. The nucleotide sequence of the gene of interest is typically operably linked to one or more other nucleotide sequences, including but not limited to the gene for a promoter; an enhancer; transcription initiation, termination sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product.
Various expression control sequences, including promoters which are native, constitutive, inducible and/or tissue-specific, are known in the art and may be utilized in the recombinant AAV vectors of the present disclosure. Non-limiting examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer), the SV40 promoter, the dihydrofolate reductase promoter, the j-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 promoter.
In some embodiments, an inducible promoter is used. Inducible promoters allow regulation of gene expression and can be regulated by exogenously supplied compounds, environmental factors such as temperature, or the presence of a specific physiological state, e.g., acute phase, a particular differentiation state of the cell, or in replicating cells only. Inducible promoters and inducible systems are available from a variety of commercial sources, including, without limitation, Invitrogen, Clontech and Ariad. Many other systems have been described and can be readily selected by one of skill in the art. Examples of inducible promoters regulated by exogenously supplied compounds, include, the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system; the ecdysone insect promoter (No et al. (1996) Proc. Natl. Acad. Sci. USA 93:3346-3351), the tetracycline-repressible system (Gossen et al. (1992)Proc. Natl. Acad. Sci. USA 89:5547-5551), the tetracycline-inducible system (Gossen et al. (1995) Science 268:1766-1769; Harvey et al. (1998) Curr. Opin. Chem. Biol. 2:512-518), the RU486-inducible system (Wang et al. (1997) Nat. Biotech. 15:239-243 and Wang et al. (1997) Gene Ther. 4:432-441) and the rapamycin-inducible system (Magari et al. (1997) J. Clin. Invest. 100:2865-2872). Other types of inducible promoters which may be useful in this context are those which are regulated by a specific physiological state, e.g., temperature, acute phase, a particular differentiation state of the cell, or in replicating cells only.
In some embodiments, the native promoter of the transgene may be used. The native promoter may be used when it is desired that expression of the transgene should mimic the native expression. The native promoter may be used when expression of the transgene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to specific transcriptional stimuli. In a further embodiment, other native expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences may also be included to mimic the native expression.
In some embodiments, the nucleotide sequence encoding a gene of interest is operably linked to an tissue-specific promoter. In some embodiments, the nucleotide sequence encoding a gene of interest is under control of a promoter active in a liver cell. Non-limiting examples of the liver-specific promoter include LP 1 promoter, liver albumin promoter, alpha-fetoprotein promoter, alpha 1-antitrypsin promoter, and transferrin transthyretin promoter (e.g., hTTR, mTTR), and thyroxine binding globulin (TBG) promoter. See, e.g., Powell (2015) Discov. Med. 19(102):49-57; Kyostio-Moore (2016) Mol. Ther. Methods Clin. Dev. 3: 16006, which are herein incorporated by reference in their entirety.
In some embodiments, the liver-specific promoter is a transferrin transthyretin promoter.
Additionally, other promoters may also be used, including but not limited to, a breast-specific promoter, a brain-specific promoter, a pancreas-specific promoter, a colon-specific promoter, a kidney-specific promoter, a bladder-specific promoter, a lung-specific promoter, a thyroid-specific promoter, a stomach-specific promoter, a prostate-specific promoter, an ovary-specific promoter, or a cervix-specific promoter. Non-limiting examples of the breast-specific promoter include c-erb-B2 promoter, erb-B3 promoter, β-casein, β-lacto-globulin, and WAB (whey acidic protein) promoter. Non-limiting examples of the brain-specific promoter include glial fibrillary acidic protein promoter, mature astrocyte specific protein promoter, myelin promoter, and tyrosine hydroxylase promoter. Non-limiting examples of the pancreas-specific promoter include villin promoter, glucagon promoter, and Insulin Islet amyloid polypeptide (amylin) promoter. Non-limiting examples of the colon-specific promoter include carbonic anhydrase I promoter and carcinoembryonic antigen promoter (CEA). Non-limiting examples of the kidney-specific promoter include renin promoter, liver/bone/kidney alkaline phosphatase promoter, and erythropoietin (epo) promoter. Non-limiting examples of the lung-specific promoter include surfactant protein C Uroglobin (cc-10, Cllacell 10 kd protein) promoter. Non-limiting examples of the thyroid-specific promoter include thyroglobulin promoter, and calcitonin promoter. Non-limiting examples of the bone-specific promoter include Alpha 1 (I) collagen promoter, osteocalcin promoter, and bone sialoglycoprotein promoter. Non-limiting examples of the skin-specific promoter include K-14-keratin promoter, human keratin 1 or 6 promoter, and loicrin promoter. Non-limiting examples of the prostate-specific promoter include prostate specific antigen (PSA) promoter and its mutants including APSA, ARR2PB and probasin (PB) promoters, gp91-phox gene promoter, and prostate-specific kallikrein (hKLK2) promoter. Non-limiting examples of the ovary- or placenta-specific promoter include estrogen-responsive promoter, aromatase cytochrome P450 promoter, cholesterol side chain cleavage P450 promoter, 17 alpha-hydroxylase P450 promoter.
The AAV vectors comprising a variant AAV8 capsid polypeptide described herein may exhibit higher transduction efficiency of the liver compared to a wild-type AAV8 vector. Transduction efficiency of an AAV vector in a liver cell or in the liver may be assessed using methods and techniques known in the art or described in the Examples section below, such as next-generation sequencing (NGS) or fluorescence-activated cell sorting (FACS) of the AAV genomic DNA or RNA, or evaluation of transgene protein expression. In some embodiments, the AAV vector comprising a variant AAV8 capsid polypeptide described herein may have a liver transduction efficiency that is about 1-2500 times higher compared to a wild-type AAV8 vector. In some embodiments, an AAV vector comprising a variant AAV8 capsid polypeptide described herein may have a liver transduction efficiency that is at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times, at least 60 times, at least 70 times, at least 80 times, at least 90 times, at least 100 times, at least 150 times, at least 200 times, at least 500 times at least 800 times, at least 1000 times, at least 1500 times, at least 2000 times, at least 2200 times higher compared to a wild-type AAV8 vector. In some embodiments, an AAV vector comprising a variant AAV8 capsid polypeptide described herein have a liver transduction efficiency that is about 1-1.5 times, about 1.5-2 times, about 1-2 times, about 2-5 times, about 5 times, about 4-8 times, about 5-10 times, about 10 times, about 8-12 times, about 10-15 times, about 15 times, about 12-18 times, about 15-20 times, about 20 times, about 15-25 times, about 30 times, about 35 times, about 20-40 times, about 40 times, about 30-50 times, about 50 times, about 40-80 times, about 50-100 times, about 60 times, about 70 times, about 80 times, about 90 times, about 100 times, about 100-200 times, about 150 times, about 200 times, or about 200-500 times higher compared to a wild-type AAV8 vector.
The AAV vector comprising a variant AAV8 capsid polypeptide described herein may exhibit a higher transduction specificity of the liver compared to the wild-type AAV8 vector. Tissue specificity of an AAV vector may be assessed using methods and techniques known in the art or described in the Examples section below, such as next-generation sequencing (NGS) of the AAV genomic DNA or RNA in the liver compared to other tissues. In some embodiments, the AAV vector comprising a variant AAV8 capsid polypeptide described herein may have a liver transduction specificity that is about 1-5 times higher compared to a wild-type AAV8 vector. In some embodiments, an AAV vector comprising a variant AAV8 capsid polypeptide described herein has a liver transduction specificity that is about 1-1.01 times, about 1-1.02 times, about 1-1.03 times, about 1-1.04 times, about 1-1.05 times, about 1-1.06 times, about 1-1.07 times, about 1-1.08 times, about 1-1.09 times, about 1-1.1 times, about 1-1.11 times, about 1-1.12 times, about 1-1.13 times, about 1-1.14 times, about 1-1.15 times, about 1-1.16 times, about 1-1.17 times, about 1-1.18 times, about 1-1.19 times, about 1-1.2 times, about 1-1.3 times, about 1-1.4 times, about 1-1.5 times, about 1-2 times, or about 1-3 times higher compared to a wild-type AAV8 vector.
In one aspect, the present disclosure provides a host cell comprising a recombinant vector comprising a variant AAV8 capsid polypeptide described herein or a recombinant vector comprising a nucleic acid encoding a variant AAV8 capsid polypeptide described herein.
Host cells may be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including and not limited to, insect cells, yeast cells and mammalian cells. Exemplary host cells include those selected from mammalian species, including, without limitation, cells such as A549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, C3H10T1/2 fibroblasts, BSC 1, BSC 40, BMT 10, VERO, W138, HeLa, 293 cells (which express functional adenoviral E1), Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals including human, monkey, mouse, rat, rabbit, and hamster. Exemplary requirements for the cell used is that it not carry any adenovirus gene other than E1, E2a and/or E4 ORF6; it not contain any other virus gene which could result in homologous recombination of a contaminating virus during the production of rAAV; and it is capable of infection or transfection of DNA and expression of the transfected DNA. In one embodiment, the host cell is one that has rep and cap stably transfected in the cell.
The host cell of the present disclosure can be used for production of the AAV vectors of the present invention. When the host cell of the present invention is used for producing vectors, the host cell may be referred to as a “packaging cell” or “producer cell”. The host cell of the present disclosure may comprise the recombinant vector of the present disclosure as described herein integrated into the genome or retain the recombinant vector in the cell so as to transiently express the variant AAV capsid polypeptide(s).
One host cell useful in the present disclosure is a host cell stably transformed with the sequences encoding rep and cap, and which is transfected with the adenovirus E1, E2a, and E40RF6 DNA and a construct carrying the heterologous nucleic acid as described above. Stable rep and/or cap expressing cell lines, such as B-50 (See, e.g., U.S. Pat. No. 7,238,526, incorporated herein by reference in its entirety), or those described in U.S. Pat. No. 5,658,785, incorporated herein by reference in its entirety, may also be similarly employed. Another desirable host cell contains the minimum adenoviral DNA which is sufficient to express E4 ORF6. Yet other cell lines can be constructed using the variant AAV8 capsid sequences of the present disclosure.
The preparation of a host cell according to this disclosure involves techniques such as assembly of selected DNA sequences. This assembly may be accomplished utilizing conventional techniques. Such techniques include cDNA and genomic cloning, which are well known (See, e.g., Sambrook et al. (2014) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, incorporated herein by reference in its entirety), use of overlapping oligonucleotide sequences of the adenovirus and AAV genomes, combined with polymerase chain reaction, synthetic methods, and any other suitable methods which provide the desired nucleotide sequence.
Introduction of the molecules (as plasmids or viruses) into the host cell may also be accomplished using techniques known to the skilled artisan and as discussed throughout the specification. In some embodiment, standard transfection techniques are used, e.g., polyethylenimine (PEI)-mediated transfection, CaPO4 transfection or electroporation, and/or infection by hybrid adenovirus/AAV vectors into cell lines such as the human embryonic kidney cell line HEK 293 (a human kidney cell line containing functional adenovirus E1 genes which provides trans-acting E1 proteins). Other techniques, such as direct microinjection into cells, liposome-mediated gene transfection, or nucleic acid delivery using a high-speed particle gun can also be used.
AAV vectors of the present disclosure may be prepared using methods and techniques known in the art and described in the Examples section below. For example, the AAV preparation may be produced by transfected host cells. In certain embodiments, the AAV preparation represents a supernatant harvested or cell suspension from a cell culture comprising host cells transfected with a triple plasmid system, wherein one plasmid of the system comprises a gene or cDNA of interest, one plasmid encodes a capsid protein. In certain embodiments, the capsid protein is a variant AAV8 capsid protein described herein. Triple plasmid transfection for purposes of rAAV production is known in the art. See, e.g., Qu et al. (2015), Curr Pharm Biotechnol. August; 16(8): 684-695, and Mizukami et al. (1998) “A Protocol for AAV vector production and purification.” PhD dissertation, Division of Genetic Therapeutics, Center for Molecular Medicine, Jichi Medical School; and Kotin et al. (2011) Hum. Mol. Genet. 20(R1):R2-R6. In certain embodiments, the transfection may be carried out using inorganic compounds, e.g., calcium phosphate, or organic compounds, polyethylenimine (PEI), or non-chemical means, e.g., electroporation.
In certain embodiments, the host cells are adherent cells. In certain embodiments, the host cells are suspension cells. In certain embodiments, the host cells are HEK293 cells or Sf9 cells (e.g., baculovirus infected Sf9 cells) or HeLa or BHK (Herpes Virus System). In certain embodiments, the cell culture comprises culture medium which is serum and protein free. In certain embodiments, the medium is chemically defined and is free of animal derived components, e.g., hydrolysates.
In certain embodiments, the preparation comprising recombinant AAV particles represents a preparation comprising HEK293 cells transfected with a triple plasmid system. In certain embodiments, the preparation comprising AAV particles represents a preparation of the harvest after about 2 to about 7 days after transfection of the HEK293 cells or when the cell culture has a cell density of greater than or about 5×106 cells/mL and has a cell viability of greater than or about 50%.
In certain embodiments, the AAV is prepared by a triple plasmid transfection followed by harvest from one to 7 days later. In certain embodiments, the AAV is prepared from cell disruption.
In certain embodiments, the AAV is prepared by the following: The HEK293 cells are adherent and grown in a commercially-available culture medium that may be chemically-defined and may be free of animal-derived components, e.g. serum and proteins. The cells are cultured to a cell density of about 3×106 to about 12×106 cells/ml, e.g., about 6×106 to about 10×106 cells/ml, which leads to a confluence of 50-80% when the cells adhere to the surface. The cells are then split in about a 1:2 ratio such that the cell density is about 3-5×106 cells/ml. After the split and after the cells are allowed sufficient time to adhere firmly to the growth surface, the cells may be transfected with three plasmids that include (1) a helper plasmid capable of providing one or more helper viral functions essential AAV production, (2) a plasmid that encodes for one or more genes involved in capsid generation, replication and packaging of the virus, and (3) a plasmid comprising a gene of interest (GOI) to be packaged into the resulting rAAV particle. For example, the GOI may be a vector DNA comprising human coagulation Factor IX Padua in a single stranded self-complementary form, with the vector DNA. As another example, the GOI may be a vector DNA comprising human coagulation Factor IX Padua in a double stranded self-complementary form, with the vector DNA having a full length of 4.8 kB. As another example, the GOI may be a vector DNA comprising a B-domain deleted human coagulation Factor VIII in a single stranded self-complementary form, with the vector DNA, included by ITRs, having a full length of 4.8 kB, after rescue from the plasmid vector. Other GOI may be used. Transfection may be carried out in a transient manner, such as by using cationic polymers. Before elution, the HEK293 cell line may be cultivated for at least about 1 days, e.g., 3-5 days, before harvesting.
In some embodiments, the AAV preparation is a concentrated AAV preparation. In certain embodiments, the AAV preparation comprises at least about 1×1010, about 1×1011, about 1×1012, about 1×1013, about 1×1014, or about 1×1015 AAV total particles per mL. In certain embodiments, the AAV preparation comprises at least about 1×1012 AAV total particles per mL. The AAV particles may include empty AAV capsids and full AAV capsids.
In certain embodiments, the preparation comprising AAV particles is described in U.S. Publication No. US20190365835, which is incorporated herein in its entirety.
Purification of the AAV vectors of the present disclosure may be carried out using standard techniques known in the art and may optionally be combined with one or more additional steps.
In exemplary embodiments, purification of the AAV vectors of the present disclosure may comprise an ultracentrifugation step during which a density gradient is formed. Though not wishing to be bound to a theory, it is believed that the ultracentrifugation step allows for full AAV capsids to be partially separated from empty AAV capsids. Examples of ultracentrifugation protocols can be found in, for example, U.S. Pat. No. 8,969,533 and US Publication No. US20190365835, each of which are incorporated herein in their entirety for all purposes.
Purification of the AAV vectors of the present disclosure may comprise yet other additional steps, which may further increase the purity of the AAV and remove other unwanted components and/or concentrate the preparation and/or condition the preparation for a subsequent step.
In certain embodiments, purification comprises a depth filtration step. In certain embodiments, purification comprises subjecting a fraction of a transfected HEK293 cell culture supernatant to depth filtration using a filter comprising cellulose and perlites and having a minimum permeability of about 500 L/m2. In certain embodiments, purification further comprises use of a filter having a minimum pore size of about 0.2 μm. In certain embodiments, the depth filtration is followed by filtration through the filter having a minimum pore size of about 0.2 μm. In certain embodiments, one or both of the depth filter and filter having a minimum pore size of about 0.2 μm are washed and the washes are collected. In certain embodiments, the washes are pooled together and combined with the filtrate obtained upon depth filtration and filtration with the filter having a minimum pore size of about 0.2 μm. In certain embodiments, the depth filtration step and other filtration step occurs prior to the ultracentrifugation step described herein.
In certain embodiments, purification of the AAV vectors of the present disclosure may comprise one or more chromatography steps. In certain embodiments, purification comprises a negative chromatography step whereby unwanted components bind to the chromatography resin and the desired AAV does not bind to the chromatography resin. In certain embodiments, purification comprises a negative anion exchange (AEX) chromatography step, or an AEX chromatography step in the “non-binding mode”. Advantages of “non-binding mode” include relative ease of carrying out the procedure and in conducting subsequent assaying. Accordingly, in certain embodiments, the methods of purifying AAV particles comprise performing negative anion exchange (AEX) chromatography on a fraction comprising AAV particles by applying the fraction to an AEX chromatography column or membrane under conditions that allow for the AAV to flow through the AEX chromatography column or membrane and collecting AAV particles. In certain embodiments, the fraction is applied to the AEX chromatography column or membrane with a loading buffer comprising about 100 mM to about 150 mM salt, e.g., NaCl, optionally, wherein the pH of the loading buffer is about 8 to about 9. In certain embodiments, the loading buffer comprises about 115 mM to about 130 mM salt, e.g., NaCl, optionally, wherein the loading buffer comprises about 120 mM to about 125 mM salt, e.g., NaCl. In certain embodiments, the negative AEX step occurs prior to the ultracentrifugation step described herein.
In certain embodiments, purification of the AAV vectors of the present disclosure may comprise concentrating an AAV fraction using an ultra/diafiltration system. In certain embodiments, purification methods comprise one more tangential flow filtration (TFF) steps. In certain embodiments, the AAV fraction undergoes ultra/diafiltration. In certain embodiments, the AAV fraction is concentrated with the ultra/diafiltration system before a step comprising performing negative AEX chromatography, after a step comprising performing negative AEX chromatography, or before and after comprising performing negative AEX chromatography.
In certain embodiments, the methods of the present disclosure comprise treating a fraction comprising AAV particles with a solvent detergent to inactivate lipid enveloped viruses.
In certain embodiments, purification of the AAV vectors of the present disclosure comprises filtration of a fraction comprising rAAV particles to remove viruses of greater size than the rAAV particles in the fraction. In certain embodiments, purification of the AAV vectors of the present disclosure comprises filtration of a fraction comprising AAV to remove viruses sized greater than or about 35 nm. In certain embodiments, the pore size of the filter is in the nanometer range, and, in certain embodiments, the purification method comprises nanofiltration. In certain embodiments, the purification method of the present disclosure comprises use of a nanofilter of pore size in the range of 35 nanometer+2 nanometer, as determined by a water flow method. Classification of the type of filter is dependent on membrane structure, material, and vendor.
In certain embodiments, during the filtration step, a pressure difference over the filter is maintained. In certain embodiments, the pressure (pressure drop across the filter) is about 0.02 MPa to about 0.1 MPa. In certain embodiments, the pressure (e.g., pressure drop across the filter) is about 0.02 MPa to about 0.08 MPa. In case the filter is run in dead-end mode, the pressure difference can be affected by the feed pressure of the sample applied (i.e., by adjustment of a pump to a specific flow, which affects the feed pressure).
In certain embodiments, the filtration step for removal of viruses larger than the rAAV particles occurs once during the process of the present disclosure. In certain embodiments, the filtration step occurs twice during the process. In certain embodiments, the filtration step for removal of viruses larger than the rAAV particles occurs after the ultracentrifugation step described herein. In certain embodiments, the filtration step for removal of viruses larger than the rAAV particles occurs after a polish step.
In certain embodiments, purification of the AAV vectors of the present disclosure comprises a polish step comprising performing AEX chromatography, optionally with a column comprising tentacle gel.
In one aspect, the present disclosure provides a pharmaceutical composition comprising a recombinant vector (e.g., recombinant AAV vector) described herein. The pharmaceutical composition containing a recombinant vector (e.g., recombinant AAV vector) of the disclosure, may contain a pharmaceutically acceptable excipient, diluent or carrier. Examples of suitable pharmaceutical carriers and/or excipients are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Such carriers can be formulated by conventional methods and can be administered to the subject at a suitable dose. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intraperitoneal, subcutaneous, intramuscular, topical or intradermal administration. The route of administration may depend on the kind of vector contained in the pharmaceutical composition. The dosage regimen will be determined by the attending physician and other clinical factors. As is well known in the medical arts, dosages for any one patient depends on many factors, including the patient's size, body surface area, age, sex, the particular compound to be administered, time and route of administration, the kind and stage of infection or disease, general health and other drugs being administered concurrently.
In one aspect, the present disclosure provides a method of delivering a gene product to a liver cell, said method comprising contacting the liver cell with an effective amount of the AAV vectors described herein or the pharmaceutical composition described herein.
Liver cells suitable for use in the methods of the present disclosure include, but are not limited to, hepatocytes, hepatic stellate cells, Kupffer cells, or liver endothelial cells. In some embodiments, the liver cell is a hepatocyte.
In one aspect, the present disclosure provides a method of delivering a gene product to the liver of a subject in need thereof, said method comprising administering to the subject an effective amount of the AAV vectors described herein or the pharmaceutical composition described herein.
In some embodiments, for the therapeutic methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×105 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×106 vg to about 1×109 vg, about 1×107 vg to about 1×1010 vg, about 1×108 vg to about 1×1011 vg, about 1×109 vg to about 1×1012 vg, about 1×1010 vg to about 1×1013 vg, about 1×1011 vg to about 1×1014 vg, about 1×1012 vg to about 1×1015 vg, about 1×1013 vg to about 1×1016 vg, or about 1×1014 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×1010 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vector vectors administered to the subject is at least about 1×106 vg, at least about 1×107 vg, at least about 1×108 vg, at least about 1×109 vg, at least about 1×1010 vg, at least about 1×1011 vg, at least about 1×1012 vg, at least about 5×1012 vg, at least about 1×1013 vg, at least about 1×1014 vg, or at least about 1×1015 vg. In certain embodiments, the vg is total vector genome per subject.
In certain embodiments, for the therapeutic methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×105 vg/kg to about 1×1014 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×106 vg/kg to about 1×108 vg/kg, about 1×107 vg/kg to about 1×109 vg/kg, about 1×108 vg/kg to about 1×1010 vg/kg, about 1×109 vg/kg to about 1×1011 vg/kg, about 1×1010 vg/kg to about 1×1012 vg/kg, about 1×1011 vg/kg to about 1×1013 vg/kg, or about 1×1012 vg/kg to about 1×1014 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×1010 vg/kg to about 1×1016 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vector vectors administered to the subject is at least about 1×106 vg/kg, at least about 1×107 vg/kg, at least about 1×108 vg/kg, at least about 1×109 vg/kg, at least about 1×1010 vg/kg, at least about 1×1011 vg/kg, at least about 1×1012 vg/kg, at least about 1×1013 vg/kg. In certain embodiments, the vg/kg is total vector genome per kg of the subject.
In some embodiments, a therapeutically effective amount of a protein or peptide encoded by the rAAV vectors is produced in the mammalian host. Whether a therapeutically effective amount of a particular protein is produced in the mammalian host using a subject method is readily determined using assays appropriate to the particular protein. For example, where the protein is EPO, hematocrit is measured.
The AAV vectors or the pharmaceutical compositions described herein may be administered to the subject via any route, for example and without limitation, intravenous, parenteral, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprotatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection. In one embodiment, the AAV vector(s) or the pharmaceutical composition(s) described herein is administered to the subject via intravenous injection.
The AAV vectors or the pharmaceutical compositions described herein may be administered at least once in order to treat or ameliorate or prevent a disease or condition described herein. In some embodiments, the AAV vectors or the pharmaceutical compositions may be administered more than one time, for example from one to four times daily up to a non-limited number of days.
The gene product delivered via the recombinant AAV vectors to a subject may be used for the treatment or prevention of a disease or disorder that arise from or are related to liver cells and/or liver function. For example, the gene product and associated disease states include, but are not limited to: glucose-6-phosphatase, associated with glycogen storage deficiency type 1A; phosphoenolpyruvate-carboxykinase, associated with Pepck deficiency; galactose-1 phosphate uridyl transferase, associated with galactosemia; phenylalanine hydroxylase, associated with phenylketonuria; branched chain alpha-ketoacid dehydrogenase, associated with Maple syrup urine disease; fumarylacetoacetate hydrolase, associated with tyrosinemia type 1; methylmalonyl-CoA mutase, associated with methylmalonic acidemia; medium chain acyl CoA dehydrogenase, associated with medium chain acetyl CoA deficiency; ornithine transcarbamylase, associated with ornithine transcarbamylase deficiency; argininosuccinic acid synthetase, associated with citrullinemia; low density lipoprotein receptor protein, associated with familial hypercholesterolemia; UDP-glucuronosyltransferase, associated with Crigler-Najjar disease; adenosine deaminase, associated with severe combined immunodeficiency disease; hypoxanthine guanine phosphoribosyl transferase, associated with Gout and Lesch-Nyan syndrome; biotinidase, associated with biotinidase deficiency; beta-glucocerebrosidase, associated with Gaucher disease; beta-glucuronidase, associated with Sly syndrome; peroxisome membrane protein 70 kDa, associated with Zellweger syndrome; porphobilinogen deaminase, associated with acute intermittent porphyria; alpha-1 antitrypsin for treatment of alpha-1 antitrypsin deficiency (emphysema); and a tumor suppressor gene such as p53 for the treatment of various cancers.
In some embodiments, the gene product delivered via the recombinant AAV vectors to a subject may be used for the treatment or prevention of a coagulation disorder. “Coagulation disorders” include bleeding disorders caused by deficient blood coagulation factor activity and deficient platelet activity. Blood coagulation factors include, but are not limited to, Factor V (FV), FVII, FVIII, FIX, FX, FXI, FXIII, FII (responsible for hypoprothrombinemia), Protein C, and von Willebrand's factor. Factor deficiencies are caused by, for instance, a shortened in vivo-half-life of the factor, altered binding properties of the factor, genetic defects of the factor, and a reduced plasma concentration of the factor. Coagulation disorders can be congenital or acquired. Potential genetic defects include deletions, additions and/or substitution within a nucleotide sequence encoding a clotting factor whose absence, presence, and/or substitution, respectively, has a negative impact on the clotting factor's activity. Coagulation disorders also stem from development of inhibitors or autoimmunity (e.g., antibodies) against clotting factors. In one example, the coagulation disorder is hemophilia A. Alternatively, the coagulation disorder is hemophilia B or hemophilia C.
Platelet disorders are caused by deficient platelet function or abnormally low platelet number in circulation. Low platelet count may be due to, for instance, underproduction, platelet sequestration, or uncontrolled patent destruction. Thrombocytopenia (platelet deficiencies) may be present for various reasons, including chemotherapy and other drug therapy, radiation therapy, surgery, accidental blood loss, and other disease conditions. Exemplary disease conditions that involve thrombocytopenia are: aplastic anemia; idiopathic or immune thrombocytopenia (ITP), including idiopathic thrombocytopenic purpura associated with breast cancer; HIV-associated ITP and HIV-related thrombotic thrombocytopenic purpura; metastatic tumors which result in thrombocytopenia; systemic lupus erythematosus, including neonatal lupus syndrome splenomegaly; Fanconi's syndrome; vitamin B12 deficiency; folic acid deficiency; May-Hegglin anomaly; Wiskott-Aldrich syndrome; chronic liver disease; myelodysplastic syndrome associated with thrombocytopenia; paroxysmal nocturnal hemoglobinuria; acute profound thrombocytopenia following C7E3 Fab (Abciximab) therapy; alloimmune thrombocytopenia, including maternal alloimmune thrombocytopenia; thrombocytopenia associated with antiphospholipid antibodies and thrombosis; autoimmune thrombocytopenia; drug-induced immune thrombocytopenia, including carboplatin-induced thrombocytopenia and heparin-induced thrombocytopenia; fetal thrombocytopenia; gestational thrombocytopenia; Hughes' syndrome; lupoid thrombocytopenia; accidental and/or massive blood loss; myeloproliferative disorders; thrombocytopenia in patients with malignancies; thrombotic thrombocytopenia purpura, including thrombotic microangiopathy manifesting as thrombotic thrombocytopenic purpura/hemolytic uremic syndrome in cancer patients; post-transfusion purpura (PTP); autoimmune hemolytic anemia; occult jejunal diverticulum perforation; pure red cell aplasia; autoimmune thrombocytopenia; nephropathia epidemica; rifampicin-associated acute renal failure; Paris-Trousseau thrombocytopenia; neonatal alloimmune thrombocytopenia; paroxysmal nocturnal hemoglobinuria; hematologic changes in stomach cancer; hemolytic uremic syndromes (e.g., uremic conditions in childhood); and hematologic manifestations related to viral infection including hepatitis A virus and CMV-associated thrombocytopenia. Platelet disorders also include, but are not limited to, Von Willebrand Disease, paraneoplastic platelet dysfunction, Glanzman's thrombasthenia, and Bernard-Soulier disease. Additional bleeding disorders amenable to treatment with a recombinant AAV vector of the present disclosure include, but are not limited to, hemorrhagic conditions induced by trauma; a deficiency in one or more contact factors, such as FXI, FXII, prekallikrein, C1-inhibitor and high molecular weight kininogen (HMWK); vitamin K deficiency; a fibrinogen disorder, including afibrinogenemia, hypofibrinogenemia, and dysfibrinogenemia; and alpha2-antiplasmin deficiency. All of the above are considered “blood coagulation disorders” in the context of the disclosure.
Other suitable therapeutic polypeptides and proteins include those which may be useful for treating individuals suffering from autoimmune diseases and disorders by conferring a broad based protective immune response against targets that are associated with autoimmunity including cell receptors and cells which produce “self”-directed antibodies. T cell mediated autoimmune diseases include Rheumatoid arthritis (RA), multiple sclerosis (MS), Sjögren's syndrome, sarcoidosis, insulin dependent diabetes mellitus (IDDM), autoimmune thyroiditis, reactive arthritis, ankylosing spondylitis, scleroderma, polymyositis, dermatomyositis, psoriasis, vasculitis, Wegener's granulomatosis, Crohn's disease and ulcerative colitis.
In some embodiments, for all therapeutic methods disclosed herein, the subject is a human or non-human animal (e.g., chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats, rabbit and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, or geese). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human, such as a mouse, a rat, a mouse, a rabbit, a dog, a cat, a sheep, a pig, or a non-human primate.
In one aspect, provided herein are methods of treating liver-borne blood disorders in a human subject in need thereof, said methods comprising administering to the subject an effective amount of an adeno-associated virus (AAV) vector described herein or a pharmaceutical composition described herein, wherein the AAV vector comprises a heterologous nucleic acid comprising a nucleotide sequence encoding a therapeutic protein, wherein the therapeutic protein is a protein used for the treatment of a liver-borne blood disorder.
In some embodiments, for the therapeutic methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×105 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×106 vg to about 1×109 vg, about 1×107 vg to about 1×1010 vg, about 1×108 vg to about 1×1011 vg, about 1×109 vg to about 1×1012 vg, about 1×1010 vg to about 1×1013 vg, about 1×1011 vg to about 1×1014 vg, about 1×1012 vg to about 1×1015 vg, about 1×1013 vg to about 1×1016 vg, or about 1×1014 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×1010 vg to about 1×1016 vg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vector vectors administered to the subject is at least about 1×106 vg, at least about 1×107 vg, at least about 1×108 vg, at least about 1×109 vg, at least about 1×1010 vg, at least about 1×1011 vg, at least about 1×1012 vg, at least about 5×1012 vg, at least about 1×1013 vg, at least about 1×1014 vg, or at least about 1×1015 vg. In certain embodiments, the vg is total vector genome per subject.
In certain embodiments, for the therapeutic methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×105 vg/kg to about 1×1014 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×106 vg/kg to about 1×108 vg/kg, about 1×107 vg/kg to about 1×109 vg/kg, about 1×108 vg/kg to about 1×1010 vg/kg, about 1×109 vg/kg to about 1×1011 vg/kg, about 1×1010 vg/kg to about 1×1012 vg/kg, about 1×1011 vg/kg to about 1×1013 vg/kg, or about 1×1012 vg/kg to about 1×1014 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vectors administered to the subject is between about 1×1010 vg/kg to about 1×1016 vg/kg. In certain embodiments, for the methods disclosed herein, the dose of the AAV vector vectors administered to the subject is at least about 1×106 vg/kg, at least about 1×107 vg/kg, at least about 1×108 vg/kg, at least about 1×109 vg/kg, at least about 1×1010 vg/kg, at least about 1×1011 vg/kg, at least about 1×1012 vg/kg, at least about 1×1013 vg/kg. In certain embodiments, the vg/kg is total vector genome per kg of the subject.
In some embodiments, for the therapeutic methods disclosed herein, a therapeutically effective amount of a protein or peptide encoded by the rAAV vectors is produced in the mammalian host. Whether a therapeutically effective amount of a particular protein is produced in the mammalian host using a subject method is readily determined using assays appropriate to the particular protein. For example, where the protein is EPO, hematocrit is measured.
The AAV vectors or the pharmaceutical compositions described herein may be administered to the subject via any route, for example and without limitation, intravenous, parenteral, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprotatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection. In one embodiment, the AAV vector(s) or the pharmaceutical composition(s) described herein is administered to the subject via intravenous injection.
The AAV vectors or the pharmaceutical compositions described herein may be administered at least once in order to treat or ameliorate a liver-borne blood disorder. In some embodiments, the AAV vectors or the pharmaceutical compositions may be administered more than one time, for example from one to four times daily up to a non-limited number of days.
The gene product delivered via the recombinant AAV vectors to a subject may be used for the treatment of a liver-borne blood disorder. A “liver-borne blood disorder” is for example a coagulation disorder or a blood coagulation disorder as disclosed in the next two paragraphs, optionally disclosed therein together with corresponding therapeutic proteins to be used for the treatment of a liver-borne blood disorder.
In some embodiments, the gene product delivered via the recombinant AAV vectors to a subject may be used for the treatment of a coagulation disorder. “Coagulation disorders” include bleeding disorders caused by deficient blood coagulation factor activity and deficient platelet activity. Blood coagulation factors include, but are not limited to, Factor V (FV), FVII, FVIII, FIX, FX, FXI, FXIII, FII (responsible for hypoprothrombinemia), Protein C, and von Willebrand's factor. Factor deficiencies are caused by, for instance, a shortened in vivo-half-life of the factor, altered binding properties of the factor, genetic defects of the factor, and a reduced plasma concentration of the factor. Coagulation disorders can be congenital or acquired. Potential genetic defects include deletions, additions and/or substitution within a nucleotide sequence encoding a clotting factor whose absence, presence, and/or substitution, respectively, has a negative impact on the clotting factor's activity. Coagulation disorders also stem from development of inhibitors or autoimmunity (e.g., antibodies) against clotting factors. In one example, the coagulation disorder is hemophilia A. Alternatively, the coagulation disorder is hemophilia B or hemophilia C.
Platelet disorders are caused by deficient platelet function or abnormally low platelet number in circulation. Low platelet count may be due to, for instance, underproduction, platelet sequestration, or uncontrolled patent destruction. Thrombocytopenia (platelet deficiencies) may be present for various reasons, including chemotherapy and other drug therapy, radiation therapy, surgery, accidental blood loss, and other disease conditions. Exemplary disease conditions that involve thrombocytopenia are: aplastic anemia; idiopathic or immune thrombocytopenia (ITP), including idiopathic thrombocytopenic purpura associated with breast cancer; HIV-associated ITP and HIV-related thrombotic thrombocytopenic purpura; metastatic tumors which result in thrombocytopenia; systemic lupus erythematosus, including neonatal lupus syndrome splenomegaly; Fanconi's syndrome; vitamin B12 deficiency; folic acid deficiency; May-Hegglin anomaly; Wiskott-Aldrich syndrome; chronic liver disease; myelodysplastic syndrome associated with thrombocytopenia; paroxysmal nocturnal hemoglobinuria; acute profound thrombocytopenia following C7E3 Fab (Abciximab) therapy; alloimmune thrombocytopenia, including maternal alloimmune thrombocytopenia; thrombocytopenia associated with antiphospholipid antibodies and thrombosis; autoimmune thrombocytopenia; drug-induced immune thrombocytopenia, including carboplatin-induced thrombocytopenia and heparin-induced thrombocytopenia; fetal thrombocytopenia; gestational thrombocytopenia; Hughes' syndrome; lupoid thrombocytopenia; accidental and/or massive blood loss; myeloproliferative disorders; thrombocytopenia in patients with malignancies; thrombotic thrombocytopenia purpura, including thrombotic microangiopathy manifesting as thrombotic thrombocytopenic purpura/hemolytic uremic syndrome in cancer patients; post-transfusion purpura (PTP); autoimmune hemolytic anemia; occult jejunal diverticulum perforation; pure red cell aplasia; autoimmune thrombocytopenia; nephropathia epidemica; rifampicin-associated acute renal failure; Paris-Trousseau thrombocytopenia; neonatal alloimmune thrombocytopenia; paroxysmal nocturnal hemoglobinuria; hematologic changes in stomach cancer; hemolytic uremic syndromes (e.g., uremic conditions in childhood); and hematologic manifestations related to viral infection including hepatitis A virus and CMV-associated thrombocytopenia. Platelet disorders also include, but are not limited to, Von Willebrand Disease, paraneoplastic platelet dysfunction, Glanzman's thrombasthenia, and Bernard-Soulier disease. Additional bleeding disorders amenable to treatment with a recombinant AAV vector of the present disclosure include, but are not limited to, hemorrhagic conditions induced by trauma; a deficiency in one or more contact factors, such as FXI, FXII, prekallikrein, C1-inhibitor and high molecular weight kininogen (HMWK); vitamin K deficiency; a fibrinogen disorder, including afibrinogenemia, hypofibrinogenemia, and dysfibrinogenemia; and alpha2-antiplasmin deficiency. All of the above are considered “blood coagulation disorders” in the context of the disclosure.
Embodiment 1. A variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-50.
Embodiment 2. The variant AAV8 capsid polypeptide of embodiment 1, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 8, 9, 11, 15, 16, 18, 19, 26, 27, 29, 32, 34, 35, 36, 38, 40, 42, 43, and 45.
Embodiment 3. The variant AAV8 capsid polypeptide of embodiment 1 or 2, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 8, 9, 19, 26, 27, and 42.
Embodiment 4. The variant AAV8 capsid polypeptide of any one of embodiments 1-3, wherein the peptide insertion comprises an amino acid sequence of SEQ ID NO: 27.
Embodiment 5. The variant AAV8 capsid polypeptide of any one of embodiments 1-4, wherein the peptide insertion further comprises a G at the N-terminus and an A at the C-terminus.
Embodiment 6. The variant AAV8 capsid polypeptide of embodiments 1-5, wherein the three amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQS or GQR and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA.
Embodiment 7. The variant AAV8 capsid polypeptide of any one of embodiments 1-6, wherein the variant AAV8 capsid polypeptide has tropism for liver.
Embodiment 8. A variant adeno-associated virus 8 (AAV8) capsid polypeptide comprising a peptide insertion after amino acid 590 (VP1 numbering) relative to a wild-type AAV8 capsid polypeptide, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 51-100, and wherein N590 is deleted.
Embodiment 9. The variant AAV8 capsid polypeptide of embodiment 8, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 52, 58, 59, 61, 65, 66, 68, 69, 76, 77, 79, 82, 84, 85, 86, 88, 90, 92, 93, and 95.
Embodiment 10. The variant AAV8 capsid polypeptide of embodiment 8 or 9, wherein the peptide insertion comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 52, 58, 59, 69, 76, 77, and 92.
Embodiment 11. The variant AAV8 capsid polypeptide of any one of embodiments 8-10, wherein the peptide insertion comprises an amino acid sequence of SEQ ID NO: 77.
Embodiment 12. The variant AAV8 capsid polypeptide of any one of embodiments 8-11, wherein the peptide insertion further comprises an A at the C-terminus.
Embodiment 13. The variant AAV8 capsid polypeptide of any one of embodiment 8-12, wherein the two amino acids preceding the site into which said peptide is inserted into the capsid polypeptide have been changed to GQ or GQ and/or the three amino acids following the site into which said peptide is inserted have been changed to QAA.
Embodiment 14. The variant AAV8 capsid polypeptide of any of embodiments 8-13, wherein the variant AAV8 capsid polypeptide has tropism for liver.
Embodiment 15. The variant AAV8 capsid polypeptide of any one of embodiments 1-14, wherein the variant AAV8 capsid polypeptide is a VP1, VP2, or VP3.
Embodiment 16. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 1-15, comprising an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and 200.
Embodiment 17. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of embodiment 16, comprising an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, and 190.
Embodiment 18. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of embodiment 16 or 17, comprising an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184.
Embodiment 19. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16-19, comprising an amino acid sequence having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 154.
Embodiment 20. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of embodiment 16, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, and 200.
Embodiment 21. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16, 17, and 20, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 104, 116, 118, 122, 130, 132, 136, 138, 152, 154, 158, 164, 168, 170, 172, 176, 180, 184, 186, and 190.
Embodiment 22. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16-18, 20 and 21, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 104, 116, 118, 138, 152, 154, and 184.
Embodiment 23. The variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16-22 comprising an amino acid sequence of SEQ ID NO: 154.
Embodiment 24. A variant adeno-associated virus 8 (AAV8) capsid polypeptide, comprising an amino acid sequence of amino acids 138-747 of the variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16-23.
Embodiment 25. A variant adeno-associated virus 8 (AAV8) capsid polypeptide, comprising an amino acid sequence of amino acids 204-747 of the variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 16-23.
Embodiment 26. A nucleic acid encoding the variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 1-25.
Embodiment 27. The nucleic acid of embodiment 26, said nucleic acid comprising a nucleotide sequence having at least 80% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, and 199.
Embodiment 28. The nucleic acid of embodiment 27, comprising a nucleotide sequence having at least 80% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189.
Embodiment 29. The nucleic acid of embodiment 27 or 28, comprising a nucleotide sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
Embodiment 30. The nucleic acid of any one of embodiments 27-29, comprising a nucleotide sequence having at least 80% sequence identity to an amino acid sequence of SEQ ID NO: 153.
Embodiment 31. The nucleic acid of embodiment 27, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, and 199.
Embodiment 32. The nucleic acid of any one of embodiments 27, 28, and 31, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 103, 115, 117, 121, 129, 131, 135, 137, 151, 153, 157, 163, 167, 169, 171, 175, 179, 183, 185, and 189.
Embodiment 33. The nucleic acid of any one of embodiments 27-29, 31 and 32, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 103, 115, 117, 137, 151, 153, and 183.
Embodiment 34. The nucleic acid of any one of embodiments 27-33, comprising a nucleotide sequence of SEQ ID NO: 153.
Embodiment 35. A nucleic acid encoding a variant adeno-associated virus 8 (AAV8) capsid polypeptide, comprising a nucleotide sequence of nucleotides 412-2244 of nucleic acid of any one of embodiments 27-34.
Embodiment 36. A nucleic acid encoding a variant adeno-associated virus 8 (AAV8) capsid polypeptide, comprising a nucleotide sequence of nucleotides 610-2244 of nucleic acid of any one of embodiments 27-34.
Embodiment 37. A recombinant DNA comprising the nucleic acid of any one of embodiments 26-36.
Embodiment 38. An isolated host cell comprising the nucleic acid of any one of embodiments 26-36 or the recombinant DNA of embodiment 37.
Embodiment 39. An adeno-associated virus (AAV) vector comprising the variant adeno-associated virus 8 (AAV8) capsid polypeptide of any one of embodiments 1-25.
Embodiment 40. The AAV vector of embodiment 39, further comprising a heterologous nucleic acid.
Embodiment 41. The AAV vector of embodiment 40, wherein the heterologous nucleic acid comprises a nucleotide sequence encoding a therapeutic protein.
Embodiment 42. The AAV vector of embodiment 41, wherein the therapeutic protein is an antibody.
Embodiment 43. The AAV vector of embodiment 41, wherein the therapeutic protein is coagulation factor VIII or coagulation factor IX.
Embodiment 44. The AAV vector of any one of embodiments 41 to 43, wherein the nucleotide sequence encoding a therapeutic protein is operably linked to a liver-specific promoter.
Embodiment 45. The AAV vector of embodiment 44, wherein the liver-specific promoter is selected from liver albumin promoter, alpha-fetoprotein promoter, alpha 1-antitrypsin promoter, and transferrin transthyretin promoter.
Embodiment 46. The AAV vector of embodiment 44 or 45, wherein the liver-specific promoter is a transferrin transthyretin promoter.
Embodiment 47. The AAV vector of any one of embodiments 39-46, wherein the AAV vector exhibits higher transduction efficiency of the liver compared to the AAV8 wild-type vector.
Embodiment 48. The AAV vector of embodiment 47, wherein the transduction efficiency of the AAV vector is between 1 to 2220-fold higher compared to the AAV8 wild-type vector.
Embodiment 49. The AAV vector of any one of embodiments 39-48, wherein the AAV vector exhibits higher transduction specificity of the liver compared to the AAV8 wild-type vector.
Embodiment 50. The AAV vector of embodiment 49, wherein the transduction specificity of the AAV vector is between 1 to 1.1-fold higher compared to the AAV8 wild-type vector.
Embodiment 51. A pharmaceutical composition comprising the AAV vector of any one of embodiments 39-50, and a pharmaceutically acceptable carrier and/or excipient.
Embodiment 52. A method of delivering a gene product to a liver cell, said method comprising contacting the liver cell with an effective amount of the adeno-associated virus (AAV) vector of any one of embodiments 39-50 or the pharmaceutical composition of embodiment 51.
Embodiment 53. The method of embodiment 52, wherein the liver cell is a hepatic stellate cell, a Kupffer cell, or a liver endothelial cell.
Embodiment 54. The method of embodiment 53, wherein the liver cell is a hepatocyte.
Embodiment 55. A method of delivering a gene product to the liver of a subject in need thereof, said method comprising administering to the subject an effective amount of the adeno-associated virus (AAV) vector of any one of embodiments 39-50 or the pharmaceutical composition of embodiment 51.
Embodiment 56. The method of embodiment 55, wherein the AAV vector or the pharmaceutical composition is administered at about 1×1011 to about 1×1014 vg/kg.
Embodiment 57. The method of embodiment 56, wherein the AAV vector or the pharmaceutical composition is administered at about 5×1011 vg/kg.
Embodiment 58. The method of any one of embodiments 55-57, wherein the AAV vector or the pharmaceutical composition is administered via intravenous, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprostatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection.
Embodiment 59. The method of any one of embodiments 55-58, wherein the subject has hemophilia A or hemophilia B.
Embodiment 60. The method of any one of embodiments 55-59, wherein the subject is human.
Embodiment 61. The method of any one of embodiments 55-59, wherein the subject is a non-human.
Embodiment 62. The method of embodiment 61, wherein the non-human is a mouse, a rat, a rabbit, a dog, a cat, a sheep, a pig, or a non-human primate.
Embodiment 63. A method of treating a liver-borne blood disorder in a human subject in need thereof, said method comprising administering to the subject an effective amount of the adeno-associated virus (AAV) vector of any one of embodiments 41 and 43-50 or a pharmaceutical composition comprising the AAV vector of any one of embodiments 41 and 43-50, and a pharmaceutically acceptable carrier and/or excipient, wherein the therapeutic protein is a protein used for the treatment of a liver-borne blood disorder.
Embodiment 64. The method of embodiment 63, wherein the therapeutic protein is a blood coagulation factor.
Embodiment 65. The method of embodiment 63 or 64, wherein the liver-borne blood disorder is a coagulation disorder.
Embodiment 66. The method of embodiment 65, wherein the coagulation disorder is hemophilia.
Embodiment 67. The method of embodiment 66, wherein the hemophilia is hemophilia A or hemophilia B.
Embodiment 68. The method of embodiment 63, wherein the AAV vector or the pharmaceutical composition is administered at about 1×1011 to about 1×1014 vg/kg.
Embodiment 69. The method of embodiment 68, wherein the AAV vector or the pharmaceutical composition is administered at about 5×1011 vg/kg.
Embodiment 70. The method of any one of embodiments 63-69, wherein the AAV vector or the pharmaceutical composition is administered via intravenous, intramuscular, subcutaneous, intratumor, intradermal, transdermal, intranodal, intraspinal, intraprostatic, intralymphatic, intraparenchymal, intraportal or intraperitoneal route injection.
All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.
The embodiments of this disclosure are described herein. Variations of these embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the disclosure to be practiced otherwise than as specifically described herein. Accordingly, this disclosure includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the disclosure, even if the combination of features is not found together in the same sentence, or paragraph, or section of this document, unless otherwise indicated herein or otherwise clearly contradicted by context. The disclosure also includes, for instance, all embodiments of the disclosure narrower in scope in any way than the variations specifically mentioned above.
All publications, patents and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference in its entirety to the extent that it is not inconsistent with the disclosure.
It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.
Additional aspects and details of the disclosure will be apparent from the following examples, which are intended to be illustrative rather than limiting.
Four new viral capsid libraries were created which were to be combined and screened together in liver cell cultures and in vivo.
The goal of this Example was to identify the best peptides from the four different peptide display library which mediate maximum AAV8 transduction of hepatocytes. The best candidates should be novel AAV8 variants that (i) outperform wild-type AAV8 in the liver, and (ii) do so in the presence of neutralizing anti-AAV8 antibodies.
The pool of the four AAV8 peptide display libraries were screened in parallel in both, primary mouse and human hepatocytes. In a third screen, the four pooled libraries were directly injected into adult mice and the livers were extracted one week later. In all three cases, the part of the AAV8 capsid gene from the transduced cells that comprises the peptide insertion were PCR-amplified and then (i) the individual colonies were sequenced by Sanger sequencing after sub-cloning, to monitor successful evolution (evidenced by an enrichment of specific sequences), and (ii) the entire PCR fragment pool was re-cloned into the AAV8 capsid-encoding plasmid for production of a new library.
Concurrent with these three schemes with the AAV8 peptide display libraries, identical screens were also conducted with another library which was generated through “DNA family shuffling” of AAV serotypes 1 to 10. The design of the new shuffled AAV library from AAV1-10 took into account the role of the AAP protein and compatibility of AAV serotypes.
The AAV peptide insertion libraries were pooled into a single comprehensive library and selected for four rounds in Huh-7 cells and primary mouse hepatocytes, and three selection rounds in primary human hepatocytes. For each round of selection, enrichment of individual mutants was observed. After each selection round, a sub-library of AAV mutants was generated, by amplifying and sub-cloning a PCR product spanning the random peptide sequence inserted in the cap gene. For all selections, NGS sequencing was applied. Following injection of the enriched library into animals, the liver and several organs were harvested and NGS sequencing used to identify liver-specific AAV variants. This NGS sequencing established a transduction map of AAV variants across the tissues analyzed and allowed for the isolation of capsids with highest liver specificity.
A summary of results after 4 and 3 rounds of selection of AAV libraries in vitro in Huh-7 cells, mouse and human hepatocytes, respectively is shown in
Materials and methods used in this Example are described below.
293T and Huh-7 (H7) cells were kept in DMEM (Gibco) supplemented with L-Glutamine, 10% FCS and 1:100-Penicillin/Streptomycin (50 mg/ml stock solution). Additionally, 1% of non-essential amino acids was added to the medium for Huh-7 cells. Cells were routinely split according to density every 2-3 days to a maximum of 25 passages and then exchanged with cells from another frozen early-passage vial. Both cell lines were tested negatively for Mycoplasma infection after each thawing.
Primary human hepatocytes (HH) from male donors were ordered from Cytes Biotechnologies upon availability and shipped within 24 hour after isolation. Cells were plated in 6-wells with corresponding hepatocyte growth medium. Primary human cells for validation of barcoded AAVs, i.e., human cardiac myocytes (CM), human saphenous vein endothelial cells (VE), human skeletal muscle cells (SM) and human pulmonary fibroblasts (LF) from male donors, were obtained from PromoCell in frozen vials with corresponding cell culture media, thawed upon arrival and passaged twice in T25 flasks to expand cells and remove cell debris according to manufacturer's recommendations. Subsequently, cells were seeded in a 6-well format and duplicate wells used for AAV transduction experiments.
Animal experiments were performed based on the animal proposal G-89/16. For AAV library selection, 6-8 weeks old C57Bl/6J mice were purchased from Janvier and injected intravenously (i.v.) with 1011 viral particles by tail vein injection. One week after library application, liver (Li) and main off-target tissues were removed and processed for gDNA extraction. These included Lung (Lu), Spleen (Sp), Kidney (Ki), Heart (He), Muscle (Mu), Diaphragm (Di), Pancreas (Pa), Gut (Gu), white Fat (Fa) and Brain (Br). Additional biopsies from all tissues of interest were snap-frozen in liquid N2 as a backup. For the validation of barcoded variants, AAV dose was increased to 1012 viral particles/animal and two weeks incubation time with remaining parameters maintained as described above. Library selections were performed with three animals per selection round, while group size was increased to four animals for the analysis of barcoded vectors.
For mouse hepatocyte (NM) isolation, 6-8 weeks old C57Bl/6J mice were purchased from Janvier. Experiments were performed in accordance with the animal proposal T-67/16. Animals were euthanized using carbon dioxide and the liver perfused through vena cava with liver perfusion medium (Gibco) followed by liver digest medium (Gibco) for 10 min each. Isolated liver cells were resuspended in 35 ml hepatocyte adhesion medium consisting of William's E medium (Sigma) supplemented with L-Glutamine, 10% FCS, 1:100—Penicillin/Streptomycin (50 mg/ml), 1:1000—Dexamethasone (100 μM) and Insulin (50 mg/ml). The cell suspension was further homogenized through a 100 μm cell strainer and hepatocytes separated from other liver cell subtypes by centrifugation on a Percoll (VWR) cushion. Isolated hepatocytes were collected from the pellet after Percoll centrifugation, resuspended in hepatocyte adhesion medium and seeded on collagen-coated 6-well plates. Cells were used for AAV transduction experiments 24 h later.
Genomic DNA (gDNA) and RNA Extraction
Mouse tissue samples were homogenized with metal beads using a TissueLyser (Qiagen) according to manufacturer's recommendations. For peptide library enrichment and biodistribution experiments, only gDNA was extracted from liver or off-target tissues with the DNeasy Blood and Tissue kit (Qiagen) following manufacturer's instructions. For validation experiments, gDNA and RNA were extracted simultaneously with the AllPrep DNA/RNA kit (Qiagen). DNase digestion was performed on column as well as after RNA extraction to remove residual DNA contaminants. Isolation of nucleic acids from primary cells and cell lines was performed, accordingly.
Peptide libraries were constructed by SfiI-based insertion of short DNA oligonucleotides in the cap fragment of recombinant AAV8 serotype at position 590. A set of four different sub-libraries was generated containing either a fully or partially randomized peptide with seven amino acids flanked upstream by a two amino-acid motif “RG” or “SG”. Oligonucleotides used for library construction were purchased from IDT and are listed in Table 1. For all libraries, second strand synthesis was performed with oligo “PEPLIBRev” and double-stranded oligos were digested with BglI, thus yielding overhangs compatible for ligation into Sfi-cleaved cap8 vector backbone.
Cloned peptide libraries were electroporated in electrocompetent E. coli in 20-25 single electroporations per library and theoretical library diversity was calculated based on grown colony numbers ranging from 4.03-6.84×106 clones for individual sub-libraries. The electroporations were pooled and total plasmid DNA was purified from grown bacterial cultures by NucleoBond Maxi kit (Macherey-Nagel) according to manufacturer's instructions.
AAV production was performed in 15 cm dishes by transient transfection with polyethylenimine (PEI). Briefly, 293T cells were seeded at 4.5×106 cells per dish and transfected two days later with an equal ratio of three plasmids for individual virus productions, including one plasmid providing viral rep2 and cap8-PV genes in trans, an adenoviral helper plasmid, and an ITR-flanked reporter construct encoding eYFP under a CMV promoter with a unique 15 nt-long barcode sequence in the 3′UTR assigned to each AAV peptide variant. Virus particles were harvested from cells three days after transfection. Cells were removed with cell scrapers, pooled in 50 ml falcons and pelleted by centrifugation. Cell pellets were lysed by five consecutive rounds of freezing in liquid N2 followed by thawing in a water bath at 37° C. Cell debris was removed by centrifugation and remaining cellular contaminants digested by Benzonase (75 U/ml) for 1 h at 37° C. The cell lysate was cleared by centrifugation, loaded on an iodixanol gradient and full AAV particles enriched in the 40% iodixanol phase through ultracentrifugation at 50,000 rpm for 2 hours.
For in vivo experiments, AAVs were PEG-precipitated from cell lysate, purified by CsCl ultracentrifugation at 45,000 rpm for 23 hours, and dialyzed in multiple rounds against PBS.
AAV peptide library production was performed with the same protocol as described above with the exception that two plasmids were enough for transfection, since rep2 and cap8-PV flanked by ITRs were used for AAV library generation, which allowed packaging inside capsids.
AAV Titer Determination by qPCR and ddPCR
AAV genomes were liberated from their capsids by alkaline lysis with NaOH, neutralized with HCl and diluted to a final volume of 1 ml AAV lysate with H2O. Genome copy numbers were quantified either by qPCR and calculated in relation to a plasmid standard curve or absolute values were determined by ddPCR from 1:4000-1:8000-fold diluted AAV lysates. Titration of peptide libraries was done with rep2-specific primers, titration of barcoded peptide variants was done with an eYFP-recognizing primer set. Primer and TaqMan probe sequences are listed in Table 2.
For selections performed in vitro, Huh-7 cells, primary mouse and human hepatocytes were transduced in 6-wells at a multiplicity of infection (MOI) of 105 and cell pellets collected 48 hours later. Cell lysates were prepared through incubation with DirectPCR lysis reagent (Viagen) supplemented with Proteinase K (250 μg/ml). Cell lysates were used for PCR amplification with Phusion Hot Start II DNA Polymerase (Thermo Fischer Scientific) and primers listed in Table 3 resulting in an approximately 800 bp-fragment. Unique MluI and SpeI restriction sites were introduced through PCR primer sequences and used for subcloning in the parental vector. For in vivo selections, gDNA was isolated as described above and 50 ng was used for each PCR amplification.
In total, four selection rounds were performed in Huh-7 cells and primary mouse hepatocytes, while only three selection rounds were possible in primary human hepatocytes during the selection time course due to limited access to patient material. In mice, four consecutive selection rounds were done and a full biodistribution analysis included in the fourth round.
Cell lysates of following samples were analyzed by NGS to monitor peptide enrichment between different selection rounds:
For in vivo selections, gDNA of three mice was used for PCR amplification in rounds I to III followed by a biodistribution analysis of three mice in round IV, resulting in the following sample set:
Viral DNA spanning peptide insertions was amplified by PCR with NGS primers listed in Table 4 yielding a 106 bp-fragment. Unique sequencing adaptors were ligated to PCR amplicons with the Ovation Library System for Low Complexity Samples (NuGEN), which allowed multiplexing of up to 32 individual libraries. Sequencing was performed with the NextSeq 500 system (Illumina) at the EMBL Genomics Core Facility (GeneCore) in Heidelberg.
In addition to the methods described above, a general specificity score GS may be calculated based on the corresponding NGS data: GS=Sheart×Slung×Skidney×Sorganx. See, J. Körbelin et al. (2016) Mol Ther. 24(6):1050-1061.
The analysis of NGS reads reveals cell type-specific enrichment of AAV mutants with mostly unique peptide sequences. The selection of peptide sequences for the generation of a barcoded library is based on the top 20 most enriched peptide sequences from in vitro screening in Huh-7 (round IV), mouse hepatocytes (round IV) and human hepatocytes (round III) mutants and on the 3 criteria below. Additional peptide sequences were selected based on the NGS data from the 4th round in vivo.
Peptide motifs were selected from top 20 enriched peptide motifs by NGS reads in each cell type.
The top 20 hits identified from in vitro screening in Huh-7 cells (round IV), mouse hepatocytes (round IV) and human hepatocytes (round III) are shown in
Based on the above selection criteria, a total of 35 peptide motifs were selected from the in vitro AAV library screening (
The top 20 hits identified from in vivo screening in the three mice from selection round three are shown in
A 4th round of in vivo screening was performed. Biodistribution of each peptide in the tissues of the 4th round mice were evaluated. Data are shown in
Based on the 4th round of screening in vivo, a total of 15 further peptide sequences were selected (
The total 50 selected peptide sequences are provided in Table 5 and also shown in
Selected peptide motifs were cloned in an AAV helper plasmid (WHc_AAV8_SfiI, based on p5E18, with an additional SpeI site 3′ of cap8 and a SfiI site for peptide insertion) and AAV vectors in small scale including 1× iodixanol gradient purification. The barcoded AAV vector harbors a co-transcribed barcode, and an expression cassette coding for YFP (see
The productivity of each vector was expected to be better or yields not more than 3-fold lower when compared to AAV8 WT. The transduction of Huh-7 cells (% transduced cells and mean fluorescence intensity [MFI]) was assessed by fluorescence-activated cell sorting (FACS) and were better or not more than 3-fold lower when compared to AAV8WT. Standard QC analysis of AAV vectors includes qualitative determination of intensity of capsid protein bands when analyzed with Sypro Ruby-stained SDS-PAGE gels.
Materials and methods used in this Example are described below.
After NGS-based data analysis of all peptide selections performed in vitro and in vivo, a set with 50 different peptide variants (PV) was chosen for further validation from the enriched libraries. For subcloning of individual peptides, oligonucleotides were designed spanning the peptide region in both orientations. Oligonucleotides were annealed by heat-induced denaturation at 95° C. and stepwise cooled down to room temperature. Annealed sequences yielded overhangs compatible with SfiI-based insertion into the cap-gene within a vector backbone containing rep2 and cap8 without ITRs. Peptide-specific oligonucleotides were purchased from Sigma and are listed in Table 6.
Custom-made in-house Python scripts were used for peptide enrichment as well as barcode analysis. For peptide libraries, two Python scripts were generated. The first script extracts randomized peptide regions from raw data and generates read counts for each sequence. The second script performs a ranking of the sequences on DNA as well as on peptide level and can further distinguish between peptide sub-libraries.
Data analysis of barcoded AAV libraries was performed. Briefly, two consecutive Python scripts are included in analysis of barcoded libraries. The first script extracts barcode sequences from the raw data sets and generates read counts for all barcodes followed by a multistep normalization with the second script which takes into account differences in raw read numbers between samples as well as fluctuations in the injected AAV library pool and viral genome copy numbers across analyzed tissues. Thus, a quantitative assessment of viral tropism is made possible and a side-by-side comparison of transduction efficiencies as well as transcriptional activity of different AAV variants in relation to known benchmark viruses.
In addition to the selection criteria described above, the following criteria was also considered for the selection of the panel with 50 most promising peptide variants from all peptide library screens for further validation with barcoded vectors. The top 20 most highly enriched peptides for each in vitro and in vivo screening system (total 120 peptides as shown in
Selection criteria for 35 peptide candidates chosen from in vitro screened libraries:
Selection criteria for 15 peptide candidates chosen from in vivo screened libraries:
Transduction and expression levels of each vector from the barcoded AAV library were evaluated in murine hepatocytes, human hepatocytes and non-hepatocyte cells (cardiac myocytes, saphenous vein endothelial cells, skeletal muscle cells, and pulmonary fibroblasts). AAV8 WT was included as a reference vector. Cells were transduced with the pooled barcoded AAV library and DNA and RNA extracted from transduced cells, and NGS sequencing of AAV DNA and RNA applied. Upon bioinformatical analysis of peptide motif abundance, the AAV variants were ranked with respect to specificity and combination of best transduction and expression properties. This pre-validation of a barcoded AAV library with peptide mutants in vitro allows for selection of a total of about 18 AAV variants from the collection of 50 capsids in the library exhibiting the most effective and most selective human hepatocyte transduction.
The results of the analysis for each peptide are shown in
For validation experiments, a set with 50 selected peptide variants was produced with uniquely barcoded eYFP-reporter constructs. Transduction efficiency as well as cell type specificity was compared in vitro in a set of different primary cells and in vivo in a biodistribution analysis of four C57Bl/6J mice. In contrast to peptide library sequencing, where only viral DNA was assessed, both viral genomes as well as RNA transcripts were analyzed for barcoded libraries. Prior to amplicon generation, cDNA was reverse transcribed from isolated total RNA with High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific). The barcoded region was then amplified by PCR and obtained fragment size was 113 bp. The oligonucleotides used for NGS PCR of barcoded libraries are provided in Table 7.
Subsequent library preparation was done as described above for peptide library sequencing, i.e., unique sequencing adaptors were ligated to PCR amplicons with the Ovation Library System for Low Complexity Samples (NuGEN) and sequencing was performed with the NextSeq 500 system (Illumina) at the EMBL Genomics Core Facility (GeneCore) in Heidelberg. Transductions in vitro were performed in duplicates at a multiplicity of infection (MOI) of 105 in 6-wells resulting in the following sample set:
The pooled barcoded AAV library was applied to WT B16 mice (n=4) and the liver as well as off-target organs isolated 2 weeks after tail vein injection of the library. From each organ, DNA and RNA was isolated and the regions spanning the DNA barcode amplified by PCR from gDNA and reverse-transcribed cDNA, respectively. Upon bioinformatical analysis of peptide motif abundance, the AAV variants were ranked with respect to specificity and combination of best transduction and expression properties.
For in vivo biodistribution analysis, four WT B16 mice were injected intravenously (i.v.) with 1012 viral particles by tail vein injection and following tissues were removed two weeks after library application:
The results of the analysis for each peptide are shown in
It is of note that wild-type AAV8 vector already has strong tissue-specific tropism for the liver. Therefore, any further improvement in liver specificity is regarded as an advancement in vector development. While wild-type AAV8 is specific for the liver with a range between 73.4% (gDNA level,
To select candidate peptide variants for further evaluation, a scoring system was applied based on the NGS data of barcoded vectors validated in vitro and in vivo. A combined score was determined for each of the 50 peptide variants taking into account the level of transcription in human hepatocytes and mouse liver, as well as tissue specificity and expression in off-target cells. This yielded a panel with 18 peptide variants for further validation. Additionally, PV2 and PV35 were included as internal controls, and AAV8 and AAV5 WT serotypes were added as benchmarks known from literature. A more detailed description of the scoring system is provided below.
In order to identify and select a subset of AAV vectors containing the most efficient (I.) and specific (II.) peptide variants for further evaluation, 14 parameters were defined from the NGS data generated in the above Examples as listed below.
In a first analysis, all 14 parameters were scored. A score of one was attributed when the corresponding peptide variant was performing better than AAV8 WT. In some cases, 2 points were scored when the efficiency values were above 10-times higher than AAV8 WT or the specificity values were above 0.9. Based on these criteria, the maximal possible score was assessed for each peptide variant. However, the implementation of the Max score including all 14 parameters results in a low level of selectivity, since all peptide variants score well in some of the different areas.
Therefore, a combined score was generated including a subset of the 14 possible parameters as shown below.
The combined score has a stronger focus on an efficient transduction and transcription in human hepatocytes in vitro and in the mouse liver in vivo. Moreover, tissue specificity was scored only on RNA level. To further increase stringency, only an improvement in efficiency above 5-fold was scored for human hepatocytes in vitro and 2 points were scored when the efficiency values were above 50-times higher than AAV8 WT (parameter 1) and 4)). All remaining parameters were scored as described previously. The improved combined scoring resulted in the determination of highly efficient and/or selective peptide variants.
A comparison of transduction efficiency values from fluorescence-activated cell sorting (FACS) and next-generation sequencing (NGS) data in Huh-7 cell line, mouse hepatocyte, human hepatocyte, and mouse liver is shown in
In total, 18 peptide variants were chosen for further evaluation based on combined score values>2. Additionally, PV2 and PV35 were included as internal controls, and AAV8 WT and AAV5 WT AAVs chosen as benchmarks.
The 18 selected peptide variants are provided in Table 8 and also shown in
Human FIX under transcriptional regulation of the liver-specific promoter murine transthyretin (mTTR) was packaged in PV2, PV8, PV9, PV19, PV27, PV42 and, as a benchmark, AAV8 capsids. Each recombinant AAV vector was administered to eight male FIX KO mice (B6.129P2-F9tm1Dws) at a dose of 2×1011 vg/kg.
Human FIX under transcriptional regulation of the liver-specific promoter murine transthyretin (mTTR) was packaged in PV2, PV19, PV26, PV27, PV42 and, as a benchmark, AAV8 capsids. Each recombinant AAV vector was administered at a dose of 5×1011 vg/kg to six 27-29 week-old male FRG (FaH−/−, Rag2−/−, II2rg−/−) C57Bl/6 mice repopulated with >70% human liver cells.
The invention has been described in terms of particular embodiments found or proposed to comprise specific modes for the practice of the invention. Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAACC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
CCCAAATTGGAACTGTCAACAGCCAGGGGGCCTTACCCGGTATGGTCTGGCAGAAC
Peptide insert sequence is underlined and in bold letters in SEQ ID NOs: 101-200.
Flanking sequences are underlined in SEQ ID NOs: 101-200.
This patent application claims priority to U.S. Provisional Application No. 63/182,346, filed Apr. 30, 2021, the disclosure of which is herein incorporated by reference in its entirety.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/IB2022/000233 | 4/29/2022 | WO |
| Number | Date | Country | |
|---|---|---|---|
| 63182346 | Apr 2021 | US |
