Patent Application
20150342164
The present invention provides nucleic acid constructs and uses of the same for generating transgenic, non-human animals. The invention further relates to the use of such animals in method for testing agents for potential utility in the treatment of filaggrin based disorders.
Following the discovery of the major role of the filaggrin gene in dry skin and atopic eczema, filaggrin has emerged as a potential new drug target for treatment of these diseases. Specifically, it is desirable to develop new drugs that can up-regulate the expression of the filaggrin gene in the skin. There are few tools, if any, available to allow the development of such compounds and, in particular, there is no in vivo model to validate filaggrin up-regulation or study filaggrin expression in real time.
It is amongst the objects of the present invention to obviate and/or instigate one or more of the aforementioned disadvantages
The present invention is based upon the generation of a nucleic acid construct which may be used to generate transgenic non-human animals. The construct exploits a filaggrin based promoter region which directs the expression of a reporter sequence operatively linked thereto.
It should be noted that throughout this specification the term comprising is used to denote that embodiments of the invention “comprise” the noted features and as such, may also include other features. However, in the context of this invention, the term “comprising” encompasses embodiments in which the invention “consists essentially of” the relevant features or “consists of” the relevant features. For example, while this invention provides isolated nucleic acid sequences which comprise certain sequences, the invention further relates to isolated sequences which “consist essentially” or “consist” of the same sequences.
In a first aspect, the present invention provides a nucleic acid, said nucleic acid encoding a filaggrin promoter element and a nucleic acid sequence operatively linked thereto.
The nucleic acid sequence operatively linked thereto may not be a sequence encoding the complete, functional, wild-type and/or native human filaggrin protein. In other words, the operatively linked nucleic acid sequence may not be the complete human filaggrin (FLG) gene. Moreover, the nucleic acid of this invention may be an isolated nucleic acid. Furthermore, the nucleic acid may be artificially constructed using molecule/recombinant techniques such as, for example, cloning, PCR, ligation and the like. Hereinafter, the nucleic acid sequence of the first aspect of this invention shall be referred to as a nucleic acid “construct”.
Within this specification, reference is made to sequences which “exhibit a degree of identity or homology” to, for example, a reference sequence. As used herein, the term “degree of homology” or “degree of identity” may encompass nucleic acid and/or amino acid sequences which exhibit at least about 30%, 40%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity to a reference nucleic acid or amino acid sequence. In the context of this specification, the reference nucleic acid sequence may be a coding and/or non-coding sequence of the human filaggrin gene. For example, the reference sequence may be a coding/non-coding sequence of a (wild-type or native) human filaggrin promoter/gene sequence.
The degree of (or percentage) “homology” between two or more (amino acid or nucleic acid) sequences may be calculated by aligning the sequences and determining the number of aligned residues which are identical and adding this to the number of residues which are not identical but which differ by redundant nucleotide substitutions—the redundant nucleotide substitution having no effect upon the amino acid encoded by a particular codon, or conservative amino acid substitutions. The combined total is then divided by the total number of residues compared and the resulting figure is multiplied by 100—this yields the percentage homology between aligned sequences.
A degree of (or percentage) “identity” between two or more (amino acid or nucleic acid) sequences may also be determined by aligning the sequences and ascertaining the number of exact residue matches between the aligned sequences and dividing this number by the number of total residues compared—multiplying the resultant figure by 100 would yield the percentage identity between the sequences.
The constructs provided by this invention comprise a filaggrin promoter element. A filaggrin promoter element suitable for use may encode a sequence which is capable of directing the expression of a gene or genes–particularly a gene or genes which are located downstream of the promoter element and/or which are operatively linked thereto. Promoter sequences may otherwise be referred to as encoding “transcription regulators”. As such, the filaggrin promoter element of the constructs of this invention may encode a transcription regulator capable of directing the expression of one more sequences operatively linked thereto. Suitable promoter elements may be capable of directing the expression of the human filaggrin gene. Accordingly, the constructs of this invention may comprise at least one human filaggrin gene transcription regulator sequence/element.
The filaggrin promoter element of the constructs of this invention may comprise a sequence which exhibits a degree of identity or homology to a filaggrin promoter sequence, for example the human filaggrin promoter sequence. It should be understood that a filaggrin promoter sequence may be a sequence of the filaggrin promoter which regulates the expression of the filaggrin gene. The promoter element may comprise a sequence which exhibits a degree of identity or homology to a wild type (or native) human filaggrin promoter sequence, the degree of identity/homology being determined by comparison between the sequence of the promoter element of the construct and the sequence of a reference human filaggrin gene promoter sequence.
The promoter element of the constructs described herein may be encoded by a sequence exhibiting a degree of identity and/or homology to a complete (or substantially complete) human filaggrin promoter sequence or to a fragment or portion thereof. A fragment or portion of a human filaggrin promoter sequence may comprise from about x to about n−1 nucleotides (and every number therebetween), where “x” is a nucleic acid fragment comprising from about 10 to about 5000 nucleotide bases (for example, about 10, 20, 30, 40, 50, 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 10,000 nucleotide bases) and “n” is the total number of nucleotide bases of a reference human filaggrin promoter sequence. Any fragment or portion of a promoter sequence (for example a human filaggrin promoter sequence) may be functionally active. That is to say, fragments or portions of promoter sequences as described herein (including the human filaggrin promoter sequence) may act as transcriptional regulators and be capable of controlling the expression of sequences operatively linked thereto. Accordingly, promoter elements of this invention exhibiting a degree of identity and/or homology to a fragment or portion of a reference sequence, for example a human filaggrin promoter sequence, may be also be functional transcription regulators. Functional fragments of this type will be referred to hereinafter as “promoter fragments”.
In view of the above, the present invention provides a nucleic acid, said nucleic acid encoding a filaggrin promoter element and a nucleic acid sequence operatively linked thereto, wherein the filaggrin promoter element comprises a sequence exhibiting a degree of identity or homology to a wild type or native filaggrin promoter sequence.
An exemplary human filaggrin promoter sequence is provided below as SEQ ID NO: 1.
As such, the invention provides nucleic acid constructs comprising a sequence selected from the group consisting of:
The nucleic acid constructs of this invention may comprise a sequence exhibiting a degree of identity or homology to a human filaggrin promoter sequence derived from a clone of a human genome library. For example, suitable human filaggrin promoter sequences may be obtained from Bacterial Artificial Chromosome clone (BAC) libraries. An exemplary BAC clone is RP1-14N1.2 which comprises a sequence encompassing the entire human filaggrin locus. Specifically, BAC clone RP1-14N1.2 comprises a sequence which exhibits a degree of homology identity to sequences of the human filaggrin locus. The sequence of BAC clone RP1-14N1.2 comprises the following filaggrin sequences: ˜10 kb upstream of the transcription start site, the 15 bp exon 1 (partial 5′UTR) sequence and the first 18 by of intron 1 (ending at the Mlu1 restriction site).
The nucleic acid constructs of this invention may further comprise sequences which exhibit a degree of identity or homology to the human filaggrin gene or to one or more fragment(s) or portion(s) thereof. This additional filaggrin sequence will be referred to hereinafter as the “filaggrin component”. The filaggrin component may not comprise a sequence which represents a filaggrin coding sequence. In other words, the filaggrin component may not comprise a sequence which encodes a functional filaggrin protein.
A fragment of the human filaggrin gene may comprise between about y and about n−1 nucleotide bases of the human filaggrin gene. The term “y” may encompass a fragment comprising about 10 to about 600 nucleotides of the human filaggrin gene. For example, suitable “y” sized fragments may comprise about 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 460, 470, 480, 481, 482, 483, 484, 485, 490, 500, 550 or about 600 nucleotides. The term “n” represents the total number of nucleotides of the human filaggrin gene. As stated, it should be understood that the nucleotides of any filaggrin component of the construct may be derived from a single region or domain of the human filaggrin gene or from multiple different regions or domains of the human filaggrin gene.
The filaggrin component of the constructs described herein may comprise a sequence exhibiting a degree of identity or homology to a nucleotide sequence of exon 1 of the human filaggrin gene or a sequence or sequences exhibiting a degree of identity or homology to a fragment or portion of exon 1 of the human filaggrin gene. The filaggrin component of the nucleic acid constructs of this invention may comprise a sequence which exhibits a degree of identity or homology to all, or substantially all, of the sequence of exon 1. The sequence of exon 1 is given below as SEQ ID NO: 2.
As such, and in addition to the filaggrin promoter element, the nucleic acids of this invention may comprise a filaggrin component, the filaggrin component comprising a sequence exhibiting a degree of identity or homology to SEQ ID NO: 2 or a fragment (for example a fragment comprising 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 bases) thereof.
Additionally, or alternatively, the filaggrin component may comprise or further comprise a sequence which exhibits a degree of identity or homology to the sequence of intron 1 of the human filaggrin sequence or a sequence or sequences which exhibit a degree of identity or homology to one or more fragments or portions of intron 1 of the human filaggrin gene. By way of example, the filaggrin component of the construct may comprise (in addition to any sequence exhibiting a degree of identity or homology to exon 1 of the human filaggrin gene) a sequence which exhibits a degree of identity or homology to 5′ and/or 3′ regions or domains of intron 1.
A sequence exhibiting a degree of identity or homology to a sequence of inton 1 of the human filaggrin gene is given as SEQ ID NO: 3.
A further sequence exhibiting a degree of identity or homology to a sequence of intron 1 of the human filaggrin gene is given as SEQ ID NO: 4.
The filaggrin component of the nucleic acids described herein may comprise SEQ ID NO: 3 and/or SEQ ID NO: 4.
The filaggrin component may, in addition to comprising a sequence of SEQ ID NO: 2, may further comprise a sequence of SEQ ID NOS: 3 and/or 4 (or fragments of either).
In addition to any sequence derived from SEQ ID NO: 2, the filaggrin component may comprise the sequence of SEQ ID NO: 5 of a sequence derived therefrom. SEQ ID NO: 5 represents a combination of SEQ ID NOS: 3 and 4 and is therefore a sequence comprising domains/regions which each exhibit a degree of identity or homology to a part of intron 1 of the human filaggrin gene.
As such, and in addition to the filaggrin promoter element (for example the sequence of SEQ ID NO: 1 or a promoter fragment thereof), the nucleic acids of this invention may comprise a filaggrin component, the filaggrin component may comprising one or more sequences selected from the group consisting of:
a sequence exhibiting a degree of identity or homology to SEQ ID NO: 2 or a fragment thereof;
a sequence exhibiting a degree of identity and/or homology to SEQ ID NO: 3 or a fragment thereof;
a sequence exhibiting a degree of identity and/or homology to SEQ ID NO: 4 or a fragment thereof; and
a sequence exhibiting a degree of identity and/or homology to SEQ ID NO: 5 or a fragment thereof.
In addition to any sequences exhibiting a degree of identity or homology to sequences of exon 1 and/or intron 1, the filaggrin component may comprise, or further comprise a sequence which exhibits a degree of identity or homology to the sequence of exon 2 of the human filaggrin sequence. Alternatively, the filaggrin component may comprise, or further comprise a sequence or sequences which exhibit a degree of identity or homology to one or more fragments or portions of exon 2 of the human filaggrin gene. By way of example, the filaggrin component of the construct may comprise (in addition to any sequence exhibiting a degree of identity or homology to exon 1 and/or intron 1 of the human filaggrin gene) a sequence which exhibits a degree of identity or homology to a 5′ region or domain of exon 2. The filaggrin component may comprise or further comprise a sequence which exhibits a degree of identity or homology to the 5′UTR of exon 2 of the human filaggrin gene.
A sequence which exhibits a degree of identity or homology to the sequence of exon 2 of the human filaggrin gene (in particular a 5′ region or domain of exon 2) is given as SEQ ID NO: 6.
gttcacatttattgccaaaagctt
A nucleic acid construct of this invention may comprise a sequence exhibiting a degree of identity or homology to SEQ ID NO: 7:
ttcacatttattgccaaaagctt
The constructs provided by this invention may comprise or further comprise a nucleic acid sequence which is operatively linked to the filaggrin promoter element of the nucleic acid construct. The sequence operatively linked to the filaggrin promoter element may encode a reporter gene.
The reporter sequence may encode a gene or peptide/protein, the expression of which can be detected by some means. Suitable reporter sequences may encode genes and/or proteins, the expression of which can be detected by, for example, optical, immunological or molecular means. Exemplary reporter sequences may encode, for example, fluorescent and/or luminescent proteins. Examples may include sequences encoding firefly luciferase (Luc: including codon-optimised forms), green fluorescent protein (GFP), red fluorescent protein (dsRed). One of skill will be familiar with the range of commercially available vectors which encode reporter gene sequences. Vectors of this type may further comprise one or more sites designed to accept heterologous sequences which may comprise genes capable of directing the expression of the reporter gene sequence. An exemplary vector system may be the luc2P/Puro vectors produced by Promega. For example, the pG4.21[luc2P/Puro] vector is a basic vector with no promoter and multiple cloning regions into which a promoter of choice may be cloned. Using such a vector, the luc2P gene can be placed under the transcriptional control of a human filaggrin promoter sequence.
The nucleic acid constructs of this invention may comprise a nucleic acid sequence encoding:
As stated, the nucleic acid sequence operatively linked to the human filaggrin promoter sequence may not be a sequence encoding a functional, complete or wild-type/native human filaggrin gene. Moreover, the filaggrin component may not comprise a sequence which encodes a functional filaggrin protein.
Reading 5′ to 3′, the nucleic acid construct of this invention may comprise (i), (ii) and (iii) [as defined above] in that order—i.e., filaggrin component (ii) is between promoter sequence (i) and the nucleic acid sequence (iii) operatively linked to (i).
The human filaggrin promoter sequence may comprise a sequence exhibiting a degree of identity or homology to SEQ ID NO: 1.
The filaggrin component may comprise (1) a sequence exhibiting a degree of identity to exon 1 (SEQ ID NO: 2); (2) (i) a 5′ region (SEQ ID NO: 3) and a 3′ region (SEQ ID NO: 4) of intron 1 of the human filaggrin gene; or (ii) a sequence comprising regions or domains which each exhibit a degree of identity or homology to 5′ and 3′ regions of intron 1 of the human filaggrin gene (SEQ ID NO: 5); and (3) exon 2 (SEQ ID NO: 6) of the human filaggrin gene.
SEQ ID NO: 7 is a sequence which comprises (5′ to 3′) the sequence of SEQ ID NO: 1, the sequence of SEQ ID NO: 2, the sequence of SEQ ID NO: 3, the sequence of SEQ ID NO: 4 (SEQ ID NOS 3 and 4 together being the sequence of SEQ ID NO: 5) and SEQ ID NO: 6.
The nucleic acid sequence operatively linked to the filaggrin promoter element may encode a reporter gene sequence.
The nucleic acid construct of this invention may be as shown in the Figures of this specification and as substantially described herein.
In a second aspect, the present invention provides a non-human transgenic animal comprising a nucleic acid sequence according to the first aspect of this invention.
The transgenic non-human animal may be a rodent, for example a mouse, rat, rabbit, guinea pig, hamster or the like. The invention may provide a transgenic mouse.
In a third aspect, there is provided a method of making the non-human transgenic animal of the second aspect of this invention, said method comprising introducing a nucleic acid according to the first aspect of this invention into the germline of a non-human animal.
One of skill will appreciate that there are many ways in which nucleic acid sequences may be introduced into the germline of non-human animals and all such methods may be applied here. For example, a nucleic acid sequence (for example a construct according to the first aspect of this invention) may be introduced into the genome of suitable non-human embryonic stem cells. Using embryonic stem cell gene targeting techniques which may exploit, for example, homologous recombination events, it is possible to introduce a nucleic acid sequence into the genome of an embryonic stem cell. In this way, the genome of murine embryonic stem cells may be modified so as to include a nucleic acid sequence according to the first aspect of this invention.
Where the non-human transgenic animal is a mouse, a nucleic acid sequence according to the first aspect of this invention may be introduced into a genomic locus which permits generalised expression. For example, a nucleic acid of this invention may be targeted to the ROSA26 locus of the murine genome. As such, the ROSA26 locus of a transgenic mice according to this invention may comprise a nucleic acid sequence according to claim 1 (or as described elsewhere in this specification).
The present invention may provide a transgenic mouse comprising cells, the genetic material (genome) of the cells being modified such that the ROSA26 locus comprises a nucleic acid sequence encoding a nucleic acid construct of this invention.
Transgenic rodents (for example mice) produced in accordance with the methods described herein, exhibit localised expression of the reporter gene under the control of the filaggrin promoter element. This is surprising as nucleic acids introduced into the murine ROSA26 are generally widely expressed. The inventors have observed that reporter gene expression from the constructs described herein, is predominantly localised to the footpad epidermis. Additionally, the inventors have noted that reporter gene expression is detected in the granular layer of the epidermis—mirroring the expression profile of filaggrin in humans.
These features are particularly advantageous as they permit live, in vivo imaging of filaggrin promoter activity. Additionally, the murine footpad epidermis is a tissue which most closely resembles human skin and as such, the non-human (murine) transgenic animals of this invention provide a valuable model which may be used to test compounds for potential use in the treatment of human diseases associated with filaggrin expression. The localised footpad expression avoids the requirement for removing fur or other obstructive tissues, structures prior to imaging. The localised (footpad) expression of the nucleic acid constructs of this invention, ensures that the non-human transgenic animals may be used in left/right comparison studies in which control agents are applied to certain regions expressing the nucleic acid construct (for example the left or right footpad(s) or the fore or hind footpads) and test agents applied to the other regions.
In view of the above, the present invention provides methods of identifying agents potentially useful in the treatment or prevention of various diseases—in particular diseases which affect the skin and/or cells/tissues thereof. Such methods may generally be referred to as “methods of identifying therapeutic agents” and agents identified by such methods are potentially useful in the treatment and/or prevention of a disease.
A method of identifying a therapeutic agent may comprise:
contacting a non-human transgenic animal of this invention with an agent to be tested;
identifying modulation of reporter gene expression;
wherein modulation of reporter gene expression indicates that the test agent might be useful in the treatment of a disease.
The method of identifying a therapeutic agent may be exploited in order to identify agents potentially useful in the treatment of disorders or diseases of the skin (including disorders or diseases which affect the cells and/or tissues of the skin). The method of identifying a therapeutic agent may be used to identify agents potentially useful in the treatment of filaggrin based diseases. A “filaggrin based disease” may be any disease and/or condition caused or contributed to by filaggrin gene expression and/or the expression of mutated (variant) filaggrin genes and/or proteins. For example, filaggrin based diseases may include ichthyosis vulgaris (IV), atopic dermatitis and eczema. One of skill will appreciate that diseases of this type may stem from aberrant filaggrin expression and/or the expression of mutant/variant filaggrin genes (for example, the expression of truncated filaggrin proteins).
Agents which modulate reporter gene expression in the non-human transgenic animals described herein may find utility in the treatment of filaggrin based diseases as described above. Modulation of reporter gene expression may be detected as any increase or decrease in reporter gene expression in comparison to the level of reporter gene expression occurring in a transgenic animal not contacted with or exposed to, the test agent. Accordingly, test agents which are found to increase or decrease reporter gene expression may be useful in the treatment of filaggrin based diseases.
Suitable test agents may comprise, for example small organic molecules, amino acids, peptides, proteins, antibodies (or antibody fragments), carbohydrates, nucleic acids and the like. Additionally, the (non-human) transgenic animals provided by this invention may be used to test the potential utility of cutaneous delivery of gene silencing technologies, in the treatment of filaggrin based diseases. For example small interfering RNA (siRNA) or antisense molecules may be used as test agents.
It should be understood that any of the test agents described herein may used in isolation or together with one or more other test agents.
The test agents may be applied by any suitable means. The test agents may be applied topically and/or parenterally by injection. Test agents administered parenterally, may be administered by sub-cutaneous, intra-peritoneal, intra-muscular or intra-venous injection. Test agents may also be administered orally. Additionally, or alternatively, a test agent may be delivered using implanted osmotic mini-pumps. Pumps of this type are known in the art and a miniature infusion pumps which permit for the continuous dosing in, for example, mice and rats. Test agents may also be administered by periorbital delivery.
The step of contacting a test agent with a non-human transgenic animal of this invention may comprise the step of applying a test agent to one or more of the footpads of the transgenic animal.
The method of identifying a therapeutic agent, may further comprise the step of comparing the results with the results of a control experiment in which a test agent is not used. As explained above, the present invention represents a distinct advantage over the prior art as both test and control experiments can be conducted simultaneously (or together) in a single non-human transgenic animal. For example, the step of contacting a test agent with a non-human transgenic animal may comprise applying a test agent to one or more of the footpad(s) of the non-human transgenic animal. A control experiment may be conducted on one or more of the other footpad(s) of the same animal. Once the experiment is complete, the expression of reporter gene in the footpads contacted with test agent may be compared to the expression of reporter gene in the footpads used for the control experiments.
In a fourth aspect, the present invention provides a vector encoding the nucleic acid construct if this invention. The vector may take the form of a plasmid encoding one or more cloning sites.
In a fifth aspect, the present invention provides a host cell transformed with the nucleic acid of the first aspect of this invention or with a vector according to the second aspect of this invention.
The term “host cell” may encompass any embryonic or adult (somatic) cell. The cell may be a mammalian cell, for example a rodent cell. The cell may be a stem cell, for example an embryonic stem cell. The cell may not be a human embryonic stem cell. The cell may be a rodent, for example, murine embryonic stem cell.
The present invention will now be described in detail with reference to the following Figures which show:
A 10,146 by human filaggrin promoter fragment was cloned from a genomic bacterial artificial chromosome (BAC) clone encompassing the entire human locus using recombineering. This clone covers the region from ˜10 kb upstream of the transcription start site, all of the 15 by exon 1 (partial 5′UTR), and ends at an Mlu I restriction site just 18 by inside intron 1.
A 483 by fragment containing the last 459 by of intron 1 and the start of exon 2 (covering the remainder of the 5′UTR was generated by PCR and sequence-verified. This fragment had artificial restriction sites added to allow cloning and also the ATG of exon 2 was mutated out so that translation will start from the first Kozak sequence and ATG placed downstream.
The two fragments were ligated together via their Mlu I sites (within intron 1) to make a construct that consists of >10 kb upstream promoter sequence and a cut-down intron 1. The whole fragment is flanked by an Xho I site upstream and a HinD III site downstream and consists of 10,623 by of DNA. This construct was designated “FLG-10K” for convenience.
The Xho I-HinD III fragment was cloned into pGL4.21 so that the FLG-10K promoter drives luc2p expression. Luc2p encodes the mammalian codon-optimized, protein destabilized firefly luciferase gene.
ggt aag caa tat gaa aac aat ttg tag ctc att cac
tgc cag aca ctg act cga gaC aac tta tat cgt atg
ggtaagcaatatgaaaacaatttgtagctcattcactgccagacactgac
tcgagaCaacttatatcgtatggggc
tcc ttc agg cta cat tct att tgc tct ttt ggt gaa
caa ggt aag Aag gaa tac gcg tta cgc ccc gcc ctg
GAGCAAATAGAATGTAGCCTGAAGGA
Cloned by recombineering, with addition of Xho I and Mul I sites in recombination primers
FLG Intron Fragment (pGL-intron, clone 243)
ctcgagtcagtgtctggcagtgaatgagctacaaattgttttcatattgc
atct
TTCACATTTATTGCCAAAAG
CTT
The FLG-10k-luc2p construct was sent to TaconicArtemis GmbH under contract to generate a single-copy transgenic mouse via mouse embryonic stem cell gene targeting into the murine ROSA26 Icous. ROSA26 is a site where high-efficiency gene targeting can be achieved and is a locus where at least heterozygous transgene insertion exerts no harmful phenotypic effects. The resultant mice were transported to Dundee.
Indirect immunofluorescence was used to show co-expression of luciferase with endogenous mouse filaggrin.
All mice were treated with a single intradermal injection on day 0 and were imaged daily for 6 days.
FLG-luc2p heterzygous animals were subjected to live animal imaging using the Caliper/Xenogen IVIS200 system, which allows imaging of the luc2p gene bioluminescence signal, following intraperitoneal injection of luciferin (the luc2p substrate), thus revealing, in real-time, quantifiable in vivo luciferase gene activity. Surprisingly, luc2p reporter gene expression in these mice was largely detected in the footpad epidermis, whereas one would have predicted that the FLG promoter would drive expression all over the epidermis. Upon covering the footpads and performing longer exposures, luc2p expression can be detected elsewhere in the epidermis but at a much lower level than footpad.
The results of live animal imaging (under anaesthetic) are shown in
Regional gene expression was also examined by quantitative reverse transcriptase PCR (QRT-PCR; Applied Biosystems Taqman gene expression assay) and western blot for luciferase protein. This confirmed that luc2p expression is very much greater in the footpad epidermis than elsewhere in the mouse epidermis on both the mRNA transcript and protein levels (see
To determine if the FLG-10K promoter is able to direct expression to the correct epidermal compartment—the granular layer—where filaggrin is expressed, immunofluorescence staining was performed in mouse footpad epidermis using antibodies against murine filaggrin and luciferase. This revealed that indeed, the FLG-10K promoter directs expression to the correct epidermal cell layers (see
This footpad-localised expression was not predicted and may be a consequence of (a) the precise FLG-10K sequence used including its shortened intron 1 and lack of intron 2; (b) targeting into ROSA26, outside of the epidermal differentiation complex gene cluster where FLG is normally located; and/or (c) the fact that the human filaggrin promoter was used here to direct expression in the mouse.
The footpad-restricted high-level reporter gene expression in the FLG-luc2p mice is particularly useful for analysis of filaggrin gene expression in real-time. The well circumscribed expression in the footpad, with negligible expression elsewhere in the epidermis, makes this mouse model exceptionally well suited to split body studies where one paw receives injected or topical treatment and the other side receives control treatment. For this to be a useful system for testing cutaneous delivery of therapeutics, the left-to-right expression levels must be consistent from day to day. This was investigated by imaging the same set of FLG-luc2p mice over time and comparing quantification of bioluminescence signals from the left and right footpads (
To test the ability of FLG-luc mice to act as a model for epidermal delivery of drugs and gene silencing agents, siRNA-targeting luc2p was intradermally injected into the left footpad of FLG-luc2p mice. Control siRNA was injected into the right footpad. Two types of siRNA chemistries were used: native RNA or Dharmacon's Accell siRNA chemistry (nuclease resistant with a self-delivery moiety to aid cell penetration). Mice were given a single injection of siRNA on day 0 and were imaged daily over 6 days. The results are summarised in
PBS treatment only had no effect on left-right ratio over the entire time course; see also green trace
We have developed a transgenic mouse expressing a luciferase reporter gene under control of a modified human filaggrin gene promoter. This is a very valuable animal model that will allow in vivo analysis and validation of chemical compounds that can up-regulate the activity of the human gene.
Surprisingly, we found that animals modified to harbour the nucleic acid constructs described herein, generated a luciferase reporter gene that is expressed primarily in the footpad epidermis rather than all over the epidermis. Thus, these animals allow live imaging of the luciferase reporter in small, circumscribed areas and left-right comparison in vehicle/control experiments such as assessment of topically applied filaggrin upregulation compounds. Moreover, the mouse footpad epidermis is most comparable to human skin in terms of tissue architecture.
In addition to the study of filaggrin gene regulation, these animals can also be used for the in vivo assessment of cutaneous delivery of gene silencing technologies, such as small interfering RNA (siRNA) or antisense molecules, applied by injection, systemically or topical formulation.
FLG-luc mice express the luciferase reporter gene, luc2p, primarily in the footpad, the site of mouse epidermis most similar in structure to human epidermis, with low-level negligible expression elsewhere in the epidermis.
The FLG-10K promoter directs expression to the granular layer of the epidermis, where filaggrin is normally expressed in mouse or human epidermis.
Using left-right ratio analysis, these mice are a useful model system for assessing epidermal delivery, and relative efficacy and longevity of gene silencing agents (e.g. siRNA).
Similarly, these mice can be used to assess cutaneous delivery of small molecules or other agents aimed at modulating filaggrin gene expression, in real-time, in living animals.
| Number | Date | Country | Kind |
|---|---|---|---|
| 1222881.3 | Dec 2012 | GB | national |
| Filing Document | Filing Date | Country | Kind |
|---|---|---|---|
| PCT/GB2013/053367 | 12/19/2013 | WO | 00 |
