Described herein are compositions comprising lncRNA SNHG12 and methods of use thereof.
Atherosclerosis, a chronic arterial disease of medium-to-large sized arteries, is the most frequent cause of death worldwide and depends on traditional risk factors including lipoprotein accumulation, as well as immune cell functions, and extracellular matrix metabolism (1, 2). Accumulating studies demonstrate that cells of advanced plaques are more prone to senescence, a permanent cellular growth arrest often triggered by DNA damage (3-5). Reactive oxygen species (ROS)-mediated oxidative stress and DNA damage can contribute to cellular senescence and dysfunction of endothelial cells (ECs) and macrophages (6, 7) and thus to chronic disease such as atherosclerosis, neurodegenerative disorders, premature aging, senescence, among others (8, 9). Lesional DNA damage increases with the progression of atherosclerosis (10). The consequences of unrepaired or extensive DNA damage include growth arrest, cell senescence, and apoptosis, which all rise with plaque severity (11). Advanced plaques contain cells bearing senescence markers such as senescence-associated β-galactosidase (SA-βgal) activity and elevated expression of p16, p21, and p53 (12). Recently, elimination of senescent-positive cells (i.e. p16+) in advanced lesions from LDLR−/− mice led to inhibition of lesion growth, prevention of maladaptive plaque remodeling, and a reduction in the secretion of pro-inflammatory molecules (13). Despite these important findings, major mechanistic gaps remain in the understanding of the underlying molecular signaling events that contribute to the increased DNA damage and senescence in advanced atherosclerotic lesions.
In addition to the above, atherosclerosis is a pathology that leads to myocardial infarction and stroke. For many years after its recognition, atherosclerosis was thought to involve passive lipid deposition in the vessel wall. Today we understand that atherosclerosis is a chronic inflammatory disease driven by lipids, specifically low density lipoproteins (LDL) and leukocytes. Neither atherosclerosis nor its complications adhere to a simple arithmetic of dietary lipid imbalance, but rather encompass a syndrome in which environmental and genetic inputs disrupt biological systems. In other words, lifestyle, age, hereditary factors, and co-morbidities disturb immune, digestive, endocrine, circulatory, and nervous systems, thereby altering immune function, metabolism, and many other processes, while eliciting inflammation, hypercholesterolemia, and hypertension. Atherosclerosis develops and causes myocardial infarction or stroke when many things go wrong in many different ways.
Provided herein are methods of treating a subject who has a disease associated with a malfunction in DNA repair response, the method comprising: administering to the subject a therapeutically effective dose of a pharmaceutical composition that increases expression of Small Nucleolar Host Gene-12 (SNHG12) long non-coding RNA in a cell of the subject in need thereof.
Also provided herein are pharmaceutical compositions for use in treating a subject suffering from a disease associated with a malfunction in DNA repair response, comprising a nucleic acid molecule comprising (i) all or part of the SNHG12 long-coding RNA sequence, or (ii) a sequence encoding all or part of the SNHG12 long-coding RNA, optionally in an expression vector
In some embodiments, the pharmaceutical composition comprises a nucleic acid molecule comprising (i) all or part of the SNHG12 long-coding RNA sequence, or (ii) a sequence, optionally in an expression vector, encoding all or part of the SNHG12 long-coding RNA.
In some embodiments, the expression vector comprises an adeno-associated virus (AAV), adenovirus, lentivirus, or a DNA plasmid.
In some embodiments, the nucleic acid molecule is an RNA molecule comprising all or part of SEQ ID NO: 1 or 2.
In some embodiments, the nucleic acid molecule comprises SEQ ID NO: 1 or 2.
In some embodiments, the nucleic acid molecule has at least 90% of sequence identity with SEQ ID NO: 1 or 2.
In some embodiments, the nucleic acid has at least 80% sequence identity with SEQ ID NO: 1 or 2 and is capable of increasing the expression of Small Nucleolar Host Gene-12 (SNHG12) long non-coding RNA.
In some embodiments, wherein the composition is administered to the subject parenterally, intramuscularly, intravitreally, subcutaneously, arterially, intravenously, topically, orally, or by local administration, such as by aerosol or transdermally.
In some embodiments, the nucleic acid molecule comprises a chemical modification that improves one or more, or all, of nuclease stability, decreased likelihood of triggering an innate immune response, lowering incidence of off-target effects, and improved pharmacodynamics relative to a non-modified nucleic acid.
In some embodiments, the at least one chemical modification comprises a modification selected from phosphorothioate, boranophosphate, 4′-thio-ribose, locked nucleic acid, 2′-O-(2-methoxyethyl), 2′-O-alkyl, 2′-O-alkyl-O-alkyl, 2′-O-methyl, 2′-fluoro, 2′-amino, or 2′-deoxy-2′-fluoro-b-D-arabinonucleic acid.
In some embodiments, the at least one chemical modification comprises a 5′ cap.
In some embodiments, the composition is administered to the tunica intima of the subject.
In some embodiments, the disease is atherosclerosis, heart failure, diabetes, hypertension, neurodegenerative disease, autoimmune disease, ataxia telangiectasia, aging, Bloom's Syndrome, immunodeficiency, Cockayne syndrome, Nijmegen breakage syndrome, Trichothiodystrophy, Fanconi Anaemia, Werner Syndrome, Li-Fraumeni syndrome, xeroderma pigmentosum, senescence, Hutchinson-Gilford progeria syndrome, or cancer.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
Long noncoding RNAs (lncRNAs) are defined as RNA molecules greater than 200 nucleotides in length that have low protein-coding potential. Traditionally viewed as transcriptional noise, they are now emerging as important regulators of cellular functions such as protein synthesis, RNA maturation/transport, chromatin remodeling, and transcriptional activation and/or repression programs because of their ability to interact with RNA, DNA, or protein depending in part on their cellular localization (14). They have been shown to influence biological processes such as stem cell pluripotency, cell cycle, and DNA damage response. While lncRNAs have a low cross-species conservation rate and may have lower copy numbers per cell than mRNAs (15, 16), several studies have identified lncRNAs enriched in a tissue- or cell-specific manner that can exert profound phenotypic effects (17). Identification of lncRNAs specifically expressed in the intima of lesions during the progression phase of atherosclerosis may provide a better understanding for their roles in a stage-specific manner and potentially uncover new insights for repairing or reducing DNA damage in advanced lesions.
The Examples provide evidence for dynamic regulation of lncRNA SNHG12 towards stress-induced DNA damage. In support, lncRNA SNHG12 expression fell in intimal lesions during the progression phase after 12 weeks of HCD, whereas SNHG12 expression nearly normalized during the regression phase after resumption of 6 weeks of normal chow diet. Consistent with findings in mice, the expression of this evolutionary conserved lncRNA fell markedly in atherosclerotic arteries of pigs and humans, and correlated inversely with DNA damage and markers for senescence (
Mechanistically, SNHG12 knockdown increased markers of DSBs (e.g. gammaH2AX) in part by inhibiting the DNA-PK interaction with Ku70 and Ku80, heterodimeric proteins that bind DSBs and that facilitate the NHJ pathway. These findings identify SNHG12 as a regulator of DNA-PK and the DDR in vitro and in vivo. While SNHG12 can increase DNA-PKcs activity, SNHG12 is probably not essential for V(D)J recombination function of DNA-PK as other studies have shown that minimal DNA-PKcs protein is suffice to mediate V(D)J recombination, but not the DDR evoked by ionizing radiation (33).
Sustained DNA damage may lead to cellular senescence and aggravate the pathogenesis of chronic disease states such as atherosclerosis. While a definitive role for DNA-PK in atherosclerotic lesion progression is poorly defined, DNA-PK activity increases with progression of atherosclerosis potentially as a means to repair DNA damage observed in the vessel wall (34). Furthermore, markers of DNA DSBs, oxidative DNA damage, and DNA reparative enzymes increase with advanced atherosclerotic lesions across mice, rabbits, and humans, highlighting the evolutionary conservation of this pathway, an indication of its potential importance (34-37). In addition to atherosclerosis, the maintenance of genomic integrity resists malignant transformation of a cell provoked by genotoxic stress and carcinogenic insults such as irradiation (38). To date, SNHG12 has been described in several forms of cancer as for example in prostate (39), gastric (40) and breast cancer (41). Upregulation of SNHG12 in some cancer cell types increased cellular proliferation and resistance to cell death insults in vitro (42). However, a definitive in vivo role of SNHG12 in Murine tumors is lacking. The findings from this study may have translational value not only for atherosclerosis, but also for cancer as this study demonstrates the regulatory role of the lncRNA SNGH12 in maintenance of cellular genomic stability by interacting with DNA-PK.
While SNHG12 knockdown elevated markers for DSBs and senescence primarily in the vascular endothelium and macrophages of lesions, we cannot rule out the possibility of similar effects in other cell types such as vascular smooth muscle cells (VSMCs). This possibility arises as delivery of ASO SNGH12 by intravenous tail vein injection may not penetrate the VSMC-enriched aortic media sufficiently to reduce SNHG12 expression. The recent recognition that VSMC-derived DNA damage had minimal effects on atherogenesis, but altered fibrous cap areas in advanced lesions, also suggests a modest contribution of DNA damage derived from this cell type (43).
As a consequence of increased DNA damage, cells may exhibit impaired homeostatic control of functions important to lipoprotein entry or clearance of cellular debris or apoptotic cells (12). Consistent with this notion, knockdown of SNHG12 in ECs increased permeability via LDL transcytosis and impaired macrophage efferocytosis, or the ability to engulf apoptotic cells, a process implicated in the clearance of cells from the core of plaques (
Oxidative stress induces genomic instability that can lead to DNA damage check point arrest, and if not appropriately repaired, to senescence and/or apoptosis (11). Most lesional DNA defects occur through the generation ROS via the NAD(P)H oxidase (44, 45). Herein, we demonstrate that NR, a clinical grade small molecule activator of NAD+ that serves as a precursor for NAPDH, which in turn activates a number of canonical pathways that reduce oxidative stress and hence DNA damage (46), completely rescued the effects on DNA damage, vascular senescence, and atherosclerosis. Because clinical trials are investigating the use of NR formulations for diverse chronic conditions including peripheral artery disease (ClinicalTrials.gov: NCT03743636), heart failure (ClinicalTrials.gov: NCT03423342), and cognitive function (ClinicalTrials.gov: NCT03562468), the findings in this study provide new mechanistic insights into the role of NR in vascular senescence applicable to these conditions. Furthermore, the findings that NR can rescue accelerated atherosclerosis, may inform new strategies to ameliorate a range of vascular occlusive disease states.
Our study builds upon the emerging roles of lncRNAs in the progression of atherosclerosis. For example, the lncRNAs LeXis and MeXis control lipid metabolism via LXR pathways (47, 48). Deficiency of lncRNA Malat1 accelerated atherosclerosis and triggered robust immune system dysregulation mediated by bone marrow-derived cells (49). Collectively, these studies highlight that lncRNAs exert profound regulation of key signaling pathways relevant to homeostasis in the vessel wall. In summary, we have identified lncRNA SNHG12 in atherosclerotic lesions as a homeostatic regulator of genomic stability by interaction with DNA-PK, a key mediator of the DDR. Knockdown of the lncRNA SNHG12 impairs DNA damage repair leading to lesional DNA damage, vascular senescence, and accelerated atherosclerosis independent of effects on lipid-lowering or lesional inflammation. Intravenous administration of the lncRNA SNHG12 reduced lesional DNA damage and plaque burden. Strategies aimed at restoring SNHG12 expression or facilitating SNHG12-DNA-PK interactions may provide a translational approach to limit DNA damage and vascular senescence applicable to a range of chronic disease states.
Diseases Associated with Malfunctions in DNA Damage Repair
The ability to repair DNA damage is an essential component of the genetic mechanisms conserving genomic fidelity. DNA damage may take several forms, including single- and double-strand breaks, inter- and intrastrand crosslinks and different kinds of base modifications. DNA damage may be the result of a variety of factors. Common exogenous sources of DNA damage include, chemical compounds and irradiation. Endogenous sources include spontaneous chemical conversion (e.g. deamination or depurination), the effect of oxygen and free radicals (causing base damage and DNA strand breaks), and malfunctions in DNA replication mechanisms (causing base mismatches and deletions). At the cellular level DNA damage may affect functions such as transcription, DNA replication, cell cycle, apoptosis and mutagenesis. At the phenotypic level this can lead to the development of diseases such as cancer and aging. Each cell has several complex methods in place to deal with both single base, and structural mismatches. Common repair pathways for double stranded breaks are homologous recombination based mechanisms. Another common mechanism for double-stranded DNA break repair is non-homologous end joining. The mechanisms of double-stranded break repair, and the diseases associated with them, have been reviewed by Khanna and Jackson “DNA double-strand breaks: signaling, repair and the cancer connection.” Nature Genetics March 2001; 27(3):247-254.
Non-homologous end joining (NHEJ) is a pathway that repairs double-strand breaks in DNA. NHJ is referred to as “non-homologous” because the break ends are directly ligated without the need for a homologous template. Ku is a dimeric protein complex that binds to DNA double-strand break ends and is required for the NHJ pathway of DNA repair. Ku is a heterodimer of two polypeptides, Ku70 (XRCC6) and Ku80 (XRCC5). The two Ku subunits form a basket-shaped structure that threads onto the DNA end. Once bound, Ku can slide down the DNA strand, allowing more Ku molecules to thread onto the end. In higher eukaryotes, Ku forms a complex with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the full DNA-dependent protein kinase, DNA-PK. Ku is thought to function as a molecular scaffold to which other proteins involved in NHEJ can bind, orienting the double-strand break for ligation. A malfunction in DNA repair is a loss or reduction of function of any part of the repair pathway, and results in accumulation of mutations.
Malfunctions in DNA repair pathways have been implicated in a number of diseases, including cancer and aging. Exemplary diseases associated with DNA repair mechanisms include the following: atherosclerosis, heart failure, diabetes, hypertension, neurodegenerative disease, autoimmune disease, ataxia telangiectasia, aging, Bloom's Syndrome, immunodeficiency, Cockayne syndrome, Nijmegen breakage syndrome, Trichothiodystrophy, Fanconi Anaemia, Werner Syndrome, Li-Fraumeni syndrome, xeroderma pigmentosum, senescence, Hutchinson-Gilford progeria syndrome, and cancer, including breast cancer, lung cancer, and skin cancer, and toxicity from chemotherapeutic drugs. The present methods can be particularly useful in chemopreventative strategies that reduce the risk of developing cancer in subjects with a a genetic predisposition to develop cancer, e.g., subjects with BRCA1-related genetic predisposition for breast cancer; subjects who are carriers of rare familial adenomatous polyposis (FAP); or subjects with chronic inflammatory syndromes that are predisposed to cancer such as ulcerative colitis, Crohn's disease who are prone to colon cancer.
The present disclosure is based in part on the discovery that the SNHG12 lncRNA regulates DNA damage repair. Accordingly, in some embodiments, provided herein are methods of treating, or reducing risk of developing or progression of DNA damage or a disease associated with a malfunction in DNA repair. Generally, the methods include administering an amount of all or part of the SNHG12 lncRNA or a nucleic acid encoding SNHG12 lncRNA, as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment.
As used herein, “treating” a subject suffering from a disease associated with a malfunction in DNA repair response means administration to a patient by any suitable dosage regimen, procedure and/or administration route of a composition, device or structure with the object of achieving a desirable clinical/medical end-point, including but not limited to, stopping or slowing progression, reversing, or reducing the rate of DNA damage such that symptoms of a given disorder ameliorated.
As used in this context, to “treat” means to ameliorate at least one symptom or clinical parameter of disease associated with a malfunction in DNA repair. For instance, in the case of atherosclerosis, a treatment can result in stopping, slowing, reversing, or reducing of plaque formation. If the disease is cancer, symptoms (depending on the type) can include persistent cough or blood-tinged saliva, change in bowel habits, blood in the stool, anemia, breast lump or breast discharge, lumps in the testicles, a change in urination, swollen glands, changes in warts or moles, indigestion, weight gain or loss, night sweats, fever, sores, headaches, back pain, pelvic pain, bloating; a treatment can result in a reduction in any one or more of the symptoms, or in reduction in tumor size, number, growth rate, or metastatic potential.
Subjects
As used herein, the term “patient” or “subject” refers to members of the animal kingdom including but not limited to human beings and “mammal” refers to all mammals, including, but not limited to human beings and veterinary subjects such as cats, dogs, horses, pigs, cows, goats, and sheep.
In some embodiments, the present methods are used to treat subjects who have or are at risk (i.e., have a risk level above that of the general population or a relevant reference population) of developing a disease associated with malfunctions in DNA repair (e.g., as described above). Risk can be determined based on the presence or degree of known risk factors, including family history, history of smoking, history of exposure to environmental toxins known to cause DNA damage, and dietary habits (e.g., a history of consumption of high fat, high cholesterol foods). The methods can include identifying a subject for treatment using a method described herein, based on the presence (e.g., diagnosis) or risk of developing a disease associated with DNA damage. A subject at risk for or having such a disease can be readily recognized by one of ordinary skill in the art.
Atherosclerosis
Atherosclerosis has recently been shown to be associated with DNA damage, which affects both resident cells in the vessel wall and circulating cells that migrate into plaque (3-5). Therefore, in some embodiments, provided herein are methods of treating, or reducing risk of developing or progression of atherosclerosis. Generally, the methods include administering an amount of all or part of the SNHG12 lncRNA, as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment.
As used in this context, to “treat” means to ameliorate at least one symptom of atherosclerosis. Often, atherosclerosis results in formation and buildup of plaques on arterial walls, resulting eventually in narrowing of the blood vessel, with symptoms (e.g., angina pectoris) and acute coronary syndromes due to plaque breakup and arterial blockage; thus, a treatment can result in a reduction in formation and buildup of plaques on arterial walls and a reduction in level or risk of vessel narrowing and/or acute coronary syndromes (acute coronary thrombosis, myocardial infarction or sudden cardiac death).
Atherosclerotic Subjects
In some embodiments, the present methods are used to treat subjects who have or are at risk (i.e., have a risk level above that of the general population or a relevant reference population) of developing atherosclerosis. Risk can be determined based on the presence or degree of known risk factors, including family history, hypercholesterolaemia/hyperlipidemia (i.e., high levels as shown in Table A), diagnosis of diabetes mellitus, history of past or present cigarette smoking, hypertension (see Table B), dyslipoproteinaemia, and dietary deficiency of antioxidants (see, e.g., Burke et al., Circulation. 2002; 105:419-424).
The American Heart Association (AHA) classification system categories include early stage lesions: initial type I, adaptive intimal thickening; and type II, fatty streak. Type III are transitional or intermediate lesions. Advanced plaques are categorized as type IV, atheromas; type V, fibroatheromas or atheromas with thick fibrous caps; and type VI, complicated plaques with surface defects, hematoma-hemorrhage, and/or thrombosis. In some embodiments, subjects treated using a method described herein have early stage atherosclerosis, e.g., type I or type II lesions, or have intermediate (type III) lesions. (Stary et al., Arterioscler Thromb. 1994; 14:840-856; Stary et al., Arterioscler Thromb Vasc Biol. 1995; 15:1512-1531). Alternatively, a modified classification system has been proposed, see Table C. (see Virmani et al., Arteriosclerosis, Thrombosis, and Vascular Biology. 2000; 20:1262-1275).
In some embodiments, subjects treated using a method described herein have nonatherosclerotic intimal lesions, or have pathological intimal thickening with or without erosion. See, e.g. Ladich et al., Atherosclerosis Pathology, Updated: Sep. 12, 2016, available at reference.medscape.com/article/1612610-overview#showall; Virmani et al., Arteriosclerosis, Thrombosis, and Vascular Biology. 2000; 20:1262-1275; Bergheanu et al., Neth Heart J. 2017 April; 25(4): 231-242. In some embodiments, the subjects do not yet have plaque formation.
Additionally, in some embodiments, subjects include those without established atherosclerosis, e.g. at risk for atherosclerosis such as patients with diabetes who are at high risk for DNA damage in the vessel wall and atherosclerosis.
Small Nucleolar Host Gene-12 (SNHG12) Long Non-Coding RNA
As used herein, the term “nucleic acid” or “nucleic acid molecule” refers to any nucleic acid containing molecule, including but not limited to, DNA, RNA (e.g., long non coding RNA). The term encompasses sequences that include any of the known base analogs of DNA and RNA including, but not limited to, 4-acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethyl guanine, 2-methyladenine, 2-methylguanine, 3-methyl cytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxy-aminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.
Lon non-coding RNAs (lncRNA) are functional RNA molecules that are not translated into a protein. Long ncRNAs are generally considered to be non-protein coding transcripts longer than about 200 nucleotides and have been shown to play roles in regulation of gene transcription, post-transcriptional regulation and epigenetic regulation (see, e.g., Guttman, M. et al., Nature., 2009, 458, 223-227).
Small Nucleolar Host Gene-12 (SNHG12), also known as LNC04080, is a lncRNA located at the p35.3 region on chromosome 1. It is 1,867 bases long and encodes four small nucleolar RNAs (SNORA66, SNORA61, SNORA16A, and SNORD99) from its spliced introns. Studies have implicated SNHG12 in a number of cancers, such as breast, gastric, osteosarcoma, and glioma and other cancer types. The altered expression of SNHG12 has been correlated with the viability, proliferation, metastasis, and invasion of tumor cells, impacting the prognosis and survival of cancer patients (Tamang, S et al., “SNHG12: An LncRNA as a Potential Therapeutic Target and Biomarker for Human Cancer”, Front Oncol. 2019; 9: 901). However, the previous investigations have shown nothing more than an association with cancer, lacking any demonstration of causality or evidence of a role in vivo.
The compositions useful in the present methods can include all or part of the SNHG12 lncRNA, or a nucleic acid sequence encoding the SNHG12 lncRNA.
In some embodiments, the sequence of SNHG12 lncRNA is or comprises: TCTAGAGCTAGCGAATTCCTTTCTCCCCGCCGCATTCCCGGTGTCGACTTACT AGCTGCAAGCCTCTGCCTGCCTTCCTGCGCGCCGTTCCCCGCTAGTCGCTGCT GCTGGCGCGCACTCGCCGGGTTTTTCCTCCCACGGCCTCGAGATGGTGGTGA ATGTGGCACGGAGGAGCCGGGCCTTCCAACCCGGTGGGCCCGAGCTCCGAAA GGCCCCCTCGGCAGTGAGAGGGGCGGGAGCCCGCGGGGGCCGCGCCCTTCTC TCGCTTCGGACTGCGCAACGCTGCGCTCTGGGCTGACAGGCGGATAAAACGG TCCCATCAAGACTGAGAAAAAGCACACCAGCTATTGGCACAGCGTGGGCAGT GGGGCCTACAGGATGACTGACTTAGTCTACAGAGATCCCGGCGTACTTAAGC AGATGAAGACTCTTAAGATGACAGAAGGTGATTTTTCTGGTGATCGAGGACT TCCGGGGTAATGACAGTGATGAAATGCAGGGGACCTGGTTGCCCCCAAGTTT CCTGGCAGTGTGTGATACTGAGGAGGTGAGCTTGTTTCTGGAGCTGTGCTTTA AGGTAAAGTTGATCAGCTTAATCCTCCTGATCCCTTTCCCATCGGATCTGAAC ACTGGTCTTGGTGGTCGTAAAAGGAGGAAAAGTAATAGTGAAGCTGGCCTAA ATGTTGTAATCTGGTATATGGCATGTGGGCTAGTTTCAGACAGGTTTCAGAGA TGGTTGGATCTCTGAAATTGTAAAATGAAGTATAATCTTAGGCTAAGGGAAG GATGCGTGTGAAGCTCTGGAGGTTGGTATAGTAATAGCTGACCTATTACTGC ATTTGGGAGGGATCTGTCATAGCTTCCTTGCCTCTTAATTAAGGGTGGTGTTT TTTTCTTTTAGATTCATGTTACATGTAAAGCTGTCCTCATTTGTGACTATGGAC CTATGGAGTTGGGACAATCTCTATGGGAAGCAGAAGGCAAGGACCCCGGTCA TTTTAGGTAGAAACAACAGCATGCTAATGCAAAAAATTATGCAGTGTGCTAC TGAACTTCAGAGGTGATCAATAAAAGAAGAATAAAAAGACTAATAAAAGTA GAATTCTGATCAGGATCC (SEQ ID NO: 1); i.e. full length SNHG12 lncRNA.
In some embodiments, the sequence of SNHG12 lncRNA is or comprises:
In some embodiments, the sequence of SNHG12 lncRNA is or comprises: nucleotide residues 598 to 1117 position of SEQ ID NO: 1, and optionally an additional 38 nucleotides from exon 1, e.g., SEQ ID NO: 2.
In some embodiments, provided herein are synthetic SNHG12 lncRNA (e.g., SEQ ID NO: 1 or 2 or sequences with at least 40, 45, 50, 55, 65, 70, 75, 80, 85, 90, 95, or 99% sequence identity with SEQ ID NO: 1 or 2)). The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at gcg. com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the invention) are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
Viral Vectors
Viral vectors for use in the present methods and compositions include recombinant retroviruses, adenovirus, adeno-associated virus, alphavirus, and lentivirus.
A preferred viral vector system useful for delivery of nucleic acids in the present methods is the adeno-associated virus (AAV). AAV is a tiny non-enveloped virus having a 25 nm capsid. No disease is known or has been shown to be associated with the wild type virus. AAV has a single-stranded DNA (ssDNA) genome. AAV has been shown to exhibit long-term episomal transgene expression, and AAV has demonstrated excellent transgene expression in the brain, particularly in neurons. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous DNA is limited to about 4.7 kb. An AAV vector such as that described in Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985) can be used to introduce DNA into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al., Proc. Natl. Acad. Sci. USA 81:6466-6470 (1984); Tratschin et al., Mol. Cell. Biol. 4:2072-2081 (1985); Wondisford et al., Mol. Endocrinol. 2:32-39 (1988); Tratschin et al., J. Virol. 51:611-619 (1984); and Flotte et al., J. Biol. Chem. 268:3781-3790 (1993). There are numerous alternative AAV variants (over 100 have been cloned), and AAV variants have been identified based on desirable characteristics. Moreover, the AAV capsid can be genetically engineered to increase transduction efficient and selectivity, e.g., biotinylated AAV vectors, directed molecular evolution, self-complementary AAV genomes and so on. In some embodiments, AAV1 is used. In some embodiments, AAV 8 is used. In some embodiments, AAV 9 is used.
Alternatively, retrovirus vectors and adeno-associated virus vectors can be used as a recombinant gene delivery system for the transfer of exogenous genes in vivo, particularly into humans. These vectors provide efficient delivery of genes into cells, and the transferred nucleic acids are stably integrated into the chromosomal DNA of the host. The development of specialized cell lines (termed “packaging cells”) which produce only replication-defective retroviruses has increased the utility of retroviruses for gene therapy, and defective retroviruses are characterized for use in gene transfer for gene therapy purposes (for a review see Miller, Blood 76:271 (1990)). A replication defective retrovirus can be packaged into virions, which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Ausubel, et al., eds., Current Protocols in Molecular Biology, Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are known to those skilled in the art. Examples of suitable packaging virus lines for preparing both ecotropic and amphotropic retroviral systems include ΨCrip, ΨCre, Ψ2 and ΨAm. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad. Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad. Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-4115; U.S. Pat. Nos. 4,868,116; 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573).
Another viral gene delivery system useful in the present methods utilizes adenovirus-derived vectors. The genome of an adenovirus can be manipulated, such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See, for example, Berkner et al., BioTechniques 6:616 (1988); Rosenfeld et al., Science 252:431-434 (1991); and Rosenfeld et al., Cell 68:143-155 (1992). Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, or Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances, in that they are not capable of infecting non-dividing cells and can be used to infect a wide variety of cell types, including epithelial cells (Rosenfeld et al., (1992) supra). Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ, where introduced DNA becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al., supra; Haj-Ahmand and Graham, J. Virol. 57:267 (1986).
Alphaviruses can also be used. Alphaviruses are enveloped single stranded RNA viruses that have a broad host range, and when used in gene therapy protocols alphaviruses can provide high-level transient gene expression. Exemplary alphaviruses include the Semliki Forest virus (SFV), Sindbis virus (SIN) and Venezuelan Equine Encephalitis (VEE) virus, all of which have been genetically engineered to provide efficient replication-deficient and -competent expression vectors. Alphaviruses exhibit significant neurotropism, and so are useful for CNS-related diseases. See, e.g., Lundstrom, Viruses. 2009 June; 1(1): 13-25; Lundstrom, Viruses. 2014 June; 6(6): 2392-2415; Lundstrom, Curr Gene Ther. 2001 May; 1(1):19-29; Rayner et al., Rev Med Virol. 2002 September-October; 12(5):279-96.
Where a vector, virus, or naked DNA is delivered, regulatory sequences controlling expression of the lncRNA should also be included, e.g., a promoter; an enhancer sequence, e.g., 5′ untranslated region (UTR) and/or a 3′ UTR; a polyadenylation site; an insulator sequence; or another sequence that increases the expression of the lncRNA.
The present methods can include delivery of RNA, e.g., naked RNA, or delivery of a nucleic acid encoding the lncRNA, e.g., a cDNA, vector, or virus encoding the lncRNA. The nucleic acids used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/generated recombinantly. Recombinant nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including, for e.g., in vitro bacterial, fungal, mammalian, yeast, insect, or plant cell expression systems. Nucleic acid sequences that can be used in any of the methods described herein can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example, as described in Sambrook et al., Molecular Cloning: A Laboratory Manual., 1989; Coffin et al., Retroviruses, 1997; and “RNA Viruses: A Practical Approach” (Alan J. Cann, Ed., Oxford University Press, 2000). As will be apparent to one of ordinary skill in the art, a variety of suitable vectors are available for transferring nucleic acids (e.g., a nucleic acid comprising all or a part of SEQ ID NO: 1 or 2) into cells.
The selection of an appropriate vector to deliver nucleic acids and optimization of the conditions for insertion of the selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation. Viral vectors include a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell. Viral vectors expressing nucleic acids (e.g., a sequence comprising all or a part of SEQ ID NO: 1 or 2) can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes simplex virus, pox virus, or alphavirus. The recombinant vectors capable of expressing a nucleic acid (e.g., a nucleic acid comprising all or part of SEQ ID NO: 1 or 2) can be delivered as described herein, and persist in target cells (e.g., stable transformants).
In addition to viral transfer methods, such as those illustrated above, non-viral methods can also be employed to cause expression of a nucleic acid compound described herein. Typically non-viral methods of gene transfer rely on the normal mechanisms used by mammalian cells for the uptake and intracellular transport of macromolecules. In some embodiments, non-viral gene delivery systems can rely on endocytic pathways for the uptake of the subject gene by the targeted cell. Exemplary gene delivery systems of this type include liposomal derived systems, poly-lysine conjugates, and artificial viral envelopes. Other embodiments include plasmid injection systems such as are described in Meuli et al., J. Invest. Dermatol. 116(1):131-135 (2001); Cohen et al., Gene Ther. 7(22):1896-905 (2000); or Tam et al., Gene Ther. 7(21):1867-74 (2000). Other embodiments include Crispr-Cas9/Cas13 based systems to modify lncRNA expression (see, e.g., ncbi.nlm.nih.gov/pubmed/30045635).
Nucleic acid sequences comprising all or a part of SEQ ID NO: 1 or 2 can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams, J. Am. Chem. Soc. 105:661, 1983; Belousov, Nucleic Acids Res. 25:3440-3444, 1997; Frenkel, Free Radic. Biol. Med. 19:373-380, 1995; Blommers, Biochemistry 33:7886-7896, 1994; Narang, Meth. Enzymol. 68:90, 1979; Brown, Meth. Enzymol. 68:109, 1979; Beaucage, Tetra. Lett. 22:1859, 1981; and U.S. Pat. No. 4,458,066.
Nucleic acid sequences comprising all or a part of SEQ ID NO: 1 or 2 can be stabilized against nucleolytic degradation, nuclease stability, decrease the likelihood of triggering an innate immune response, lower the incidence of off-target effects, and/or improve pharmacodynamics relative to non-modified molecules so as to increase potency and specificity, such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences (e.g., nucleic acids comprising all or a part of SEQ ID NO: 1 or 2) can include a phosphorothioate, boranophosphate, or 4′-thio-ribose.
As another example, the nucleic acid sequence can include a 2′-modified nucleotide, e.g., a 2′-deoxy, 2′-deoxy-2′-fluoro, 2′-O-methyl, 2′-O-methoxyethyl (2′-O-MOE), 2′-O-aminopropyl (2′-O-AP), 2′-O-dimethylaminoethyl (2′-O-DMAOE), 2′-O-dimethylaminopropyl (2′-O-DMAP), 2′-O-dimethylaminoethyloxyethyl (T-O-DMAEOE), (2′-O—N-methylacetamido (2′-O-NMA), 2′-O-(2′-methoxyethyl), 2′-O-alkyl, 2′-O-alkyl-O-alkyl, 2′-amino, T-deoxy-T-fluoro-b-D-arabinonucleic acid. As another example, the nucleic acid sequence can include at least one 2′-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2′-O-methyl modification. In some embodiments, the nucleic acids are “locked,” i.e., nucleic acid analogues in which the ribose ring is “locked” by a methylene bridge connecting the 2′-o atom and the 4′-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290, 2005; Koshkin et al., J. Am. Chem. Soc. 120(50):13252-13253, 1998). In some embodiments, the RNA is modified by pseudouridine and/or 5-methylcytidine substitution. For additional modifications see Kaczmarek et al., Genome Med. 2017; 9: 60, US 2010/0004320, US 2009/0298916, and US 2009/0143326.
The nucleic acid can be further modified at the 5′ end by capping the end, which is known in the art. At the end of transcription, the 5′ end of the RNA transcript contains a free triphosphate group since it was the first incorporated nucleotide in the chain. Capping replaces the triphosphate group with another structure called the “5′ cap”. Suitable 5′ caps include methylated guanosine. In some embodiments, a N7-methyl guanosine is connected to the 5′ nucleotide through a 5′ to 5′ triphosphate linkage, typically referred to as m7G cap, m7 Gppp, or cap 0 in the literature. An additional methylation on the 2′O position of the initiating nucleotide generates Cap 1, or referred to as m7GpppNm-, where Nm denotes any nucleotide with a 2′O methylation. See, e.g., Kaczmarek et al., Genome Med. 2017; 9: 60.
In some embodiments, the nucleic acid is delivered using a liposome or nanoparticle, e.g., by attachment to or encapsulation within a biocompatible nanoparticle. The nanoparticles can be tagged with antibodies against cell surface antigens of the target tissue. In some embodiments, the nucleic acid is modified to with a N-acetylgalactosamine GalNAc-conjugate approach (include wherever lipid nanoparticle is mentioned). In some embodiments, the nucleic acid is conjugated with PEI or an antibody targeted to the tunica intima or other relevant cell types.
Examples of biocompatible nanoparticles include liposomes and polymeric nanoparticles. As used herein, the term “liposome” means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged nucleic acid molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
Liposomes can also include “sterically stabilized” liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.
Polymeric nanoparticles for use in the present methods and compositions can comprise cationic polymers, such as amine-containing polymers, poly-L-lysine, polyamidoamine, and polyethyleneimine, chitosan, poly(β-amino esters). In some embodiments the cationic polymers electrostatically condense the negatively charged RNA into nanoparticles. See, e.g., Pack et al., Nat Rev Drug Discov. 2005 July; 4(7):581-93; Kaczmarek et al., Genome Med. 2017; 9: 60.
Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, and amplification), sequencing, hybridization, and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed., 2001; Current Protocols in Molecular Biology, Ausubel et al., Eds. (John Wiley & Sons, Inc., New York, 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual, 1990; Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization with Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, Ed., Elsevier, N.Y., 1993.
In certain embodiments, gene therapy, utilizing zinc finger recombinase fusion proteins, is used to site-specifically exchange the promoter of SNHG12 with a promoter that has constitutive or higher level expression. In some embodiments, the Tet promoter, for example, is used, and after recombining in the targeted cells, the gene is turned on by administering tetracycline to the subject. One exemplary alternative of this approach is to introduce the SNHG12 gene behind the native promoter with the desired level of expression. Another exemplary alternative is using CrispR to activate upstream sequences to SNHG12; or by using small molecule activators.
In some embodiments, the expression of negative regulators of SNHG12 are reduced and/or inhibited, thereby increasing the expression of SNHG12. Similarly, in certain embodiments, degradation of SNHG12 can be reduced by administering agents that inhibit SNHG12 degradation pathways.
The methods described herein can include the administration of pharmaceutical compositions and formulations that include the nucleic acid sequences described herein (e.g., nucleic acids comprising all or a part of, or encoding all or part of, the sequence of SEQ ID NO: 1 or 2).
As used herein, the term “effective amount” refers to the amount of a composition sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
The term “compound” refers to any chemical entity, pharmaceutical, drug, and the like that can be used to treat or prevent a disease, illness, sickness, or disorder of bodily function. Compounds comprise both known and potential therapeutic compounds. A compound can be determined to be therapeutic by screening using screening methods. A “known therapeutic compound” refers to a therapeutic compound that has been shown (e.g., through animal trials or prior experience with administration to humans) to be effective in such treatment. In other words, a known therapeutic compound is not limited to a compound efficacious in the treatment of disease (e.g., atherosclerosis).
In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, intramuscularly, intravitreally, subcutaneously, arterially, intravenously (IV, i.v.), topically, orally, or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary.
The nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers, and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring, perfuming agents, preservatives, and antioxidants can also be present in the compositions. Formulations of the compositions that may be used in the methods described herein include those suitable for intradermal, inhalation, intramuscular, subcutaneous, arterial, intravenous, oral/nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., a nucleic acid sequence described herein) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intravenous or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect Pharmaceutical formulations of this invention can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents, and preserving agents. A formulation can be admixed with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may include one or more diluents, emulsifiers, preservatives, buffers, excipients, etc., and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
In some embodiments, the pharmaceutical composition comprising all or a part of the sequence of SEQ ID NO: 1 or 2 also includes a gene enhancer that increases the expression of SNHG12. In some embodiments the all or a part of the sequence of SEQ ID NO: 1 or 2 may be co-administered with a gene enhancer.
In some embodiments, provided herein is a pharmaceutical composition capable of increasing SNHG12 expression. In some embodiments the all or a part of the sequence of SEQ ID NO: 1 or 2 may be co-administered with a compound capable of increasing SNHG12 expression.
Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). For example, a single bolus may be administered, several divided doses may be administered over time, or the composition may be administered continuously or in a pulsed fashion with doses or partial doses being administered at regular intervals, for example, ever 10, 15, 20, 30, 45, 60, 90, or 120 minutes, every 2 through 12 hours daily, or every other day, etc. be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. In some instances, it may be especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. The specification for the dosage unit forms of the invention are dictated by and directly dependent on (a) the unique characteristics of the active compound and the particular therapeutic or prophylactic effect to be achieved, and (b) the limitations inherent in the art of 20 compounding such an active compound for the treatment of sensitivity in individuals.
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
The following materials and methods were used in the Examples below.
The main goal of this study was to identify dynamically regulated lncRNAs with progression of atherosclerosis. Among them, we identified the lncRNA SNHG12 as a highly abundant and evolutionary conserved lncRNA from mouse to pig to human. Loss-of-function studies were performed with modified ASOs (gapmeRs) to assess the role of SNHG12 in the progression of atherosclerosis. In vivo experiments for loss-of-function studies were performed in atherosclerotic prone LDLR−/− mice in conjunction with HCD by tail vein administration of gapmeRs twice per week over the course of 12 weeks in the presence or absence of NR. For gain-of-function experiments SNGH12 RNA was delivered via the same route in ApoE−/− mice that were 12 weeks of age at the start of the study. The study was performed over the course of 6 weeks on HCD. Experimental groups included at least 10 mice per group to robustly identify alterations in disease progression, and mice were randomly assigned to each group. All measurements were blinded. GapmeR-mediated knockdown and lentiviral overexpression in human endothelial cells and human primary macrophages was performed to verify the evolutionary conserved function of SNHG12. For in vitro studies, experiments included a minimum of n=3 independently performed replicates. Expression data from human and pig carotid cross sections were used to assess the atherosclerosis-specific expression profile of SNHG12. No data points were excluded as outliers.
All protocols concerning animal use were approved by the Institutional Animal Care and Use Committee at Brigham and Women's Hospital and Harvard Medical School, Boston, Mass. and conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Studies were performed in LDLR−/− mice (Jackson Laboratory, Stock#: 002207), ApoE−/− mice 12 weeks old (Jackson Laboratory, Stock#:002052), or in C57B1/6 mice (Charles River, Strain code#027).
Efferocytosis assay was performed as described in (50). Briefly, 5×106 cells/mL Jurkat cells were labeled with 5 μM AM Calcein (Invitrogen, LS-H2452-50). After 2 hrs incubation, cells were washed and irradiated with UV (150 mJ/cm2) with an open lid, followed by another 2 hrs incubation before apoptotic cells were added in a 1:1 ratio to gapmeR-transfected primary macrophages. After several rounds of gentle washing, macrophages were counted positive for internalized green apoptotic bodies if they contained >3 μm clusters of green dots. Quantification was performed from four images with a total of 400 macrophages. For quantification of in vivo efferocytosis, macrophages were stained using rat anti-Mac2 (Cadarlane, CL8942AP, 1:100), as described below for immunofluorescence. TUNEL protocol was performed based on the manufacturer's protocol (Roche, In situ cell death detection kit, TMR red). The ratio of macrophage-free TUNEL over macrophage-associated TUNEL signaling was calculated as described (29).
RNA from the lesser and greater curvature (LC, GC) was isolated from C57B1/6 mice using nitrocellulose slides (ONCYTE NOVA). To this end, aortas were isolated and cut for areas of LC or GC and placed with the tunica intima side towards the nitrocellulose side for 15 min at RT (n=3 mice were pooled to represent n=1) (51, 52). After removing the aorta from the slide, RNA lysis buffer was directly added to the slide, followed by RNA isolation (QIAGEN, RNeasy Plus Micro Kit, #74034).
In vivo permeability in arteries with Evans Blue extravasation was performed as described (27). Briefly, a cone-shape polyethylene constrictive cuff (CC) was placed in the left common carotid artery (LCCA) and secured by a circumferential suture. Evans Blue extravasation was determined following 24 hrs post-surgery. C57B1/6 mice were injected (i.v.) with either SNHG12-gapmeRs or control-gapmeRs (7.5 mg/kg) or with in vitro transcribed SNHG12 RNA (15 μg/injection) (as described below in MST assay) on two constitutive days followed by CC surgery on day 3. Downstream Evans Blue area of the CC elongation in longitudinal cross sections of the LCCA was compared to corresponding controls.
Frozen sections were prepared from human normal carotid arteries and carotid atherosclerotic lesions that were obtained from the Division of Cardiovascular Medicine, Brigham and Women's Hospital in accordance with the Institutional Review Board-approved protocol for use of discarded human tissues (protocol #2010-P-001930/2).
To quantify atherosclerosis in LDLR−/− mice that were placed on HCD (Research Diets Inc., D12108C), aortic roots and aortic arch were embedded in OCT and frozen at −80° C. Serial cryostat sections (6 μm) were prepared using tissue processor Leica CM3050. Lesion characterizations, including Oil Red 0 (ORO) staining of the thoracic-abdominal aorta and aortic root and staining for macrophages (anti-Mac3, BD Pharmingen, 553322, 1:900) T cells (anti-CD4, BD Pharmingen, 553043, 1:90; anti-CD8, Chemicon, CBL1318, 1:100), and vascular smooth muscle cells (SM-α-actin, Sigma, F-3777, 1:500), were performed as previously described (53, 54). The staining area was measured using Image-Pro Plus software, Media Cybernetics, and CD4+ and CD8+ cells were counted manually.
Intimal RNA isolation from Aorta Tissue
Isolation of intimal RNA from aorta was performed as previously described in (54, 55). Briefly, aortas were carefully flushed with PBS, followed by intima peeling using TRIzol reagent (Invitrogen, 15596018). TRIzol was flushed for 10 sec-10 sec pause—another 10 sec flushed and collected in an Eppendorf tube (˜300-400 μL total) and snap frozen in liquid nitrogen.
LDL transcytosis assay was performed as previously described (56). Briefly, total internal reflection fluorescence (TIRF) microscopy uses an evanescent wave to illuminate just the proximal ˜100 nm of the cell, thereby facilitating selective imaging of the basal membrane of a live EC with minimal confounding from the overlying cytoplasm and apical surface. Confluent human coronary artery HCAEC monolayers were exposed to a fluorophore-tagged ligand added to the apical cell surface while the basal membrane of the cell was imaged by TIRF. Cytoplasmic vesicles undergoing exocytosis with the basal membrane were directly visualized and quantified. TIRF microscopy was performed on a Leica DMi8 microscope with 63×/1.47 (O) objectives, 405 nm, 488 nm, 561 nm and 637 nm laser lines, 450/50, 525/50, 600/50, 610/75 and 700/75 emission filters and run with Quorum acquisition software (Quorum). Microscope settings were kept constant between conditions. Briefly, cells at 100% confluency were placed in a live cell imaging chamber and treated with 20 μg/mL DiI-LDL in cold HPMI media for 10 min at 4° C. to allow apical membrane-binding. Following membrane binding, cells were washed twice with cold PBS+ to remove unbound ligand and room temperature HPMI was added. Cells were incubated on the live cell imaging stage at 37° C. for two minutes before initial image acquisition. Confluent regions of the monolayer were selected by viewing the number of nuclei in the DAPI field of view after staining with NucBlue Live ReadyProbes Reagent (Thermo Fisher) and TIRF microscopy of the basal membrane was performed to visualize exocytosis. For each coverslip, 10-15 videos of 150 frames (100 ms exposure) were captured. Image analysis was performed using a custom MATLAB single particle-tracking algorithm (56).
LC-MS/MS was performed as previously described (57). Briefly, lncRNA pulldown of SNHG12 or LacZ purified samples were reduced with 10 mM DTT for 30 min at 56° C. in the presence of 0.1% RapiGest SF (Waters). Cysteines were alkylated with 22.5 mM iodoacetamide for 20 min at room temperature in the dark. Samples were digested overnight at 37° C. with trypsin. Rapigest was then cleaved according to manufacturer's instructions and peptides purified by reversed phase and strong cation exchange chromatography. Peptides were loaded onto a precolumn (4 cm POROS 10R2, Applied Biosystems), resolved on a self-packed analytical column (12 cm Monitor C18, Column Engineering) after gradient elution (NanoAcquity UPLC system, Waters; 5%-35% B in 90 min; A=0.2M acetic acid in water, B=0.2M acetic acid in acetonitrile), and introduced to the MS (TripleTOF 5600, ABSciex, Framingham, Mass.) by ESI (spray voltage=2.2 kV). The mass spectrometer was programmed to perform data-dependent MS/MS (unit resolution, m/z 100-2000) on the 20 most abundant precursors in each MS1 scan (m/z 300-2000; accumulation time=0.5 seconds; threshold=70 counts; charge state=2+ to 5+) using a rolling collision energy. After MS/MS, each precursor was excluded for 25 seconds. Raw data were converted to .mgf using ABSciex MSDataConverter; precursor and product ions were recalibrated using a linear equation derived from fitting experimentally observed masses obtained in an initial low mass tolerance database search. Recalibrated data were matched to peptide sequences in a forward/reversed human NCBI refseq database using Mascot version 2.4.1. Search parameters included trypsin specificity with up to two missed cleavages, fixed carbamidomethylation (C, +57 Da) and variable oxidation (M, +16 Da). Precursor and product mass tolerances were 12 ppm and 25 mmu. Protein hits with FDR<0.1 from SNHG12-specific pulldown were compared to negative control (LacZ) (n=2, with two technical replicates).
NHJ ability was assessed as previously described (22). Lentivirus was produced in 293T cells as described above under “Lentivirus production and transduction” for pDRR (double strand break repair reporter (pLCN DSB Repair Reporter, Addgene, #98895) and pCBASceI (Addgene, #26477). HUVECs were transduced in 10 cm dish with pDRR without Geneticin selection, because >85% were GFP positive cells after 4-5 days. Cells were transfected with GapmeRs, siRNA or transduced with lentivirus for SNHG12 and 24-48 hrs after, cells were transduced with lentivirus for pCBASceI. FACS analysis for GFP positive cells was performed 48-72 hrs post pCBASceI transduction.
The study protocol included 15 male hypercholesterolemic Yorkshire swine that were placed on an HCD for up to 60 weeks. Detailed sectioning of 3-mm coronary artery segments was performed so that the gene sequencing samples were derived from the exact same portions of the coronary artery plaques used for the histology and immunohistochemistry analyses. Histology and IHC analyses included H & E, van Gieson elastin staining, smooth muscle cell α-actin, oil red-O staining (ORO), picrosirius red staining, CD31 and CD45 cells as described in (58)
In silico coding potential assessment tool (CPAT) online algorithm was used for prediction of coding potential (59). For in vitro validation of peptide coding potential, SNHG12 mouse or human transcripts were cloned upstream of p3×FLAG-CMV-14 expression vector (Sigma, E7908) using EcoRI restriction site. 293T cells were transfected with 500 ng plasmid using Lipofectamine 2000 (Invitrogen) and protein lysate was isolated 72 hrs post-transfection, followed by immunoblotting for FLAG Tag (Cell Signaling, 8146).
10 μg of linearized and purified T7 vector with the cassette for LacZ or SNHG12 was used for 1× T7 RNA polymerase transcription reaction (Promega, RiboMax™ Large Scale RNA, P1300) based on the manufacturer's protocol. Following 4 hrs incubation at 37° C., RNA was purified by standard phenol:chloroform isolation method and resuspended in 140 μL RNAase-free water. After 5 min at 65° C., RNA was capped and 2′-O-Methylated (NEB, #M0366) based on the manufacturer's protocol before purification using a column-based approach (QIAGEN, RNeasy Plus Universal Midi Kit, #73442) and stored in −80° C. RNA with concentration of 2-3 μg/μL was injected i.v. using (Polyplus, in vivo jetPEI, #201-50G). Briefly, 15 μg RNA was diluted in water and glucose (final conc.5%) in a volume of 100 μL. This mixture was combined with a premixed cocktail of 6.4 μL jetPEI, 43.6 μL, RNAase-free water, and 50 μL 10% glucose (final conc. 5%) and incubated for 15 min at RT before administrated (200 μL, volume total).
RNA-Seq analysis was performed after ribodepletion and standard library construction using Illumina HiSeq2500 V4 2×100 PE (Genewiz, South Plainfield, N.J.). All samples were processed using an RNA-seq pipeline implemented in the bcbio-nextgen project (https://bcbio-nextgen.readthedocs.org/en/latest/). Raw reads were examined for quality issues using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) to ensure library generation and sequencing were suitable for further analysis. Trimmed reads were aligned to UCSC build mm10 of the Mouse genome, augmented with transcript information from Ensembl release 79 using STAR (60). Alignments were checked for evenness of coverage, rRNA content, genomic context of alignments (for example, alignments in known transcripts and introns), complexity and other quality checks using a combination of FastQC, Qualimap (61). Counts of reads aligning to known genes were generated by featureCounts (62). Differential expression at the gene level were called with DESeq2 (63). The total gene hit counts and CPM values were calculated for each gene and for downstream differential expression analysis between specified groups was performed using DESeq2 and an adapted DESeq2 algorithm, which excludes overlapping reads, called no-overlapping reads (NOR). Genes with adjusted FDR<0.05 and log 2fold-change (1.5) were called as differentially expressed genes for each comparison. Mean quality score of all samples was 35.67 within a range of 40,000,000-50,000,000 reads per sample. All samples had at least >70% of mapped fragments over total.
Data throughout the paper are expressed as mean±SD. Statistical differences between two groups was assessed by unpaired two-tailed Student's t test and for more than two groups, one-way ANOVA analysis was used. A probability of p<0.05 was considered statistically significant. Ns, not significant; * p<0.05; ** p<0.01; *** p<0.001; ****p<0.0001. For illustration of differentially expressed genes GraphPad software (V.7.0a or 8) was used.
To identify lncRNAs whose expression changes in the aortic intima during the progression and regression phases of atherosclerosis, LDLR−/− mice consumed a high cholesterol diet (HCD) and RNA derived from the aortic intima after 0, 2, and 12 weeks on HCD (progression phase; groups 1-3) and at 18 weeks after 6 weeks of resumption of a normal chow diet (regression phase; group 4) (
To explore the role of systemically delivered SNHG12-gapmeRs in atherosclerosis, LDLR−/− mice received vehicle control or SNHG12-gapmeR (7.5 mg/kg/2×weekly i.v.) for 12 weeks on HCD (
Surprisingly, neither loss-nor gain-of-function of SNHG12 changed the accumulation of lesional cells bearing markers of macrophages or vascular smooth muscle cells, or of CD4+ or CD8+ T cells, (
To identify potential SNHG12-interacting proteins that may inform mechanisms underlying these findings, biotin-labeled T7 in vitro transcribed SNHG12 or LacZ was incubated with nuclear protein lysate of HUVECs (
To identify the functional consequences of the interaction of SNHG12 with DNA-PK, we assessed the effect of SNHG12 on DNA-PK's kinase activity (DNA-PKcs). Incubation of purified DNA-PK protein with in vitro transcribed SNHG12 assessed the ability of DNA-PKcs to convert ATP to ADP. In the presence of SNHG12, DNA-PKcs increased by 2-fold compared to the LacZ control and positive control NU7441 (
The DDR involves DNA strand break recognition, followed by the initiation of a cascade that promotes DNA repair. In response to extrinsic stress, such as γ-irradiation, or intrinsic stimuli such as H2O2, SNHG12 expression fell dose-dependently (
Consistent with these in vitro findings, lesions of LDLR−/− mice treated with SNHG12-gapmeRs exhibited a 2-fold increase in γH2AX foci in the vascular endothelium (CD31+ cells) (
To test whether the SNHG12-mediated effect on γH2AX foci formation depends on DNA-PK, DNA-PK was silenced in combination with simultaneous SNHG12 knockdown. DNA-PK silencing blocked the SNHG12-gapmeR mediated increase of γH2AX foci and tail moment after ROS- or CPT-induced DNA damage (
Exploration of the pathways and processes affected by SNHG12 knockdown used unbiased genome-wide RNA-Seq on SNHG12-gapmeR transfected ECs exposed to H2O2. This undertaking identified a number of dynamically regulated genes (log 2FC<0.5, FDR<0.05) (
As a consequence of increased DNA damage, ECs may exhibit impaired homeostatic control of functions important to lipoprotein entry and macrophages may display impaired clearance of cellular debris or apoptotic cells. To assess lipoprotein entry, we performed transcytosis assays using confluent monolayers of human coronary artery endothelial cells (HCAECs) and total internal reflection fluorescence microscopy (TIRF) (26). SNHG12 knockdown significantly (P<0.0001) increased DiI-LDL transport from the apical to the basolateral membrane by 1.8-fold (
Human primary macrophages were tested for their ability to ingest apoptotic cells, a process described in atherosclerotic plaques as efferocytosis (28, 29). SNHG12-gapmeR transfected macrophages showed a 50% reduced uptake of apoptotic cells (
Recent work has demonstrated that ROS-induced DNA damage in tissues relate to impaired NAD+ metabolism (30). Furthermore, administration of the NAD+ precursor NR can limit DNA damage. Repletion of NAD+ by NR also prolonged the life span in mice by rescuing DDR and senescence (30). To assess whether SNHG12-deficient lesion progression involves increased DNA damage, SNHG12-gapmeR was delivered i.v. as described in (
Mitochondrial dysfunction is a hallmark of senescence and reparative responses during oxidative insults requires effective energy metabolism. Oxidative stress-induced DNA damage activates NAD+ consumption pathways (31). Examination of the effect of SNHG12 knockdown on key mitochondrial activities such as mitochondrial respiration and glycolysis in ECs used Seahorse analyses. Loss of SNHG12 decreased the extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of live cells (
SNHG12 is conserved across mouse, human, and pig (
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
This application claims the benefit of U.S. Provisional Application Ser. Nos. 62/757,832 and 62/905,479 filed on Nov. 9, 2018 and Sep. 25, 2019, respectively. The entire contents of the foregoing are incorporated herein by reference.
This invention was made with Government support under Grant Nos. HL115141, HL117994, HL134849, GM115605, and HL134892 awarded by the National Institutes of Health. The Government has certain rights in the invention.
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/US2019/061006 | 11/12/2019 | WO | 00 |
| Number | Date | Country | |
|---|---|---|---|
| 62757832 | Nov 2018 | US | |
| 62905479 | Sep 2019 | US |